ABCMdb

ABCB1 p.Ser400Asn

ClinVar:	c.1199G>A , p.Ser400Asn N , Benign
Predicted by SNAP2:	A: N (87%), C: N (57%), D: N (66%), E: N (78%), F: N (78%), G: N (87%), H: N (97%), I: N (82%), K: N (82%), L: N (72%), M: N (78%), N: N (57%), P: D (91%), Q: N (93%), R: N (97%), T: N (97%), V: N (82%), W: D (85%), Y: N (82%),
Predicted by PROVEAN:	A: N, C: D, D: N, E: N, F: D, G: D, H: D, I: D, K: N, L: D, M: D, N: N, P: D, Q: N, R: D, T: N, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Mechanisms of resistance to anticancer drugs: the ... Pharmacogenomics. 2005 Mar;6(2):115-38. Lepper ER, Nooter K, Verweij J, Acharya MR, Figg WD, Sparreboom A
Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2.
Pharmacogenomics. 2005 Mar;6(2):115-38., [PMID:15882131]

Abstract [show]
ATP-binding cassette (ABC) genes play a role in the resistance of malignant cells to anticancer agents. The ABC gene products, including ABCB1 (P-glycoprotein) and ABCG2 (breast cancer-resistance protein [BCRP], mitoxantrone-resistance protein [MXR], or ABC transporter in placenta [ABCP]), are also known to influence oral absorption and disposition of a wide variety of drugs. As a result, the expression levels of these proteins in humans have important consequences for an individual's susceptibility to certain drug-induced side effects, interactions, and treatment efficacy. Naturally occurring variants in ABC transporter genes have been identified that might affect the function and expression of the protein. This review focuses on recent advances in the pharmacogenetics of the ABC transporters ABCB1 and ABCG2, and discusses potential implications of genetic variants for the chemotherapeutic treatment of cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
90 A detailed analysis of the potential functional consequences of different ABCB1 variants has not yet been performed, except for the five most common non-synonymous coding SNPs (i.e., Asn21Asp, Phe103Leu, Ser400Asn, Ala893Ser/Thr, and Ala998Thr) as assessed by a vaccinia virus-based transient expression system [74]. Login to comment
106 Nonetheless, the association of the C3435T polymorphism with Table 2. Summary of common genetic variants in the ABCB1 gene cDNA position* Region‡ Wild-type allele Variant allele Amino acid Change§ -274 Intron -1 G A -223 Intron -1 C T -146 Intron -1 T C -60 Intron -1 A T -41 Intron -1 A G Non-coding -241 Exon 1 G A Non-coding -145 Exon 1 C G Non-coding -129 Exon 1 T C Non-coding -43 Exon 1 A G Non-coding +140 Intron 1 C A +237 Intron 1 G A -4 Exon 2 C T Non-coding -1 Exon 2 G A Non-coding 61 Exon 2 A G 21 Asn to Asp -8 Intron 3 C G 266 Exon 4 T C 89 Met to Thr 307 Exon 5 T C 103 Phe to Leu -25 Intron 4 G T +139 Intron 6 C T +145 Intron 6 C T 548 Exon 7 A G 183 Asn to Ser 729 Exon 8 A G 243 Syn 781 Exon 8 A G 261 Ile to Val -44 Intron 9 A G -41 Intron 10 T G 1199 Exon 11 G A 400 Ser to Asn -4 Intron 11 G A 1236¶ Exon 12 C T 412 Syn 1308 Exon 12 A G 436 Syn +17 Intron 12 G A +44 Intron 12 C T 1474 Exon 13 C T 492 Arg to Cys +24 Intron 13 C T 1617 Exon 14 C T 539 Syn +38 Intron 14 A G +38 Intron 15 G A 1985 Exon 16 T G 662 Leu to Arg 2005 Exon 16 C T 669 Arg to Cys -27 Intron 17 A G +8 Intron 20 C G *cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758 with an A as the reference at position 43. Login to comment

[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
94 Kimchi-Sarfaty et al. [73] assessed the five most common coding SNPs (i.e., N21D, F103L, S400N, A893S and A999T) by using a vaccinia virus-based transient expression system. Login to comment
100 Woodahl et al. [74] evaluated functional consequences of S400N in LLC-PK1 cells stably expressing the wild-type or the S400N variant. Login to comment
101 Their cytotoxicity studies have shown that both wild-type and S400N variant exhibited similar resistance profiles toward doxorubicin, whereas LLC-PK1 cells expressing the S400N variant were more resistant to vincristine and vinblastine. Login to comment
102 The apparent transepithelial permeability of Rhodamine-123 in LLC-PK1 cells expressing the S400N variant was lower than that of the wild type. Login to comment
103 These results suggest that the functional consequence of the S400N substitution varies depending on the compounds tested. Login to comment
106 Position Allele Amino acid Allele frequency in Caucasian populations Allele frequency in Japanese populatins Allele frequency in African populations n % n % n % 61 A G 21 Asn 21 Asp 799 89.7 10.3 193 100 0 100 97.5 2.5 266 T C 89 Met 89 Thr 100 99.5 0.5 145 100 0 100 100 0 307 T C 103 Phe 103 Leu 546 99.9 0.1 48 100 0 ND ND ND 325 G A 108 Glu 108 Lys ND ND ND 37 95.9 4.1 ND ND ND 781 A G 261 Ile 261 Val 100 100 0 145 100 0 100 98.5 1.5 1199 G A 400 Ser 400 Asn 696 95.0 5.0 193 100 0 100 99 1 1985 T G 662 Leu 662 Arg 100 99.5 0.5 145 100 0 100 100 0 2005 C T 669 Arg 669 Cys 100 100 0 145 100 0 100 99 1 2485 A G 829 Ile 829 Val 185 99.2 0.8 ND ND ND ND ND ND 2547 A G 849 Ile 849 Met 100 99.5 0.5 145 100 0 100 100 0 2677 G T A 893 Ala 893 Ser 893 Thr 611 55.1 42.1 2.8 241 40.0 41.1 18.9 100 90 10 0.5 2956 A G 986 Met 986 Val ND ND ND 100 99.5 0.5 ND ND ND 3151 C G 1051 Pro 1051 Ala 100 100 0 145 100 0 100 99.5 0.5 3320 A C 1107 Gln 1107 Pro 461 99.8 0.2 ND ND ND ND ND ND 3322 T C 1108 Trp 1108 Arg 100 100 0 145 100 0 100 99.5 0.5 3421 T A 1141 Ser 1141 Thr 100 100 0 145 100 0 100 88.9 11.1 3751 G A 1251 Val 1251 Ile 100 100 0 145 99 1 100 100 0 3767 C A 1256 Thr 1256 Lys 100 99.5 0.5 145 100 0 100 100 0 Data from [31-38, 203]. Login to comment
115 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A) were generated by site-directed mutagenesis. Login to comment
124 The variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A), as well as the wild type, of ABCB1 exhibited the verapamil-enhanced ATPase activity. Login to comment
129 N21D M89T N44S H2N F103L E108K N183S G185V I261V S400N R492C A599T L662R R669C V801M A893S/T I829V I849M M986V A999T G1063A P1051A Q1107P W1108R I1145M S1141T V1251I T1256K COOH ATP-binding site ATP-binding site EXTRACELLULAR INTRACELLULAR A80E Figure 2. Login to comment

[hide] High-speed screening of human ATP-binding cassette... Methods Enzymol. 2005;400:485-510. Ishikawa T, Sakurai A, Kanamori Y, Nagakura M, Hirano H, Takarada Y, Yamada K, Fukushima K, Kitajima M
High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics.
Methods Enzymol. 2005;400:485-510., [PMID:16399366]

Abstract [show]
Drug transporters represent an important mechanism in cellular uptake and efflux of drugs and their metabolites. Hitherto a variety of drug transporter genes have been cloned and classified into either solute carriers or ATP-binding cassette (ABC) transporters. Such drug transporters are expressed in various tissues such as the intestine, brain, liver, kidney, and, importantly, cancer cells, where they play critical roles in the absorption, distribution, and excretion of drugs. We developed high-speed functional screening and quantitative structure-activity relationship analysis methods to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. Furthermore, we demonstrate a new "SNP array" method to detect genetic polymorphisms of ABC transporters in human samples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
167 For this purpose, we have prepared several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A, and G1063A) by site‐ directed mutagenesis. Login to comment

[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]

Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
761 0.09d c. 61 A>G N21D 0.11d IVS 5-35 G>C intronic 0.006c IVS 5-25 G>T intronic 0.16c IVS 6+139 C>T intronic 0.37d c. 548 A>G N183S 0.01e c. 1199 G>A S400N 0.05d c. 1236 C>T synonymous 0.41d IVS 12+44 C>T intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17-76 T>A intronic 0.46d IVS 17+137 A>G intronic 0.006c c. 2650 C>T synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T synonymous 0.54e c. 4030 G >C synonymous 0.005b c. 4036 A>G synonymous 0.30b a Taniguchi et al. (2003). Login to comment

[hide] ABC multidrug transporters: structure, function an... Pharmacogenomics. 2008 Jan;9(1):105-27. Sharom FJ
ABC multidrug transporters: structure, function and role in chemoresistance.
Pharmacogenomics. 2008 Jan;9(1):105-27., [PMID:18154452]

Abstract [show]
Three ATP-binding cassette (ABC)-superfamily multidrug efflux pumps are known to be responsible for chemoresistance; P-glycoprotein (ABCB1), MRP1 (ABCC1) and ABCG2 (BCRP). These transporters play an important role in normal physiology by protecting tissues from toxic xenobiotics and endogenous metabolites. Hydrophobic amphipathic compounds, including many clinically used drugs, interact with the substrate-binding pocket of these proteins via flexible hydrophobic and H-bonding interactions. These efflux pumps are expressed in many human tumors, where they likely contribute to resistance to chemotherapy treatment. However, the use of efflux-pump modulators in clinical cancer treatment has proved disappointing. Single nucleotide polymorphisms in ABC drug-efflux pumps may play a role in responses to drug therapy and disease susceptibility. The effect of various genotypes and haplotypes on the expression and function of these proteins is not yet clear, and their true impact remains controversial.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
325 The G1199A polymorphism (S400N) affected the trans-epithelial transport of five HIV protease inhibitors [140]. Login to comment

[hide] Clinical pharmacogenetics and potential applicatio... Curr Drug Metab. 2008 Oct;9(8):738-84. Zhou SF, Di YM, Chan E, Du YM, Chow VD, Xue CC, Lai X, Wang JC, Li CG, Tian M, Duan W
Clinical pharmacogenetics and potential application in personalized medicine.
Curr Drug Metab. 2008 Oct;9(8):738-84., [PMID:18855611]

Abstract [show]
The current 'fixed-dosage strategy' approach to medicine, means there is much inter-individual variation in drug response. Pharmacogenetics is the study of how inter-individual variations in the DNA sequence of specific genes affect drug responses. This article will highlight current pharmacogenetic knowledge on important drug metabolizing enzymes, drug transporters and drug targets to understand interindividual variability in drug clearance and responses in clinical practice and potential use in personalized medicine. Polymorphisms in the cytochrome P450 (CYP) family may have had the most impact on the fate of pharmaceutical drugs. CYP2D6, CYP2C19 and CYP2C9 gene polymorphisms and gene duplications account for the most frequent variations in phase I metabolism of drugs since nearly 80% of drugs in use today are metabolised by these enzymes. Approximately 5% of Europeans and 1% of Asians lack CYP2D6 activity, and these individuals are known as poor metabolizers. CYP2C9 is another clinically significant drug metabolising enzyme that demonstrates genetic variants. Studies into CYP2C9 polymorphism have highlighted the importance of the CYP2C9*2 and CYP2C9*3 alleles. Extensive polymorphism also occurs in a majority of Phase II drug metabolizing enzymes. One of the most important polymorphisms is thiopurine S-methyl transferases (TPMT) that catalyzes the S-methylation of thiopurine drugs. With respect to drug transport polymorphism, the most extensively studied drug transporter is P-glycoprotein (P-gp/MDR1), but the current data on the clinical impact is limited. Polymorphisms in drug transporters may change drug's distribution, excretion and response. Recent advances in molecular research have revealed many of the genes that encode drug targets demonstrate genetic polymorphism. These variations, in many cases, have altered the targets sensitivity to the specific drug molecule and thus have a profound effect on drug efficacy and toxicity. For example, the beta (2)-adrenoreceptor, which is encoded by the ADRB2 gene, illustrates a clinically significant genetic variation in drug targets. The variable number tandem repeat polymorphisms in serotonin transporter (SERT/SLC6A4) gene are associated with response to antidepressants. The distribution of the common variant alleles of genes that encode drug metabolizing enzymes, drug transporters and drug targets has been found to vary among different populations. The promise of pharmacogenetics lies in its potential to identify the right drug at the right dose for the right individual. Drugs with a narrow therapeutic index are thought to benefit more from pharmacogenetic studies. For example, warfarin serves as a good practical example of how pharmacogenetics can be utilized prior to commencement of therapy in order to achieve maximum efficacy and minimum toxicity. As such, pharmacogenetics has the potential to achieve optimal quality use of medicines, and to improve the efficacy and safety of both prospective and licensed drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
489 The 1199G>A polymorphism is located at exon 11, which changes Ser400 to Asn. Login to comment
532 Nucleotide change rs number Amino acid change 49T>C rs28381804 F17L 61A>G rs61615398; rs9282564 N21D 131A>G rs1202183 N44S 178A>C rs41315618 I60L 239C>A rs9282565 A80E 266T>C Rs35810889 M89T 431T>C rs61607171 I144T 502G>A rs61122623 V168I 548A>G rs60419673 N183S 554G>T rs1128501 G185V 781A>G rs36008564 I261V 1199G>A rs2229109 S400N 1696G>A rs28381902 E566K 1777C>T rs28381914 R593C 1778G>A rs56107566 R593H 1795G>A rs2235036 A599T 1837G>T rs57001392 D613Y 1985T>G rs61762047 L662R 2005C>T rs35023033 R669C 2207A>T rs41316450 I736K 2398G>A rs41305517 D800N 2401G>A rs2235039 V801M 2485A>G rs2032581 I829V 2506A>G rs28381967 I836V 2547A>G rs36105130 I849M 2677T>A/G rs2032582 S893A/T 2975G>A rs56849127 S992N 3151C>G rs28401798 P1051A 3188G>C rs2707944 G1063A 3262G>A rs57521326 D1088N 3295A>G rs41309225 K1099E 3320A>C rs55852620 Q1107P 3322T>C rs35730308 W1108R 3410G>T rs41309228 S1137I 3421T>A rs2229107 S1141T 3502A>G rs59241388 K1168E 3669A>T rs41309231 E1223D 3751G>A rs28364274 V1251I 3767C>A r35721439 T1256K Data are from NCBI dbSNP (access date: 2 August 2008). Login to comment

[hide] Intracellular trafficking of MDR transporters and ... Curr Top Med Chem. 2009;9(2):197-208. Porcelli L, Lemos C, Peters GJ, Paradiso A, Azzariti A
Intracellular trafficking of MDR transporters and relevance of SNPs.
Curr Top Med Chem. 2009;9(2):197-208., [PMID:19200005]

Abstract [show]
Multi-drug resistance (MDR) frequently contributes to the failure of chemotherapeutic treatments in cancer patients. Mechanisms underlying the development of MDR have been extensively studied and are considered multifactorial. Among them, the ATP-Binding Cassette (ABC) family of proteins plays a pivotal role. Processes of cellular distribution and subcellular localization of MDR-ABC proteins are not yet well explored and to enlighten these topics could be crucial to understand cellular drug uptake and retention. In this review, we analysed literature data concerning i) intracellular trafficking of MDR-ABC proteins (BCRP, P-gp and MRP1) and ii) mechanisms altering their cellular localization and trafficking. Moreover, we describe single nucleotide polymorphisms (SNP) that have been reported for some multidrug resistance (MDR) transporters, such as BCRP and P-gp, emphasizing their ability to affect the expression, function and localization of the transporters, with implications on drug resistance phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
229 [113], who showed that HeLa cells transfected with either the wild-type or the ABCB1 polymorphisms A61G (N21D), T307C (F103L), G1199A (S400N), G2677T (A893S) and G2995A (A998T) expressed the transporter at the cell surface. Login to comment
230 Additionally, cells transfected with double mutants (N21D-S400N, N21D-A893S, and S400N-A893S) revealed similar ABCB1 cell surface expression [113]. Login to comment
231 Regarding the S400N SNP, Woodahl et al. Login to comment
232 [114] reported that LLC-PK1 cells transfected with wild-type and S400N ABCB1 expressed similar amounts of the transporter predominantly on the apical membrane. Login to comment

[hide] Pharmacogenetics of ATP-binding cassette transport... Methods Mol Biol. 2010;596:95-121. Cascorbi I, Haenisch S
Pharmacogenetics of ATP-binding cassette transporters and clinical implications.
Methods Mol Biol. 2010;596:95-121., [PMID:19949922]

Abstract [show]
Drug resistance is a severe limitation of chemotherapy of various malignancies. In particular efflux transporters of the ATP-binding cassette family such as ABCB1 (P-glycoprotein), the ABCC (multidrug resistance-associated protein) family, and ABCG2 (breast cancer resistance protein) have been identified as major determinants of chemoresistance in tumor cells. Bioavailability depends not only on the activity of drug metabolizing enzymes but also to a major extent on the activity of drug transport across biomembranes. They are expressed in the apical membranes of many barrier tissues such as the intestine, liver, blood-brain barrier, kidney, placenta, testis, and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics of a variety of anticancer drugs and many others contributing to the clinical outcome of certain leukemias and further malignancies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Functional Significance of ABCB1 SNPs Table6.3 Frequency of ABCB1 genetic variants in Caucasians, position on DNA, putative effect, and frequencies (134) Position Amino acid or effect Frequency of the variant allele 5'-Flanking -2903 T>C 0.02a 5'-Flanking -2410 T>C 0.10a 5'-Flanking -2352 G>A 0.28a 5'-Flanking -1910 T>C 0.10a 5'-Flanking -1717 T>C 0.02a 5'-Flanking -1325 A>G 0.02a 5'-Flanking -934 A>G 0.10a 5'-Flanking -692 T>C 0.10a 5'-Flanking -41 A>G 0.09b IVS 1a -145 C>G 0.02b IVS 1b -129 T>C 0.06b IVS 1b 12 T>C 0.06c IVS 2 -1 G>A 0.09d c. 61 A>G N21D 0.11d IVS 5 -35 G>C Intronic 0.006c IVS 5 -25 G>T Intronic 0.16c IVS 6 +139 C>T Intronic 0.37d c. 548 A>G N183S 0.01e c. 1199 G>A S400N 0.05d c. 1236 C>T Synonymous 0.41d IVS 12 +44 C>T Intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17 -76 T>A Intronic 0.46d IVS 17 +137 A>G Intronic 0.006c c. 2650 C>T Synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T Synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T Synonymous 0.54d c. 4030 Synonymous 0.005b c. 4036 Synonymous 0.30b References: a [42], b [26], c [25], d [28], e [23] with lower activity or expression in Caucasians. Login to comment
62 A further rare missense SNP 1199 G>T (frequency 0.05 in Caucasians, (28)) leading to a Ser400Asn amino acid replacement is associated with lower activity and accordingly higher sensitivity against anticancer drugs. Login to comment
76 Table6.4 Functional significance of ABCB1 genetic variants and relevance for clinical outcome Position Amino acid exchange Effect of variant 5'-Flanking -2410 T>C Decreased mRNAa 5'-Flanking -692 T>C Decreased mRNAa c. 571 G>A G191R Reduced chemotherapy resistanceb c. 1199 G>A S400N Elevated activityc c. 1236 C>T Synonymous Increased imatinib disposition and therapy responsed c. 2677 G>T/A A893S/T In vitro increased vmax ,q no effect on vincristine,e increased imatinib response in CMLd c. 3435 C>T Synonymous Decreased mRNA and protein expression,f, g decreased invitro transport,h no effect on expression and bioavailability of talinolol,i no effect on invitro transport,j, k decreased digoxin bioavailability,l increased etoposid disposition,m no effect on AML or ALL outcome,k better prognosis of multiple myeloma,n better chemotherapy response in breast cancer,o no effect in colon cancerp References: a [42], b [69], c [38], d [53], e [51], f [23], g [64], h [31], i [39], j [135], k [65-67], l [40, 41], m [52], n [68], o [74], p [70, 71], q [36] As mentioned earlier, the first systematic study on ABCB1 genetic variability and its association to expression and bioavailability was the first one, showing an association of 3435C>T with digoxin plasma levels. Login to comment

[hide] ABC drug transporters: hereditary polymorphisms an... Pharmacogenomics. 2001 Feb;2(1):51-64. Kerb R, Hoffmeyer S, Brinkmann U
ABC drug transporters: hereditary polymorphisms and pharmacological impact in MDR1, MRP1 and MRP2.
Pharmacogenomics. 2001 Feb;2(1):51-64., [PMID:11258197]

Abstract [show]
Transport by ATP-dependent efflux pumps, such as P-glycoprotein (PGP) and multi-drug resistance related proteins (MRPs), influences bioavailability and disposition of drugs. These efflux pumps serve as defence mechanisms and determine bioavailability and CNS concentrations of many drugs. However, despite the fact that substantial data have been accumulated on the structure, function and pharmacological role of ABC transporters and even though modification of PGP function is an important mechanism of drug interactions and adverse effects in humans, there is a striking lack of data on variability of the underlying genes. This review focuses on the human drug transporter proteins PGP (MDR1) and the multi-drug resistance proteins MRP1 and MRP2. An overview is provided of pharmacologically relevant genetic, structural and functional data as well as on hereditary polymorphisms, their phenotypical consequences and pharmacological implications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 SNP Region N Frequency of SNPs (%) Effect Heterozygous Homozygous Observed Estimated T-12C E1 85 11.8 0 0.4 Non-coding G-1A E2 188 11.2 0 0.4 TL initiation A61G E2 188 17.6 0.5 0.81 Asn21Asp G-25T I4 85 26 3.5 2.3 G-35C I4 85 1.2 0 0.01 # T307C E5 85 1.2 0 0.01 Phe103Leu C+139T I5 85 48.2 16.5 16.8 C+145T I5 85 2.4 0 0.01 G1199A E11 85 12.9 0 0.4 Ser400Asn C1236T E12 188 48.9 13.3 14.4 Gly412Gly # C+44T I12 188 11.7 0 0.4 T-76A I16 85 45.9 22.4 20.3 A+137G I17 85 1.2 0 0.01 G2677T E21 83b 43.4 42.2 38.4 Ala893Ser G2995A E24 36b 11.1 38.4 Ala999Thr C3435T E26 537 47.7 26.4 24.1 Ile1145Ile C3396T E26 188 0.53 0 0.01 Wobble § MDR1 sequences gb:AC002457 and AC005068 are defined as 'wild type`. Login to comment

[hide] Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplot... Pharmacogenet Genomics. 2005 Sep;15(9):599-608. Colombo S, Soranzo N, Rotger M, Sprenger R, Bleiber G, Furrer H, Buclin T, Goldstein D, Decosterd L, Telenti A
Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo.
Pharmacogenet Genomics. 2005 Sep;15(9):599-608., [PMID:16041239]

Abstract [show]
OBJECTIVES: The human immunodeficiency virus protease inhibitor nelfinavir is substrate of polyspecific drug transporters encoded by ABCB1 (P-glycoprotein), ABCC1 (MRP1) and ABCC2 (MRP2), and an inhibitor of BCRP, encoded by ABCG2. Genetic polymorphism in these genes may be associated with changes in transport function. METHODS: A comprehensive evaluation of single nucleotide polymorphisms (39 SNPs in ABCB1, 7 in ABCC1, 27 in ABCC2, and 16 in ABCG2), and inferred haplotypes was done to assess possible associations of genetic variants with cellular exposure of nelfinavir in vivo. Analysis used peripheral mononuclear cells from individuals receiving nelfinavir (n=28). Key results were re-examined in a larger sample size (n=129) contributing data on plasma drug levels. RESULTS AND CONCLUSIONS: There was no significant association between cellular nelfinavir area under the curve (AUC) and SNPs or haplotypes at ABCC1, ABCC2, ABCG2. There was an association with cellular exposure for two loci in strong linkage disequilibrium: ABCB1 3435C>T; AUCTT>AUCCT>AUCCC (ratio 2.1, 1.4, 1, Ptrend=0.01), and intron 26 +80T>C; AUCCC> AUCCT > AUCTT (ratio 2.4, 1.3, 1, Ptrend=0.006). Haplotypic analysis using tagging SNPs did not improve the single SNP association values.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 or Ref sequence; locus Frequencies Fold-increase of nelfinavir AUCintracell Significance AA Aa aa Aa2 AA Aa aa Aa2 chi-squared P-value ABCB1 IVS 1 - 80delG rs3214119 27 1 1 1.0 0.03 0.85 c.61A > G (N21D) rs9282564 26 2 1 2.5 3.85 0.05 TAG1 rs3789243 7 17 3 1 0.8 0.6 1.23 0.54 c.1199G > A (S400N) rs2229109 24 2 1 0.9 0.62 0.43 TAG5 rs1128503 4 18 5 1 0.8 1.3 3.33 0.19 TAG6 rs2235046 6 18 3 1 0.6 0.7 4.43 0.11 c.2677G > T (A893S) rs2032582 4 17 5 1 1 1.0 1.7 1.2 6.42 0.09 IVS 21 + 49T > C rs2032583 19 8 1 0.6 3.45 0.06 TAG8, 3435C > T rs1045642 4 18 6 1 1.4 2.1 6.35 0.04 IVS 26 + 59T > G rs2235047 24 2 1 1.0 0.02 0.89 IVS 26 + 80T > C rs2235048 3 17 6 1 1.3 2.4 7.09 0.03 TAG11 rs1186746 16 10 1 1 1.1 0.3 2.46 0.29 TAG12 rs1186745 17 9 1 1 0.7 1.0 0.33 0.85 ABCC1 c.816G > A NM_004996; c.1012G > A 27 1 1 1.5 1.05 0.30 c.825T > C rs246221 13 11 3 1 1.5 0.7 3.99 0.14 c.1062T > C rs35587 13 11 3 1 1.5 0.7 3.02 0.22 IVS 9 + 8A > G rs35588 13 11 3 1 1.5 0.7 3.02 0.22 IVS 10 + 64C > T NC_000016; g.98791C > T 23 3 1 0.4 1.97 0.16 ABCC2 g. Login to comment
69 - 4 C > T exon 2 (50 UTR) Epidauros md-v-177 c.61A > G exon 2 p.N21D Hoffmeyer et al., 2000 md-v-017 rs9282564 IVS 2 + 23 T > C intron 2 Epidauros md-v-057 Tag 1 intron 3 Soranzo et al., 2004 rs3789243 IVS 11 - 40 T > G intron 10 Epidauros md-v-078 rs2235029 c.1137 C > G exon 11 p.P373A Epidauros md-v-079 c.1149 C > T exon 11 synonymous (p.H383H) Epidauros md-v-080 c.1199G > A exon 11 p.S400N Hoffmeyer et al., 2000 md-v-025 rs2229109 IVS11 + 48 T > A intron 11 Epidauros md-v-081 Tag 5 exon 12 Soranzo et al., 2004 rs1128503 Tag 6 intron 16 Soranzo et al., 2004 rs2235046 IVS 21 - 78 G > A intron 20 Epidauros md-v-228 IVS 21 - 43 A > T intron 20 Epidauros md-v-160 c.2547A > G exon 21 p.I849M Kroetz et al., 2003 md-v-222 c. Login to comment

[hide] Impact of CYP2C8*3 on paclitaxel clearance: a popu... Pharmacogenomics J. 2011 Apr;11(2):113-20. Epub 2010 Apr 6. Bergmann TK, Brasch-Andersen C, Green H, Mirza M, Pedersen RS, Nielsen F, Skougaard K, Wihl J, Keldsen N, Damkier P, Friberg LE, Peterson C, Vach W, Karlsson MO, Brosen K
Impact of CYP2C8*3 on paclitaxel clearance: a population pharmacokinetic and pharmacogenomic study in 93 patients with ovarian cancer.
Pharmacogenomics J. 2011 Apr;11(2):113-20. Epub 2010 Apr 6., [PMID:20368717]

Abstract [show]
The primary purpose of this study was to evaluate the effect of CYP2C8*3 and three genetic ABCB1 variants on the elimination of paclitaxel. We studied 93 Caucasian women with ovarian cancer treated with paclitaxel and carboplatin. Using sparse sampling and nonlinear mixed effects modeling, the individual clearance of unbound paclitaxel was estimated from total plasma paclitaxel and Cremophor EL. The geometric mean of clearance was 385 l h(1) (range 176-726 l h(1)). Carriers of CYP2C8*3 had 11% lower clearance than non-carriers, P=0.03. This has not been shown before in similar studies; the explanation is probably the advantage of using both unbound paclitaxel clearance and a population of patients of same gender. No significant association was found for the ABCB1 variants C1236T, G2677T/A and C3435T. Secondarily, other candidate single-nucleotide polymorphisms were explored with possible associations found for CYP2C8*4 (P=0.04) and ABCC1 g.7356253C>G (P=0.04).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
135 This effect on clearance of a 'non-fixed` variable provides a competing and dynamic biological explanation for clearance that certainly should be Table 4 Clearance of unbound paclitaxel as function of observed genotypes Gene/allelea Effectb Reference homozygote Heterozygote Variant homozygote P-valuee SNP IDf Nc CLd (10th-90th) Nc CLd (10th-90th) Nc CLd (10th-90th) Candidate SNPs for confirmative analysis CYP2C8 1196A4G(*3) K399R 74 395 (297-490) 19 350 (238-458) 0.03* (0.04) rs10509681 ABCB1 1236C4T G412G 29 391 (270-569) 45 393 (299-490) 19 359 (291-437) 0.25 (0.25) rs1128503 2677G4T/Ag A893S/T 26 387 (270-490) 42(GT) 396 (299-490) 20(TT) 356 (294-437) 0.20 (0.26) rs2032582 3435C4T I1145I 11 403 (326-548) 44 387 (282-490) 38 378 (297-468) 0.83 (0.43) rs1045642 Candidate SNPs for exploratory analysis CYP2C8 792C4G(*4) I264M 86 391 (297-490) 7 321 (270-374) 0.04* (0.03) rs1058930 15577956G4T (*1B) - 49 395 (298-552) 43 373 (291-478) 1 461 0.75 (0.36) rs7909236 15578055A4C (*1C) - 69 382 (291-478) 24 393 (300-552) 0.48 (0.62) rs17110453 ABCB1 À1A4G - 1 458 29 396 (270-592) 63 379 (297-477) 0.56 (0.3) rs2214102 61A4G N21D 63 384 (282-490) 29 386 (298-478) 1 437 0.52 (0.77) rs9282564 1199G4A S400N 83 385 (291-490) 10 386 (322-461) 0.74 (0.99) rs2229109 CYP3A4 24616372T4C (*1B) - 85 383 (296-490) 7 397 (270-641) 0.67 (0.72) rs2740574 CYP3A5 219-237G4A Frameshift 84 388 (297-490) 9 360 (176-726) 0.30 (0.36) rs776746 SLCO1B3 699G4A M233I 1 326 19 377 (299-481) 73 388 (291-490) 0.99 (0.46) rs7311358 767G4C G256A 67 386 (298-481) 26 383 (291-490) 0.63 (0.89) rs60140950 CYP1B1 1294C4G (*3) V432L 30 389 (270-530) 36 401 (298-490) 27 361 (300-470) 0.77 (0.24) rs1056836 ABCC1 7356253C4G - 65 394 (297-548) 27 368 (291-470) 1 332 0.04* (0.15) rs504348 ABCC2 1249G4A V417I 67 381 (291-490) 24 396 (297-552) 2 415 (368-468) 0.21 (0.39) rs2273697 3563T4A V1188E 87 386 (296-490) 5 370 (176-569) 0.7 (0.7) rs17222723 4544G4A C1515Y 75 389 (296-490) 3 355 (176-569) 0.72 (0.52) rs8187710 ABCG2 421C4A Q141K 61 374 (291-478) 32 408 (315-548) 0.4 (0.09) rs2231142 34G4A V12M 87 385 (291-490) 4 395 (296-726) 0.68 (0.83) rs2231137 ABCC10 2759T4C I920T 46 386 (297-478) 43 386 (291-548) 4 373 (326-467) 0.88 (0.89) rs2125739 Abbreviations: CL, clearance of unbound paclitaxel; SNP, single-nucleotide polymorphism. Login to comment

