ABCMdb

PMID: 11238261

Clee SM, Zwinderman AH, Engert JC, Zwarts KY, Molhuizen HO, Roomp K, Jukema JW, van Wijland M, van Dam M, Hudson TJ, Brooks-Wilson A, Genest J Jr, Kastelein JJ, Hayden MR
Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease.
Circulation. 2001 Mar 6;103(9):1198-205., [PubMed]

Sentences

No. Mutations Sentence Comment

5 ABCA1 p.Arg219Lys The R219K variant has a carrier frequency of 46% in Europeans. Login to comment 7 ABCA1 p.Arg219Lys Atherosclerosis progresses more slowly in carriers of R219K than in noncarriers. Login to comment 11 ABCA1 p.Arg219Lys The R219K variant has a carrier frequency of 46% in Europeans. Login to comment 13 ABCA1 p.Arg219Lys Atherosclerosis progresses more slowly in carriers of R219K than in noncarriers. Login to comment 24 ABCA1 p.Arg219Lys We report here that a common ABCA1 cSNP, R219K, is associated with decreased TG, increased HDL-C and, importantly, a decreased progression of atherosclerosis and a reduced risk of coronary events, suggesting that common genetic variants in ABCA1 may influence these clinical outcomes in the general population. Login to comment 27 ABCA1 p.Arg219Lys We studied the effects of these cSNPs on the baseline lipid parameters of the cohort of 804 Dutch men with proven CAD who participated in the Regression Growth Evaluation Statin Study (REGRESS); these subjects were described previously.11 For replication studies with the R219K variant, we genotyped 3 smaller cohorts. Login to comment 29 ABCA1 p.Arg219Lys We report here that a common ABCA1 cSNP, R219K, is associated with decreased TG, increased HDL-C and, importantly, a decreased progression of atherosclerosis and a reduced risk of coronary events, suggesting that common genetic variants in ABCA1 may influence these clinical outcomes in the general population. Login to comment 32 ABCA1 p.Arg219Lys We studied the effects of these cSNPs on the baseline lipid parameters of the cohort of 804 Dutch men with proven CAD who participated in the Regression Growth Evaluation Statin Study (REGRESS); these subjects were described previously.11 For replication studies with the R219K variant, we genotyped 3 smaller cohorts. Login to comment 39 ABCA1 p.Ile883Met ABCA1 p.Val771Met ABCA1 p.Glu1172Asp ABCA1 p.Val399Ala ABCA1 p.Thr774Pro To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed. Login to comment 43 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Ser1731Cys ABCA1 p.Lys776Asn ABCA1 p.Val825Ile ABCA1 p.Val771Met ABCA1 p.Glu1172Asp ABCA1 p.Val399Ala ABCA1 p.Thr774Pro Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment 44 ABCA1 p.Ile883Met ABCA1 p.Val771Met ABCA1 p.Glu1172Asp ABCA1 p.Val399Ala ABCA1 p.Thr774Pro To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed. Login to comment 48 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Ser1731Cys ABCA1 p.Lys776Asn ABCA1 p.Val825Ile ABCA1 p.Val771Met ABCA1 p.Glu1172Asp ABCA1 p.Val399Ala ABCA1 p.Thr774Pro Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment 56 ABCA1 p.Arg219Lys The population-attributable risk for R219K is calculated from the sum of each genotype frequency multiplied by its risk (relative to KK). Login to comment 61 ABCA1 p.Arg219Lys The population-attributable risk for R219K is calculated from the sum of each genotype frequency multiplied by its risk (relative to KK). Login to comment 63 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys The