ABCMdb

PMID: 14962947

Tregouet DA, Ricard S, Nicaud V, Arnould I, Soubigou S, Rosier M, Duverger N, Poirier O, Mace S, Kee F, Morrison C, Denefle P, Tiret L, Evans A, Deleuze JF, Cambien F
In-depth haplotype analysis of ABCA1 gene polymorphisms in relation to plasma ApoA1 levels and myocardial infarction.
Arterioscler Thromb Vasc Biol. 2004 Apr;24(4):775-81. Epub 2004 Feb 12., [PubMed]

Sentences

No. Mutations Sentence Comment

3 ABCA1 p.Arg219Lys Two polymorphisms were associated with plasma levels of ApoA1, 1 in the promoter (C-564T) and 1 in the coding (R1587K) regions, whereas only 1 polymorphism (R219K) was associated with the risk of MI. Login to comment 7 ABCA1 p.Arg219Lys Two polymorphisms were associated with plasma levels of ApoA1, 1 in the promoter (C-564T) and 1 in the coding (R1587K) regions, whereas only 1 polymorphism (R219K) was associated with the risk of MI. Login to comment 75 ABCA1 p.Arg219Lys ABCA1 p.Val825Ile Strong LD was also present in the coding region for 1 cluster of polymorphisms (R219K, G316G, I680I, V771 M, V825I, I883 M) located in exons 8 to 17. Login to comment 79 ABCA1 p.Arg219Lys ABCA1 p.Val825Ile Strong LD was also present in the coding region for 1 cluster of polymorphisms (R219K, G316G, I680I, V771 M, V825I, I883 M) located in exons 8 to 17. Login to comment 80 ABCA1 p.Arg219Lys ABCA1 p.Val825Ile ABCA1 p.Glu1172Asp Description and Frequency of ABCA1 Gene Polymorphisms in the 2 Centers From the United Kingdom Sequence Allele Frequencyߤ Name 5b18; Flanking Nucleotide Change 3b18; Flanking Belfast (Nafd;888) Glasgow (Nafd;725) A-1814G CAGCCTCCTG A/g GATAACAGGC 0.339 0.366 C-1801T TAACAGGCGC C/t CGCCACCACA 0.443 0.433 A-1652G CACTGCGCCC A/g GCTCAGATCC 0.350 0.364 G-1506C CTCTTCTATG G/c GTCTGTCCTG 0.203 0.205 C-1395T TGAATGTCTG C/t ATGCAGGTGG 0.428 0.425 G-1252A TGCCCTTCAA G/a GTGGCTACAA 0.095 0.088 C-1217T AGGTAGGAGA C/t CTTGTGGCCT 0.120 0.121 afa;1034ins/del ATATTTAGAC afe;AT ATGGTGTGTA 0.210 0.220 T-940G GGCAAACAGA T/g AAGTTGGAGG 0.486 0.483 G-803A AAATTAAAAG G/a GGGCTGGTCC 0.108 0.093 afa;777rpt/23nt* CTGTGTTTTTGTTTGTTTGTTTC 0.527 0.518 afa;777rpt/28nt CTGTGTTTTTGTTTGTTTTGTTTGTTTC 0.267 0.272 afa;777rpt/32nt CTGTGTTTTTGTTTGTTTGTTTTGTTTGTTTC 0.206 0.210 C-564T GAGGACTGTC C/t GCCTTCCCCT 0.456 0.472 G-407C GCGGAAAGCA G/c GATTTAGAGG 0.455 0.459 C-302T CGTCTTAGGC C/t GGCGGGCCCG 0.196 0.189 G-278C GGGGGAAGGG G/c ACGCAGACCG 0.435 0.424 C-14T GGAACTAGTC C/t CGGCAAAAAC 0.335 0.346 R219K GGCCTACCAA G/a GGAGAAACTG 0.283 0.278 G316G AGGGAGGGGG G/a CTGAAGATCA 0.114 0.095 I680I ACAACAGCAT C/a CTCTGGTTTA 0.129 0.118 V771 M GCAGGACTAC G/a TGGGCTTCAC 0.029 0.034 V825I CACCACTTCG G/a TCTCCATGAT 0.056 0.060 I883 M AGAAGAGAAT A/g TCAGAAAGTA 0.137 0.126 L1122L GAAGAACCAG C/t TGGGAACAGG 0.023 0.017 E1172D GCGACCATGA G/c AGTGACACGC 0.026 0.027 T1427T GCAGAGACAC G/a CCCTGCCAGG 0.069 0.083 R1587K CTGGACACCA G/a AAATAATGTC 0.216 0.226 *1 subject carried an additional GTTT deletion, leading to an allele of 19 nucleotides. Login to comment 84 ABCA1 p.Arg219Lys ABCA1 p.Val825Ile ABCA1 p.Glu1172Asp Description and Frequency of ABCA1 Gene Polymorphisms in the 2 Centers From the United Kingdom Sequence Allele Frequency† Name 5Ј Flanking Nucleotide Change 3Ј Flanking Belfast (Nϭ888) Glasgow (Nϭ725) A-1814G CAGCCTCCTG A/g