ABCMdb

PMID: 21691255

Megaraj V, Zhao T, Paumi CM, Gerk PM, Kim RB, Vore M
Functional analysis of nonsynonymous single nucleotide polymorphisms of multidrug resistance-associated protein 2 (ABCC2).
Pharmacogenet Genomics. 2011 Aug;21(8):506-15., [PubMed]

Sentences

No. Mutations Sentence Comment

2 ABCC2 p.Val417Ile ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Thr1477Met Objectives To characterize the transport function of human wild-type (WT) MRP2 and four SNP variants, S789F, A1450T, V417I, and T1477M. Login to comment 6 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr Results The Vmax for transport activity was decreased for all substrates for S789F, and for all substrates except E217G for A1450T. Login to comment 7 ABCC2 p.Val417Ile ABCC2 p.Thr1477Met V417I showed decreased apparent affinity for LTC4, E23G, and E217G, whereas transport was similar between wild-type (WT) and T1477M, except for a modest increase in TUDC transport. Login to comment 8 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr Examination of substrate-stimulated MRP2-dependent ATPase activity of S789F and A1450T, SNPs located in MRP2 nucleotide-binding domains (NBDs), demonstrated significantly decreased ATPase activity and only modestly decreased affinity for ATP compared with WT. Login to comment 9 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr Conclusion SNPs in the NBDs (S789F in the D-loop of NBD1, or A1450T near the ABC signature motif of NBD2) variably decreased the transport of all substrates. Login to comment 10 ABCC2 p.Val417Ile ABCC2 p.Thr1477Met V417I in membrane spanning domain 1 selectively decreased the apparent affinity for the glutathione and glucuronide conjugated substrates, whereas the T1477M SNP in the carboxyl terminus altered only TUDC transport. Login to comment 48 ABCC2 p.Val417Ile ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Thr1477Met Construction of recombinant baculovirus containing multidrug resistance protein 2 The plasmid (pEF6/V5-His-TOPO; Invitrogen) containing the WT MRP2 (NM_000392) or its SNP variants S789F, A1450T, V417I, and T1477M, was used to create the MRP2 baculovirus expression vector. Login to comment 49 ABCC2 p.Val417Ile ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Thr1477Met The pENTR 4 vector (Invitrogen) was mutated to generate a Hind III site using Quik Change II site-directed mutagenesis Kit (Stratagene; La Jolla, California, USA) using primers Hind IIIF and Hind IIIR (Hind IIIF: AGGCTCCAC- CATGGGAAGCTTCAGTCGACTGGATC; Hind IIIR: Table 1 Nucleotide sequence of variants in MRP2 leading to amino acid changes in multidrug resistance-associated protein 2 and their allelic frequencya SNP position Amino acid change Exon Location Allelic frequency Functional consequencesb C2366T S789F 18 NBD1 (D loop) 0.01 (Japanese) 52 G4348A A1450T 31 NBD2 (immediately after the ABC signature motif) 0.01 (Japanese) 52 G1249A V417I 10 MSD1 (between transmembrane helices 7 and 8) 0.125/0.312/0.184 (Japanese/Iranian/Moroccan) 27,46,47,52,58,59 C4430T T1477M 31 Carboxy terminal 0.006 (Japanese) MSD, membrane-spanning domain; NBD, nucleotide-binding domain; SNP, single nucleotide polymorphism. Login to comment 56 ABCC2 p.Val417Ile ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Thr1477Met The pENTR4M containing the WT, S789F, A1450T, V417I, and T1477M SNPs were sequenced (MWG Biotech, Inc., Huntsville, Alabama, USA). Login to comment 86 ABCC2 p.Ser789Phe Membrane ATPase measurements ATPase activity of WT, S789F, and A1450Twas measured as the level of sodium vanadate-sensitive release of inorganic phosphate from ATP [27]. Login to comment 94 ABCC2 p.Ser789Phe Although the SNPs, S789F and A1405T, are reported to have low allelic frequencies, they were of interest for inclusion in this study due to their