R219K Polymorphism Is Associated With a Decreased Severity of CAD The G1051A polymorphism results in the substitution of a lysine for arginine at amino acid 219 of the ABCA1 protein (R219K; Table 2). Login to comment 66 ABCA1 p.Arg219Lys The K allele of the R219K polymorphism was associated with a decreased severity of CAD (Table 3), as indicated by an increased MSD and MOD. Login to comment 68 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys The R219K Polymorphism Is Associated With a Decreased Severity of CAD The G1051A polymorphism results in the substitution of a lysine for arginine at amino acid 219 of the ABCA1 protein (R219K; Table 2). Login to comment 71 ABCA1 p.Arg219Lys The K allele of the R219K polymorphism was associated with a decreased severity of CAD (Table 3), as indicated by an increased MSD and MOD. Login to comment 73 ABCA1 p.Arg219Lys For the R219K variant, the population-attributable risk is 5.3%, suggesting that the frequency of CAD events would be 5.3% lower if all individuals carried the KK genotype. Login to comment 74 ABCA1 p.Arg219Lys If the K allele of the R219K variant is protective against CAD, we might expect its frequency to be reduced in this cohort, which was selected for CAD. Login to comment 76 ABCA1 p.Arg219Lys Association of the R219K Polymorphism With Plasma Lipid Levels TG were significantly lower in the carriers of the K allele (Table 4). Login to comment 78 ABCA1 p.Arg219Lys For the R219K variant, the population-attributable risk is 5.3%, suggesting that the frequency of CAD events would be 5.3% lower if all individuals carried the KK genotype. Login to comment 79 ABCA1 p.Arg219Lys If the K allele of the R219K variant is protective against CAD, we might expect its frequency to be reduced in this cohort, which was selected for CAD. Login to comment 80 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Ser1731Cys ABCA1 p.Lys776Asn ABCA1 p.Val825Ile ABCA1 p.Val771Met ABCA1 p.Glu1172Asp ABCA1 p.Val399Ala ABCA1 p.Thr774Pro Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment 81 ABCA1 p.Arg219Lys Association of the R219K Polymorphism With Plasma Lipid Levels TG were significantly lower in the carriers of the K allele (Table 4). Login to comment 85 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Ser1731Cys ABCA1 p.Lys776Asn ABCA1 p.Val825Ile ABCA1 p.Val771Met ABCA1 p.Glu1172Asp ABCA1 p.Val399Ala ABCA1 p.Thr774Pro Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment 87 ABCA1 p.Arg219Lys In younger individuals, cholesterol efflux and HDL-C were increased in KK compared with RR individuals, which suggests that the R219K variant may be especially protective against premature CAD. Login to comment 88 ABCA1 p.Arg219Lys Age Subgroup Analysis Indicates CAD Progresses More Slowly in R219K Carriers In the noncarriers, MOD and MSD decreased significantly with age, reflecting increased atherosclerosis in the older individuals (1.77afe;0.34 versus 1.69afe;0.35 mm, Pb0d;0.0001, and 2.75afe;0.36 versus 2.65afe;0.38 mm, Pafd;0.006 for MOD and MSD, respectively, in younger versus older noncarriers). Login to comment 89 ABCA1 p.Arg219Lys In contrast, in carriers of the R219K variant, these measurements do not significantly change with age (1.83afe;0.36 versus 1.78afe;0.34 mm, Pafd;0.30, and 2.79afe;0.37 versus 2.75afe;0.37 mm, Pafd;0.18, for MOD and MSD, respectively, in younger versus older carriers). Login to comment 