[hide] Frequency of single nucleotide polymorphisms in th... Clin Pharmacol Ther. 2001 Mar;69(3):169-74. Cascorbi I, Gerloff T, Johne A, Meisel C, Hoffmeyer S, Schwab M, Schaeffeler E, Eichelbaum M, Brinkmann U, Roots I
Frequency of single nucleotide polymorphisms in the P-glycoprotein drug transporter MDR1 gene in white subjects.
Clin Pharmacol Ther. 2001 Mar;69(3):169-74., [PMID:11240981]

Abstract [show]
BACKGROUND: P-glycoprotein, the gene product of MDR1, confers multidrug resistance against antineoplastic agents but also plays an important role in the bioavailability of common drugs in medical treatment. Various polymorphisms in the MDR1 gene were recently identified. A silent mutation in exon 26 (C3435T) was correlated with intestinal P-glycoprotein expression and oral bioavailability of digoxin. OBJECTIVE: We wanted to establish easy-to-use and cost-effective genotyping assays for the major known MDR1 single nucleotide polymorphisms and study the allelic frequency distribution of the single nucleotide polymorphisms in a large sample of volunteers. METHODS: In this study, the distribution of the major MDR1 alleles was determined in 461 white volunteers with the use of polymerase chain reaction and restriction fragment length polymorphism. RESULTS: Five amino acid exchanges were found with allelic frequencies of 11.2% for Asn21Asp and 5.5% for Ser400Asn. Strikingly, in exon 21 three variants were discovered at the same locus: 2677G (56.4%), 2677T (41.6%), and 2677A (1.9%), coding for 893Ala, Ser, or Thr. A novel missense Gln1107Pro mutation was found in two cases (0.2%). The highest frequencies were observed for intronic and silent polymorphisms; C3435T occurred in 53.9% of the subjects heterozygously, and 28.6% of individuals were homozygous carriers of 3435T/T with functionally restrained P-glycoprotein. CONCLUSION: This study provides the first analysis of MDR1 variant genotype distribution in a large sample of white subjects. It gives a basis for large-scale clinical investigations on the functional role of MDR1 allelic variants for bioavailability of a substantial number of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Results: Five amino acid exchanges were found with allelic frequencies of 11.2% for Asn21Asp and 5.5% for Ser400Asn. Login to comment
54 G1199A (Ser400Asn) appeared with a frequency of 5.5%. Login to comment

[hide] Naturally occurring mutations and functional polym... J Med Genet. 2002 May;39(5):340-6. Potocnik U, Ravnik-Glavac M, Golouh R, Glavac D
Naturally occurring mutations and functional polymorphisms in multidrug resistance 1 gene: correlation with microsatellite instability and lymphoid infiltration in colorectal cancers.
J Med Genet. 2002 May;39(5):340-6., [PMID:12011154]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
264 To the best of our knowledge, this Table 2 Correlation between MDR1 polymorphisms and increased lymphoid infiltration in tumours Exon Genotype (polymorphism) Amino acid change No (%) of tumours with specific genotype (polymorphism)/No of tumours analysed No (%) of tumours with specific genotype (polymorphism) and lymphoid infiltration p* Promoter †Promoter +8 T/T 313/327 (96%) 152/313 (49%) Promoter Promoter +8 T/C Non-coding 14/327 (4%) 9/14 (64%) 0.036 Intron 1b IVS1-81 (G)4 311/327 (95%) 149/311 (48%) Intron 1b IVS1-81 (G)4/(G)3 Non-coding 16/327 (5%) 12/16 (75%) 0.010 Intron 1b ‡IVS-1 G/G 271/317 (85%) 127/271 (47%) Intron 1b IVS-1 G/A 45/317 (14%) 27/45(60%) NS Intron 1b IVS-1 A/A Non-coding 1/317 (<1%) 1/1 (100%) NS 2 ‡61 A/A 266/321 (83%) 125/266 (47%) 2 61 A/G Asn21Asp 51/321 (16%) 29/51 (57%) NS 2 61 G/G 4/321 (1%) 2/4 (50%) NS Intron 4 ‡IVS4-25 G/G 44/63 (70%) 19/44 (43%) Intron 4 IVS4-25 G/T Non-coding 15/63 (24%) 7/15 (47%) NS Intron 4 IVS4-25 T/T 4/63 (6%) 2/4 (50%) NS 11 1199 G/G 307/327 (94%) 152/307 (50%) 11 1199 G/A Ser400Asn 20/327 (6%) 11/20 (55%) NS 12 ‡1236 C/C 81/327 (25%) 39/81 (48%) 12 1236 C/T No change 163/327 (50%) 80/163 (49%) NS 12 1236 T/T 83/327 (25%) 42/83 (51%) NS Intron 16 IVS16+158 G/G 82/87 (94%) 41/82 (50%) Intron 16 IVS16+158 G/A Non-coding 5/87 (6%) 3/5 (60%) NS 21 §2677 G/G 14/41 (34%) 7/14 (50%) 21 2677 G/T Ala893Ser 17/41 (41%) 7/17 (41%) NS 21 2677 T/T 10/41 (24%) 4 /10 (40%) NS 26 ‡3435 C/C 44/159 (28%) 18/44 (41%) 26 3435 C/T No change 85/159 (53%) 46/85 (54%) NS 26 3435 T/T 30/159 (19%) 15/30 (50%) NS NS=not significant. Login to comment

[hide] Functional characterization of coding polymorphism... Mol Pharmacol. 2002 Jul;62(1):1-6. Kimchi-Sarfaty C, Gribar JJ, Gottesman MM
Functional characterization of coding polymorphisms in the human MDR1 gene using a vaccinia virus expression system.
Mol Pharmacol. 2002 Jul;62(1):1-6., [PMID:12065748]

Abstract [show]
The human MDR1-encoded transporter is a 170-kDa plasma membrane glycoprotein [P-glycoprotein (P-gp)] capable of binding and energy-dependent extrusion of structurally diverse organic compounds and drugs. P-gp seems to play a significant role in uptake, distribution, and excretion of many different drugs. To determine whether common polymorphic forms of P-gp are likely to alter function of P-gp, we characterized five known MDR1 coding polymorphisms (N21D, F103L, S400N, A893S, and A998T) using a vaccinia virus-based transient expression system. Cell surface expression of wild-type P-gp was time-dependent over a time course of 5.5 to 34.5 h; highest expression was obtained by 22 to 26.5 h after infection/transfection, indicating that a semiquantitative assay for P-gp expression levels was possible. HeLa cells stained with the P-gp specific monoclonal antibodies MRK-16 and Western blots probed with C219 revealed similar cell surface expression for the polymorphisms and for wild-type protein. Time-dependent P-gp pump function maximal at 22 h after infection/transfection was demonstrated for the following MDR1 fluorescence substrates: 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoic acid, succinimidyl ester (bodipy-FL)-verapamil, bodipy-FL-vinblastine, calcein-AM, bodipy-FL-prazosin, bisantrene, and bodipy-FL-forskolin, but not for daunorubicin. Transport studies of all tested substrates indicated that the substrate specificity of the pump was not substantially affected by any of the tested polymorphisms. Cell surface expression and function of double mutants including the more common polymorphisms (N21D-S400N, N21D-A893S, and S400N-A893S) showed no differences from wild-type. These results demonstrate that the common MDR1 coding polymorphisms result in P-gps with a cell surface distribution and function similar to wild-type P-gp.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 To determine whether common polymorphic forms of P-gp are likely to alter function of P-gp, we characterized five known MDR1 coding polymorphisms (N21D, F103L, S400N, A893S, and A998T) using a vaccinia virus-based transient expression system. Login to comment
7 Cell surface expression and function of double mutants including the more common polymorphisms (N21D-S400N, N21D-A893S, and S400N-A893S) showed no differences from wild-type. Login to comment
20 In this study, we examined the five most common P-gp coding polymorphisms previously reported in the literature (N21D, F103L, S400N, A893S, and A998T). Login to comment
30 Using the technique described by Kunkel et al. (1987), five different mutated sites were introduced into the MDR1 gene with the following primers: for the N21D (A3G) polymorphism, 5Ј TTT TTC ACT TTT ATC GTT CAG TTT AA 3Ј; for the F103L (C3T) polymorphism, 5Ј CAG ATT CAT GAA GAG CCC TGT ATC A 3Ј; for the S400N (G3T) polymorphism, 5Ј TCG AGA TGG GTA ATT GAA GTG AAC AT 3Ј; for the A893S (G3T) polymorphism, 5Ј AGC GAT CTT CCC AGA ACC TTC TAG TT 3Ј; and for the A998T (G3A) polymorphism, 5Ј TAT TTT GGC TTT GGT ATA GTC AGG AGC 3Ј. Login to comment
31 Double mutant MDR1s were generated using the NdeI and XhoI restriction enzymes on single mutant templates (N21D-S400N, N21D-A893S, and S400N-A893S). Login to comment
48 We have chosen HeLa cells for these studies because of their low level of endogenous P-gp expression, their ability to express high TABLE 1 Common MDR1 polymorphisms that change amino acids Location Polymorphic Variant Heterozygous Frequency Reference Exon Nucleotide % 2 61 N21D 17.6 Hoffmeyer et al. (2000) 11.2 Cascorbi et al. (2001) 5.7 Decleves et al. (2000) 5 307 F103L 1.2 Hoffmeyer et al. (2000) 10 1107 G369P 0.2 Cascorbi et al. (2001) 11 1199 S400N 12.9 Hoffmeyer et al. (2000) 5.5 Cascorbi et al. (2001) A893S 43.0 Mickley et al. (1998) A893T 41.6 Cascorbi et al. (2001) 21 2677 A893S 62.0a , 13.0b Kim et al. (2001) A893G 56.4 Cascorbi et al. (2001) 24 2995 A998T 11.0 Mickley et al. (1998) a European Americans. b African Americans. levels of wild-type and mutant P-gp after vaccinia infection/ transfection, and their relative ease of transfection (Hrycyna et al., 1998; Ramachandra et al., 1998; Gribar et al., 2000). Login to comment
63 HeLa cells were infected/transfected with the pTM1-MDR1 vector harboring the MDR1 polymorphisms N21D, F103L, S400N, A893S, and A998T (described in Table 1). Login to comment
70 All cells infected/ transfected with double mutants (N21D-S400N, N21D-A893S, and S400N-A893S) revealed results similar to those of the single mutants (data not shown). Login to comment
71 Discussion In this study a transient vaccinia expression system was used to determine the effect of five known coding human MDR1 polymorphisms on P-gp function: N21D, F103L, S400N, A893S, and A998T. Login to comment
113 Infected/transfected HeLa cells with wild-type pTM1-MDR1 (--), pTM1-MDR1-N21D (- -⅐- -⅐), pTM1-MDR1-F103L (⅐⅐⅐⅐), pTM1-MDR1-S400N (-⅐-⅐-), pTM1-MDR1-A998T (- - - -), and pTM1-MDR1-A893S (⅐⅐⅐-⅐⅐⅐) were incubated and analyzed by FACS as described under Materials and Methods, with MRK-16 or control IGg2a␬ monoclonal antibodies (-⅐-⅐-⅐) 13.5 h after infection/transfection. Login to comment
117 Cells were transfected with pTM1 (control), pTM1-MDR1, (wild-type P-gp), pTM1-MDR1- N21D, pTM1-MDR1-F103L, pTM1-MDR1-S400N, pTM1-MDR1-A893S, and pTM1-MDR1-A998T. Login to comment
119 with A, 0.5 ␮M Calcein-AM: wild-type (--), N21D (- -⅐- -⅐), and S400N (-⅐-⅐-), in the presence of an inhibitor, 5 ␮M cyclosporin A (- - -); B, 0.5 ␮M bodipy-FL-forskolin: wild-type (--), N21D (- -⅐- -⅐), F103L (⅐⅐⅐⅐), and S400N (-⅐-⅐-), in the presence of an inhibitor, 5 ␮M cyclosporin A (- - -); C, 0.5 ␮M bodipy-FL-verapamil: wild-type (--), N21D (- -⅐- -⅐), F103L (⅐⅐⅐⅐), and S400N (-⅐- ⅐-), in the presence of an inhibitor, 5 ␮M cyclosporin A (- - -); D, 0.1 ␮M bodipy-FL-paclitaxel: wild-type (--), A893S (- -⅐- -⅐), in the presence of an inhibitor, 5 ␮M cyclosporin A for the wild-type (- -), and for A893S (- - -). Login to comment

[hide] C3435T polymorphism in the MDR1 gene affects the e... Pharmacogenetics. 2002 Aug;12(6):451-7. Goto M, Masuda S, Saito H, Uemoto S, Kiuchi T, Tanaka K, Inui K
C3435T polymorphism in the MDR1 gene affects the enterocyte expression level of CYP3A4 rather than Pgp in recipients of living-donor liver transplantation.
Pharmacogenetics. 2002 Aug;12(6):451-7., [PMID:12172213]

Abstract [show]
The bioavailability of structurally unrelated drugs is limited by active secretion via the multidrug resistance gene (MDR1) product P-glycoprotein (Pgp) from enterocyte into lumen as well as intestinal metabolism by cytochrome P450 IIIA4 (CYP3A4). In the present study, we analyzed whether genetic polymorphism of the MDR1 had some influence on the intestinal expression levels of Pgp and CYP3A4 and the tacrolimus concentration/dose ratio over the first postoperative days in recipients of living-donor liver transplantation (LDLT). Genotyping assays were performed for the major 10 polymorphisms in the MDR1 gene by the polymerase chain reaction-restriction enzyme length polymorphism method. The allele frequencies of variations at five positions were almost comparable with those in the former studies in Caucasians and Japanese, but there was no variation at the other five positions. Although no polymorphism correlated with the intestinal expression of MDR1 mRNA or the tacrolimus concentration/dose ratio in the LDLT recipients, the C3435T polymorphism significantly affected the intestinal expression level of CYP3A4 mRNA as follows; 3435C/C>3435C/T (P < 0.05 vs. 3435C/C)>3435T/T (P < 0.01 vs. 3435C/C). Therefore, the identified polymorphisms including C3435T in the MDR1 gene were indicated to have no influence on the intestinal expression level of Pgp or the tacrolimus concentration/dose ratio in the recipients of LDLT. On the other hand, the C3435T polymorphism of MDR1 was suggested to correlate with the enterocyte expression of CYP3A4 rather than Pgp linking unknown genetic variation in CYP3A4 gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 In the present study, the variants in exon 2 G-1A, A61G (Asn21 Asp) in exon 2, T307C (Phe103 Leu) in exon 5, G1199A (Ser400 Asn) in exon 11 and C+44T in intron 12 were not observed. Login to comment

[hide] Does the A118G polymorphism at the mu-opioid recep... Anesthesiology. 2002 Oct;97(4):814-9. Lotsch J, Zimmermann M, Darimont J, Marx C, Dudziak R, Skarke C, Geisslinger G
Does the A118G polymorphism at the mu-opioid receptor gene protect against morphine-6-glucuronide toxicity?
Anesthesiology. 2002 Oct;97(4):814-9., [PMID:12357145]

Abstract [show]
BACKGROUND: Some, but not all, patients with renal dysfunction suffer from side effects after morphine administration because of accumulation of the active metabolite morphine-6-glucuronide (M6G). The current study aims to identify genetic causes that put patients at risk for, or protect them from, opioid side effects related to high plasma M6G. Candidate genetic causes are the single nucleotide polymorphism (SNP) A118G of the mu-opioid-receptor gene (OPRM1), which has recently been identified to result in decreased potency of M6G, and mutations in the MDR1-gene coding P-glycoprotein, of which morphine and M6G might be a substrate. METHODS: Two men, aged 87 and 65 yr, with renal failure (creatinine clearance of 6 and 9 ml/min) received 30 mg/day oral morphine for pain treatment. Both patients had sufficient analgesia from morphine. However, while one patient tolerated morphine well despite high plasma M6G of 1735 nM, in the patient with M6G plasma concentrations of 941 nM it caused severe sleepiness and drowsiness. Patients were genotyped for known SNPs of the OPRM1 and MDR1 genes. RESULTS: The patient who tolerated morphine well despite high plasma M6G was a homozygous carrier of the mutated G118 allele of the mu-opioid-receptor gene, which has been previously related to decreased M6G potency. In contrast, the patient who suffered from side effects was "wild-type" for this mutation. No other differences were found between the OPRM1 and MDR1 genes. CONCLUSIONS: The authors hypothesize that the A118G single nucleotide polymorphism of the mu-opioid-receptor is among the protective factors against M6G-related opioid toxicity. The observation encourages the search for pharmacogenetic reasons that cause interindividual variability of the clinical effects of morphine.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 33 T/T T/T MDR1 2 A61G Asn21Asp 11.2 20.6 9 A/G A/G Forward: 5Ј-AGG AGC AAA GAA GAA GAA CTT TTT TAA ACT GAT C-3Ј 9.3 17.6 8 Reverse: 5Ј-GAT TCC AAA GGC TAG CTT GC-3Ј 5 T307C Phe103Leu 0.6 1.2 9 T/T T/T Forward: 5Ј-GTG GTT GCA CAC AGT CAG CA-3Ј Reverse: 5Ј-GGA GGA TGT CTA ATT ACC TGG TCA-3Ј 11 G1199A Ser400Asn 5.5 11.1 9 G/G G/G Forward: 5Ј-CAG CTA TTC GAA GAG TGG GC-3Ј 6.5 12.9 8 Reverse: 5Ј-CCG TGA GAA AAA AAC TTC AAG G-3Ј 21 G2677T Ala893Ser 41.6 49.2 9 T/T T/T Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј 63.9 43.4 8 Reverse: 5Ј-GTT TGA CTC ACC TTC CCA G-3Ј 21 G2677A Ala893Thr 0.9 2 9 NA NA Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј Reverse: 5Ј-TTT AGT TTG ACT CAC CTT CCC G-3Ј 26 A3320C Gln1107Pro 0.2 0.4 9 A/A A/A 26 C3396T Ala1132Ala 0.3 0.5 8 C/C C/C Forward: 5Ј-ATC TGT GAA CTC TTG TTT TCA GC-3Ј 26 C3435T Ile1145Ile 50.3 47.7 8 T/T T/T Reverse: 5Ј-TCG ATG AAG GCA TGT ATG TTG-3Ј 53.9 50.5 9 - - MRP2 10 G1249A Val417Ile 12.5 20.8 34 G/G G/G Forward: 5Ј-GGG TCC TAA TTT CAA TCC TTA-3Ј Reverse: 5Ј-TAT TCT TCT GGG TGA CTT TTT-3Ј 18 C2302T Arg768Trp 1 2.1 34 C/C C/C Forward: 5Ј-GGA GTA GTG CTT AAT ATG AAT-3Ј 18 C2366T Ser789Phe 1 2.1 34 C/C C/C Reverse: 5Ј-CCC ACC CCA CCT TTA TAT CTT-3Ј 28 C3972T Ile132Ile 21.9 35.4 34 C/T C/T Forward: 5Ј-TGC TAC CCT TCT CCT GTT CTA-3Ј Reverse: 5Ј-ATC CAG GCC TTC CTT CAC TCC-3Ј 31 G4348A Ala1450Thr 1 2.1 34 G/G G/G Forward: 5Ј-AGG AGC TAA CAC ATG GTT GCT-3Ј Reverse: 5Ј-GGG TTA AGC CAT CCG TGT CAA-3Ј † Sequence is not translated. Login to comment

[hide] Genetic polymorphisms of the human MDR1 drug trans... Annu Rev Pharmacol Toxicol. 2003;43:285-307. Epub 2002 Jan 10. Schwab M, Eichelbaum M, Fromm MF
Genetic polymorphisms of the human MDR1 drug transporter.
Annu Rev Pharmacol Toxicol. 2003;43:285-307. Epub 2002 Jan 10., [PMID:12359865]

Abstract [show]
P-glycoprotein is an ATP-dependent efflux pump that contributes to the protection of the body from environmental toxins. It transports a huge variety of structurally diverse compounds. P-glycoprotein is involved in limiting absorption of xenobiotics from the gut lumen, in protection of sensitive tissues (brain, fetus, testis), and in biliary and urinary excretion of its substrates. P-glycoprotein can be inhibited or induced by xenobiotics, thereby contributing to variable drug disposition and drug interactions. Recently, several SNPs have been identified in the MDR1 gene, some of which can affect P-glycoprotein expression and function. Potential implications of MDR1 polymorphisms for drug disposition, drug effects, and disease risk are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Of the 15 identified SNPs, three polymorphisms resulted in protein alterations, one in exon 2 (Asn21Asp), in exon 5 (Phe103Leu), and in exon 11 (Ser400Asn). Login to comment
60 In a Northern Italian population, the extent of linkage disequilibrium TABLE 2 Summary of MDR1 genetic variants in different ethnic groups Location Position Allele Effect Reference promotor 5 flanking/-41a A (28) G exon 1a exon 1a/-145 C (28) G exon 1b exon 1b/-129 T (25, 33) C intron 1 exon 2/-4 C (29) T intron 1 exon 2/-1 G initiation of translation (25, 27, 29) A exon 2 exon 2/61 A Asn21Asp (25-27, 29) G intron 4 exon 5/-35 G (25) C intron 4 exon 5/-25 G (25) T exon 5 exon 5/307 T Phe103Leu (25) C intron 6 exon 6/+139 C (25, 27) T intron 6 exon 6/+145 C (25) T exon 7 exon 7/548 A Asn183Ser (29) G exon 11 exon 11/1199 G Ser400Asn (25, 27, 29) A exon 12 exon 12/1236 C wobble (23, 25, 27, 29) T (Gly412Gly) intron 12 exon 12/+44 C (25, 27) T exon 13 exon 13/1474 C Arg492Cys (29) T intron 16 exon 17/-76 T (25, 27) A intron 17 exon 17/137 A (25) G exon 21 exon 21/2650 C wobble (29) T (Leu884Leu) (Continued ) TABLE 2 (Continued) Location Position Allele Effect Reference exon 21 exon 21/2677 G (22, 23, 27, 29) T Ala893Ser A Ala893Thr exon 24 exon 24/2956 A Met986Val (33) G exon 24 exon 24/2995 G Ala999Thr (22) A exon 26 exon 26/3320 A Gln1107Pro (27) C exon 26 exon 26/3396 C wobble (25) T exon 26 exon 26/3421 T Ser1141Thr (29, 30) A exon 26 exon 26/3435 C wobble (23, 25, 29) T (Ile1145Ile) exon 28 exon 28/4030 G (33) C exon 28 exon 28/4036 A (23, 33) G The positions of the polymorphisms correspond to positions of MDR1 cDNA with the first base of the ATG start codon set to 1 (GenBank accession # M14758). Login to comment
71 The nonsynonymous G1199A SNP in exon 11 (Ser400Asn) results in a significant size change dependent on pH and isoelectric environment of the residue, leading possibly to a charge change in the protein. Login to comment
86 However, a recent publication characterized the functional consequences of five coding SNPs (Asn21Asp, Phe103Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system (40a). Login to comment

[hide] MDR1 genotype-related pharmacokinetics and pharmac... Biol Pharm Bull. 2002 Nov;25(11):1391-400. Sakaeda T, Nakamura T, Okumura K
MDR1 genotype-related pharmacokinetics and pharmacodynamics.
Biol Pharm Bull. 2002 Nov;25(11):1391-400., [PMID:12419946]

Abstract [show]
The multidrug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily of membrane transporters. MDR1 acts as an energy-dependent efflux pump that exports its substrates out of cells. MDR1 was originally isolated from resistant tumor cells as part of the mechanism of multidrug resistance, but over the last decade, it has been elucidated that human MDR1 is also expressed throughout the body to confer intrinsic resistance to the tissues by exporting unnecessary or toxic exogeneous substances or metabolites. A number of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics and pharmacodynamics. In 2000, Hoffmeyer et al. performed a systemic screening for MDR1 polymorphisms and detected 15 single nucleotide polymorphisms (SNPs). They also indicated that a polymorphism in exon 26 at position 3435 (C3435T), a silent mutation, affected the expression level of MDR1 protein in duodenum, and thereby the intestinal absorption of digoxin. To date, the genotype frequencies of C3435T have been investigated extensively using a larger population and interethnic difference has been elucidated, and a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical studies on MDR1 genotype-related MDR1 expression and pharmacokinetics have also been performed around the world; however, results were not always consistent with Hoffmeyer's report. In this review, published reports are summarized for the future individualization of pharmacotherapy based on MDR1 genotyping. In addition, recent investigations have raised the possibility that MDR1 and related transporters play a fundamental role in regulating apoptosis and immunology, and in fact, there are reports of MDR1-related susceptibility to inflammatory bowel disease, HIV infection and renal cell carcinoma. Herein, these issues are also summarized, and the current status of the knowledge in the area of pharmacogenomics of other transporters is briefly introduced.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Kim et al. defined 15 alleles based on the frequencies of 11 polymorphisms of C-4T (noncoding), G-1A (noncoding), A61G (Asn21Asp), A548G (Asn183Ser), G1199A (Ser400Asn), C1236T (silent), C1474T (Arg492Cys), C2650T (silent), G2677T (Ala893Ser), T3421A (Ser1141Thr) and C3435T (silent).54) Six of 11 accompanied an amino acid change, and the others were conservative mutations. Login to comment
56 In 2001, Hitzl et al. also indicated that healthy Caucasian subjects with T/T3435 had a more decreased efflux of rhodamine from CD56ϩ NK cells and a lower MDR1 mRNA expression in leukocytes than those with C/C3435 .65) In renal tissues, the C3435T polymorphism is reported to be associated with reduced MDR1 expression.31) However, Tanabe et al. suggested that C3435T had no effect on the placental MDR1 expression based on 89 subjects and Western blotting.53) We determined MDR1 mRNA levels in biopsy specimens of the duodenum obtained from 13 healthy Japanese subjects by real time quantitative RT-PCR and found that MDR1 mRNA expression was higher in T/T3435 than C/C3435 or C/T3435 (Fig. 1).66) The discrepancies between the reports might be ex- November 2002 1393 Table 2. Summary of Genetic Polymorphisms in MDR1 Position Location Effect A1a/-41G Intron Noncoding C-145G Exon 1a Noncoding T-129C (T12C) Exon 1b Noncoding C-4T Exon 2 Noncoding G-1A Exon 2 Noncoding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/ϩ139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/ϩ44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/ϩ137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent This list was based on the literature (refs. 49-54). Login to comment
61 Kim et al. indicated that cells transduced with a variant MDR1 containing Ser893 showed a reduced intracellular accumulation of [3 H]-digoxin compared with cells with the wild-type Ala893 , suggesting enhanced efflux by the polymorphism of Ala893Ser (G2677T).54) On the other hand, very recently, Kimchi-Sarfaty et al. indicated that the cell surface expression and function of double mutants including the more common polymorphisms (A61G (Asn21Asp) and G1199A (Ser400Asn), A61G (Asn21Asp) and G2677T (Ala893Ser), G1199A (Ser400Asn) and G2677T (Ala893Ser)) showed no differences from the wild-type.67) MDR1 Genotype-Related Pharmacokinetics The aim of the clinical study by Greiner et al.64) was to elucidate the role of intestinal MDR1 expression in the interaction of digoxin with rifampin, and plasma concentration-time profiles were monitored after oral and intravenous administration of digoxin at 1 mg before and after oral administration of rifampin once daily for 16 d. Using the digoxin plasma concentration data after MDR1 induction by rifampin, Hoffmeyer et al.50) suggested that intestinal absorption of digoxin was greater in the subjects with the T-allele at position 3435. Login to comment

[hide] The effects of the human MDR1 genotype on the expr... Clin Pharmacol Ther. 2002 Nov;72(5):572-83. Siegmund W, Ludwig K, Giessmann T, Dazert P, Schroeder E, Sperker B, Warzok R, Kroemer HK, Cascorbi I
The effects of the human MDR1 genotype on the expression of duodenal P-glycoprotein and disposition of the probe drug talinolol.
Clin Pharmacol Ther. 2002 Nov;72(5):572-83., [PMID:12426521]

Abstract [show]
BACKGROUND AND OBJECTIVES: A single-nucleotide polymorphism (SNP) of the human multidrug-resistance gene in wobble position of exon 26 reportedly predicts expression and function of P-glycoprotein in human enterocytes and lymphocytes. Several other allelic variants of MDR1 have been identified, some of which lead to amino acid exchange with as yet unknown functional relevance. METHODS: In healthy white volunteers, we investigated the influence of the hereditary variants C3435T in exon 26 and G2677T/A (Ala893Ser/Thr) in exon 21 and the influence of 7 frequent or putative functional SNPs on duodenal MDR1 messenger ribonucleic acid (n = 32) and immunoreactive P-glycoprotein (n = 37) expression. Moreover, the disposition of the probe drug talinolol was evaluated in 55 subjects after oral administration (100 mg) and in 23 subjects after intravenous administration(30 mg). RESULTS: Duodenal MDR1 messenger ribonucleic acid and P-glycoprotein, as assessed by real-time polymerase chain reaction (TaqMan) and immunostaining, were not influenced by any MDR1 polymorphism studied. Talinolol disposition was not affected by the exon 26 mutation C3435T. In carriers of the TT/TA variants of G2677T/A, the area under the serum concentration-time curve values of oral talinolol were slightly but significantly elevated compared with those in carriers of at least 1 wild-type allele (P <.05, Kruskal-Wallis test; P =.014, Mann-Whitney U test). However, multiple comparisons with combinations of putative functional SNPs did not confirm a significant influence of the MDR1 genotype on talinolol disposition. CONCLUSIONS: We did not identify any influence of MDR1 genotypes on duodenal expression of P-glycoprotein and disposition of talinolol in humans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 The following 10 most frequent or putatively functional SNPs of the MDR1 gene were identified, as recently described19 : intron 1 (exon 2 -1) G/A, exon 2 A61G (amino acid exchange Asn21Asp), intron 6 (exon 6 ϩ139) C/T, exon 11 G1199A (Ser400Asn), exon 12 C1236T, intron 12 (exon 12 ϩ44) C/T, intron 16 (exon 17 -76) T/A, exon 21 G2677T (Ala893Ser), G2677A (Ala893Thr), and exon 26 C3435T. Login to comment
112 Other authors, however, did not observe any significant correlation between the MDR1 genotype and fexofenadine disposition35 ; furthermore, a study in human placenta trophoblasts obtained from 100 Japanese women revealed less placental P-glycoprotein (Western blotting) in individuals having the G2677A/T allele.20 The nonanonymous variants A61G (Asn21Asp) in exon 2 and G1199A (Ser400Asn) in exon 11 were also expected to have a functional impact on human P-glycoprotein. Login to comment
113 The Asn21Asp exchange is located close to the N-terminus and the Ser400Asn variant just preceding the first adenosine triphosphate-binding domain.22 However, both mutations in our study did not influence P-glycoprotein expression and talinolol disposition. Login to comment

[hide] Pharmacogenetics of irinotecan. Curr Med Chem Anticancer Agents. 2003 May;3(3):225-37. Toffoli G, Cecchin E, Corona G, Boiocchi M
Pharmacogenetics of irinotecan.
Curr Med Chem Anticancer Agents. 2003 May;3(3):225-37., [PMID:12769780]

