ABCMdb

PMID: 15024730

Katzov H, Chalmers K, Palmgren J, Andreasen N, Johansson B, Cairns NJ, Gatz M, Wilcock GK, Love S, Pedersen NL, Brookes AJ, Blennow K, Kehoe PG, Prince JA
Genetic variants of ABCA1 modify Alzheimer disease risk and quantitative traits related to beta-amyloid metabolism.
Hum Mutat. 2004 Apr;23(4):358-67., [PubMed]

Sentences

No. Mutations Sentence Comment

74 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Val825Ile ABCA1 p.Val771Met Details of ABCA1 SNPs, and Oligos for PCR and DASHn Variant dbSNP rsID Base change Forward primer sequence (50 ^30 ) Reverse primer sequence (30 ^50 ) Probe sequence (50 ^30 ) p.R219K rs2230806 c.658G4A g.10300705G4A b-TTTCTGAGCTTTGTGGCCTACC GCTCTGCTGCAGCCAGTTTCTC GTTTCTCCCTTGGTAGG p.V771M rs2066718 c.2314G4A g.102969093G4A b-TGTGTGTGGCATGGCAGGACTA GCGAAGATCTTGAGTGTGAAGC GAAGCCCACGTAGTCCT p.V825I rs4149312 c.2476G4A g.102967871G4A b-ATGGCTTCAATCTCACCACTTG GGTGTCAAACAGCATCATGGAG CATGGAGACCCAAGTGG p.I883M rs4149313 c.2650A4G g.102966591A4G b-GAGGTCAACAGCACTTACTTTCT AGAAGAGCCACCCTTGTTCCAA AAGAGAATGTCAGAAAG p.R1587K rs2230808 c.4762G4A g.102942642G4A b-ATTTATGACAGGACTGGACACC AGCGGTTTACCTTGACATTATT CATTATTTCTGGTGTCC n Genotyping of SNPs was performed using dynamic allele speci'c hybridization (DASH) [Prince et al., 2001]. Login to comment 81 ABCA1 p.Arg219Lys Among these models, significant association for marker rs2230806 (c.658G4A, p.R219K) was observed (P=0.014 for genotypes, P=0.048 for alleles; Table 3). Login to comment 86 ABCA1 p.Val825Ile Marker rs4149312 (c.2476G4A, p.V825I) was found to be monomorphic in set B. Login to comment 88 ABCA1 p.Val771Met While no supporting evidence of association with marker rs2230806 was detected, significant associations were observed for markers rs2230808 (c.4762G4A, p.R1587K) (P=0.016 for genotypes, P=0.013 for alleles) and marker rs2066718 (c.2314G4A, p.V771M) (P=0.029 for genotypes, P=0.031 for alleles) (Table 3). Login to comment 93 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Val825Ile ABCA1 p.Val771Met Single MarkerAssociations forABCA1and Alzheimer Diseasew p.R219K (rs2230806) G/G G/A A/A P value Set A AD 238 (.62) 125 (.33) 21 (.05) 0.014n Controls 102 (.58) 51 (.29) 22 (.13) Set B AD 58 (.48) 53 (.44) 9 (.08) 0.76 Controls 76 (.53) 59 (.41) 9 (.06) Set C AD 82 (.57) 53 (.37) 8 (.06) 0.66 Controls 183 (.56) 117 (.36) 26 (.08) Set D AD 183 (.56) 122 (.37) 22 (.07) 0.93 Controls 60 (.57) 40 (.38) 6 (.06) p.I883M (rs4149313) C/C C/T T/T Set A AD 2 (.01) 81 (.21) 301 (.78) 0.39 Controls 0 (.00) 31 (.18) 145 (.82) Set B AD 0 (.00) 29 (.24) 91 (.76) 0.27 Controls 3 (.02) 32 (.21) 115 (.77) Set C AD 2 (.01) 27 (.19) 116 (.80) 0.84 Controls 3 (.01) 53 (.17) 256 (.82) Set D AD 3 (.01) 68 (.21) 253 (.78) 0.61 Controls 2 (.02) 19 (.19) 83 (.80) p.R1587K (rs2230808) G/G G/A A/A Set A AD 253 (.66) 114 (.30) 15 (.04) 0.13 Controls 101 (.57) 66 (.38) 9 (.05) Set B AD 56 (.46) 58 (.48) 7 (.06) 0.016n Controls 96 (.64) 48 (.32) 7 (.05) Set C AD 80 (.55) 56 (.39) 9 (.06) 0.70 Controls 189 (.58) 121 (.37) 15 (.05) Det D AD 185 (.57) 118 (.36) 24 (.07) 0.18 Controls 68 (.64) 28 (.26) 10 (.09) p.V771M (rs2066718) G/G G/A A/A Set A AD 365 (.95) 20 (.05) 0 (.00) 0.28 Controls 167 (.95) 7 (.04) 1 (.01) Set B AD 109 (.98) 2 (.02) 0 (.00) 0.029n Controls 126 (.92) 11 (.08) 0 (.00) p.V825I (rs4149312) G/G G/A A/A Set A AD 341 (.93) 20 (.05) 4 (.01) 0.17 Controls 164 (.92) 15 (.08) 0 (.00) w Genotype frequencies for all studied SNPs in ABCA1 are presented. Login to comment 99 ABCA1 p.Ile883Met We noted from this that typing markers rs2230806, rs4149313 (c.2650A4G, p.I883M), and rs2230808 would be sufficient to differentiate between the six most common haplotypes (all with frequencies above 3%), thereby provisionally acting as ''tag`` SNPs [Johnson et al., 2001]. Login to comment 144 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys Single Marker QuantitativeTrait Associationsn p.R219K (rs2230806) Trait G/G G/A A/A P-value Set A CSF Tau 6407280 (156) 6447280 (78) 7097240 (12) NS CSFAb42 4627167 (149) 4877176 (75) 5067230 (11) NS AAO 72.478.4 (205) 72.377.8 (99) 72.577.0 (18) NS SP-NFT 7.472.0 (43) 6.972.2 (25) 4.771.2 (3) 0.039 Set B AAO 52.077.6 (56) 52.276.2 (52) 55.474.9 (8) NS Set C AAO 76.777.1 (80) 77.276.4 (52) 74.478.1 (8) NS Set D Ab load 4.671.9 (35) 4.372.3 (26) 4.972.7 (7) NS AAO 71.9712.3 (81) 7378.9 (58) 70.176.2 (10) NS p.I883M (rs4149313) Trait C/C C/T T/T Set A CSF Tau 5747318 (2) 6907328 (52) 6337262 (192) NS CSFAb42 354754 (2) 4437137 (48) 4817181 (185) NS AAO 64.978.6 (2) 72.078.8 (68) 72.477.8 (253) NS SP-NFT N/A 6.372.4 (16) 7.371.9 (55) 0.078 Set B AAO N/A 52.075.7 (28) 52.477.2 (88) NS Set C AAO 73.5719. Login to comment 201 ABCA1 p.Arg219Lys The observation of an association with the common rs2230806 (R219K) variant was in indirect agreement with a smaller, recently published study, which suggested an effect upon AAO [Wollmer et al., 2003]. Login to comment