90 ABCA1 p.Arg219Lys Thus, vascular disease progresses more slowly with age in carriers of R219K compared with noncarriers (Figure I; can be found Online at www.circulationaha.org). Login to comment 91 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Replication Cohorts Show the R219K Variant Is Associated With Decreased TG and Increased HDL-C To confirm and replicate the relationship observed between the R219K variant and plasma lipid levels, we genotyped this variant in 3 small cohorts of European subjects. Login to comment 92 ABCA1 p.Arg219Lys In younger individuals, cholesterol efflux and HDL-C were increased in KK compared with RR individuals, which suggests that the R219K variant may be especially protective against premature CAD. Login to comment 93 ABCA1 p.Arg219Lys Age Subgroup Analysis Indicates CAD Progresses More Slowly in R219K Carriers In the noncarriers, MOD and MSD decreased significantly with age, reflecting increased atherosclerosis in the older individuals (1.77Ϯ0.34 versus 1.69Ϯ0.35 mm, PϽ0.0001, and 2.75Ϯ0.36 versus 2.65Ϯ0.38 mm, Pϭ0.006 for MOD and MSD, respectively, in younger versus older noncarriers). Login to comment 94 ABCA1 p.Arg219Lys In contrast, in carriers of the R219K variant, these measurements do not significantly change with age (1.83Ϯ0.36 versus 1.78Ϯ0.34 mm, Pϭ0.30, and 2.79Ϯ0.37 versus 2.75Ϯ0.37 mm, Pϭ0.18, for MOD and MSD, respectively, in younger versus older carriers). Login to comment 95 ABCA1 p.Arg219Lys Thus, vascular disease progresses more slowly with age in carriers of R219K compared with noncarriers (Figure I; can be found Online at www.circulationaha.org). Login to comment 96 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Replication Cohorts Show the R219K Variant Is Associated With Decreased TG and Increased HDL-C To confirm and replicate the relationship observed between the R219K variant and plasma lipid levels, we genotyped this variant in 3 small cohorts of European subjects. Login to comment 98 ABCA1 p.Arg219Lys CAD in R219K Carriers Compared With Controls RR RK KK Carriers (RKaf9;KK) P RK vs RR KK vs RR RKaf9;KK vs RR n 424 330 36 366 MSD, mm 2.70afe;0.37 2.77afe;0.37 2.78afe;0.40 2.77afe;0.37 0.01 0.22 0.005 MOD, mm 1.73afe;0.35 1.81afe;0.35 1.85afe;0.35 1.81afe;0.35 0.002 0.05 0.001 MI before trial, % (n) 48.3 (205) 47.1 (155) 33.3 (12) 45.8 (167) 0.71 0.12 0.48 Events during trial, % (n) 17 (71) 13 (41) 11 (4) 12 (45) 0.10 0.49 0.09 Total events, % (n) 59 (248) 52 (170) 39 (14) 50 (184) 0.06* 0.03ߤ 0.02ߥ Values are meanafe;SD or % (n). Login to comment 103 ABCA1 p.Arg219Lys CAD in R219K Carriers Compared With Controls RR RK KK Carriers (RKϩKK) P RK vs RR KK vs RR RKϩKK vs RR n 424 330 36 366 MSD, mm 2.70Ϯ0.37 2.77Ϯ0.37 2.78Ϯ0.40 2.77Ϯ0.37 0.01 0.22 0.005 MOD, mm 1.73Ϯ0.35 1.81Ϯ0.35 1.85Ϯ0.35 1.81Ϯ0.35 0.002 0.05 0.001 MI before trial, % (n) 48.3 (205) 47.1 (155) 33.3 (12) 45.8 (167) 0.71 0.12 0.48 Events during trial, % (n) 17 (71) 13 (41) 11 (4) 12 (45) 0.10 0.49 0.09 Total events, % (n) 59 (248) 52 (170) 39 (14) 50 (184) 0.06* 0.03† 0.02‡ Values are meanϮSD or % (n). Login to comment 106 ABCA1 p.Val825Ile Other ABCA1 cSNPs Influence Plasma Lipid Levels and Risk of CAD Carriers of the V825I cSNP (nafd;103 VI af9; 4 II) had no obvious differences in lipid levels or baseline MSD or MOD (Table 6), but they did have a significantly increased number of events during the trial (44% versus 33% in