ABCMdb

ABCC2 p.Val417Ile

None has been submitted yet.

Publications

PMID: 15229462 [PubMed] Sparreboom A et al: "Diflomotecan pharmacokinetics in relation to ABCG2 421C>A genotype."

No. Sentence Comment

56 Frequencies for studied variant genes and genotype-phenotype relationships Polymorphism and nomenclature Effect Allele frequencies Ratio (q/p) for intravenous AUC Ratio (q/p) for oral AUC p q Value† P value Value† P value ABCG2 421CϾA Q141K 0.88 0.12 2.98 .015 1.15 .74 ABCC2-24CϾT 5'-UTR 0.89 0.11 0.868 .82 0.890 .78 ABCC2 1249GϾA V417I 0.86 0.14 1.06 .92 2.10 .063 ABCC2 156231AϾG Intron 3 1.00 0.00 NA NA NA NA ABCB1 1236CϾT‡ (ABCB1*8§) G411G 0.40 0.60 0.877 .82 0.585 .31 ABCB1 2677GϾA/T࿣ (ABCB1*7§) A893S/T 0.63 0.34/0.03 0.784 .61 1.27 .55 ABCB1 3435CϾT‡ (ABCB1*6§) I1145I 0.45 0.55 0.978 .97 0.955 .93 CYP3A4 -392AϾG (CYP3A4*1B) Promotor 0.91 0.09 0.731 .63 0.834 .75 CYP3A4 15713TϾC‡ (CYP3A4*2) S222P 1.00 0.00 NA NA NA NA CYP3A4 23172TϾC (CYP3A4*3) M445T 1.00 0.00 NA NA NA NA CYP3A5 22893GϾA‡ (CYP3A5*3) Splice Variant 0.86 0.14 0.808 .77 0.813 .76 CYP3A5 30597GϾA (CYP3A5*6) Splice Variant 1.00 0.00 NA NA NA NA AUC, Area under plasma concentration-time curve normalized to dose (ie, observed AUC/dose in milligrams); NA, not available. Login to comment

PMID: 16766035 [PubMed] Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."

No. Sentence Comment

858 The most frequent were -24C>T in the 5'-UTR (allele frequency 0.19), 1249G>A (V417I) in exon 10 (frequency 0.12), and a silent 3972C>T SNP in exon 28. Login to comment
867 Whereas the transport activity of the wild-type, V417I, and A1450T were similar towards the substrates LTC4, 17β estradiol-D-17β-glucuronide (E217βG), and dinitrophenyl-labeled surfactant protein C (DNP-SP), the transport activity of S789F was slightly higher. Login to comment
882 0.01 Exon 2 56 C>T P19L 0.01 Exon 3 234 A>G synonymous 0.01 Exon 3 299 G>A R100Q 0.01 Exon 7 842 G>A S281N 0.01 Exon 10 1249 G>A V417I 0.12 (0.21) Exon 10 1457 C>T T486I 0.03 Exon 18 2302 C>T R768W 0.01 (0.00) Exon 18 2366 C>T S789F 0.01 (0.00) slightly elevated activity, lower expressionb Exon 20 2647 G>A D883N 0.01 Exon 21 2882 A>G K961R 0.01 Exon 22 2934 G>A synonymous 0.05 Exon 22 3039 C>T synonymous 0.01 Exon 22 3057 G>T Q1019H 0.01 Exon 24 3321 G>T synonymous 0.01 Exon 25 3521 G>A R1174H 0.01 Exon 25 3563 T>A V1188E 0.01 Exon 26 3732 C>T N1244K 0.01 Exon 28 3972 C>T synonymous 0.21 (0.34) Exon 29 4100 C>G S1367C 0.01 Exon 30 4290 G>T synonymous 0.01 Exon 31 4348 G>A A1450T 0.01 (0.00) decreased activity, lower expressionb Exon 31 4488 C>T synonymous 0.01 Exon 32 4544 G>A C1515Y 0.01 a Haenisch et al. (in press). Login to comment

PMID: 17323126 [PubMed] Huang Y et al: "Pharmacogenetics/genomics of membrane transporters in cancer chemotherapy."

No. Sentence Comment

149 Among them, the 24C>T (promoter), 1249G>A (exon10) and 3972C>T (exon28) are frequently observed: 1249G>A is associated with amino acid alteration from Val to Ile at 417, whereas 3972C>T is a silent SNP at 1324. Login to comment

PMID: 17534875 [PubMed] Han JY et al: "Associations of ABCB1, ABCC2, and ABCG2 polymorphisms with irinotecan-pharmacokinetics and clinical outcome in patients with advanced non-small cell lung cancer."

No. Sentence Comment

81 of patients Genotype frequencies{ Allele frequencies§ w/w w/m m/m w m ABCB1 1236C > T Synonymous 105 14 57 34 0.405 0.595 2677G > T Ala893Ser 105 22 37 (GT) 10 (TT) 0.457 0.338 (T) 2677G > A Ala893Thr 15 (GA) 14 (TA) 0.205 (A) 7 (AA) 3435C > T Synonymous 105 43 51 11 0.652 0.348 ABCC2 À24C > T - 107 57 47 3 0.752 0.248 1249G > A Val417Ile 107 86 19 2 0.893 0.107 3972C > T Synonymous 107 51 48 8 0.701 0.299 ABCG2 34G > A Val12Met 106 60 41 5 0.759 0.241 421C > A Gln141Lys 105 59 42 4 0.762 0.238 w indicates wild type allele; m, mutant type allele. Login to comment

PMID: 17925548 [PubMed] Marsh S et al: "Pharmacogenetic assessment of toxicity and outcome after platinum plus taxane chemotherapy in ovarian cancer: the Scottish Randomised Trial in Ovarian Cancer."

No. Sentence Comment

55 Homozygous Wild-Type Heterozygous Homozygous Variant p‫ء‬ q† ABCB1 1236CϾT Pac, Doc 896 287 448 161 0.57 0.43 ABCB1 2677GϾT‡§ Pac, Doc 900 269 416 162 0.55 0.42 ABCB1 3435CϾT Pac, Doc 898 207 445 246 0.48 0.52 ABCC1 S1334S Pac, Doc 890 469 360 61 0.73 0.27 ABCC1 IVS18-30CϾG Pac, Doc 886 649 215 22 0.85 0.15 ABCC2 24CϾT Pac, Doc, Carb 899 593 277 29 0.81 0.19 ABCC2 IVS12ϩ148AϾG Pac, Doc, Carb 892 338 422 132 0.62 0.38 ABCC2 V417I Pac, Doc, Carb 867 575 264 28 0.82 0.18 ABCG2 Q141K Pac, Doc, Carb 904 726 168 10 0.90 0.10 CDKN1A 10971CϾT Pac, Doc 873 749 124 0 0.93 0.07 CYP1B1‫ء‬ 3 Pac, Doc 823 228 421 174 0.53 0.47 CYP2C8 M264I Pac 892 683 191 18 0.94 0.06 CYP2C8 R139K Pac 905 799 104 2 0.87 0.13 CYP2C8 K399R Pac 841 650 174 17 0.88 0.12 CYP3A4‫ء‬ 1B Pac, Doc 875 838 37 0 0.98 0.02 CYP3A4‫ء‬ 3ʈ Pac, Doc 900 893 7 0 0.996 0.004 CYP3A5‫ء‬ 3C Pac, Doc 883 6 95 782 0.06 0.94 ERCC1 17677GϾT Carb 889 742 136 11 0.91 0.09 ERCC1 8092CϾA Carb 854 477 317 60 0.74 0.26 ERCC1 N118N Carb 869 347 396 126 0.63 0.37 ERCC2 K751Q Carb 901 367 398 136 0.63 0.37 GSTP1 A114V Carb 867 748 114 5 0.93 0.07 GSTP1 I105V Carb 881 394 367 120 0.66 0.34 MAPT P587P Pac, Doc 853 791 59 3 0.96 0.04 MPO -463GϾA Carb 888 565 277 46 0.79 0.21 TP53 R72P Pac, Doc 877 495 323 59 0.75 0.25 XRCC1 R399Q Carb 869 390 395 84 0.68 0.32 Abbreviations: SCOTROC1, Scottish Randomised Trial in Ovarian Cancer; Pac, paclitaxel; Doc, docetaxel; Carb, carboplatin. Login to comment
72 However, in a study Table 3. Uncorrected P Values From ␹2 Analysis of Development Set From SCOTROC1 Data Gene and Variant Neurotoxicity (paclitaxel) Neurotoxicity (docetaxel) Hematologic (docetaxel) Grade 3/4 GI (paclitaxel) Grade 3/4 GI (docetaxel) ABCB1 1236CϾT .790 .179 .864 .649 .559 ABCB1 2677GϾT/A .816 .783 .740 .382 .472 ABCB1 3435CϾT .362 .771 .345 .507 .919 ABCC1 S1334S .981 .745 .327 .880 .125 ABCC1 IVS18-30CϾG .943 1.000 .623 .053 .354 ABCC2 -24CϾT .975 .567 .348 .961 .537 ABCC2 IVS12ϩ148AϾG .655 .935 .227 .570 .017 ABCC2 V417I .059 .738 .351 .838 .182 ABCG2 Q141K .711 .318 .838 .086 .205 CDKN1A 10971CϾT .359 1.000 .094 .483 .002‫ء‬ CYP1B1‫ء‬ 3 .709 .587 .764 .175 .006‫ء‬ CYP2C8 M264I .601 .069 1.000 1.000 .148 CYP2C8 R139K .421 .315 .314 .020 .157 CYP2C8 K399R .232 .353 .285 .007 .147 CYP3A4‫ء‬ 1B .590 1.000 .714 .750 .743 CYP3A5‫ء‬ 3C .121 .243 1.000 .730 .272 ERCC1 17677GϾT .171 .079 .705 .159 .638 ERCC1 8092CϾA .010 .662 .069 .683 .975 ERCC1 N118N .261 .427 .171 .655 .981 ERCC2 K751Q .206 .209 .501 .062 .108 GSTP1 A114V .231 .400 .812 1.000 .072 GSTP1 I105V .205 .018 .467 .566 .277 MAPT P587P .797 .308 .590 .329 .361 MPO -463GϾA .236 .724 .829 .496 .138 TP53 R72P .298 .954 .945 .490 .157 XRCC1 R399Q .917 .467 .068 .793 .977 NOTE. Login to comment
94 For example, polymorphisms in SLCO1B3 were not associated with taxanepharmacokinetics.42 Inadditiontoidentifyingfunctionalpoly- morphisms in known candidate genes, ongoing genome-wide strategies may provide novel candidate genes/chromosome regions for future pharmacogenetics studies.43 Recent studies also suggest that Table 4. Uncorrected P Values From ␹2 (response) and Log-Rank (progression-free survival) Analysis for Genotype-Outcome Associations in the Development Set Gene and Variant Progression-Free Survival (567-594 patients) CA-125 Response (260-287 patients) Clinical/Radiologic Response (295- 341 patients) ABCB1 1236CϾT .719 .897 .541 ABCB1 2677GϾT/A‫ء‬ .023 .308 .138 ABCB1 3435CϾT .614 .500 .740 ABCC1 S1334S .671 1.000 .903 ABCC1 IVS18-30CϾG .335 .226 .305 ABCC2 -24CϾT .619 .616 .693 ABCC2 IVS12ϩ148AϾG .712 .689 .848 ABCC2 V417I .278 .582 .503 ABCG2 Q141K .427 1.000 .344 CDKN1A 10971CϾT .305 .014 1.000 CYP1B1‫ء‬ 3 .120 .865 .291 CYP2C8 M264I .481 .762 .295 CYP2C8 R139K .572 .080 .154 CYP2C8 K399R .617 .004 .319 CYP3A4‫ء‬ 1B .687 1.000 .780 CYP3A5‫ء‬ 3C .499 .570 .909 ERCC1 17677GϾT .517 .292 .635 ERCC1 8092CϾA .677 .029 .593 ERCC1 N118N .851 .214 .204 ERCC2 K751Q .562 .613 .198 GSTP1 A114V .178 .512 .243 GSTP1 I105V .693 .187 .939 MAPT P587P .253 1.000 .827 MPO -463GϾA .537 .349 .088 TP53 R72P .212 .878 .309 XRCC1 R399Q .254 .422 .256 NOTE. Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."

No. Sentence Comment

101 Several molecular defects in MRP2 have been suggested to result in DJS including those which produce deficient protein maturation (Hashimoto et al., 2002; Keitel et al., 2003), proteasomal degradation (Keitel, 2003), impaired membrane sorting (Hashimoto et al., 2002; Mor-Cohen et al., 2001), loss in transport activity (Mor-Cohen et al., 2001), Figure 2 Predicted membrance topology of MRP2 (ABCC2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 2 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD in out Membrane Pro19Leu Phe39Tyr Arg100* Arg100Gln Ser281Asn Ser325* Asp333Gly Arg353His Arg412Gly Val417Ile Lys430Arg Thr486Ile Gly676Arg Trp709Arg Asn718Ser Ser789Phe Arg768Trp Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* Phe981Leu Gln1019His Arg1066* Arg1150His Arg1100Cys Arg1100His Ile1137Phe Ile1173Phe Val1188Glu Arg1174His Arg1181Leu Asn1244Lys Thr1273Ala Pro1291Leu Lys1299Gln Arg1310* Ser1367Cys Gln1382Arg Arg1392del Met1393del Ala1450Thr Thr1476Met Cys1515Tyr MRP2 (ABCC2) NBD NBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* NBD NBDNBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* 325 Table2MRP2(ABCC2)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Amino acidexchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 56C>TPro19LeuExon2--1[1]b -- 116T>APhe39TyrExon2--0[2]--rs927344 298C>TArg100*Exon3--[3]-DJS[3] 299G>AArg100GlnExon3--1[1]b -- 842G>ASer281AsnExon7-0[4]1[1]b -- 974C>GSer325*Exon8---Malayan[5]DJS[5] 998A>GAsp333GlyExon8--0[2]--rs17222674 1058G>AArg353HisExon9--0[2]--rs7080681 1271A>GArg412GlyExon10-[6]0[2]-DJS;Decreaseinmethotrexateelimination[6] 1249G>AVal417IleExon10-22[7]13[9]-lowermRNAand(protein)expressioninpreterm placenta[11] rs2273697 26[8]16[4]noeffectonRNAandproteinininduodenum[12] 19[10]noeffectonproteininliver[8] noeffectonconjugatedbilirubinlevelinserum[13] changesinlocalizationinneuroepithelialtumors[14] possibleassociationwithtenofovir-inducedrenal proximaltubulopathy[15] 1289A>GLys430ArgExon10-4[16]0[2]-- 1457C>TThr486IleExon10-0[4]3[1]b -- 2026G>CGly676Arg--0[2]-DJS[17] 2125T>CTrp709Arg--0[2]-DJS[17] 2153A>GAsn718SerExon17-0[4]0[2]--rs3740072 2302C>TArg768TrpExon18-0[18]1[9]-DJS;deficientmaturationandimpairedsorting[19] 2366C>TSer789PheExon18-0[18]1[9]-lowerexpressionandmembranelocalization[20] noeffectonconjugatedbilirubinlevelinserum[13]/ heterozygous 2647G>AAsp883AsnExon20--1[1]b -- 2677G>CGlu893GlnExon20--0[2]--rs3740071 2780T>GLeu927ArgExon21-1[10]0[2]-- (Continued) Table2(Continued) Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 2882A>GLys961ArgExon21--1[1]b --- 2901C>ATyr967*Exon22--0[2]--rs17222547 2943C>GPhe981LeuExon22-2[21]0[2]-Noinfluenceonpravastatinkinetics[21] 3057G>TGln1019HisExon22--1[1]b -- 3196C>TArg1066*Exon23-[22]0[2]-DJS;truncatedprotein[22][23] 3298C>TArg1100CysExon24-1[10]0[2]-- 3299G>AArg1100HisExon24-1[10]0[2]-- 3449G>AArg1150HisExon25--0[2]Israeli[24]DJS;impairedtransportactivityintransfectedcells althoughnormalexpressionandlocalization[24] 3517A>TIle1173PheExon25--0[2]Israeli[24]DJS;impairedproteinmaturationandproteasomal degradation[25] lowexpression,mislocation,andimpairedtransport activityintransfectedcells[24] 3521G>AArg1174HisExon25-0[4]1[1]b -- 3542G>TArg1181LeuExon25-0[4]0[2]--rs8187692 3563T>AVal1188GluExon25-7[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4],rs17222723 4[16]associatedwithanthracycline-induced cardiotoxicity[26] 6[8] 3732C>TAsn1244LysExon26--0[1]b -- 0[2] 3817A>GThr1273AlaExon27--0[2]--rs8187699 3872C>TPro1291LeuExon28--0[2]--rs17216317 3897A>CLys1299GlnExon28--0[2]--rs4148400 3928C>TArg1310*Exon28--0[2]-DJS[17,27] 4100C>GSer1367CysExon29--1[1]b -- 4145A>GGln1382ArgExon29--[28]-DJS;noeffectonmaturationorsorting,impaired substrate-inducedATPhydrolysis[19] 4175-80delArg1392delExon30--0[2]-DJS;deficientMRP2maturationandimpaired sortingtoapicalmembraneintransfectedcells[29] 327 4348G>AAla11450ThrExon31-0[18]1[9]-lowerexperssionandmembracelocalizationin transfectedcells[20] 4461C>TThr1476MetExon31-[30]1[2]-- 4544G>ACys1515TyrExon32-9[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4]rs8187710 5[10]associatedwithanthracycline-induced cardiotoxicity[26] 4[16] 6[8] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment
139 In terms of more commonly occurring SNPs, the most widely studied amino acid change in MRP2 is Val417Ile. Login to comment

PMID: 18673259 [PubMed] Nakamura T et al: "Pharmacogenetics of intestinal absorption."

No. Sentence Comment

83 In Vitro Studies Associated with Common SNPs of Drug Transporter Genes Exon Polymorphism Effect dbSNP Cell Expression Function Reference ABCC2 Exon 1 -24C>T 5`-UTR rs717620 116A>T Tyr2Phe rs927344Exon 2 159A>G synonymous rs17222596 Exon 7 736A>C Met246Leu rs17222744 Exon 8 998A>G Asp333Gly rs17222674 Exon 9 1058G>A Arg353His rs7080681 1219C>T synonymous rs17216198 1249G>A Val417Ile rs2273697 LLC-PK1 Protein (n.s.) Membrane localization (n.s.) Transport activity (n.s.) Hirouchi et al. [51] 1434G>T synonymous 1434G>A synonymous rs4267009 Exon 10 1457C>T Thr486Ile rs17222589 Exon 11 1483A>G Lys495Glu rs17222561 Exon 13 1686T>G Phe562Leu rs17216233 2009T>C Ile670Thr rs17222632Exon 16 2073C>A synonymous rs17222624 Exon 17 2153A>G Asn718Ser rs3740072 Exon 19 2546T>G Leu849Arg rs17222617 Exon 20 2677G>C Glu893Gln rs3740071 2901C>A Tyr967stop rs17222547 2934G>A synonymous rs3740070 Exon 22 2944A>G Ile982Val rs17222554 3107T>C Ile1036Thr rs17216149Exon 23 3188A>G Asn1063Ser rs17222540 Exon 24 3396T>C synonymous rs17216345 3542G>T Arg1181Leu rs8187692 3561G>A synonymous rs17216324 Exon 25 3563T>A Val1188Glu rs17222723 Exon 27 3817A>G Thr1273Ara rs8187699 3872C>T Pro1291Leu rs17216317 3895A>C Lys1299Gln rs4148400 3927C>T synonymous rs4148401 Exon 28 3972C>T synonymous rs3740066 4062C>T synonymous rs17216275Exon 29 4110C>T synonymous rs7899457 4242C>T synonymous rs17216296Exon 30 4290G>T synonymous rs1137968 4410G>A synonymous rs8187706Exon 31 4488C>T synonymous rs8187707 4527C>T synonymous rs8187709Exon 32 4544G>A Cys1515Tyr rs8187710 ABCG2 PA317 mRNA (n.s.) Protein (n.s.) Drug sensitivity (n.s.) Topotecan uptake (n.s.) Imai et al. [85] mRNA (n.s.) Protein (n.s.) Apical localization (impaired) Drug sensitivity ( ) Indolocarbazole uptake ( ) Indolocarbazole efflux ( ) Mizuarai et al. [88] Exon 2 34G>A Val12Met rs2231137 LLC-PK1 Apical localization (n.s.) . Login to comment
36 Hirouchi and colleagues evaluated the cellular location and function of ABCC2 Val417Ile (1249G>A), Arg768Trp (2302C>T), Ser789Phe (2366C>T), and Ala1450Thr (4348G>A) variants in LLC-PK1 cells, finding that Ser789Phe and Ala1450Thr mutations caused less expression and mislocation [51]. Login to comment
92 Exon Polymorphism Effect dbSNP Subject Expression Function Reference DNT patient Tumoral protein (GG GA) Peritumoral protein (GG GA) Vogelgesang et al. [54] Nasopharyngeal cancer patient Irinotecan PK (CC CT TT) SN-38 PK (CC CT TT) SN-38G PK (CC CT TT) Zhou et al. [56] Colorectal cancer patient (Japanese) Tumoral mRNA (CC CT TT) Drug sensitivity (CC CT TT) Tumor growth rate (CC CT TT) Nishioka et al. [57] HIV patient (Caucasian) Nelfinavir intracellular AUC (CC CT TT) Colombo et al. [58] Spina Bifida patient Disease-susceptibility (CC CT TT) Jensen et al. [60] Cancer patient (Caucasian) Diflomotecan PK (CC CA) Sparreboom et al. [96] 116A>T Tyr2Phe rs927344Exon 2 159A>G synonymous rs17222596 Exon 7 736A>C Met246Leu rs17222744 Exon 8 998A>G Asp333Gly rs17222674 Exon 9 1058G>A Arg353His rs7080681 1219C>T synonymous rs17216198 1249G>A Val417Ile rs2273697 Healthy (Finnish) Pravastatin PK (GG GA AA) Niemi et al. [48] Women undergoing cesarean section Placental mRNA [preterms] (GG>GA>AA), [term] (GG GA AA) Placental protein (GG GA AA) Meyer zu Schwabedissen et al. [52] DNT patient Tumoral protein (GG<GA) Peritumoral protein (GG GA) Vogelgesang et al. [54] HIV patient (Caucasian) Nelfinavir intracellular AUC (GG GA AA) Colombo et al. [58] Cancer patient (Caucasian) Diflomotecan PK (CC CA) Sparreboom et al. [96] 1434G>T synonymous 1434G>A synonymous rs4267009 Exon 10 1457C>T Thr486Ile rs17222589 Exon 11 1483A>G Lys495Glu rs17222561 Exon 13 1686T>G Phe562Leu rs17216233 2009T>C Ile670Thr rs17222632Exon 16 2073C>A synonymous rs17222624 Exon 17 2153A>G Asn718Ser rs3740072 Exon 19 2546T>G Leu849Arg rs17222617 Exon 20 2677G>C Glu893Gln rs3740071 2901C>A Tyr967stop rs17222547 2934G>A synonymous rs3740070 Exon 22 2944A>G Ile982Val rs17222554 3107T>C Ile1036Thr rs17216149Exon 23 3188A>G Asn1063Ser rs17222540 (Table 3) contd…. Login to comment

PMID: 19771428 [PubMed] Sai K et al: "Additive effects of drug transporter genetic polymorphisms on irinotecan pharmacokinetics/pharmacodynamics in Japanese cancer patients."

No. Sentence Comment

46 ABCC2*2 [1246G[A (V417I)] and *1H [2934G[A (S978S)] [27] showed no statistically significant effects (data not shown). Login to comment

PMID: 19949922 [PubMed] Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."

No. Sentence Comment

190 0.01* (0.00) c. 56 C>T P19L 0.01* c. 234 A>G Synonymous 0.01* c. 299 G>A R100Q 0.01* c. 842 G>A S281N 0.01* c. 1249 G>A V417I 0.13 (0.21) c. 1446 C>G (0.01) c. 1457 C>T T486I 0.03* (0.00) c. 2302 C>T R768W 0.01 (0.00) c. 2366 C>T S789F 0.01 (0.00) c. 2647 G>A D883N 0.01* c. 2882 A>G K961R 0.01* c. 2934 G>A Synonymous 0.05* c. 3039 C>T Synonymous 0.01* c. 3057 G>T Q1019H 0.01* c. 3321 G>T Synonymous 0.01* c. 3521 G>A R1174H 0.01* c. 3542 G>T (0.001) c. 3561 G>A (0.00) c. 3563 T>A V1188E 0.01* (0.05) c. 3732 C>T N1244K 0.01* c. 3972 C>T Synonymous 0.22* (0.34) c. 4100 C>G S1367C 0.01* c. 4290 G>T Synonymous 0.01* c. 4348 G>A A1450T 0.01 (0.00) c. 4488 C>T Synonymous 0.01* c. 4544 G>A C1515Y 0.01* (0.04) association to cholestatic or mixed type hepatitis whereas -24T carriers exhibited more often hepatocellular-type hepatitis after intake of drugs or herbal remedies (96). Login to comment
192 A missense SNP 1249G>A (Val417Ile) is located in substrate-binding region of the first transmembrane domain and is associated with lower oral bioavailability and increased residual clearance after intravenous administration of the beta-blocker talinolol, indicating a higher activity of the intestinal transporter (92). Login to comment
210 Function and Substrate Specificity Table 6.7 ABCC2 polymorphisms currently described to exhibit a clinical influence ABCC2 polymorphism Effect Clinical impact on Function Reference -1774 G /del 5'-flanking Hepatotoxicity of herbal and conventional drugs Decreased [96] -24C>T 5'-UTR Hepatotoxicity of drugs e.g. diclofenac and herbal remedies Decreased [96, 97] Oral clearance of Mycophenolic acid Decreased [93, 94] Risk of renal failure, renal expression Decreased [90, 95] Bioavailability and side effects of methotrexate Decreased [104] Tumor response and side effects of irinotecan Decreased [105, 106] c.1249G>A V417I Intestinal activity, bioavailability of talinolol Increased [92] Gastrointestinal toxicity of methotrexate Increased? Login to comment

PMID: 20922799 [PubMed] Tanaka M et al: "Association of multi-drug resistance gene polymorphisms with pancreatic cancer outcome."

No. Sentence Comment

75 Minor Allele Frequency Observeda /Reportedb MDR1 7q21.12a Ex27 -55T>C I1145I 1045642 0.49/0.47 MRP1 16p13.11a Ex28 36G>A S1219S 2239330 0.28/0.24 MRP2 10q24.2c Ex10 40G>A V417I 2273697 0.25/0.23 Ex28 -16C>T I1324I 3740066 0.35/0.35 MRP3 17q21.33b Ex26 -13C>T H1314H 2277624 0.24/0.17 MRP4 13q32.1a Ex8 40A>G R317R 2274406 0.39/0.37 MRP5 3q27.1b Ex10 -2A>G Q382Q 7636910 0.35/0.39 BCRP 4q22.1b Ex5 43C>A Q141K 2231142 0.12/0.10 SNP indicates single-nucleotide polymorphism; RS No., reference SNP identification number. Login to comment

PMID: 11266082 [PubMed] Ito S et al: "Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects."

No. Sentence Comment

37 Four were associated with an amino acid substitution; G to A transversion at position 1249 (G1249A, Val to Ile at codon 417) in exon 10, C to T at 2302 (C2302T, Arg to Trp at 768) and C to T at 2366 (C2366T, Ser to Phe at 789) in exon 18, and G to A at 4348 (G4348A, Ala to Thr at 1450) in exon 31 (position numbering: Taniguchi et al., 1996; Toh et al., 1999) (Fig. 3). Login to comment

PMID: 12166651 [PubMed] Saito S et al: "Identification of 779 genetic variations in eight genes encoding members of the ATP-binding cassette, subfamily C (ABCC/MRP/CFTR."

