ABCMdb

PMID: 16806540

Saleheen D, Khanum S, Haider SR, Nazir A, Ahmad U, Khalid H, Hussain I, Shuja F, Shahid K, Habib A, Frossard PM
A novel haplotype in ABCA1 gene effects plasma HDL-C concentration.
Int J Cardiol. 2007 Jan 31;115(1):7-13. Epub 2006 Jun 23., [PubMed]

Sentences

No. Mutations Sentence Comment

6 ABCA1 p.Val825Leu Results: LL genotype of V825L polymorphism was associated with decreased levels of HDL-C [À0.17 (À0.32 to À0.19); P=0.02] and P774 allele showed a significant increase in HDL-C levels as compared to T774 allele [À0.15 (À0.18 to À0.02); P=0.01]. Login to comment 7 ABCA1 p.Arg219Lys ABCA1 p.Val771Met R219K, A399V and V771M polymorphisms did not show any association with levels of HDL-C, LDL-C, cholesterol and triglycerides. Login to comment 8 ABCA1 p.Arg219Lys ABCA1 p.Val825Leu Haplotype analysis between R219K and V825L polymorphisms showed a unique interaction between R219 allele and L825 allele. Login to comment 50 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Val771Met ABCA1 p.Val771Met ABCA1 p.Val399Ala ABCA1 p.Val399Ala ABCA1 p.Val825Leu ABCA1 p.Val825Leu Subjects were classified as having diabetes mellitus if he or she already Table 1 Methods for restriction fragment length polymorphism for screening of ABCA1 SNPs Variant Forward oligo (5VY3V), reverse oligo (5VY3V) Annealing temperature Enzyme Product (bp), wild-type allele, variant allele R219K (G1051A) ''aaagacttcaaggacccagctt``, ''cctcacattccgaaagcatta`` 62.5 -C EcoNI 309, 184, 125 V399A (T1591C) ''ctcattgtctgtgcttctcctc``, ''gtgaccagaaactcacctctcc`` 64.0 -C HphI 117, 71, 48, 188, 48 V771M (G2706A) ''tacaagtgagtgcttgggattg``, ''cccattggaaaagacaatcatc`` 60.0 -C BsaAI 254, 137, 391 V825L (G2868A) ''ttctgcaccttatgattgatcc``, ''agcacaaagaaaggacatcagc`` 62.5 -C BsaI 265, 127, 392 Polymerase chain reaction (PCR) was carried out using a Perkin Elmer GeneAmp PCR system 2400 (Perkin Elmer Corp., Applied Biosystems Division, USA). Login to comment 70 ABCA1 p.Val825Leu L825 allele is associated with decreased HDL-C levels LL genotype of V825L polymorphism was associated with decreased levels of HDL-C as compared to VV-the wild type genotype. This association remained significant when LL genotype was compared with LV+VV genotypes [À0.164 (À0.313 to À0.016); P-value<0.05, adjusted for age and gender. Login to comment 77 ABCA1 p.Arg219Lys ABCA1 p.Val771Met ABCA1 p.Val399Ala R219K, V399A and V771M polymorphisms did not show any association with levels of HDL-C, LDL-C, cholesterol and triglycerides. Login to comment 80 ABCA1 p.Arg219Lys ABCA1 p.Val771Met ABCA1 p.Val399Ala ABCA1 p.Thr774Pro ABCA1 p.Val825Leu R219K, V399A and T774P polymorphisms followed the HWE however V825L and V771M showed a departure from HWE. Login to comment 82 ABCA1 p.Arg219Lys ABCA1 p.Val771Met ABCA1 p.Val825Leu Linkage disequilibrium and haplotype analysis R219K polymorphism was in significant linkage disequilibrium (LD) with V825L and V771M (DV=0.50; P-value<10À3 ). Login to comment 83 ABCA1 p.Thr774Pro ABCA1 p.Val825Leu Similarly, T774P showed high LD with V825L (DV=0.70; P-value<10À3 ). Login to comment 84 ABCA1 p.Val399Ala Interestingly, V399A Table 2 Characteristics of the study population Total (200) Males (64%) Females (36%) P-value Age1 49.35 (5.0) 49.13 (5.30) 49.93 (4.47) 0.32 HDL-C1 (mmolÀ1 ) 1.05 (0.28) 1.02 (0.27) 1.15 (0.30) 10À2 Cholesterol1 (mmolÀ 1 ) 4.86 (1.16) 4.83 (1.17) 4.95 (1.13) 0.53 Triglycerides1 (mmolÀ1 ) 1.89 (1.17) 1.93 (1.24) 1.79 (0.94) 0.42 LDL-C1 (mmolÀ1 ) 3.09 (0.95) 3.08 (0.97) 3.14 (0.91) 0.67 Hypertension2 22.1% 20.1% 27.3% 0.27 Diabetes mellitus2 11.1% 12.5% 7.3% 0.29 Smoking status2 17.1% 22.9% 1.8% 10À4 Variables1 are expressed in mean (S.D.). Login to comment 87 ABCA1 p.Val771Met ABCA1 p.Val771Met ABCA1 p.Thr774Pro