noncarriers, Pafd;0.0008; odds ratio, 2.31; 95% CI, 1.41 to 3.83). Login to comment 107 ABCA1 p.Ile883Met Although there were no differences in mean lipid levels between the genotypes in carriers of the I883M cSNP (IMaf9;MM, Table 6), MM individuals (nafd;14) had an increased progression in MOD (mean change, 0.53afe;0.79 versus 0.11afe;0.25 mm in noncarriers, Pb0d;0.001) and a cardiac event rate double that of the II individuals (nafd;320; 21.4% versus 10.6%, Pafd;0.19). Login to comment 111 ABCA1 p.Val825Ile Other ABCA1 cSNPs Influence Plasma Lipid Levels and Risk of CAD Carriers of the V825I cSNP (nϭ103 VI ϩ 4 II) had no obvious differences in lipid levels or baseline MSD or MOD (Table 6), but they did have a significantly increased number of events during the trial (44% versus 33% in noncarriers, Pϭ0.0008; odds ratio, 2.31; 95% CI, 1.41 to 3.83). Login to comment 112 ABCA1 p.Ile883Met Although there were no differences in mean lipid levels between the genotypes in carriers of the I883M cSNP (IMϩMM, Table 6), MM individuals (nϭ14) had an increased progression in MOD (mean change, 0.53Ϯ0.79 versus 0.11Ϯ0.25 mm in noncarriers, PϽ0.001) and a cardiac event rate double that of the II individuals (nϭ320; 21.4% versus 10.6%, Pϭ0.19). Login to comment 113 ABCA1 p.Val399Ala Heterozygous carriers of V399A had a trend toward higher HDL-C compared with noncarriers. Login to comment 115 ABCA1 p.Arg219Lys Event-free survival curves for R219K carriers (RKaf9;KK; thin line) and noncarriers (RR; thick line). Login to comment 117 ABCA1 p.Arg219Lys Carriers of R219K had a 29% increased event-free survival compared with noncarriers. Login to comment 118 ABCA1 p.Val399Ala Heterozygous carriers of V399A had a trend toward higher HDL-C compared with noncarriers. Login to comment 119 ABCA1 p.Arg219Lys Baseline Demographics and Lipid Levels in the REGRESS Cohort by R219K Genotype RR RK KK RKaf9;KK P RK vs RR KK vs RR RKaf9;KK vs RR n 424 330 36 366 Age, y 57afe;8 55afe;8 57afe;7 55afe;8 0.0007 1 0.03 BMI, kg/m2 25.8afe;2.6 26.3afe;2.7 25.5afe;2.3 26.2afe;2.7 0.01 0.50 0.09 Total cholesterol, mmol/L 6.02afe;0.86 6.07afe;0.89 5.89afe;0.85 6.06afe;0.89 0.44 0.38 0.60 HDL-C, mmol/L 0.92afe;0.22 0.93afe;0.23 0.92afe;0.20 0.93afe;0.23 0.54 1 0.81 LDL-C, mmol/L 4.27afe;0.75 4.35afe;0.83 4.33afe;0.82 4.35afe;0.83 0.17 0.65 0.19 TG, mmol/L 1.84afe;0.77 1.78afe;0.78 1.42afe;0.49 1.74afe;0.76 0.29 0.001 0.08 Values are meanafe;SD. Login to comment 120 ABCA1 p.Arg219Lys Event-free survival curves for R219K carriers (RKϩKK; thin line) and noncarriers (RR; thick line). Login to comment 121 ABCA1 p.Arg219Lys Changes in HDL-C and efflux with age by R219K genotype. Login to comment 122 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Carriers of R219K had a 29% increased event-free survival compared with noncarriers. Login to comment 124 ABCA1 p.Arg219Lys Baseline Demographics and Lipid Levels in the REGRESS Cohort by R219K Genotype RR RK KK RKϩKK P RK vs RR KK vs RR RKϩKK vs RR n 424 330 36 366 Age, y 57Ϯ8 55Ϯ8 57Ϯ7 55Ϯ8 0.0007 1 0.03 BMI, kg/m2 25.8Ϯ2.6 26.3Ϯ2.7 25.5Ϯ2.3 26.2Ϯ2.7 0.01 0.50 0.09 Total cholesterol, mmol/L 6.02Ϯ0.86 6.07Ϯ0.89 5.89Ϯ0.85 6.06Ϯ0.89 0.44 0.38 0.60 HDL-C, mmol/L 0.92Ϯ0.22 0.93Ϯ0.23 0.92Ϯ0.20 0.93Ϯ0.23 0.54 1 0.81 LDL-C, mmol/L 4.27Ϯ0.75 4.35Ϯ0.83 4.33Ϯ0.82 4.35Ϯ0.83 0.17 0.65 0.19 TG, mmol/L 1.84Ϯ0.77 1.78Ϯ0.78 1.42Ϯ0.49 1.74Ϯ0.76 0.29 0.001 0.08 Values are