No. Sentence Comment

72 A longer Fig. 1a-h. Continued Fig. 1a-h. Continued Fig. 1a-h. Continued Table 2a. Summary of genetic variations detected in the ABCC1 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -1661 A/G 2 Intron 2 601 G/A rs215109 3 Intron 2 635 T/C 4 Intron 2 4769 G/del 5 Intron 2 4834 G/A rs1472532 6 Intron 2 10069 T/C 7 Intron 2 11782 A/G rs215096 8 Intron 2 (11965-11984) (T)18-20 9 Intron 4 4302 T/G 10 Intron 4 4394 A/C 11 Intron 4 4524 T/C 12 Intron 5 409 G/A rs1967120 13 Intron 5 1759 C/G rs185005 14 Intron 5 1768 T/C rs246215 15 Intron 6 9045 G/A 16 Intron 7 208 G/A rs2062541 17 Intron 7 (3059-3071) (A)11-13 18 Intron 8 54 C/Ab rs903880 19 Intron 8 (886-889) GAAA/del 20 Intron 8 2420 C/T rs246230 21 Exon 9 16 T/C(Val275Val)c rs246221 22 Exon 10 22 T/C(Asn354Asn) rs35587 23 Intron 10 8 A/G rs35588 2a. Continued No. Location Positiona Genetic variation NCBI SNP ID 24 Intron 10 1940 C/G rs35591 25 Intron 10 1953 T/C rs35592 26 Intron 11 198 C/A 27 Intron 11 784 C/G 28 Intron 12 122 C/G 29 Intron 12 (3138-3148) (A)10-12 30 Intron 12 3197 G/A rs35595 31 Intron 12 3227 C/Tc 32 Intron 13 2060 T/C 33 Intron 13 (2061-2062) C/ins 34 Intron 13 7882 G/A rs35597 35 Intron 13 11776 G/A 36 Intron 13 11824 A/G rs35604 37 Exon 14 7 T/C(Leu562Leu)c rs35605 38 Intron 14 105 C/T rs35606 39 Intron 14 179 A/T 40 Intron 14 321 T/C rs35607 41 Intron 15 2754 G/C rs35620 42 Intron 15 3022 C/T rs35621 43 Intron 15 3980 C/T rs35625 44 Intron 16 219 G/T 45 Intron 16 310 C/T 46 Intron 16 357 G/T rs35626 47 Intron 16 513 G/A rs35627 48 Intron 16 848 A/G rs35628 49 Intron 16 890 G/T 50 Intron 16 1184 C/T rs35629 51 Exon 17 19 C/T(Pro669Pro) rs2301666 52 Intron 17 1171 G/A 53 Intron 17 1332 A/G 54 Exon 18 53 G/A(Arg723Gln) 55 Intron 19 293 T/C rs2074086 56 Intron 19 (3369-3374) (CA)2-3 57 Intron 19 3383 G/C rs207487 58 Intron 20 2730 C/T 59 Intron 20 2789 G/C 60 Intron 20 2919 C/T 61 Intron 20 3024 C/T 62 Intron 20 8716 G/A rs2239996 63 Intron 20 9718 A/C 64 Intron 20 9733 G/C 65 Intron 20 (9895-9896) AT/del 66 Intron 20 9952 G/A 67 Intron 20 11120 A/G 68 Intron 20 11147 G/A 69 Intron 20 (11629-11631) CTT/del 70 Intron 20 11864 C/T 71 Intron 21 3860 G/del 72 Intron 22 878 G/A 73 Intron 22 (4428-4445) (GGGGCT)3-4 74 Intron 23 62 T/C 75 Intron 24 3171 C/T 76 Intron 24 (3349-3368) (T)19-22 77 Intron 24 3369 T/C 78 Intron 24 3584 A/G 79 Intron 24 5322 T/G rs2238475 80 Exon 25 60 G/A(Pro1150Pro) 81 Intron 27 4539 G/A 82 Intron 28 179 G/A rs212011 83 Intron 28 1354 G/A rs212082 84 Intron 28 2150 G/A rs212083 85 Exon 29 36 G/A(Ser1334Ser)c rs2239330 86 Intron 29 1920 G/A rs212087 87 Intron 30 (1708-1714) (T)6-7 88 Intron 31 18 G/Ab rs212088 89 Exon 32 652 C/T(3ЈUTR) 90 Exon 32 910 C/G(3ЈUTR) rs129081 2b. Summary of genetic variations detected in the ABCC2 gene No. Location Positiona Genetic variation NCBI SNP ID 1 Exon 1 77 C/T(5ЈUTR) rs717620 2 Intron 1 413 A/C rs2756103 3 Intron 2 192 T/G 4 Intron 2 1020 G/C 5 Intron 2 3639 C/A 6 Intron 2 3930 A/G 7 Intron 2 3989 C/T 8 Intron 2 4078 T/C rs2145852 9 Intron 2 4171 C/T rs2756107 10 Intron 2 4257 G/A rs2145853 11 Intron 2 4436 C/G rs2180990 12 Intron 2 5227 A/G 13 Intron 2 5373 A/G 14 Intron 2 5538 G/T 15 Intron 3 772 A/T rs2073336 16 Intron 3 1145 C/T rs2804400 17 Intron 7 1658 G/T rs2756109 18 Exon 10 40 G/A(Val417Ile) rs2273697 19 Intron 11 1672 T/A 20 Intron 12 148 A/G rs2073337 21 Intron 13 180 G/C 22 Intron 13 1497 T/C rs2756114 23 Intron 15 169 T/C 24 Intron 15 949 A/G 25 Intron 15 984 A/C 26 Intron 16 4059 C/G 27 Intron 19 10899 G/A 28 Exon 22 51 G/A(Ser978Ser) 29 Intron 23 56 C/T 30 Intron 23 432 G/A 31 Intron 23 734 G/A 32 Intron 23 801 T/G 33 Intron 26 154 T/C 34 Intron 27 124 C/G 35 Exon 28 52 A/C(Lys1299Gln) 36 Exon 28 84 C/T(Tyr1309Tyr) 37 Exon 28 129 C/T(Ile1324Ile) 38 Intron 29 154 A/G 39 Intron 30 91 T/C 40 Intron 31 170 A/G 41 3ЈFlanking 371 C/T rs12826 ABCC2, ATP-binding cassette, subfamily C, member2 Table 2a. Continued No. Location Positiona Genetic variation NCBI SNP ID 91 Exon 32 975 T/A(3ЈUTR) rs212090 92 3ЈFlanking 158 G/A 93 3ЈFlanking (187-199) (T)11-13 94 3ЈFlanking 378 T/C rs212091 95 3ЈFlanking 2227 G/A ABCC1, ATP-binding cassette, subfamily C, member1; NCBI, National Center for Biotechnology Information; SNP, single-nucleotide polymorphism; UTR, untranslated region; del, deletion; ins, insertion a For SNPs in the 5Ј flanking region, intron region, or 3Ј flanking region, nucleotide positions are counted from the first intronic nucleotide at the exon/intron junction (for SNPs in the exon region, nucleotide positions are counted from the first exonic nucleotide at the exon/intron junction) b SNPs previously reported by Conrad et al. (2001) c SNPs previously reported by Ito et al. (2001) 2c. Summary of genetic variations detected in the ABCC3 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -1064 C/T 2 5ЈFlanking -(827-820) (C)7-8 3 Intron 1 1226 T/G 4 Intron 1 (1389-1399) (A)10-12 5 Intron 1 2070 C/T 6 Intron 1 4378 A/G rs1548529 7 Intron 1 4477 G/A 8 Intron 1 6189 T/C 9 Intron 2 268 G/A 10 Intron 2 376 G/C 11 Intron 2 446 C/T 12 Intron 3 166 G/A rs2301836 13 Intron 5 206 G/A rs739923 14 Intron 6 432 G/C rs733393 15 Intron 6 546 G/A rs733392 16 Intron 7 1132 C/G rs1978153 17 Intron 7 1537 C/T rs2301837 18 Intron 8 2323 C/G 19 Intron 12 85 C/del 20 Intron 14 257 T/C rs879459 21 Intron 18 303 G/A rs2240801 22 Intron 19 1581 C/T 23 Intron 20 29 C/T rs2072365 24 Intron 20 53 G/A rs2072366 25 Exon 22 180 C/T(Gly1013Gly) 26 Intron 23 1053 G/A rs2240802 27 Intron 24 84 C/T rs967935 28 Exon 27 135 C/T(His1314His) rs2277624 29 Intron 28 412 T/C rs872793 30 Intron 30 1979 C/G 31 Intron 30 2340 A/G 32 Exon 31 34 A/G(Glu1503Glu) rs1051640 33 3ЈFlanking (555-558) AAGA/del 34 3ЈFlanking 1455 G/A 35 3ЈFlanking (1650-1659) (A)9-11 ABCC3, ATP-binding cassette, subfamily C, member3 Table 2d. Summary of genetic variations detected in the ABCC4 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -644 C/T 2 5ЈFlanking -527 C/G rs869951 3 Exon 1 67 C/T(5ЈUTR) 4 Intron 1 (864-865) CT/del 5 Intron 1 21255 A/G 6 Intron 1 21503 T/C 7 Intron 1 21900 C/G 8 Intron 1 22005 C/T 9 Intron 1 (22256-22264) (T)8-9 10 Intron 1 27784 C/G 11 Intron 1 27821 A/T 12 Intron 1 27837 A/G 13 Intron 1 27880 C/T 14 Intron 1 40310 A/T 15 Intron 1 40372 G/A 16 Intron 1 40413 G/A 17 Intron 1 40958 A/G 18 Intron 1 50060 G/A 19 Intron 2 181 G/T 20 Intron 2 254 G/A 21 Intron 2 290 T/C 22 Intron 2 543 T/C 23 Intron 3 557 G/A 24 Intron 3 718 G/A 25 Intron 3 801 G/A 26 Intron 3 1022 T/C 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 27 Intron 3 1471 A/G 28 Intron 3 1490 G/A 29 Intron 3 (1833-1834) G/ins 30 Intron 3 1870 G/A 31 Intron 3 1927 G/A 32 Intron 3 1970 A/T 33 Intron 3 2039 T/C 34 Intron 3 (2067-2068) CTTT/ins 35 Intron 3 3563 G/A 36 Intron 3 3696 C/G 37 Intron 3 4093 T/C 38 Intron 3 4097 T/del 39 Intron 3 9724 A/G 40 Intron 3 9988 G/A 41 Intron 3 10952 A/G 42 Intron 3 11125 A/G 43 Intron 3 11244 C/del 44 Intron 3 11916 A/del 45 Intron 3 12047 A/G 46 Exon 4 205 T/G(Cys171Gly) 47 Intron 4 (412-414) GTT/del 48 Intron 4 -(9757-9756) T/ins 49 Intron 4 -6373 C/G 50 Intron 4 -6267 T/C 51 Intron 4 -6097 T/C 52 Intron 4 -6057 C/T 53 Intron 4 -5295 A/G 54 Intron 4 -803 C/T 55 Intron 4 -745 C/T rs1678400 56 Intron 4 -736 C/T 57 Intron 4 -728 C/T 58 Intron 4 -624 A/C 59 Intron 4 -470 C/T 60 Intron 4 -411 G/A 61 Intron 4 -323 C/T 62 Intron 4 -246 A/G 63 Intron 4 -199 C/T 64 Intron 4 -108 C/T rs899497 65 Intron 5 50 C/T rs899496 66 Intron 5 73 C/T 67 Intron 5 403 G/A 68 Intron 5 537 T/A rs943288 69 Intron 5 559 G/A rs873706 70 Intron 5 749 G/A rs873705 71 Intron 5 750 C/T rs899495 72 Intron 5 937 G/C 73 Intron 5 949 A/C rs2389203 74 Intron 5 965 G/C rs1678403 75 Exon 6 48 C/T(Ile223Ile) rs899494 76 Intron 6 150 C/T 77 Intron 6 158 C/T rs2389204 78 Intron 6 (380-381) AT/ins 79 Intron 6 1400 T/G rs2274410 80 Intron 6 1474 G/A rs2274409 81 Intron 7 80 G/A rs2274408 82 Intron 7 894 A/T 83 Exon 8 1 G/T(Lys302Asn) rs2274407 84 Exon 8 40 G/A(Arg317Arg) rs2274406 85 Exon 8 58 G/A(Ser323Ser) rs2274405 86 Intron 8 82 C/G 87 Intron 8 100 C/T 88 Intron 8 5212 A/T 89 Intron 8 5444 T/G 90 Intron 8 8969 A/G 91 Intron 8 9106 T/C 92 Intron 8 9189 G/A rs1751021 93 Intron 8 9412 G/A 94 Intron 9 70 T/C rs2274403 95 Intron 9 116 A/G 96 Intron 9 1384 T/C 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 97 Intron 9 1428 A/G rs1751015 98 Intron 9 1459 A/G 99 Intron 9 1485 C/A rs1751014 100 Intron 9 1632 C/A 101 Intron 9 3630 G/del 102 Intron 9 3830 C/T 103 Intron 9 3940 C/T 104 Intron 9 4023 G/A rs1678374 105 Intron 10 1411 A/G rs1557069 106 Intron 10 1504 G/A 107 Intron 11 171 C/A rs2148529 108 Intron 11 1233 T/C rs1564351 109 Intron 11 1293 G/A rs1751008 110 Intron 11 1817 G/C 111 Intron 11 3261 C/T rs1887163 112 Intron 11 3322 C/A rs1887162 113 Intron 11 3342 T/C 114 Intron 11 3377 T/C 115 Intron 11 (3610-3625) (A)15-17 116 Intron 11 3737 A/G 117 Intron 11 6953 C/A 118 Intron 13 91 G/A rs1751005 119 Intron 13 118 C/T rs2296653 120 Intron 13 280 G/A rs1678405 121 Intron 13 349 T/G rs1073500 122 Intron 13 373 A/G rs2009772 123 Intron 13 386 G/A rs2478461 124 Intron 13 442 G/C 125 Intron 13 459 T/C 126 Intron 13 633 G/A 127 Intron 13 645 G/T 128 Intron 13 3092 C/T rs1751003 129 Intron 13 3306 A/C 130 Intron 13 6722 G/A rs1729786 131 Intron 14 252 A/G 132 Intron 15 124 C/T 133 Intron 15 219 G/A rs1729770 134 Intron 15 1016 A/G rs1038138 135 Intron 15 1552 C/T 136 Intron 16 107 T/C rs1729764 137 Intron 16 157 G/A 138 Intron 17 329 T/C 139 Exon 18 56 G/A(Glu757Lys) 140 Intron 19 5440 T/C rs1729788 141 Intron 19 7202 T/del 142 Intron 19 7445 T/C 143 Intron 19 8337 T/C rs1471481 144 Intron 19 9018 A/G 145 Intron 19 9127 G/T rs899498 146 Intron 19 10304 C/A rs1479390 147 Intron 19 11388 A/G 148 Intron 19 11646 T/del 149 Intron 19 13517 A/T 150 Intron 19 19989 A/T rs997777 151 Intron 19 21033 G/A 152 Intron 19 21095 A/T 153 Intron 19 21582 G/A rs2619313 154 Intron 19 21634 C/T 155 Intron 19 21715 C/T 156 Intron 19 23090 G/A 157 Intron 19 24297 A/G 158 Intron 19 25947 C/A 159 Intron 19 30193 A/C 160 Intron 19 33424 A/G rs1189428 161 Intron 19 33474 T/C rs1189429 162 Intron 19 34901 T/G rs1564353 163 Intron 19 34916 G/T rs1564354 164 Intron 19 35277 T/C rs1564355 165 Intron 19 36938 C/G 166 Intron 19 37322 C/T 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 167 Intron 19 (38361-38362) T/ins 168 Intron 19 38746 T/C 169 Intron 19 41603 T/C rs1678342 170 Intron 19 42343 C/T 171 Intron 19 44733 A/del 172 Intron 19 45056 T/G rs1678394 173 Intron 20 (405-419) (T)13-15 174 Intron 20 (637-648) (A)12-13 175 Intron 20 842 T/del 176 Intron 20 843 T/C 177 Intron 20 1347 T/del 178 Intron 20 1614 A/G rs1729748 179 Intron 20 2222 G/A rs1678395 180 Intron 20 4115 G/A rs1628382 181 Intron 20 9851 T/G rs1678363 182 Intron 20 10233 C/T rs1729775 183 Intron 20 12141 T/G rs1630807 184 Intron 20 12153 G/C rs1751059 185 Intron 20 (14553-14567) (A)13-15 186 Intron 20 15487 C/T 187 Intron 20 15698 G/C rs1678354 188 Intron 20 15951 C/A rs1729761 189 Intron 20 16152 T/C rs1729760 190 Intron 20 16161 T/C 191 Intron 20 16185 A/G rs1729759 192 Intron 20 30891 C/T 193 Intron 20 30984 C/T rs1189434 194 Intron 20 31180 G/A 195 Intron 20 31283 A/del 196 Intron 20 31526 A/G rs1189435 197 Intron 20 32572 A/C rs1189437 198 Intron 21 404 C/T rs1189438 199 Intron 21 428 G/A rs1189439 200 Intron 21 2016 C/T rs1751052 201 Intron 21 3703 G/A rs1678362 202 Intron 21 3898 G/C rs1751050 203 Intron 21 3902 C/T rs1624638 204 Intron 21 4204 A/T 205 Intron 21 4336 T/C rs943290 206 Intron 21 4471 C/T rs943289 207 Intron 21 4527 A/G rs1729755 208 Intron 21 7071 C/A rs1751042 209 Exon 22 26 A/G(Leu904Leu) rs1678339 210 Intron 22 1026 A/C 211 Exon 23 38 C/T(Phe948Phe) rs1189466 212 Intron 23 377 A/G 213 Intron 23 395 G/A rs1189465 214 Intron 23 602 G/A rs1189464 215 Intron 24 99 A/G rs2274401 216 Intron 24 1096 G/A rs1189462 217 Intron 25 128 G/A rs1189461 218 Intron 25 4122 C/G/T 219 Intron 25 4422 G/C rs1189457 220 Intron 25 4936 A/C rs1678365 221 Intron 25 5251 A/G rs1751036 222 Intron 25 5428 G/A rs1678409 223 Intron 25 6418 C/A 224 Intron 25 8764 T/C rs1751035 225 Intron 25 (8765-8775) (T)5-11 226 Exon 26 138 A/G(Lys1116Lys) rs1751034 227 Intron 26 67 G/C 228 Intron 26 100 T/G rs1751033 229 Intron 26 (101-109) (T)8-9 230 Intron 26 362 G/A rs931110 231 Intron 26 463 T/C rs922522 232 Intron 26 591 T/C rs931111 233 Intron 26 7716 G/A rs1189444 234 Intron 26 7816 G/A rs1189445 235 Intron 26 7845 A/G rs1189446 236 Intron 26 9266 A/G rs1189449 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 237 Intron 27 7469 G/A rs1151471 238 Intron 28 391 T/del 239 Intron 29 2569 C/T 240 Intron 29 7820 C/T 241 Intron 30 6269 A/G 242 Intron 30 6320 C/T 243 Intron 30 6474 A/G 244 Intron 30 6519 C/T 245 Intron 30 6574 C/T 246 Intron 30 6680 A/G 247 Intron 30 -704 A/C 248 Intron 30 -228 A/G 249 Intron 30 -(14-5) (T)9-10 250 Exon 31 146 G/T(3ЈUTR) 251 3ЈFlanking 173 A/G 252 3ЈFlanking (430-440) (A)10-11 253 3ЈFlanking 556 G/A 254 3ЈFlanking 741 T/C rs1059751 255 3ЈFlanking 1144 T/C 256 3ЈFlanking 1426 A/T 257 3ЈFlanking 1454 C/T rs1059762 ABCC4, ATP-binding cassette, subfamily C, member4 Table 2e. Summary of genetic variations detected in the ABCC5 gene No. Location Positiona Genetic variation NCBI SNP ID 1 Intron 1 628 G/C 2 Intron 1 1834 C/T 3 Intron 1 3055 A/del 4 Intron 2 -20280 T/C 5 Intron 2 -20260 A/T 6 Intron 2 -19204 C/T 7 Intron 2 -19043 G/A 8 Intron 2 -18824 A/G 9 Intron 2 -18807 G/A 10 Intron 2 -(18735-18734) A/ins 11 Intron 2 -16898 C/T rs2292997 12 Intron 2 -15903 G/A 13 Intron 2 -15901 C/T 14 Intron 2 -15847 G/A 15 Intron 2 -15605 C/T 16 Intron 2 -13571 G/A 17 Intron 2 -13402 G/T 18 Intron 2 -13325 G/C 19 Intron 2 -7293 C/T 20 Intron 5 374 C/T 21 Intron 5 1490 T/C rs939338 22 Intron 5 (2212-2213) CT/del 23 Intron 5 3283 C/T 24 Intron 5 3469 C/T 25 Intron 5 4411 G/C rs939337 26 Intron 5 4630 C/T rs2313212 27 Intron 7 28 G/A rs2293001 28 Intron 7 443 C/T 29 Intron 7 458 T/G 30 Exon 9 38 C/T(Ala395Ala) rs2271938 31 Intron 9 176 A/G 32 Intron 9 214 G/T 33 Intron 10 703 T/C 34 Intron 10 3580 A/G 35 Intron 10 3655 G/A 36 Intron 10 3854 T/C 37 Intron 10 5040 C/T 38 Intron 10 5062 C/T rs869335 39 Intron 10 5316 C/T 40 Intron 11 213 A/G rs869417 2e. Continued No. Location Positiona Genetic variation NCBI SNP ID 41 Exon 12 21 T/C(Cys594Cys) rs939336 42 Intron 12 234 G/A 43 Intron 12 300 A/G 44 Intron 12 318 A/G 45 Intron 12 1545 C/T 46 Intron 13 20 T/C 47 Intron 14 13 C/T rs2271937 48 Intron 14 76 C/T rs1879257 49 Intron 14 278 A/G 50 Intron 15 117 A/C rs2292999 51 Intron 16 (1654-1663) (T)9-10 52 Intron 16 1664 A/T 53 Intron 17 20 T/G 54 Intron 18 232 C/T 55 Intron 19 249 G/A 56 Intron 20 846 G/A 57 Intron 20 1154 A/del 58 Intron 22 (1424-1425) AT/ins 59 Intron 22 1799 T/C rs2280392 60 Intron 23 50 C/G rs1016752 61 Intron 23 1279 G/A rs2292998 62 Intron 24 132 A/G 63 Intron 24 -874 A/G 64 Intron 24 -630 G/A 65 Intron 24 -102 G/C 66 Exon 25 120 C/T(Leu1208Leu) 67 Intron 26 263 C/T 68 Intron 26 -3717 G/A rs2037379 69 Intron 26 -3257 T/C 70 Intron 27 873 G/A 71 Intron 29 (2733-2734) TGTCCAAAGGAAGGACACG/ins 72 Intron 29 2959 A/G 73 Intron 29 4020 G/A 74 Exon 30 684 G/A(3ЈUTR) 75 Exon 30 947 C/T(3ЈUTR) 76 Exon 30 (1145-1160) (TC)6-8(3ЈUTR) 77 Exon 30 1345 A/G(3ЈUTR) rs562 78 3ЈFlanking 4 A/C 79 3ЈFlanking 1729 C/T rs2313217 80 3ЈFlanking 1911 C/T rs1533684 81 3ЈFlanking 1958 A/G rs1000002 82 3ЈFlanking 2008 C/del 83 3ЈFlanking 2052 A/G 84 3ЈFlanking 2238 G/A rs1533683 85 3ЈFlanking 2845 A/G rs1533682 ABCC5, ATP-binding cassette, subfamily C, member5 Table 2f. Summary of genetic variations detected in the CFTR gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -834 T/G 2 5ЈFlanking -729 T/del 3 Exon 1 125 G/C(5ЈUTR) rs1800501 4 Intron 1 6200 G/A rs2283054 5 Intron 1 7538 C/A 6 Intron 1 9203 T/C rs885993 7 Intron 1 13519 T/C rs2237721 8 Intron 1 14110 T/del 9 Intron 1 14293 C/del 10 Intron 1 14316 C/G 11 Intron 1 14433 G/A 12 Intron 1 14824 G/C 13 Intron 1 23401 C/G 14 Intron 3 879 C/A 2f. Continued No. Location Positiona Genetic variation NCBI SNP ID 15 Intron 3 922 G/C 16 Intron 3 933 C/T 17 Intron 3 2632 A/C rs980574 18 Intron 3 13704 A/del 19 Intron 3 13758 A/G 20 Intron 3 21578 G/A rs1429566 21 Intron 4 240 T/del 22 Intron 4 376 A/G 23 Intron 4 586 T/C 24 Intron 4 1089 G/A rs957461 25 Intron 4 1101 T/A rs213942 26 Intron 4 1615 C/T 27 Intron 4 1946 T/C 28 Intron 6 783 A/G 29 Intron 6 (1104-1131) (GATT)6-7 30 Intron 7 (731-732) T/ins 31 Intron 7 1434 T/C 32 Intron 7 1481 A/G rs213935 33 Intron 8 752 A/G rs2237725 34 Intron 8 1109 G/A 35 Intron 8 1312 T/del 36 Intron 9 (6499-6520) (TG)11-12 b 37 Intron 10 395 G/A rs1820871 38 Intron 10 2119 T/G 39 Intron 10 2406 G/A rs213946 40 Exon 11 16 G/A(Val470Met)c rs213950 41 Intron 11 3867 A/del 42 Intron 11 11844 A/del 43 Intron 11 12144 T/C rs2082056 44 Intron 11 20975 G/A 45 Intron 11 21152 A/G rs213955 46 Intron 11 21297 G/A rs213956 47 Intron 11 27057 G/A 48 Intron 11 27131 T/del 49 Intron 12 1280 G/A rs213963 50 Intron 12 1449 A/G rs213964 51 Intron 12 1650 T/A rs213965 52 Intron 13 152 T/A 53 Intron 13 287 T/C 54 Intron 14 1826 A/G rs117243 55 Intron 15 (85-86) AT/del 56 Intron 15 106 T/A 57 Intron 15 3267 T/G rs213976 58 Intron 15 3333 T/G rs213977 59 Intron 15 3341 A/C 60 Intron 15 5556 A/T rs2246450 61 Intron 15 5919 C/A rs2106155 62 Intron 15 6282 A/T rs2213958 63 Intron 17 2479 A/C rs2299445 64 Intron 18 -81 A/del 65 Intron 19 751 A/G 66 Intron 19 820 T/C 67 Intron 20 1011 G/T rs213980 68 Intron 21 1532 T/del 69 Intron 21 1607 C/T rs2237726 70 Intron 21 4244 G/A rs213985 71 Intron 21 11260 T/C 72 Intron 22 (130-131) AT/del 73 Intron 23 1837 A/del 74 Intron 24 (7100-7112) (T)12-14 75 Intron 25 237 C/T 76 Exon 27 115 C/T(Arg1453Trp) 77 Exon 27 334 T/del(3ЈUTR) CFTR, Cystic fibrosis transmembrane conductance regulator b SNP previously reported by Chu et al. (1993) c SNP previously reported by Cuppens et al. (1998) 2g. Summary of genetic variations detected in the ABCC8 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -1099 T/C 2 5ЈFlanking -(424-422) CAC/del 3 Intron 1 382 G/C rs985136 4 Intron 1 1212 A/G 5 Exon 2 59 T/C(Pro69Pro)b rs1048099 6 Intron 2 1003 C/A rs2283253 7 Intron 2 1253 C/T rs2283254 8 Intron 2 1382 T/C rs2283255 9 Intron 2 2371 T/A 10 Intron 3 1957 C/T 11 Intron 3 (2088-2089) CCA/ins 12 Intron 3 2204 G/A rs2283257 13 Intron 3 2286 A/G 14 Intron 3 2312 C/G 15 Intron 3 2356 A/G 16 Intron 3 2359 A/C 17 Intron 3 2370 G/A 18 Intron 3 2382 A/G 19 Intron 3 4910 G/A 20 Intron 3 4969 A/G 21 Intron 3 5003 C/G 22 Intron 3 5019 A/C 23 Intron 4 14 C/Tb rs2301703 24 Intron 4 187 G/A rs2301704 25 Intron 4 204 G/C 26 Intron 4 254 G/A 27 Intron 4 357 G/C 28 Intron 5 92 G/A rs2074317 29 Intron 5 801 C/T rs886289 30 Intron 5 802 A/G rs886290 31 Intron 6 87 A/G rs886291 32 Intron 6 4205 G/A rs2237975 33 Intron 6 5519 A/C rs2237976 34 Intron 6 5575 G/C rs2237977 35 Intron 6 6587 C/T rs2073585 36 Intron 6 6747 C/T rs2073586 37 Intron 7 348 A/C rs2057661 38 Intron 8 28 G/A rs1800850 39 Intron 8 4015 T/G rs886292 40 Intron 9 191 A/G rs2073587 41 Intron 10 1963 T/G rs2283261 42 Intron 10 2047 T/C rs886293 43 Intron 10 2724 A/G rs2237979 44 Intron 10 2938 G/C rs2237980 45 Intron 10 3094 T/del 46 Intron 10 3368 A/G rs2237981 47 Intron 10 8897 C/T 48 Intron 11 308 G/A 49 Intron 11 1171 G/A rs2074308 50 Exon 12 7 G/A(Val560Met) 51 Exon 12 15 C/T(His562His) rs1799857 52 Intron 12 356 G/T 53 Intron 12 934 G/T 54 Intron 12 1370 C/G rs2283262 55 Exon 14 25 G/A(Lys649Lys) rs1799858 56 Intron 15 412 C/T 57 Intron 15 688 A/G 58 Intron 15 709 C/Tc rs1799854 59 Intron 16 4464 G/A rs2237988 60 Intron 16 4574 T/C 61 Intron 16 5011 C/T rs2299638 62 Intron 16 6138 A/T rs929235 63 Intron 16 7608 C/G rs2299641 64 Intron 16 7730 G/A rs2299642 65 Intron 16 7818 C/G rs916828 66 Intron 16 8369 T/C rs2237991 67 Intron 16 9708 T/G rs2074315 68 Intron 17 651 A/G rs2234773 69 Intron 17 692 A/G 70 Intron 17 1541 C/T 2g. Continued No. Location Positiona Genetic variation NCBI SNP ID 71 Intron 18 580 C/T 72 Intron 18 658 C/Tb 73 Intron 18 660 T/Cb 74 Intron 19 93 T/C 75 Intron 19 123 T/C 76 Intron 19 219 C/T 77 Intron 19 845 C/T rs2074309 78 Intron 20 338 A/G rs2355017 79 Exon 21 10 C/T(Leu829Leu) 80 Intron 21 192 C/del 81 Intron 23 17 A/G rs2106865 82 Intron 23 67 C/T 83 Intron 23 581 T/C rs1319447 84 Intron 26 268 G/C rs2077654 85 Intron 26 308 C/T rs2077655 86 Intron 26 348 A/G rs2077144 87 Intron 26 613 A/G rs739688 88 Intron 26 807 G/A 89 Intron 26 834 G/C rs2073583 90 Intron 28 (118-121) AAAA/del 91 Intron 28 1348 G/A rs2067043 92 Intron 29 1253 G/T 93 Intron 29 1589 A/G 94 Intron 29 2322 G/A rs2074310 95 Intron 29 2348 T/C rs2074311 96 Intron 29 2418 C/T rs2074312 97 Intron 29 2494 C/A 98 Intron 29 2735 C/T 99 Intron 30 386 C/T 100 Exon 31 66 G/A(Arg1273Arg)c rs1799859 101 Exon 33 117 T/G(Ser1369Ala) rs757110 102 Intron 33 93 G/T 103 Intron 33 358 C/T 104 Intron 33 446 T/C rs757111 105 Intron 33 959 T/Cd rs759689 106 Intron 38 54 G/C 107 Intron 38 466 C/del 108 Intron 38 529 A/G ABCC8, ATP-binding cassette, subfamily C, member8 b SNPs previously reported by Nestorowicz et al. (1998) c SNPs previously reported by Inoue et al. (1996) d SNP previously reported by Goksel et al. (1998) Table 2h. Summary of genetic variations detected in the ABCC9 gene No. Location Positiona Genetic variation NCBI SNP ID 1 Intron 2 -321 T/C rs870134 2 Intron 2 -266 A/G rs870135 3 Intron 3 38 C/A 4 Intron 3 305 T/A rs2176394 5 Intron 3 320 A/G 6 Intron 3 631 G/C 7 Intron 3 8644 A/G 8 Intron 4 757 A/C 9 Intron 4 1022 A/C 10 Intron 5 -1217 A/G 11 Intron 5 -1208 A/G rs1344569 12 Intron 5 -180 A/G rs1517276 13 Intron 6 (100-106) (T)8-9 14 Intron 6 1347 A/del 15 Intron 6 1618 G/A rs2418021 16 Intron 6 1835 C/Tb 17 Intron 7 407 T/G 18 Intron 7 423 C/T 19 Intron 8 743 A/T 20 Intron 8 850 T/G 2h. Continued No. Location Positiona Genetic variation NCBI SNP ID 21 Intron 8 1360 C/T rs1421602 22 Intron 9 585 A/T 23 Intron 9 1394 G/C 24 Intron 11 1035 A/G rs704217 25 Intron 12 908 T/C rs704215 26 Intron 12 1113 T/C rs1914361 27 Intron 12 1167 G/A rs2292771 28 Intron 12 1195 A/G rs2292772 29 Intron 12 2123 G/A 30 Intron 12 2622 G/A rs704212 31 Intron 12 (2653-2656) TAAC/del 32 Intron 12 2756 G/A rs2032775 33 Intron 13 (3043-3044) CTCTTT/ins or CT/ins 34 Intron 13 4877 A/C rs1283802 35 Intron 13 4887 A/G rs1356368 36 Intron 14 85 T/A 37 Intron 14 275 T/C 38 Intron 14 453 T/C 39 Intron 14 3709 G/A 40 Intron 14 3813 C/T 41 Intron 14 4000 A/del 42 Intron 14 5522 T/A rs1492138 43 Intron 14 5535 T/G rs704205 44 Intron 16 1466 A/C 45 Intron 16 5357 T/G 46 Intron 16 7395 A/G rs697252 47 Intron 16 7407 C/T rs768314 48 Intron 17 970 A/T rs704194 49 Intron 17 (1358-1368) (T)10-11 50 Intron 18 119 C/T rs704193 51 Intron 18 773 T/C rs704192 52 Intron 18 865 A/G rs704191 53 Intron 20 98 G/A 54 Intron 20 173 C/T rs704189 55 Intron 22 28 A/C rs2307024 56 Intron 22 194 G/del 57 Intron 22 1370 C/T 58 Intron 22 1487 C/G 59 Intron 22 3148 T/G rs1283822 60 Intron 23 (455-462) AATTAGAA/del 61 Intron 23 1221 A/G rs829080 62 Intron 23 1976 C/A rs829079 63 Intron 24 (460-465) TTTAAAA/TTTTAA 64 Intron 24 595 A/G rs2307025 65 Intron 26 -150 T/G rs1643235 66 Intron 27 1628 C/T rs704179 67 Intron 27 1770 C/G rs704178 68 Intron 27 1976 A/T rs704177 69 Intron 28 -926 G/A rs2112080 70 Intron 29 667 T/C rs1283811 71 Intron 29 1072 A/C rs1283810 72 Intron 29 2692 T/del 73 Intron 29 2959 T/C rs1873638 74 Intron 29 5464 G/A 75 Intron 29 -1830 A/T 76 Intron 31 102 G/A rs2638441 77 Intron 33 877 A/G 78 Intron 33 1069 T/C rs2216525 79 Intron 36 (1270-1281) (T)11-12 80 Intron 37 533 C/G rs829060 81 3ЈFlanking 197 T/G ABCC9, ATP-binding cassette, subfamily C, member9 b SNP previously reported by Iwasa et al. (2001) 3. Login to comment