GATAACAGGC 0.339 0.366 C-1801T TAACAGGCGC C/t CGCCACCACA 0.443 0.433 A-1652G CACTGCGCCC A/g GCTCAGATCC 0.350 0.364 G-1506C CTCTTCTATG G/c GTCTGTCCTG 0.203 0.205 C-1395T TGAATGTCTG C/t ATGCAGGTGG 0.428 0.425 G-1252A TGCCCTTCAA G/a GTGGCTACAA 0.095 0.088 C-1217T AGGTAGGAGA C/t CTTGTGGCCT 0.120 0.121 -1034ins/del ATATTTAGAC ϮAT ATGGTGTGTA 0.210 0.220 T-940G GGCAAACAGA T/g AAGTTGGAGG 0.486 0.483 G-803A AAATTAAAAG G/a GGGCTGGTCC 0.108 0.093 -777rpt/23nt* CTGTGTTTTTGTTTGTTTGTTTC 0.527 0.518 -777rpt/28nt CTGTGTTTTTGTTTGTTTTGTTTGTTTC 0.267 0.272 -777rpt/32nt CTGTGTTTTTGTTTGTTTGTTTTGTTTGTTTC 0.206 0.210 C-564T GAGGACTGTC C/t GCCTTCCCCT 0.456 0.472 G-407C GCGGAAAGCA G/c GATTTAGAGG 0.455 0.459 C-302T CGTCTTAGGC C/t GGCGGGCCCG 0.196 0.189 G-278C GGGGGAAGGG G/c ACGCAGACCG 0.435 0.424 C-14T GGAACTAGTC C/t CGGCAAAAAC 0.335 0.346 R219K GGCCTACCAA G/a GGAGAAACTG 0.283 0.278 G316G AGGGAGGGGG G/a CTGAAGATCA 0.114 0.095 I680I ACAACAGCAT C/a CTCTGGTTTA 0.129 0.118 V771 M GCAGGACTAC G/a TGGGCTTCAC 0.029 0.034 V825I CACCACTTCG G/a TCTCCATGAT 0.056 0.060 I883 M AGAAGAGAAT A/g TCAGAAAGTA 0.137 0.126 L1122L GAAGAACCAG C/t TGGGAACAGG 0.023 0.017 E1172D GCGACCATGA G/c AGTGACACGC 0.026 0.027 T1427T GCAGAGACAC G/a CCCTGCCAGG 0.069 0.083 R1587K CTGGACACCA G/a AAATAATGTC 0.216 0.226 *1 subject carried an additional GTTT deletion, leading to an allele of 19 nucleotides. Login to comment 94 ABCA1 p.Arg219Lys Coding Region By single-locus analysis, the R219K polymorphism was associated with MI, with K219 allele being associated with a decreased risk consistently in the 2 centers (population adjusted ORafd;0.80 [0.68-0.94], Pafd;0.007). Login to comment 98 ABCA1 p.Arg219Lys Coding Region By single-locus analysis, the R219K polymorphism was associated with MI, with K219 allele being associated with a decreased risk consistently in the 2 centers (population adjusted ORϭ0.80 [0.68-0.94], Pϭ0.007). Login to comment 100 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys The "best" model encountered in the systematic exploration was the model with the R219K polymorphism alone, suggesting that apart from the raw effect of the R219K polymorphism, no other polymorphism was associated with the risk of MI. Login to comment 104 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys The "best" model encountered in the systematic exploration was the model with the R219K polymorphism alone, suggesting that apart from the raw effect of the R219K polymorphism, no other polymorphism was associated with the risk of MI. Login to comment 120 ABCA1 p.Arg219Lys ABCA1 p.Val825Ile ABCA1 p.Glu1172Asp Discussion Much attention has been focused on the association of ABCA1 gene polymorphisms with different phenotypes including lipid variables and clinical endpoints.23,25-29,39 Several studies have consistently reported an association between the R219K polymorphism and coronary artery disease.23,26,27 This polymorphism has been shown to be associated with triglycerides23 but not with HDL-C.26,27 Inconsistent results were also observed for other ABCA1 gene polymorphisms including V825I, I883 M, and E1172D. Login to comment 124 ABCA1 p.Arg219Lys ABCA1 p.Val825Ile ABCA1 p.Glu1172Asp Discussion Much attention has been focused on the association of ABCA1 gene polymorphisms with different phenotypes