meanϮSD. Login to comment 126 ABCA1 p.Arg219Lys Changes in HDL-C and efflux with age by R219K genotype. Login to comment 127 ABCA1 p.Arg219Lys ABCA1 p.Val399Ala A depicts the relationship between HDL-C and age in R219K carriers (RKϩKK; dashed line) compared with noncarriers (RR; solid line). Login to comment 129 ABCA1 p.Val771Met Carriers of the V771M (nafd;37 VM) had decreased focal atherosclerosis (MOD) compared with noncarriers (Table 6) and a trend toward less diffuse atherosclerosis (increased MSD). Login to comment 130 ABCA1 p.Val771Met Carriers of V771M had no difference in lipid levels compared with noncarriers. Login to comment 131 ABCA1 p.Arg219Lys ABCA1 p.Val771Met However, all but 2 carriers of V771M were also carriers of R219K. Login to comment 132 ABCA1 p.Lys776Asn ABCA1 p.Glu1172Asp ABCA1 p.Val399Ala ABCA1 p.Thr774Pro Carriers of V399A had half the frequency of a positive family history of CAD (22.2% versus 49.4%, Pϭ0.18) and trends toward an increased baseline MOD (Table 6) and less progression in MSD (-0.05Ϯ0.10 versus 0.08Ϯ0.19 mm in noncarriers, Pϭ0.16) during the trial. Login to comment 133 ABCA1 p.Ser1731Cys No carriers of S1731C were detected in the REGRESS population. Login to comment 134 ABCA1 p.Val771Met Carriers of the V771M (nϭ37 VM) had decreased focal atherosclerosis (MOD) compared with noncarriers (Table 6) and a trend toward less diffuse atherosclerosis (increased MSD). Login to comment 135 ABCA1 p.Val771Met ABCA1 p.Arg2144* ABCA1 p.Arg2144* Carriers of V771M had no difference in lipid levels compared with noncarriers. Login to comment 136 ABCA1 p.Arg219Lys ABCA1 p.Ser1731Cys ABCA1 p.Val771Met However, all but 2 carriers of V771M were also carriers of R219K. Login to comment 137 ABCA1 p.Lys776Asn ABCA1 p.Glu1172Asp ABCA1 p.Thr774Pro Carriers of the other 3 rare variants (T774P, K776N, and E1172D) showed no significant differences in lipid levels or CAD compared with their respective noncarriers (Table 6). Login to comment 138 ABCA1 p.Arg219Lys ABCA1 p.Ser1731Cys No carriers of S1731C were detected in the REGRESS population. Login to comment 139 ABCA1 p.Arg219Lys ABCA1 p.Lys776Asn ABCA1 p.Val771Met Two rare cSNPs (V771M and K776N) are most commonly found in individuals carrying the R219K K allele. Login to comment 140 ABCA1 p.Arg219Lys ABCA1 p.Lys776Asn ABCA1 p.Val771Met ABCA1 p.Arg2144* ABCA1 p.Arg2144* The presence of this variant in individuals heterozygous for the R2144X ABCA1 mutation was associated with further significantly decreased HDL-C compared with R2144X carriers without this polymorphism (0.16Ϯ0.04 mmol/L, nϭ2, versus 0.64Ϯ0.14 mmol/L, nϭ10; Pϭ0.0009). Login to comment 141 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Ser1731Cys In unaffected family members, although carriers of S1731C (nϭ6) had slightly lower HDL-C compared with noncarriers (nϭ14, 1.03Ϯ0.22 versus 1.09Ϯ0.23 mmol/L), the difference was not statistically significant. Login to comment 142 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys We identified R219K carriers who do not also carry either the I883M or R1587K genotype (nafd;62) and compared them with the group of individuals who do not carry any of the 3 variants (nafd;116). Login to comment 143 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys The Phenotypic Effects of R219K Are Independent of Other cSNPs There is linkage disequilibrium between cSNPs in the ABCA1 gene. Login to