PMID: 16041239 [PubMed] Colombo S et al: "Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo."

No. Sentence Comment

71 - 24C > T exon 1 Itoda et al., 2002 mp-v-004 rs717620 IVS 6-30 G > T intron 6 Epidauros mp-v-051 rs8187666 c.842G > A exon 7 p.S281N Epidauros mp-v-115 c.998G > A intron 7 Epidauros mp-v-083 c.1219C > T exon 10 synonymous (p.L407L) Epidauros mp-v-007 rs8187669 c.1249G > A exon 10 p.V417I Itoda et al., 2002 mp-v-008 rs2273697 c.1346C > G exon 10 synonymous (p.T482T) Epidauros mp-v-114 c.1457C > T exon 10 p.T486I Epidauros mp-v-055 rs8187670 IVS 16 - 47 G > A intron 16 Epidauros mp-v-118 IVS 16 - 30 T > A intron 16 Epidauros mp-v-119 c.2153A > G exon 17 p.N718S Epidauros mp-v-093 rs3740072 c.2216T > C exon 17 p.L739P Epidauros mp-v-108 c.3449G > A exon 25 p.R1150H Mor-Cohen et al., 2001 mp-v-085 c.3517A > T exon 25 p.I1173F Keitel et al., 2003 mp-v-096 c.3521G > A exon 25 p.R1174H Epidauros mp-v-068 c.3542G > T exon 25 p.R1181L Epidauros mp-v-069 rs8187692 c.3563T > A exon 25 p.V1188E Epidauros mp-v-025 rs8187694 IVS 30 - 53 C > T intron 30 Epidauros mp-v-105 rs3824610 c.4348G > A exon 31 p.A1450T Suzuki et al. 2002 mp-v-106 c.4410G > A exon 31 synonymous (p.E1470E) Epidauros mp-v-077 rs8187706 c.4488C > T exon 31 synonymous (p.H1496H) Epidauros mp-v-038 rs8187707 IVS 31 + 12 G > A intron 31 Epidauros mp-v-039 rs8187708 IVS 31 + 74 C > T intron 31 Epidauros mp-v-040 IVS 31 - 9 T > C intron 31 Epidauros mp-v-042 c 4527C > T exon 32 synonymous (p.A1509A) Epidauros mp-v-048 rs8187709 c.4544G > A exon 32 p.C1515Y Epidauros mp-v-043 rs8187710 + 259 G > T 30 flanking Epidauros mp-v-120 Transporter polymorphisms and HIV treatment Colombo et al. 601 BCRP (ABCG2) g. Login to comment
102 - 24C > T rs717620 19 5 3 1 1.5 1.1 0.64 0.73 c.1249G > A (V417I) rs2273697 20 7 1 1 1.4 0.2 4.43 0.11 c.1346C > G NM_000392; c.1483C > G 26 1 1 0.6 1.34 0.25 IVS 16 - 47 G > A NC_000010; g.34448G > A 27 1 1 1.5 0.86 0.35 c.3563T > A (V1188E) rs8187694 23 4 1 1.1 0.07 0.78 c.4488C > T rs8187707 23 5 1 0.8 0.04 0.83 IVS 31 + 12G > A rs8187708 23 5 1 0.8 0.04 0.83 IVS 31 + 74C > T NC_000010; g.68057C > T 24 4 1 1.1 0.00 0.95 c.4544G > A (C1515Y) rs8187710 22 5 1 0.8 0.02 0.90 g. Login to comment

PMID: 19349540 [PubMed] Innocenti F et al: "Comprehensive pharmacogenetic analysis of irinotecan neutropenia and pharmacokinetics."

No. Sentence Comment

110 % of Patients HWE Exact P (white)African American (n ϭ 11) White (n ϭ 67) Other (n ϭ 7) ABCC1 IVS9 ϩ8AϾG 35588 1.000 A/A 27.3 46.3 57.1 A/G 45.4 43.3 42.9 G/G 27.3 10.4 0 ABCC1 IVS11 -48CϾT 3765129 .092 C/C 81.8 71.6 71.4 C/T 18.2 22.4 28.6 T/T 0 6.0 0 ABCC1 1684TϾC 35605 .738 T/T 9.1 6.0 14.3 T/C 27.3 34.3 14.3 C/C 63.6 59.7 71.4 ABCC1 IVS18 -30CϾG 2074087 .464 C/C 0 6.0 14.3 C/G 36.4 29.8 14.3 G/G 63.6 64.2 71.4 ABCC1 4002GϾA 2230671 .392 G/G 63.6 47.8 71.4 G/A 36.4 46.3 14.3 A/A 0 6.0 14.3 ABCC1 IVS30 ϩ18AϾG 212088 .392 A/A 18.2 4.5 0 A/G 18.2 25.4 14.3 G/G 63.6 70.1 85.7 ABCC2 -1549AϾG 1885301 .602 A/A 27.3 16.4 14.3 A/G 27.3 43.3 28.6 G/G 45.4 40.3 57.1 ABCC2 -1019AϾG 2804402 .792 A/A 54.6 40.3 57.1 A/G 45.4 44.8 28.6 G/G 0 14.9 14.3 ABCC2 -24CϾT 717620 .678 C/C 100 65.7 85.7 C/T 0 32.8 14.3 T/T 0 1.5 0 ABCC2 1249GϾA (V417I) 2273697 .043 G/G 54.5 62.7 85.7 G/A 45.5 26.9 14.3 A/A 0 10.4 0 ABCC2 IVS26 -34TϾC 17216177 1.000 T/T 72.7 94.0 85.7 T/C 27.3 6.0 14.3 C/C 0 0 0 ABCC2 3972CϾT 3740066 .790 C/C 45.5 44.8 85.7 C/T 45.5 43.3 0 T/T 9.0 11.9 14.3 ABCB1 -129TϾC 3213619 .006 T/T 100 92.5 100 T/C 0 4.5 0 C/C 0 3.0 0 ABCB1 IVS4 -25GϾT 2235015 .700 G/G 72.7 65.7 100 G/T 27.3 29.8 0 T/T 0 4.5 0 (continued on following page) Irinotecan Pharmacogenetics www.jco.org (c) 2009 by American Society of Clinical Oncology 2609 discovered this variant during a resequencing study of the region 5Ј to the UGT1A exon 119 and hypothesized that UGT1A1*93 was a better predictor of neutropenia than UGT1A1*28.6 This variant has unknown function at the molecular level and, in our study, is associated withincreasedexposureofpatientstoSN-38.DespiteitshighLDwith the UGT1A1*28 allele, our data are consistent with the recent results of a study identifying UGT1A1*93 as the only predictor of severe hematologic toxicity in colorectal cancer patients receiving fluorouracil, leucovorin, and CPT-11.20 In addition to UGT1A1, our data suggest that ABCC transporter genes play a major role in the pharmacology of CPT-11. Login to comment

PMID: 20368717 [PubMed] Bergmann TK et al: "Impact of CYP2C8*3 on paclitaxel clearance: a population pharmacokinetic and pharmacogenomic study in 93 patients with ovarian cancer."

No. Sentence Comment

135 This effect on clearance of a 'non-fixed` variable provides a competing and dynamic biological explanation for clearance that certainly should be Table 4 Clearance of unbound paclitaxel as function of observed genotypes Gene/allelea Effectb Reference homozygote Heterozygote Variant homozygote P-valuee SNP IDf Nc CLd (10th-90th) Nc CLd (10th-90th) Nc CLd (10th-90th) Candidate SNPs for confirmative analysis CYP2C8 1196A4G(*3) K399R 74 395 (297-490) 19 350 (238-458) 0.03* (0.04) rs10509681 ABCB1 1236C4T G412G 29 391 (270-569) 45 393 (299-490) 19 359 (291-437) 0.25 (0.25) rs1128503 2677G4T/Ag A893S/T 26 387 (270-490) 42(GT) 396 (299-490) 20(TT) 356 (294-437) 0.20 (0.26) rs2032582 3435C4T I1145I 11 403 (326-548) 44 387 (282-490) 38 378 (297-468) 0.83 (0.43) rs1045642 Candidate SNPs for exploratory analysis CYP2C8 792C4G(*4) I264M 86 391 (297-490) 7 321 (270-374) 0.04* (0.03) rs1058930 15577956G4T (*1B) - 49 395 (298-552) 43 373 (291-478) 1 461 0.75 (0.36) rs7909236 15578055A4C (*1C) - 69 382 (291-478) 24 393 (300-552) 0.48 (0.62) rs17110453 ABCB1 À1A4G - 1 458 29 396 (270-592) 63 379 (297-477) 0.56 (0.3) rs2214102 61A4G N21D 63 384 (282-490) 29 386 (298-478) 1 437 0.52 (0.77) rs9282564 1199G4A S400N 83 385 (291-490) 10 386 (322-461) 0.74 (0.99) rs2229109 CYP3A4 24616372T4C (*1B) - 85 383 (296-490) 7 397 (270-641) 0.67 (0.72) rs2740574 CYP3A5 219-237G4A Frameshift 84 388 (297-490) 9 360 (176-726) 0.30 (0.36) rs776746 SLCO1B3 699G4A M233I 1 326 19 377 (299-481) 73 388 (291-490) 0.99 (0.46) rs7311358 767G4C G256A 67 386 (298-481) 26 383 (291-490) 0.63 (0.89) rs60140950 CYP1B1 1294C4G (*3) V432L 30 389 (270-530) 36 401 (298-490) 27 361 (300-470) 0.77 (0.24) rs1056836 ABCC1 7356253C4G - 65 394 (297-548) 27 368 (291-470) 1 332 0.04* (0.15) rs504348 ABCC2 1249G4A V417I 67 381 (291-490) 24 396 (297-552) 2 415 (368-468) 0.21 (0.39) rs2273697 3563T4A V1188E 87 386 (296-490) 5 370 (176-569) 0.7 (0.7) rs17222723 4544G4A C1515Y 75 389 (296-490) 3 355 (176-569) 0.72 (0.52) rs8187710 ABCG2 421C4A Q141K 61 374 (291-478) 32 408 (315-548) 0.4 (0.09) rs2231142 34G4A V12M 87 385 (291-490) 4 395 (296-726) 0.68 (0.83) rs2231137 ABCC10 2759T4C I920T 46 386 (297-478) 43 386 (291-548) 4 373 (326-467) 0.88 (0.89) rs2125739 Abbreviations: CL, clearance of unbound paclitaxel; SNP, single-nucleotide polymorphism. Login to comment

PMID: 12357145 [PubMed] Lotsch J et al: "Does the A118G polymorphism at the mu-opioid receptor gene protect against morphine-6-glucuronide toxicity?"

No. Sentence Comment

106 33 T/T T/T MDR1 2 A61G Asn21Asp 11.2 20.6 9 A/G A/G Forward: 5Ј-AGG AGC AAA GAA GAA GAA CTT TTT TAA ACT GAT C-3Ј 9.3 17.6 8 Reverse: 5Ј-GAT TCC AAA GGC TAG CTT GC-3Ј 5 T307C Phe103Leu 0.6 1.2 9 T/T T/T Forward: 5Ј-GTG GTT GCA CAC AGT CAG CA-3Ј Reverse: 5Ј-GGA GGA TGT CTA ATT ACC TGG TCA-3Ј 11 G1199A Ser400Asn 5.5 11.1 9 G/G G/G Forward: 5Ј-CAG CTA TTC GAA GAG TGG GC-3Ј 6.5 12.9 8 Reverse: 5Ј-CCG TGA GAA AAA AAC TTC AAG G-3Ј 21 G2677T Ala893Ser 41.6 49.2 9 T/T T/T Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј 63.9 43.4 8 Reverse: 5Ј-GTT TGA CTC ACC TTC CCA G-3Ј 21 G2677A Ala893Thr 0.9 2 9 NA NA Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј Reverse: 5Ј-TTT AGT TTG ACT CAC CTT CCC G-3Ј 26 A3320C Gln1107Pro 0.2 0.4 9 A/A A/A 26 C3396T Ala1132Ala 0.3 0.5 8 C/C C/C Forward: 5Ј-ATC TGT GAA CTC TTG TTT TCA GC-3Ј 26 C3435T Ile1145Ile 50.3 47.7 8 T/T T/T Reverse: 5Ј-TCG ATG AAG GCA TGT ATG TTG-3Ј 53.9 50.5 9 - - MRP2 10 G1249A Val417Ile 12.5 20.8 34 G/G G/G Forward: 5Ј-GGG TCC TAA TTT CAA TCC TTA-3Ј Reverse: 5Ј-TAT TCT TCT GGG TGA CTT TTT-3Ј 18 C2302T Arg768Trp 1 2.1 34 C/C C/C Forward: 5Ј-GGA GTA GTG CTT AAT ATG AAT-3Ј 18 C2366T Ser789Phe 1 2.1 34 C/C C/C Reverse: 5Ј-CCC ACC CCA CCT TTA TAT CTT-3Ј 28 C3972T Ile132Ile 21.9 35.4 34 C/T C/T Forward: 5Ј-TGC TAC CCT TCT CCT GTT CTA-3Ј Reverse: 5Ј-ATC CAG GCC TTC CTT CAC TCC-3Ј 31 G4348A Ala1450Thr 1 2.1 34 G/G G/G Forward: 5Ј-AGG AGC TAA CAC ATG GTT GCT-3Ј Reverse: 5Ј-GGG TTA AGC CAT CCG TGT CAA-3Ј † Sequence is not translated. Login to comment

PMID: 16370938 [PubMed] Dey S et al: "Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition."

No. Sentence Comment

180 The SNP associated with G1249A also changes the amino acid residue from Val to Ile (Val417Ile); however, C3972T is a 'silent mutation` with no change in amino acid sequence. Login to comment

PMID: 16788565 [PubMed] Haenisch S et al: "Influence of polymorphisms of ABCB1 and ABCC2 on mRNA and protein expression in normal and cancerous kidney cortex."

No. Sentence Comment

4 The DNA of all patients was genotyped for ABCB1 À2352G4A, À692T4C, 2677G4T/A (Ala893Ser/Thr), and 3435C4T, and ABCC2 À24C4T, 1249G4A (Val417Ile) and 3972C4T. Login to comment
26 Cancerous and adjacent non-cancerous tissue of each patient and blood samples of controls were genotyped for the ABCB1 polymorphisms À2352G4A, À692T4C, 2677G4T/A (Ala893Ser/Thr), 3435C4T (silent), and for À24C4T, 1249G4A (Val417Ile) and 3972C4T (silent) in the ABCC2 gene. Login to comment
94 Analyzing the ABCC2 SNPs À24C4T, 1249G4A (Val417Ile) and 3972C4T, a lower frequency of the 1249A variant, coding for isoleucin, was found in clear-cell carcinomas (15.1 vs 22.2%), however without reaching statistical significance (P ¼ 0.09). Login to comment

PMID: 16799996 [PubMed] Meier Y et al: "Interindividual variability of canalicular ATP-binding-cassette (ABC)-transporter expression in human liver."

No. Sentence Comment

63 Primers and Probes of RealTime PCR for Allelic Discrimination of Single Nucleotide Polymorphisms (SNPs) in Whites Gene Exon cDNA PositionA SNPB GenBank Reference Amino Acid Exchange Sense-Antisense Primer Probesc ABCB11 13 1457 T Ͼ C rs2287617* V444A 5Ј-CTTTCTTCTCCAGATTCTAAATGACCTCA-3Ј/ VIC 5Ј-CCTGGTTTAATGACCATGT-3Ј 5Ј-GTCCTACCAGAGCTGTCATTTCC-3Ј FAM 5Ј-CTGGTTTAATGGCCATGT-3Ј ABCB11 17 2155 A Ͼ G Ref. 14,15** M677V 5Ј-TCATGCTGTGTTGAGTAGATGCA-3Ј/ VIC 5Ј- CTGAAGATGACATGCTT-3Ј 5Ј-GGTAGCTCCCTCTGCTAAAGGT-3Ј FAM 5Ј- ACTGAAGATGACGTGCTT-3Ј ABCB4 16 3826 A Ͼ G rs8187799* R652G 5Ј-TCCAGTCAGAAGAATTTGAACTAAATGATGAA-3Ј/ VIC 5Ј-CTGCCACTAGAATGG-3Ј 5Ј-GCCTAAATAGATTTCCAGCCATTTGG-3Ј FAM 5Ј-TGCCACTGGAATGG-3Ј ABCC2 10 1286 G Ͼ A rs2273697* V417I 5Ј-CCAACTTGGCCAGGAAGGA-3Ј/ VIC 5Ј-CTGTTTCTCCAACGGTGTA-3Ј 5Ј-GGCATCCACAGACATCAGGTT-3Ј FAM 5Ј-ACTGTTTCTCCAATGGTGTA-3Ј ABCC2 25 3600 T Ͼ A rs8187694* V1188E 5Ј-GCACCAGCAGCGATTTCTG-3Ј/ VIC 5Ј-ACACAATGAGGTGAGGAT-3Ј 5Ј-AGGTGATCCAGGAAAAGACACATTT-3Ј FAM 5Ј-ACAATGAGGAGAGGAT-3Ј ABCC2 32 4581 G Ͼ A rs8187710* C1515Y 5Ј-GTAATGGTCCTAGACAACGGGAAG-3Ј/ VIC 5Ј- AGAGTGCGGCAGCC -3Ј 5Ј-CCAGGGATTTGTAGCAGTTCTTCAG-3Ј FAM 5Ј-ATTATAGAGTACGGCAGCC-3Ј ABCB1 26 3435 CϾT rs1045642* synonym. Login to comment
141 Distribution of Genotypes and Allelic Frequencies of Investigated SNPs in Individuals With Low, Normal and High Transporter Expression Phenotypes SNP Study population Low expressorsA Normal expressorsB High expressionC 1) BSEP n ϭ 110 (100%) n ϭ 14 (100%) n ϭ 79 (100%) n ϭ 17 (100%) Alleles (2n) 220 (100%) 28 (100%) 158 (100%) 34 (100%) a) ABCB11 1457T>C (V444A): Genotypes: TT 19 (17%) 1 (7%) 14 (18%) 4 (24%) CC 29 (26%) 6 (43%) 19 (24%) 4 (24% TC 62 (56%) 7 (50%) 46 (58%) 9 (53%) Allelic frequency: C-allele 120 (55%) 19 (68%) 84 (53%) 17 (50%) b) ABCB11 2155A>G (M677V): Genotypes: AA 102 (93%) 14 (100%) 72 (91%) 16 (94%) AG 8 (7%) 7 (9%) 1 (6%) Allelic frequency: G-allele 8 (4%) 7 (7%) 1 (3%) 2) MDR3 n ϭ 110 (100%) n ϭ 13 (100%) n ϭ 86 (100%) n ϭ 11 (100%) Alleles (2n) 220 (100%) 26 (100%) 172 (100%) 22 (100%) ABCB4 3826A>G (R652G): Genotypes: AA 87 (89%) 8 (62%) 71 (83%) 8 (73%) AG 23 (21%) 5 (38%) 15 (17%) 3 (27%) Allelic frequency: G-allele 23 (10%) 5 (19%) 15 (9%) 3 (14%) 3) MRP2 n ϭ 110 (100%) n ϭ 11 (100%) n ϭ 90 (100%) n ϭ 9 (100%) Alleles (2n) 220 (100%) 22 (100%) 180 (100%) 18 (100%) a) ABCC2 1286G>A (V417I): Genotypes: GG 64 (58%) 7 (64%) 51 (57%) 6 (67%) AA 1 (1%) 1 (1%) GA 45 (41%) 4 (36%) 38 (42%) 3 (33%) Allelic frequency: A-allele 47 (26%) 4 (18%) 40 (22%) 3 (17%) b) ABCC2 3600T>A (V1188E): Genotypes: TT 95 (86%) 10 (91%) 80 (89%) 5 (56%) AA 1 (1%) 1 (11%) TA 14 (13%) 1 (9%) 10 (11%) 3 (33%) Allelic frequency: A-allele 16 (6%) 1 (5%) 10 (5%) 5 (28%) c) ABCC2 4581G>A (C1515Y): Genotypes: GG 95 (86%) 10 (91%) 80 (89%) 5 (56%) AA 1 (1%) 1 (11%) GA 14 (13%) 1 (9%) 10 (11%) 3 (33%) Allelic frequency: A-allele 16 (6%) 1 (5%) 10 (5%) 5 (28%) 4) MDR1 n ϭ 110 (100%) n ϭ 17 (100%) n ϭ 77 (100%) n ϭ 16 (100%) Alleles (2n) 220 (100%) 34 (100%) 154 (100%) 32 (100%) a) ABCB1 3435C>T: Genotypes: CC 23 (21%) 3 (18%) 16 (21%) 4 (25%) TT 28 (25%) 4 (24%) 20 (26%) 4 (25%) CT 59 (54%) 10 (58%) 41 (53%) 8 (50%) Allelic frequency: T-allele 115 (52%) 18 (53%) 81 (53%) 16 (50%) b) ABCB1 2677G>T/A (A893S/T): Genotypes: GG 31 (28%) 6 (35%) 20 (26%) 5 (31%) TT 21 (19%) 5 (29%) 15 (20%) 1 (6%) AA 1 (1%) 1 (6%) GT 48 (44%) 4 (24%) 35 (45%) 9 (56%) GA 4 (4%) 3 (4%) 1 (6%) TA 5 (5%) 1 (6%) 4 (5%) Allelic frequency: T/A-allele 95/11 (43%/5%) 15/3 (44%/9%) 69/7 (45%/5%) 11/1 (34%/3%) AIndividuals with phenotype low expressors (Ͻmean-1SD) and very low (Ͻmean-2SD) transporter expression levels. Login to comment
147 Among the three ABCC2 polymorphisms, the 1286GϾA (V417I) was not associated with different MRP2 expression phenotypes (Table 3). Login to comment

PMID: 17001288 [PubMed] Owen A et al: "Pharmacogenetics of HIV therapy."