Abstract [show]
Pharmacogenetics focuses on intersubjects variation in therapeutic drug effects and toxicity depending on genetic polymorphisms. This is particularly interesting in oncology since anticancer drugs usually have a narrow margin of safety. Irinotecan [7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycamptothecin] is used in cancer chemotherapy as a topoisomerase I inhibitor and it is characterised by a sometimes unpredictable severe toxicity. It is mostly intestinal with nausea, vomit and diarrhoea or haematologic with leuko-thrombocytopenia. Its complex metabolism involves many proteins. Human carboxylesterase isoforms 1 and 2 (hCE1, hCE2) activate irinotecan to its metabolite SN-38 (7-ethyl-10-hydroxycamptothecin); cytochrome P450 isoforms 3A4 and 3A5 (CYP3A4, CYP3A5) mediate the oxidation of the parental compound to irinotecan; uridino-glucuronosil transferase isoform 1A1 (UGT1A1) catalyses glucuronidation of SN-38; the multi-resistance protein isoform 2 (MRP2) allows the cellular excretion of the SN-38 glucuronide (SN-38G) and the multi-drug resistance gene (MDR1), encoding for P-glycoprotein, is responsible for the excretion of irinotecan from the cell. Polymorphic structures in the genes encoding for all these proteins have been described. In particular, the UGT1A1*28 allele has been associated with an increased toxicity after irinotecan chemotherapy. Classical parameters used in the clinic, such as body-surface area, have no longer a meaningful correlation with clinical outcome. Hence it emerges the importance of studying the individual genotype to predict the toxicity and efficacy of irinotecan and to individualise therapy. In this review, we summarise the new developments on the study of the pharmacogenetics of irinotecan, stressing its importance in drug cytotoxic effect.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
261 Also T307C and G1199A are mutations causing a significant aminoacid change (Phe103Leu and Ser400Asn respectively) in important zones of the protein and possibly affecting the P-gp efficacy. Login to comment

[hide] Pharmacogenetics of MDR1 and its impact on the pha... Pharmacogenomics. 2003 Jul;4(4):397-410. Sakaeda T, Nakamura T, Okumura K
Pharmacogenetics of MDR1 and its impact on the pharmacokinetics and pharmacodynamics of drugs.
Pharmacogenomics. 2003 Jul;4(4):397-410., [PMID:12831320]

Abstract [show]
The multi-drug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette (ABC) superfamily of membrane transporters. MDR1 was originally isolated from resistant tumor cells as part of the mechanism of multi-drug resistance, but over the last decade, it has been elucidated that human MDR1 is also expressed throughout the body to confer intrinsic resistance to the tissues by exporting unnecessary or toxic exogeneous substances or metabolites. A number of various types of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics and pharmacodynamics. In 2000, Hoffmeyer et al. performed a systemic screening for MDR1 polymorphisms and indicated that a single nucleotide polymorphism (SNP), C3435T in exon 26, which caused no amino acid change, was associated with the duodenal expression of MDR1 and thereby the plasma concentrations of digoxin after oral administration. Interethnic differences in genotype frequencies of C3435T have been clarified, and, at present, a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical studies on the effects of C3435T on MDR1 expression and function in the tissues, and also on the pharmacokinetics and pharmacodynamics have been performed around the world; however, there are still discrepancies in the results, suggesting that the haplotype analysis of the gene should be included instead of SNP detection, and the design of clinical trials must be carefully planned to avoid misinterpretations. A polymorphism of C3435T is also reported to be a risk factor for a certain class of diseases such as the inflammatory bowel diseases, Parkinson's disease and renal epithelial tumor, and this might also be explained by the effects on MDR1 expression and function. In this review, the latest reports are summarized for the future individualization of pharmacotherapy based on MDR1 genotyping.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Position Location Effect A1a/-41G Intron Non-coding C-145G Exon 1a Non-coding T-129C (T12C) Exon 1b Non-coding C-4T Exon 2 Non-coding G-1A Exon 2 Non-coding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/+139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/+44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/+137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent See references [34-39]. Login to comment

[hide] Sequence diversity and haplotype structure in the ... Pharmacogenetics. 2003 Aug;13(8):481-94. Kroetz DL, Pauli-Magnus C, Hodges LM, Huang CC, Kawamoto M, Johns SJ, Stryke D, Ferrin TE, DeYoung J, Taylor T, Carlson EJ, Herskowitz I, Giacomini KM, Clark AG
Sequence diversity and haplotype structure in the human ABCB1 (MDR1, multidrug resistance transporter) gene.
Pharmacogenetics. 2003 Aug;13(8):481-94., [PMID:12893986]

Abstract [show]
OBJECTIVES: There is increasing evidence that polymorphism of the ABCB1 (MDR1) gene contributes to interindividual variability in bioavailability and tissue distribution of P-glycoprotein substrates. The aim of the present study was to (1) identify and describe novel variants in the ABCB1 gene, (2) understand the extent of variation in ABCB1 at the population level, (3) analyze how variation in ABCB1 is structured in haplotypes, and (4) functionally characterize the effect of the most common amino acid change in P-glycoprotein. METHODS AND RESULTS: Forty-eight variant sites, including 30 novel variants and 13 coding for amino acid changes, were identified in a collection of 247 ethnically diverse DNA samples. These variants comprised 64 statistically inferred haplotypes, 33 of which accounted for 92% of chromosomes analyzed. The two most common haplotypes, ABCB1*1 and ABCB1*13, differed at six sites (three intronic, two synonymous, and one non-synonymous) and were present in 36% of all chromosomes. Significant population substructure was detected at both the nucleotide and haplotype level. Linkage disequilibrium was significant across the entire ABCB1 gene, especially between the variant sites found in ABCB1*13, and recombination was inferred. The Ala893Ser change found in the common ABCB1*13 haplotype did not affect P-glycoprotein function. CONCLUSION: This study represents a comprehensive analysis of ABCB1 nucleotide diversity and haplotype structure in different populations and illustrates the importance of haplotype considerations in characterizing the functional consequences of ABCB1 polymorphisms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
141 Unauthorized reproduction of this article is prohibited. Table 1 Genetic variation in ABCB1 Allele frequencyd Variant cDNA NT DNA/AA AA Total CA AA AS ME PA No.a positionb changec position change (n ¼ 494) (n ¼ 200) (n ¼ 200) (n ¼ 60) (n ¼ 20) (n ¼ 14) 1.1Ã (À274) G to A Intron À1 0.006 0 0.016 0 0 0 1.2Ã (À223) C to T Intron À1 0.002 0.005 0 0 0 0 1.3Ã (À146) T to C Intron À1 0.002 0 0.005 0 0 0 1.4Ã (À60) A to T Intron À1 0.004 0 0.010 0 0 0 1.5 (À41) A to G Intron À1 0.002 0 0 0.017 0 0 1.6Ã À241 G to A Non-coding 0.002 0 0 0.017 0 0 1.7 À145 C to G Non-coding 0.002 0 0 0.017 0 0 1.8 À129 T to C Non-coding 0.060 0.051 0.071 0.036 0.100 0.071 1.9 À43 A to G Non-coding 0.012 0 0.020 0.036 0 0 1.10Ã (+140) C to A Intron 1 0.013 0.005 0.021 0 0 0.071 1.11Ã (+237) G to A Intron 1 0.004 0 0.010 0 0 0 2.1 À4 C to T Non-coding 0.004 0 0.010 0 0 0 2.2 À1 G to A Non-coding 0.036 0.080 0.005 0 0.050 0 2.3 61 A to G 21 Asn to Asp 0.045 0.080 0.025 0.017 0 0 4.1Ã (À8) C to G Intron 3 0.002 0.005 0 0 0 0 4.2Ã 266 T to C 89 Met to Thr 0.002 0.005 0 0 0 0 5.1 (À25) G to T Intron 4 0.210 0.158 0.300 0.067 0.200 0.286 8.1 729 A to G 243 Syn 0.002 0.005 0 0 0 0 8.2Ã 781 A to G 261 Ile to Val 0.006 0 0.015 0 0 0 10.1Ã (À44) A to G Intron 9 0.400 0.450 0.255 0.685 0.450 0.571 11.1Ã (À41) T to G Intron 10 0.002 0 0 0.017 0 0 11.2 1199 G to A 400 Ser to Asn 0.014 0.025 0.010 0 0 0 12.1Ã (À4) G to A Intron 11 0.002 0 0.005 0 0 0 12.2 1236 C to T 412 Syn 0.385 0.459 0.209 0.685 0.450 0.571 12.3Ã 1308 A to G 436 Syn 0.002 0 0.005 0 0 0 12.4Ã (+17) G to A Intron 12 0.008 0 0.020 0 0 0 12.5 (+44) C to T Intron 12 0.088 0.046 0.168 0 0 0 13.1 (+24) C to T Intron 13 0.530 0.521 0.542 0.540 0.450 0.571 14.1 1617 C to T 539 Syn 0.002 0.005 0 0 0 0 14.2 (+38) A to G Intron 14 0.540 0.505 0.540 0.683 0.450 0.500 15.1 (+38) G to A Intron 15 0.004 0.005 0.005 0 0 0 16.1Ã 1985 T to G 662 Leu to Arg 0.002 0.005 0 0 0 0 16.2Ã 2005 C to T 669 Arg to Cys 0.004 0 0.010 0 0 0 18.1Ã (À27) A to G Intron 17 0.008 0.010 0.005 0 0.050 0 20.1Ã (+8) C to G Intron 20 0.002 0 0.005 0 0 0 20.2 (+24) G to A Intron 20 0.126 0.121 0.150 0.067 0.200 0 20.3Ã (+40) C to T Intron 20 0.014 0 0.035 0 0 0 21.1Ã 2547 A to G 849 Ile to Met 0.002 0.005 0 0 0 0 21.2 2650 C to T 884 Syn 0.004 0.005 0.005 0 0 0 21.3a 2677 G to T 893 Ala to Ser 0.308 0.464 0.100 0.450 0.400 0.357 21.3b 2677 G to A 893 Ala to Thr 0.035 0.036 0.005 0.067 0 0.357 22.1 (+31) G to A Intron 22 0.002 0 0.005 0 0 0 25.1Ã 3151 C to G 1051 Pro to Ala 0.002 0 0.005 0 0 0 26.1Ã 3322 T to C 1108 Trp to Arg 0.002 0 0.005 0 0 0 26.2 3421 T to A 1141 Ser toThr 0.047 0 0.111 0 0.050 0 26.3 3435 C to T 1145 Syn 0.392 0.561 0.202 0.400 0.500 0.500 28.1 3751 G to A 1251 Val to Ile 0.002 0 0 0 0.050 0 28.2 3767 C to A 1256 Thr to Lys 0.002 0.005 0 0 0 0 28.3 (+21) T to C Intron 28 0.031 0 0.077 0 0 0 a Variants are numbered sequentially by exon. Login to comment
164 M89T I849M V1251I T1256K S1141TW1108R P1052AR669C A893S/T L662R Cytoplasm S400N I261V N21D Extracellular Fig. 1. Login to comment
301 Other non-synonymous variants (Asn21Asp, Phe103Leu, Ser400Asn, and Ala998Thr) have also been shown not to affect P-glycoprotein function [43]. Login to comment

[hide] P-glycoprotein: from genomics to mechanism. Oncogene. 2003 Oct 20;22(47):7468-85. Ambudkar SV, Kimchi-Sarfaty C, Sauna ZE, Gottesman MM
P-glycoprotein: from genomics to mechanism.
Oncogene. 2003 Oct 20;22(47):7468-85., 2003-10-20 [PMID:14576852]

Abstract [show]
Resistance to chemically different natural product anti-cancer drugs (multidrug resistance, or MDR) results from decreased drug accumulation, resulting from expression of one or more ATP-dependent efflux pumps. The first of these to be identified was P-glycoprotein (P-gp), the product of the human MDR1 gene, localized to chromosome 7q21. P-gp is a member of the large ATP-binding cassette (ABC) family of proteins. Although its crystallographic 3-D structure is yet to be determined, sequence analysis and comparison to other ABC family members suggest a structure consisting of two transmembrane (TM) domains, each with six TM segments, and two nucleotide-binding domains. In the epithelial cells of the gastrointestinal tract, liver, and kidney, and capillaries of the brain, testes, and ovaries, P-gp acts as a barrier to the uptake of xenobiotics, and promotes their excretion in the bile and urine. Polymorphisms in the MDR1 gene may affect the pharmacokinetics of many commonly used drugs, including anticancer drugs. Substrate recognition of many different drugs occurs within the TM domains in multiple-overlapping binding sites. We have proposed a model for how ATP energizes transfer of substrates from these binding sites on P-gp to the outside of the cell, which accounts for the apparent stoichiometry of two ATPs hydrolysed per molecule of drug transported. Understanding of the biology, genetics, and biochemistry of P-gp promises to improve the treatment of cancer and explain the pharmacokinetics of many commonly used drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Kioka et al. (1989) showed a slight increase in resistance to doxorubicin, but no effect on colchicine or vinblastine Table 2 Common MDR1 exonic polymorphisms Exon number Polymorphic nucleotide variant Change in amino acid References 1 À145 - Ito et al. (2001) 1 À129 - Hoffmeyer et al. (2000); Tanabe et al. (2001) 2 61 N21D Cascorbi et al. (2001); Decleves et al. (2000); Hoffmeyer et al. (2000); Kim et al. (2001) 5 307 F103L Hoffmeyer et al. (2000) 7 548 N183S Kim et al. (2001) 10 1107 G369P Hoffmeyer et al. (2000) 11 1199 S400N Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001) 12 1236 Wobble Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 13 1474 R492C Kim et al. (2001) 21 2650 Wobble Kim et al. (2001) 21 2677 893A, S, or T Cascorbi et al. (2001); Kim et al. (2001); Kioka et al. (1989); Mickley et al. (1998) 24 2956 M986V Tanabe et al. (2001) 24 2995 A999T Mickley et al. (1998) 26 3320 Q1107P Cascorbi et al. (2001) 26 3396 Wobble Hoffmeyer et al. (2000) 26 3421 S1141T Kim et al. (2001) 26a 3435 Wobble Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 28 4030 - Tanabe et al. (2001) 28 4036 - Kioka et al. (1989); Tanabe et al. (2001) a The only polymorphism that correlates with changes in drug delivery and disposition P-glycoprotein SV Ambudkar et al resistance in the SNP located on exon 21, position 2677, Ser893 (Kioka et al., 1989). Login to comment
110 HeLa cells were infected/transfected with empty vector (pTM1), wild-type pTM1-MDR1, pTM1-MDR1-S400N, pTM1-MDR1-N21D, pTM1-MDR1-F103L, pTM1-MDR1-A998T, and pTM1-MDR1-A893S, and were analysed by FACS as described previously (Kimchi-Sarfaty et al., 2002) Table 3 Selected substrates and modulators of P-glycoprotein Substrates Modulators Vinca alkaloids Calcium channel blockers Vinblastine Verapamil Vincristine Dihydropyridines Anthracyclines Antiarrhythmics Daunorubicin Quinine Doxorubicin Antihypertensives Antibiotics Reserpine Dactinomycin Antibiotics Actinomycin D Cephalosporins Other cytotoxic agents Immunosuppressants Mitomycin Cyclosporin A Taxol Steroid hormones Colchicine Progesterone Puromycin HIV protease inhibitors Digoxin Saquinavir Alcoholism treatment drug Disulfiram Phytochemical Curcumin Moreover, most of these studies correlated the manifestation of this polymorphism with a change in drug delivery or disposition. Login to comment

[hide] Haplotype analysis of ABCB1/MDR1 blocks in a Japan... Pharmacogenetics. 2003 Dec;13(12):741-57. Sai K, Kaniwa N, Itoda M, Saito Y, Hasegawa R, Komamura K, Ueno K, Kamakura S, Kitakaze M, Shirao K, Minami H, Ohtsu A, Yoshida T, Saijo N, Kitamura Y, Kamatani N, Ozawa S, Sawada J
Haplotype analysis of ABCB1/MDR1 blocks in a Japanese population reveals genotype-dependent renal clearance of irinotecan.
Pharmacogenetics. 2003 Dec;13(12):741-57., [PMID:14646693]

Abstract [show]
We performed comprehensive haplotyping of ABCB1/MDR1 gene blocks using 49 genetic polymorphisms, including seven novel ones, obtained from 145 Japanese subjects. The ABCB1/MDR1 gene was divided into four blocks (Blocks -1, 1, 2, and 3) based on linkage disequilibrium analysis of polymorphisms. Using an expectation-maximization based program, 1, 2, 8, and 3 haplotype groups (3, 12, 32, and 18 haplotypes) were identified in Blocks -1, 1, 2, and 3, respectively. Within Block 2, haplotype groups *1, *2, *4, *6, and *8 reported by Kim and colleagues (Clin Pharmacol Ther 2001; 70:189-199) were found, and additional three groups (*9 to *11) were newly defined. We analyzed the association of haplotypes with the renal clearance of irinotecan and its metabolites in 49 Japanese cancer patients given irinotecan intravenously. There was a significant association of the *2 haplotype in Block 2, which includes 1236C>T, 2677G>T and 3435C>T, with a reduced renal clearance of those compounds. Moreover, tendencies of reduced and increased renal clearance were also observed with *1f in Block 2 and *1b in Block 3, respectively. These findings suggest that the P-glycoprotein encoded by ABCB1/MDR1 in the proximal tubules plays a substantial role in renal exclusion of drugs and, moreover, that block-haplotyping is valuable for pharmacogenetic studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 746Pharmacogenetics2003,Vol13No12 Copyright(c)LippincottWilliams&Wilkins.Unauthorizedreproductionofthisarticleisprohibited. Table 3 Classification of major ABCB1 haplotypes Site Exon 2 Exon 5 Exon 7 Exon 11 Exon 12 Exon 13 Exon 21 Exon 21 Exon 21 Exon 26 Exon 26 Exon 27 Exon 28 PositionÃ Exon 1 Exon 1 61A.G 325G.A 548A.G 1199G.A 1236C.T 1474C.T 2650C.T 2677G.T 2677G.A 3421T.A 3435C.T 3587T.G 3751G.A Effect on protein À4C.T À1G.A N21D E109K N183S S400N G412G R492C L884L A893S A893T S1141T I1145I I1196S V1251I Classification by Kim et al. [12] Ã1 - - - - - - - - - - - Ã1A - - - - A - - - - - - Ã1B T - - - - - - - - - - Ã1C - - - - - - - - - A - Ã1D - - - G - - - - - - - Ã2 - - - - - T - - T - T Ã2A - - G - - T - - T - T Ã2B - - - - - T - T T - T Ã2C - - - - - T T - T - T Ã3 - - - - - - - - T - T Ã4 - - - - - T - - - - T Ã5 - A - - - - - - - - T Ã6 - - - - - - - - - - T Ã7 - - - - - - - - T - - Ã8 - - - - - T - - - - - Classification of haplotype group detected in this paperÃÃ Block 1 Ã1 - - - - Ã2 - - G - Block 2 Ã1 - - - - - - - - - Ã2 - - T - - T - - T Ã4 - - T - - - - - T Ã6 - - - - - - - - T Ã8 - - T - - - - - - Ã9 - - - - - - - - - Ã10 - - - - - - A - - Ã11 - - T - - - A - - Block 3 Ã1 - - Ã2 - A Ã3 G - ÃAdenine of the initiation codon ATG in exon 2 was numbered +1. Login to comment

[hide] Warfarin sensitivity related to CYP2C9, CYP3A5, AB... Pharmacogenomics J. 2004;4(1):40-8. Wadelius M, Sorlin K, Wallerman O, Karlsson J, Yue QY, Magnusson PK, Wadelius C, Melhus H
Warfarin sensitivity related to CYP2C9, CYP3A5, ABCB1 (MDR1) and other factors.
Pharmacogenomics J. 2004;4(1):40-8., [PMID:14676821]

Abstract [show]
The required dose of the oral anticoagulant warfarin varies greatly, and overdosing often leads to bleeding. Warfarin is metabolised by cytochrome P450 enzymes CYP2C9, CYP1A2 and CYP3A. The target cell level of warfarin may be dependent on the efflux pump P-glycoprotein, encoded by the adenosine triphosphate-binding cassette gene ABCB1 (multidrug resistance gene 1). Genetic variability in CYP2C9, CYP3A5 and ABCB1 was analysed in 201 stable warfarin-treated patients using solid-phase minisequencing, pyrosequencing and SNaPshot. CYP2C9 variants, age, weight, concurrent drug treatment and indication for treatment significantly influenced warfarin dosing in these patients, explaining 29% of the variation in dose. CYP3A5 did not affect warfarin dosing. An ABCB1 haplotype containing the exon 26 3435T variant was over-represented among low-dose patients. Thirty-six patients with serious bleeding complications had higher prothrombin time international normalised ratios than 189 warfarin-treated patients without serious bleeding, but there were no significant differences in CYP2C9, CYP3A5 or ABCB1 genotypes and allelic variants.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 There are many known polymorphisms in ABCB1: for example, À12T4C in exon 1 in the 50 untranslated region, À1G4A at the initiation of translation in exon 2, 1199G4A in exon 11 leading to amino-acid change S400N, 1236C4T in exon 12 at a wobble position G412G, 2677G4T or G4A in exon 21 leading to A893S or T, and in exon 26 two polymorphisms at wobble positions, 3396C4T A1132A and 3435C4T I1145I.28,30 Polymorphisms of ABCB1 are suggested to be important for variability in drug bioavailability, but the pharmacological implication of these polymorphisms has not been fully established.30 Haemorrhage is the most common adverse reaction to coumarin anticoagulants, and a great under-reporting of these events is believed to exist.3,31 Swedish studies have shown that 4.5% of warfarin-treated patients experience major bleeding and 0.5% suffer fatal complications.31 The risk of bleeding is 10 times higher during the first month compared to after the first year.5 There is a clear relationship between haemorrhage and the intensity of treatment, with PT INR elevation being a strong predictor.3,5,10,32 Age, concurrent medication, specific comorbid conditions, especially cerebrovascular, kidney, heart and liver disease as well as prosthetic heart valves, are independent risk factors.5,32 Several studies suggest that patients with CYP2C9 variant alleles have a higher incidence of bleeding complications than carriers of the wild-type genotype.15,16,20,22 The risk of haemorrhage must always be weighed against the prevention of thromboembolism, and in most patients the preventive effect outweighs the risk of bleeding.4,32 The aim of the study was to identify factors that influence the effect of warfarin and the required dose. Login to comment
74 Table 5 Alignment and frequencies of predicted ABCB1 haplotypes in the dose requirement study ABCB1 haplotypes A B C D E F G Others Variable sites Exon 1 (À12T4C 50 untranslated region) T T T T T T T Exon 2 (À1G4A translation initiation) G G A G G G G Exon 11 (1199G4A S400N) G G G G A G G Exon 12 (1236C4T G412G) T C C C C C T Exon 21 (2677G4T/A A893S/T) T G G G G A T Exon 26 (3396C4T A1132A) C C C C C C C Exon 26 (3435C4T I1145I) T C T T C T C Frequencies in dose study (201 patients)a 40.8% 33.3% 10.0% 5.0% 3.5% 2.5% 1.0% p1.0% each Distribution of haplotypes in three dose groups Low dose/BW (o0.33 mg/kg) 33.3% 34.8% 24.3% 60.0% 30.8% 40.0% 25.0% Medium dose/BW (0.33-0.46 mg/kg) 35.7% 30.4% 29.7% 25.0% 23.1% 20.0% 25.0% High dose/BW (40.46 mg/kg) 31.0% 34.8% 46.0% 15.0% 46.2% 40.0% 50.0% P w2 0.5575 0.6016 0.1786 0.0242 0.5623 0.6564 0.7749 P Fischer`s exact 0.5769 0.6369 0.1821 0.0348 0.6778 0.7767 1.00 P trend 0.5888 1.00 0.0745 0.0094 0.4824 1.00 0.5362 a Two out of 201 were not genotyped for Exon 1 (À12T4C), and their haplotypes are estimated as B/B and A/F, respectively, according to the results from polymorphisms in Exon s 2, 11, 12, 21, 26 and 26. Login to comment

[hide] Polymorphisms in human MDR1 (P-glycoprotein): rece... Clin Pharmacol Ther. 2004 Jan;75(1):13-33. Marzolini C, Paus E, Buclin T, Kim RB
Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance.
Clin Pharmacol Ther. 2004 Jan;75(1):13-33., [PMID:14749689]

Abstract [show]
Drug transporters are increasingly recognized to be important to drug disposition and response. P-glycoprotein, the encoded product of the human MDR1 (ABCB1) gene, is of particular clinical relevance in that this transporter has broad substrate specificity, including a variety of structurally divergent drugs in clinical use today. Moreover, expression of this efflux transporter in certain tissue compartments such as the gastrointestinal tract and brain capillary endothelial cells limits oral absorption and central nervous system entry of many drugs. Recently, a number of single-nucleotide polymorphisms (SNPs) in MDR1 have been identified. An increasing number of studies have also implicated certain commonly occurring SNPs in MDR1 in problems including altered drug levels and host susceptibility to diseases such as Parkinson's disease, inflammatory bowel disease, refractory seizures, and CD4 cell recovery during human immunodeficiency virus therapy. However, in many such cases, the reported effects of MDR1 SNPs have been inconsistent and, in some cases, conflicting. In this review SNPs in MDR1 in relation to population frequencies, drug levels, and phenotypes are outlined. In addition, issues relating to MDR1 haplotypes, environmental factors, and study design, as potential confounding factors of the observed MDR1 polymorphism effect in vivo, are also discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Summary of genetic polymorphisms in MDR1 Location Position Mutation Effect Mutant allele frequency (%) Hoffmeyer et al89 : C Cascorbi et al90 : C Siegmund et al91 : C Promotor 5' flanking/-41 A/G Noncoding Exon 1a Exon 1a/-145 C/G Noncoding Exon 1b Exon 1b/-129 T/C Noncoding 5.9 Intron 1 Exon 2/-4 C/T Noncoding Intron 1 Exon 2/-1 G/A Initial translation 5.6 9 3.7 Exon 2 Exon 2/61 A/G Asn21Asp 9.3 11.2 8.9 Intron 4 Exon 5/-35 G/C 0.6 Intron 4 Exon 5/-25 G/T 16.5 Exon 5 Exon 5/307 T/C Phe103Leu 0.6 0 Intron 6 Exon 6/ϩ139 C/T 40.6 37.2 35.8 Intron 6 Exon 6/ϩ145 C/T 1.2 Exon 7 Exon 7/548 A/G Asn183Ser Exon 11 Exon 11/1199 G/A Ser400Asn 6.5 5.5 2.9 Exon 12 Exon 12/1236 C/T Silent 37.8 41 34.3 Intron 12 Exon 12/ϩ44 C/T 5.9 4.9 7.5 Exon 13 Exon 13/1474 C/T Arg492Cys Intron 16 Exon 17/-76 T/A 45.3 46.2 49.3 Intron 17 Exon 17/ϩ137 A/G 0.6 Exon 21 Exon 21/2650 C/T Silent Exon 21 Exon 21/2677 G/T Ala893Ser 41.6 40.3 G/A Ala893Thr 1.9 3.7 Exon 24 Exon 24/2956 A/G Met986Val Exon 24 Exon 24/2995 G/A Ala999Thr Exon 26 Exon 26/3320 A/C Gln1107Pro 0.2 Exon 26 Exon 26/3396 C/T Silent 0.3 Exon 26 Exon 26/3421 T/A Ser1141Thr Exon 26 Exon 26/3435 C/T Silent 48.1 53.9 50.7 Exon 28 Exon 28/4030 G/C Exon 28 Exon 28/4036 A/G The positions of the polymorphisms were established with the first base of the ATG start codon set to 1. Login to comment

[hide] Multidrug resistance gene G1199A polymorphism alte... J Pharmacol Exp Ther. 2004 Sep;310(3):1199-207. Epub 2004 Apr 20. Woodahl EL, Yang Z, Bui T, Shen DD, Ho RJ
Multidrug resistance gene G1199A polymorphism alters efflux transport activity of P-glycoprotein.
J Pharmacol Exp Ther. 2004 Sep;310(3):1199-207. Epub 2004 Apr 20., [PMID:15100388]

Abstract [show]
The significance of the human multidrug resistance gene (MDR1) G1199A polymorphism, resulting in a Ser400Asn modification in P-glycoprotein (P-gp), remains unclear. We have developed stable recombinant LLC-PK1 epithelial cells expressing either MDR1wt or MDR11199 to evaluate functional consequences of G1199A [N-(4-[2-(1,2,3,4-tetrahydro-6,7-dimethoxy-2-isoquinolinyl)ethyl]-phenyl)- 9,10-dihydro-5-methoxy-9-oxo-4-acridine carboxamide]. P-gp activity observed in MDR1wt and MDR11199 cells was completely inhibited in the presence of the specific P-gp inhibitor GF120918. Comparable expression of mRNA and protein in the MDR1-expressed cells and correct localization of P-gp in the apical membrane of recombinant cells was verified. Mean intracellular rhodamine-123 (R123) accumulation, measured by flow cytometry, was approximately 4.75-fold higher in MDR11199 recombinant cells than MDR1wt cells. Cytotoxicity studies have shown that MDR1wt and MDR11199 cells exhibited similar resistance, as measured by EC50 values, to doxorubicin (155 +/- 68 versus 120 +/- 32 nM); however, MDR11199 cells were more resistant to vinblastine (1.41 +/- 0.51 versus 15.7 +/- 4.0 nM; p < 0.001) and vincristine (1.18 +/- 0.56 versus 3.41 +/- 1.47 nM; p < 0.05). The apparent transepithelial permeability ratios of R123 in MDR1wt and MDR11199 cells were 3.54 +/- 0.94 and 2.02 +/- 0.51 (p < 0.05), respectively. Therefore, the G1199A polymorphism alters the efflux and transepithelial permeability of a fluorescent substrate and sensitivity to select cytotoxic agents, which may influence drug disposition and therapeutic efficacy of some P-gp substrates.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Multidrug Resistance Gene G1199A Polymorphism Alters Efflux Transport Activity of P-Glycoprotein Erica L. Woodahl, Ziping Yang, Tot Bui, Danny D. Shen, and Rodney J. Y. Ho Department of Pharmaceutics, University of Washington, Seattle, Washington Received January 13, 2004; accepted April 20, 2004 ABSTRACT The significance of the human multidrug resistance gene (MDR1) G1199A polymorphism, resulting in a Ser400Asn modification in P-glycoprotein (P-gp), remains unclear. Login to comment

[hide] Functional implications of genetic polymorphisms i... Pharm Res. 2004 Jun;21(6):904-13. Pauli-Magnus C, Kroetz DL
Functional implications of genetic polymorphisms in the multidrug resistance gene MDR1 (ABCB1).
Pharm Res. 2004 Jun;21(6):904-13., [PMID:15212152]