comment 144 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Lys776Asn ABCA1 p.Val771Met Two rare cSNPs (V771M and K776N) are most commonly found in individuals carrying the R219K K allele. Login to comment 145 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Lys776Asn ABCA1 p.Val825Ile ABCA1 p.Val771Met If all V771M and K776N carriers are excluded, the results are unaltered, with increased MOD (1.80Ϯ0.35 versus 1.73Ϯ0.35 mm, Pϭ0.006) and MSD (2.76Ϯ0.36 versus 2.70Ϯ0.37 mm, Pϭ0.02) and lower mean TG levels (1.71Ϯ0.75 versus 1.84Ϯ0.77 mmol/L, Pϭ0.02) in carriers of R219K (nϭ329) compared with noncarriers (nϭ422). Login to comment 146 ABCA1 p.Ile883Met ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Val825Ile The I883M and R1587K cSNPs are also often seen in carriers of R219K. Login to comment 147 ABCA1 p.Ile883Met ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Val825Ile We identified R219K carriers who do not also carry either the I883M or R1587K genotype (nϭ62) and compared them with the group of individuals who do not carry any of the 3 variants (nϭ116). Login to comment 148 ABCA1 p.Arg219Lys ABCA1 p.Glu1172Asp MSD was still significantly increased in R219K carriers compared with noncarriers (2.81Ϯ0.37 versus 2.69Ϯ0.36 mm, Pϭ0.04); MOD was increased in carriers (1.78Ϯ0.39 versus 1.73Ϯ0.38 mm); and TG remained significantly decreased in carriers (1.67Ϯ0.76 versus 1.97Ϯ0.74 mmol/L, Pϭ0.02). Login to comment 149 ABCA1 p.Arg219Lys ABCA1 p.Glu1172Asp Thus, the effects of the R219K variant described herein are not due to other cSNPs that are found in linkage disequilibrium with it. Login to comment 150 ABCA1 p.Ile883Met ABCA1 p.Val825Ile The V825I cSNP was found to be in linkage disequilibrium with I883M. Login to comment 151 ABCA1 p.Ile883Met ABCA1 p.Val825Ile ABCA1 p.Glu1172Asp ABCA1 p.Glu1172Asp The relative risk of the V825I carriers adjusted for I883M genotype was 2.31 (95% CI, 0.78 to 6.85). Login to comment 152 ABCA1 p.Ile883Met ABCA1 p.Val825Ile Because the effects of the I883M variant were only evident in homozygous carriers, the number of individuals was too few to correct for V825I genotype. Login to comment 153 ABCA1 p.Glu1172Asp The E1172D cSNP was found exclusively in carriers of the R1587K variant. Login to comment 154 ABCA1 p.Glu1172Asp Excluding carriers of E1172D (nϭ34), a trend toward decreasing HDL-C with the R1587K K allele was still evident (0.87Ϯ0.18 mmol/L in KK, 0.92Ϯ0.23 mmol/L in RK, and 0.94Ϯ0.23 mmol/L in RR, Pϭ0.19). Login to comment 156 ABCA1 p.Ile883Met ABCA1 p.Lys776Asn ABCA1 p.Val825Ile ABCA1 p.Val771Met ABCA1 p.Glu1172Asp ABCA1 p.Glu1172Asp ABCA1 p.Val399Ala ABCA1 p.Thr774Pro No significant differences in lipid levels or CAD were observed for E1172D carriers compared with R1587K heterozygotes without E1172D. Login to comment 157 ABCA1 p.Glu1172Asp not due to the nonfunctional E1172D variant, with which it is in linkage disequilibrium. Login to comment 159 ABCA1 p.Arg219Lys The R219K variant, with a carrier frequency of 46% in European populations, is associated with a decreased severity of CAD, which manifests as decreased focal and diffuse atherosclerosis, with less progression and decreased coronary events. Login to comment 161 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Lys776Asn ABCA1 p.Val825Ile ABCA1 p.Val771Met ABCA1 p.Val399Ala ABCA1 p.Thr774Pro ABCA cSNPs in REGRESS MOD, mm MSD, mm HDL-C, mmol/L