predicted functional relevance when analyzed using the Polyphen Database [5], likely due to their location in the catalytic NBD domains of MRP2. Login to comment 95 ABCC2 p.Val417Ile V417I located in MSD1 is reported to have a much higher allelic frequency in several different populations and is frequently associated with adverse drug reactions in humans [27,28]. Login to comment 96 ABCC2 p.Thr1477Met There are no reports on the effects of SNP T1477M in the carboxy terminal on MRP2 function or expression; despite its low allelic frequency, the location of this SNP was of interest because the function of this portion of MRP2 is rarely studied [29]. Login to comment 97 ABCC2 p.Val417Ile ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Thr1477Met Protein expression of wild-type multidrug resistance-associated protein 2 and single nucleotide polymorphism variants in Sf9 cells WT MRP2 and the SNP variants S789F, A1450T, V417I, and T1477M were expressed in Sf9 cells using recombinant baculovirus. Login to comment 101 ABCC2 p.Ser789Phe ABCC2 p.Thr1477Met Statistical analysis of triplicate experiments showed that MRP2 expression was significantly reduced approximately 40% for S789F and T1477M variants, located in NBD1 and carboxy terminal region, respectively. Login to comment 102 ABCC2 p.Val417Ile ABCC2 p.Ala1450Thr However, there was no significant difference in the expression of V417I in MSD1 or of A1450T in NBD2 compared with WT MRP2 (Fig. 1b). Login to comment 108 ABCC2 p.Val417Ile ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Thr1477Met ABCC2 p.Thr1477Met LTC4 and E23G were transported with classic Michaelis-Menten kinetics by WT MRP2; however, E217G and TUDC demonstrated positive Fig. 1 8000 6000 4000 Density(%)INT/mm2 2000 0 T1477M * V417IA1450TS789F * WTEV 185 KD EV WT S789F A1450T V417I T1477M (a) (b) Expression of WT multidrug resistance-associated protein 2 (MRP2) and its variants in Sf9 plasma membranes. Login to comment 119 ABCC2 p.Ser789Phe The S789F variant located in the D-loop of NBD1 showed markedly reduced transport capacity of all substrates tested compared with WT; Vmax values were decreased by 40-60% relative to WT MRP2 (Fig. 2a-d; Table 2). Login to comment 120 ABCC2 p.Ser789Phe The apparent affinity for substrates LTC4, E217G, and TUDC were unchanged, however, the Km for E23G was increased two-fold compared with WT MRP2 for the S789F SNP (Fig. 2b; Table 2). Login to comment 121 ABCC2 p.Ala1450Thr The A1450T variant, which is located immediately after the ABC signature motif of NBD2, showed a 30-55% decrease in the Vmax for transport of LTC4, E23G, and TUDC, but not for E217G, whereas the apparent affinity for all of the substrates tested was not different from that of WT MRP2 (Fig. 2a-d; Table 2). Login to comment 122 ABCC2 p.Val417Ile The V417I SNP, located in MSD1 between the seventh and eighth transmembrane helices, showed a 2-3-fold increased Km for LTC4 and E217G. Login to comment 124 ABCC2 p.Val417Ile Interestingly, the V417I SNP also abolished the positive cooperativity in E217G transport, decreasing the HC from 2.2 to 1.1. Login to comment 125 ABCC2 p.Thr1477Met The T1477M SNP located in the carboxyl terminal region induced modest but significant changes, and showed both increased Km (50%) and Vmax (13%) for TUDC, but a decrease in the Vmax for E23G (20%), whereas it did not influence the transport of other substrates (Fig. 2a-d; Table 2). Login to comment 126 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr Substrate-stimulated ATPase activity of multidrug resistance-associated protein 2 and single nucleotide polymorphism variants To identify the mechanism of reduced transport activity of the SNP variants, S789F and A1450T, located in the ATP-binding domains, we determined their vanadate-sensitive ATPase activity