including lipid variables and clinical endpoints.23,25-29,39 Several studies have consistently reported an association between the R219K polymorphism and coronary artery disease.23,26,27 This polymorphism has been shown to be associated with triglycerides23 but not with HDL-C.26,27 Inconsistent results were also observed for other ABCA1 gene polymorphisms including V825I, I883 M, and E1172D. Login to comment 129 ABCA1 p.Arg219Lys ABCA1 p.Val825Ile ABCA1 p.Glu1172Asp Haplotype Structure Defined by the Polymorphisms of the ABCA1 Gene Coding Region (Nd1d;1296) Polymorphisms Estimated Haplotype Frequencies R219K G316G (G/A) I680I (C/A) V771 M V825I I883 M L1122L (C/T) E1172D T1427T (G/A) R1587K Controls (Nafd;639) Cases (Nafd;657) R G C V V I C E G R 0.470 0.522 R G C V V I C E G K 0.089 0.085 R G C V V I C E A R 0.026 0.031 R G C V V I C D G K 0.018 0.019 R G C V V I T E G R 0.016 0.017 R G A V I M C E G R 0.015 0.015 R G A V I M C E G K 0.015 0.015 R G A V I M C E A R 0.028 0.026 K G C V V I C E G R 0.077 0.063 K G C V V I C E G K 0.041 0.037 K G A V V M C E G R 0.026 0.020 K G A V V M C E G K 0.014 0.012 K G A V V M C E A R 0.016 0.019 K A C V V I C E G R 0.042 0.035 K A C V V I C E G K 0.034 0.027 K A C M V I C E G R 0.028 0.027 The haplotype structure of the coding region of the ABCA1 gene can be completely defined by a minimal subset of 8 "tag" polymorphisms indicated in boxes. Login to comment 133 ABCA1 p.Arg219Lys ABCA1 p.Val825Ile ABCA1 p.Glu1172Asp Haplotype Structure Defined by the Polymorphisms of the ABCA1 Gene Coding Region (N‫)6921؍‬ Polymorphisms Estimated Haplotype Frequencies R219K G316G (G/A) I680I (C/A) V771 M V825I I883 M L1122L (C/T) E1172D T1427T (G/A) R1587K Controls (Nϭ639) Cases (Nϭ657) R G C V V I C E G R 0.470 0.522 R G C V V I C E G K 0.089 0.085 R G C V V I C E A R 0.026 0.031 R G C V V I C D G K 0.018 0.019 R G C V V I T E G R 0.016 0.017 R G A V I M C E G R 0.015 0.015 R G A V I M C E G K 0.015 0.015 R G A V I M C E A R 0.028 0.026 K G C V V I C E G R 0.077 0.063 K G C V V I C E G K 0.041 0.037 K G A V V M C E G R 0.026 0.020 K G A V V M C E G K 0.014 0.012 K G A V V M C E A R 0.016 0.019 K A C V V I C E G R 0.042 0.035 K A C V V I C E G K 0.034 0.027 K A C M V I C E G R 0.028 0.027 The haplotype structure of the coding region of the ABCA1 gene can be completely defined by a minimal subset of 8 "tag" polymorphisms indicated in boxes. Login to comment 140 ABCA1 p.Arg219Lys Conversely, the R219K polymorphism was associated with MI but not with ApoA1 levels. Login to comment 144 ABCA1 p.Arg219Lys Conversely, the R219K polymorphism was associated with MI but not with ApoA1 levels. Login to comment 145 ABCA1 p.Arg219Lys There are also a number of inconsistencies in the results that we are unable to explain for the moment, especially the fact that R1587K affects plasma ApoA1 but appears unrelated to MI and conversely that R219K is associated with MI but does not affect plasma ApoA1 levels. Login to comment 149 ABCA1 p.Arg219Lys There are also a number of inconsistencies in the results that we are unable to explain for the moment, especially the fact that R1587K affects plasma ApoA1 but appears unrelated to MI and conversely that R219K is associated with MI but does not affect plasma ApoA1 levels. Login to comment