TG, mmol/L Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P V825I 1.74Ϯ0.37 (107) 1.77Ϯ0.35 (575) 0.39 2.70Ϯ0.38 2.75Ϯ0.38 0.21 0.91Ϯ0.23 0.93Ϯ0.22 0.42 1.86Ϯ0.84 1.80Ϯ0.76 0.49 I883M 1.74Ϯ0.38 (100) 1.75Ϯ0.36 (320) 0.71 2.69Ϯ0.38 2.73Ϯ0.36 0.41 0.91Ϯ0.22 0.91Ϯ0.21 0.97 1.75Ϯ0.77 1.82Ϯ0.75 0.42 R1587K 1.77Ϯ0.34 (346) 1.76Ϯ0.37 (433) 0.75 2.73Ϯ0.39 2.74Ϯ0.36 0.64 0.90Ϯ0.22 0.94Ϯ0.23 0.03 1.79Ϯ0.76 1.81Ϯ0.78 0.77 V399A 1.92Ϯ0.32 (9) 1.73Ϯ0.35 (540) 0.13 2.73Ϯ0.40 2.71Ϯ0.37 0.89 1.03Ϯ0.28 0.92Ϯ0.23 0.15 1.71Ϯ0.63 1.82Ϯ0.78 0.68 V771M 1.89Ϯ0.38 (37) 1.76Ϯ0.35 (598) 0.045 2.83Ϯ0.49 2.73Ϯ0.37 0.13 0.91Ϯ0.20 0.92Ϯ0.22 0.58 1.98Ϯ0.79 1.78Ϯ0.76 0.11 T774P 1.63Ϯ0.31 (4) 1.76Ϯ0.36 (621) 0.47 2.85Ϯ0.34 2.73Ϯ0.37 0.52 0.85Ϯ0.07 0.93Ϯ0.22 0.50 1.90Ϯ1.04 1.82Ϯ0.77 0.84 K776N 1.92Ϯ0.33 (3) 1.78Ϯ0.34 (546) 0.48 2.95Ϯ0.48 2.76Ϯ0.37 0.36 0.94Ϯ0.28 0.93Ϯ0.22 0.93 2.25Ϯ0.94 1.76Ϯ0.76 0.26 E117SD 1.80Ϯ0.39 (34) 1.77Ϯ0.36 (610) 0.67 2.78Ϯ0.35 2.74Ϯ0.37 0.42 0.93Ϯ0.23 0.94Ϯ0.23 0.89 1.80Ϯ0.90 1.77Ϯ0.76 0.80 Values are meanϮSD (n). Login to comment 162 ABCA1 p.Glu1172Asp not due to the nonfunctional E1172D variant, with which it is in linkage disequilibrium. Login to comment 163 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Both the finding of decreased TG and of increased HDL-C in younger carriers of the R219K K allele is consistent with the decreased CAD observed in carriers of the variant.15,16 TG levels showed similar trends in our replication groups, and increased HDL-C levels in R219K carriers were observed in our independent populations. Login to comment 164 ABCA1 p.Arg219Lys The R219K variant, with a carrier frequency of 46% in European populations, is associated with a decreased severity of CAD, which manifests as decreased focal and diffuse atherosclerosis, with less progression and decreased coronary events. Login to comment 166 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Val771Met The phenotypic effects of the remaining cSNPs are less striking than those of R219K. Login to comment 168 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Both the finding of decreased TG and of increased HDL-C in younger carriers of the R219K K allele is consistent with the decreased CAD observed in carriers of the variant.15,16 TG levels showed similar trends in our replication groups, and increased HDL-C levels in R219K carriers were observed in our independent populations. Login to comment 171 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Val771Met The lack of obvious differences in HDL-C in carriers of different cSNPs (R219K, V771M, and I883M), together with clear differences in CAD, suggests that stimulating the RCT pathway can increase the net flux of cholesterol toward the liver without altering steady-state plasma HDL-C levels. Login to comment 173 ABCA1 p.Arg219Lys The mechanism underlying the decreased TG in carriers of the R219K variant is unknown. Login to comment 174 ABCA1 p.Arg219Lys In heterozygotes, the phenotype is more pronounced in older individuals.9 This suggests that ABCA1 activity may normally increase with age but that this is blunted in R219K heterozygotes. Login to comment 175 ABCA1 p.Arg219Lys Age-related increases in the expression and activity of P-glycoprotein, another ATP-binding cassette transporter, have been described.22,23 In the present study, we show that the R219K polymorphism was also associated with an altered relationship