Abstract [show]
The multidrug resistance (MDR1) gene product P-glycoprotein is a membrane protein that functions as an ATP-dependent efflux pump, transporting exogenous and endogenous substrates from the inside of cells to the outside. Physiological expression of P-glycoprotein in tissues with excretory or protective function is a major determinant of drug disposition and provides a cellular defense mechanism against potentially harmful compounds. Therefore, P-glycoprotein has significant impact on therapeutic efficacy and toxicity as it plays a key role in absorption of oral medications from the intestinal tract, excretion into bile and urine, and distribution into protected tissues such as the brain and testes. There is increasing interest in the possible role of genetic variation in MDR1 in drug therapy. Numerous genetic polymorphisms in MDR1 have been described, some of which have been shown to determine P-glycoprotein expression levels and substrate transport. Furthermore, some of these polymorphisms have an impact on pharmacokinetic and pharmacodynamic profiles of drug substrates and directly influence outcome and prognosis of certain diseases. This review will focus on the impact of genetic variation in MDR1 on expression and function of P-glycoprotein and the implications of this variation for drug therapy and disease risk.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 6, June 2004 ((c) 2004) 9040724-8741/04/0600-0904/0 (c) 2004 Plenum Publishing Corporation Table I. MDR1 Coding Variants cDNA positiona NT change DNA/AA position AA change Allele frequencyb Total (n ‫ס‬ 494) CA (n ‫ס‬ 200) AA (n ‫ס‬ 200) AS (n ‫ס‬ 60) ME (n ‫ס‬ 20) PA (n ‫ס‬ 14) 61 A to G 21 Asn to Asp 0.045 0.080 0.025 0.017 0 0 266 T to C 89 Met to Thr 0.002 0.005 0 0 0 0 729 A to G 243 Syn 0.002 0.005 0 0 0 0 781 A to G 261 Ile to Val 0.006 0 0.015 0 0 0 1199 G to A 400 Ser to Asn 0.014 0.025 0.010 0 0 0 1236 C to T 412 Syn 0.385 0.459 0.209 0.685 0.450 0.571 1308 A to G 436 Syn 0.002 0 0.005 0 0 0 1617 C to T 539 Syn 0.002 0.005 0 0 0 0 1985 T to G 662 Leu to Arg 0.002 0.005 0 0 0 0 2005 C to T 669 Arg to Cys 0.004 0 0.010 0 0 0 2547 A to G 849 Ile to Met 0.002 0.005 0 0 0 0 2650 C to T 884 Syn 0.004 0.005 0.005 0 0 0 2677 G to T 893 Ala to Ser 0.308 0.464 0.100 0.450 0.400 0.357 2677 G to A 893 Ala to Thr 0.035 0.036 0.005 0.067 0 0.357 3151 C to G 1051 Pro to Ala 0.002 0 0.005 0 0 0 3322 T to C 1108 Trp to Arg 0.002 0 0.005 0 0 0 3421 T to A 1141 Ser to Thr 0.047 0 0.111 0 0.050 0 3435 C to T 1145 Syn 0.392 0.561 0.202 0.400 0.500 0.500 3751 G to A 1251 Val to Ile 0.002 0 0 0 0.050 0 3767 C to A 1256 Thr to Lys 0.002 0.005 0 0 0 0 a cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758. Login to comment

[hide] Pharmacogenomics of drug transporters: a new appro... Biol Pharm Bull. 2004 Jul;27(7):939-48. Ishikawa T, Onishi Y, Hirano H, Oosumi K, Nagakura M, Tarui S
Pharmacogenomics of drug transporters: a new approach to functional analysis of the genetic polymorphisms of ABCB1 (P-glycoprotein/MDR1).
Biol Pharm Bull. 2004 Jul;27(7):939-48., [PMID:15256718]

Abstract [show]
In the 21st century, emerging genomic technologies (i.e., bioinformatics, functional genomics, and pharmacogenomics) are shifting the paradigm of drug discovery research and improving the strategy of medical care for patients. In order to realize the personalized medicine, it is critically important to understand molecular mechanisms underlying inter-individual differences in the drug response, namely, pharmacological effect vs. side effect. Evidence is now accumulating to strongly suggest that drug transporters are one of the determinant factors governing the pharmacokinetic profile of drugs. Effort has been made to identify genetic variation in drug transporter genes. In particular, genetic variations of the human ABCB1 (P-glycoprotein/MDR1) gene have been most extensively studied. Hitherto more than fifty single nucleotide polymorphisms (SNPs) and insertion/deletion polymorphisms in the ABCB1 gene have been reported. However, at the present time, information is still limited with respect to the actual effect of those genetic polymorphisms on the function of ABCB1. In this context, we have undertaken functional analyses of ABCB1 polymorphisms. To quantify the impact of genetic polymorphisms on the substrate specificity of ABCB1, we have developed a high-speed screening system and a new structure-activity relationship (SAR) analysis method. This review addresses functional aspects of the genetic polymorphism of ABCB1 and provides the standard method to evaluate the effect of polymorphisms on the function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 For this purpose, the cDNA of ABCB1 was cloned from the human liver cDNA library, and several variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) were prepared by site-directed mutagenesis (see Fig. 4A for primers). Login to comment
94 The variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) exhibited the verapamil-enhanced ATPase activity, as did the wild type of ABCB1. Login to comment
118 Kinetic Parameters of the Wild Type and SNP Variants of ABCB1 Variant Km Vmax (mM) (nmol/min/mg protein) Wild type 2.190Ϯ0.150 13.14Ϯ1.95 N21D 0.502Ϯ0.126 45.26Ϯ11.33 N44S 0.580Ϯ0.148 31.03Ϯ4.65 F103L 1.100Ϯ0.078 36.34Ϯ8.33 G185V 0.831Ϯ0.102 56.76Ϯ6.76 S400N 0.327Ϯ0.025 13.74Ϯ2.08 A893S 0.441Ϯ0.042 17.24Ϯ6.72 A893T 0.904Ϯ0.244 10.77Ϯ1.35 M986V 0.419Ϯ0.062 22.69Ϯ6.84 The wild type and variants of ABCB1 were then expressed it in Sf9 cells using the pFASTBAC1 vector and recombinant baculoviruses. Login to comment

[hide] Pharmacogenetics of drug transporters and its impa... Curr Top Med Chem. 2004;4(13):1385-98. Sakaeda T, Nakamura T, Okumura K
Pharmacogenetics of drug transporters and its impact on the pharmacotherapy.
Curr Top Med Chem. 2004;4(13):1385-98., [PMID:15379652]

Abstract [show]
Most drug responses are determined by the interplay of several gene products that influence pharmacokinetics and pharmacodynamics, i.e., drug metabolizing enzymes, drug transporters, and drug targets. With the sequencing of the human genome, it has been estimated that approximately 500-1200 genes code for drug transporters. Concerning the effects of genetic polymorphisms on pharmacotherapy, the best characterized drug transporter is the multidrug resistant transporter P-glycoprotein/MDR1, the gene product of MDR1. Little such information is available on other drug transporters. MDR1 is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily, and is expressed mainly in intestines, liver, kidneys and brain. A number of various types of structurally unrelated drugs are substrates for MDR1, and their intestinal absorption, hepatobiliary secretion, renal secretion and brain transport are regulated by MDR1. The first investigation on the effects of MDR1 genotypes on pharmacotherapy was reported in 2000: a silent single nucleotide polymorphism (SNP), C3435T in exon 26, was found to be associated with the duodenal expression of MDR1, and thereby the plasma concentration of digoxin after oral administration. At present, a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical investigations on the association of MDR1 genotypes with the expression and function of MDR1 in tissues, and with pharmacokinetics and pharmacodynamics have mainly focused on C3435T; however, there are still discrepancies in the results, suggesting that the haplotype of the gene should be analyzed instead of a SNP. C3435T is also reported to be a risk factor for a certain class of diseases including the inflammatory bowel diseases, Parkinson's disease and renal epithelial tumor, and this also might be explained by the effects on MDR1 expression and function. In this review, the latest reports on the effects of genetic polymorphisms of MDR1 on pharmacotherapy are summarized, and the pharmacogenetics of other transporters is briefly introduced.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 Position Location Effect A1a/-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G G5/-25T G5/-35C exon 2 intron intron Asn21Asp T307C C6/+139T exon 5 intron Phe103Leu A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T C12/+44T exon 12 intron silent C1474T T17/-76A A17/+137G exon 13 intron intron Arg492Cys C2650T exon 21 silent G2677(A,T) exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent The list was based on the reports [67,68,71-74]. Login to comment

[hide] Functional evaluation of ABCB1 (P-glycoprotein) po... Drug Metab Pharmacokinet. 2004 Feb;19(1):1-14. Ishikawa T, Hirano H, Onishi Y, Sakurai A, Tarui S
Functional evaluation of ABCB1 (P-glycoprotein) polymorphisms: high-speed screening and structure-activity relationship analyses.
Drug Metab Pharmacokinet. 2004 Feb;19(1):1-14., [PMID:15499164]

Abstract [show]
Evidence is accumulating to strongly suggest that drug transporters are one of the determinant factors governing the pharmacokinetic profile of drugs. Effort has been made to identify genetic variation in drug transporter genes. In particular, genetic variations of the human ABCB1 (MDR1) gene have been most extensively studied. Hitherto more than fifty single nucleotide polymorphisms (SNPs) and insertion/deletion polymorphisms in the ABCB1 gene have been reported. However, at the present time, information is still limited with respect to the actual effect of those genetic polymorphisms on the function of ABCB1. In this context, we have undertaken functional analyses of ABCB1 polymorphisms. To quantify the impact of genetic polymorphisms on the substrate specificity of ABCB1, we have developed a high-speed screening system and a new structure-activity relationship (SAR) analysis method. This review addresses functional aspects of the genetic polymorphism of ABCB1 and provides the standard method to evaluate the effect of polymorphisms on the function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 For this purpose, the cDNA of ABCB1 was cloned from the human liver cDNA library, and several variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) were prepared by site-directed mutagenesis (see Fig. 2A for primers). Login to comment
86 The variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) exhibited the verapamil-enhanced ATPase activity, as did the wild type of ABCB1. Login to comment
105 Kinetic parameters of the wild type and SNP variants of ABCB1 Variant Km Vmax (mM) (nmolWminWmg protein) Wild type 2.190±0.150 13.14±1.95 N21D 0.502±0.126 45.26±11.33 N44S 0.580±0.148 31.03±4.65 F103L 1.100±0.078 36.34±8.33 G185V 0.831±0.102 56.76±6.76 S400N 0.327±0.025 13.74±2.08 A893S 0.441±0.042 17.24±6.72 A893T 0.904±0.244 10.77±1.35 M986V 0.419±0.062 22.69±6.84 The wild type and variants of ABCB1 were then expressed it in Sf9 cells using the pFASTBAC1 vector and recombinant baculoviruses. Login to comment

[hide] Ethnic differences in genetic polymorphisms of CYP... Drug Metab Pharmacokinet. 2004 Apr;19(2):83-95. Ozawa S, Soyama A, Saeki M, Fukushima-Uesaka H, Itoda M, Koyano S, Sai K, Ohno Y, Saito Y, Sawada J
Ethnic differences in genetic polymorphisms of CYP2D6, CYP2C19, CYP3As and MDR1/ABCB1.
Drug Metab Pharmacokinet. 2004 Apr;19(2):83-95., [PMID:15499174]

Abstract [show]
Metabolic capacities for debrisoquin, sparteine, mephenytoin, nifedipine, and midazolam, which are substrates of polymorphic CYP2D6, CYP2C19, and CYP3A, have been reported to exhibit, in many cases, remarkable interindividual and ethnic differences. These ethnic differences are partly associated with genetic differences. In the case of the drug transporter ABCB1/MDR1, interindividual differences in its transporter activities toward various clinical drugs are also attributed to several ABCB1/MDR1 genetic polymorphisms. In this review, the existence and frequency of various low-activity alleles of drug metabolizing enzymes as well as populational drug metabolic capacities are compared among several different races or ethnicities. Distribution of nonsynonymous ABCB1/MDR1 SNPs and haplotype frequency in various races are summarized, with the association of nonsynonymous SNPs with large functional alterations as a rare event.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Ethnic dierences in nonsynonymous SNPs of ABCB1W MDR1 cDNA positiona Position and amino acid change C AA AS J 61AÀG N21D 0.080 0.025 0.017 0 266TÀC M89T 0.005 0 0 0 781AÀG I261V 0 0.015 0 0 1199GÀA S400N 0.025 0.010 0 0 1985TÀG L662R 0.005 0 0 0 2005CÀT R669C 0 0.010 0 0 2547AÀG I849M 0.005 0 0 0 2677GÀT A893S 0.464 0.100 0.450 0.403 2677GÀA A893T 0.036 0.005 0.067 0.200 3151CÀG P1051A 0 0.005 0 0 3322TÀC W1108R 0 0.005 0 0 3421TÀA S1141T 0 0.111 0 0 3751GÀA V1251I 0 0 0 0.010 3767CÀA T1256K 0.005 0 0 0 C, 100 Caucasians; AA, 100 African-Americans; AS, 30 Asians; J, 145 Japanese (our study 116) ). Login to comment

[hide] Polymorphism of MDR1 gene in healthy japanese subj... Drug Metab Pharmacokinet. 2002;17(5):479-81. Honda T, Dan Y, Koyabu N, Ieiri I, Otsubo K, Higuchi S, Ohtani H, Sawada Y
Polymorphism of MDR1 gene in healthy japanese subjects: a novel SNP with an amino acid substitution (Glu108Lys).
Drug Metab Pharmacokinet. 2002;17(5):479-81., [PMID:15618700]

Abstract [show]
We discovered a novel single nucleotide polymorphism (SNP) at position 325 (G325A) in exon 5 of the multidrug-resistance 1 (MDR1) gene in a study of 37 healthy Japanese subjects. Details are as follows. SNP, 020614Honda001; GENE NAME, human P-glycoprotein (MDR1); ACCESSION NUMBER, M29427; LENGTH, 25 bases; 5'-ATGAATCTGGAGG/AAAGACATGACCA-3'. This SNP is expected to cause an amino acid substitution (Glu108Lys). In this study, one homozygote and one heterozygote for G325A were identified.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 To date, the following SNPs in the MDR1 gene leading to amino acid substitutions have been identiˆed: A61G (Asn21Asp) in exon 2, T307C (Phe103Leu) in exon 5, G1199A (Ser400Asn) in exon 11, G2677T (Ala893Ser) in exon 21, G2677A (Ala893Thr) in exon 21 and A2956G (Met986Val) in exon 24. Login to comment

[hide] Twelve novel single nucleotide polymorphisms in AB... Drug Metab Pharmacokinet. 2002;17(6):566-71. Itoda M, Saito Y, Komamura K, Ueno K, Kamakura S, Ozawa S, Sawada J
Twelve novel single nucleotide polymorphisms in ABCB1/MDR1 among Japanese patients with ventricular tachycardia who were administered amiodarone.
Drug Metab Pharmacokinet. 2002;17(6):566-71., [PMID:15618713]

Abstract [show]
Twelve novel single nucleotide polymorphisms (SNPs) were found in the gene encoding the ATP-binding cassette transporter, P-glycoprotein, from 60 Japanese individuals who were administered the anti-antiarrythmic drug, amiodarone. The detected SNPs were as follows: 1) SNP, MPJ6_AB1017 (IVS6-109); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 2) SNP, MPJ6_AB1018 (IVS7+14); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 3) SNP, MPJ6_AB1021 (IVS9-44); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 4) SNP, MPJ6_AB1052 (IVS12+17); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 5) SNP, MPJ6_AB1029 (IVS15-69); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 6) SNP, MPJ6_AB1040 (IVS24+16); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 7) SNP, MPJ6_AB1053 (IVS27-189); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 8) SNP, MPJ6_AB1054 (IVS27-172); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 9) SNP, MPJ6_AB1048 (IVS27-167); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 10) SNP, MPJ6_AB1055 (IVS27-152); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 11) SNP, MPJ6_AB1049 (IVS27-119); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 12) SNP, MPJ6_AB1051 (at nucleotide 3751 (exon 28) from the A of the translation initiation codon); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168. Among these SNPs, only MPJ6_AB1051 resulted in an amino acid alteration, V1251I.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 Much eort has been taken to uncover polymorphisms in the ABCB1WMDR1 gene since a synonymous SNP, which correlated with diminished MDR1 expression levels in the human duodenum, was reported by Homeyer et al.7) To date, information on 19 single nucleotide polymorphisms (SNPs) including 7 nonsynonymous ones (N21D, F103L, S400N, A893S, A893T, A999T and Q1107P) for ABCB1WMDR1 have been reported in Caucasians.8,9) ABCB1WMDR1 gene SNPs including intronic10) and 2 nonsynonymous SNPs (E108K, M986V)11,12) were also reported in Japanese population. Login to comment
78 Moreover, the reported nonsynonymous polymorphisms, N21D, F103L, S400N, A893S and A999T have been shown not to substantially aect the activity of P-glycoprotein14) . Login to comment

[hide] Single nucleotide polymorphisms of ABCB1 (MDR1) ge... Eur J Clin Pharmacol. 2005 Apr;61(2):97-102. Epub 2005 Feb 4. Allabi AC, Horsmans Y, Issaoui B, Gala JL
Single nucleotide polymorphisms of ABCB1 (MDR1) gene and distinct haplotype profile in a West Black African population.
Eur J Clin Pharmacol. 2005 Apr;61(2):97-102. Epub 2005 Feb 4., [PMID:15692830]

Abstract [show]
OBJECTIVE: The ABCB1 (MDR1) multidrug transporter plays a key role in determining drug bioavailability. Differences in drug response exist among different ethnic groups. However, until now, no haplotype data are available in a Black African population. METHODS: Exons 2, 7, 10, 11, 12, 14, 17, 21, 26, and the surrounding intronic regions were sequenced using genomic DNA from 111 Beninese subjects to examine 19 intragenic single nucleotide polymorphisms (SNPs). Linkage disequilibrium analysis and haplotypes were generated using the expectation-maximization algorithm. RESULTS: We identified 12 SNPs, 3 of which were novel: IVS9-57delA, IVS9-8T>A, 1662G>C (exon 14). The most common SNP was IVS14+38A>G. At the MRD1 locus, 53 haplotypes were inferred from the SNP data sets. The 4 SNPs, IVS6+139C>T, IVS9-44A>G, 1236C>T, and 3435C>T, showed strong linkage disequilibrium with each other, confirming the block concept. Moreover, our findings suggest that ABCB1 exonic SNPs are less frequently observed in our population than in African-Americans. CONCLUSION: Our data are compatible with a close evolutionary relationship in Black Africans from Benin.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 AA amino acid, n number of chromosomes examined, ND not detected Variant no.a cDNA positionb NT changec DNA/AA position AA change Allele frequencyd (n=222) 2.1 À4 C to T Non-coding 0.0045 2.2 À1 G to A Non-coding 0 2.3 61 A to G 21 Asn to Asp 0 6.1 139 C to T Intron 6 0.17 9.0* À57 del A Intron 9 0.009 10.1 À44 A to G Intron 9 0.18 10.0* À8 T to A Intron 9 0.0045 11.1 À41 T to G Intron 10 0 11.2 1199 G to A 400 Ser to Asn 0 12.2 1236 C to T 412 Syn 0.15 14.1 1617 C to T 539 Syn 0 14.0* 1662 G to C 554 Syn 0.009 14.2 38 A to G Intron 14 0.49 17.1 À76 T to A Intron 16 0.347 21.2 2650 C to T 884 Syn 0 21.3a 2677 G to T 893 Ala to Ser 0.009 21.3b 2677 G to A 893 Ala to Thr 0 26.2 3421 T to A 1141 Ser to Thr 0.054 26.3 3435 C to T 1145 Syn 0.14 a Variants are numbered sequentially by exon. Login to comment

[hide] The implications of P-glycoprotein in HIV: friend ... Fundam Clin Pharmacol. 2005 Jun;19(3):283-96. Owen A, Chandler B, Back DJ
The implications of P-glycoprotein in HIV: friend or foe?
Fundam Clin Pharmacol. 2005 Jun;19(3):283-96., [PMID:15910652]

Abstract [show]
P-glycoprotein (P-gp), coded by the ABCB1 gene, has a wide tissue distribution. The drug transporter is known to limit the bioavailability of a plethora of drugs and xenobiotics including the human immunodeficiency virus (HIV) protease inhibitors. There remains a considerable degree of debate in the literature with respect to the role of ABCB1 polymorphisms in HIV-treatment outcome and some studies have also implicated antiretroviral drugs as inducers of P-gp. Recent evidence indicates a role for P-gp in the inhibition of viral infectivity and/or release and cellular relationships with other infection-related proteins (and cholesterol). It is becoming increasingly clear that future studies on P-gp in HIV should consider both pharmacological and virological issues.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 Increased in TT homozygotesCD4 response Singh et al. (2003) [84] 71 (11% Caucasian; 23% Hispanic; 66% Black) 8 weeks NFV, EFV NFV level Lower in CC homozygotes CD4 response No difference Petersen et al. (2003) [85] 142 (Caucasian, African-American or Hispanic) 48 weeks NFV, EFV CD4 response No difference Verstuyft et al. (2003) [86] 76 (Not given) 72 weeks IDV Drug level No difference Maher et al. (2003) [87] 12 (Caucasian) 1 dose IDV Cmax Higher in CC homozygotes Brumme et al. (2003) [88] 461 (Predominantly Caucasian and Aboriginal) 192 weeks Not Specified CD4 response No difference Nasi et al. (2003) [89] 149 (Caucasian) 24 weeks Not specified CD4 and virological response to PIs No difference CD4 response to NNRTIs Higher in TT homozygotes Ifergan et al. (2003) [90] 137 (Caucasian) N/A N/A HIV-1 infectivity No difference Chandler et al. (2003) [44] 16 (Caucasian) N/A N/A P-gp inducibility No difference Haas et al. (2003) [91] 31 (84% Caucasian) 24 weeks RTV Ctrough No difference CD4 and virological response No difference Winzer et al. (2003) [92] 67 (Caucasian) LPV 53 weeks; EFV 105 weeks LPV, EFV LPV Ctrough No difference EFV C12 No difference Bleiber et al. (2004) [53] 411 (Predominantly Caucasian) 8 years Not specified CD4+ response No difference van der Ende et al. (2004) [93] 186 (61% Caucasian; 30% Black) 12 weeks NVP Drug levels No difference Hulgan et al. (2004) [94] 205 (72% Caucasian; 28% Black) During routine care Not specified P-gp efflux activity Lower in TT homozygotes CD4 and virological response No difference Anderson et al. (2004) [95] 33 (79% Caucasian; 21% Black) 72 weeks IDV CL/F No difference Owen et al. (2004) [96] 108 (>80% Caucasian) 48 weeks IDV, SQV, RTV Ctrough No difference serine to asparagine at position 400 of the protein. Login to comment

[hide] Complex haplotypic effects of the ABCB1 gene on ep... Pharmacogenomics. 2005 Jun;6(4):411-7. Hung CC, Tai JJ, Lin CJ, Lee MJ, Liou HH
Complex haplotypic effects of the ABCB1 gene on epilepsy treatment response.
Pharmacogenomics. 2005 Jun;6(4):411-7., [PMID:16004559]

Abstract [show]
OBJECTIVES: The aim of this study was to investigate the association of the complex haplotype system of the adenosine triphosphate-binding cassette B1 (ABCB1) gene with the epilepsy treatment response. METHODS AND RESULTS: Ten polymorphisms were genotyped in 108 drug-resistant epileptic patients, 223 seizure-free patients and 287 normal controls. Highly significant linkage disequilibrium was shown among exon 12 C1236T, exon 21 G2677T and exon 26 C3435T. Haplotypic analysis demonstrated that patients with the CGC, TGC, and TTT haplotypes were more likely to be drug resistant. Further analysis of haplotype combinations demonstrated that drug-resistant patients tended to have the CGC/CGC, CGC/TGC, CGC/TTT, and TGC/TTT haplotype combinations over the seizure-free patients and controls (all p-values < 0.0001). In contrast, patients with the TTC/TTC, TTC/CGT, TTC/TGT, CGT/CGT and TGT/CGT haplotype combinations were more likely to be seizure-free (all p-values<0.0001 except CGT/CGT [p=0.0063]). CONCLUSION: Our results showed that the three loci, C1236T, G2677T and C3435T, jointly influenced the treatment response for epileptic patients. They should be regarded together as a complex polymorphic drug-response system. These findings suggest that examination of the haplotypes of the three loci could be useful in predicting drug resistance in epilepsy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 The following 10 SNPs of the ABCB1 gene were identified by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) [15]: intron 1 (exon 2 -1) G/A, exon 2 A61G (amino acid exchange Asn21Asp), intron 6 (exon 6 +139) C/T, exon 11 G1199A (Ser400Asn), exon 12 C1236T, intron 12 (exon 12 +44) C/T, intron 16 (exon 17 -76) T/A, exon 21 G2677T (Ala893Ser), G2677A (Ala893Thr), and exon 26 C3435T. Login to comment

[hide] MDR1 G1199A polymorphism alters permeability of HI... AIDS. 2005 Oct 14;19(15):1617-25. Woodahl EL, Yang Z, Bui T, Shen DD, Ho RJ
MDR1 G1199A polymorphism alters permeability of HIV protease inhibitors across P-glycoprotein-expressing epithelial cells.
AIDS. 2005 Oct 14;19(15):1617-25., 2005-10-14 [PMID:16184031]

Abstract [show]
OBJECTIVE: To evaluate the impact of the human multidrug resistance gene (MDR1) G1199A polymorphism (amino acid change Ser400Asn) on P-glycoprotein (P-gp)-dependent transepithelial permeability and uptake kinetics of HIV protease inhibitors (PI), by using recombinant epithelial cells expressing wild-type MDR1 (MDR1wt) or the G1199A variant (MDR1(1199A)). METHODS: Using a recombinant expression system developed previously, the transepithelial permeability and uptake kinetic parameters of five PI, amprenavir, indinavir, lopinavir, ritonavir, and saquinavir were estimated across polarized epithelial cells. RESULTS: For all PI, the transepithelial permeability ratio (basolateral-to-apical transport divided by apical-to-basolateral transport) was significantly greater in MDR1(1199A) cells than MDR1wt cells: amprenavir (1.7-fold), indinavir (1.8-fold), lopinavir (1.5-fold), ritonavir (2.8-fold), and saquinavir (2.1-fold). However, the impact of G1199A on P-gp activity appeared to primarily influence drug permeability in the apical-to-basolateral direction. Kinetic analysis of ritonavir and saquinavir uptake by MDR1wt- and MDR1(1199A)-expressing cells showed that Vmax was similar, while uptake Km was significantly higher in cells expressing the G1199A variant suggesting that alterations in P-gp-dependent efflux mediated by G1199A were due to changes in transporter affinity. CONCLUSIONS: Alterations in transepithelial permeability of HIV PI due to the G1199A polymorphism may impact oral bioavailability of PI and penetration into cells and tissues of the lymphoid and central nervous systems.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 MDR1 G1199A polymorphism alters permeability of HIV protease inhibitors across P-glycoprotein-expressing epithelial cells Erica L. Woodahl, Ziping Yang, Tot Bui, Danny D. Shen and Rodney J.Y. Ho Objective: To evaluate the impact of the human multidrug resistance gene (MDR1) G1199A polymorphism (amino acid change Ser400Asn) on P-glycoprotein (P-gp)- dependent transepithelial permeability and uptake kinetics of HIV protease inhibitors (PI), by using recombinant epithelial cells expressing wild-type MDR1 (MDR1wt ) or the G1199A variant (MDR11199A). Login to comment
29 G1199A results in a serine to asparagine transition at amino acid 400 (Ser400Asn) in a cytoplasmic domain of P-gp, with an allelic frequency of approximately 5.5% in Caucasians [26-28]. Login to comment
135 The mechanisms by which G1199A alters P-gp activity are not yet known. The G1199A polymorphism causes a Ser400Asn, which lies adjacent to the first ATP-binding domain of P-gp and to transmembrane domain 6, one of the transmembrane domains important in substrate binding [32,33]. Login to comment
136 However, because a crystal structure for P-gp is not yet available, the exact orientation of Ser400Asn relative to the substrate-binding regions or ATP-binding domain of P-gp is not known. The G1199A polymorphism may affect ATPase activity of P-gp, altering ATP hydrolysis necessary for substrate efflux. Login to comment

[hide] Single nucleotide polymorphisms in human P-glycopr... Expert Opin Drug Deliv. 2006 Jan;3(1):23-35. Dey S
Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition.
Expert Opin Drug Deliv. 2006 Jan;3(1):23-35., [PMID:16370938]

Abstract [show]
Drug efflux pumps belong to a large family of ATP-binding cassette transporter proteins. These pumps bind their substrate and export it through the membrane using energy derived from ATP hydrolysis. P-glycoprotein, the main efflux pump in this family, is expressed not only in tumour cells but also in normal tissues with excretory function (liver, kidney and the intestine). It has a broad specificity of substrates and plays an important role in drug delivery and disposition. Recently, genetic screening of P-glycoprotein has yielded multiple single nucleotide polymorphisms, which seem to alter transporter function and expression. This review discusses the various polymorphisms of this gene and its impact on drug disposition and diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 The G1199A SNP is located in the cytoplasmic loop close to the first ATP-binding domain and changes the amino acid from Ser to Asn (Ser400Asn). Login to comment
123 Location Position Mutation Effect Promoter 5`/-41 A→G Noncoding Exon 1a Exon 1a/-145 C→G Noncoding Exon 1b Exon 1b/-129 T→C Noncoding Intron 1 Exon 2/-4 C→T Noncoding Intron 1 Exon 2/-1 G→A Initiation of translation Exon 2 Exon 2/61 A→G Asn21Asp Intron 4 Exon 5/-35 G→C Intron 4 Exon 5/-25 G→T Exon 5 Exon 5/307 T→C Phe103Leu Intron 6 Exon 6/+139 C→T Intron 6 Exon 6/+145 C→T Exon 7 Exon 7/548 A→G Asn183Ser Exon 11 Exon 11/1119 G→A Ser400Asn Exon 12 Exon 12/1236 C→T Silent base change Intron 12 Exon 12/+44 C→T Exon 13 Exon 13/1474 C→T Arg492Cys Intron 16 Exon 17/-76 T→A Intron 17 Exon 17/+137 A→G Exon 21 Exon 21/2650 C→T Silent base change Exon 21 Exon 21/2677 G→T G→A Ala893Ser Ala893Thr Exon 24 Exon 24/2956 A→G Met986Val Exon 24 Exon 24/2995 G→A Ala999Thr Exon 26 Exon 26/3320 A→C Gln1107Pro Exon 26 Exon 26/3396 C→T Silent base change Exon 26 Exon 26/3421 T→A Ser1141Thr Exon 26 Exon 26/3435 C→T Silent base change Exon 28 Exon 28/4030 G→C Exon 28 Exon 28/4036 A→G The positions of the polymorphism are from the first base of the ATG start codon set to 1. Login to comment

[hide] MDR1 genotype-related pharmacokinetics: fact or fi... Drug Metab Pharmacokinet. 2005 Dec;20(6):391-414. Sakaeda T
MDR1 genotype-related pharmacokinetics: fact or fiction?
Drug Metab Pharmacokinet. 2005 Dec;20(6):391-414., [PMID:16415525]

Abstract [show]
Multidrug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily of membrane transporters. A number of various types of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics. The first investigation of the effects of MDR1 genotypes on pharmacotherapy was reported in 2000; a silent single nucleotide polymorphism (SNP), C3435T in exon 26, was found to be associated with the duodenal expression of MDR1, and thereby the plasma concentration of digoxin after oral administration. In the last 5 years, clinical studies have been conducted around the world on the association of MDR1 genotype with MDR1 expression and function in tissues, and with the pharmacokinetics and pharmacodynamics of drugs; however, there are still discrepancies in the results on C3435T. In 1995, a novel concept to predict in vivo oral pharmacokinetic performance from data on in vivo permeability and in vitro solubility has been proposed, and this Biopharmaceutical Classification System strongly suggested that the effects of intestinal MDR1 on the intestinal absorption of substrates is minimal in the case of commercially available oral drugs, and therefore MDR1 genotypes are little associated with the pharmacokinetics after oral administration. This review summarizes the latest reports for the future individualization of pharmacotherapy based on MDR1 genotyping, and attempts to explain discrepancies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 Representative genetic polymorphisms in MDR1 Position Location EŠect A1aW-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G exon 2 Asn21Asp G5W-25T intron G5W-35C intron T307C exon 5 Phe103Leu C6W＋139T intron C6W＋145T intron A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T exon 12 silent C12W＋44T intron C1474T exon 13 Arg492Cys T17W-76A intron A17W＋137G intron C2650T exon 21 silent G2677A,T exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent See references 27, 32-36. Login to comment