No. Sentence Comment

171 Pharmacogenetics of HIV therapy Owen et al. 699 Table 1 Polymorphisms that have been studied within the context of metabolism, transport and toxicity (but not progression and response) along with the reference ID (where available), the genotypic consequence and the observed phenotype for antiretroviral drugs Gene SNP (haplotype) Reference SNP Genotypic consequence Phenotypic consequence Confirmation CYP3A4 A - 392G (CYP3A4*1B) rs2740574 Promoter; altered expression No effect on nelfinavir or efavirenz Yes for nelfinavir; controversial for efavirenz T878C (CYP3A4*18) rs4986909 L293P; altered activity No effect on efavirenz No CYP3A5 A6986G (CYP3A5*3) rs776746 Splice defect No effect on nelfinavir, saquinavir or efavirenz AUC but altered urinary metabolic ratio of saquinavir Yes for efavirenz G14690A (CYP3A5*6) rs10264272 Splice defect No effect on nelfinavir or efavirenz Yes CYP2C19 G681A (CYP2C19*2) rs4244285 Truncated protein Higher nelfinavir AUC and trend toward decreased virological failure; no effect on efavirenz Yes for efavirenz; controversial for nelfinavir CYP2D6 A2549del (CYP2D6*3) NT21914757 Frameshift Trend to higher plasma levels of nelfinavir and efavirenz No G1846A (CYP2D6*4) rs3892097 Splice defect Trend to higher plasma levels of nelfinavir and efavirenz No T1707del (CYP2D6*6) rs5030655 Frameshift Higher plasma nelfinavir concentrations No CYP2B6 G516 T (CYP2B6*6, *7, *9, *13, *19 and *20) rs3745274 Q172H Higher plasma and intracellular efavirenz AUCs and increased neurotoxicity Yes, numerous studies C1459T (CYP2B6*5 and *7) rs3211371 R487C No effect on nelfinavir or efavirenz No ABCB1 IVS1 - 80delG rs3214119 N/A No influence on cellular nelfinavir No A61G rs9282564 N21D No influence on cellular nelfinavir No TAG1 rs3789243 N/A No influence on cellular nelfinavir No G1199A rs2229109 S400N No influence on cellular nelfinavir No TAG5 rs1128503 N/A No influence on cellular nelfinavir No TAG6 rs2235046 N/A No influence on cellular nelfinavir No IVS21 + T49C rs2032583 N/A No influence on cellular nelfinavir No C3435T rs1045642 Synonymous Some evidence of an influence on plasma and intracellular nelfinavir; decreased efavirenz plasma concentrations; currently under debate; increase in HDL cholesterol with efavirenz Controversial G2677T rs2032582 Ala893Ser No effect on efavirenz, ritonavir, nelfinavir, indinavir or viral decay and CD4 count Yes IVS26 + T59G rs2235047 N/A No influence on cellular nelfinavir No IVS26 + T80C rs2235048 N/A Increased intracellular nelfinavir concentrations No TAG11 rs1186746 N/A No influence on cellular nelfinavir No TAG12 rs1186745 N/A No influence on cellular nelfinavir No ABCC1 G816A P272P No influence on cellular nelfinavir No T825C rs246221 V275V No influence on cellular nelfinavir No T1062C rs35587 Synonymous No influence on cellular nelfinavir No IVS9 + A8G rs35588 N/A No influence on cellular nelfinavir No IVS10 + C64T N/A No influence on cellular nelfinavir No ABCC2 C - 24T rs717620 N/A No influence on cellular nelfinavir No G1249A rs2273697 V417I No influence on cellular nelfinavir No C1436G Synonymous No influence on cellular nelfinavir No IVS16 - G47A N/A No influence on cellular nelfinavir No T3563A rs8187694 V1188E No influence on cellular nelfinavir No C4488T rs8187707 Synonymous No influence on cellular nelfinavir No IVS31 + G12A rs8187708 N/A No influence on cellular nelfinavir No IVS31 + C74T N/A No influence on cellular nelfinavir No G4544A rs8187710 C1515Y No influence on cellular nelfinavir No G + 259T N/A No influence on cellular nelfinavir No ABCG2 - 19571_ - 19568delT- CAC rs4148162 Deletion No influence on cellular nelfinavir No A-19541G N/A No influence on cellular nelfinavir No G34A rs2231137 V12M No influence on cellular nelfinavir No IVS2 + 35G rs4148152 N/A No influence on cellular nelfinavir No C421A rs2231142 Q141K No influence on cellular nelfinavir No APOCIII C-482T Pending Promoter Hyperlipidaemia in presence of ritonavir Yes T-455C Pending Promoter Hyperlipidaemia in presence of ritonavir Yes C3238G rs5128 30 UTR variant Hyperlipidaemia in presence of ritonavir Yes APOE 2060T/2198T (APOEe2) rs429358 R112C/R158C Hyperlipidaemia in presence of ritonavir Yes 2060T/2198C (APOEe3) rs7412 R112C/R158R Hyperlipidaemia in presence of ritonavir Yes TNFa G - 238A rs361525 Promoter Rapid development of lipoatrophy Controversial SPINK-1 C112T rs17107315 N34S Associated with risk of pancreatitis Yes, in general population CFTR G1717 - 1A Splice defect Associated with risk of pancreatitis Yes, in general population IVS8 5T Splice defect Associated with risk of pancreatitis Yes, in general population HLA-B HLA-B*57.1 N/A Abacavir hypersensitivity Yes, but not in all populations HLA-DR HLA-DRB1*0101 N/A Nevirapine hypersensitivity No HSPA1L C2437T rs2227956 M493T Abacavir hypersensitivity No UGT1A1 A(TA)7TAA, - 43_ - 42in- sTA (UGT1A1*28) rs8175347 Promoter; insertion at TATA box Gilberts syndrome, hyperbilirubinaemia in presence of atazanavir and indinavir but not saquinavir Yes MT-CO1 C7028T Synonymous Haplogroup T associated with greater incidence of peripheral neuropathy No 700 Pharmacogenetics and Genomics 2006, Vol 16 No The NNRTI nevirapine can also cause a hypersensitivity syndrome characterized by a rash with systemic symptoms; occasionally liver injury may be part of the clinical picture, or alternatively, may actually be the only manifestation. Login to comment

PMID: 21619426 [PubMed] Stieger B et al: "Pharmacogenetics of drug transporters in the enterohepatic circulation."

No. Sentence Comment

97 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Intestinal efflux transporters (cont.) ABCC2 MRP2 c.1249G>A p.V417I N/A Unchanged [221] c.1249G>A p.S789F N/A Reduced transport protein expression, no change in transport activity [221] c.1249G>A p.A1450T N/A Reduced transport protein expression, no change in transport activity [221] ABCC3 MRP3 c.32G>A p.G11D N/A Unchanged [222] c.1037C>T p.S346F N/A Reduced transport activity [222] c.1820G>A p.S607N N/A Reduced transport activity [222] c.2293G>C p.V765L N/A Unchanged [222] c.2758C>T p.P920S N/A Unchanged [222] c.2768G>A p.R923Q N/A Increased transport activity [222] c.3856G>C p.R1286G N/A Unchanged [222] c.3890G>A p.R1297H 52 Unchanged [131] c.4042C>T p.R1348C N/A Increased transport activity [222] c.4094A>G p.Q1365R N/A Unchanged [222] c.4141C>A p.R1381S N/A Unchanged [222] Liver uptake transporters SLCO1B1 OATP1B1 c.218T>C p.F73L N/A Increased Km , reduced protein synthesis and membrane expression [143] c.245T>C p.V82A N/A [143] c.388A>G p.N130D N/A Increased Km [143] c.455G>A p.R152K N/A [143] c.463C>A p.P155T N/A Unchanged [143] c.467A>G p.E156G N/A [143] c.521T>C p.V174A N/A Decreased Vmax , reduced transport protein expression [143] c.721G>A p.D241N N/A [143] c.1058T>C p.I353T N/A Increased Km , reduced transport protein expression [143] c.1294A>G p.N432D N/A Decreased Vmax [143] c.1385A>G p.D462G N/A Decreased Vmax [143] c.1463G>C p.G488A N/A Reduced intrinsic clearance, reduced transport protein expression [143] c.1964A>G p.D655G N/A Increased Km [143] c.2000A>G p.E667G N/A Unchanged [143] SLCO1B3 OATP1B3 c.334T>G p.S112A N/A Unchanged [223,224] c.439A>G p.T147A N/A Unchanged [223] c.699G>A p.M233I N/A Reduced transport activity, substrate-dependent alteration of Km [223,224] c.767G>C p.G256A N/A Unchanged [223] c.1559A>G p.H520P N/A Reduced transport activity [223] c.1564G>T p.G522C N/A Reduced transport activity [224] c.1679T>C p.V560A N/A Reduced transport activity [223] SLCO2B1 OATP2B1 c.43C>T p.P15S N/A Reduced transport activity [149] c.601G>A p.V201M N/A Reduced transport activity [149] c.1175C>T p.T392I N/A Reduced Vmax [148] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment

PMID: 18176959 [PubMed] Meier Y et al: "Increased susceptibility for intrahepatic cholestasis of pregnancy and contraceptive-induced cholestasis in carriers of the 1331T>C polymorphism in the bile salt export pump."

No. Sentence Comment

59 ABCC2: Three non-synonymous polymorphisms with a potential impact on MRP2 function and expression were chosen for genotyping[25] : 1249G>A variant (V417I, rs2273697), 3563T>A (V1188E, rs17222723) and 4544G>A (C1515Y, rs8187710). Login to comment
82 Table 1 Primers and probes of real-time PCR for allelic discrimination of ABCC2 SNPs in Caucasians cDNA position 1 SNP Exon Amino acid change Eense-/antisense primer Probes 2 1249 G>A 10 V417I 5'-CCAACTTGGCCAGGAAGGA-3'/ VIC 5'-CTGTTTCTCCAACGGTGTA-3' 5'-GGCATCCACAGACATCAGGTT-3' FAM 5'-ACTGTTTCTCCAATGGTGTA-3' 3563 T>A 25 V1188E 5'-GCACCAGCAGCGATTTCTG-3'/ VIC 5'-ACACAATGAGGTGAGGAT-3' 5'-AGGTGATCCAGGAAAAGACACATTT-3' FAM 5'-ACAATGAGGAGAGGAT-3' 4544 G>A 32 C1515Y 5'-GTAATGGTCCTAGACAACGGGAAG-3'/ VIC 5'-AGAGTGCGGCAGCC-3' 5'-CCAGGGATTTGTAGCAGTTCTTCAG-3' FAM 5'-ATTATAGAGTACGGCAGCC-3' 1 cDNA sequence from GenBank accession numbers NM_000392 starting at the ATG; 2 For each SNP two probes were designed and labeled with the fluorescent reporter dyes VIC (allele 1) and FAM (allele 2). Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."

No. Sentence Comment

7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment
7143 The V417I ABCC2 variant is also associated with higher plasma concentrations of mycophenolic acid-acyl glucuronide in Chinese recipients of renal transplants (Zhang et al., 2008b). Login to comment
7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined. Login to comment
7140 The V417I ABCC2 variant is also associated with higher plasma concentrations of mycophenolic acid-acyl glucuronide in Chinese recipients of renal transplants (Zhang et al., 2008b). Login to comment

PMID: 21996082 [PubMed] Shuker N et al: "ATP-binding cassette transporters as pharmacogenetic biomarkers for kidney transplantation."

No. Sentence Comment

867 The following ABCC2 SNPs are the most frequent: -24CNT (located in the 5'-upstream promoter region), a G to A transition at position 1249 (Val to Ile at codon 417) within exon 10, and a silent C to T transition at position 3972 in exon 28. Login to comment

PMID: 22955427 [PubMed] Nishijima T et al: "Single Nucleotide Polymorphisms in ABCC2 Associate With Tenofovir-Induced Kidney Tubular Dysfunction in Japanese Patients With HIV-1 Infection: A Pharmacogenetic Study."

No. Sentence Comment

60 The 14 SNPs selected were (1) ABCC2 (encodes MRP2) -24C → T (in the promoter; rs717620); 1249G → A (Val417Ile; rs2273697); 2366C → T (Ser789Phe; rs56220353); 2934G → A (Ser978Ser; rs3740070), (2) ABCC4 (encodes MRP4) 559G → T (Gly187Trp; rs11568658); 912G → T (Lys304Asn; rs2274407); 2269G → A (Glu757Lys; rs3765534); 3348A → G (Lys1116Lys; rs1751034); 4135T → G [in the 3' untranslated region (UTR); (rs3742106)]; 4976T → C (3' UTR; rs1059751), (3) ABCC10 (encodes MRP10) 526G → A (intron; rs9349256); 2759T → C (Ile920Thr; rs2125739), (4) SLC22A6 (encodes OAT1) 180C → T (Asn60Asn; rs11568630), and (5) ABCB1 (encodes P-glycoprotein) 2677T → A/G (A:Ser893Thr, G:Ser893Ala; rs2032582). Login to comment
84 Genotype Frequencies at ABCC2, ABCC4, ABCC10, SLC22A6, and ABCB1 in Patients With and Without Kidney Tubular Dysfunction Genotype Amino Acid Patients With KTD (n = 19) Patients With Normal Tubular Function (n = 171) P Valuea ABCC2 (MRP2) -24 C → T, rs717620 C/C 18 (94.7) 108 (63.2) C/T 1 (5.3) 52 (30.4) .018 T/T 0 (0) 11 (6.4) 1249 G → A, rs2273697 Val417Ile G/G 11 (57.9) 133 (77.8) A/G 5 (26.3) 34 (19.9) .017 A/A 3 (15.8) 4 (2.3) 2366 C → T, rs56220353 Ser789Phe C/C 19 (100) 167 (97.7) C/T 0 (0) 3 (1.8) 1.000 T/T 0 (0) 1 (0.6) 2934 G → A, rs3740070 Ser978Ser G/G 18 (94.7) 159 (93.0) G/A 1 (5.3) 11 (6.4) 1.000 A/A 0 (0) 1 (0.6) ABCC4 (MRP4) 559 G → T, rs11568658 Gly187Trp G/G 13 (68.4) 133 (77.8) G/T 4 (21.1) 34 (19.9) .126 T/T 2 (10.5) 4 (2.3) 912G → T, rs2274407 G/G 13 (68.4) 102 (59.6) T/G 6 (31.6) 52 (30.4) .461 T/T 0 (0) 17 (9.9) 2269 G → A, rs3765534 Glu757Lys G/G 15 (78.9) 129 (75.4) G/A 2 (10.5) 35 (20.5) .241 A/A 2 (10.5) 7 (4.1) 3348 A → G, rs1751034 Lys1116Lys A/A 13 (68.4) 98 (57.3) A/G 3 (15.8) 58 (33.9) .185 G/G 3 (15.8) 15 (8.8) 4135 T → G, rs3742106 T/T 6 (31.6) 46 (26.9) T/G 7 (36.8) 79 (46.2) .707 G/G 6 (31.6) 46 (26.9) 4976T → C, rs1059751 T/T 6 (31.6) 46 (26.9) T/C 5 (26.3) 86 (50.3) .090 C/C 8 (42.1) 39 (22.8) ABCC10 (MRP7) 526G → A, rs9349256 G/G 4 (21.1) 32 (18.7) A/G 9 (47.4) 65 (38) .569 A/A 6 (31.6) 74 (43.3) Table 2 summarizes the distribution of genotypes at the ABCC2, ABCC4, ABCC10, SLC22A11, and ABCB1 genes in the 2 groups. Login to comment

PMID: 22868256 [PubMed] Cecchin E et al: "A prospective validation pharmacogenomic study in the adjuvant setting of colorectal cancer patients treated with the 5-fluorouracil/leucovorin/oxaliplatin (FOLFOX4) regimen."

No. Sentence Comment

123 Although this association did not pass the FDR cutoff (q-value 0.1109), rs2273697 is a missense polymorphism causing a Val417Ile amino-acid substitution increasing the transporter efficiency.41 Enhanced ABCC2 expression can lead to decreased cellular glutathione content.43 Glutathione is needed for oxaliplatin detoxification via conjugation, and it was reported that low glutathione intra-cellular levels can cause increased oxaliplatin cytotoxicity.40 Moreover, ABCC2 mediates the export of the oxaliplatin-glutathione conjugated form, and ABCC2 overexpressing cells were resistant to platinum derivatives.44 Taken together with our results, ABCC2 variants might change the susceptibility of patients to oxaliplatin toxicity via a glutathione-mediated mechanism. Login to comment

PMID: 22630058 [PubMed] Qu J et al: "ABCC2 polymorphisms and haplotype are associated with drug resistance in Chinese epileptic patients."

No. Sentence Comment

31 Recently, a study found a significant association between ABCC2 V417I polymorphism and reduced oral bioavailability of talinolol [21]. Login to comment

PMID: 22565165 [PubMed] Grover S et al: "Genetic association analysis of transporters identifies ABCC2 loci for seizure control in women with epilepsy on first-line antiepileptic drugs."

No. Sentence Comment

89 - 24C > T 50 UTR k Promoter activity [haplotype containing (- 1549A)-(- 24T)] [33] k mRNA expression [29] m Expression and activity [35] m Expression [haplotype containing (- 24C)-1249A- 3972C] [36] k Expression [haplotype containing (- 24C)- 1249G- 3972T, (-24T)-1249G- 3972C or (-24T)-1249G- 3972T] [36] k Clearance of mycophenolic acid [35] k Clearance of methotrexate [37] k Clearance of irinotecan (ABCC2*2 containing the wild-type C allele) [29] 0.137 5 rs4919395 chr10:101542963 c.33 + 329G > A Intron 1 0.384 6 rs2756104 chr10:101544026 c.34 - 339C > T Intron 1 0.392 7 rs927344 chr10:101544447 c.116T > A Exon 2 (Phe39Tyr) 0.000 8 rs4148385 chr10:101548177 c.207+ 3639C > A Intron 2 0.382 9 rs2180990 chr10:101548974 c.208 - 3017C > G Intron 2 0.392 10 rs35191126 chr10:101549533:34 c.208 - 2458_208 - 2457G > delG Intron 2 0.384 11 rs4148389 chr10:101549911 c.208 - 2080A > G Intron 2 0.396 12 rs2804400 chr10:101553259 c.334 - 49C > T Intron 3 0.394 13 rs2756109 chr10:101558746 c.868 - 218T > G Intron 7 0.364 14 rs7080681 chr10:101560169 c.1058G > A Exon 9 (Arg353His) 0.000 15 rs2273697 chr10:101563815 c.1249G > A Exon 10 (Val417Ile) m mRNA expression [38] m Expression [haplotype containing (- 24C)-1249A- 3972C] [36] k Expression [haplotype containing (- 24C)- 1249G- 3972T, (-24T)-1249G- 3972C or (-24T)-1249G- 3972T] [36] k Clearance of irinotecan (ABCC*2 containing G allele) [34] 0.271 16 rs113646094 chr10:101564012 c.1446C > G Exon 10 (Thr482Thr) m mRNA expression [39] 0.002 17 rs2073337 chr10:101567426 c.1668 + 148A > G Intron 12 0.388 18 rs2756114 chr10:101569483 c.1816 - 408T > C Intron 13 0.393 19 rs3740074 chr10:101571528 c.1967+ 169T > C Intron 15 0.368 20 rs4148394 chr10:101572343 c.1968 - 432A > C Intron 15 0.206 21 rs3740072 chr10:101577123 c.2153A > G Exon 17 (Asn718Ser) 0.000 22 rs56199535 chr10:101578577 c.2302C > T Exon 18 (Arg768Trp) 0.000 23 rs56220353 chr10:101578641 c.2366C > G/T Exon 18 (Ser789Cys/Phe) k Activity, k expression and impaired membrane localization [40] 0.000 24 rs2002042 chr10:101587931 c.2621 - 2133C > T Intron 19 0.204 25 rs11442349 chr10:101589215:16 c.2621 - 849_2621 - 848T > delT Intron 19 0.375 26 rs3740071 chr10:101590120 c.2677C > G Exon 20 (Gln893Glu) 0.000 27 rs7898096 chr10:101593385 c.3259 -752G > A Intron 23 0.000 28 rs17216345 chr10:101594274 c.3396T > C Exon 24 (Ile1132Ile) 0.027 29 rs72558200 chr10:101595882 c.3449 G > A Exon 25 (Arg1150His) 0.000 30 rs72558201 chr10:101595950 c.3517 A > T Exon 25 (Ile1173Phe) 0.000 31 rs8187692 chr10:101595975 c.3542G > T Exon 25 (Leu1181Arg) 0.000 32 rs17222723 chr10:101595996 c.3563T > A Exon 25 (Val1188Glu) m Expression [41] 0.016 ABCC2 polymorphism and response to AEDs Grover et al. 451 or liver functioning. Login to comment

PMID: 22318656 [PubMed] Deo AK et al: "Interindividual variability in hepatic expression of the multidrug resistance-associated protein 2 (MRP2/ABCC2): quantification by liquid chromatography/tandem mass spectrometry."

No. Sentence Comment

7 In contrast, the single nucleotide polymorphism 21214G>A (V417I; rs2273697) was associated with significantly higher hepatic MRP2 expression. Login to comment
85 Genotyping revealed polymorphisms for ABCC2 at the following sites: 1846AϾT(Y39F; rs927344), 21214GϾA(V417I; rs2273697), -24CϾT (rs717620), 36351TϾG(L849R; rs45494393), 53395TϾA(V1188E; rs17222723), 61606CϾT(I1324I; rs3740066), SNP-1 - - + - - - + - - + - - + - - - - - + - - - - - + - - + - - - - - - - - - + + - - + - - - - - - + + - SNP-2 - - - - - - - - - - - - - - - - - - - - - - - - - - - - + - - - - - - - - - - - + - - - - - - - - + - SNP-3 - - - + + - - - - - - - - + + + - - + + - - + + - - - - - - + - - + + + - + - + - - - + - - - + + - - 0.00 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00 4.50 HL102 HL103 HL105 HL106 HL111 HL112 HL113 HL114 HL115 HL119 HL127 HL129 HL132 HL137 HL139 HL152 HL155 HL157 HL167 HL168 HL171 HL172 Average HL104 HL109 HL120 HL126 HL128 HL133 HL135 HL142 HL144 HL150 HL151 HL153 HL156 HL158 HL159 HL162 HL163 HL165 Average HL125 HL136 HL138 HL146 Average HL143 HL145 HL147 HL149 HL166 Average HL141 HL140 MRP2protein(fmol/ugprotein) A Acute injury FaƩy FibroƟc Normal B FIG. 2. Login to comment
88 SNP-1, SNP-2, and SNP-3 represent -24CϾT (rs717620), 68693GϾA(C1515Y; rs8187710) and 21214GϾA(V417I; rs2273697), respectively. Login to comment
95 However, Meier et al. (2006) have shown that this SNP is associated with increased MRP2 expression. It is noteworthy that the SNP 21214GϾA (V417I; rs2273697; 16 heterozygotes, 2 homozygotes), which has not been reported to affect MRP2 expression, showed a significantly (P Ͻ 0.004) higher expression of MRP2 (1.87 Ϯ 0.77 fmol/␮g membrane protein; n ϭ 18) versus the wild-type livers (1.34 Ϯ 0.38 fmol/␮g membrane protein; n ϭ 27). Login to comment

PMID: 21887680 [PubMed] Windsor RE et al: "Germline genetic polymorphisms may influence chemotherapy response and disease outcome in osteosarcoma: a pilot study."

No. Sentence Comment

44 3R adverse prognosis in ALL.45 ABC efflux ABCB1 (MDR1) 7q21.12 MAP 1128503 1236C>T Gly412 Gly T allele : exposure to doxorubicin in breast cancer patients.4 No association in platinum-treated ovarian cancer.5 1045642 3435C>T Ile145 Ile CC : response to platinum chemotherapy in NSCLC.6 No association in platinum-treated ovarian cancer.5 ABCG2 (BCRP) 4q22.1 MAP 2231142 421C>A Gln141 Lys A ; OS in platinum-treated lung cancer.7 No association in platinum-treated ovarian cancer.5 ABCC1 (MRP1) 6p13.11 M 246240 A>G G ; methotrexate toxicity in psoriasis.8 3784862 A>G ABCC2 10q24.2 M 717620 24C>T T : response to platinum chemotherapy in NSCLC.9 No association in ovarian cancer.5 2273697 1249G>A Val417 Ile No association with response to platinum chemotherapy in NSCLC.9 17222723 3563T>A Val1188 Glu A : acute ACT, in 100% LD with Cis1515 Tyr.10 8087710 4544G>A Cis1515 Tyr DNA repair ERCC1 19q13.32 A, P 3212986 1510C>A (8092C>A)* Clinical effects conflicting. Login to comment

PMID: 22112610 [PubMed] Tian C et al: "Common variants in ABCB1, ABCC2 and ABCG2 genes and clinical outcomes among women with advanced stage ovarian cancer treated with platinum and taxane-based chemotherapy: a Gynecologic Oncology Group study."

No. Sentence Comment

4 Sequenom iPLEXTMGOLD Assay and MALDI-TOF platform were used to genotype the non-synonymous G2677T/A (rs2032582; encoding Ala893Ser/Thr) and synonymous C3435T (rs1045642; encoding Ile1145Ile) variants in ABCB1, the non-synonymous G1249A variant in ABCC2 (rs2273697; encoding Val417Ile), and the non-synonymous C421A variant in ABCG2 (rs2231142; encoding Q141K, Gln141Lys) in normal DNA from up to 511 women in Gynecologic Oncology Group (GOG) phase III trials, GOG-172 or GOG-182. Login to comment
143 The G1249A polymorphism encodes Val417Ile, and one study reported that this polymorphism was associated with a higher activity of the intestinal transporter [50]. Login to comment

PMID: 22041137 [PubMed] Kiyotani K et al: "Pharmacogenomics of tamoxifen: roles of drug metabolizing enzymes and transporters."

No. Sentence Comment

74 Recent SNP screening for the ABCC2 gene identified several common SNPs such as %1774delG ¤*1A¥, %24ChT ¤*1C¥ and 1249GhA ¤*2¥.80,81¥ No functional significance of 1249GhA causing Val417Ile has been shown in vitro,82,83¥ but its in vivo association was reported.84¥ %1774delG and %24ChT are associated with reduction of its promoter activity.82,85¥ In our recent study, an intronic SNP of ABCC2 ¤rs3740065¥ was found to be significantly associated with the clinical outcome of patients with tamoxifen therapy, whereas this SNP was not associated with plasma concentration of endoxifen or 4-hydroxytamoxifen, suggesting that the contribution of ABCC2 to biliary excretion of tamoxifen and its metabolites might be limited ¤Fig. 2¥.38¥ An in vitro study reporting that ABCC2 was expressed at higher levels in tamoxifen-resistant breast cancer cells suggests the possibility that active metabolites of tamoxifen are transported by ABCC2 from breast cancer cells.86¥ As described previously,87,88¥ rs3740065A/G is in strong linkage disequilibrium ¤r2 (c) 0.89¥ with %1774G/ delG, which was reported to be associated with decreased ABCC2 promoter activity. Login to comment

PMID: 22178260 [PubMed] Kim SH et al: "Polymorphisms in drug transporter genes (ABCB1, SLCO1B1 and ABCC2) and hepatitis induced by antituberculosis drugs."

No. Sentence Comment

48 Gene (chromosome) Reference SNP ID Position SNP name Chromosome position (dbSNP build 126) Minor allele frequency HWE p-value ABCB1 (7q21.1) rs10261685 Promoter À114918T > G 86989069 0.408 0.639 rs17149694 Exon 27 T1141S (T > A) 86783310 0.122 1 rs1045642 Exon 27 I1145I (T > C) 86783296 0.119 1 SLCO1B1 (12p12.2) rs4149013 Promoter À12095A > G 24844102 0.202 0.391 rs4149014 Promoter À11556G > T 24844641 0.288 0.799 rs11835045 Promoter À10690C > T 24845507 0.071 1 rs2306283 Exon 5 D130N (G > A) 24891397 0.195 0.929 rs4149056 Exon 6 A174V (T > C) 24893202 0.155 0.463 ABCC2 (10q24) Novel Promoter À1774del > G 101672054 0.381 1 rs1885301 Promoter À1549G > A 101672279 0.293 1 rs717620 Promoter À24C > T 101673804 0.267 0.399 rs2804400 Intron IVS3-49C > T 101684485 0.290 1 rs2273697 Exon 10 V417I (G > A) 101695041 0.066 0.580 rs3740070 Exon 22 S978S (G > A) 101722644 0.050 0.436 rs3740066 Exon 28 I1324I (C > T) 101735433 0.292 0.503 Polymorphisms selected for genotyping are indicated in bold. Login to comment
56 Of the 12 SNPs screened in ABCC2, seven SNPs (À1774del > G, À1549G > A, À24C > T, IVS3-49C > T, V417I G > A, S978S G > A, I1324I C > T) had a frequency >2.0% in healthy subjects and were genotyped in our study subjects. Login to comment
72 Gene SNP Genotype Hepatitis (N ¼ 67) Control (N ¼ 159) P value ABCB1 À114918T > G TT 56 (72.2%) 130 (81.8%) NS TG 9 (22.2%) 29 (18.2%) GG 1 (5.6%) 0 (0.0%) I1145I CC 27 (40.9%) 68 (42.9%) NS CT 31 (47.0%) 69 (41.8%) TT 8 (12.1%) 20 (15.3%) SLCO1B1 À12095A > G AA 43 (65.2%) 115 (74.2%) NS AG 23 (34.8%) 35 (22.6%) GG 0 (0.0%) 5 (3.2%) À11556G > T TT 38 (57.6%) 83 (53.2%) NS TG 23 (34.9%) 64 (41.0%) GG 5 (7.6%) 9 (5.8%) D130N GG 33 (50.8%) 85 (54.5%) NS GA 26 (40.0%) 60 (38.5%) AA 6 (9.2%) 11 (7.0%) A174V TT 46 (69.7%) 113 (72.4%) NS TC 20 (30.3%) 40 (25.6%) CC 0 (0.0%) 3 (1.9%) ABCC2 À1774del > G GG 25 (37.9%) 43 (27.4%) NS G/- 33 (50.0%) 94 (59.9%) À/À 8 (12.1%) 20 (12.7%) À1549G > A GG 34 (51.5%) 89 (57.1%) NS GA 27 (40.9%) 60 (38.5%) AA 5 (7.6%) 7 (4.5%) À24C > T CC 38 (52.6%) 92 (59.4%) NS CT 26 (39.4%) 57 (36.8%) TT 2 (3.0%) 6 (3.9%) IVS3-49C > T CC 34 (50.8%) 91 (57.2%) NS CT 29 (43.3%) 61 (38.4%) TT 4 (6.0%) 7 (4.4%) V417I GG 61 (92.4%) 134 (84.3%) NS GA 5 (7.6%) 23 (14.5%) AA 0 (0.0%) 2 (1.3%) S978S GG 61 (92.4%) 147 (92.5%) NS GA 5 (7.6%) 12 (7.6%) AA 0 (0.0%) 0 (0.0%) I1324I CC 35 (53.0%) 91 (58.3%) NS CT 26 (39.4%) 56 (35.9%) TT 5 (7.6%) 9 (5.8%) NS, not significant. Login to comment

PMID: 21799461 [PubMed] Ufer M et al: "Impact of ABCC2 genotype on antiepileptic drug response in Caucasian patients with childhood epilepsy."