ABCA1 p.Thr774Pro ABCA1 p.Val825Leu ABCA1 p.Val825Leu D. Saleheen et al. / International Journal of Cardiology 115 (2007) 7-13 9 polymorphism was in complete linkage equilibrium with T774P, V825L and V771M polymorphisms. Login to comment 92 ABCA1 p.Arg219Lys ABCA1 p.Val825Leu On two-point haplotype analysis, the haplotype model between R219K and V825L polymorphisms showed RL haplotype to be associated with decreased levels of HDL-C. Importantly, this association remained significant when age, gender, hypertension and diabetes mellitus were introduced in to the haplotype model. Login to comment 97 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Val771Met ABCA1 p.Val771Met ABCA1 p.Val771Met ABCA1 p.Val771Met ABCA1 p.Val399Ala ABCA1 p.Val399Ala ABCA1 p.Thr774Pro ABCA1 p.Thr774Pro ABCA1 p.Thr774Pro ABCA1 p.Thr774Pro ABCA1 p.Val825Leu ABCA1 p.Val825Leu ABCA1 p.Val825Leu ABCA1 p.Val825Leu ABCA1 p.Val825Leu South Asian populations (from Pakistan, India, Bangladesh and Sri Lanka) represent a quarter of the developing world and harbor thirty percent of the global Table 4 Haplotype association analysis of the ABCA1 gene polymorphisms in relation with the HDL-C levels Haplotype Haplotype frequencies Haplotypic additive effects [95% CI] P-value R219K RV 0.47 + V825L RL 0.18 À0.12 [À0.22 to À0.03] 0.001 KV 0.28 À0.04 [À0.10 to 0.01] 0.15 KL 0.06 0.08 [À0.06 to 0.22] 0.25 T774P TV 0.21 0.03 [À0.05 to 0.12] 0.41 V825L TL 0.09 0.10 [À0.06 to 0.27] 0.22 PV 0.47 + PL 0.21 0;0.06 [À0.14 to 0.02] 0.15 R219K RM 0.55 + V771M RV 0.07 À0.13 [À0.45 to 0.19] 0.41 KM 0.34 À0.02 [À0.09 to 0.05] 0.54 KV 0.04 0.07 [À0.12 to 0.27] 0.46 Table 3 Mean HDL-C levels (S.D.) for the genotypes and alleles of the studied polymorphisms Frequencies HDL-C (S.D.) b (95% CI) P-value R219K RR 39.8 1.06 (0.30) À0.02 (À0.16 to 0.13) 0.85 RK 46.0 1.10 (0.28) 0.00 (À0.14 to 0.14) 0.99 KK 14.3 1.10 (0.31) + R 62.7 1.08 (0.26) 0.01 (À0.05 to 0.07) 0.79 K 37.3 1.09 (0.31) V399A AA 6.0 1.01 (0.23) À0.03 (À0.24 to 0.16) 0.70 AV 34.7 1.11 (0.28) 0.10 (À0.04 to 0.16) 0.22 VV 59.3 1.04 (0.31) + A 23.3 1.09 (0.28) À0.03 (À0.10 to 0.05) 0.58 V 76.7 1.04 (0.31) T774P PP 9.6 1.10 (0.31) 0.20 (0.01 to 0.40) 0.03 PT 37.5 1.03 (0.32) 0.13 (À0.03 to 0.20) 0.14 TT 52.9 0.97 (0.28) + P 28.4 1.05 (0.32) À0.15 (À0.18 to À0.02) 0.01 T 71.6 0.99 (0.29) V771M MM 6.1 1.09 (0.30) 0.01 (À0.24 to 0.25) VM 10.1 0.98 (0.24) À0.07 (À0.27 to 0.12) 0.46 VV 83.8 1.07 (0.29) + 0.94 M 11.1 1.04 (0.27) 0.03 (À0.10 to 0.15) 0.71 V 88.9 1.07 (0.29) V825L LL 9.8 0.89 (0.299) À0.17 (À0.32 to À0.19) 0.02 LV 32.8 1.06 (0.265) À0.03 (À0.11 to 0.076) 0.70 VV 57.5 1.07 (0.30) + L 26.1 1.07 (0.29) 0.10 (À0.00 to .13) 0.05 V 73.9 1.00 (0.28) P-values are adjusted for age and gender. Login to comment 105 ABCA1 p.Val825Leu We found LL genotype of V825L polymorphism to be associated with decreased levels of HDL-C on both univariate and multivariate analyses. Login to comment 107 ABCA1 p.Arg219Lys ABCA1 p.Val825Leu ABCA1 p.Val825Leu On haplotype analysis, the RL haplotype generated from the R219K and V825L polymorphisms was strongly associated with decreased levels of HDL-C. Importantly, association of this haplotype was stronger than the association observed for V825L polymorphism. Login to comment 113 ABCA1 p.Arg219Lys R219K is the most widely studied polymorphism in association with coronary artery disease, atherosclerosis and HDL-C levels [21,23,24,28]. Login to comment 115 ABCA1 p.Val771Met ABCA1 p.Val399Ala Similarly, a lack of association of V399A and V771M polymorphisms is consistent with the published literature [28]. Login to comment 116 ABCA1 p.Val825Leu Importantly, we have shown that carriers of LL genotype of V825L polymorphism are associated with decreased levels of HDL-C. Login to comment