[hide] Exon sequencing and high resolution haplotype anal... Pharmacogenet Genomics. 2006 Jun;16(6):439-50. Leschziner G, Zabaneh D, Pirmohamed M, Owen A, Rogers J, Coffey AJ, Balding DJ, Bentley DB, Johnson MR
Exon sequencing and high resolution haplotype analysis of ABC transporter genes implicated in drug resistance.
Pharmacogenet Genomics. 2006 Jun;16(6):439-50., [PMID:16708052]

Abstract [show]
BACKGROUND: The ATP-binding cassette (ABC) proteins are a superfamily of efflux pumps implicated as a mechanism for multidrug resistance in cytotoxic chemotherapy, immunosuppressive therapy, HIV and epilepsy. Genetic variation in P-glycoprotein, the product of the ABCB1 gene, is proposed to mediate de novo drug resistance, but associations between polymorphisms in ABCB1 and pharmacoresistance have produced conflicting results. Potential explanations for the inconsistency of results include inadequate characterization of gene structure, variation and linkage disequilibrium (LD) in ABCB1, as well as overlap in substrate specificity between ABCB1 and the various other drug transporters. METHODS AND RESULTS: We undertook a fundamental analysis of gene structure, variation and LD in ABCB1 and four other drug transporter genes implicated in pharmacoresistance: ABCC1, ABCC2, ABCC5 and ABCB4. Manual annotation of the five genes revealed nine shorter alternative transcripts with new untranslated regions and one novel region of coding sequence, demonstrating that on-line annotations are incomplete. Sequencing of exons in 47 Caucasian individuals identified 75 novel single nucleotide polymorphisms (SNPs) previously undescribed in any public database, including 14 new coding sequence SNPs. Genotyping of 502 SNPs in 842 Caucasian individuals across the five genes revealed large blocks of high LD, and low haplotype diversity across all five genes that could be characterized by between 67 and 114 tagging SNPs, depending on the tagging criteria. CONCLUSION: The study illustrates that publicly available data resources on genomic organization of genes and common variation can have important gaps and limitations, and establishes a comprehensive set of tagging SNPs for future association studies in pharmacoresistance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 444 SNPs, rs2229109, a non-synonymous SNP (S400N), and rs9282563. Login to comment

[hide] Pharmacogenetics of HIV therapy. Pharmacogenet Genomics. 2006 Oct;16(10):693-703. Owen A, Pirmohamed M, Khoo SH, Back DJ
Pharmacogenetics of HIV therapy.
Pharmacogenet Genomics. 2006 Oct;16(10):693-703., [PMID:17001288]

Abstract [show]
Drug treatment in HIV disease is characterized by variable responses, in terms of both efficacy and toxicity. Both genetic and environmental factors are important determinants of this variability, although the relative contributions are unclear and likely to vary with different drugs. Many of the antiretrovirals are metabolized by polymorphically expressed enzymes (cytochrome P450, CYP450; glucuronyl transferase, GT) and/or transported by drug transporters (ABC and SLC families). Initial studies of antiretroviral efficacy have therefore focused on these genes. For example, it has recently been shown that a CYP2B6 genetic variant predicts higher plasma efavirenz exposure and possibly increased central nervous system toxicity. A large number of studies on ABCB1 genetics with antiretrovirals have also been undertaken; however, as in other therapeutic areas, the data have been contradictory, and currently, no firm conclusions can be reached on the effect of ABCB1 variability as a determinant of efficacy. Indeed, this highlights the need for validation of initial association studies in pharmacogenetic research. By contrast, the clearest association between genetic variants and response relates to the hypersensitivity reaction that occurs with abacavir. The identification that the major histocompatibility complex haplotype 57.1 acts as a strong genetic predisposing factor can be regarded as a prime example of how fundamental research can be translated into a pharmacogenetic test. Nevirapine hypersensitivity has also been related to an HLA gene (HLA-DRB1*0101) but the predictive value does not appear to be sufficient to implement in clinical practice. Much more work needs to be done to define the genetic factors determining response to antiretroviral agents. These studies need to be sufficiently powered and utilize a modern genotyping strategy. Most importantly, the phenotype needs to be carefully characterized. We also need to disseminate this information: a pivotal resource for this can be found at www.HIV-pharmacogenomics.org.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 Another polymorphism that has been studied in the context of PI disposition is the G1199A SNP that results in an amino acid change (Ser400Asn) in P-glycoprotein. Login to comment
171 Pharmacogenetics of HIV therapy Owen et al. 699 Table 1 Polymorphisms that have been studied within the context of metabolism, transport and toxicity (but not progression and response) along with the reference ID (where available), the genotypic consequence and the observed phenotype for antiretroviral drugs Gene SNP (haplotype) Reference SNP Genotypic consequence Phenotypic consequence Confirmation CYP3A4 A - 392G (CYP3A4*1B) rs2740574 Promoter; altered expression No effect on nelfinavir or efavirenz Yes for nelfinavir; controversial for efavirenz T878C (CYP3A4*18) rs4986909 L293P; altered activity No effect on efavirenz No CYP3A5 A6986G (CYP3A5*3) rs776746 Splice defect No effect on nelfinavir, saquinavir or efavirenz AUC but altered urinary metabolic ratio of saquinavir Yes for efavirenz G14690A (CYP3A5*6) rs10264272 Splice defect No effect on nelfinavir or efavirenz Yes CYP2C19 G681A (CYP2C19*2) rs4244285 Truncated protein Higher nelfinavir AUC and trend toward decreased virological failure; no effect on efavirenz Yes for efavirenz; controversial for nelfinavir CYP2D6 A2549del (CYP2D6*3) NT21914757 Frameshift Trend to higher plasma levels of nelfinavir and efavirenz No G1846A (CYP2D6*4) rs3892097 Splice defect Trend to higher plasma levels of nelfinavir and efavirenz No T1707del (CYP2D6*6) rs5030655 Frameshift Higher plasma nelfinavir concentrations No CYP2B6 G516 T (CYP2B6*6, *7, *9, *13, *19 and *20) rs3745274 Q172H Higher plasma and intracellular efavirenz AUCs and increased neurotoxicity Yes, numerous studies C1459T (CYP2B6*5 and *7) rs3211371 R487C No effect on nelfinavir or efavirenz No ABCB1 IVS1 - 80delG rs3214119 N/A No influence on cellular nelfinavir No A61G rs9282564 N21D No influence on cellular nelfinavir No TAG1 rs3789243 N/A No influence on cellular nelfinavir No G1199A rs2229109 S400N No influence on cellular nelfinavir No TAG5 rs1128503 N/A No influence on cellular nelfinavir No TAG6 rs2235046 N/A No influence on cellular nelfinavir No IVS21 + T49C rs2032583 N/A No influence on cellular nelfinavir No C3435T rs1045642 Synonymous Some evidence of an influence on plasma and intracellular nelfinavir; decreased efavirenz plasma concentrations; currently under debate; increase in HDL cholesterol with efavirenz Controversial G2677T rs2032582 Ala893Ser No effect on efavirenz, ritonavir, nelfinavir, indinavir or viral decay and CD4 count Yes IVS26 + T59G rs2235047 N/A No influence on cellular nelfinavir No IVS26 + T80C rs2235048 N/A Increased intracellular nelfinavir concentrations No TAG11 rs1186746 N/A No influence on cellular nelfinavir No TAG12 rs1186745 N/A No influence on cellular nelfinavir No ABCC1 G816A P272P No influence on cellular nelfinavir No T825C rs246221 V275V No influence on cellular nelfinavir No T1062C rs35587 Synonymous No influence on cellular nelfinavir No IVS9 + A8G rs35588 N/A No influence on cellular nelfinavir No IVS10 + C64T N/A No influence on cellular nelfinavir No ABCC2 C - 24T rs717620 N/A No influence on cellular nelfinavir No G1249A rs2273697 V417I No influence on cellular nelfinavir No C1436G Synonymous No influence on cellular nelfinavir No IVS16 - G47A N/A No influence on cellular nelfinavir No T3563A rs8187694 V1188E No influence on cellular nelfinavir No C4488T rs8187707 Synonymous No influence on cellular nelfinavir No IVS31 + G12A rs8187708 N/A No influence on cellular nelfinavir No IVS31 + C74T N/A No influence on cellular nelfinavir No G4544A rs8187710 C1515Y No influence on cellular nelfinavir No G + 259T N/A No influence on cellular nelfinavir No ABCG2 - 19571_ - 19568delT- CAC rs4148162 Deletion No influence on cellular nelfinavir No A-19541G N/A No influence on cellular nelfinavir No G34A rs2231137 V12M No influence on cellular nelfinavir No IVS2 + 35G rs4148152 N/A No influence on cellular nelfinavir No C421A rs2231142 Q141K No influence on cellular nelfinavir No APOCIII C-482T Pending Promoter Hyperlipidaemia in presence of ritonavir Yes T-455C Pending Promoter Hyperlipidaemia in presence of ritonavir Yes C3238G rs5128 30 UTR variant Hyperlipidaemia in presence of ritonavir Yes APOE 2060T/2198T (APOEe2) rs429358 R112C/R158C Hyperlipidaemia in presence of ritonavir Yes 2060T/2198C (APOEe3) rs7412 R112C/R158R Hyperlipidaemia in presence of ritonavir Yes TNFa G - 238A rs361525 Promoter Rapid development of lipoatrophy Controversial SPINK-1 C112T rs17107315 N34S Associated with risk of pancreatitis Yes, in general population CFTR G1717 - 1A Splice defect Associated with risk of pancreatitis Yes, in general population IVS8 5T Splice defect Associated with risk of pancreatitis Yes, in general population HLA-B HLA-B*57.1 N/A Abacavir hypersensitivity Yes, but not in all populations HLA-DR HLA-DRB1*0101 N/A Nevirapine hypersensitivity No HSPA1L C2437T rs2227956 M493T Abacavir hypersensitivity No UGT1A1 A(TA)7TAA, - 43_ - 42in- sTA (UGT1A1*28) rs8175347 Promoter; insertion at TATA box Gilberts syndrome, hyperbilirubinaemia in presence of atazanavir and indinavir but not saquinavir Yes MT-CO1 C7028T Synonymous Haplogroup T associated with greater incidence of peripheral neuropathy No 700 Pharmacogenetics and Genomics 2006, Vol 16 No The NNRTI nevirapine can also cause a hypersensitivity syndrome characterized by a rash with systemic symptoms; occasionally liver injury may be part of the clinical picture, or alternatively, may actually be the only manifestation. Login to comment

[hide] ABCB1 and GST polymorphisms associated with TP53 s... Pharmacogenet Genomics. 2007 Feb;17(2):127-36. Nordgard SH, Ritchie MD, Jensrud SD, Motsinger AA, Alnaes GI, Lemmon G, Berg M, Geisler S, Moore JH, Lonning PE, Borresen-Dale AL, Kristensen VN
ABCB1 and GST polymorphisms associated with TP53 status in breast cancer.
Pharmacogenet Genomics. 2007 Feb;17(2):127-36., [PMID:17301692]

Abstract [show]
BACKGROUND AND OBJECTIVE: Many environmental and genetic factors influence the development of chemoresistance. The goal of this study was to characterize the genetic variation in the ABCB1, GSTM1, GSTT1 and GSTP1 genes, as well as the haplotype structure in the ABCB1 gene. METHODS: Variants in these genes were studied in 109 healthy controls and 93 breast cancer cases, both of Caucasian origin. The cases were analyzed in relation to TP53 mutation status and response to doxorubicin. Both single and multiple single nucleotide polymorphism analyses were performed. RESULTS: Chi-square analyses revealed a significant association between TP53 mutation status and both the GA genotype of ABCB1 exon 11 (Ser400Asn) and the GG genotype of GSTP1 (Ile105Val; P<0.01 and P<0.05, respectively). Multifactor dimensionality reduction showed that carriers of the combined GG genotype for GSTP1 and the GG for ABCB1 exon 11 had the highest chance of acquiring a mutation in the TP53 gene (P<0.02). Haplotype analysis of ABCB1 revealed a significantly different distribution of haplotypes between the breast cancer cases and the controls (P<0.01). A specific haplotype association to TP53 mutation (P<0.01) distant metastases (P<0.05) and estrogen receptor status (P<0.05) was also observed in the case group. CONCLUSION: An association between polymorphisms in GSTP1 and ABCB1 and risk of acquiring intratumoral TP53 mutations suggests the existence of putative predisposing genotype backgrounds. The degree of linkage disequilibrium in the ABCB1 gene was higher in healthy individuals, whereas haplotypes in the cases seemed degenerated by a number of low frequency variants. This observation may either point to the existence of a protective haplotype in the controls or may underline the importance of the accumulation of low frequency variants as susceptibility factors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Results Chi-square analyses revealed a significant association between TP53 mutation status and both the GA genotype of ABCB1 exon 11 (Ser400Asn) and the GG genotype of GSTP1 (Ile105Val; P<0.01 and P<0.05, respectively). Login to comment
164 The polymorphism in exon 11 replaces Ser-400 to asparagine, thereby changing the size of the side chain of the protein and generating a new phosphorylation site. Login to comment

[hide] Effect of MDR1 gene polymorphism on progression of... Acta Pharmacol Sin. 2007 Apr;28(4):579-83. Zhang WX, Chen B, Zhang W, Chen N, Yu ZC, Cai WM
Effect of MDR1 gene polymorphism on progression of end-stage renal disease.
Acta Pharmacol Sin. 2007 Apr;28(4):579-83., [PMID:17376299]

Abstract [show]
AIM: P-glycoprotein is localized at the apical brush-border membrane of the proximal renal tubule and functions as extruding toxins and xenobiotics out of cells. The difference of P-glycoproteinos function resulted from single nucleotide polymorphisms in MDR1 (multidrug resistance gene encoding for P-gp) and may be the cause of interindividual differences in susceptibility to end-stage renal disease (ESRD). The purpose of this study is to compare the genotype frequency of C3435T and G1199A polymorphisms in MDR1 between ESRD patients and healthy controls in the Chinese population to determine whether the alteration of the P-gp function is associated with ESRD. METHODS: Two hundred and eighty-four healthy Chinese controls and 244 Chinese patients with ESRD were involved in this study. Allele specific PCR and polymerase chain reaction-restriction fragment length polymorphism assay were used to determine the genotype MDR1 G1199A and C3435T, respectively. RESULTS: The genotype distribution of 3435CC, 3435CT, and 3435TT were 0.35, 0.50, and 0.15, respectively, in the control group and 0.38, 0.47, and 0.15 in the group with the ESRD patients. No variant allele 1199G>A was found in any of the patients. The value of serum creatinine for genotypes 3435CC, 3435CT, and 3435TT in the ESRD patients were 753.8+/-276.0 mumol/L, 849.6+/-342.2 micromol/L, and 987.0+/-512.0 micromol/L, respectively. The difference between 3435TT and 3435CC reached statistical significance (P<0.05). CONCLUSION: The low expression of P-glycoprotein was not the etiological factor for the kidney disease, but it may contribute to the progression of ESRD and affect the severity. Chinese people do not carry the 1199G>A variant allele. More studies are needed to clarify the cause and interindividual differences in the susceptibility for the risk of ESRD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 The substitution of G to A in the position 1199 of MDR1 results in a serine-to-asparagine substitution at amino acid 400 in a cytoplasmic domain of P-gp. Login to comment

[hide] Quantitative structure--activity relationship anal... Biochemistry. 2007 Jul 3;46(26):7678-93. Epub 2007 Jun 9. Sakurai A, Onishi Y, Hirano H, Seigneuret M, Obanayama K, Kim G, Liew EL, Sakaeda T, Yoshiura K, Niikawa N, Sakurai M, Ishikawa T
Quantitative structure--activity relationship analysis and molecular dynamics simulation to functionally validate nonsynonymous polymorphisms of human ABC transporter ABCB1 (P-glycoprotein/MDR1).
Biochemistry. 2007 Jul 3;46(26):7678-93. Epub 2007 Jun 9., 2007-07-03 [PMID:17559192]

Abstract [show]
Several preclinical and clinical studies suggest the importance of naturally occurring polymorphisms of drug transporters in the individual difference of drug response. To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells. The kinetic properties (Km and Vmax) of those variants were analyzed by measuring the ATPase activity to obtain the ATPase profile for each variant toward structurally unrelated substrates. On the basis of the experimental data, we determined the substrate specificity of ABCB1 WT and its variants by the quantitative structure-activity relationship (QSAR) analysis method. While several SNP variants appeared to influence the substrate specificity of ABCB1, the nonsynonymous polymorphisms of 2677G > T, A, or C at amino acid position 893 (Ala > Ser, Thr, or Pro) have great impacts on both the activity and the substrate specificity of ABCB1. The A893P variant (2677G > C), a rare mutation, exhibited markedly high activity of ATPase toward different test compounds. Molecular dynamics (MD) simulation based on a three-dimensional structural model of human ABCB1 revealed that multiple kinks are formed in the intracellular loop between transmembrane domains 10 and 11 of the A893P variant (2677G > C) protein. The polymorphisms of 2677G, 2677T, and 2677A exhibit wide ethnic differences in the allele frequency, and these nonsynonymous polymorphisms are suggested to be clinically important because of their altered ATPase activity and substrate specificity toward different drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells. Login to comment
38 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis. Login to comment
53 SNP data were obtained from the NCBI dbSNP database and recent publications: S400N (6, 7, 29, 31); R492C (7); R669C (16); I849M (16); A893P (NCBI dbSNP, rs2032582); A893S (8, 16, 23, 29-31); A893T (8, 16, 23, 29-31); M986V (30); A999T (28); P1051A (16); G1063A (NCBI dbSNP, rs2707944). Login to comment
80 Briefly, seventy-two hours after Table 1: Data on Oligonucleotide Primers Used for Site-Directed Mutagenesis and Experimental Conditionsa SNP amino acid cDNA F/R primers primer sequence (5' f 3') primer length (bases) % GC Tm (°C) S400N 1199G > A F CAGAAATGTTCACTTCAATTACCCATCTCGAAAAG 35 36.5 77.2 R CTTTTCGAGATGGGTAATTGAAGTGAACATTTCTG 35 36.5 77.2 R492C 1474C > T F TGAAAACATTCGCTATGGCTGTGAAAATGTCACCATGG 38 42.1 81.0 R CCATGGTGACATTTTCACAGCCATAGCGAATGTTTTCA 38 42.1 81.0 R669C 2005C > T F TCTAATAAGAAAAAGATCAACTTGTAGGAGTGTCCGTGGATC 42 37.9 80.9 R GATCCACGGACACTCCTACAAGTTGATCTTTTTCTTATTAGA 42 37.9 80.9 I849M 2547A > G F GGGACAGGAATAATTATGTCCTTCATCTATGGTTGGCA 38 34.5 77.9 R TGCCAACCATAGATGAAGGACATAATTATTCCTGTCCC 38 34.5 77.9 A893P 2677G > C F AGAAAGAACTAGAAGGTCCTGGGAAGATCGCTAC 34 47.1 80.9 R GTAGCGATCTTCCCAGGACCTTCTAGTTCTTTCT 34 47.1 80.9 A893S 2677G > T F GAAAGAACTAGAAGGTTCTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGAACCTTCTAGTTCTTTC 33 45.4 79.6 A893T 2677G > A F GAAAGAACTAGAAGGTACTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGTACCTTCTAGTTCTTTC 33 45.4 79.6 M986V 2956A > G F GTCTTTGGTGCCGTGGCCGTGGGGC 25 73.8 84.7 R GCCCCACGGCCACGGCACCAAAGAC 25 73.8 84.7 A999T 2995G > A F GTTCATTTGCTCCTGACTATACCAAAGCCAAAATATCAGCAG 42 40.5 82.0 R CTGCTGATATTTTGGCTTTGGTATAGTCAGGAGCAAATGAAC 42 40.5 82.0 P1051A 3151C > G F CGACCGGACATCGCAGTGCTTCAGGG 26 60.0 80.1 R CCCTGAAGCACTGCGATGTCCGGTCG 26 60.0 80.1 G1063A 3188G > C F GAGGTGAAGAAGGCCCAGACGCTGGCTC 28 64.3 83.7 R GAGCCAGCGTCTGGGCCTTCTTCACCTC 28 64.3 83.7 a F, forward; R, reverse. Login to comment
142 On the basis of the ABCB1 (WT) cDNA cloned from a human liver cDNA library, those variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis as described in Experimental Procedures. Login to comment
180 Figure 3 depicts the verapamil-stimulated ATPase activity of ABCB1 WT, S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A, where the verapamil-stimulated ATPase activities are normalized by considering the ABCB1 protein amounts. Login to comment
186 Sf9 plasma membranes (2 µg of protein) expressing ABCB1 WT and variants (S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were incubated with ATP (2 mM) and verapamil at different concentrations (0, 1, 2, 5, 10, 20, 50, and 100 µM) at 37 °C for 30 min. After the incubation, the amount of liberated phosphate was measured as described in Experimental Procedures. All activities are expressed as mean values ( SD (n ) 6). Login to comment
187 Table 2: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Verapamila SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 ] Vmax/Km WT 5.8 ( 2.3 62.4 ( 7.8 10.8 S400N 5.8 ( 2.8 46.7 ( 5.3** 8.0 R492C 5.6 ( 1.9 49.6 ( 10.0* 8.9 R669C 3.2 ( 1.6* 64.7 ( 6.9 20.1 I849M 1.5 ( 0.7** 80.3 ( 9.5** 51.8 A893P 1.5 ( 0.5** 405.2 ( 16.5** 274.6 A893S 11.1 ( 5.4 43.1 ( 7.1** 3.9 A893T 4.3 ( 1.4 98.9 ( 9.5** 22.9 M986V 5.1 ( 1.1 114.9 ( 13.6** 22.5 A999T 2.0 ( 0.8** 143.1 ( 21.2** 70.9 P1051A 6.2 ( 3.0 52.1 ( 13.6 8.4 G1063A 6.2 ( 3.7 117.9 ( 16.4** 19.0 a Data are expressed as mean ( SD, n ) 6. Login to comment
189 Table 3: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Nicardipinea SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 Vmax/Km WT 1.1 ( 0.6 45.2 ( 8.7 41.0 S400N 1.7 ( 0.8 39.1 ( 9.1 23.4 R492C 1.1 ( 0.5 46.6 ( 6.4 43.5 R669C 0.3 ( 0.3** 53.5 ( 13.1 164.6 I849M 0.8 ( 0.9 80.2 ( 9.6** 102.9 A893P 0.1 ( 0.0** 341.2 ( 36.6** 4858.4 A893S 2.0 ( 0.6 39.2 ( 6.0 19.5 A893T 0.4 ( 0.2** 77.0 ( 16.9** 207.8 M986V 0.7 ( 0.4 89.7 ( 17.7** 129.9 A999T 0.3 ( 0.3** 115.4 ( 21.2** 393.6 P1051A 0.9 ( 0.3 33.1 ( 8.8* 36.3 G1063A 0.8 ( 0.4 93.2 ( 27.6** 121.4 a Data are expressed as mean ( SD, n ) 6. Login to comment
240 On the other hand, the benzene structure linked to the other ring by a single or double bond (CFC ) M113) negatively contributed to the drug-stimulated ATPase activity of M986V, G1063A, A999T, S400N, and A893S variants and WT, whereas the activity of the other variants was not affected by this structural component. Login to comment
269 The present study addresses the impact of nonsynonymous polymorphisms of ABCB1 (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) on its function. Login to comment
273 Table 5: ABCB1 WT and Variant-Specific Descriptors and Corresponding Coefficients Deduced from QSAR Analysisa coefficients (95% reliability) for ABCB1 WT and vatiants descriptor WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 21.2 18.5 35.9 52.7 169.8 14.0 61.2 39.4 63.0 13.9 52.1 (3.76) (5.81) (5.87) (7.68) (11.30) (18.84) (4.03) (7.75) (8.76) (9.39) (4.78) (10.94) M132 21.5 14.1 13.6 32.8 61.4 135.6 11.2 52.8 38.2 65.9 7.6 24.3 (3.89) (5.34) (5.78) (6.89) (12.66) (22.95) (4.06) (7.16) (8.62) (8.44) (5.71) (10.46) C-CHN-BT 3.3 3.8 1.7 3.5 5.7 11.6 1.2 6.1 7.1 7.3 2.0 2.8 (0.72) (0.95) (0.87) (1.08) (1.55) (2.48) (0.65) (1.29) (1.43) (1.44) (0.66) (1.86) ESTR -10.1 -12.5 (4.93) (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 -4.4 (7.86) (1.73) RT -8.9 -17.7 (4.21) (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 -11.7 -7.7 -22.8 -16.4 -16.5 (3.69) (5.30) (3.70) (8.75) (8.19) (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 14.4 (5.46) (7.91) M392 73.3 10.3 (25.03) (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 24.0 (4.01) (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) constant -12.2 -5.5 -0.2 -2.3 -24.0 -7.1 1.3 -4.3 0.9 9.0 0.6 -11.2 R2 0.934 0.847 0.853 0.906 0.893 0.981 0.782 0.954 0.915 0.956 0.836 0.831 FO(6, 29) 68.9 26.8 28.1 46.4 40.5 254.5 17.3 100.3 51.8 106.2 24.6 23.7 Q2 0.883 0.710 0.767 0.729 0.826 0.968 0.572 0.923 0.828 0.909 0.617 0.760 a R2 , correlation coefficient; FO, Fisher value (level of statistical significance). Login to comment
293 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are the same as those shown in Table 5. Login to comment
316 Other nonsynonymous polymorphisms, such as S400N, R492C, R669C, P1051A, and G1063A occurring in intracellular loops as well as I849M, M986V, and A999T alterations in transmembrane domains, exhibited moderate changes in the kinetic properties of ABCB1. Login to comment
340 of samples allele frequency (%) allele frequency (%) ref S400N 1199 G > A African 111 G 100.0 A 0.0 23 African-American 100 G 99.0 A 1.0 16 German 461 G 94.5 A 5.5 29 Caucasian 85 G 87.1 A 12.9 6 Caucasian 50 G 98.0 A 2.0 31 Caucasian 100 G 97.5 A 2.5 16 Mexican-American 10 G 100.0 A 0.0 16 Asian-American 30 G 100.0 A 0.0 16 Pacific Islander 7 G 100.0 A 0.0 16 R492C 1474 C > T African-American 23 C 100.0 T 0.0 7 Caucasian 37 C 98.6 T 1.4 7 R669C 2005 C > T African-American 100 C 99.0 T 1.0 16 Caucasian 100 C 100.0 T 0.0 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 I849M 2547 A > G African-American 100 C 100.0 T 0.0 16 Caucasian 100 C 99.5 T 0.5 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 A893P/S/T 2677 G > T/A/C African (Beninese) 111 G 99.1 T 0.9 23 A 0.0 African-American 100 G 89.5 T 10.0 16 A 0.5 Caucasian 100 G 50.0 T 46.5 16 A 3.5 Caucasian 50 G 52.0 T 38.0 31 A 10.0 German 461 G 56.5 T 41.6 29 A 1.9 Mexican-American 10 G 60.0 T 40.0 16 A 0.0 Asian-American 30 G 33.3 T 45.0 16 A 21.7 Japanese 117 G 44.0 T 35.5 8 A 20.5 Japanese (placenta) 100 G 43.0 T 39.0 30 A 18.0 Japanese 48 G 36.5 T 41.7 30 A 21.8 Pacific Islander 7 G 28.6 T 35.7 16 A 35.7 ND ND G ND C ND NCBI dbSNP (rs2032582) M986V 2956 A > G Japanese (placenta) 100 A 99.5 G 0.5 30 Japanese 48 A 100.0 G 0.0 30 A999T 2995 G > A cell lines 36 G 94.4 A 5.6 28 P1051A 3151 C > G African-American 100 C 99.5 G 0.5 16 Caucasian 100 C 100.0 G 0.0 16 Mexican-American 10 C 100.0 G 0.0 16 Asian-American 30 C 100.0 G 0.0 16 Pacific Islander 7 C 100.0 G 0.0 16 G1063A 3188 G > A ND ND G ND A ND NCBI dbSNP (rs2707944) a ND, not determined. Login to comment

[hide] Pharmacogenomic associations in ABCB1 and CYP3A5 w... Pharmacogenomics J. 2008 Aug;8(4):248-55. Epub 2007 Aug 14. Woodahl EL, Hingorani SR, Wang J, Guthrie KA, McDonald GB, Batchelder A, Li M, Schoch HG, McCune JS
Pharmacogenomic associations in ABCB1 and CYP3A5 with acute kidney injury and chronic kidney disease after myeloablative hematopoietic cell transplantation.
Pharmacogenomics J. 2008 Aug;8(4):248-55. Epub 2007 Aug 14., [PMID:17700595]

Abstract [show]
Renal disease is a major complication in patients following myeloablative allogeneic hematopoietic cell transplantation (HCT). Post-HCT patients receive immunosuppressive regimens containing calcineurin inhibitor (CNIs), cyclosporine or tacrolimus, for graft-versus-host disease prophylaxis. In this retrospective trial, we investigated pharmacogenomic associations in the multidrug resistance (ABCB1) and cytochrome P450 3A5 (CYP3A5) genes and acute kidney injury (AKI) and chronic kidney disease (CKD) in a cohort of 121 patients. ABCB1 and CYP3A5 are responsible for the renal disposition of CNIs, which are known to be nephrotoxic. AKI was defined as doubling of baseline serum creatinine during the first 100 days post-HCT, and CKD as at least one glomerular filtration rate <60 ml/min/m2 between 6 and 18 months post-HCT. Patients were genotyped for CYP3A5*1>*3 and ABCB1 single nucleotide polymorphisms (SNPs) (1199G>A, 1236C>T, 2677G>T/A and 3435C>T). Odds ratios were calculated using logistic regression. Haplotype estimation and univariate association analyses were performed because of strong ABCB1 linkage disequilibrium (LD). AKI occurred in 48 of 121 patients (39.7%) and CKD in 16 of 66 patients (24.2%). No pharmacogenomic associations were found between ABCB1 and CYP3A5 SNPs and the incidences of AKI or CKD. The degree of LD(r2) between ABCB1 SNPs was estimated as follows: 2677G>T/3435C>T (0.44), 1236C>T/3435C>T (0.42) and 1236C>T/2677G>T (0.72). ABCB1 1199G>A showed no LD to other SNPs (<0.05). No associations were found between the most common ABCB1 haplotypes and AKI or CKD. Since no significant pharmacogenomic associations were observed, tailoring CNIs dosing based on these genotypes is unlikely to lower significantly the risk of renal injury following myeloablative HCT.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 We also evaluated two nonsynonymous SNPs; the tri-allelic non-synonymous SNP at nucleotide position 2677, which results in a 2677G4T (Ala893Ser) or a 2677G4A (Ala893Thr) transition, and the 1199G4A SNP (Ser400Asn) that we have shown to cause a functional alteration in P-gp activity.10,11 Because significant linkage disequilibrium (LD) exists in ABCB1, we also evaluated the associated risk of ABCB1 haplotypes.12-14 Understanding the influence of genetic variability in the intrarenal concentrations of CNIs in post-HCT patients may allow for the a priori identification of patients at high risk of CNI-induced renal dysfunction who would be candidates for non-CNI containing regimens. Login to comment
71 ABCB1 is highly polymorphic and displays considerable LD and several SNPs have been associated with changes in the expression and activity of P-gp.9 The first ABCB1 polymorphism found to be associated with alterations in P-gp was the synonymous SNP 3435C4T.16 Subsequently, it was reported that 3435C4T is in LD with two other ABCB1 SNPs; a tri-allelic non-synonymous SNP at nucleotide position 2677, which results in a 2677G4T (Ala893Ser) and a 2677G4A (Ala893Thr) transition, as well as 1236C4T, another synonymous SNP.13 In addition, we have recently observed a functional alteration in P-gp activity due to another non-synonymous ABCB1 polymorphism, 1199G4A (Ser400Asn).10,11 The in vivo significance of ABCB1 polymorphisms has been conflicting as to their functional effect on renal P-gp expression.22-24 Since significant linkage exists in the ABCB1 gene, it is important to understand the role of ABCB1 haplotypes in pharmacogenomic association studies. Login to comment