No. Sentence Comment

102 Previously, the ABCC2 1249G > A (Val417Ile) polymorphism has been shown to be associated with lower oral bioavailability and increased clearance of the ABCC2 substrates, talinolol [16] and irinotecan in vivo [30], suggesting increased efflux activity of variant allele carriers. Login to comment

PMID: 21691255 [PubMed] Megaraj V et al: "Functional analysis of nonsynonymous single nucleotide polymorphisms of multidrug resistance-associated protein 2 (ABCC2)."

No. Sentence Comment

2 Objectives To characterize the transport function of human wild-type (WT) MRP2 and four SNP variants, S789F, A1450T, V417I, and T1477M. Login to comment
7 V417I showed decreased apparent affinity for LTC4, E23G, and E217G, whereas transport was similar between wild-type (WT) and T1477M, except for a modest increase in TUDC transport. Login to comment
10 V417I in membrane spanning domain 1 selectively decreased the apparent affinity for the glutathione and glucuronide conjugated substrates, whereas the T1477M SNP in the carboxyl terminus altered only TUDC transport. Login to comment
48 Construction of recombinant baculovirus containing multidrug resistance protein 2 The plasmid (pEF6/V5-His-TOPO; Invitrogen) containing the WT MRP2 (NM_000392) or its SNP variants S789F, A1450T, V417I, and T1477M, was used to create the MRP2 baculovirus expression vector. Login to comment
49 The pENTR 4 vector (Invitrogen) was mutated to generate a Hind III site using Quik Change II site-directed mutagenesis Kit (Stratagene; La Jolla, California, USA) using primers Hind IIIF and Hind IIIR (Hind IIIF: AGGCTCCAC- CATGGGAAGCTTCAGTCGACTGGATC; Hind IIIR: Table 1 Nucleotide sequence of variants in MRP2 leading to amino acid changes in multidrug resistance-associated protein 2 and their allelic frequencya SNP position Amino acid change Exon Location Allelic frequency Functional consequencesb C2366T S789F 18 NBD1 (D loop) 0.01 (Japanese) 52 G4348A A1450T 31 NBD2 (immediately after the ABC signature motif) 0.01 (Japanese) 52 G1249A V417I 10 MSD1 (between transmembrane helices 7 and 8) 0.125/0.312/0.184 (Japanese/Iranian/Moroccan) 27,46,47,52,58,59 C4430T T1477M 31 Carboxy terminal 0.006 (Japanese) MSD, membrane-spanning domain; NBD, nucleotide-binding domain; SNP, single nucleotide polymorphism. Login to comment
56 The pENTR4M containing the WT, S789F, A1450T, V417I, and T1477M SNPs were sequenced (MWG Biotech, Inc., Huntsville, Alabama, USA). Login to comment
95 V417I located in MSD1 is reported to have a much higher allelic frequency in several different populations and is frequently associated with adverse drug reactions in humans [27,28]. Login to comment
97 Protein expression of wild-type multidrug resistance-associated protein 2 and single nucleotide polymorphism variants in Sf9 cells WT MRP2 and the SNP variants S789F, A1450T, V417I, and T1477M were expressed in Sf9 cells using recombinant baculovirus. Login to comment
102 However, there was no significant difference in the expression of V417I in MSD1 or of A1450T in NBD2 compared with WT MRP2 (Fig. 1b). Login to comment
108 LTC4 and E23G were transported with classic Michaelis-Menten kinetics by WT MRP2; however, E217G and TUDC demonstrated positive Fig. 1 8000 6000 4000 Density(%)INT/mm2 2000 0 T1477M * V417IA1450TS789F * WTEV 185 KD EV WT S789F A1450T V417I T1477M (a) (b) Expression of WT multidrug resistance-associated protein 2 (MRP2) and its variants in Sf9 plasma membranes. Login to comment
122 The V417I SNP, located in MSD1 between the seventh and eighth transmembrane helices, showed a 2-3-fold increased Km for LTC4 and E217G. Login to comment
124 Interestingly, the V417I SNP also abolished the positive cooperativity in E217G transport, decreasing the HC from 2.2 to 1.1. Login to comment
127 Isolated plasma membrane preparations of Sf9 cells expressing WT MRP2 showed a high capacity, drug-stimulated ATPase activity (Fig. 3a), as reported Fig. 2 2000 (a) (b) (c) (d) 1000 ATP-dependent3 H-LTC4 transport(pmol/min/mg) 0 0 5 10 LTC4 (μmol/l) 15 20 4000 1000 2000 3000 ATP-dependent3 H-E217G transport(pmol/min/mg) 0 0 100 200 E217G (μmol/l) 300 200 400 600 ATP-dependent3H-TUDC transport(pmol/min/mg) 0 0 100 200 TUDC (μmol/l) 300 2000 1000 ATP-dependent3 H-E23G transport(pmol/min/mg) 0 0 250 500 E23G (μmol/l) 750 1000 WT S789F V417I T1477MA1450T ATP-dependent transport of wild-type (WT) and multidrug resistance-associated protein 2 single nucleotide polymorphism variants in Sf9 plasma membrane vesicles. Login to comment
136 Four SNPs were selected for characterization, one in each of the two NBDs (S789F in NBD1 and A1450T in NBD2), one in MSD1 (V417I), and one in the carboxy terminal (T1477M), to probe how changes in these portions of MRP2 protein might impact its transport properties. Login to comment
149 The V417I SNP, located in MSD1, was found to have decreased apparent affinity for LTC4, E23G, and E217G, but not for TUDC. Login to comment
150 These data imply that valine 417 plays a critical and selective role in binding of glutathione Table 2 Kinetic parameters for transport of substrates by wild-type multidrug resistance-associated protein 2 and four single nucleotide polymorphism variants Substrates Kinetic parameters WT S789F A1450T V417I T1477M LTC4 Km 4 (1.8-6.5) 3 (1.8-4.4) 3 (2-3.6) 9 (7.8-12.7)* 6 (3.5-9) Vmax 1464 (1314-1713) 732 (648-816)* 658 (618-699)* 1366 (1200-1531) 1659 (1373-1945) E23G Km 103 (73-133) 235 (173-296)* 106 (64-148) 212 (95-330) 172 (88-230) Vmax 1458 (1339-1578) 615 (558-671)* 855 (746-964)* 1794 (1454-2134) 1157 (975-1338)* E217bG Km 84 (64-104) 72 (67-76) 88 (75-100) 263 (241-285)* 94 (89-100) Vmax 3154 (2691-3617) 1799 (1732-1866)* 2665 (2422-2907) 2647 (2520-2773) 2646 (2555-2737) HC 2.2 (1.4-3) 2.4 (2.1-2.6) 2 (1.6-2.4) 1.1 (1.1-1.2)* 1.8 (1.7-1.9) TUDC Km 71 (65-78) 64 (71-96) 71 (57-86) 74 (70-79) 109 (103-116)* Vmax 595 (563-627) 359 (343-376)* 424 (376-472)* 577 (553-600) 671 (645-699)* HC 2 (1.7-2.3) 2.3 (1.9-2.6) 1.8 (1.3-2.3) 2.6 (2.3-2.8) 2.2 (2-2.4) The kinetic parameters [Km (mmol/l); Vmax (pmol/mg/min); HC] of ATP-dependent transport of LTC4, E23G, E217G, and TUDC were determined in Sf9 plasma membrane vesicles. Login to comment
159 V417I also significantly reduced the HC for E217G from 2.2 in WT MRP2 to 1.1 (Fig. 2c; Table 2). Login to comment
162 Our data showing increased apparent Km values for three glucuronide or glutathione conjugate substrates by V417I could be of clinical relevance since this is a common SNP in the population, and has been detected at frequencies of more than 20% in Caucasians and somewhat less in Japanese subjects (Table 1) [16]. Login to comment
164 The V417I SNP was also suggested to play a role in altered pharmacokinetics of talinolol, resulting in its lowered oral bioavailability and increased clearance after intravenous administration [47]. Login to comment
165 However, in population studies of MRP2 haplotypes, V417I was not found to associate with cholestatic or toxic hepatitis [48], and there was no effect on MRP2 protein expression in liver [49] or on serum-conjugated bilirubin levels in individuals with this SNP [16]. Login to comment
190 Hirouchi et al. [52] also characterized the expression and transport activity of several MRP2 variants (V417I, S789F, A1450T) using a Tet-off recombinant adenovirus system in LLC-PK1 cells. Login to comment
191 However, these researchers did not detect any change in transport of E217G, LTC4, or 2,4-dinitrophenyl-S-glutathione by SNP V417I after normalization for expression levels, and further found that transport of these substrates was increased by S789F. Login to comment
199 V417I selectively inhibited the transport of glutathione and glucuronide-conjugated substrates, whereas T1477M only altered the transport of TUDC, a hydrophilic bile acid. Login to comment
204 These data indicate that closer evaluation of the role of these MRP2 SNPs in haplotype analyses or genome-wide association studies of adverse drug reactions and/or disease is warranted, as is careful monitoring of patients with the relatively frequent MRP2 SNP, V417I. Login to comment

PMID: 21451505 [PubMed] Franke RM et al: "Effect of ABCC2 (MRP2) transport function on erythromycin metabolism."

No. Sentence Comment

55 (b) Correlation of observed 14CO2 production over the course of 1 h from the same patients, with predicted values obtained from a binomial equation originally derived from data obtained in healthy volunteers.23 Table 1 Description and allele frequencies of the investigated ABCC2 variants ABCC2 genotype Position Effecta Functionb NCBI ID p q ABCC2 -1549G>A 5'-Flanking - Unknown rs1885301 0.843 0.157 ABCC2 -1019A>G 5'-Flanking - Unknown rs2804402 0.617 0.383 ABCC2 -24C>T 5' UTR - Decreased rs717620 0.832 0.168 ABCC2 1249G>A Exon 10 V417I Unknown rs2273697 0.791 0.209 ABCC2 IVS26 -34T>C Intron 26 Exon 26 Unknown rs8187698 0.939 0.061 ABCC2 3972C>T Exon 28 I1324I Unknown rs3740066 0.640 0.360 ABCC2 4544G>Ac Exon 32 C1515Y Unknown rs8187710 0.971 0.029 Hardy-Weinberg notation for allele frequencies. Login to comment

PMID: 20943283 [PubMed] Han B et al: "Association of ABCC2 polymorphisms with platinum-based chemotherapy response and severe toxicity in non-small cell lung cancer patients."

No. Sentence Comment

81 patients 445 Mean age in years (S.D.) 57 ≤57 years-old 226 (50.8) >57 years-old 219 (49.2) Gender Male 317 (71.2) Female 128 (28.8) Performance status (PS) (n = 444) 0-1 427 (96.0) 2 17(4.0) TNM stage IIIA 43(9.7) IIIB 131 (29.4) IV 271 (60.9) Histologic type Adenocarcinoma 269 (60.4) Squamous cell 88(19.8) Adenosquamocarcinoma 16(3.6) Othersa 72(16.2) Chemotherapy regimens Platinum-vinorelbine 233 (52.4) Platinum-gemcitabine 77(17.3) Platinum-paclitaxel 90 (20.2) Platinum-docetaxel 22(4.9) Other platinum combinations 23(5.2) ABCC2 C-24T C/C 266 (60.3) C/T 159 (36.1) T/T 16(3.6) ABCC2 G1249A (V417I) G/G 353 (81.0) A/G 76(17.4) A/A 7(1.6) ABCC2 C3972T (I1324I) C/C 262 (59.5) C/T 157 (35.7) T/T 21(4.8) a Other carcinomas include mixed cell, neuroendocrine carcinoma or undifferentiated carcinoma. Login to comment
109 ABCC2 genotype Responder (CR + PR), n (%) Non-responder (SD + PD), n (%) OR (95% CI)a P-value C-24T 0.032 C/C 55(72.4) 196 (58.3) 1.00 (reference) C/T + T/T 21(27.6) 140 (41.7) 1.84 (1.05-3.23) G1249A (V417I) 0.308 G/G 64(83.8) 267 (80.2) 1.00 (reference) A/G + A/A 12(16.2) 66(19.8) 1.44 (0.72-2.89) C3972T (I1324I) 0.137 C/C 49(67.1) 196 (58.0) 1.00 (reference) C/T + T/T 24(32.9) 142 (42.0) 1.51 (0.88-2.61) Abbreviation: PS, performance status. Login to comment
112 ABCC2 genotype Any grade 0-2 thrombocytopenia toxicity, n (%) Any grade 3 or 4 thrombocytopenia toxicity, n (%) OR (95% CI)a P-Valuea C-24T 0.074 C/C 235 (60.9) 11(42.3) 1.00 (reference) C/T + T/T 151 (39.1) 15(57.7) 2.09 (0.93-4.70) G1249A (V417I) G/G 306 (80.3) 23(88.5) 1.00 (reference) 0.309 A/G + A/A 75(19.7) 3(11.5) 0.59 (0.17-2.11) C3972T (I1324I) 0.034 C/C 232 (60.3) 10(38.5) 1.00 (reference) C/T + T/T 153 (39.7) 16(61.5) 2.43 (1.06-5.56) a Data were calculated by unconditional logistic regression, adjusted for performance status and type of treatment regime. Login to comment

PMID: 20351751 [PubMed] Laechelt S et al: "Impact of ABCC2 haplotypes on transcriptional and posttranscriptional gene regulation and function."

No. Sentence Comment

30 Genotyping After isolation of DNA according to manufacture`s instruction (DNeasy Tissue kit, Qiagen, Hilden, Germany) SK-Hep 1, A-498 and Caco-2 cells were genotyped for the polymorphisms À24C4T (rs717620), À23G4A (rs17216156), 1249G4A (V417I, rs2273697) and 3972C4T (I1324I, rs3740066) by pyrosequencing (PSQ) using the PSQ96HS system (Biotage, Uppsala, Sweden) following a standard protocol as described before.9 Primers were created by the Assay Design software version 1.0 (Biotage). Login to comment

PMID: 20071452 [PubMed] Karlsson JE et al: "High-activity p-glycoprotein, multidrug resistance protein 2, and breast cancer resistance protein membrane vesicles prepared from transiently transfected human embryonic kidney 293-epstein-barr virus nuclear antigen cells."

No. Sentence Comment

160 NM_000392 for BCRP, P-gp, and MRP2, respectively) with the exception of MRP2 for which the amino acid change V417I was observed. Login to comment

PMID: 20216337 [PubMed] Kim WJ et al: "A nonsynonymous variation in MRP2/ABCC2 is associated with neurological adverse drug reactions of carbamazepine in patients with epilepsy."

No. Sentence Comment

5 Results A nonsynonymous polymorphism, c.1249G > A (p.V417I, rs2273697), showed a strong association with the neurological ADR caused by carbamazepine (P = 0.005). Login to comment
36 Here, we provide evidence that carbamazepine is a substrate of MRP2, and the V417I (c.1249G > A) nonsynonymous polymorphism in the human MRP2 gene is associated with CNS ADRs of carbamazepine. Methods Participants In the initial exploratory stage of the study, a total of 146 patients with epilepsy who had been prescribed carbamazepine from March 2004 to February 2006 at epilepsy clinics in Sinchon and Yongdong Severance Hospital, Seoul, Korea, were enrolled after giving informed consent. Login to comment
84 Of the five tag SNPs, the MRP2 c.1249G > A (p.V417I, rs2273697) polymorphism showed a strong association with CNS ADR. Login to comment
94 As MRP2 c.1249G > A (p.V417I, rs2273697) showed an association with CNS ADR of carbamazepine, this SNP was regenotyped in a larger independent set of cohort and the association was reevaluated (Table 4). Login to comment
102 Functional evaluation of the MRP2 c.1249G > A variant c.1249G > A is a nonsynonymous variation that causes substitution of a valine with an isoleucine at position 417. Login to comment
103 Earlier, it has been shown that the V417I variation did not greatly affect protein expression levels and membrane transport of CF, a standard substrate of MRP2 [13,24]. Login to comment
108 - 24C > T rs717620 C 0.809, 0.763 0.379 c.1249G > A (p.V417I) rs2273697 A 0.149, 0.061 0.013* c.2934G > A (p.S978S) rs3740070 G 0.968, 0.965 0.880 c.3972C > T (p.I1324I) rs3740066 C 0.798, 0.732 0.225 P values were obtained by comparing the CNS ADR Yes and No groups using the Pearson`s w2 or Fisher`s exact test (expected cell value < 5). Login to comment
117 - 24C > T C/C 74 (67.3) 30 (63.8) 61 (61.6) 0.284 rs717620 C/T 34 (30.9) 16 (34.0) 29 (29.3) T/T 2 (1.8) 1 (2.1) 9 (9.1) c.1249G > A G/G 92 (83.6) 33 (70.2) 88 (88.9) 0.009* (p.V417I) G/A 15 (13.6) 14 (29.8) 10 (10.1) 0.005*,b rs2273697 A/A 3 (2.7) 0 (0.0) 1 (1.0) c.2934G > A G/G 100 (90.9) 44 (93.6) 92 (92.2) > 0.999 (p.S978S) G/A 9 (8.2) 3 (6.4) 7 (7.1) rs3740070 A/A 1 (0.9) 0 (0.0) 0 (0.0) c.3972C > T C/C 61 (55.5) 29 (61.7) 56 (56.6) 0.234 (p.I1324I) C/T 47 (42.7) 17 (36.2) 33 (33.3) rs3740066 T/T 2 (1.8) 1 (2.1) 10 (10.1) P values were obtained by comparing the CNS ADR-Yes and CNS ADR-No groups using the Pearson`s w2 or Fisher`s exact test (expected cell value < 5). Login to comment
132 As an ABC transporter, MRP2 hydrolyzes ATP and liberates inorganic phosphates Table 4 Association study results for c.1249G > A (p.V417I, rs2273697) in MRP2 and CNS ADR caused by carbamazepine Exploratory stage Replication stage Variant CNS ADR-Yes CNS ADR-No CNS ADR-Yes CNS ADR-No Control Genotypes Number of individuals (%) G/G 33 (70.2) 88 (88.9) 55 (74.3) 174 (84.9) 92 (83.6) G/A 14 (29.8) 10 (10.1) 18 (24.3) 30 (14.6) 15 (13.6) A/A 0 (0.0) 1 (1.0) 1 (1.4) 1 (0.5) 3 (2.7) Total 47 (100.0) 99 (100.0) 74 (100.0) 205 (100.0) 110 (100.0) Alleles Number of chromosomes (%) G 80 (85.1) 186 (93.9) 128 (86.5) 378 (92.2) 199 (90.5) A 14 (14.9) 12 (6.1) 20 (13.5) 32 (7.8) 21 (9.5) Total 94 (100.0) 198 (100.0) 148 (100.0) 410 (100.0) 220 (100.0) Pgenotype in minor allele dominant mode, OR (95% CI) 0.005**, 3.40 (1.40-8.23) 0.042*, 1.94 (1.02-3.70) Joint Pgenotype 0.001**, 2.40 (1.43-4.02) Pallele, OR (95% CI) 0.013*, 2.72 (1.20-6.12) 0.041*, 1.85 (1.02-3.34) Joint Pallele 0.002**, 2.10 (1.30-3.37) P values were obtained by comparing the CNS ADR Yes and No groups using the Pearson`s w2 or Fisher`s exact test (expected cell value < 5). Login to comment

PMID: 19568750 [PubMed] Sun N et al: "MRP2 and GSTP1 polymorphisms and chemotherapy response in advanced non-small cell lung cancer."

No. Sentence Comment

4 MRP2 C-24T (¡24C>T), MRP2 Val417Ile (1249G>A), MRP2 Ile1324Ile (3972C>T), and GSTP1 Ile105Val (342A>G) genotype were determined by gene-chip method (a 3-D (three dimensions) polyacrylamide gel-based DNA microarray method) using DNA samples isolated from peripheral blood collected before treatment. Login to comment
96 Table 2 Sequences of primers and probes Locus Primers and probes MRP2 Forward primer: 5Ј-CCTTTACGGAGAACATCAGA-3Ј (C-24T, rs717620) Reverse primer: 5Ј-Acrydite™-TTTGCATTACATTTCCCAGA-3Ј Probe: 5Ј-Cy3-AGTCTTCGTTCCA-3Ј 5Ј-Cy5-AGTCTTTGTTCCA-3Ј MRP2 (Val 417 Ile) Forward primer: 5Ј-TGGAGGCAAGAAGTCACAGT-3Ј (G1249A, rs2273697) Reverse primer: 5Ј-Acrydite™-GATTACAAGCACCATCACCC-3Ј Probe: 5Ј-Cy3-TACACCGTTGGAG-3Ј 5Ј-Cy5-TACACCATTGGAG-3Ј MRP2 (Ile 1,324 Ile) Forward primer: 5Ј-Acrydite™-CACTGCTACCCTTCTCCTGTTC-3Ј (C3972T, rs3740066) Reverse primer: 5Ј-CTGACCCTTTCCCTCCATCC-3Ј Probe: 5Ј-Cy3-GCTACCGATGTCA-3Ј 5Ј-Cy5-GCTACCAATGTCA-3Ј GSTP1 (Ile 105 Val) Forward primer: 5Ј-CAGGGCTCTATGGGAAGGAC-3Ј (A342G, rs1695) Reverse primer: 5Ј-Acrydite™-CAGGAGATCAGAAACCACCAGTT-3Ј Probe: 5Ј-Cy3-AAATACATCTCCC-3Ј 5Ј-Cy5-AAATACGTCTCCC-3Ј Fig. 1 Microarray hybridization scanning patterns of SNPs genotyping. Login to comment
97 A, B, C and D the microarray images of locus MRP2 C-24T, MRP2 Val417Ile, MRP2 Ile1324Ile and GSTP1 Ile105Val; green, yellow and red represent wild, hybrid and mutation type, respectively. Login to comment
116 A signiWcant P value indicates that there is an association between the Table 3 Genotype and response to chemotherapy among NSCLC patients (n = 113) Adjusted OR (95% CI): OR (95% CI) after adjusting for patient gender, age at diagnosis, tumor histology, disease stage, and chemotherapy regimens Genotype Cases Response to chemotherapy OR (95% CI) P value Adjusted OR (95% CI) Adjusted P value CR + PR (%) n = 30 SD + PD (%) n = 83 MRP2 (C-24T) C/C 66 11 (36.7) 55 (66.3) 1 0.015 4.069 (1.518-10.910) 0.005 C/T 43 16 (53.3) 27 (32.5) 2.959 (1.211-7.246) 0.023 10.514 (0.842-131.319) 0.068 T/T 4 3 (10.0) 1 (1.2) 14.925 (1.425-166.667) 0.005 4.493 (1.728-11.682) 0.002 C/T+T/T 47 19 (63.3) 28 (33.7) 3.390 (1.420-8.130) MRP2 (Val417Ile) G/G 84 20 (66.7) 64 (77.1) 1 G/A 26 9 (30.0) 17 (20.5) 1.695 (0.654-4.386) 0.274 1.910 (0.697-5.229) 0.208 A/A 3 1 (3.3) 2 (2.4) 1.600 (0.138-18.519) 0.568 1.616 (0.115-22.779) 0.722 G/A+A/A 29 10 (33.3) 19 (22.9) 1.684 (0.674-4.202) 0.262 1.879 (0.710-4.968) 0.204 MRP2 (Ile1324Ile) C/C 74 20 (66.7) 54 (65.1) 1 C/T 33 8 (26.7) 25 (30.1) 0.864 (0.335-2.227) 0.762 1.066 (0.385-2.951) 0.901 T/T 6 2 (6.7) 4 (4.8) 1.350 (0.229-7.937) 0.665 1.508 (0.210-10.830) 0.683 C/T+T/T 39 10 (33.3) 29 (34.9) 0.931 (0.385-2.252) 0.874 1.133 (0.441-2.911) 0.796 GSTP1 (Ile105Val) A/A 71 13 (43.3) 58 (69.9) 1 A/G 38 15 (50.0) 23 (27.7) 2.907 (1.200-7.042) 0.016 2.788 (1.106-7.029) 0.030 G/G 4 2 (6.7) 2 (2.4) 4.464 (0.574-34.483) 0.176 4.083 (0.457-36.463) 0.208 A/G+G/G 42 17 (56.7) 25 (30.1) 3.030 (1.282-7.194) 0.010 2.881 (1.167-7.113) 0.022 haplotype C-A (MRP2-24C and GSTP1105A) and the treatment response. Login to comment
137 Table 4 Allele frequencies Locus Allele Frequency Standard Error 95% CI MRP2 (C-24T) C 0.7743 0.0265 0.7168-0.8230 T 0.2257 0.0265 0.1770-0.2832 MRP2 (Val417Ile) A 0.1416 0.0238 0.0973-0.1903 G 0.8584 0.0238 0.8097-0.9027 MRP2 (Ile1324Ile) C 0.8009 0.0277 0.7434-0.8540 T 0.1991 0.0277 0.1460-0.2566 GSTP1 (Ile105Val) A 0.7965 0.0263 0.7434-0.8451 G 0.2035 0.0263 0.1549-0.2566 Table 5 Genotype frequencies Locus Genotype Frequency HWD coeV Standard error 95% CI MRP2 (C-24T) C/C 0.5841 ¡0.0155 0.0151 ¡0.0459-0.0149 C/T 0.3805 ¡0.0155 0.0151 ¡0.0459-0.0149 T/T 0.0354 ¡0.0155 0.0151 ¡0.0459-0.0149 MRP2 (Val417Ile) A/A 0.0265 0.0065 0.0126 ¡0.0165-0.0318 A/G 0.2301 0.0065 0.0126 ¡0.0165-0.0318 G/G 0.7434 0.0065 0.0126 ¡0.0165-0.0318 MRP2 (Ile1324Ile) C/C 0.6549 0.0135 0.0163 ¡0.0185-0.0484 C/T 0.2920 0.0135 0.0163 ¡0.0185-0.0484 T/T 0.0531 0.0135 0.0163 ¡0.0185-0.0484 GSTP1 (Ile105Val) A/A 0.6283 ¡0.0060 0.0146 ¡0.0313-0.0218 A/G 0.3363 ¡0.0060 0.0146 ¡0.0313-0.0218 G/G 0.0354 ¡0.0060 0.0146 ¡0.0313-0.0218 Board et al. Login to comment
161 G1249A polymorphism is a G!A base change that results in amino acid alterations from Val to Ile at 417, and 1,249 AA is associated with decreased mRNA [44]; whereas C3972T is the 'silent` mutation at 1,324 (Ile1324Ile). Login to comment

PMID: 19415824 [PubMed] Ufer M et al: "Non-response to antiepileptic pharmacotherapy is associated with the ABCC2 -24C>T polymorphism in young and adult patients with epilepsy."

No. Sentence Comment

27 Recently, we have observed a significant association of the ABCC2 1249G > A (V417I) polymorphism with reduced oral bioavailability of talinolol presumably as a result of increased MRP2 activity [22]. Login to comment

PMID: 19214140 [PubMed] Grisk O et al: "Multidrug resistance-related protein 2 genotype of the donor affects kidney graft function."

No. Sentence Comment

187 Genetic analyses All samples were genotyped for five ABCC2 variants ( - 24C > T, 1249G > A [V417I], 3972C > T, 4544G > A [C1515Y], 3563T > A [V1188E]). Login to comment

PMID: 18509327 [PubMed] Baker SD et al: "Pharmacogenetic pathway analysis of docetaxel elimination."