between age and HDL-C. Login to comment 179 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Val399Ala In heterozygotes, the phenotype is more pronounced in older individuals.9 This suggests that ABCA1 activity may normally increase with age but that this is blunted in R219K heterozygotes. Login to comment 180 ABCA1 p.Arg219Lys ABCA1 p.Val399Ala Age-related increases in the expression and activity of P-glycoprotein, another ATP-binding cassette transporter, have been described.22,23 In the present study, we show that the R219K polymorphism was also associated with an altered relationship between age and HDL-C. Login to comment 181 ABCA1 p.Ile883Met Furthermore, we show that I883M is a common variant that is possibly associated with an increased risk of CAD in the homozygous state, although no differences in HDL-C were evident. Login to comment 184 ABCA1 p.Ile883Met ABCA1 p.Ile883Met ABCA1 p.Val399Ala Of note, the V399A and I883M variants were shown to cosegregate on a mutation-bearing chromosome in one of the initial Tangier families described.6 The authors suggested that 1 of these 2 variants was likely the functional mutation. Login to comment 185 ABCA1 p.Val399Ala Yet, here we show that the V399A variant was associated with a trend toward increased HDL-C. Login to comment 186 ABCA1 p.Ile883Met ABCA1 p.Lys776Asn ABCA1 p.Val771Met ABCA1 p.Thr774Pro Furthermore, we show that I883M is a common variant that is possibly associated with an increased risk of CAD in the homozygous state, although no differences in HDL-C were evident. Login to comment 187 ABCA1 p.Arg219Lys We showed that common ABCA1 cSNPs are associated with altered plasma lipid levels and severity of atherosclerosis. Specifically, the frequent R219K variant is associated with a decreased severity of atherosclerosis, a decreased risk of coronary events, decreased TG, and increased HDL-C, which is consistent with a gain of function in ABCA1. Login to comment 188 ABCA1 p.Arg219Lys These effects were independent of any other cSNPs found in association with R219K and were seen both in different measures of CAD and in multiple cohorts. Login to comment 189 ABCA1 p.Ile883Met The distribution of cSNPs was not random (Figure 1); they were found away from known functional domains, such as the ATP-binding cassettes and regions where mutations cluster.9 The one exception to this pattern was the I883M variant, which was located just N-terminal of the first ATP-binding cassette region, where several mutations have been shown to occur (amino acids 909 to 93724). Login to comment 191 ABCA1 p.Lys776Asn ABCA1 p.Val771Met ABCA1 p.Thr774Pro Similarly, the region containing the V771M, T774P, and K776N variants is unlikely to be critical to ABCA1 function, because a high degree of polymorphism is tolerated without functional effects. Login to comment 192 ABCA1 p.Arg219Lys We showed that common ABCA1 cSNPs are associated with altered plasma lipid levels and severity of atherosclerosis. Specifically, the frequent R219K variant is associated with a decreased severity of atherosclerosis, a decreased risk of coronary events, decreased TG, and increased HDL-C, which is consistent with a gain of function in ABCA1. Login to comment 193 ABCA1 p.Arg219Lys These effects were independent of any other cSNPs found in association with R219K and were seen both in different measures of CAD and in multiple cohorts. Login to comment