[hide] Sequential influences of leukemia-specific and gen... Clin Cancer Res. 2007 Dec 1;13(23):7059-66. Seedhouse CH, Grundy M, White P, Li Y, Fisher J, Yakunina D, Moorman AV, Hoy T, Russell N, Burnett A, Pallis M
Sequential influences of leukemia-specific and genetic factors on p-glycoprotein expression in blasts from 817 patients entered into the National Cancer Research Network acute myeloid leukemia 14 and 15 trials.
Clin Cancer Res. 2007 Dec 1;13(23):7059-66., 2007-12-01 [PMID:18056183]

Abstract [show]
PURPOSE: P-glycoprotein (Pgp) is a major prognostic factor for chemotherapy failure in acute myeloid leukemia (AML). This study compared the influence of genetic and leukemia-specific factors on Pgp. EXPERIMENTAL DESIGN: Eight hundred and seventeen samples were studied prospectively for Pgp protein expression and function and G1199A, G2677T, and C3435T polymorphisms in the encoding gene ABCB1. RESULTS: Age, low WBC count, high bcl-2, secondary AML and myelodysplastic syndrome, and adverse cytogenetics all correlated strongly with high Pgp (MRK16) protein expression. However, ABCB1 3435TT homozygosity was negatively correlated with Pgp. Pgp protein is only expressed in 41% of samples such that the negative effect of the polymorphism was not seen at baseline Pgp levels but was marked in the upper 41% of samples (MRK16 Deltamean fluorescence intensity of 75th centile sample = 9 units for TT variant samples and 26 units for CC/CT; P = 0.003). However, no association was found between genetic factors and Pgp function using rhodamine 123 accumulation. CONCLUSIONS: The genetic polymorphism 3435TT (which results in unstable mRNA) has a significant effect on Pgp expression, but this is only seen in approximately 40% of cases in which mRNA and protein are detectable. Moreover, leukemia-specific factors, such as low WBC count and poor risk cytogenetics, have a much greater effect than genetic polymorphisms on Pgp expression in AML blasts.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 This includes data on three single nucleotide polymorphisms: G2677T (Ala893 Ser), C3435T (synonymous), and G1199A (Ser400 Asn). Login to comment

[hide] Substrate-dependent effects of human ABCB1 coding ... J Pharmacol Exp Ther. 2008 May;325(2):435-42. Epub 2008 Feb 20. Gow JM, Hodges LM, Chinn LW, Kroetz DL
Substrate-dependent effects of human ABCB1 coding polymorphisms.
J Pharmacol Exp Ther. 2008 May;325(2):435-42. Epub 2008 Feb 20., [PMID:18287207]

Abstract [show]
One of the many obstacles to effective drug treatment is the efflux transporter P-glycoprotein (P-gp), which can restrict the plasma and intracellular concentrations of numerous xenobiotics. Variable drug response to P-gp substrates suggests that genetic differences in ABCB1 may affect P-gp transport. The current study examined how ABCB1 variants alter the P-gp-mediated transport of probe substrates in vitro. Nonsynonymous ABCB1 variants and haplotypes with an allele frequency >/=2% were transiently expressed in HEK293T cells, and the transport of calcein acetoxymethyl ester and 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY-FL)-paclitaxel was measured in the absence or presence of the P-gp inhibitor cyclosporin A. The A893S, A893T, and V1251I variants and the N21D/1236C>T/A893S/3435C>T haplotype altered intracellular accumulation compared with reference P-gp in a substrate-dependent manner. It is interesting that certain variants showed altered sensitivity to cyclosporin A inhibition that was also substrate-specific. These functional data demonstrate that nonsynonymous polymorphisms in ABCB1 may selectively alter P-gp transport and drug-drug interactions in a substrate- and inhibitor-dependent manner.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
135 The representative histogram of APC fluorescence for empty vector (gray, dotted), NBD mutant (gray), reference (black), and variant-transfected cells (N21D, yellow; S400N, cyan; R669C, purple; A893S, green; A893T, orange; S1141T, pink; V1251I, blue; 1236CϾT/A893S/3435CϾT, brown; and N21D/1236CϾT/A893S/3435CϾT, red) shows P-gp expression based on the intensity of APC fluorescence, as indicated on the x-axis. Login to comment
156 The N21D, S400N, R669C, and A893T variants and the 1236CϾT/A893S/3435CϾT haplotype were within 5% of the reference (Fig. 3c). Login to comment
163 Six of 13 previously described nonsynonymous variants were chosen for study based on an allele frequency Ͼ2%: N21D, S400N, A893S, A893T, S1141T, and V1251I. Login to comment
193 Previous work consistent with the current findings has shown that N21D, S400N, and A893S do not change calcein-AM transport (Kimchi-Sarfaty et al., 2002; Kroetz et al., 2003). Login to comment
198 This suggests that the S400N variation alters P-gp function in a substrate-specific manner. Login to comment
202 The ABCB1 S400N variant has been shown to confer higher drug resistance to paclitaxel, but the stable cell line overexpressing this P-gp was selected for G418 resistance (Crouthamel et al., 2006). Login to comment
206 In one study, the N21D, F103L, S400N, A893S, and A998T SNPs and three double mutants (N21N/S400N, N21D/A893S, and S400N/ A893S) were investigated using a vaccinia virus expression system with BODIPY-FL-paclitaxel, and no differences in function were noted among the variant and reference P-gps (Kimchi-Sarfaty et al., 2002). Login to comment
207 Our results are similar for N21D and S400N, but we found that A893S and N21D/A893S have decreased transport of BODIPY-FL-paclitaxel (Table 3). Login to comment

[hide] Single nucleotide polymorphisms in the multidrug r... Pharmacogenet Genomics. 2008 Mar;18(3):263-73. Vaclavikova R, Nordgard SH, Alnaes GI, Hubackova M, Kubala E, Kodet R, Mrhalova M, Novotny J, Gut I, Kristensen VN, Soucek P
Single nucleotide polymorphisms in the multidrug resistance gene 1 (ABCB1): effects on its expression and clinicopathological characteristics in breast cancer patients.
Pharmacogenet Genomics. 2008 Mar;18(3):263-73., [PMID:18300948]

Abstract [show]
OBJECTIVES: Resistance of tumor cells to multiple cytostatic agents is one of the major impediments of successful cancer chemotherapy. A large part of resistance of tumors to chemotherapy is caused by the ABC transporter P-glycoprotein encoded by the ABCB1 gene. The main aim of this study was to assess the prognostic value of ABCB1 genotype and phenotype in breast cancer. METHODS: Six ABCB1 single nucleotide polymorphisms (SNPs) were determined in 90 Czech breast cancer patients by a novel method that allows simultaneous assessment of multiple polymorphisms on a single electronic microarray. Expression levels of ABCB1 were quantified in tumor and nontumor samples of breast cancer patients by real-time PCR. T-test, analysis of variance and Fisher's exact test were used to analyze the effect of ABCB1 polymorphisms on ABCB1 expression levels and for the analysis of associations between ABCB1 expression, genotype and clinical and pathological characteristics. RESULTS: ABCB1 was expressed in 98.9% of the tumor and in 97.5% of the nontumor samples. ABCB1 was downregulated in 79.5% of tumors compared with the nontumor samples. No significant correlation was observed between ABCB1 mRNA expression levels and clinical and pathological characteristics. High frequencies of the variant alleles in ABCB1 exon 12 (1236C>T, 38.3%) and exon 26 (3435C>T, 54.0%) were observed. Individuals with variant alleles in exons 12 and 26 had significantly lower ABCB1 expression levels in their tumors. SNPs in exons 12 and 26 also correlated with estrogen receptor status of patients. CONCLUSION: ABCB1 SNPs may affect function of P-glycoprotein by influencing the expression level and modify breast cancer prognosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 Six SNPs in ABCB1 [( - 1)G > A, rs2214102; 61A > G, Asn21Asp, rs9282564; 1199G> A, Ser400Asn, rs2229109; 1236C> T, Gly412Gly, rs1128503; ( + 44)C > T, rs2032588 and 3435C > T, Ile1145Ile, rs1045642] were detected on the NanoChip Molecular Biology Workstation (Nanogen Inc.). Login to comment
154 Age, menopausal status, staging, tumor size, nodal status and histological type and grade of tumor did not significantly associate either with frequencies of Table 3 Distribution of ABCB1 genotypes and allele frequencies in breast cancer patients ABCB1 genotypea Nb Allele frequency ( - 1)G > A, rs2214102 G/G 77 (88.5) G (93.1) G/A 8 (9.2) A (6.9) A/A 2 (2.3) Total 87 61A > G, Asn21Asp, rs9282564 Asn/Asn 75 (84.3) Asn (91.6) Asn/Asp 13 (14.6) Asp (8.4) Asp/Asp 1 (1.1) Total 89 1199G > A, Ser400Asn, rs2229109 Ser/Ser 86 (95.6 Ser (97.8) Ser/Asn 4 (4.4) Asn (2.2) Asn/Asn 0 (0) Total 90 1236C > T, Gly412Gly, rs1128503 C/C 32 (35.6) C (61.7) C/T 47 (52.2) T (38.3) T/T 11 (12.2) Total 90 12( + 44)C > T, rs2032588 C/C 79 (89.8) C (93.8) C/T 7 (8.0) T (6.2) T/T 2 (2.2) Total 88 3435C > T, Ile1145Ile, rs1045642 C/C 17 (19.5) C (46.0) T/C 46 (52.9) T (54.0) T/T 24 (27.6) Total 87 a Protein positions are displayed for nonsynonymous single nucleotide polymorphisms (SNPs) in exons. Login to comment

[hide] Influence of ABCB1 genetic polymorphisms on cyclos... Pharmacogenet Genomics. 2008 Apr;18(4):307-15. Crettol S, Venetz JP, Fontana M, Aubert JD, Ansermot N, Fathi M, Pascual M, Eap CB
Influence of ABCB1 genetic polymorphisms on cyclosporine intracellular concentration in transplant recipients.
Pharmacogenet Genomics. 2008 Apr;18(4):307-15., [PMID:18334915]

Abstract [show]
OBJECTIVE: The expression on lymphocytes of P-glycoprotein, an efflux transporter encoded by the ABCB1 gene, might influence cyclosporine intracellular concentration. METHODS: ABCB1 genotypes, cyclosporine intracellular and blood concentrations were determined in 64 stable renal, liver or lung transplant recipients. RESULTS: Cyclosporine intracellular concentration correlated moderately with blood concentration (r=0.30, P<0.00005). The ABCB1 1199A carriers presented a 1.8-fold decreased cyclosporine intracellular concentration (P=0.04), whereas the 3435T carriers presented a 1.7-fold increase (P=0.02) as well as a 1.2-fold increased blood concentration (P=0.04). In contrast, ABCB1 61A>G, 1236C>T and 2677G>T polymorphisms did not influence cyclosporine intracellular and blood concentrations. CONCLUSION: This is the first report demonstrating that ABCB1 polymorphisms influence cyclosporine intracellular concentration. Interestingly, its influence on intracellular concentration is significantly higher than on blood concentration (P<0.002). This may therefore modulate cyclosporine immunosuppressive activity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 In contrast, the 1199G > A (S400N) and 3435C > T SNPs significantly influenced cyclosporine concentration in opposite directions. Login to comment

[hide] Structure, function and regulation of P-glycoprote... Xenobiotica. 2008 Jul;38(7-8):802-32. Zhou SF
Structure, function and regulation of P-glycoprotein and its clinical relevance in drug disposition.
Xenobiotica. 2008 Jul;38(7-8):802-32., [PMID:18668431]

Abstract [show]
1. P-glycoprotein (P-gp/MDR1), one of the most clinically important transmembrane transporters in humans, is encoded by the ABCB1/MDR1 gene. Recent insights into the structural features of P-gp/MDR1 enable a re-evaluation of the biochemical evidence on the binding and transport of drugs by P-gp/MDR1. 2. P-gp/MDR1 is found in various human tissues in addition to being expressed in tumours cells. It is located on the apical surface of intestinal epithelial cells, bile canaliculi, renal tubular cells, and placenta and the luminal surface of capillary endothelial cells in the brain and testes. 3. P-gp/MDR1 confers a multi-drug resistance (MDR) phenotype to cancer cells that have developed resistance to chemotherapy drugs. P-gp/MDR1 activity is also of great clinical importance in non-cancer-related drug therapy due to its wide-ranging effects on the absorption and excretion of a variety of drugs. 4. P-gp/MDR1 excretes xenobiotics such as cytotoxic compounds into the gastrointestinal tract, bile and urine. It also participates in the function of the blood-brain barrier. 5. One of the most interesting characteristics of P-gp/MDR1 is that its many substrates vary greatly in their structure and functionality, ranging from small molecules such as organic cations, carbohydrates, amino acids and some antibiotics to macromolecules such as polysaccharides and proteins. 6. Quite a number of single nucleotide polymorphisms have been found for the MDR1 gene. These single nucleotide polymorphisms are associated with altered oral bioavailability of P-gp/MDR1 substrates, drug resistance, and a susceptibility to some human diseases. 7. Altered P-gp/MDR1 activity due to induction and/or inhibition can cause drug-drug interactions with altered drug pharmacokinetics and response. 8. Further studies are warranted to explore the physiological function and pharmacological role of P-gp/MDR1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
298 A G1199A polymorphism is located at exon 11, which changes Ser-400 to Asn. Login to comment

[hide] MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alter... Cancer Chemother Pharmacol. 2009 Jun;64(1):183-8. Epub 2009 Jan 4. Woodahl EL, Crouthamel MH, Bui T, Shen DD, Ho RJ
MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents.
Cancer Chemother Pharmacol. 2009 Jun;64(1):183-8. Epub 2009 Jan 4., [PMID:19123050]

Abstract [show]
PURPOSE: P-glycoprotein (P-gp), encoded by MDR1 (or ABCB1), is important in anticancer drug delivery and resistance. We evaluated alterations in P-gp-mediated transport of anticancer agents due to the MDR1 G1199A polymorphism. METHODS: Using stable recombinant epithelial cells expressing wild-type (MDR1 (wt)) or G1199A (MDR1 (1199A)), anticancer drug sensitivity and transepithelial permeability were evaluated. RESULTS: The recombinant cells MDR1 (wt) and MDR1 ( 1199A ) displayed comparable doxorubicin resistance. However, MDR1 (1199A) cells displayed greater resistance to vinblastine, vincristine, paclitaxel, and VP-16 (11-, 2.9-, 1.9-, and 2.9-fold, respectively). Alterations in transepithelial permeability paralleled these changes. Efflux of doxorubicin was similar between MDR1 wt - and MDR1 (1199A)-expressing cells, while P-gp-mediated transport was greater for vinblastine and vincristine in MDR1 (1199A) cells (2.9- and 2.0-fold, respectively). CONCLUSIONS: The occurrence and magnitude of the MDR1 G1199A effect is drug specific. Overall, the MDR1 G1199A polymorphism may impact anticancer efficacy through modulation of drug distribution and delivery to target tumor cells.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 DOI 10.1007/s00280-008-0906-4 123 SHORT COMMUNICATION MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents Erica L. Woodahl · Matthew H. Crouthamel · Tot Bui · Danny D. Shen · Rodney J. Y. Ho Received: 11 August 2008 / Accepted: 14 December 2008 / Published online: 4 January 2009 (c) Springer-Verlag 2009 Abstract Purpose P-glycoprotein (P-gp), encoded by MDR1 (or ABCB1), is important in anticancer drug delivery and resistance. Login to comment
18 The model for this recombinant cell expression system was expression of the MDR1 G1199A SNP, which results in a serine to asparagine transition at amino acid 400 (Ser400Asn) in a cytoplasmic domain of P-gp (allelic frequency »5.5% in Caucasians) [3, 4]. Login to comment

[hide] Steroid biosynthesis and renal excretion in human ... Am J Hypertens. 2009 Apr;22(4):357-63. Epub 2009 Feb 5. Tripodi G, Citterio L, Kouznetsova T, Lanzani C, Florio M, Modica R, Messaggio E, Hamlyn JM, Zagato L, Bianchi G, Staessen JA, Manunta P
Steroid biosynthesis and renal excretion in human essential hypertension: association with blood pressure and endogenous ouabain.
Am J Hypertens. 2009 Apr;22(4):357-63. Epub 2009 Feb 5., [PMID:19197249]

Abstract [show]
BACKGROUND: Endogenous ouabain (EO) has been linked with long-term changes in sodium balance and cardiovascular structure and function. The biosynthesis of EO involves, cholesterol side-chain cleavage (CYP11A1), 3-beta-hydroxysteroid dehydrogenase (HSD3B) with sequential metabolism of pregnenolone and progesterone. Furthermore, the renal excretion of cardiac glycosides is mediated by the organic anion transporter (SLCO4C1) at the basolateral membrane and the P-glycoprotein (PGP) (encoded by MDR1) at the apical membrane of the nephron. METHODS: Average 24-h ambulatory blood pressures were recorded in 729 untreated essential hypertensives. Aldosterone (Aldo), EO, urinary Na+, and K+ excretions were determined. Single-nucleotide polymorphism (SNP) and haplotype-based association study was performed with a total of 26 informative SNPs. RESULTS: Plasma EO was significantly directly related to both day (r = 0.131, P < 0.01) and nighttime diastolic blood pressure (DBP) (r = 0.143, P < 0.01), and remained significantly related after correction for confounders (sex, body mass index, age). Genotype analysis for EO levels and daytime DBP gave significant results for CYP11A1 rs11638442 and MDR1 rs1045642 (T/C Ile1145) in which the minor allele tracked with higher EO levels (T/T 210.3 (147-272) vs. C/C 270.7 (193-366) pmol/l, P < 0.001). Association was found between HSD3B1 polymorphisms and/or haplotypes with blood pressure (systolic blood pressure (SBP) 140.3 (11.7) vs. 143.8 (11.2) mm Hg, P < 0.01) and plasma Aldo (P < 0.05). Haplotype-based analyses support the data of SNP analysis. CONCLUSIONS: Among patients with essential hypertension, cholesterol side-chain cleavage and MDR1 loci are related to circulating EO and DBP, most likely by influencing EO synthesis and transmembrane transport, respectively. In contrast, variants in HSD3B1 are related with SBP probably via Aldo.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 A = 0.17; G = 0.83 SLCO4C1 rs3811976 5q21.1 101599098 Untranslated 3'-UTR A = 0.82; G = 0.08 SLCO4C1 rs6596425 5q21.1 101603285 Intron C = 0.18; G = 0.82 SLCO4C1 rs10515323 5q21.1 101611553 Intron C = 0.13; G = 0.87 SLCO4C1 rs174414 5q21.1 101620640 Intron A = 0.35; G = 0.65 SLCO4C1 rs370176 5q21.1 101623456 Intron A = 0.78; G = 0.22 SLCO4C1 rs2600831 5q21.1 101633969 Intron A = 0.58;T = 0.42 SLCO4C1 rs2548724 5q21.1 101648072 Intron A = 0.20; G = 0.80 SLCO4C1 rs709369 5q21.1 101652234 Intron A = 0.52; G = 0.48 SLCO4C1 rs841922 5q21.1 101658594 Intron A = 0.27; C = 0.73 MDR1 rs17064 7q21.12 86971405 Untranslated 3'-UTR A = 0.07;T = 0.93 MDR1 rs1045642 7q21.12 86976580 Synonymous Ile1145 T = 0.52; C = 0.48 MDR1 rs2032582 7q21.12 86998553 Nonsynonymous Ala893Ser G = 0.54;T = 0.46 MDR1 rs2229109 7q21.12 87017744 Nonsynonymous Ser400Asn A = 0.05; G = 0.95 SNP ID is a GenBank ID number (NCBI), gene map position and SNP function were taken from the most recent human genome sequence assembly hg18 (NCBI Build 36.1). Login to comment

[hide] Clinical significance of ABCB1 genotyping in oncol... J Oncol Pharm Pract. 2010 Mar;16(1):39-44. Epub 2009 Apr 28. Hamidovic A, Hahn K, Kolesar J
Clinical significance of ABCB1 genotyping in oncology.
J Oncol Pharm Pract. 2010 Mar;16(1):39-44. Epub 2009 Apr 28., [PMID:19401306]

Abstract [show]
BACKGROUND: P-glycoprotein (Pgp) is a drug efflux pump that transports natural products, including taxanes and other chemotherapeutic agents, from cells. Several frequent polymorphisms in ATP binding cassette gene B1 (ABCB1) may influence Pgp levels and drug efflux. The purpose of this review was to assess the clinical significance of ABCB1 polymorphisms in oncology. METHODS: Peer-reviewed studies were identified through a search of PubMed/MEDLINE (1990-2008) and the ASCO abstracts (2003-2008) database. Included studies described clinical trials where ABCB1 genotyping was performed in patients with cancer. Search terms included ABCB1, Pgp, docetaxel, paclitaxel, irinotecan, imatinib, and anticancer agent. Studies were excluded if the manuscript was not available in English. RESULTS: The influence of polymorphisms in ABCB1 2677G>T/A, 3435C>T, and 1236C>T and progression-free and overall survival in 309 patients from the Australian Ovarian Cancer Study treated with paclitaxel/carboplatin demonstrated that compared to homozygote GG carriers at 2677, women with the minor T/A alleles were significantly less likely to relapse following treatment. Other trials of ABCB1 genotyping in breast and prostate cancer patients receiving taxanes have shown inconsistent results. Pharmacokinetic studies where ABCB1 was genotyped and patients received irinotecan or imatinib have also shown inconsistent results. CONCLUSION: A number of commercially available drugs are substrates for Pgp, and the ABCB1-variant genotypes are frequent and functionally significant, which may have future implications for drug dosing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Pgp substrates clinically relevant to oncology Anti-cancer agents6,9,13-16 Actinomycin D Mithramycin Bisantrene Mitomycin C Colchicine Mitoxantrone Daunorubicin Paclitaxel Docetaxel Temozolomide Doxorubicin Teniposide Epirubicin Topotecan Etoposide Vinblastine Irinotecan Vincristine Methotrexate Vindesine Examples of MDR-reversal agents in clinical trials15 Verapamil Tamoxifen Cyclosporine A Azidopine Quinidine 40 ABCB1 gene, respectively.11 The SNPs represent the three most frequent ABCB1 SNPs in the Caucasian population and have been shown to be in linkage disequilibrium.19 G2677T/A is at a wobble position which results in an Ala to Ser/Thr change at position 893.20 C1236T is a synonymous mutation resulting in a Ser to Asn change at position 400.21 C3435T is also a synonymous mutation at a wobble position but does not change the amino acid from an Ile at position 1145.22 The allelic frequencies of these three SNPs are highly variable between ethnicities.11,19,22 (Table 2). Login to comment

[hide] No significant effect of ABCB1 haplotypes on the p... Br J Clin Pharmacol. 2009 Aug;68(2):207-13. Keskitalo JE, Kurkinen KJ, Neuvonen M, Backman JT, Neuvonen PJ, Niemi M
No significant effect of ABCB1 haplotypes on the pharmacokinetics of fluvastatin, pravastatin, lovastatin, and rosuvastatin.
Br J Clin Pharmacol. 2009 Aug;68(2):207-13., [PMID:19694740]

Abstract [show]
AIMS: This study aimed to investigate possible effects of ABCB1 genotype on fluvastatin, pravastatin, lovastatin, and rosuvastatin pharmacokinetics. METHODS: In a fixed-order crossover study, 10 healthy volunteers with the ABCB1 c.1236C/C-c.2677G/G-c.3435C/C (CGC/CGC) genotype and 10 with the c.1236T/T-c.2677T/T-c.3435T/T (TTT/TTT) genotype ingested a single 20-mg dose of fluvastatin, pravastatin, lovastatin, and rosuvastatin. Plasma fluvastatin, pravastatin, and lovastatin concentrations were measured up to 12 h and plasma and urine rosuvastatin concentrations up to 48 and 24 h, respectively. RESULTS: The ABCB1 genotype had no significant effect on the pharmacokinetics of any of the investigated statins. The geometric mean ratio (95% confidence interval) of the area under the plasma concentration-time curve from 0 h to infinity (AUC(0-infinity)) in participants with the TTT/TTT genotype to that in those with the CGC/CGC genotype was 0.96 (0.77, 1.20; P= 0.737) for fluvastatin, 0.92 (0.53, 1.62; P= 0.772) for pravastatin, 0.83 (0.36, 1.90; P= 0.644) for lovastatin, 1.25 (0.72, 2.17; P= 0.400) for lovastatin acid, and 1.10 (0.73, 1.65; P= 0.626) for rosuvastatin. The AUC(0-infinity) of lovastatin acid correlated significantly with that of rosuvastatin (r= 0.570, P= 0.009), but none of the other AUC(0-infinity) pairs showed a significant correlation. CONCLUSIONS: These data suggest that the ABCB1 c.1236C-c.2677G-c.3435C and c.1236T-c.2677T-c.3435T haplotypes play no significant role in the interindividual variability in the pharmacokinetics of fluvastatin, pravastatin, lovastatin, and rosuvastatin.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 In addition, participants were genotyped for the ABCB1 c.1199G→A (p.Ser400Asn; rs2229109), CYP3A5*3 (g.6986A→G; rs776746), CYP2C9*3 (c.1075A→C, p.Ile359Thr; rs1057910) and SLCO1B1 c.521T→C (p.Val174Ala; rs4149056) alleles [18-21]. Login to comment

[hide] A novel polymorphism in ABCB1 gene, CYP2B6*6 and s... Br J Clin Pharmacol. 2009 Nov;68(5):690-9. Mukonzo JK, Roshammar D, Waako P, Andersson M, Fukasawa T, Milani L, Svensson JO, Ogwal-Okeng J, Gustafsson LL, Aklillu E
A novel polymorphism in ABCB1 gene, CYP2B6*6 and sex predict single-dose efavirenz population pharmacokinetics in Ugandans.
Br J Clin Pharmacol. 2009 Nov;68(5):690-9., [PMID:19916993]

Abstract [show]
AIMS: Efavirenz exhibits pharmacokinetic variability causing varied clinical response. The aim was to develop an integrated population pharmacokinetic/pharmacogenetic model and investigate the impact of genetic variations, sex, demographic and biochemical variables on single-dose efavirenz pharmacokinetics among Ugandan subjects, using NONMEM. METHODS: Efavirenz plasma concentrations (n = 402) from 121 healthy subjects were quantified by high-performance liquid chromatography. Subjects were genotyped for 30 single nucleotide polymorphisms (SNPs), of which six were novel SNPs in CYP2B6, CYP3A5 and ABCB1. The efavirenz pharmacokinetics was described by a two-compartment model with zero- followed by first-order absorption. RESULTS: Apparent oral clearance (95% confidence interval) was 4 l h l(-1) (3.5, 4.5) in extensive metabolizers. In the final model, incorporating multiple covariates, statistical significance was found only for CYP2B6*6 and CYP2B6*11 on apparent oral clearance as well as ABCB1 (rs3842) on the relative bioavailability. Subjects homozygous for CYP2B6*6 (G516T, A785G) and *11 displayed 21 and 20% lower apparent oral clearance, respectively. Efavirenz relative bioavailability was 26% higher in subjects homozygous for ABCB1 (rs3842). The apparent peripheral volume of distribution was twofold higher in women compared with men. CONCLUSIONS: The model identified the four factors CYP2B6*6, CYP2B6*11, a novel variant allele in ABCB1 (rs3842) and sex as major predictors of efavirenz plasma exposure in a healthy Ugandan population after single-dose administration. Use of mixed-effects modelling allowed the analysis and integration of multiple pharmacogenetic and demographic covariates in a pharmacokinetic population model.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
119 785 A→G rs2279343 CYP2B6*4, *6, *7, *13, *16 *19, *20 K262R Reduced expression and activity 36.4 c.516 G→T rs3745274 CYP2B6*6, *7, *9, *13, *19, *20 Q172H Reduced expression and activity 35.6 c.136A→G rs35303484 CYP2B6*11 M46V Phenotypic null allele 13.6 c.983 T→C rs28399499 CYP2B6*16, *18 I328T Phenotypic null allele 10.4 c.64 C→T rs8192709 CYP2B6*2 R22C Phenotypic null allele 8.0 c.1282 C→T rs35010098 CYP2B6*21 P428T Phenotypic null allele 1.1 exon 8/-6 C→T rs35449271 New SNP Undetermined 32.0 296 G→A rs36060847 CYP2B6*12 G99E Reduced expression 3.6 1375 A→G rs3211369 CYP2B6*23 M459V Unknown 24.0 c.1172 T→A rs35979566 CYP2B6*15 I391N Reduced expression 7.7 CYP3A5 g.27289C→A rs28365083 CYP3A5*2 T398N Unknown 0 g.6986A→G rs776746 CYP3A5*3 Splicing defect Phenotypic null allele 18.2 g.14665A→G CYP3A5*4 Q200R Unknown 8.6 g.14690G→A CYP3A5*6 Splicing defect Phenotypic null allele 17.2 g.27131-27132insT rs241303343 CYP3A5*7 346 frame shift Phenotypic null allele 18.4 g.3699C→T rs28371764 CYP3A5*8 R28C Phenotypic null allele 0 g.19386G→A rs28383479 CYP3A5*9 A337T Decreased activity 11.4 ABCB1 c.1236 C→T rs1128503 Gly412Gly Phenotypic null allele 11.9 c.2677 G/A→T rs2032582 Ala/Thr893 Ser Phenotypic null allele 3.7 c.3435 T/C rs1045642 Ile1145Ile Phenotypic null allele 4.8 c.4036 A/G rs3842 New SNP 3' UTR Undetermined 16.8 c.1659 G→C rs2235012 Leu554Leu 1.1 exon 6/+139 C→T rs1202168 New SNP - Undetermined 18.6 exon 19/-88 T→C rs4728699 New SNP - Undetermined 7.7 c.781A→G rs36008564 Ile261Val 6.9 c.239C→A rs9282565 Ala80Glu 2.8 exon 12/+44 C→T rs20328588 New SNP Intron 13 Undetermined 5.1 c.1199G→A rs2229109 Ser400Asn 2.6 c.1795C→T rs2235036 Ala599Thr 7.0 exon 20/+24 G→A rs2235040 New SNP - Undetermined 4.6 *Position based on cDNA numbering (c. Login to comment

[hide] Regional P-glycoprotein activity and inhibition at... Clin Pharmacol Ther. 2010 May;87(5):579-85. Epub 2010 Mar 24. Eyal S, Ke B, Muzi M, Link JM, Mankoff DA, Collier AC, Unadkat JD
Regional P-glycoprotein activity and inhibition at the human blood-brain barrier as imaged by positron emission tomography.
Clin Pharmacol Ther. 2010 May;87(5):579-85. Epub 2010 Mar 24., [PMID:20336065]

