PMID: 17060857

Naesens M, Kuypers DR, Verbeke K, Vanrenterghem Y
Multidrug resistance protein 2 genetic polymorphisms influence mycophenolic acid exposure in renal allograft recipients.
Transplantation. 2006 Oct 27;82(8):1074-84., [PubMed]
Sentences
No. Mutations Sentence Comment
45 ABCB1 p.Gly1249Ala
X
ABCB1 p.Gly1249Ala 17060857:45:23
status: NEW
view ABCB1 p.Gly1249Ala details
ABCC2 p.Val417Ile
X
ABCC2 p.Val417Ile 17060857:45:131
status: NEW
view ABCC2 p.Val417Ile details
The similarly frequent G1249A (exon 10) variant of MRP2 (allelic frequency 12.5-22%), which leads to an amino acid alteration from Val to Ile at position 417, has been associated with a reduced expression of MRP2 in preterm placentas (37). Login to comment
82 ABCB1 p.Gly1249Ala
X
ABCB1 p.Gly1249Ala 17060857:82:176
status: NEW
view ABCB1 p.Gly1249Ala details
150 ␮L of GeneAmp௡ 10ϫ PCR buffer and GeneAmp MgCl2 (Applied Biosystems) were added to the PCR mixture, to a MgCl2 concentration of 1.5 mmol/L for C-24T and G1249A and of 2.0 mmol/L for the other MRP2 SNPs. Login to comment
83 ABCB1 p.Gly1249Ala
X
ABCB1 p.Gly1249Ala 17060857:83:477
status: NEW
view ABCB1 p.Gly1249Ala details
Then 10 ␮L of PCR mixture was added to 5 ␮L of 10 ng/␮L DNA to a final PCR reaction volume of 15 ␮L. PCR conditions were as follows: 12 min at 95°C; 35 cycles of 30 sec at 93°C, 35 sec at 55°C, 30 sec at 72°C; and finally five min at 72°C for the C-24TSNP and 12 min at 95°C. Annealing temperature was respectively 56°C, 60°C, 60°C, 63°C, 58°C, and 58°C for the G-1549A, G-1023A, A-1019G, G1249A, C3972T and G4544A SNP. Login to comment
89 ABCB1 p.Gly1249Ala
X
ABCB1 p.Gly1249Ala 17060857:89:625
status: NEW
view ABCB1 p.Gly1249Ala details
Primers and restriction enzymes used for restriction fragment length polymorphism analysis of MRP2 and UGT1A9 single nucleotide polymorphisms Gene Polymorphism Primers Restriction enzymes MRP2 A-1549G FW 5Ј tgacttgtgaagttgattcagttg 3Ј AccI REV 5Ј aactgatgaagagttaatatccacag 3Ј G-1023A FW 5Ј agcaatttaagtgacagtacaaaagg 3Ј StyI REV 5Ј gtctcaaactccaggcttcaacaatcat 3Ј A-1019G FW 5Ј agcaatttaagtgacagtacaaaagg 3Ј BstF5I REV 5Ј gtctcaaactccaggcttcaacaatcat 3Ј C-24T FW 5Ј ctgttccactttctttgatga 3Ј BbsI REV 5Ј tcttgttggtgaccaccctaa 3Ј G1249A FW 5Ј gggcaaagaagtgtgtggat 3Ј NcoI REV 5Ј acatcaggttcactgtttctccca 3Ј C3972T FW 5Ј aacttacttctcatcttgtctccttgc 3Ј ClaI REV 5Ј ctccacctaccttctccatgctatc 3Ј G4544A FW 5Ј gtaaaacgacggccagtggcctagacttgagatgctgct 3Ј RsAI REV 5Ј aacagctatgaccatgttcacttatccttttttaaaacgtaca 3Ј UGT1A9 C-2152T FW 5Ј ttgagacagagtcgtgctgttt 3Ј MseI REV 5Ј aggtcaaggtgggcgtatc 3Ј T-275A FW 5Ј tcagtgctaagggccttgtt 3Ј XbaI REV 5Ј cctgtgctgcaatgttaagtcta 3Ј T98C FW 5Ј gttctctgatggcttgcaca 3Ј StyI REV 5Ј atgccccctgagaatgagtt 3Ј were compared by the chi-square test for association. Login to comment
107 ABCB1 p.Gly1249Ala
X
ABCB1 p.Gly1249Ala 17060857:107:56
status: NEW
view ABCB1 p.Gly1249Ala details
Testing the influence of the G-1549A, G-1023A, A-1019G, G1249A and G4544A SNP on dose-corrected MPA pharmacokinetics, no significant effect was noted at seven days after transplantation. Login to comment
125 ABCB1 p.Gly1249Ala
X
ABCB1 p.Gly1249Ala 17060857:125:318
status: NEW
view ABCB1 p.Gly1249Ala details
Also similarly to the C-24T SNP, there was no differential effect of liver dysfunction on MPA exposure parameters in patients carrying the C3972T SNP (nϭ49) (MPA AUC0-12/dose 73.9Ϯ50.8 vs. 73.9Ϯ27.6 mg.hr/L.g;PϭNS).Therewerenodifferentialeffectsoftheother MRP2 SNPs (G-1549A, G-1023A, A-1019G, G1249A, G4544A) on MPA pharmacokinetics in patients with or without liver dysfunction (data not shown). Login to comment
137 ABCB1 p.Gly1249Ala
X
ABCB1 p.Gly1249Ala 17060857:137:50
status: NEW
view ABCB1 p.Gly1249Ala details
The other MRP2 SNPs (G-1549A, G-1023A, A-1019 and G1249A) were not associated with differences in MPA pharmacokinetics at these later time points. Login to comment