No. Sentence Comment

42 Visual genotyping of the CYP3A locus We next used the Centre d`Etude du Polymorphisme Humain (CEPH) HapMap samples (http://www.cephb.fr/cephdb/) Table 2 Description and allele frequencies of the studied variants Allele frequencya Gene (allele)b dbSNP ID Region Effectc p q SLCO1B3 334T>G(*2) rs4149117 Exon3 S112A 0.147 0.853 439A>G(*3) N/A Exon4 T147A 0.995 0.005 699G>A(*4) rs7311358 Exon6 M233I 0.159 0.841 767G>C(*5) N/A Exon7 G256A 0.811 0.189 1559A>C(*6) N/A Exon11 H520P 1.00 0 1679T>C(*7) rs12299012 Exon11 V560A 0.984 0.016 CYP3A4 -392A>G(*1B) rs2740574 5'-Flanking - 0.951 0.049 CYP3A5 6986A>G(*3C) rs776746 Intron3 Frameshift 0.076 0.924 ABCB1 1236C>T(*8) rs1128503 Exon12 G412G 0.539 0.461 2677G>T/A(*7) rs2032582 Exon21 A893S/T 0.556 0.422/0.022 3435C>T(*6) rs1045642 Exon26 I1145I 0.478 0.522 ABCC2 -1019A>G rs2804402 5'-Flanking - 0.614 0.386 -24C>T rs717620 5'-UTR - 0.815 0.185 1249G>A rs2273697 Exon 10 V417I 0.789 0.211 IVS26 -34T>C rs8187698 Intron 26 Exon 26 0.946 0.054 3972C>T rs3740066 Exon28 I1324I 0.647 0.353 4544G>Ad rs8187710 Exon32 C1515Y 0.967 0.033 UTR, untranslated region; dbSNP, single-nucleotide polymorphism database. Login to comment

PMID: 18981587 [PubMed] Fujita K et al: "Association of ATP-binding cassette, sub-family C, number 2 (ABCC2) genotype with pharmacokinetics of irinotecan in Japanese patients with metastatic colorectal cancer treated with irinotecan plus infusional 5-fluorouracil/leucovorin (FOLFIRI)."

No. Sentence Comment

40 Six polymorphisms (-1549GϾA, -1023GϾA, -1019AϾG, -24CϾT, 1249GϾA [V417I] and 3972CϾT [I324I], based on assigning the A in the translation start codon as ϩ1) were examined by direct DNA sequencing. Login to comment
88 The presence of the 1249GϾA that causes the amino acid change (V417I) resulted in the lower AUC of irinotecan. Login to comment

PMID: 18418374 [PubMed] Rosner GL et al: "Pharmacogenetic pathway analysis of irinotecan."

No. Sentence Comment

97 Table 3 Associations between the principal components and polymorphisms Polymorphism PC1 PC2 PC3 PC4 PC5 PC6 PC7 PC8 PC9 UGT1A1, -53A(TA)6>7TAA, PROMOTER 0.086/0.5 0.301/0.2 0.007/4.9 0.019/1.8 0.216/0.2 0.009/3.4 0.314/0.2 0.204/0.2 0.123/0.4 UGT1A1, -3279G>T (UGT1A1*60), PBREM 0.021/1.7 0.056/0.7 0.043/0.9 0.027/1.3 0.588/0.1 0.001/24.8 0.482/0.1 0.527/0.1 0.046/0.8 UGT1A1, -3156G>A, PBREM 0.008/4.2 0.136/0.3 0.014/2.6 0.017/2.0 0.322/0.2 0.005/6.7 0.031/1.1 0.268/0.2 0.083/0.5 UGT1A7, 387G>T (N129K), EXON 1 0.007/4.6 0.139/0.3 0.001/26.7 0.050/0.8 0.050/0.8 0.103/0.4 0.116/0.4 0.186/0.3 0.114/0.4 UGT1A7, 622T>C (W208R), EXON 1 0.000/77.5 0.392/0.2 0.002/17.3 0.019/1.8 0.332/0.2 0.003/11.2 0.289/0.2 0.055/0.7 0.270/0.2 UGT1A9, -118(T)9>10, UGT1A9*1b, PROMOTER 0.003/12.3 0.258/0.2 0.001/36.4 0.017/2.0 0.054/0.7 0.025/1.4 0.067/0.6 0.279/0.2 0.066/0.6 UGT1A9, -2152C>T, PROMOTER 0.809/0.1 0.453/0.1 0.293/0.2 0.703/0.1 0.328/0.2 0.473/0.1 0.615/0.1 0.238/0.2 0.784/0.1 UGT1A9, -275T>A, PROMOTER 0.632/0.1 0.217/0.2 0.297/0.2 0.764/0.1 0.148/0.3 0.583/0.1 0.527/0.1 0.245/0.2 0.944/0.1 HNF1α, 79A>C (I27L), EXON 1 0.625/0.1 0.001/37.3 0.154/0.3 0.434/0.1 0.527/0.1 0.423/0.2 0.517/0.1 0.366/0.2 0.213/0.2 CYP3A4, -392A>G, CYP3A4*1B, 5ʹ-UTR 0.414/0.2 0.556/0.1 0.337/1.2 0.967/0.4 0.721/0.1 0.323/0.2 0.772/0.2 0.487/0.3 0.923/0.1 CYP3A5, 6986A>G, CYP3A5*3, INTRON 3 0.861/0.4 0.179/0.9 0.255/0.5 0.480/0.1 0.124/0.4 0.704/0.1 0.536/0.1 0.822/0.1 0.443/ 0.1 SLCO1B1, 388A>G (N130D), SLCO1B1*1b, EXON 4 0.079/0.5 0.106/0.4 0.023/1.6 0.097/0.4 0.580/0.1 0.379/0.2 0.317/0.2 0.038/1.0 0.269/0.2 SLCO1B1, 521T>C (V174A), SLCO1B1*15, EXON 5 0.878/0.1 0.614/0.6 0.600/0.1 0.433/0.2 0.751/0.2 0.159/0.5 0.942/0.1 0.145/0.3 0.066/0.6 ABCC2, -1549A>G, 5ʹ-Flanking region 0.383/0.2 0.001/47.4 0.301/0.2 0.308/0.2 0.171/0.3 0.749/0.1 0.705/0.1 0.253/0.2 0.643/0.1 ABCC2, -1019A>G, 5ʹ-Flanking region 0.583/0.1 0.002/15.4 0.254/0.2 0.249/0.2 0.398/0.2 0.732/0.1 0.681/0.1 0.226/0.2 0.809/0.1 ABCC2, -24C>T, 5ʹ-UTR 0.985/0.1 0.013/2.7 0.575/0.2 0.950/1.1 0.054/0.9 0.221/0.7 0.402/0.2 0.641/0.1 0.366/0.6 ABCC2, 1249G>A (V417I), EXON 10 0.443/0.1 0.045/0.9 0.934/0.1 0.358/0.2 0.521/0.1 0.329/0.2 0.495/0.1 0.002/14.9 0.706/0.1 ABCC2, -34T>C, INTRON 26 0.469/0.1 0.258/0.2 0.963/0.1 0.167/0.3 0.639/0.1 0.829/0.1 0.049/0.8 0.734/0.1 0.345/0.2 ABCC2, 3972C>T (I1324I), EXON 28 0.250/0.2 0.011/3.1 0.224/0.2 0.103/0.4 0.013/2.5 0.144/0.3 0.175/0.3 0.200/0.3 0.149/0.3 ABCC1, 1062T>C (N354N), EXON 9 0.136/0.3 0.179/0.3 0.221/0.2 0.120/0.4 0.139/0.3 0.684/0.1 0.013/2.3 0.228/0.2 0.082/0.5 ABCC1, -48C>T, INTRON 11 0.302/0.2 0.187/0.3 0.840/0.2 0.175/0.3 0.105/0.4 0.748/0.5 0.577/0.2 0.642/0.1 0.084/0.6 ABCC1, 1684T>C (L562L), EXON 13 0.405/0.2 0.018/2.0 0.414/0.2 0.098/0.4 0.579/0.1 0.436/0.1 0.805/0.1 0.037/1.0 0.233/0.2 ABCC1, -30C>G, INTRON 18 0.188/0.3 0.004/8.0 0.362/0.2 0.155/0.3 0.879/0.1 0.620/0.1 0.526/0.1 0.061/0.6 0.177/0.3 ABCC1, 4002G>A (S1334S), EXON 28 0.001/29.4 0.022/1.7 0.300/0.2 0.195/0.3 0.416/0.2 0.096/0.4 0.184/0.3 0.064/0.6 0.072/0.6 ABCC1, +18A>G, INTRON 30 0.023/1.6 0.198/0.3 0.424/0.2 0.825/0.1 0.365/0.2 0.296/0.2 0.217/0.2 0.403/0.2 0.236/0.2 ABCB1, -129T>C, 5ʹ-UTR 0.559/0.5 0.811/0.1 0.610/0.3 0.977/0.2 0.725/0.9 0.807/0.4 0.163/0.3 0.177/0.3 0.009/3.5 ABCB1, -25G>T, INTRON 4 0.229/0.3 0.774/0.1 0.832/0.5 0.826/1.1 0.635/0.1 0.877/0.2 0.368/0.2 0.661/0.1 0.832/0.1 ABCB1, -44A>G, INTRON 9 0.147/0.3 0.605/0.1 0.618/0.1 0.570/0.1 0.109/0.4 0.156/0.3 0.096/0.4 0.338/0.2 0.051/0.8 ABCB1, 1236C>T (G412G), EXON 12 0.182/0.3 0.437/0.1 0.382/0.2 0.482/0.1 0.090/0.5 0.280/0.2 0.106/0.4 0.376/0.2 0.153/0.3 ABCB1, +24C>T, INTRON 13 0.725/0.1 0.439/0.1 0.491/0.1 0.540/0.1 0.532/0.1 0.076/0.5 0.100/0.4 0.306/0.2 0.016/2.1 ABCB1, +38A>G, INTRON 14 0.627/0.1 0.538/0.1 0.669/0.1 0.540/0.1 0.532/0.1 0.054/0.7 0.100/0.4 0.306/0.2 0.033/1.1 ABCB1, 2677G>A/T (A893T/S), EXON 21 0.302/0.2 0.543/0.1 0.491/0.1 0.962/0.1 0.943/0.1 0.309/0.2 0.210/0.2 0.890/0.1 0.004/6.9 ABCB1, 3435C>T (I1145I), EXON 26 0.319/0.2 0.441/0.1 0.531/0.1 0.631/0.1 0.664/0.1 0.644/0.1 0.402/0.2 0.226/0.2 0.013/2.5 ABCG2, 34G>A (V12M), EXON 2 0.479/0.1 0.828/0.1 0.139/0.3 0.348/0.2 0.588/0.2 0.673/0.1 0.087/0.5 0.219/0.2 0.780/0.1 ABCG2, 421C>A (Q141K), EXON 5 0.565/0.1 0.397/0.2 0.421/0.2 0.435/0.1 0.628/0.1 0.256/0.2 0.708/0.1 0.533/0.1 0.787/0.1 CES2, -363C>G, 5ʹ-UTR 0.999/2.3 0.546/0.2 0.028/1.9 0.624/0.1 0.872/0.1 0.899/0.1 0.379/0.6 0.92/.1 0.586/0.1 CES2, +1361A>G, INTRON 1 0.381/1.0 0.549/0.2 0.616/0.8 0.118/0.4 0.546/0.1 0.629/0.1 0.275/0.3 0.26/0.2 0.352/0.2 Split to SN-38 and SN-38 to bile to gut to SN-38 IRN compartments SN-38 to SN-38G and SN-38G elimination Split to APC from IRN central compartment APC elimination EHR SN-38 recir-- culation without EHR SN-38 elimination IRN elimination The table shows the P values and Bayes factors, respectively, separated by a"/. Login to comment
193 UGT1A1, -53A(TA)6>7TAA, PROMOTER 0.709(6):0.286(7) 0.62(6):0.38(7) 15,32 UGT1A1, -3279G>T (UGT1A1*60), PBREM 0.47(G):0.53(T) 0.85(G):0.15(T) UGT1A1, -3156G>A, PBREM 0.69(G):0.31(A) 0.715(G):0.285(A) UGT1A1, 211G>A (G71R), UGT1A1*6, EXON 1 0(A):1(G) 0(A):1(G) UGT1A1, 686C>A (P229Q), UGT1A1*27, EXON 1 0(A):1(C) 0(A):1(C) UGT1A7, 387G>T (N129K), EXON 1 0.646(G):0.354(T) 0.522(G):0.478(T) Supplementary Data S1 onlinea UGT1A7, 391C>A (R131K), EXON 1 0.646(G):0.354(T) 0.522(G):0.478(T) UGT1A7, 622T>C (W208R), EXON 1 0.521(T):0.479(C) 0.729(T):0.271(C) UGT1A9, -118(T)9>10, UGT1A9*1b, PROMOTER 0.59(9):0.41(10) 0.56(9):0.44(10) 42 UGT1A9, -2152C>T, PROMOTER 0.91(C):0.09(T) Unknownb UGT1A9, -275T>A, PROMOTER 0.91(T):0.09(A) Unknownb HNF1α, 79A>C (I27L), EXON 1 0.75(A):0.25(C) Unknownb Supplementary Data S1 onlinea CYP3A4, -392A>G, CYP3A4*1B, 5ʹ-UTR 0.977(A):0.023(G) 0.321(A):0.679(G) 43 CYP3A5, 6986A>G, CYP3A5*3, INTRON 3 0.023(A):0.977(G) 0.633(A):0.367(G) SLCO1B1, 388A>G (N130D), SLCO1B1*1b, EXON 4 0.396(C):0.604(T) 0.717(C):0.283(T) Supplementary Data S1 onlinea SLCO1B1, 521T>C (V174A), SLCO1B1*15, EXON 5 0.083(C):0.917(T) 0.022(C):0.978(T) ABCC1, 1062T>C (N354N), EXON 9 0.458(C):0.542(T) 0.643(C):0.357(T) 44 ABCC1, +8A>G, INTRON 9 0.643(A):0.357(G) 0.433(A):0.567(G) ABCC1, -48C>T, INTRON 11 0.146(T):0.854(C) 0(T):1.0(C) ABCC1, 1684T>C (L562L), EXON 13 0.917(C):0.083(T) 0.848(C):0.152(T) ABCC1, -30C>G, INTRON 18 0.042(C):0.958(G) 0.217(C):0.783(G) ABCC1, 4002G>A (S1334S), EXON 28 0.688(C):0.312(T) 0.955(C):0.045(T) ABCC1, +18A>G, INTRON 30 0.213(T):0.787(C) 0.042(T):0.958(C) ABCC2, -1549A>G, 5ʹ-Flanking region 0.43(A):0.57(G) 0.485(A):0.515(G) 44 ABCC2, -1019A>G, 5ʹ-Flanking region 0.43(G):0.57(A) 0.365(G):0.635(A) ABCC2, -24C>T, 5ʹ-UTR 0.230(A):0.770(G) 0.06(A):0.940(G) ABCC2, 1249G>A (V417I), EXON 10 0.146(A):0.854(G) 0.239(A):0.761(G) ABCC2, -34T>C, INTRON 26 0.17(C):0.83(T) 0.25(C):0.75(T) ABCC2, 3972C>T (I1324I), EXON 28 0.380(A):0.620(G) 0.280(A):0.720(G) ABCB1, -129T>C, 5ʹ-UTR 0.620(C):0.938(T) 0.043(C):0.957(T) 44 ABCB1, -25G>T, INTRON 4 0.273(T):0.737(G) 0.385(T) :0.615(G) ABCB1, -44A>G, INTRON 9 0.409(C):0.591(T) 0.20(C):0.80(T) ABCB1, 1236C>T (G412G), EXON 12 0.523(C):0.477(T) 0.864(C):0.136(T) ABCB1, +24C>T, INTRON 13 0.50(T):0.50(C) 0.467(T):0.533(C) ABCB1, +38A>G, INTRON 14 0.429(A):0.571(G) 0.389(A):0.611(G) ABCB1, 2677G>A/T (A893T/S), EXON 21 0.614(G):0.386(T) 0.923(G):0.077(T) ABCB1, 3435C>T (I1145I), EXON 26 0.375(C):0.625(T) 0.848(C):0.152(T) ABCG2, 34G>A (V12M), EXON 2 0.017(A):0.983(G) 0.071(A):0.929(G) Supplementary Data S1 onlinea ABCG2, 421C>A (Q141K), EXON 5 0.045(A):0.955(C) 0.023(A):0.977(C) CES2, -363C>G, 5ʹ-UTR 0.810(C):0.190(G) 0.733(C):0.267(G) Supplementary Data S1 onlinea CES2, +1361A>G, INTRON 1 0.143(G):0.857(A) 0.438(G):0.562(A) CES2, 108C>G, 3ʹ-UTR 0.004(G):0.996(C) 0(G):1.0(C) PBREM, phenobarbital-responsive enhancer module; UTR, untranslated region. Login to comment

PMID: 18597651 [PubMed] Levesque E et al: "Pharmacokinetics of mycophenolate mofetil and its glucuronide metabolites in healthy volunteers."

No. Sentence Comment

102 Nucleotide position Polymorphism Amino acid Reported impact Present study Ref. Observed frequency PK effect* Promoter -24C>T ↓ mRNA expression 0.24 25% ↑ AcMPAG [28] Exon 10 1219C>T Leu407Leu ‡ 0.01 - 1234A>G Arg412Gly ↓ Activity 0 - [33] 1249G>A Val417Ile ↓ or = expression 0.21 NS [29,30] 1289A>G Lys430Arg Unknown 0 - [32] 1446C>G Thr482Thr ↑ mRNA expression 0.01 - [32] Exons 25/32 3563T>A/ 4544G>A Val1188Glu/ Cys1515Tyr ↑ Expression 0.04 NS [31] Exon 28 3972C>T Ile1324Ile Altered mRNA stability 0.43 NS [34] *Multivariate analysis ‡In-vitro functional impact not evaluated The PK parameters of the ABCC2 codon 482 variant are presented in Figure 1C. Login to comment

PMID: 18334920 [PubMed] Haenisch S et al: "Influence of genetic polymorphisms on intestinal expression and rifampicin-type induction of ABCC2 and on bioavailability of talinolol."

No. Sentence Comment

7 The variant ABCC2 1249G > A (V417I), however, was associated with lower oral bioavailability (P = 0.001), and increased residual clearance of intravenous talinolol (P = 0.021). Login to comment
8 Intestinal ABCC2 mRNA and protein expression were upregulated by rifampicin treatment, a genetic influence could be detected in only four cases heterozygote for 3563T > A or 4544G > A. Conclusion The 1249G > A (V417I) polymorphism is obviously associated with higher activity of the intestinal transporter. Login to comment
17 So far, the polymorphism -24C > T in the 50 -untranslated region, the nonsynonymous single nucleotide polymorphisms (SNPs) c.1249G > A (V417I), c.3563T > A (V1188E), c.4544G > A (C1515Y), and the synonymous SNPs 1446C > G (Thr482Thr) and 3972C > T (I1324I) were subjects of evaluations [15-17]. Login to comment
38 Genotyping The ABCC2 SNPs -24C > T (rs717620), c.1249G > A (V417I, rs2273697), c.2302C > T (Arg768Trp), c.2366C > T (Ser789Phe), c.3972C > T (I1324I, rs3740066), c.4348G > A (Ala1450Thr) were genotyped using PCR-restriction fragment length polymorphism (RFLP) analysis. Login to comment
99 Talinolol disposition After oral administration of talinolol, the AUC was significantly associated with the nonsynonymous ABCC2 polymorphism 1249G > A (V417I) in a gene-dose-related manner (P = 0.005). Login to comment
112 With regard to the activity of ABCC2, however, the nonsynonymous variant 1249G > A (V417I) seems to be associated with increased activity of the efflux transporter as evidenced by significantly decreased bioavailability of b1-selective blocker talinolol in carriers of the variant allele. Login to comment
128 ABCC2 1249G > A leads to an exchange of valine to isoleucine at position 417 of the transmembrane protein domain 1. Login to comment
135 In-vitro transport studies in recombinant Lewis lung carcinoma porcine kidney cells, however, did not suggest differences Table 6 Influence of ABCC2 1249G > A (V417I) on disposition of talinolol after intravenous infusion (10 mg/30 min) and oral administration of 100 mg in 31 healthy white subjects All participants GG GA AA Intravenous Oral Intravenous Oral Intravenous Oral Intravenous Oral N 31 31 18 18 11 11 2 2 AUC (ng Â h/ml) 1385.6 ± 229 3131 ± 757 1400 ± 223 3420 ± 708 1380 ± 232 2910 ± 485a 1320 ± 417 1750 ± 695a,b F (%) - 68.9 ± 14.6 - 75.1 ± 12.0 - 63.2 ± 9.3 - 44.3 ± 29.7a t1/2 (h) 12.9 ± 2.3 13.7 ± 2.2 12.6 ± 1.7 13.3 ± 1.5 13.5 ± 3.1 14.1 ± 2.9 11.9 ± 0.6 15.5 ± 3.2 CLR (ml/min) 188 ± 57 169 ± 54.1 183 ± 52 159 ± 40 199 ± 59 186 ± 72 167 ± 123 169 ± 58 CLM (ml/min) 4.6 ± 3.2 - 4.84 ± 3.97 - 4.29 ± 2.04 - 4.68 ± 1.85 - CLres (ml/min) 179 ± 51 - 180 ± 58 - 169 ± 37 - 226 ± 0.54b - AUC, area under the concentration-time curve; CLM, metabolic clearance; CLR, renal clearance; CLres, residual clearance; F, bioavailability; t1/2, half-life. Login to comment
140 Duodenal ABCC2 expression and function Haenisch et al. 363 in V417I dependent transport [18]. Login to comment
161 The 1249G > A (V417I) polymorphism, however, is obviously associated with higher activity of the intestinal transporter as evidenced by gene-dose related decrease of oral absorption and increased residual clearance of talinolol. Login to comment

PMID: 18398970 [PubMed] Kiser JJ et al: "Clinical and genetic determinants of intracellular tenofovir diphosphate concentrations in HIV-infected patients."

No. Sentence Comment

40 Genotyping The complete genotyping methods have been previously described.22 Subjects were genotyped for 6 SNPs: 2 in SLC22A6 (encodes hOAT1): 728G.A (Arg50His; rs11568626) and 453G.A in the 5# untranslated region (UTR) (rs4149170); 2 in ABCC2 (encodes MRP2): 224C.T in the promoter (rs717620) and 1249G.A (Val417Ile; rs2273697); and 2 in ABCC4 (encodes MRP4): 3463A.G (Lys1116Lys; rs1751034) and 4131T.G in the 3# UTR (rs3742106). Login to comment

PMID: 17597712 [PubMed] Kiser JJ et al: "The effect of lopinavir/ritonavir on the renal clearance of tenofovir in HIV-infected patients."

No. Sentence Comment

201 G1249A (Val417Ile) Exon 10 23.3% CA 23.9% AA In membrane spanning domain, could alter substrate specificity (Ito, S. et al. Pharmacogenetics 11:175-184 (2001); Toh, S. et al. Am. J. Hum. Login to comment

PMID: 18974617 [PubMed] Ho WF et al: "Genetic variations of the ABCC2 gene in the Chinese, Malay, and Indian populations of Singapore."

No. Sentence Comment

54 Among the reported variations, the ones that may be of functional relevance include -24CÀT,7,25) 1249GÀA (Val417Ile),5) 3563TÀA (Val1188Glu),5,26-28) 3972CÀT (Ile1324Ile),25) and 4544GÀA (Cys1515Tyr).26,28) The -24CÀT polymorphism was found to associate with increased plasma methotrexate concentrations in pediatric leukemia patients.7) We have also previously observed a trend for a genotypic-phenotypic correlation between -24CÀT polymorphism and increased irinotecan AUC(0, /).29) -24CÀT and 3972CÀT (Ile1324Ile) were linked to higher response rates to irinotecan and longer progression-free survival in patients with advanced non-small cell lung cancer.25) However, a study on the disposition of nitrocamptothecin and its aminocamptothecin metabolite in relation to the 3972CÀT variation revealed no significant association.30) 3563TÀA (Val1188Glu) and 4544GÀA (Cys1515Tyr) were correlated with high MRP2 expression,28) and increased susceptibility for anthracycline-induced cardiotoxicity.26) 3563TÀA (Val1188Glu) was also significantly associated with pruritus in primary biliary cirrhosis.27) Genetic polymorphisms in ABCC2 might thus constitute a risk factor for the development of acquired forms of cholestatic liver diseases.28) Mutations in the transmembrane domain: 1249GÀA (Val417Ile), 1457CÀT (Thr486Ile), and 3563TÀA (Val1188Glu) could affect their substrate specificities though their transporter activities might not be completely disrupted.5) All reported nonsynonymous variations detected in this study were predicted to be benign using the PolyPhen program. Login to comment

PMID: 18445995 [PubMed] Sai K et al: "Genetic variations and haplotypes of ABCC2 encoding MRP2 in a Japanese population."