Abstract [show]
We used positron emission tomography (PET) to evaluate the contribution of P-glycoprotein (P-gp), present at the human blood-brain barrier (BBB), to regional drug distribution in the brain. Eleven healthy volunteers underwent PET imaging with [(11)C]-verapamil before and during cyclosporine A infusion. Regional P-gp inhibition was expressed as cyclosporine A-induced percentage change in the distributional clearance of verapamil (K(1)) in the brain, normalized to the regional blood flow (rCBF). K(1) estimates were similar across gray-matter regions of the brain and lower in the white matter regions, but all these estimates were considerably lower than rCBF. Normalization of K(1) by rCBF diminished the differences in estimates related to gray matter and white matter. In contrast, the K(1) for the pituitary, which is situated outside the BBB, approximated the rCBF. The magnitude of P-gp inhibition was comparable across BBB-protected brain structures. Our results indicate that P-gp and its inhibition equally affect the distribution of drugs (and therefore their neuro-efficacy and toxicity) in the various brain regions protected by the BBB.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
307 43. Woodahl, E.L., Crouthamel, M.H., Bui,T., Shen, D.D. & Ho, R.J. MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability andsensitivity to anticancer agents. Login to comment
304 43. Woodahl, E.L., Crouthamel, M.H., Bui,T., Shen, D.D. & Ho, R.J. MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents. Login to comment

[hide] Genetic variations in ABCB1 and CYP3A5 as well as ... Ther Drug Monit. 2010 Jun;32(3):346-52. Mukonzo JK, Waako P, Ogwal-Okeng J, Gustafsson LL, Aklillu E
Genetic variations in ABCB1 and CYP3A5 as well as sex influence quinine disposition among Ugandans.
Ther Drug Monit. 2010 Jun;32(3):346-52., [PMID:20357698]

Abstract [show]
Quinine is one of the most effective antimalarial drugs, although its clinical use is limited as a result of its narrow safety margin. Quinine is a substrate of the polymorphic p-glycoprotein and CYP3A4/3A5. This study aimed to examine the effects of genetic variations in ABCB1 and CYP3A5 genes, sex, demographic, and biochemical variables (serum albumin, creatinine, alanine aminotransferase and albumin) on quinine disposition among Ugandans. Quinine (600 mg) was orally administered to 140 healthy volunteers. Quinine and its metabolite 3-hydroxyquinine concentrations were determined from 16-hour postdose plasma by high-performance liquid chromatography. CYP3A5 activity was measured using quinine/3-hydroxyquinine ratio (metabolic ratio). Genotyping for a total of 20 single nucleotide polymorphisms in ABCB1 (n = 13) and CYP3A5 (n = 7) was done using Taqman and minisequencing on microarray. There were 20.5- and 13-fold variations in body weight-adjusted plasma quinine concentrations (mean +/- standard deviation, 5.26 +/- 2.5 mumol/L; range, 0.88-18.10 mumol/L) and quinine-to-3-hydroxyquinine metabolic ratio (mean +/- standard deviation, 7.68 +/- 3.3 mumol/L; range, 1.66-22.3 mumol/L), respectively. Weight-adjusted plasma quinine concentration was significantly influenced by sex and ABCB1 haplotype. There was a significant sex difference in quinine metabolic ratio, women being faster metabolizers than men (P = 0.01). CYP3A5 genotype/haplotype significantly (P = 0.03) influenced quinine disposition with a clear CYP3A5*1 gene dose effect. The result confirms that quinine disposition is influenced mainly by sex as well as by ABCB1 and CYP3A5 genotypes. Despite being fast metabolizers, women display higher quinine bioavailability than men in Uganda. This may have clinical significance in determining an individual's susceptibility to quinine-associated adverse reactions such as cinchonism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 T rs2032582 Ala/Thr893 Ser Altered activity 3.7 c.3435 C/T rs1045642 Ile1145Ile Altered activity 4.8 c.4036 A/G rs3842 New SNP 3` UTR Undetermined 16.8 c.1659 G.C rs2235012 Leu554Leu Detected only in blacks 1.1 Exon 6/ +139 C.T rs1202168 New SNP - Undetermined 18.6 Exon 19/-88 T.C rs4728699 - Undetermined 7.7 c.781A.G rs36008564 Ile261Val 6.9 c.239C.A rs9282565 Ala80Glu 2.8 Exon 12/+44 C.T rs20328588 New SNP Intron 13 Undetermined 5.1 c.1199G.A rs2229109 Ser400Asn 2.6 c.1795C.T rs2235036 Ala599Thr 7.0 Exon 20/+24 G.A rs2235040 New SNP - Undetermined 4.6 CYP3A5 g.27289C.A rs28365083 CYP3A5*2 T398N Unknown 0 g.6986A.G rs776746 CYP3A5*3 Splicing defect Phenotypic null allele 18.2 g.14665A.G CYP3A5*4 Q200R Unknown 6.7 g.14690G.A CYP3A5*6 Splicing defect Phenotypic null allele 17.2 g.27131-27132insT rs241303343 CYP3A5*7 346 frame shift Phenotypic null allele 11.4 g.3699C.T rs28371764 CYP3A5*8 R28C Phenotypic null allele 0 g.19386G.A rs28383479 CYP3A5*9 A337T Decreased activity 9.6 *Position based on cDNA numbering (c. Login to comment

[hide] Effect of ABCB1 haplotypes on the pharmacokinetics... Eur J Clin Pharmacol. 2010 Sep;66(9):865-70. Epub 2010 May 23. Tapaninen T, Neuvonen PJ, Niemi M
Effect of ABCB1 haplotypes on the pharmacokinetics and renin-inhibiting effect of aliskiren.
Eur J Clin Pharmacol. 2010 Sep;66(9):865-70. Epub 2010 May 23., [PMID:20496145]

Abstract [show]
PURPOSE: This study aimed to investigate the possible effects of ABCB1 haplotypes on the pharmacokinetics and renin-inhibiting effect of aliskiren. METHODS: Eleven healthy volunteers homozygous for the ABCB1 c.1236C-c.2677G-c.3435C (CGC) haplotype and 11 homozygous for the c.1236T-c.2677T-c.3435T (TTT) haplotype ingested a single 150-mg dose of aliskiren. Plasma aliskiren concentrations were measured up to 72 h, its excretion into urine up to 12 h, and plasma renin activity up to 24 h. RESULTS: The ABCB1 haplotypes had no significant effect on the pharmacokinetics or renin-inhibiting effect of aliskiren. The geometric mean ratio (95% confidence interval) of aliskiren peak plasma concentration and area under the plasma concentration-time curve from 0 h to infinity in participants homozygous for the TTT haplotype to those in participants homozygous for the CGC haplotype were 1.14 (0.66, 1.96; P = 0.631) and 1.01 (0.58, 1.76; P = 0.960) respectively. CONCLUSIONS: These data suggest that the ABCB1 c.1236C-c.2677G-c.3435C and c.1236T-c.2677T-c.3435T haplotypes have no clinically meaningful effect on the pharmacokinetics of aliskiren.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 To minimize variability in aliskiren pharmacokinetics due to other genetic variants, all subjects were genotyped for the functionally significant ABCB1 c.1199G > A (p.Ser400Asn; rs2229109) [17] and CYP3A5*3 (g.6986A>G; rs776746) [26] alleles and only noncarriers of the ABCB1 c.1199A and CYP3A5 g.6986A (CYP3A5 expressor) alleles were recruited. Login to comment

[hide] P-glycoprotein: tissue distribution, substrates, a... Handb Exp Pharmacol. 2011;(201):261-83. Cascorbi I
P-glycoprotein: tissue distribution, substrates, and functional consequences of genetic variations.
Handb Exp Pharmacol. 2011;(201):261-83., [PMID:21103972]

Abstract [show]
P-glycoprotein (ABCB1, MDR1) belongs to the ABC transporter family transporting a wide range of drugs and xenobiotics from intra- to extracellular at many biological interfaces such as the intestine, liver, blood-brain barrier, and kidney. The ABCB1 gene is highly polymorphic. Starting with the observation of lower duodenal protein expression and elevated digoxin bioavailability in relation to the 3435C>T single nucleotide polymorphism, hundreds of pharmacokinetic and outcome studies have been performed, mostly genotyping 1236C>T, 2677G>T/A, and 3435C>T. Though some studies pointed out that intracellular concentrations of anticancer drugs, for example, within lymphocytes, might be affected by ABCB1 variants resulting in differential outcome, current knowledge of the functional significance genetic variants of ABC membrane transporters does not allow selection of a particular SNP to predict an individual's pharmacokinetics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 Absence of the gene, as being the case in double-knockout mice, is conformable N21D S400N A893S/T Q1107P 3435C>T1236T>C N183S R492C S1141T NBD1 NBD2 Intracellular (e.g. lymphocyte) Extracellular M986V Fig. 1 Two-dimensional structure of ABCB1 with locations of amino acid replacements and two frequent synonymous SNPs, NBD ¼ nucleotide binding domain [adapted from Cascorbi and Haenisch (2010)] Inducer intra cellular ABCB1 Transkription Translation ABCB1 (P-gp) luminal Fig. 2 Induction of ABCB1 via the nuclear PXR/RXR receptor leading to accelerated extrusion of P-glycoprotein substrates with life. Login to comment
78 The rare missense SNP 1199G>T (Ser400Asn) was associated with lower transport capacity in vitro leading to putatively higher sensitivity against cytostatics. Login to comment
81 Table 2 Frequency of ABCB1 genetic variants in Caucasians, position on DNA, putative effect, and frequencies [according to Cascorbi (2006) and Cascorbi and Haenisch (2010)] Position Amino acid or effect Frequency of the variant allele Association to expression, kinetics or drug response 50 -flanking À2903 T>C 0.02a 50 -flanking À2410 T>C 0.10a Decreased mRNAa 50 -flanking À2352 G>A 0.28a 50 -flanking À1910 T>C 0.10a 50 -flanking À1717 T>C 0.02a 50 -flanking À1325 A>G 0.02a 50 -flanking À934 A>G 0.10a 50 -flanking À692 T>C 0.10a Decreased mRNAa 50 -flanking À41 A>G 0.09b IVS 1a À145 C>G 0.02b IVS 1b À129 T>C 0.06b IVS 1b 12 T>C 0.06c IVS 2 À1 G>A 0.09d c. 61 A>G N21D 0.11d IVS 5 À35 G>C Intronic 0.006c IVS 5 À25 G>T Intronic 0.16c IVS 6 þ139 C>T Intronic 0.37d c. 548 A>G N183S 0.01e c. 571 G>A G191R 0.07f Reduced chemotherapy resistancef c. 1199 G>A S400N 0.05d c. 1199 C>T S400I 0.02g Elevated activityg c. 1236 C>T Synonymous 0.41d Increased imatinib disposition and therapy responseh IVS 12 þ44 C>T Intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17 À76 T>A Intronic 0.46d IVS 17 þ137 A>G Intronic 0.006c c. 2650 C>T Synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d In vitro increased vmax,i increased imatinib response in CMLh c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T Synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T Synonymous 0.54d Decreased mRNA and protein expression,e, k decreased in vitro transport,l no effect on expression and bioavailability of talinolol,m no effect on in vitro transport,n, o decreased digoxin (continued) 4.2.1 Digoxin The heart glycoside digoxin is widely accepted as typical P-glycoprotein substrate. Login to comment

[hide] Modification of menopausal hormone therapy-associa... Endocr Relat Cancer. 2011 Jun 8;18(3):371-84. Print 2011. Rudolph A, Sainz J, Hein R, Hoffmeister M, Frank B, Forsti A, Brenner H, Hemminki K, Chang-Claude J
Modification of menopausal hormone therapy-associated colorectal cancer risk by polymorphisms in sex steroid signaling, metabolism and transport related genes.
Endocr Relat Cancer. 2011 Jun 8;18(3):371-84. Print 2011., [PMID:21490239]

Abstract [show]
The mechanisms underlying the association of menopausal hormone therapy (MHT) with reduced colorectal cancer (CRC) risk are unknown and the identification of genetic modifiers may yield further insight. We explored the effect modification of MHT-associated CRC risk in postmenopausal women by 47 polymorphisms with known or putative functional relevance in 16 candidate genes related to hormone metabolism (COMT, CYP1A1, CYP1A2, CYP1B1, CYP2C9, CYP2C19, CYP3A4, CYP17A1, GSTP, and HSD17B1), transport (ABCB1), and signaling (ESR1, ESR2, SHBG, PGR, and NR1I2). A total of 685 CRC patients and 684 healthy controls from a German population-based case-control study (DACHS) were genotyped. Multiplicative statistical interaction between polymorphisms and ever MHT use as well as duration of use was assessed using multivariate logistic regression. CRC risk associated with ever MHT use as well as with duration was significantly modified by rs1202168 in the transporter gene ABCB1 (P interaction=0.04). The MHT-associated risk reduction was not significant in homozygous non-carriers (odds ratio (OR) ever use=0.84, 95% confidence interval (CI) 0.53-1.34; OR per 5 year duration=0.94, 95% CI 0.83-1.08), while homozygous carriers of the minor T allele had a 57% lower risk with ever use of MHT (95% CI 0.21-0.88) and a 22% lower risk per 5 years of MHT use (95% CI 0.62-0.97). Significant effect modification was also observed for the ESR1_rs910416 polymorphism (P interaction=0.03 for ever use and 0.07 for duration of use), whereby the decreased risk was attenuated in homozygous carriers of the minor C allele (OR ever use=0.87, 95% CI 0.48-1.60, OR per 5 year duration=0.99, 95% CI 0.83-1.18). Results of this exploratory study provide first evidence that polymorphisms in genes related to estrogen transport and signaling may modify MHT-associated CRC risk but warrant replication in an independent population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
119 Table 2 Genotype frequencies and colorectal cancer risk estimates of polymorphisms in genes related to sex steroid signaling, transport, and metabolism in the female postmenopausal DACHS study population Gene Variant Genotype Effect estimate dbSNP rs# Amino acid substitution and functional consequence MAF Genotype N Co/N Ca OR (95% CI)a P trend ABCB1 rs1045642 I1145I, T allele associated with lower protein expression (Hoffmeyer et al. 2000) 49% T/T 183/190 1.00 T/C 329/336 1.04 (0.77-1.40) C/C 167/156 0.98 (0.69-1.39) 0.914 ABCB1 rs2229109 S400N, functional consequences unknown 6% G/G 596/614 1.00 G/A 86/64 0.69 (0.47-1.03) A/A 1/1 1.00 (0.03-33.9) 0.078 ABCB1 rs1202168 Intronic, functional consequences unknown, in high LD interval (Soranzo et al. 2004) 40% C/C 249/218 1.00 C/T 312/337 1.08 (0.82-1.42) T/T 119/127 1.02 (0.71-1.46) 0.829 ABCB1 rs9282564 N21D, results in a net charge change of the protein (Brinkmann and Eichelbaum 2001) 10% A/A 545/544 1.00 A/G 117/124 1.05 (0.76-1.45) G/G 12/9 0.73 (0.23-2.27) 0.997 ABCB1 rs2214102 50 -UTR, located at a translation initiation site (Hoffmeyer et al. 2000) 7% G/G 593/580 1.00 G/A 81/97 1.33 (0.91-1.92) A/A 6/6 0.96 (0.26-3.51) 0.208 SHBG rs6259 D356N, A allele is associated with reduced clearance of SHBG (Cousin et al. 1998) 11% G/G 525/549 1.00 G/A 141/115 0.69 (0.50-0.95) A/A 6/10 1.13 (0.36-3.60) 0.061 ESR2 rs1255998 30 -UTR, functional consequences unknown, G allele associated with endometrial cancer risk (Ashton et al. 2009) 12% C/C 519/547 1.00 C/G 138/114 0.76 (0.55-1.04) G/G 14/5 0.33 (0.11-1.01) 0.015 ESR2 rs928554 30 -UTR, G allele might create new acceptor splice site (MARIE-GENICA-Consortium 2010a) 40% A/A 246/222 1.00 A/G 316/317 1.19 (0.90-1.56) G/G 111/133 1.48 (1.03-2.13) 0.032 ESR2 rs4986938 30 -UTR, potentially affects pre-mRNA splicing (Zheng et al. 2003) 38% G/G 260/264 1.00 G/A 310/306 0.97 (0.74-1.27) A/A 99/106 1.02 (0.70-1.48) 0.997 ESR2 rs1271572 50 -UTR, might modulate binding of transcription factors (MARIE-GENICA-Consortium 2010a) 42% G/G 231/208 1.00 G/T 329/330 1.29 (0.97-1.70) T/T 120/138 1.40 (0.98-2.00) 0.046 ESR1 rs851984 50 -UTR, functional consequences unknown, T allele associated with breast cancer risk (MARIE-GENICA-Consortium 2010a) 41% C/C 221/231 1.00 C/T 341/314 0.95 (0.72-1.25) T/T 103/122 1.07 (0.74-1.55) 0.833 ESR1 rs2881766 50 -UTR, functional consequences unknown, G allele associated with breast cancer risk (MARIE-GENICA-Consortium 2010a) 18% T/T 461/453 1.00 T/G 190/195 1.02 (0.77-1.35) G/G 25/22 0.95 (0.48-1.87) 0.989 ESR1 rs2071454 50 -UTR, functional consequences unknown 11% T/T 536/551 1.00 T/G 132/120 0.81 (0.59-1.12) G/G 5/8 1.75 (0.51-6.03) 0.467 ESR1 rs2077647 S10S, potentially affects mRNA structure (Tanaka et al. 2003) 47% A/A 183/187 1.00 A/G 347/349 0.97 (0.73-1.30) G/G 140/135 0.93 (0.65-1.33) 0.697 ESR1 rs827421 Intronic, functional consequences unknown 48% T/T 172/178 1.00 T/C 350/355 1.02 (0.76-1.37) C/C 151/143 0.91 (0.64-1.30) 0.620 ESR1 rs2234693 Intronic, C allele introduces a binding site for transcription factor B-myb, leading to altered transcription (Herrington et al. 2002) 46% T/T 188/209 1.00 T/C 348/341 0.93 (0.70-1.24) C/C 136/120 0.87 (0.61-1.24) 0.429 ESR1 rs9340799 Intronic, functional consequences unknown, may lead to altered transcription or splicing (Schuit et al. 2004) 36% A/A 274/287 1.00 A/G 319/317 1.01 (0.78-1.32) G/G 83/72 0.94 (0.63-1.42) 0.864 ESR1 rs3798577 30 -UTR, functional consequences unknown 45% T/T 203/189 1.00 T/C 328/330 1.14 (0.86-1.52) C/C 139/154 1.27 (0.89-1.80) 0.181 Table 2 continued Gene Variant Genotype Effect estimate dbSNP rs# Amino acid substitution and functional consequence MAF Genotype N Co/N Ca OR (95% CI)a P trend ESR1 rs910416 30 near gene, functional consequences unknown, modified estrogen monotherapy- associated breast cancer risk (MARIE-GENICA-Consortium 2010a) 48% T/T 178/188 1.00 T/C 338/314 0.81 (0.61-1.10) C/C 148/159 0.92 (0.65-1.31) 0.599 PGR rs1042838 V660L, SNP possibly affects receptor dimerization, nuclear localization, ligand binding, cofactor interaction (Agoulnik et al. 2004) 15% C/C 495/478 1.00 C/A 154/181 1.32 (0.99-1.76) A/A 24/16 0.91 (0.44-1.88) 0.202 PGR rs1379130 G393G, functional consequences unknown 36% G/G 272/298 1.00 G/A 311/268 0.74 (0.56-0.96) A/A 88/108 1.01 (0.69-1.47) 0.412 PGR rs10895068 50 -UTR, creates new transcription start site, increasing expression of PR-B isoform (De Vivo et al. 2002) 4% G/G 615/619 1.00 G/A 58/59 0.89 (0.58-1.38) A/A 1/1 1.94 (0.05-80.6) 0.670 PGR rs518162 50 -UTR, SNP is located between PR-B and PR-A transcription start sites, potentially affecting PR-A/B expression (De Vivo et al. 2002) 7% G/G 580/586 1.00 G/A 93/88 1.06 (0.74-1.53) A/A 3/4 1.23 (0.21-7.06) 0.710 NR1I2 rs1523127 50 -UTR, belongs to a haplotype incl. SNPs that introduce new transcription factor binding sites (Zhang et al. 2001) 39% A/A 245/258 1.00 A/C 326/317 0.89 (0.68-1.17) C/C 98/88 0.89 (0.61-1.32) 0.450 NR1I2 rs2276706 Intronic, belongs to a haplotype incl. SNPs that introduce new transcription factor binding sites (Zhang et al. 2001) 38% G/G 251/267 1.00 G/A 329/324 0.92 (0.70-1.20) A/A 95/83 0.89 (0.60-1.31) 0.474 NR1I2 rs1464603 Intronic, functional consequences unknown 32% T/T 303/307 1.00 T/C 310/291 1.05 (0.80-1.36) C/C 65/78 1.11 (0.73-1.69) 0.608 NR1I2 rs6785049 Intronic, G allele associated with increased induction of CYP3A (Zhang et al. 2001) 38% A/A 260/264 1.00 A/G 323/313 1.00 (0.77-1.31) G/G 94/101 1.10 (0.75-1.60) 0.698 NR1I2 rs2276707 Intronic, T allele associated with increased induction of CYP3A (Zhang et al. 2001) 17% C/C 446/439 1.00 C/T 180/190 1.00 (0.75-1.32) T/T 21/24 1.19 (0.58-2.44) 0.794 NR1I2 rs1054191 30 -UTR, A allele associated with decreased induction of CYP3A (Zhang et al. 2001) 14% G/G 499/518 1.00 G/A 161/143 0.95 (0.70-1.28) A/A 17/12 0.80 (0.35-1.87) 0.581 NR1I2 rs3814057 30 -UTR, C allele associated with decreased induction of P-glycoprotein (Zhang et al. 2001) 17% A/A 458/440 1.00 A/C 177/201 1.15 (0.87-1.52) C/C 22/24 1.20 (0.60-2.41) 0.307 COMT rs4680 V158M, A allele leads to thermo-labile protein and 2-3 fold lower catalytic activity (Dawling et al. 2001) 49% G/G 171/177 1.00 A/G 343/327 0.88 (0.66-1.19) A/A 162/175 1.05 (0.74-1.48) 0.802 HSD17B1 rs605059 G313S, functional consequences unknown, C allele has been associated with lower estradiol levels (Setiawan et al. 2004) 46% T/T 199/167 1.00 T/C 330/340 1.30 (0.97-1.75) C/C 144/170 1.41 (0.99-2.01) 0.051 CYP1B1 rs1800440 N453S, G allele leads to enzyme which catalyzes hydroxylation of estradiol more efficiently (Hanna et al. 2000) 19% A/A 452/467 1.00 A/G 202/187 0.89 (0.68-1.18) G/G 26/22 0.81 (0.40-1.62) 0.342 CYP1B1 rs1056836 L432V, G allele leads to enzyme with increased activity (Shimada et al. 1999) 41% C/C 224/220 1.00 C/G 339/320 1.00 (0.75-1.32) G/G 106/128 1.31 (0.91-1.88) 0.209 CYP1B1 rs1056827 A119S, T allele leads to enzyme which catalyzes hydroxylation of estradiol more efficiently (Hanna et al. 2000) 31% G/G 317/323 1.00 G/T 304/297 0.90 (0.70-1.17) T/T 57/55 0.85 (0.54-1.35) 0.362 continued gene ESR1 (interaction ORZ1.49, 95% CI 1.04-2.13, P interactionZ0.03). Login to comment

[hide] An update on ABCB1 pharmacogenetics: insights from... Pharmacogenomics J. 2011 Oct;11(5):315-25. doi: 10.1038/tpj.2011.16. Epub 2011 May 31. Wolf SJ, Bachtiar M, Wang J, Sim TS, Chong SS, Lee CG
An update on ABCB1 pharmacogenetics: insights from a 3D model into the location and evolutionary conservation of residues corresponding to SNPs associated with drug pharmacokinetics.
Pharmacogenomics J. 2011 Oct;11(5):315-25. doi: 10.1038/tpj.2011.16. Epub 2011 May 31., [PMID:21625253]

Abstract [show]
The human ABCB1 protein, (P-glycoprotein or MDR1) is a membrane-bound glycoprotein that harnesses the energy of ATP hydrolysis to drive the unidirectional transport of substrates from the cytoplasm to the extracellular space. As a large range of therapeutic agents are known substrates of ABCB1 protein, its role in the onset of multidrug resistance has been the focus of much research. This role has been of particular interest in the field of pharmacogenomics where genetic variation within the ABCB1 gene, particularly in the form of single nucleotide polymorphisms (SNPs), is believed to contribute to inter-individual variation in ABCB1 function and drug response. In this review we provide an update on the influence of coding region SNPs within the ABCB1 gene on drug pharmacokinetics. By utilizing the crystal structure of the mouse ABCB1 homolog (Abcb1a), which is 87% homologous to the human sequence, we accompany this discussion with a graphical representation of residue location for amino acids corresponding to human ABCB1 coding region SNPs. Also, an assessment of residue conservation, which is calculated following multiple sequence alignment of 11 confirmed sequences of ABCB1 homologs, is presented and discussed. Superimposing a 'heat map' of residue homology to the Abcb1a crystal structure has permitted additional insights into both the conservation of individual residues and the conservation of their immediate surroundings. Such graphical representation of residue location and conservation supplements this update of ABCB1 pharmacogenetics to help clarify the often confounding reports on the influence of ABCB1 polymorphisms on drug pharmacokinetics and response.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Four of the 12 associated nsSNPs (E3/61A4G, E5/266C4T, E17/1985T4C and E17/2005C4T) cannot be mapped to the mouse crystal Table 1 Genetic conservation of amino acids corresponding to ABCB1 coding region SNPs 1 - rs28381804 E3/49T>C (F17L) F17 W16 S16 Y17 Y35 F39 - A42 - - G11 - - 2 - rs41304191 E3/55C>T (L19L) L19 M18 M18 I19 G37 P41 - E44 - - L13 - - 3 - rs76199854 E3/57G>A (L19L) L19 M18 M18 I19 G37 P41 - E44 - - L13 - - --51I--64H-34K93N12N02K02K12N)D12N(G>A16/3E4652829sr-4 7.832.8105P12A01K88D61D18T07T55S34G34N44N)S44N(G>A131/5E3812021sr1sn5 6 ns2 rs41315618 E5/178A>C (I60L) I60 I59 I59 A71 I86 A97 G32 G104 K26 N37 L66 27.3 46.6 1.924.6368N75G64N421Y25G711I601I19V97A97A08A)E08A(A>C932/5E5652829sr3sn7 8 - rs35810889 E5/266C>T (M89T) - M89 F89 S85 T96 I112 - - - - - - - - 9 ns4 rs61607171 E7/431T>C (I144T) TM2 I144 I145 I140 V152 N168 I176 A98 A172 L93 V97 L124 36.4 40.9 2.645.45841G121T711V691A221T002S291S671A461V961V861V)I861V(A>G205/7E32622116sr5sn01 11 s1 rs1128500 E8/540C>T (S180S) S180 S181 S176 S188 E204 S212 L136 N208 E129 E133 E160 27.3 42.0 12 ns6 rs60419673 E8/548A>G (N183S) N183 N184 N179 N191 K207 E215 Q139 Q211 K132 A136 S163 27.3 39.9 9.045.54561G831S431F312G141F712G902G391G181G681G581G)V581G(T>G455/8E1058211sr7sn31 14 s2 rs1128502 E8/555A>T (G185G) G185 G186 G181 G193 G209 G217 F141 G213 F134 S138 G165 45.5 40.9 15 s3 rs2235022 E9/729A>G (E243E) E243 E244 E239 E251 E267 E275 I199 Q271 R192 M196 S223 18.2 33.3 16 s4 rs28381867 E9/738G>A (A246A) A246 A247 A242 A254 R270 M278 E202 V274 A195 T199 Y226 9.1 34.5 17 ns8 rs36008564 E9/781A>G (I261V) C-NBD (Internal) I261 I262 I257 V267 I285 I293 V217 I289 I210 H214 I241 36.4 50.3 18 s5 rs80153317 E10/879T>C (I293I) TM5 I293 I294 I289 I301 L317 M325 L249 I321 R242 S246 F273 18.2 36.3 19 ns9 rs2229109 E12/1199G>A (S400N) N-NBD (Internal) S400 S401 S396 N408 T424 Q439 T355 V428 Q348 T350 H386 18.2 60.7 20 s6 rs1128503 E13/1236C>T (G412G) N-NBD (External) G412 G413 G408 G420 G436 K451 D367 N440 D359 N361 D398 27.3 55.9 21 s7 rs35068177 E13/1308A>G (T436T) T436 T437 T432 T44 I460 C475 V391 I464 L383 I385 I422 54.5 64.6 22 s8 rs41311775 E15/1326G>A (R442R) R442 R443 R438 R450 R466 R481 R397 R470 R389 R391 R428 100.0 54.5 23 s9 rs35633772 E15/1617C>T (I539I) I539 I540 I535 I547 I563 I578 I494 I576 L486 I489 I571 90.9 65.8 24 s10 rs60247941 E15/1632C>T (A544A) A544 A545 A540 A552 A568 A583 A499 A581 I491 A494 A576 63.6 65.1 25 s11 rs2235012 E15/1662G>C (L554L) L554 L555 L550 L562 L578 L593 L509 L591 L501 L504 L586 100.0 73.6 26 s12 rs56871767 E15/1674G>A (T558T) T558 T559 T554 T566 T582 T597 T513 T595 T505 T508 T590 100.0 78.7 27 s13 rs59697741 E15/1695C>T (S565S) S565 S566 S561 S573 S589 S604 S520 S602 S512 S515 S597 100.0 75.4 28 ns10 rs28381902 E15/1696G>A (E566K) E566 E567 E562 E574 E590 E605 E521 E603 E513 E516 E598 100.0 76.6 29 ns11 rs28381914 E16/1777C>T (R593C) R593 R594 R589 R601 R617 R632 R548 R630 T540 E543 R627 54.5 67.3 30 ns12 rs56107566 E16/1778G>A (R593H ) R593 R594 R589 R601 R617 R632 R548 R630 T540 E543 R627 54.5 67.3 31 s14 rs28381915 E16/1794C>T (I598I) I598 I599 I594 I606 I622 I637 I553 I635 I545 I548 I632 100.0 65.5 32 ns13 rs2235036 E16/1795G>A (A599T) A599 A600 A595 A607 I623 V638 C554 V636 V546 V549 F633 54.5 63.6 33 ns14 rs57001392 E16/1837G>T (D613Y) N-NBD (External) D613 D614 D609 S621 R637 Q652 E568 N650 R560 N563 D677 45.5 60.5 -0.0637E--807A516E896K496M176E856L366L266L)R266L(C>T5891/71E06975653sr-43 35 - rs35023033 E17/2005C>T (R669C) R669 R670 R665 R678 I702 D705 S662 T715 - - N743 0.0 - 36 - rs59340265 E17/2037C>T (D679D) D679 D680 D675 N688 D712 N715 S632 N725 - - E753 9.1 - 37 ns15 rs41316450 E18/2207T>A (I736K) TM7 I736 I737 V732 I745 M779 I771 V682 I820 I37 L48 V814 72.7 36.7 38 ns16 rs77144566 E19/2281A>C (A761S) TM8 A761 V763 I757 A769 V802 I796 G706 I844 I647 G655 L836 63.6 42.1 39 ns17 rs41305517 E21/2398G>A (D800N) C-NBD (Internal) D800 D801 D796 D808 H841 D835 E745 D883 S108 P112 E875 9.1 45.4 40 ns18 rs2235039 E21/2401G>A (V801M) C-NBD (External) V801 V802 V797 M809 I842 V836 V746 V884 A109 V113 M876 63.6 47.6 2.035.54409L931S531I219S447V468T078I738T528T038I928I)V928I(G>A5842/22E1852302sr91sn14 42 s15 rs28381966 E22/2505A>G (V835V) V835 V836 V831 L843 T876 T870 L780 T918 N141 T145 F911 45.5 33.0 43 ns20 rs28381967 E22/2506A>G (I836V) I836 I837 I832 I844 V877 I871 L781 V919 I142 V146 F911 63.6 28.5 7.448.18429M951M551I239L497I488D098I758I548I058I948I)M948I(G>A7452/22E03150163sr12sn44 45 s16 rs9282563 E22/2650C>T (L884L) L884 L885 L880 K892 V925 M919 R829 E967 R190 K194 I959 27.3 31.2 7.535.54289P302V991V679S838S829C439S109A988S498A398S)T/A398S(A/T>G7762/22E2852302sr22sn64 4.834.631801M203T892V5701F739G7201L5301T0001S889S399S299S)N299S(A>G5792/52E72194865sr32sn74 5.633.729801E903Q503T2801T449V4301Q2401A7001A599A0001A999A)T999A(A>G5992/52E48725527sr42sn84 49 s17 rs2235044 E26/3084G>A (P1028P) P1028 P1029 P1024 P1036 - P1063 P973 V1111 P332 V334 I1117 0.0 33.0 50 ns25 rs28401798 E26/3151C>G (P1051A) P1051 P1052 P1047 K1059 E1093 Q1086 I996 K1135 P355 P357 P1142 18.2 57.6 51 ns26 rs2707944 E26/3188G>C (G1063A) G1063 G1064 G1059 G1071 G1105 G1098 G1008 G1147 G367 G369 K1154 45.5 53.8 52 s18 rs2707943 E26/3189C>G (G1063G) G1063 G1064 G1059 G1071 G1105 G1098 G1008 G1147 G367 G369 K1154 45.5 53.8 53 ns27 rs74755520 E26/3222A>C (C1074W) C-NBD (Internal) C1074 C1075 C1070 C1082 C1116 C1109 S1019 C1158 G378 S380 S1165 63.6 67.8 54 ns28 rs57521326 E26/3262G>A (D1088N) D1088 D1089 D1084 D1096 D1130 D1123 D1033 D1172 D392 D394 D1179 100.0 53.9 55 ns29 rs41309225 E27/3295A>G (K1099E) K1099 K1100 K1095 I1107 S1141 C1134 R1044 V1183 H403 H405 I1237 18.2 38.5 56 ns30 rs55852620 E27/3320A>C (Q1107P) Q1107 Q1108 Q1103 Q1115 E1149 T1142 R1052 N1191 G411 A413 R1245 27.3 43.7 57 ns31 rs35730308 E27/3322T>C (W1108R) W1108 Q1109 W1104 Q1116 H1150 N1143 S1053 D1192 S412 S414 D1246 27.3 43.5 58 s19 rs34748655 E27/3396C>T (A1132A) C-NBD (Internal) A1132 A1133 A1128 A1140 I1174 S1167 M1077 V1216 L436 A438 K1270 27.3 56.8 59 ns32 rs41309228 E27/3410G>T (S1137I ) S1137 S1138 S1133 S1145 P1179 A1172 S1082 S1220 P440 E443 - 18.2 41.8 60 ns33 rs2229107 E27/3421T>A (S1141T) S1141 S1142 S1137 S1149 T1183 T1176 D1086 S1224 D444 R447 T1277 45.5 50.9 61 s20 rs1045642 E27/3435C>T (I1145I) C-NBD (Internal) I1145 I1146 I1141 I1153 V1187 I1180 I1090 M1228 V447 I450 V1281 72.7 57.6 62 ns34 rs59241388 E28/3502A>G (K1168E) K1168 R1169 R1164 R1176 R1210 R1203 C1113 L1251 E470 V473 N1304 27.3 61.9 63 ns35 rs41309231 E29/3669A>T (E1223D) E1223 E1224 E1219 E1231 E1265 E1258 V1168 Q1306 K525 K528 D1359 27.3 60.2 64 s21 rs2235051 E29/3747C>G (G1249G) C-NBD (Internal) G1249 G1250 G1245 G1257 G1291 G1284 G1194 G1332 G551 G554 T1392 63.6 63.0 65 ns36 rs45456698 E29/3751G>A (V1251I) V1251 V1252 V1247 V1259 I1293 V1286 V1196 I1334 I553 I556 V1394 81.8 59.2 4.957.279931T165T855T9331T1021N1921D8921T4621T2521T7521T6521T)K6521T(A>C7673/92E93412753sr73sn66 C-NBD (External) C-NBD (External) C-NBD (External) C-NBD (External) TM4 - TM9 TM10 - TM1 S. aureus TM12 N-NBD (Internal) N-NBD (External) N-NBD (Internal) C-NBD (External) TM3 C. elegans D. melanoga ster A. thaliana S. pombe # SNP (amino acid substitution) Mapped to Abcb1a domain (internal/external surface) rsNo Conservation (%)a H. Sapiens C. l. Familiaris M. Musculus G. gallus P. falciparum Amino acid residue housing SNP Individual Regional 3 structure E. coli a The conservation of residues corresponding to all coding regions SNPs was obtained following multiple sequence alignment of 11 confirmed ABCB1 homolog protein sequences. Login to comment
109 The evolutionary non-conserved E12/1199G4A (S400N), which alters drug pharmacokinetics and response, resides in an evolutionary conserved region SNP E12/1199G4A (S400N) (#ns9 in Figure 2b), which occurs at o4% in Caucasians and Africans but is not found in Asians (Supplementary Table 2) represents another nsSNP that has been associated with drug pharmacokinetics. Login to comment
110 Through cell-based experiments using limited substrates, Kimchi-Sarfaty et al.42 inferred that substrate specificity was not significantly influenced by the any of the nonsynonymous coding SNPs including S400N. Login to comment
113 Cellular uptake and permeability of five HIV protease inhibitors, especially ritonavir and saquinavir, was increased in cells carrying the minor allele.44 This SNP was also reported to confer resistance to vinblastine, vincristine, paclitaxel and etoposide, but not doxorubicin.45,46 Interestingly, a novel T allele of this SNP (E12/1199G4A (S400N)) coding for the amino acid, isoleucine (I), was identified in 2.3% of leukemia patients. Login to comment
116 Although only two patients with heterozygous (G/A) genotype were identified, their mean progression-free survival was only 2 months compared with 19 months for patients who are homozygous for the G allele.48 From the 3D crystal structure, this polymorphism (S400N) was found to lie in the same turn region between two b-sheets as Gly412, which corresponds to the codon housing the synonymous SNP E13/1236C4T (Figure 4b) (see flash movie at http://pfs.nus.edu.sg/demo_src/abcb1.html). Login to comment
125 This Figure 4 Location and conservation of (a) E8/554G4T (G185V), (b) E12/1199G4A (S400N), (c) E26/3151C4G (P1051A), (d) E27/3322T4C (W1108R), (e) E27/3421T4A (S1141T), (f) E29/3751G4A (V1251I). Login to comment
129 It resides within a turn region between two opposing b-sheets in an almost similar fashion to that of #ns9 E12/1199G4A (S400N) (Figure 4b), close to the well-conserved A-loop (Tyrosine 1040) and Walker A motif that is crucial for ATP activity.15,18 This residue has an individual conservation score of just 18.2% but have a regional conservation score of B60% (Table 1, Figure 4c) suggesting that during the evolution of the protein, there is also considerable tolerance of variation at this residue but not of the surrounding residues. Login to comment