in the presence of E217G (300 mmol/l). Login to comment 127 ABCC2 p.Val417Ile ABCC2 p.Ser789Phe Isolated plasma membrane preparations of Sf9 cells expressing WT MRP2 showed a high capacity, drug-stimulated ATPase activity (Fig. 3a), as reported Fig. 2 2000 (a) (b) (c) (d) 1000 ATP-dependent3 H-LTC4 transport(pmol/min/mg) 0 0 5 10 LTC4 (μmol/l) 15 20 4000 1000 2000 3000 ATP-dependent3 H-E217G transport(pmol/min/mg) 0 0 100 200 E217G (μmol/l) 300 200 400 600 ATP-dependent3H-TUDC transport(pmol/min/mg) 0 0 100 200 TUDC (μmol/l) 300 2000 1000 ATP-dependent3 H-E23G transport(pmol/min/mg) 0 0 250 500 E23G (μmol/l) 750 1000 WT S789F V417I T1477MA1450T ATP-dependent transport of wild-type (WT) and multidrug resistance-associated protein 2 single nucleotide polymorphism variants in Sf9 plasma membrane vesicles. Login to comment 131 ABCC2 p.Ser789Phe ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Ala1450Thr S789F and A1450T exhibited vanadate-sensitive ATPase activity that was stimulated by E217G, however, the ATPase activity of S789F and A1450T was significantly decreased by 37 and 20%, respectively, compared with WT MRP2 (Fig. 3a). Login to comment 132 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr To determine whether the maximal rates of ATP hydrolysis or affinity for the nucleotide were altered by the mutation seen in SNP variants S789F and A1450T, we compared their Km for ATP with that of WT MRP2 (Fig. 3b; Table 3). Login to comment 133 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr Vesicular transport studies over a wide range of concentrations of ATP and a fixed E217G concentration (300 mmol/l) showed that the apparent Km values for ATP were increased modestly but not significantly in both S789F (125 mmol/l) and A1450T (101 mmol/l), compared with WT MRP2 (79 mmol/l) (Fig. 3b; Table 3). Login to comment 134 ABCC2 p.Ala1450Thr The Vmax values were significantly decreased to 68% in S789Fand to 85% in A1450T (Table 3), consistent with the decreased E217G Vmax values seen in the saturation kinetics study (Table 2). Login to comment 136 ABCC2 p.Val417Ile ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Thr1477Met Four SNPs were selected for characterization, one in each of the two NBDs (S789F in NBD1 and A1450T in NBD2), one in MSD1 (V417I), and one in the carboxy terminal (T1477M), to probe how changes in these portions of MRP2 protein might impact its transport properties. Login to comment 138 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr The MRP2 variant S789F, located in the D-loop of NBD1, consistently decreased the Vmax for transport of all four substrates, whereas A1450T, located immediately after the ABC signature motif in NBD2, decreased the Vmax for all substrates except E217G. Login to comment 145 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr We, therefore, questioned whether S789F, most likely located in NBS2, and A1450T, likely located in NBS1, might have differential effects on ATP binding and hydrolysis. Login to comment 146 ABCC2 p.Ser789Phe ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Ala1450Thr ATPase activity was significantly inhibited in both S789F and A1450T (Fig. 3a); whereas inhibition of ATPase activity was greater for S789F (37%) than A1450T (20%), the data did not permit unequivocal determination of the differential roles of NBS1 and NBS2 in ATP hydrolysis. Login to comment 148 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr These data imply that irrespective of their locations in NBS1 or NBS2, neither variant S789F nor A1450T is directly involved in ATP binding, but rather both variants impact transport by decreasing ATP hydrolysis. Login to comment 149 ABCC2 p.Val417Ile The V417I SNP, located in MSD1, was found to have decreased apparent affinity for LTC4, E23G, and