ABCMdb

PMID: 25279016

Marvaki A, Kolovou V, Katsiki N, Boutsikou M, Kotanidou A, Orfanos S, Filippatos G, Marvaki K, Koumoulidis A, Mavrogeni S, Kolovou G
Impact of 3 Common ABCA1 Gene Polymorphisms on Optimal vs Non-Optimal Lipid Profile in Greek Young Nurses.
Open Cardiovasc Med J. 2014 Sep 25;8:83-7. doi: 10.2174/1874192401408010083. eCollection 2014., [PubMed]

Sentences

No. Mutations Sentence Comment

1 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys They evaluated the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms [such as rs2230806 (R219K), rs2230808 (R1587K) and rs4149313 (I883M)] on the human lipid profile (defined as Optimal and Non-Optimal). Login to comment 3 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys All subjects were genotyped and the ABCA1 polymorphisms (R219K, R1587K and I883M) were recorded. Login to comment 5 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys Results: No statistical differences were observed in the distribution of R219K, R1587K and I883M polymorphisms according to the lipid profile (p>0.05 in all cases). Login to comment 6 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys No statistical differences were observed in the distribution of R219K, R1587K and I883M polymorphisms according to sex (p>0.05 in all cases). Login to comment 15 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys Several ABCA1 gene polymorphisms have been identified, such as rs2230806 (R219K) in the chromosomal position 107620867, rs2230808 (R1587K) in the chromosomal position 106602625 and rs4149313 (I883M) in the chromosomal position 106626574. Login to comment 17 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys The aim of the study, in line with our previous work [57], was to evaluate the R219K, R1587K and I883M of ABCA1 gene polymorphisms according to lipid profile. Login to comment 26 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys According to Genotypes We evaluated single nucleotide polymorphisms (SNPs) in chromosome 9 such as rs2230806 (R219K) in the position 107620867, rs2230808 (R1587K) in the position 106602625 and rs4149313 (I883M) in the position 106626574 according to lipid profile by using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP`s) (see below). Login to comment 29 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys DNA Analysis and Determination of Blood Lipids The ABCA1 gene polymorphisms (R219K, R1587K and I883M) were detected using PCR and RFLP`s. Login to comment 31 ABCA1 p.Arg219Lys For R219K polymorphism the oligonucleotide primers which were used were AAAGACTTCAAGGACCCAGCTT and CCTCACATTCCGAAAGCATTA [9]. Login to comment 35 ABCA1 p.Ile883Met The oligonucleotide primers used for I883M polymorphism were 5`-GAGAAGAGCCACCCTGGTTCCAACCA GAAGAGGAT-3` and 5`- AGAAAGGCAGGAGACAT CGCTT -3 as described by Clee SM et al [4]. Login to comment 45 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys There was no difference in R219K, R1587K and I883M polymorphisms frequency according to Optimal and Non-Optimal lipid profile (p = 0.49, 0.29 and 0.42, respectively). Login to comment 48 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys DISCUSSION We examined the impact of the R219K, R1587K and I883M of ABCA1 polymorphisms as a genetic influence on the lipid profile in Greek subjects. Login to comment 49 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys In this context, the possible effects of the ABCA1 polymorphisms on lipids or cardiovascular disease were recently evaluated in various populations such as Japanese [11] in which correlation with HDL-C concentrations was found, Saudi [12] in which the ABCA1 C69T gene frequency was higher in healthy subjects compared with diabetic patients, Chinese [13], in which ABCA1 gene R219K polymorphism was associated with ischemic stroke, Greek [5-7] in which a gender-specific effect of the R219K polymorphism on plasma lipids was demonstrated, Turkish [14] in which a gender-specific effect of the R219K polymorphism on plasma lipids and CHD was shown and Mexican [15] in which several European loci as well as a novel one for high TG and low HDL-C levels were identified. Login to comment 52 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys The relationship between ABCA1 R219K, R1587K and I883M and Alzheimer disease has been reported in various ethnic groups with contradictory results. Login to comment 54 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys With regard to subgroups with low HDL-C, Hodof;lugil et al. [17] reported that R219K and I883M polymorphisms were related to higher HDL-C levels, Slatter et al. [18] found that R1587K was overexpressed in low HDL-C individuals, whereas Frikke-Schmidt et al. [19] did not observe any association with R219K but reported that R1587K polymorphism was overexpressed in individuals with low HDL-C concentrations. Login to comment 55 ABCA1 p.Arg219Lys In subgroups with high HDL-C, Kakko et al. [20] found a minor association between ABCA1 polymorphisms and HDL-C levels in women, whereas Clee et al. [4] reported a non-significant trend towards higher HDL-C levels in carriers of R219K. Login to comment 58 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys R219K R1587K I883M n (%) n (%) n (%) RR 225 (50.2) RR 211 (47.1) II 309 (69.0) RK 191 (42.6) RK 193 (43.1) IM 131 (29.2) KK 32 (7.1) KK 44 (9.8) MM 8 (1.8) R 71.5 R 68.6 I 83.6 K 28.5 K 31.4 M 16.4 Table 1. Login to comment 63 ABCA1 p.Arg219Lys For example, Clee et al. [4] reported that carriers of K allele of R219K polymorphism had significantly lower TG levels in relation to carriers of the R allele, whereas others did not find any associations. Login to comment 65 ABCA1 p.Arg219Lys Delgado-Lista et al. [21] reported a trend for lower fasting TG and large TG-rich lipoproteins in minor allele carriers compared with major allele homozygotes of R219K polymorphism. Login to comment 66 ABCA1 p.Arg219Lys In our study with young Greek nurses (living and working in similar conditions) we did not observe any association of R219K polymorphism with HDL-C or other lipid levels, although we found that individuals with RK genotype of R1587K polymorphism had significantly higher TC, LDL-C and TG levels compared with the RR genotype [7]. Login to comment 68 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Sandhofer et al. [22] found that K allele of R219K gene displayed a lower intima media thickness and a reduced risk of advanced plaque extent compared with non-carriers only in non-smokers and concluded that smoking abrogates the protective effect of the R219K. Login to comment 69 ABCA1 p.Arg219Lys Cenarro et al. [23] reported that the K allele of the R219K gene was significantly more frequent in familial hypercholesterolemia subjects without premature CHD than in familial hypercholesterolemia subjects with premature CHD and it appears to be more protective for smokers than non-smokers. Login to comment