No. Sentence Comment

11 Frequencies of the major 4 haplotype groups *1A (－1774delG), *1B (no common SNP), *1C (－24CÀT and 3972CÀT), and *2 [1249GÀA (Val417Ile)] were 0.331, 0.292, 0.172, and 0.093, respectively. Login to comment
68 Summary of ABCC2 variations detected in this study SNP ID Position This Study dbSNP (NCBI) JSNP Reference Location NT_030059.12 From the translational initiation site or from the end of the nearest exon Nucleotide change Amino acid change Frequency (total＝472) MPJ6_AC 2082 8 5?-Flanking 20289354 －1774 acttatcttgttG/_tttttttttttt 0.343 MPJ6_AC 2078 a 5?-Flanking 20289538 －1590 tttaatttgttaG/Atgtatgtttgct 0.002 MPJ6_AC 2079 8, 10, 17 5?-Flanking 20289579 －1549 tccttatagtatG/Attgtggatatta 0.203 MPJ6_AC 2080 9, 17 5?-Flanking 20290105 －1023 tgggaggccaagG/Acagaaggattgt 0.343 MPJ6_AC 2081 10, 17 5?-Flanking 20290109 －1019 aggccaaggcagA/Gaggattgttgaa 0.203 MPJ6_AC 2028 a 5?-Flanking 20290395 －733 acagtttctagcG/Tactgatgccacc 0.004 MPJ6_AC 2029 5?-Flanking 20290395 －733 acagtttctagcG/Aactgatgccacc 0.002 MPJ6_AC 2030 a 5?-Flanking 20290715 －413 ttgcagcagaagC/Tgaaactgcacat 0.002 MPJ6_AC 2003 ssj0000371 9, 12, 15-18, 20, 26 Exon 1 20291104 －24 tagaagagtcttC/Tgttccagacgca 0.174 MPJ6_AC 2004 18 Exon 1 20291105 －23 agaagagtcttcG/Attccagacgcag 0.006 MPJ6_AC 2031 ssj0000386 17, 26 Intron 3 20301785 IVS3 －49 ctcccctcagtcC/Ttcggttagtggc 0.203 MPJ6_AC 2032 a Intron 6 20302837 IVS6 ＋86 tattttattattT/Atttttttgagat 0.076 MPJ6_AC 2033 a Exon 7 20305479 732 caagtttgaaacG/Acacatgaagaga Thr244Thr 0.002 MPJ6_AC 2066 a Intron 7 20307421 IVS7 －69 tcacaggctgacC/Gaccctggagctg 0.002 MPJ6_AC 2067 a Intron 7 20307423 IVS7 －67 acaggctgaccaC/Acctggagctgct 0.002 MPJ6_AC 2035 a Exon 9 20308814 1177 ggtgtaaaagtaC/Tggacagctatca Arg393Trp 0.002 MPJ6_AC 2068 a Exon 9 20308839 1202 tggcttctgtatA/Gtaagaaggtaag Tyr401Cys 0.002 MPJ6_AC 2036 a Intron 9 20308859 IVS9 ＋13 gtaagcagaataC/Tggcaggtatcac 0.002 MPJ6_AC 2037 a Exon 10 20312319 1227 gaccctatccaaC/Tttggccaggaag Asn409Asn 0.002 MPJ6_AC 2009 ssj0000388 17, 18, 20, 23-26 Exon 10 20312341 1249 aaggagtacaccG/Attggagaaacag Val417Ile 0.097 MPJ6_AC 2010 18 Exon 10 20312549 1457 ccaagagtaagaC/Tcattcaggtaaa Thr486Ile 0.019 MPJ6_AC 2069 a Intron 11 20315600 IVS11 －67 taaaacatgggtG/Agatcagatacac 0.002 MPJ6_AC 2038 ssj0000390 26 Intron 12 20315952 IVS12 ＋148 ccgccccatgccA/Gcttttcctcctt 0.210 MPJ6_AC 2039 a Intron 13 20318344 IVS13 －73 tcatggactaacG/Aacaaagtcaaaa 0.002 MPJ6_AC 2070 a Intron 14 20318515 IVS14 ＋14 taaataaatttgG/Taagttgcttccc 0.002 MPJ6_AC 2040 a Intron 14 20318521 IVS14 ＋20 aatttggaagtt(del/ins) b cagcaaactga 0.002 MPJ6_AC 2071 a Intron 14 20318594 IVS14 ＋93 agcaaactgagaG/Tagagtgtggaga 0.002 MPJ6_AC 2041 a Intron 14 20319757 IVS14 －62 cggagagagacaC/Tgtgagggcagac 0.002 MPJ6_AC 2042 a Intron 14 20319758 IVS14 －61 ggagagagacacG/Atgagggcagaca 0.006 MPJ6_AC 2043 ssj0000393 26 Intron 15 20320054 IVS15 ＋169 aaagcaaaggttT/Ctcagccccttcc 0.210 MPJ6_AC 2044 a Intron 15 20321170 IVS15 －131 gtcttgtatatcC/Gaaggcaaatttt 0.004 MPJ6_AC 2045 a Intron 16 20325422 IVS16 －169 ttgagtcctgagA/Tgtggaataacta 0.004 MPJ6_AC 2046 ssj0000396 17 Intron 16 20325486 IVS16 －105 tgcacagttattC/Taaatttaagctc 0.214 MPJ6_AC 2072 a Exon 18 20327159 2358 tcttctagatgaC/Acccctgtctgca Asp786Glu 0.002 MPJ6_AC 2012 18, 20, 23 Exon 18 20327167 2366 atgaccccctgtC/Ttgcagtggatgc Ser789Phe 0.008 MPJ6_AC 2073 a Intron 19 20327555 IVS19 ＋3 gaagccacaggtA/Gtgtaagaaggat 0.002 MPJ6_AC 2047 a Intron 19 20327645 IVS19 ＋93 agtatccagtgaA/Tctagatttggaa 0.002 MPJ6_AC 2048 Intron 20 20338745 IVS20 ＋29 gctggcagccctC/Agtcagctctata 0.002 MPJ6_AC 2049 a Exon 21 20339052 2801 ccttgaaaactcG/Agaatgtgaatag Arg934Gln 0.002 MPJ6_AC 2015 ssj0000398 8, 18, 26 Exon 22 20339944 2934 aggattgttttcG/Aatattcttcatc Ser978Ser 0.040 MPJ6_AC 2050 a Exon 22 20340061 3051 cgactatccagcA/Gtctcagagggac Ala1017Ala 0.002 MPJ6_AC 2051 a Exon 23 20340337 3181 cacaagcaactgC/Ttgaacaatatcc Leu1061Leu 0.002 MPJ6_AC 2052 ssj0000399 17, 26 Intron 23 20340470 IVS23 ＋56 ggatctttctgaC/Tagggaggaatta 0.222 MPJ6_AC 2074 a Exon 24 20342724 3320 ttacatgcttccT/Gggggataatcag Leu1107Arg 0.002 MPJ6_AC 2053 Intron 24 20342843 IVS24 ＋25 atggctaagtcaT/Cccttccttcctc 0.030 MPJ6_AC 2075 a Intron 24 20342880 IVS24 ＋62 agcccagcctctT/Ctcctgagaatct 0.002 MPJ6_AC 2054 Intron 24 20342926 IVS24 ＋108 cactcactcctcC/Tcctcagcagctt 0.023 MPJ6_AC 2055 a Intron 24 20344318 IVS24 －56 agaaaggaggaaG/Aatggtggatgcc 0.002 MPJ6_AC 2056 a Intron 26 20352061 IVS26 －21 atgatgattttcA/Ggtcttctggttt 0.002 MPJ6_AC 2057 a Intron 27 20352227 IVS27 ＋44 ggcaaaaacaacA/Gtgcaactccttc 0.008 MPJ6_AC 2058 ssj0000404 17, 26 Intron 27 20352307 IVS27 ＋124 aaagtttcctttC/Gctctaactcaaa 0.222 MPJ6_AC 2076 26 Exon 28 20352688 3927 ccaagtgcggtaC/Tcgacctgagctg Tyr1309Tyr 0.002 MPJ6_AC 2022 ssj0000407 8, 12, 13, 17, 18, 20, 26 Exon 28 20352733 3972 cacttgtgacatC/Tggtagcatggag Ile1324Ile 0.216 MPJ6_AC 2059 a Intron 28 20352920 IVS28 ＋172 agggaaggatagC/Tagccagggatca 0.004 MPJ6_AC 2060 a Intron 29 20354201 IVS29 ＋136 cttgagctagttC/Tcctaggatggac 0.002 MPJ6_AC 2061 ssj0000408 26 Intron 29 20354219 IVS29 ＋154 gatggacacgtcA/Gtttccagaactt 0.367 MPJ6_AC 2062 IMS-JST090926 17 Intron 29 20355209 IVS29 －35 cttttctggcatG/Aagccccaacagc 0.015 MPJ6_AC 2063 a Intron 30 20358793 IVS30 －92 ggggggttttgaA/Gagtctgatctgg 0.008 MPJ6_AC 2064 IMS-JST185750 Intron 30 20358832 IVS30 －53 ccccctgccctgC/Tgtctttccttgg 0.051 MPJ6_AC 2077 a 3?-UTR 20359975 *61 c taattttattttT/Gtataaaatacag 0.002 MPJ6_AC 2065 a 3?-Flanking 20360190 *193＋83 c ttattcctttgcC/Gtttcatttctgt 0.002a8 a Novel genetic variation b delGCTTCCCAAACTTATTCGCAGTACTGGTGCCAGAATTTTGATAATACAAGAGCTTAGTAG/insTATTTACCT c Numbered from the termination codon. Login to comment
87 The *2 [including 1249GÀA (Val417Ile)] was the most frequent among them, and its frequency (0.093) was similar to those for Asians (0.10-0.13)8,12,20) and slightly lower than those for Caucasians (0.13-0.22).9,10,14,15,21) The haplotype frequencies of *3 [harboring 1457CÀT (Thr486Ile)] and *4 [2366CÀT (Ser789Phe)] were 0.019 and 0.008. Login to comment
89 No functional significance of the marker SNP [1249GÀA (Val417Ile)] of *2 has been shown in vitro,8,23) but its in vivo associations with lower MRP2 expression in the placenta24) and chemical-induced renal toxicity25) have been reported. Login to comment

PMID: 17502832 [PubMed] Choi JH et al: "MRP2 haplotypes confer differential susceptibility to toxic liver injury."

No. Sentence Comment

93 The pGL3 plasmids containing WT or mutant MRP2 promoters were Table 3 Oligonucleotide primers used in the genotyping and functional molecular studies Primer name Nucleotide sequence Primers for SNaPshot or SNaPIT PCR primers c.334-49C > T Sense 50 -CAT GGG TCC TGG AAA GGT T-30 Antisense 50 -CCC CAT GGT ACC TCC TCA T-30 c.1249G > A (p.V417I) Sense 50 -TTT GTC CAT GGG TCC TAA TTT-30 Antisense 50 -ATG AAG TTG GTC ACA TCC ATG-30 c.1457C > T (p.T486I) Sense 50 -ATG GTG CTT GTA ATC CCA ATT-30 Antisense 50 -TTG CCC AAA CTC CCA TTA-30 c.2620 + 3A > G Sense 50 -AAA AAA GGA GAG TTT GCT AAG AAT C-30 Antisense 50 -ATA CTG AGC AGT TCA GGA ATT AGA TAT T-30 c.2934G > A (p.S978S) Sense 50 -AGT TCT ACT AAT ATT GAG GTG GGG A-30 Antisense 50 -AAT AAA AGC CAC AGA ATT CAT CA-30 c.3972C > T (p.I1324I) Sense 50 -TAC CGA CCT GAG CTG GAT C-30 Antisense 50 -CAT CCA GGC CTT CCT TCA-30 c.4147 - 35G > A Sense 50 -GTA GCC ACT CCG AGC CTT AG-30 Antisense 50 -GGA ATC AGA CCT GGA TGA AAA-30 c.4508 + 12G > A Sense 50 -CCC ACA GGC TGC ACA CCA T-30 Antisense 50 -TGT TAC TGT TGA GCA AGG GTT A-30 Genotyping primers c.334 - 49C > T 50 -TCT GAA GAA TAC TGC CAC TAA CCG A-30 c.1249G > A (p.V417I) 50 -GAC ATC AGG TTC ACT GTT TCT CCA A-30 c.1457C > T (p.T486I) 50 -GGG TGA CTT TTT CTT TAC CTG AAT G-30 c.2620 + 3A > G 50 -CTA TCT TGT CCC AAT CCT TCT TAC A-30 c.2934G > A (p.S978S) 50 -ACC TAC AAG CAA TAG GAT TGT TTT C-30 c.3972C > T (p.I1324I) 50 -CTC CAC CTA CCT TCT CCA TGC TAC C-30 c.4147 - 35G > A 50 -GAA CTC CGA GGT CCT TTT CTG GCA T-30 c.4508 + 12G > A 50 -AAG CCA TCC GTG TCA AGC CCT GTC C-30 Primers for the DNA sequencing of MRP2 promoter regions g. - 1774delG Sense 50 -GAT TCT CCA CCC TCT CTT TT-30 Antisense 50 -CAT TCA GTG TGG GAG AAA AT-30 g. - 1549G > A Sense 50 -CCC ACT TTT TAA TTT GTT AGT GTA-30 Antisense 50 -CTG GGA CTA CAG GCA CAT-30 g. - 24C > T and g. - 23G > A Sense 50 -TAG GCT CAC ACT GGA TAA GC-30 Antisense 50 -TGC ACA TCT AAC ATT TCT GG-30 Mutagenic primers - 24C-T 50 -CAA TCA TAT TAA TAG AAG AGT CTT CGT TCC AGA CGC AGT CCA GGA A-30 c.1249G > A (p.V417I) 50 -GGA AGG AGT ACA CCA TTG GAG AAA CAG TGA ACC TGA TGT C-30 c.2302C > T (p.R768W) 50 -AAA TCT TAG TGG GGG TCA GAA GCA GTG GAT CAG CCT GGC CAG-30 c.2934G > A (p.S978S) 50 -CTA CAA GCA ATA GGA TTG TTT TCA ATA TTC TTC ATC ATC-30 c.3972C > T (p.I1324I) 50 -GAG GGA TCA CTT GTG ACA TTG GTA GCA TGG AGA AGG TAG G-30 Primers for MRP2 promoter cloning First round PCR ( - 2314 to + 348) Sense 50 -AGA TTC ATG ACT TCC TGG CTC CTT-30 Antisense 50 -ACA ACA ATT CTC CTT CCT CAC ACG-30 Second round PCR ( - 2229 to -1) Sense (KpnI site) 50 -CGG GGT ACC TTG ATG AAC ATT TAG ATT CT-30 Antisense (NheI site) 50 -CTA GCT AGC GAT TCC TGG ACT GCG TCT GG-30 RT-PCR primers for exon 4 splicing Sense (exon 3) 50 -CGT GTA TAA ATC CAG GAC CAA GAG A-30 Antisense (exon 5) 50 -GGA GAT GAA GAA CAG GCA GGA GTA G-30 PCR, polymerase chain reaction; RT-PCR, reverse transcription-polymerase chain reaction. Login to comment
112 Twelve genetic variations were found in the MRP2 gene after comprehensive gene scanning of a total of 100 samples derived from 50 healthy Table 4 Frequency of MRP2 genetic variations in control and toxic hepatitis patients Variant Control Hepatocellular Cholestatic or mixed n n P value n P value g. - 1774delG + / + 50 30 0.28 9 0.04* + / - 46 23 20 - / - 14 4 8 (0.34) (0.27) (0.49) g. - 1549G > A + / + 66 30 0.03* 24 0.11 + / - 42 22 10 - / - 2 5 3 (0.21) (0.28) (0.22) g. - 24C > T + / + 74 31 0.06 25 0.75 + / - 34 22 11 - / - 2 4 1 (0.17) (0.26) (0.18) g. - 23G > A + / + 105 55 37 + / - 5 2 0 (0.02) (0.02) (0.00) c.334 - 49C > T + / + 66 28 0.06 23 0.2 + / - 41 24 11 - / - 3 5 3 (0.21) (0.30) (0.23) c.1249G > A (p.V417I) 92 47 0.22 34 0.29 + / + 15 10 3 + / - 3 0 0 - / - (0.10) (0.09) (0.04) c.1457C > T (p.T486I) 107 56 36 + / + 3 1 1 + / - (0.01) (0.01) (0.01) c.2620 + 3A > G + / + 110 56 37 + / - 0 1 0 (0.00) (0.01) (0.00) c.2934G > A (p.S978S) + / + 100 52 0.52 35 0.35 + / - 9 5 2 - / - 1 0 0 (0.05) (0.04) (0.03) c.3972C > T (p.I1324I) + / + 61 29 0.02* 23 0.12 + / - 47 22 11 - / - 2 6 3 (0.23) (0.30) (0.23) c.4147-35G > A + / + 107 52 37 + / - 3 5 0 (0.01) (0.04) (0.00) c.4508 + 12G > A + / + 108 57 37 + / - 2 0 0 (0.01) (0.00) (0.00) + , major allele, - , minor allele. Login to comment
142 None of the common coding region variants, p.V417I, c.2934G > A, or c.3972C > T, induced identifiable defects in protein expression, whereas p.R768W evoked a definite decrease (Fig. 2a). Login to comment
149 Fig. 2 30 kDa 0 20 40 60 80 100 120 Transportactivity(%) 140 WT 190 kDa MRP2 Neomycin phosphotransferase II (a) (b) WT p.V417I c.2934G > A (Ser978) c.3972C > T (Ile1324) p.R768W Mock (c) 500 400 300 200 100 CC CT TT MRP2 exon 4 β-actin (1) (2) (3) (4) (5) (6) bp 300 p.V417I c.2934G > A (Ser978) c.3972C > T (Ile1324) p.R768W Functional studies of intragenic variations. Login to comment

PMID: 17397012 [PubMed] Ray AS et al: "Unlikely association of multidrug-resistance protein 2 single-nucleotide polymorphisms with tenofovir-induced renal adverse events."

No. Sentence Comment

0 CORRESPONDENCE • JID 2007:195 ( May) • 1389 1 M A Y Correspondence Unlikely Association of Multidrug-Resistance Protein 2 Single-Nucleotide Polymorphisms with Tenofovir-Induced Renal Adverse Events To the Editor-Izzedine et al. [1] reported an association between ABCC2 encoding the multidrug-resistance protein 2 [MRP2] gene polymorphism 1249 GrA leading to a nonsynonymous change of Val to Ile at position 417 and renal proximal tubulopathy induced by tenofovir. Login to comment
3 Prior reports cast doubt on the importance of the Val417Ile substitution in MRP2 function. Login to comment
5 Furthermore, in vitro functional studies have demonstrated that MRP2 Val417Ile substitution affects neither the expression, membrane localization of the transporter, nor transport efficiency observed for structurally diverse substrates [3]. Login to comment

PMID: 16847695 [PubMed] Nies AT et al: "The apical conjugate efflux pump ABCC2 (MRP2)."

No. Sentence Comment

139 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment
140 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment

PMID: 17185998 [PubMed] de Jong FA et al: "Irinotecan-induced diarrhea: functional significance of the polymorphic ABCC2 transporter protein."

No. Sentence Comment

51 Table 3 Functional consequences of investigated ABCC2 polymorphisms ABCC2 genotype Position Effecta Activityb NCBI ID Reference ABCC2 À1549G4A 50 -Flanking - Unknown rs1885301 Innocenti et al.28 ABCC2 À1019A4G 50 -Flanking - Unknown rs2804402 Innocenti et al.28 ABCC2 À24C4T 50 -UTR - Decreased rs717620 Ito et al.,31 Itoda et al.,32 Haenisch et al.39 ABCC2 1249G4A Exon 10 V417I Unknown rs2273697 Ito et al.,31 Itoda et al.,32 Kroetz et al.38 ABCC2 IVS26 -34T4C Intron 26 - Unknown rs8187698 Kroetz et al.38 ABCC2 3972C4T Exon 28 I324I Unknown rs3740066 Ito et al.,31 Itoda et al.32 NCBI ID, National Center for Biotechnology Information identification number; 50 -UTR, five prime untranslated region. Login to comment

PMID: 17241877 [PubMed] Daly AK et al: "Genetic susceptibility to diclofenac-induced hepatotoxicity: contribution of UGT2B7, CYP2C8, and ABCC2 genotypes."

No. Sentence Comment

33 PCR-RFLP Assay Primers and Conditions Gene and polymorphism Primers Annealing temperature Restriction enzyme PCR product and digestion pattern UGT2B7 C-161T GTGAACAGATCATTTACCTTCATTTGTCTT 1 min at 53°C BbsI C allele 239 bp and 20 bp (rs17551675) CAATTCCCAGAGCTAAAGCAAAAGCTCAGT T allele 259 bp (not digested) UGT2B7 A-79G GTGAACAGATCATTTACCTTCATTTGTCTT 1 min at 53°C HpyCH4III A allele 210 bp and 49 bp (no rs listed) CAATTCCCAGAGCTAAAGCAAAAGCTCAGT G allele 259 bp (not digested) UGT2B7 C801T ACAATGCGGAAAGCTGACG 1 min at 57°C FokI C allele 126 bp (not digested) (H268Y)(rs7439366) CTTAGGCAGGGGTTTGGCA T allele 84 bp and 24 bp CYP2C8 G416A TTTTTATTAGGAATCATTTC 1 min at 48°C BseRI G allele 110 bp, 40 bp and 20 bp (R139K)(rs11572080) AGTCACCCACCCTTGGTTTT A allele150 bp and 20 bp CYP2C8 C792G AAAAATGTTGCTCTTACACG 1 min at 55°C TaqI C allele 90 bp and 35 bp (I264M)(rs1058930) ATTTTACCTGCTCCATTTTG G allele 125 bp (not digested) CYP2C8 A1196G ACTACTTCTCCTCACTTCTG 1 min at 57°C SSCP assay 277 bp product (K399R)(rs10509681) TGCCATGTAAATTCCAACTA ABCC2 G-1023A TTAGCTAGGATACTGCATGGG 1 min at 62°C StyI G allele 306 bp and 204 bp (rs17216114) GTGGCATCAGTCGCTAGAAA A allele 510 bp (not digested) ABCC2 C-24T TGTCCATCCACTGTTTCAATG 1 min at 58°C TaqI C allele 174 bp and 19 bp (rs717620) CTGGACTGCGTCTGGATC T allele 193 bp (not digested) ABCC2 G1249A TCACTTCCTGAGCTTCCTCTTC 1 min at 62°C HpyCH4III G allele 165 bp, 118 bp, 12 bp (V417I)(rs2273697) TGGGATTACAAGCACCATCA A allele 165 bp, 130 bp ABCC2 T3563A CCCCAGTCTTCTCATTGGTC 1 min at 62°C HphI T allele 216 bp, 120 bp, 23 bp, (V1188E)(rs8187694) CACCTGTTGGAGGTGATCCA A allele 216 bp, 141 bp, 23 bp ABCC2 G4544A TCCTGGTTATTCTTATAAATGCCTA 1 min at 60°C RsaI G allele 307 bp, 71 bp, 22 bp (C1515Y)(rs8187710) ACAATCGAGGGGTTTCTCAA A allele 196 bp, 111 bp, 71 bp, 22 bp A mismatch in the primer sequence is indicated by an underlined nucleotide. Login to comment
99 ABCC2 Genotype Frequencies in Cases and Controls W/W W/M M/M OR for possession of variant P ABCC2 G-1023A Cases (n ϭ 24) 17 (0.71) 7 (0.29) 0 Hospital controls (n ϭ 46) 41 (0.89) 3 (0.07) 2 (0.04) 3.38 (0.94-2.14) .09 Community controls (n ϭ100) 71 (0.71) 25 (0.25) 4 (0.04) 1.0 (0.38-2.69) 1.0 ABCC2 C-24T Cases (n ϭ 24) 7 (0.29) 15 (0.62) 2 (0.08) Hospital controls (n ϭ 46) 31 (0.67) 12 (0.26) 3 (0.13) 5.02 (1.71-14.7) .005 Community controls (n ϭ 100) 72 (0.72) 25 (0.25) 3 (0.03) 6.25 (2.38-16.7) .0002 G1249A (V417I) Cases (n ϭ 24) 19 (0.79) 4 (0.17) 1 (0.04) Hospital controls (n ϭ 46) 31 (0.67) 11 (0.24) 4 (0.08) 0.54 (0.17-1.74) .4 Community controls (n ϭ 100) 69 (0.69) 30 (0.30) 1 (0.01) 0.57 (0.2-1.71) .5 T3563A (V1188E) Cases (n ϭ 24) 22 (0.92) 2 (0.08) 0 Hospital controls (n ϭ 46) 41 (0.91) 5 (0.11) 0 0.75 (0.13-4.16) 1.0 Community controls (n ϭ 100) 88 (0.88) 11 (0.11) 1 (0.01) 0.67 (0.14-3.24) 1.0 Table 8. Login to comment

PMID: 17083032 [PubMed] Izzedine H et al: "Association between ABCC2 gene haplotypes and tenofovir-induced proximal tubulopathy."

No. Sentence Comment

71 All group 2 subjects were genotyped for the -24 CrT SNP (rs717620) in exon 1 and for the 1249 GrT SNP (Val417Ile; rs2273697) in exon 10 of the ABCC2 gene by 5 nuclease allelic discrimination assays (ABI PRISM 7700; Applied Biosystems). Login to comment
77 (%) P Group 1 (n p 13) Group 2 (n p 17) ABCC2 Exon 1, -24 CrT (rs717620) … Genotype .29 CC 9 (69) 11 (64) CT 3 (23) 5 (29) TT 1 (8) 1 (6) Allele C 21 (80.8) 27 (79.4) T 5 (19.2) 7 (20.6) Exon 9, 1058 GrA (rs7080681) Arg353His Genotype .43 GG 12 (92) 17 (100) GA 1 (8) 0 AA 0 0 Allele G 25 (96.2) 34 (100) A 1 (3.8) 0 Exon 10, 1249 GrA (rs2273697) Val417Ile Genotype .02 GG 3 (23) 11 (64) GA 9 (69) 6 (35) AA 1 (8) 0 Allele G 15 (57.7) 28 (82.4) A 11 (42.3) 6 (17.6) Exon 25, 3563 TrA (rs8187694) Val1188Glu Genotype .01 TT 13 (100) 10 (59) TA 0 6 (35) AA 0 1 (6) Allele T 26 (100) 26 (76.5) A 0 8 (23.5) Exon 28, 3972 CrT (rs3740066) Ile1324Ile Genotype .96 CC 6 (46) 8 (47) CT 4 (31) 7 (41) TT 3 (23) 2 (12) Allele C 16 (61.5) 23 (67.7) T 10 (38.5) 11 (32.3) Exon 32, 4544 GrA (rs8187710) Cys1515Tyr Genotype .01 GG 13 (100) 10 (59) GA 0 6 (35) AA 0 1 (6) Allele G 26 (100) 26 (76.5) A 0 8 (23.5) ABCC4 Exon 5, 559GrT (rs11568658) Gly187Trp Genotype .07 GG 10 (77) 17 (100) GT 3 (23) 0 TT 0 0 Allele G 23 (88.5) 34 (100) T 3 (11.5) 0 (continued) 1485 Table 2. Login to comment

PMID: 17112803 [PubMed] Rau T et al: "High-dose methotrexate in pediatric acute lymphoblastic leukemia: impact of ABCC2 polymorphisms on plasma concentrations."

No. Sentence Comment

106 DNA sequence Amino acid change Genotype Frequency of W allele W/W W/R R/R Exon 1 C-24T rs717620 GAAGAGTCTT C/T GTTCCAGACG - 38 20 1 0.81 (0.73-0.87) Exon 10 G1249A rs2273697 GGAGTACACC G/A TTGGAGAAAC Val417Ile 37 22 0 0.81 (0.73-0.87) Exon 21 T2780G - CTGAAGTCCC T/G GAGAAACTCC Leu927Arg 58 1 0 0.992 (0.95-0.998) Intron 21 C2883ϩ11T - GTGAACACCA C/T ACAGAAAAGT - 58 1 0 0.992 (0.95-0.998) Exon 24 C3298T - TCAGTCCTTG C/T GCAGCTGGATT Arg1100Cys 58 1 0 0.992 (0.95-0.998) Exon 24 G3299A - TCAGTCCTTGC G/A CAGCTGGATT Arg1100His 58 1 0 0.992 (0.95-0.998) Intron 27 A3844-73G - GTTCTATGAC A/G CGAGTCCTGG - 53 6 0 0.949 (0.89-0.98) Exon 28 C3972T rs3740066 CTTGTGACAT C/T GGTAGCATGG Ile1324Ile 22 32 5 0.64 (0.55-0.72) Intron 29 G4146ϩ11C rs8187703 GTGAGCTCTA G/C AACTTACTCG - 53 6 0 0.949 (0.89-0.98) Exon 30 G4290T rs7904678 CCCACGAAGT G/T ACAGAGGCTG Val1430Val 53 6 0 0.949 (0.89-0.98) Exon 31 C4488T rs8187707 ACAGGCTGCA C/T ACCATCATGG His1496His 53 6 0 0.949 (0.89-0.98) Intron 31 G4508ϩ12A rs8187708 TGAGTGTAGG G/A GGACAGGGCT - 53 6 0 0.949 (0.89-0.98) Exon 32 G4544A rs8187710 ATTATAGAGT G/A CGGCAGCCCT Cys1515Tyr 53 6 0 0.949 (0.89-0.98) DNA, Deoxyribonucleic acid. Login to comment
133 The most frequent polymorphisms in white subjects were C-24T in the 5Ј-UTR of exon 1, G1249A in exon 10 (Val417Ile), and C3972T in exon 28 (Ile1324Ile). Login to comment

PMID: 17060857 [PubMed] Naesens M et al: "Multidrug resistance protein 2 genetic polymorphisms influence mycophenolic acid exposure in renal allograft recipients."

No. Sentence Comment

45 The similarly frequent G1249A (exon 10) variant of MRP2 (allelic frequency 12.5-22%), which leads to an amino acid alteration from Val to Ile at position 417, has been associated with a reduced expression of MRP2 in preterm placentas (37). Login to comment

PMID: 16377077 [PubMed] Wada M et al: "Single nucleotide polymorphisms in ABCC2 and ABCB1 genes and their clinical impact in physiology and drug response."

No. Sentence Comment

58 Mor-Cohen analyzed in vitro two novel missense mutations identified in exon 25 in DJS [52] (Tables 1 Table 2 Naturally occurring base-change in ABCC2 gene accompanied by amino acid substitution Location (exon) Nucleic acid substitution Amino acid substitution Domain Pathogenetic consequence (biochemical defect) Frequency (%) Jews Japanese Reference 7 842GOA S281N Linker Unkown 2.4 Not reported [52] 10 1249GOA V417I MSD2 Unkown 22.7 10.9 [42,43,52]a 16 2026GOC G676R NBD1 DJSb Not reported Not reported [92] 18 2302COT R768W NBD1 DJS (protein maturation) Not reported 0.4? Login to comment

PMID: 15821043 [PubMed] Meyer zu Schwabedissen HE et al: "Variable expression of MRP2 (ABCC2) in human placenta: influence of gestational age and cellular differentiation."

No. Sentence Comment

187 This polymorphism causes a substitution of valine417 by isoleucine. Login to comment
221 TABLE 3 C-24T G1249 (Val417Ile) and C3972T variants of the MRP2 gene in the population and in terms and preterms (preterm data in parentheses) Genotype Number Position Identified Frequency Expected Frequency Allele Allelic Frequency % C/C 37 -24 63.8 67.2 C 0.82 20 (17) 62.5 (65.4) 65.6 (68.9) 0.81 (0.83) C/T 21 -24 36.2 29.5 T 0.18 12 (9) 37.5 (34.6) 30.8 (28.2) 0.19 (0.17) T/T 0 -24 0 3.2 0 0 (0) 3.6 (2.9) G/G 37 1249 63.7 60.8 G 0.78 16 (21) 50.0 (80.8) 49.0 (74.0) 0.70 (0.86) G/A 16 1249 29.3 34.3 A 0.22 13 (3) 40.6 (11.5) 42.0 (22.4) 0.30 (0.13) A/A 5 1240 8.6 4.8 3 (2) 9.4 (7.7) 9.0 (1.8) C/C 22 3972 39.7 37.4 C 0.62 11 (11) 34.4 (46.1) 35.2 (40.3) 0.59 (0.65) C/T 27 3972 46.6 47.6 T 0.38 16 (11) 50 (42.3) 48.4 (45.5) 0.41 (0.35) T/T 9 3972 15.5 15.0 5 (4) 15.6 (15.4) 16.8 (12.2) 2) versus preterms: 1249 AA, 0.47 (n ϭ 2); Kruskal-Wallis test: ␹2 ϭ 1.895; df ϭ 2; p ϭ 0.428]. Login to comment

PMID: 15180328 [PubMed] Hirouchi M et al: "Characterization of the cellular localization, expression level, and function of SNP variants of MRP2/ABCC2."