E217G, but not for TUDC. Login to comment 150 ABCC2 p.Val417Ile ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Thr1477Met These data imply that valine 417 plays a critical and selective role in binding of glutathione Table 2 Kinetic parameters for transport of substrates by wild-type multidrug resistance-associated protein 2 and four single nucleotide polymorphism variants Substrates Kinetic parameters WT S789F A1450T V417I T1477M LTC4 Km 4 (1.8-6.5) 3 (1.8-4.4) 3 (2-3.6) 9 (7.8-12.7)* 6 (3.5-9) Vmax 1464 (1314-1713) 732 (648-816)* 658 (618-699)* 1366 (1200-1531) 1659 (1373-1945) E23G Km 103 (73-133) 235 (173-296)* 106 (64-148) 212 (95-330) 172 (88-230) Vmax 1458 (1339-1578) 615 (558-671)* 855 (746-964)* 1794 (1454-2134) 1157 (975-1338)* E217bG Km 84 (64-104) 72 (67-76) 88 (75-100) 263 (241-285)* 94 (89-100) Vmax 3154 (2691-3617) 1799 (1732-1866)* 2665 (2422-2907) 2647 (2520-2773) 2646 (2555-2737) HC 2.2 (1.4-3) 2.4 (2.1-2.6) 2 (1.6-2.4) 1.1 (1.1-1.2)* 1.8 (1.7-1.9) TUDC Km 71 (65-78) 64 (71-96) 71 (57-86) 74 (70-79) 109 (103-116)* Vmax 595 (563-627) 359 (343-376)* 424 (376-472)* 577 (553-600) 671 (645-699)* HC 2 (1.7-2.3) 2.3 (1.9-2.6) 1.8 (1.3-2.3) 2.6 (2.3-2.8) 2.2 (2-2.4) The kinetic parameters [Km (mmol/l); Vmax (pmol/mg/min); HC] of ATP-dependent transport of LTC4, E23G, E217G, and TUDC were determined in Sf9 plasma membrane vesicles. Login to comment 159 ABCC2 p.Val417Ile V417I also significantly reduced the HC for E217G from 2.2 in WT MRP2 to 1.1 (Fig. 2c; Table 2). Login to comment 162 ABCC2 p.Val417Ile Our data showing increased apparent Km values for three glucuronide or glutathione conjugate substrates by V417I could be of clinical relevance since this is a common SNP in the population, and has been detected at frequencies of more than 20% in Caucasians and somewhat less in Japanese subjects (Table 1) [16]. Login to comment 164 ABCC2 p.Val417Ile The V417I SNP was also suggested to play a role in altered pharmacokinetics of talinolol, resulting in its lowered oral bioavailability and increased clearance after intravenous administration [47]. Login to comment 165 ABCC2 p.Val417Ile However, in population studies of MRP2 haplotypes, V417I was not found to associate with cholestatic or toxic hepatitis [48], and there was no effect on MRP2 protein expression in liver [49] or on serum-conjugated bilirubin levels in individuals with this SNP [16]. Login to comment 166 ABCC2 p.Thr1477Met Interestingly, the T1477M SNP located in the carboxy terminal region caused a selective decrease in the apparent affinity for TUDC but had no effect on the transport properties of other substrates. Login to comment 168 ABCC2 p.Thr1477Met Quantitative immunoblot analysis demonstrated a decreased expression of approximately 40% for two of the SNPs, S789Fand T1477M, relative to WT MRP2. Login to comment 169 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr To ensure that the reduced expression was not antibody-dependent, we performed immunoblots using two antibodies, M2 Fig. 3 25(a) (b) 20 15 VanadatesensitiveATPaseactivity3 H-E217Gtransport(pmol/min/mg) 10 5 0 A1450TS789FWTEV 3000 2000 1000 0 7500500025000 ** ** * ATP (μmol/l) WT S789FA1450T (a) ATPase activity of Sf9 membranes expressing wild-type (WT) multidrug resistance-associated protein 2 (MRP2) and the single nucleotide polymorphism (SNP) variants S789F and A1450T. Login to comment 174 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr Transport in the Sf9 membrane vesicles expressing WT, or variants S789F and A1450T was measured in the presence of various concentrations of ATP ranging from 50 mmol/l to 7 mmol/l at a fixed concentration of [3 H]E217G (300 mmol/l) for 2 min at 371C. Login to comment 177 ABCC2 p.Ser789Phe ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Ala1450Thr Table 3 Kinetic parameters for ATP in wild-type multidrug resistance-associated protein 2 and variants S789F and A1450T Kinetic parameters WT S789F A1450T Km 79 (43-114) 125 (96-155) 101 (57-146) Vmax 2630 (2433-2927) 1796 (1721-1870)* 2242 (2071-2413)* Nonlinear regression results [Km, (mmol/l); Vmax (pmol/mg/min)] were obtained from data in Fig. 3b. Login to comment 183 ABCC2 p.Arg768Trp ABCC2 p.Ser789Phe Expression of S789F (located in NBD1) was decreased to 59% of that of WT MRP2; a nearby but different mutation in NBD1 (R768W) of MRP2 was shown to be localized in the cytoplasm with an endoplasmic reticulum-like distribution [50]. Login to comment 185 ABCC2 p.Thr1477Met Similarly, expression of T1477M, in which the SNP is located 68 amino acid residues from the C-terminal of MRP2, was decreased to 62% of WT MRP2. Login to comment 188 ABCC2 p.Thr1477Met Although the amino acid change in T1477M could contribute to the localization signal, it is located in a good distance from the C-terminal, suggesting an alternative mechanism for its decreased expression. Login to comment 189 ABCC2 p.Ser789Phe ABCC2 p.Thr1477Met From our studies, the data suggest that individuals with S789F and T1477M polymorphisms may have a lower expression level of MRP2 protein in the apical membrane of cells, and consequently, a reduced ability to export substrates. Login to comment 190 ABCC2 p.Val417Ile ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr Hirouchi et al. [52] also characterized the expression and transport activity of several MRP2 variants (V417I, S789F, A1450T) using a Tet-off recombinant adenovirus system in LLC-PK1 cells. Login to comment 191 ABCC2 p.Val417Ile ABCC2 p.Ser789Phe However, these researchers did not detect any change in transport of E217G, LTC4, or 2,4-dinitrophenyl-S-glutathione by SNP V417I after normalization for expression levels, and further found that transport of these substrates was increased by S789F. Login to comment 193 ABCC2 p.Ser789Phe Further analysis of the kinetic parameters showed that the Vmax for transport of 2,4-dinitrophenyl-S-glutathione by S789F was 1.3-fold greater than that of WT MRP2. Login to comment 194 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Ala1450Thr Finally, these researchers also showed a marked reduction in the expression of both S789F and A1450T to 24 and 18% of WT MRP2, respectively, such that transport of E217G by A1450T was too low to be normalized by its expression level [52]. Login to comment 196 ABCC2 p.Ala1450Thr These discrepancies, particularly in A1450T expression, indicate that the results of in-vitro transporter expression should be extrapolated to in-vivo situations with caution. Login to comment 199 ABCC2 p.Val417Ile ABCC2 p.Thr1477Met V417I selectively inhibited the transport of glutathione and glucuronide-conjugated substrates, whereas T1477M only altered the transport of TUDC, a hydrophilic bile acid. Login to comment 200 ABCC2 p.Ser789Phe ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr ABCC2 p.Ala1450Thr Even though the SNPs, S789F and A1450T, exist with low allelic frequency, the decreased expression and transport function of S789F and decreased transport activity of A1450T shown here could impact drug disposition in polymorphic individuals. Login to comment 201 ABCC2 p.Ser789Phe ABCC2 p.Ala1450Thr Most likely because of the relative rarity of these SNPs, there are no reports of an association between S789F or A1450T and altered pharmacokinetics of MRP2 substrates. Login to comment 204 ABCC2 p.Val417Ile These data indicate that closer evaluation of the role of these MRP2 SNPs in haplotype analyses or genome-wide association studies of adverse drug reactions and/or disease is warranted, as is careful monitoring of patients with the relatively frequent MRP2 SNP, V417I. Login to comment