No. Sentence Comment

7 The transport activity for E217betaG, LTC4, and DNP-SG, normalized by the expression level of MRP2, was similar between the wild-type, V417I, and A1450T MRP2s. Login to comment
9 However, the expression level of S789F and A1450T MRP2 proteins was significantly lower compared with the wild-type and V417I MRP2. Login to comment
10 In addition, although the wild-type and V417I MRP2 were exclusively localized in the apical membrane, S789F and A1450T MRP2 were located in the apical membrane and also in the intracellular compartment. Login to comment
12 These results suggest that the most frequently observed V417I substitution may not affect the in vivo function of MRP2, whereas the much less frequently observed S789F and A1450T may be associated with the reduced in vivo function. Login to comment
25 Among them, only G1249A is associated with amino acid alterations, from Val to Ile at amino acid position 417 (19). Login to comment
43 We have generated the following four kinds of missense mutations reported previously: Val417Ile, Arg768Trp, Ser789Phe, and Ala1450Thr. Login to comment
86 The expression level of V417I, S789F, and A1450T MRP2 was 82% and 80%, 23% and 25%, and 18% and 8%, respectively, in duplicate experiments (Fig. 1). Login to comment
94 V417I MRP2 showed the same localization as wild-type MRP2 (Fig. 2), whereas two variants (S789F and A1450T MRP2s) were expressed not only at the apical surface, but also intracellularly (Fig. 2). Login to comment
100 As shown in Fig. 4, no significant difference was observed between the wild-type and V417I MRP2s, whereas S789F MRP2 showed approximately a 1.4-to 2.0-fold higher uptake of three substrates compared with the wild-type MRP2 (Fig. 4). Login to comment
123 Key: ᭺, tTA; ᭹, wt-MRP2; ᮀ, V417I; ᭿, S789F; ᭝, A1450T. Login to comment
136 V417I and S789F MRP2s showed similar substrate specificity for glucuronide- and glutathione-conjugates to that of wild-type MRP2 (Figs. 3 and 4). Login to comment
145 Wild-type and V417I MRP2s exhibited apical localization, which is consistent with the localization under physiological conditions. Login to comment
146 Moreover, the expression level of V417I MRP2 in isolated membrane vesicles was the same as that of wild-type MRP2. Login to comment
147 Together with the finding that the transport activity of V417I MRP2 is the same as that of wild-type MRP2, this suggests that it is possible that these frequently found SNPs may not affect the disposition of substrate drugs among individuals. Login to comment
169 It is suggested that the most frequently observed amino acid substitution (V417I) may not affect the drug disposition mediated by MRP2. Login to comment

PMID: 11901087 [PubMed] Itoda M et al: "Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found in 72 established cell lines derived from Japanese individuals: an association between single nucleotide polymorphisms in the 5'-untranslated region and exon 28."

No. Sentence Comment

4 Four SNPs, c-24t, g1249a (V417I), c2366t (S789F), and c3972t (I1324I), were the same as those recently reported. Login to comment
26 The amino acid substitutions S789F (c2366t) and S1367C (c4100g) were reportedly located in nucleotide binding domains 1 and 2, respectively, those of V417I (g1249a) and T486I (c1457t) in membrane-spanning domain 2, and that of Q1019H (g3057t) in membrane spanning domain 3 (Toh et al., 1999). Login to comment
29 It was strongly suggested that functional changes by the V417I, S789F, D883N, Q1019H, N1244K, S1367C, and C1515Y alterations seemed to be worth assessing because the TM1 to TM5 domains (200 N-terminal amino This study was supported in part by the Program for Promotion of Fundamental Studies in Health Sciences (MPJ-6) of the Organization for Pharmaceutical Safety and Research of Japan. Login to comment
57 Location Substitution Genotype 72 Cell Linesa (48 Subjects)b Nucleotide Amino Acid w/w w/m m/m 5Ј-Flanking t-751a 71 1 0 5Ј-Flanking c-717t 71 1 0 5Ј-UTR c-24t 52 (31) 14 (16) 6 (1) 5Ј-UTR g-23a 70 2 0 Exon 2 c56t P19L 71 1 0 Exon 3 a234g L78L 71 1 0 Exon 3 g299a R100Q 71 1 0 Exon 7 g842a S281N 71 1 0 Exon 10 g1249a V417I 59 (37) 9 (10) 4 (1) Exon 10 c1457t T486I 69 2 1 Exon 18 c2302t R768W 72 (47) 0 (1) 0 (0) Exon 18 c2366t S789F 71 (47) 1 (1) 0 (0) Exon 20 g2647a D883N 71 1 0 Exon 21 a2882g K961R 71 1 0 Exon 22 g2934a S978S 66 5 1 Exon 22 c3039t T1013T 71 0 1 Exon 22 g3057t Q1019H 71 1 0 Exon 24 g3321t L1107L 71 1 0 Exon 25 g3521a R1174H 71 1 0 Exon 25 t3563a V1188E 71 1 0 Exon 26 t3732g N1244K 71 0 1 Exon 28 c3972t I1324I 49 (29) 14 (17) 9 (2) Exon 29 c4100g S1367C 71 1 0 Exon 30 g4290t V1430V 71 1 0 Exon 31 g4348a A1450T 72 (47) 0 (1) 0 (0) Exon 31 c4488t H1496H 71 1 0 Exon 32 g4544a C1515Y 71 1 0 UTR, untranslated region. Login to comment

PMID: 11477083 [PubMed] Mor-Cohen R et al: "Identification and functional analysis of two novel mutations in the multidrug resistance protein 2 gene in Israeli patients with Dubin-Johnson syndrome."

No. Sentence Comment

120 Identification of Novel Polymorphisms in the MRP2 Gene- Four dimorphisms in the MRP2 gene were identified: 1) -24C3T in the 5Ј-untranslated region, 2) 842G3A in exon 7 predicting a S281N substitution, 3) 1249G3A in exon 10 predicting a V417I substitution, and 4) IVS29-35G3A. Login to comment
204 Two were in non-coding regions of the gene, -24C3T and IVS29-35G3A, and two were in coding regions of the gene, 842G3A and 1249G3A predicting S281N and V417I substitutions, respectively. Login to comment

PMID: 21606946 [PubMed] Ansari M et al: "Polymorphism in multidrug resistance-associated protein gene 3 is associated with outcomes in childhood acute lymphoblastic leukemia."

No. Sentence Comment

52 A false discovery rate correction was performed to adjust for multiple comparisons using Q-value Table 1 Identity of polymorphisms, details of PCR and ASO hybridization Polymorphisms PCR ASO Gene dbSNP Position Variation Primers Probes MRP2 rs1885301 À1519 A/G F: 50 -TCATATACCTGTTGGCCATT-30 50 -TATAGTATGTTGTGGATA-30 R: 50 -GTATGGACCTTGTTACTGAT-30 50 -TATAGTATATTGTGGATA-30 rs7910642 À993 G/A F: 50 -TTAGCTAGGATACCGCATGG-30 50 -AGGCCAAGGCAGAAGGA-30 R: 50 -ATGTTTTCTGTAGGGACGGG-30 50 -AGGCCAAGACAGAAGGA-30 rs2804402 À989 C/T F: 50 -ATGTTTTCTGTAGGGACGGG-30 50 -AACAATCCTTCTGCCTTG-30 R: 50 -TTAGCTAGGATACCGCATGG-30 50 -AACAATCCTCCTGCCTTG-30 rs717620 À24 G/A F: 50 -CCACTTGTTCTGAGTCTGAG-30 50 -TCTGGAACGAAGACTC-30 R: 50 -GGTCATCCTTTACGGAGAAC-30 50 -TCTGGAACAAAGACTC-30 rs2273697 1249 G/A (Val417Ile) F: 50 -GTGTCCATATGGAGCACATC-30 50 -AGTACACCGTTGGAGA-30 R: 50 -TACAAGCACCATCACCCCAA-30 50 -AGTACACCATTGGAGA-30 rs17222723 3563 T/A (Val1188Glu) F: 50 -ATGGTGGATGCCTCATGACT-30 50 -CAATGAGGTGAGGATTG-30 R: 50 -GTGTGTGGCCAGAGTGAATT-30 50 -CAATGAGGAGAGGATTG-30 rs8187710 4544 A/G (Cys1515Tyr) F: 50 -TCAGGGTAATGGTCCTAGAC-30 50 -TATAGAGTGCGGCAGCC-30 R: 50 -TCCTTTTCTAACCCATGGGG-30 50 -TATAGAGTACGGCAGCC-30 MRP3 rs1989983 À1696 A/G F: 50 -CATGACCAGGGTCATGGAAG-30 50 -TCCCAGAGGCATCAAGG-30 R: 50 -GCTAATCTGAGAGGTCCCCA-30 50 -TCCCAGAGACATCAAGG-30 rs9895420 À189 A/T F: 50 -GTGGGAGCGCCTGTGTATCC-30 50 -TCCCCCTGGCTTGGCCCA-30 R: 50 -AGTGCCTCTGGGTCCGGTCT-30 50 -TCCCCCTGGCATGGCCCA-30 rs4793665 À140 C/T F: 50 -GTGGGAGCGCCTGTGTATCC-30 50 -AAGGGCCCCCCCACCTCT-30 R: 50 -AGTGCCTCTGGGTCCGGTCT-30 50 -AAGGGCCCCCCTACCTCT-30 rs11568591 3890 G/A (Arg1297His) F: 50 -ATCTGCCCCTCCTGCCAGGC-30 50 -TATTCTGTGCGCTACCG-30 R: 50 -CGCCTACCCCACGCGTACCT-30 50 -TATTCTGTGCACTACCG-30 MRP5 rs7627754 À1629 A/T F: 50 -GAACTTGGGAGTAGGAAAGA-30 50 -GAATAATAAATATTCAAA-30 R: 50 -GGCTGCTCAAGTTTCCTATT-30 50 -GAATAATAATTATTCAAA-30 rs1520195 À1155 T/C F: 50 -TGGATGCACCAGTCTGTTTG-30 50 -ACTAGCTAGCTGTTATAA-30 R: 50 -CTCACCCCGCCGTATTTTTT-30 50 -ACTAGCTAGTTGTTATAA-30 rs562 5638 C/T F: 50 -CACTCCCTTCCCAGAGAATT-30 50 -CCATTCAATTGATGACAG-30 R: 50 -AAGAGACCTACCTCAGGTTG-30 50 -CCATTCAACTGATGACAG-30 Abbreviations: ASO, allele-specific oligonucleotide; F, forward; MRP, multidrug resistance-related protein; R, reverse; SNP, single-nucleotide polymorphism. Login to comment
131 Several polymorphisms have been widely studied in MRP2 gene including 50 UTR C-24 T substitution and non-synonymous G1249A, T3563A and G4544A variations leading to Val417Ile, Val1188Glu and Cys1515Tyr amino-acid replacements, respectively. Login to comment
135 MRP2 Val417Ile was associated with an increased intestinal efflux and a significant decreased bioavailability of the b-blocker talinolol,44,49 in line with the observation of a higher gastrointestinal toxicity of MTX in African Americans treated for rheumatoid arthritis.50 Val1188Glu and Cys1515Tyr correlated with higher mRNA and protein expression in liver51 and with anthracycline-induced cardiotoxicity in non-Hodgkin lymphoma patients.52 We did not find significant association of these polymorphisms with endpoints studied in our ALL patients. Login to comment

PMID: 16815813 [PubMed] Choudhuri S et al: "Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters."

No. Sentence Comment

314 Six types of SNPs were identified, of which C24T (promoter), a missense mutation G1249A (Val417Ile), and a silent mutation C3972 (Ile1324) were frequently observed with an allelic frequency of 18.8%, 12.5%, and 21.9%, respectively. Login to comment
321 They found that the most frequently observed amino acid substitution (Val417Ile) as well as the two less frequently observed amino acid substitutions (Ser789Phe and Ala1450Thr) may not affect drug disposition function of MRP2. Login to comment

PMID: 22063461 [PubMed] Diaz-Padilla I et al: "Genetic polymorphisms as predictive and prognostic biomarkers in gynecological cancers: a systematic review."

No. Sentence Comment

1009 c Other polymorphisms evaluated in Marsh et al.: ABCC1 S1334S, ABCC1 IVS19-30C>G, ABCC2 24C>T, ABCC2 IVS12+148A>G, ABCC2 V417I, ABCG2 Q141K, CYP2C8 M264I, CYP2C8 R139K, CYP2C8 K399R, CYP3A4*1B, CYP3A4*3, CYP3A5*3C, ERCC1 17677G>T, MAPT P587P, MPO-463G>A, CDKN1A 10971C>T, CYP1B1*3. d The HR is outside of the 95% CI, authors were not able to resolve these contradictory numbers. Login to comment

PMID: 23396606 [PubMed] Vulsteke C et al: "Genetic variability in the multidrug resistance associated protein-1 (ABCC1/MRP1) predicts hematological toxicity in breast cancer patients receiving (neo-)adjuvant chemotherapy with 5-fluorouracil, epirubicin and cyclophosphamide (FEC)."

No. Sentence Comment

118 rs17222723 c.3563T>A Val1188Glu rs2273697 c.1249G>A Val417Ile DPD Dihydropirymidine dehydrogenase Enzyme involved in the degradation of pyrimidine and uracil analogs during 5-FU chemotherapy rs1801159 c.1627A>G Ile543Val Selected because missense mutations are likely to affect gene function. Login to comment

PMID: 25881102 [PubMed] Lambrechts S et al: "Genetic variability in drug transport, metabolism or DNA repair affecting toxicity of chemotherapy in ovarian cancer."

No. Sentence Comment

111 The following 7 genetic variants failed genotyping: rs2032582 (Ser893Ala in ABCB1), rs2273697 (Val417Ile in ABCC2), rs1058930 (Ile194Met in CYP2C8), rs11572080 (Arg69Lyes in CYP2C8), rs10509681 (Lys329Arg in CYP2C8), rs12721627 (Thr185Ser in CYP3A4), rs25487 (Gln398Arg in XRCC1). Login to comment

PMID: 24732756 [PubMed] Ulzurrun E et al: "Selected ABCB1, ABCB4 and ABCC2 polymorphisms do not enhance the risk of drug-induced hepatotoxicity in a Spanish cohort."

No. Sentence Comment

63 Samples and controls were genotyped for the ABCB1 c.1236T.C (p.Gly412Gly, rs1128503), c.3435T.C (p.Ile1145Ile, rs1045642), ABCB4 c.1954A.G (p.Arg652Gly, rs2230028) and ABCC2 c.-1549A.G (rs1885301), c.-24C.T (rs717620), c.1249G.A (p.Val417Ile, rs2273697), c.3972C.T (p.Ile1324Ile, rs3740066) and c.4544G.A (p.Cys1515Tyr, rs8187710) using a validated 59-nuclease PCR based assay with allele specific fluorescent probes (TaqMan SNP Genotyping Assays, Applied Biosystems, Foster City, CA, USA) as previously described [23]. Login to comment

PMID: 26535588 [PubMed] Nishijima T et al: "Drug Transporter Genetic Variants Are Not Associated with TDF-Related Renal Dysfunction in Patients with HIV-1 Infection: A Pharmacogenetic Study."

No. Sentence Comment

97 >10 ml/min/1.73 m2 decrement in eGFR from baseline >25% decrement in eGFR from baseline eGFR <60 ml/min/1.73 m2 Amino acid >10 ml/min/ 1.73 m2 decrement (n = 624) No decrement (n = 79) P value* >25% decrement (n = 119) No decrement (n = 584) P value* <60 ml/ min/1.73 m2 (n = 126) No decrement (n = 577) P value* ABCC2 (MRP2) -24 C!T, rs717620 C/C 382 (61) 51 (65) 76 (64) 357 (61) 83 (66) 350 (61) C/T 215 (35) 27 (34) 0.53 38 (32) 204 (35) 0.83 38 (30) 204 (35) 0.51 T/T 27 (4) 1 (1) 5 (4) 23 (4) 5 (4) 23 (4) 1249 G!A, rs2273697 Val417Ile G/G 483 (78) 61 (77) 93 (78) 451 (77) 100 (79) 444 (77) A/G 132 (21) 16 (20) 0.68 24 (20) 124 (21) 0.97 24 (19) 124 (21) 0.81 A/A 9 (1) 2 (3) 2 (2) 9 (2) 2 (2) 9 (2) ABCB1 (P-glycoprotein) 2677T!A/ G, rs2032582 A: Ser893Thr G: Ser893Ala T/T 112 (18) 13 (16) 19 (16) 106 (18) 21 (17) 104 (18) T/A 77 (12) 13 (16) 22 (18) 68 (11) 18 (14) 72 (12) G/G 122 (20) 13 (16) 0.74 20 (17) 115 (20) 0.40 21 (17) 114 (20) 0.94 G/T 195 (31) 29 (37) 39 (33) 185 (32) 41 (32) 183 (32) G/A 96 (15) 9 (12) 17 (14) 88 (15) 20 (16) 85 (15) A/A 22 (4) 2 (3) 2 (2) 22 (4) 5 (4) 19 (3) *By use of Fisher`s exact test for 2&#d7;3 table (2&#d7;6 table for rs2032582). Login to comment
102 >10 ml/min/1.73 m2 decrement in eGFR from baseline >25% decrement in eGFR from baseline eGFR <60 ml/min/1.73 m2 Amino acid >10 ml/min/ 1.73 m2 decrement (n = 624) No decrement (n = 79) P value* >25% decrement (n = 119) No decrement (n = 584) P value* <60 ml/ min/1.73 m2 (n = 126) No decrement (n = 577) P value* ABCC2 (MRP2) -24 C!T, rs717620 C/C 302 (62) 131 (61) 79 (64) 354 (61) 38 (66) 395 (61) C/T 166 (34) 76 (36) 0.59 39 (31) 203 (35) 0.62 18 (31) 224 (35) 0.91 T/T 22 (4) 6 (3) 6 (5) 22 (4) 2 (3) 26 (4) 1249 G!A, rs2273697 Val417Ile G/G 386 (79) 158 (74) 98 (79) 446 (77) 45 (78) 499 (77) A/G 95 (19) 53 (25) 0.20 24 (19) 124 (21) 0.86 12 (21) 136 (21) 1.00 A/A 9 (2) 2 (1) 2 (2) 9 (2) 1 (1) 10 (2) ABCB1 (P-glycoprotein) 2677T!A/ G, rs2032582 A: Ser893Thr G: Ser893Ala T/T 83 (17) 42 (20) 19 (15) 106 (18) 9 (15) 116 (18) T/A 62 (13) 28 (13) 24 (19) 66 (11) 8 (14) 82 (13) G/G 95 (19) 40 (19) 0.95 21 (17) 114 (20) 0.22 12 (21) 123 (19) 0.76 G/T 157 (32) 67 (31) 41 (33) 183 (32) 15 (26) 209 (32) G/A 75 (15) 30 (14) 17 (14) 88 (15) 12 (21) 93 (14) A/A 18 (4) 6 (3) 2 (2) 22 (4) 2 (3) 22 (4) *By use of Fisher`s exact test for 2&#d7;3 table (2&#d7;6 table for rs2032582). Login to comment
46 Genetic polymorphisms The selected SNPs were 1) -24C!T (in the promoter; rs717620) and 2) 1249G!A (Val417Ile; rs2273697) of ABCC2 gene, because they are the only SNPs that have consistently shown close association with tenofovir-induced tubulopathy in previous studies [11,13,16]. Login to comment

PMID: 23115734 [PubMed] Kim SH et al: "ABCC2 Haplotype is Associated With Antituberculosis Drug-Induced Maculopapular Eruption."

No. Sentence Comment

35 Polymorphisms of ABCC2 in patients with ATD-induced MPE and controls Among seven SNPs in ABCC2, IVS3-49C>T and I1324I were significantly associated with ATD-induced MPE (P=0.029 for therecessivemodel,OR=3.15,95%CI:1.09-9.11andP=0.036for theallelemodel,OR=0.029,95%CI:1.12-9.53,respectively).The genotypefrequenciesoftheotherfiveABCC2SNPs(-1774del>G, -1549G>A, -24C>T, V417I, and S978S) did not differ between cases and control subjects (Table 2). Login to comment
51 Genotype frequencies of SNPs in the ABCC2 gene in patients with ATD-induced MPE and ATD-tolerant controls SNP Genotype ATD-MPE (N=62) ATD-Control (N=159) Pvalue OR (95%CI) -1774del>G GG 23 (37.1%) 43 (27.4%) NS G/- 31 (50.0%) 94 (59.9%) -/- 8 (12.9%) 20 (12.7%) -1549G>A GG 30 (48.4%) 89 (57.1%) NS GA 24 (38.7%) 60 (38.5%) AA 8 (12.9%) 7 (4.5%) -24C>T CC 33 (53.2%) 92 (59.4%) NS CT 23 (37.1%) 57 (36.8%) TT 6 (9.7%) 6 (3.9%) IVS3-49C>T CC 30 (48.4%) 91 (57.2%) 0.029* 3.27 (1.12-9.53) CT 24 (38.7%) 61 (38.4%) TT 8 (12.9%) 7 (4.4%) V417I GG 52 (83.9%) 134 (84.3%) NS GA 9 (14.5%) 23 (14.5%) AA 1 (1.6%) 2 (1.3%) S978S GG 58 (93.6%) 147 (92.5%) NS GA 4 (6.4%) 12 (7.6%) AA 0 (0.0%) 0 (0.0%) I1324I CC 29 (46.8%) 91 (58.3%) 0.036ߤ 1.63 (1.03-2.60) CT 25 (40.3%) 56 (35.9%) TT 8 (12.9%) 9 (5.8%) *P value was calculated using the recessive model; ߤ P values were calculated using the allele model. Login to comment

PMID: 23232902 [PubMed] Mirakhorli M et al: "Multidrug resistance protein 2 genetic polymorphism and colorectal cancer recurrence in patients receiving adjuvant FOLFOX-4 chemotherapy."

No. Sentence Comment

28 This MRP2 polymorphism results in an amino acid alteration from Val to Ile at position 417, located in membrane spanning domain 2 of the protein. Login to comment

PMID: 24325761 [PubMed] Chen P et al: "The effects of ABCC2 G1249A polymorphism on the risk of resistance to antiepileptic drugs: a meta-analysis of the literature."

No. Sentence Comment

21 The G1249A (Val417Ile, rs2273697) polymorphism, which is associated with the substitution of Val with an Ile at position 417, is one of the most common polymorphisms in the ABCC2 gene, and its role in epilepsy pharmacoresistance has been the focus of recent research (Ito et al., 2001; Obata et al., 2006; Kim et al., 2010). Login to comment
100 The G1249A variant, a G to A base change that causes a substitution of isoleucine for valine at position 417 in the ABCC2 gene, has been suggested to influence ABCC2 function (Ito et al., 2001; Itoda et al., 2002; Suzuki and Sugiyama, 2002). Login to comment

PMID: 24465238 [PubMed] Yi JH et al: "Genetic Variations of ABCC2 Gene Associated with Adverse Drug Reactions to Valproic Acid in Korean Epileptic Patients."

No. Sentence Comment

36 The c.2302C &#ff1e; T and c.4348G &#ff1e; A genotypes correlate with significantly lower MRP2 protein expression levels compared to wild-type and V417I [21]. Login to comment
76 Based on logistic regression, ADRs were more likely to occur in Variant Allele Control Epilepsy patient p-value CNS ADR-Yes CNS ADR-No g.ߜ1774delG G 146 (66.4) 65 (79.3) 158 (62.7) 0.0057** del 74 (33.6) 17 (20.7) 94 (37.3) g.ߜ1549G > A G 174 (79.1) 59 (72.0) 199 (80.2) 0.1151 A 46 (20.6) 23 (28.0) 49 (19.8) g.ߜ24C > T C 182 (72.7) 54 (65.9) 198 (78.0) 0.0278* rs717620 T 38 (17.3) 28 (34.1) 56 (22.0) g.ߜ23G > A G 215 (97.7) 82 (100.0) 253 (99.6) 0.5693 A 5 (2.3) 0 (0.0) 1 (0.4) c.1249G > A G 199 (90.5) 73 (89.0) 235 (92.5) 0.3194 (p.V417I, rs2273697) A 21 (9.5) 9 (11.0) 19 (7.5) c.1457C > T C 217 (98.6) 82 (100.0) 254 (100.0) - (p.T486I) T 3 (1.4) 0 (0.0) 0 (0.0) c.2620 + 3A > G A 220 (100) 82 (100.0) 254 (100.0) - G 0 0 (0.0) 0 (0.0) c.2934G > A G 209 (95.0) 79 (96.3) 244 (96.1) 0.9095 (p.S978S, rs3740070) A 11 (5.0) 3 (3.7) 10 (3.9) c.3972C > T C 169 (76.8) 53 (64.6) 192 (75.6) 0.0522 (p.I1324I, rs3740066) T 51 (23.2) 29 (35.4) 62 (24.4) c.4147 ߜ 35G > A G 217 (98.6) 80 (97.6) 253 (99.6) 0.0869 A 3 (1.4) 2 (2.4) 1 (0.4) c.4508 + 12G > A G 218 (99.1) 82 (100.0) 254 (100.0) - A 2 (0.9) 0 (0.0) 0 (0.0) Values are presented as number (%). Login to comment
104 Frequency of MRP2 haplotypes in control and epilepsy patients Variant Control Epilepsy patient p-value CNS ADR-Yes CNS ADR-No g.ߜ1774delG +/+a 50 (45.5) 25 (61.0) 50 (39.7) 0.019* +/ߜ 46 (41.8) 15 (36.6) 58 (46.0) ߜ/ߜ 14 (12.7) 1 (2.4) 18 (14.3) g.ߜ1549G > A +/+ 66 (60.0) 21 (51.2) 82 (66.1) 0.440 +/ߜ 42 (38.2) 17 (41.5) 35 (28.2) ߜ/ߜ 2 (1.8) 3 (7.3) 7 (5.6) g.ߜ24C > T +/+ 74 (67.3) 17 (41.5) 79 (62.2) 0.243 rs717620 +/ߜ 34 (30.9) 20 (48.8) 40 (31.5) ߜ/ߜ 2 (1.8) 4 (9.8) 8 (6.3) g.ߜ23G > A +/+ 105 (95.5) 41 (100.0) 126 (99.2) >0.999 +/ߜ 5 (4.5) 0 (0.0) 1 (0.8) c.1249G > A +/+ 92 (83.6) 32 (78.0) 109 (85.8) >0.999 (p.V417I) +/ߜ 15 (13.6) 9 (22.0) 17 (13.4) rs2273697 ߜ/ߜ 3 (2.7) 0 (0.0) 1 (0.8) c.1457C > T +/+ 107 (97.3) 41 (100.0) 127 (100.0) - (p.T486I) +/ߜ 3 (2.7) 0 (0.0) 0 (0.0) c.2620 + 3A > G +/+ 110 (100.0) 41 (100.0) 127 (100.0) - c.2934G > A +/+ 100 (90.9) 38 (92.7) 117 (92.1) - (p.S978S) +/ߜ 9 (8.2) 3 (7.3) 10 (7.9) rs3740070 ߜ/ߜ 1 (0.9) 0 (0.0) 0 (0.0) c.3972C > T +/+ 61 (55.5) 17 (41.5) 74 (58.3) 0.164 (p.I1324I) +/ߜ 47 (42.7) 19 (46.3) 44 (34.6) rs3740066 ߜ/ߜ 2 (1.8) 5 (12.2) 9 (7.1) c.4147 ߜ 35G > A +/+ 107 (97.3) 39 (95.1) 126 (99.2) 0.141 +/ߜ 3 (2.7) 2 (4.9) 1 (0.8) c.4508 + 12G > A +/+ 108 (98.2) 41 (100.0) 127 (100.0) - +/ߜ 2 (1.8) 0 (0.0) 0 (0.0) Values are presented as number (%). Login to comment

PMID: 24991206 [PubMed] Goricar K et al: "Polymorphisms in folate pathway and pemetrexed treatment outcome in patients with malignant pleural mesothelioma."

No. Sentence Comment

35 MTHFD1 rs2236225 (Arg653Gln), MTHFR rs1801133 (Ala222Val) and rs1801131 (Glu429Ala), SLCO1B1 rs2306283 (Asn130Asp), and ABCB1 rs1045642 (Ile1145Ile) polymorphisms were determined using TaqMan SNP Genotyping assays according to the manufacturer`s instructions (Applied Biosystems, Foster City, CA) as previously described.22 Genotyping of MTRR rs1801394 (Ile22Met), MTR rs1805087 (Asp919Gly), SLC19A1 rs1051266 (Arg27Cys), SLCO1B1 rs11045879 (intronic), rs4149056 (Val174Ala) and rs2900478 (intronic), ABCC2 rs717620 (5` untranslated region (UTR) -24C>T), rs2273697 (Val417Ile) and rs2804402 (5` UTR -1019A>G), ABCC4 rs2274407 (Lys304Asn), and ABCG2 rs2231142 (Gln141Lys) and rs2231137 (Val12Met) polymorphisms was carried out using a fluorescence-based competitive allele-specific (KASPar) assay according to the manufacturer`s instructions (KBiosciences, Herts, UK). Login to comment