[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]

Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6832 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/ Localization ABCB1 MDR1 A61G N21D ↔ N.D. T307C F103L N.D. N.D. G1199A S400N 1↔ Normal C2005T R669C ↔ N.D. G2677T A893S 21↔ Normal G2677A A893T 1↔ Notmal T3421A S1141T 2↔ N.D. C3435T I1145I 2↔ N.D. G3751A V1251I 2 N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment

[hide] Genetic association analysis of transporters ident... Pharmacogenet Genomics. 2012 Jun;22(6):447-65. Grover S, Gourie-Devi M, Bala K, Sharma S, Kukreti R
Genetic association analysis of transporters identifies ABCC2 loci for seizure control in women with epilepsy on first-line antiepileptic drugs.
Pharmacogenet Genomics. 2012 Jun;22(6):447-65., [PMID:22565165]

Abstract [show]
OBJECTIVE: The ATP-binding cassette (ABC) superfamily of transporters is known to efflux antiepileptic drugs (AEDs) primarily in the brain, gastrointestinal tract, liver, and kidneys. In addition, they are also known to be involved in estrogen disposition and may modulate seizure susceptibility and drug response. The objective of the present study was to investigate the role of genetic variants from ABC transporters in seizure control in epilepsy patients treated with monotherapy of first-line AEDs for 12 months. METHODS: On the basis of gene coverage and functional significance, a total of 98 single nucleotide polymorphisms from ABCB1, ABCC1, and ABCC2 were genotyped in 400 patients from North India. Of these, 216 patients were eligible for therapeutic assessment. Genetic variants were compared between the 'no-seizures' and the 'recurrent-seizures' groups. Bonferroni corrections for multiple comparisons and adjustment for covariates were performed before assessment of associations. RESULTS: Functionally relevant promoter polymorphisms from ABCC2: c.-1549G>A and c.-1019A>G either considered alone or in haplotype and diplotype combinations were observed for a significant association with seizure control in women (odds ratio>3.5, P<10, power>95%). Further, low protein-expressing CGT and TGT (c.-24C>T, c.1249G>A, c.3972C>T) haplotypes were always observed to be present in combination with the AG (c.-1549G>A, c.-1019A>G) haplotype that was over-represented in women with 'no seizures'. CONCLUSION: The distribution of the associated variants supports the involvement of ABCC2 in controlling seizures in women possibly by lowering of its expression. The biological basis of this finding could be an altered interaction of ABCC2 with AEDs and estrogens. These results necessitate replication in a larger pool of patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 - 330-21247T > C Intron 1 0.005 6 rs4148731 chr7:87239329 c.-330 - 8935C > T Intron 1 0.000 7 rs9282564 chr7:87229440 c.61A > G Exon 3 (Asn21Asp) 0.000 8 rs9282565 chr7:87214875 c.239C > A Exon 5 (Ala80Glu) 0.000 9 rs28381826 chr7:87214531 c.286 + 297G > A Intron 5 0.000 10 rs1989830 chr7:87205663 c.287 - 6124C > T Intron 5 0.135 11 rs2520464 chr7:87201086 c.287 - 1547A > G Intron 5 0.409 12 rs2235023 chr7:87190452 c.827+ 127G > A Intron 9 0.000 13 rs10276036 chr7:87180198 c.1000 - 44C > T Intron 10 0.401 14 rs2229109 chr7:87179809 c.1199G > A Exon 12 (Ser400Asn) 0.000 15 rs1128503 chr7:87179601 c.1236T > C Exon 13 (Gly412Gly) 0.390 16 rs2235036 chr7:87175271 c.1795G > A Exon 16 (Ala599Thr) 0.000 17 rs2235039 chr7:87165854 c.2401G > A Exon 21 (Val801Met) 0.000 18 rs2235040 chr7:87165750 c.2481 + 24G > A Intron 21 0.155 19 rs2032581 chr7:87160810 c.2485A > G Exon 22 (Ile829Val) 0.000 20 rs2032582 chr7:87160618 c.2677T/A > G Exon 22 (Ser/Thr893Ala) 0.318 21 rs7779562 chr7:87144816 c.3085 -72G > C Intron 25 0.043 22 rs2707944 chr7:87144641 c.3188C > G Exon 26 (Ala1063Gly) 0.000 23 rs2229107 chr7:87138659 c.3421A > T Exon 27 (Thr1141Ser) 0.000 24 rs1045642 chr7:87138645 c.3435T > C Exon 27 (Ile1145Ile) m Expression and activity [28] m mRNA expression [29] Altered substrate specificity [30] 0.375 25 rs2235048 chr7:87138511 c.3489 + 80C > T Intron 27 0.381 26 rs17064 chr7:87133470 c.3932A > T 30 UTR 0.000 ABCC1 1 rs504348 chr16:16043174 rs50438C > G Near gene region k Promoter activity [31] 0.135 2 rs215106 chr16:16047542 c.48 + 3886A > G Intron 1 0.210 3 rs215049 chr16:16070768 c.48 + 27112G > C Intron 1 0.245 4 rs246220 chr16:16082128 c.49 - 19545C > G Intron 1 0.118 5 rs119774 chr16:16086833 c.49 - 14840G > A Intron 1 0.089 6 rs246217 chr16:16090354 c.49 - 11319C > A Intron 1 0.118 7 rs2014800 chr16:16099966 c.49 - 1707C > T Intron 1 0.398 8 rs41494447 chr16:16101842 c.218C > T Exon 2 (Thr73Ile) 0.000 9 rs4781712 chr16:16103232 c.226 - 401A > G Intron 2 0.355 10 rs246240 chr16:16119024 c.616 -7942A > G Intron 5 0.114 11 rs924135 chr16:16123459 c.616 - 3507A > T Intron 5 0.412 12 rs903880 chr16:16130514 c.809 + 54C > A Intron 7 0.147 13 rs8187852 chr16:16139709 c.1057G > A Exon 9 (Met353Val) 0.000 14 rs35587 chr16:16139714 c.1062T > C Exon 9 (Asn354Asn) 0.182 15 rs35592 chr16:16141823 c.1219 - 176T > C Intron 9 0.172 16 rs60782127 chr16:16142079 c.1299G > T Exon 10 (Arg433Ser) k Transport of leukotriene C4 and estrone sulfate [32] 0.008 17 rs3765129 chr16:16149901 c.1474 - 48C > T Intron 11 0.032 18 rs35597 chr16:16158034 c.1678 - 3979G > A Intron 12 0.320 19 rs35621 chr16:16168608 c.1913 - 1575C > T Intron 14 0.103 20 rs45511401 chr16:16173232 c.2012G > T Exon 16 (Gly671Val) 0.024 21 rs4148356 chr16:16177275 c.2168G > A Exon 17 (Arg723Gln) 0.000 22 rs3851713 chr16:16184873 c.2644 + 428A > T Intron 19 0.340 23 rs2239995 chr16:16192565 c.2645 - 3919G > A Intron 19 0.324 24 rs11864374 chr16:16201885 c.2871 + 1155G > A Intron 21 0.338 25 rs35529209 chr16:16205325 c.2965G > A Exon 22 (Thr989Ala) k Transport of estradiol 17b-glucuronide [32] 0.000 26 rs3887893 chr16:16205501 c.3079 + 62G > A Intron 22 0.448 27 rs13337489 chr16:16208683 c.3140G > C Exon 23 (Ser1047Cys) 0.000 28 rs2299670 chr16:16220858 c.3819 + 1090A > G Intron 26 0.399 29 rs8057331 chr16:16230411 c.4202C > T Exon 29 (Thr1401Met) 0.000 30 rs212090 chr16:16236004 c.5462T > A 30 UTR 0.357 31 rs212093 chr16:16237754 rs212093G > A Near gene region 0.429 32 rs4148382 chr16:16238494 rs4148382G > A Near gene region 0.034 ABCC2 1 g.-1774G > delG chr10:101535688 g.-1774G > delG Near gene region k Promoter activity [33] 0.000 2 rs1885301 chr10:101541053 c.-1549G > A Near gene region k Promoter activity [haplotype containing (- 1549A)-(- 24T)] [33] k Clearance of irinotecan (ABCC2*2 containing the G allele) [34] 0.379 450 Pharmacogenetics and Genomics 2012, Vol 22 No 6 Table 2 (continued) N dbSNP ida Positionb Allelesc Gene location (effect) Function MAF 3 rs2804402 chr10:101541583 c. Login to comment

[hide] Donor age and ABCB1 1199G>A genetic polymorphism a... J Surg Res. 2012 Dec;178(2):988-95. doi: 10.1016/j.jss.2012.06.070. Epub 2012 Jul 20. De Meyer M, Haufroid V, Elens L, Fusaro F, Patrono D, De Pauw L, Kanaan N, Goffin E, Mourad M
Donor age and ABCB1 1199G>A genetic polymorphism are independent factors affecting long-term renal function after kidney transplantation.
J Surg Res. 2012 Dec;178(2):988-95. doi: 10.1016/j.jss.2012.06.070. Epub 2012 Jul 20., [PMID:22835948]

Abstract [show]
BACKGROUND: In renal tubular cells, cytochrome P4503A enzyme and adenosine triphosphate-binding cassette transporter activities result in intracellular drug or metabolite exposure variability, depending on genetic polymorphisms. Our aim was to establish whether long-term renal function is affected by genetic polymorphisms in biotransformation enzymes and drug transporters of the donor after kidney transplantation. MATERIALS AND METHODS: The study was conducted in a selected cohort of 97 kidney recipients. Genotyping of donors was performed on renal biopsy samples obtained before transplantation. Serum creatinine levels and Cockcroft-Gault estimated glomerular filtration rate were considered 1 y after transplantation and at the last follow-up. RESULTS: Long-term function was significantly better in recipients of an organ from donors carrying the ABCB1 1199A mutated allele (median and range creatinine values were 1.1 mg/dL [0.8-1.5mg/dL] in case of at least one ABCB1 1199A allele versus 1.5 mg/dL [0.7-3.7 mg/dL] for homozygous carriers of wild-type allele, P < 0.01). ABCB1 1199G>A polymorphism and donor age had an independent impact on both serum creatinine and estimated glomerular filtration rate. Unlike donor age, the mutated ABCB1 1199A allele was found to have a protective effect on renal function. CONCLUSIONS: Donor age and ABCB1 1199G>A polymorphism affect long-term renal function after transplantation. Analysis of genetic factors offers a promising approach to calcineurin inhibitor toxicity risk assessment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
209 [20] Woodahl EL, Crouthamel MH, Bui T, et al. MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents. Login to comment
205 [20] Woodahl EL, Crouthamel MH, Bui T, et al. MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents. Login to comment

[hide] Emerging new technologies in Pharmacogenomics: rap... Pharmacol Ther. 2010 Apr;126(1):69-81. Epub 2010 Feb 4. Ishikawa T, Sakurai A, Hirano H, Lezhava A, Sakurai M, Hayashizaki Y
Emerging new technologies in Pharmacogenomics: rapid SNP detection, molecular dynamic simulation, and QSAR analysis methods to validate clinically important genetic variants of human ABC Transporter ABCB1 (P-gp/MDR1).
Pharmacol Ther. 2010 Apr;126(1):69-81. Epub 2010 Feb 4., [PMID:20138191]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters as well as drug-metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and, by extension, their overall pharmacological effects. There are an increasing number of reports addressing genetic polymorphisms of drug transporters. A key requirement for the development of individualized medicine or personalized therapy is the ability to rapidly and conveniently test patients for genetic polymorphisms and/or mutations. We have recently developed a rapid and cost-effective method for single nucleotide polymorphism (SNP) detection, named Smart Amplification Process 2 (SmartAmp2), which enables us to detect genetic polymorphisms or mutations in 30 to 45min under isothermal conditions without DNA isolation and PCR amplification. Furthermore, high-speed functional screening, quantitative structure-activity relationship (QSAR) analysis, and molecular dynamic (MD) simulation methods have been developed to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function and substrate specificity. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. This review addresses such new methods for validating genetic polymorphisms of human ABC transporter ABCB1 (P-gp/MDR1) which is critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
478 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
500 SNP Km Vmax Vmax / Km (µM) (nmol/min/mg protein) WT 5.8±2.3 62.4±7.8 10.8 S400N 5.8±2.8 46.7±5.3⁎⁎ 8.0 R492C 5.6±1.9 49.6±10.0⁎ 8.9 R669C 3.2±1.6⁎ 64.7±6.9 20.1 I849M 1.5±0.7⁎⁎ 80.3±9.5⁎⁎ 51.8 A893P 1.5±0.5⁎⁎ 405.2±16.5⁎⁎ 274.6 A893S 11.1±5.4 43.1±7.1⁎⁎ 3.9 A893T 4.3±1.4 98.9±9.5⁎⁎ 22.9 M986V 5.1±1.1 114.9±13.6⁎⁎ 22.5 A999T 2.0±0.8⁎⁎ 143.1±21.2⁎⁎ 70.9 P1051A 6.2±3.0 52.1±13.6 8.4 G1063A 6.2±3.7 117.9±16.4⁎⁎ 19.0 Data are expressed as mean±S.D., n=6. Login to comment
533 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment
476 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
498 SNP Km Vmax Vmax / Km (&#b5;M) (nmol/min/mg protein) WT 5.8&#b1;2.3 62.4&#b1;7.8 10.8 S400N 5.8&#b1;2.8 46.7&#b1;5.3Ìe;Ìe; 8.0 R492C 5.6&#b1;1.9 49.6&#b1;10.0Ìe; 8.9 R669C 3.2&#b1;1.6Ìe; 64.7&#b1;6.9 20.1 I849M 1.5&#b1;0.7Ìe;Ìe; 80.3&#b1;9.5Ìe;Ìe; 51.8 A893P 1.5&#b1;0.5Ìe;Ìe; 405.2&#b1;16.5Ìe;Ìe; 274.6 A893S 11.1&#b1;5.4 43.1&#b1;7.1Ìe;Ìe; 3.9 A893T 4.3&#b1;1.4 98.9&#b1;9.5Ìe;Ìe; 22.9 M986V 5.1&#b1;1.1 114.9&#b1;13.6Ìe;Ìe; 22.5 A999T 2.0&#b1;0.8Ìe;Ìe; 143.1&#b1;21.2Ìe;Ìe; 70.9 P1051A 6.2&#b1;3.0 52.1&#b1;13.6 8.4 G1063A 6.2&#b1;3.7 117.9&#b1;16.4Ìe;Ìe; 19.0 Data are expressed as mean&#b1;S.D., n=6. Login to comment
502 Descriptor Coefficients (95% reliability) for ABCB1 WT and vatiants WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 (3.76) 21.2 (5.81) 18.5 (5.87) 35.9 (7.68) 52.7 (11.30) 169.8 (18.84) 14.0 (4.03) 61.2 (7.75) 39.4 (8.76) 63.0 (9.39) 13.9 (4.78) 52.1 (10.94) M132 21.5 (3.89) 14.1 (5.34) 13.6 (5.78) 32.8 (6.89) 61.4 (12.66) 135.6 (22.95) 11.2 (4.06) 52.8 (7.16) 38.2 (8.62) 65.9 (8.44) 7.6 (5.71) 24.3 (10.46) C-CHN-BT 3.3 (0.72) 3.8 (0.95) 1.7 (0.87) 3.5 (1.08) 5.7 (1.55) 11.6 (2.48) 1.2 (0.65) 6.1 (1.29) 7.1 (1.43) 7.3 (1.44) 2.0 (0.66) 2.8 (1.86) ESTR -10.1 (4.93) -12.5 (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 (7.86) -4.4 (1.73) RT -8.9 (4.21) -17.7 (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 (3.69) -11.7 (5.30) -7.7 (3.70) -22.8 (8.75) -16.4 (8.19) -16.5 (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 (5.46) 14.4 (7.91) M392 73.3 (25.03) 10.3 (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 (4.01) 24.0 (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) Const. Login to comment
534 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment

[hide] Comparative description of haplotype structure and... Infect Genet Evol. 2010 Jan;10(1):60-7. Epub 2009 Oct 9. Benish RL, Rodriguez B, Zimmerman PA, Mehlotra RK
Comparative description of haplotype structure and genetic diversity of MDR1 (ABCB1) in HIV-positive and HIV-negative populations.
Infect Genet Evol. 2010 Jan;10(1):60-7. Epub 2009 Oct 9., [PMID:19819348]

Abstract [show]
Human P-glycoprotein (P-gp), encoded by MDR1 (ABCB1), is an efflux transporter with a wide specificity for substrates/drugs, including HIV protease inhibitors which are commonly used in HIV/AIDS treatment. Three single nucleotide polymorphisms (SNPs) in MDR1 have been shown to affect P-gp expression and function, and may affect HIV/AIDS treatment outcome: 1236C>T [G412G, exon-12], 2677G>T/A [A893S/T, exon-21] and 3435C>T [I1145I, exon-26]. In the present study, our aims were (i) to compare the 3-SNP MDR1 haplotype structure and genetic diversity between North American HIV-positive and HIV-negative individuals belonging to four major ethnic groups and (ii) to determine whether the haplotype structure and genetic diversity observed in these ethnically admixed populations differ from that in ethnically non-admixed populations. For these aims, we analyzed a cohort of 447 HIV/AIDS patients (White [n=193], Black [n=235], Hispanic [n=17], and Asian [n=2]). Results obtained for these patients were compared with the results for (i) HIV-negative individuals (n=356) and (ii) various HapMap and Environmental Genome Project populations. We observed that the genetic characteristics of MDR1 were largely consistent between HIV-positive and HIV-negative populations, but there were striking interethnic differences in the genetic characteristics of MDR1 in both populations. Although it appeared that the genetic characteristics of MDR1 were largely consistent between ethnically admixed and non-admixed populations, genetic characterization of the admixed populations remains to be done. Thus, our results provide useful comparative insights about the genetic characteristics of MDR1 that could be extrapolated across population groups worldwide. For a meaningful interpretation of these results regarding HIV/AIDS treatment outcome, MDR1 haplotype/diplotype structure data, genetic characterization of population admixture, and polymorphisms in other relevant drug transporter and/or metabolizing enzyme genes should be considered in future clinical studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
155 Thus, it is important to determine whether these interethnic genetic differences in MDR1, together with other potentially significant polymorphisms in the MDR1 coding, 1199G>A (Ser400Asn) (Woodahl et al., 2005), 571G>A (Gly191Arg) (Yang et al., 2008), and 3421T>A (Ser1141Thr) (Kroetz et al., 2003), as well as regulatory regions (Taniguchi et al., 2003; Loeuillet et al., 2007), are associated with different outcomes of protease inhibitor-based HIV/AIDS treatment. Login to comment

[hide] A synonymous polymorphism in a common MDR1 (ABCB1)... Biochim Biophys Acta. 2009 May;1794(5):860-71. Epub 2009 Mar 11. Fung KL, Gottesman MM
A synonymous polymorphism in a common MDR1 (ABCB1) haplotype shapes protein function.
Biochim Biophys Acta. 2009 May;1794(5):860-71. Epub 2009 Mar 11., [PMID:19285158]

Abstract [show]
The MDR1 (ABCB1) gene encodes a membrane-bound transporter that actively effluxes a wide range of compounds from cells. The overexpression of MDR1 by multidrug-resistant cancer cells is a serious impediment to chemotherapy. MDR1 is expressed in various tissues to protect them from the adverse effect of toxins. The pharmacokinetics of drugs that are also MDR1 substrates also influence disease outcome and treatment efficacy. Although MDR1 is a well-conserved gene, there is increasing evidence that its polymorphisms affect substrate specificity. Three single nucleotide polymorphisms (SNPs) occur frequently and have strong linkage, creating a common haplotype at positions 1236C>T (G412G), 2677G>T (A893S) and 3435C>T (I1145I). The frequency of the synonymous 3435C>T polymorphism has been shown to vary significantly according to ethnicity. Existing literature suggests that the haplotype plays a role in response to drugs and disease susceptibility. This review summarizes recent findings on the 3435C>T polymorphism of MDR1 and the haplotype to which it belongs. A possible molecular mechanism of action by ribosome stalling that can change protein structure and function by altering protein folding is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
152 A study in our lab showed that common polymorphisms of MDR1 at 61ANG (N21D), 307TNC (F103L), 1199GNA (S400N), 2677GNT (A893S) and 2995GNA (A999T) do not change the transport of four MDR1 substrates when expressed at high levels in human cells [66]. Login to comment
153 A recent study by Gow et al. suggested that all of the SNPs they tested (N21D, S400N, R669C, A893S, A893T, S1141T, V1251I) produced small changes which in most cases are not statistically significant [59]. Login to comment
342 Several amino acid residues around this SNP (e.g., Y401, S400N) are essential for ATP-binding and ATP hydrolysis [42,49]. Login to comment
151 A study in our lab showed that common polymorphisms of MDR1 at 61ANG (N21D), 307TNC (F103L), 1199GNA (S400N), 2677GNT (A893S) and 2995GNA (A999T) do not change the transport of four MDR1 substrates when expressed at high levels in human cells [66]. Login to comment
341 Several amino acid residues around this SNP (e.g., Y401, S400N) are essential for ATP-binding and ATP hydrolysis [42,49]. Login to comment

[hide] Implications of genetic polymorphisms in drug tran... Cancer Lett. 2006 Mar 8;234(1):4-33. Epub 2006 Feb 28. Kerb R
Implications of genetic polymorphisms in drug transporters for pharmacotherapy.
Cancer Lett. 2006 Mar 8;234(1):4-33. Epub 2006 Feb 28., [PMID:16504381]

Abstract [show]
Drug transporters are increasingly recognized as a key determinant of drug disposition and response. It is now widely appreciated that expression of the ATP-dependent efflux transporter, MDR1 (ABCB1, P-glycoprotein), in organs such as the gastrointestinal tract, liver and kidney significantly alters the extent of drug absorption and excretion. Moreover, expression of MDR1 at the level of the blood-brain barrier limits the entry of many drugs into the central nervous system. Given such an important role of MDR1 in the drug disposition process, it is not surprising to see increasing focus on the role of single nucleotide polymorphisms (SNPs) in this transporter as a potential determinant of interindividual variability in drug disposition and pharmacological response. However, drug transport is often the result of the concerted action of efflux and uptake pumps located both in the basolateral and apical membranes of epithelial cells. A growing list of membrane-spanning proteins involved in the in- or outward transport of a large variety of drugs has been recognized and characterized over the past few years in almost all tissues, including organic anion and cation transporters (OAT, OCT, solute carrier family SLC22A), organic anion transport proteins (OATP, solute carrier family SLCO, formerly SLC21A), and MRPs (ABCCs), other members of the ATP-binding cassette family. We are just beginning to appreciate their role for drug delivery and disposition and the contribution of genetic polymorphisms in these transport proteins to interindividual variability in the efficacy and safety for pharmacotherapy. This review summarizes the consequences of inherited differences in drug transport for pharmacotherapy. With the main focus on ABCB1, an update of recent advances is given and clinically relevant examples are used to illustrate how heritable differential drug transport can help to explain individual variability in drug response. The pharmacogenetics of other transporters is briefly introduced.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 Table 3 Overview of the 15 most common ABCB1 (MDR1) genetic variants Position Location Effect Allelic frequency (%) CA AS AA K129TOC 50 UTR Non-coding 5 4 7 K1GOA 50 UTR Non-coding 8 5 0 61AOG Exon 2 Asn21Asp 8 2 2.5 Exon 5-25GOT Intron 4 16 7 30 Exon 10-44AOG Exon 10 Intron 9 45 69 26 1199GOA Exon 11 Ser400Asn 2.5 0 !1 1236COT Exon 12 Synonymous 46 69 21 Exon 11C44COT Intron 12 5 0 17 Exon 12C24COT Intron 13 52 54 54 Exon 13C38AOG Intron 14 50 68 54 Exon 19C24GOA Intron 20 12 7 15 2677GOT/A Exon 21 Ala893Ser/Thr 46/2 45/7 O1 3421TOA Exon 26 Ser1141Thr 0 0 10 3435COT Exon 26 Synonymous 56 40 10 IVSC21TOC Intron 28 0 8 0 AA, African American; AS, Asian; CA, Caucasian. Login to comment
75 Table 3 Overview of the 15 most common ABCB1 (MDR1) genetic variants Position Location Effect Allelic frequency (%) CA AS AA K129TOC 50 UTR Non-coding 5 4 7 K1GOA 50 UTR Non-coding 8 5 0 61AOG Exon 2 Asn21Asp 8 2 2.5 Exon 5-25GOT Intron 4 16 7 30 Exon 10-44AOG Exon 10 Intron 9 45 69 26 1199GOA Exon 11 Ser400Asn 2.5 0 !1 1236COT Exon 12 Synonymous 46 69 21 Exon 11C44COT Intron 12 5 0 17 Exon 12C24COT Intron 13 52 54 54 Exon 13C38AOG Intron 14 50 68 54 Exon 19C24GOA Intron 20 12 7 15 2677GOT/A Exon 21 Ala893Ser/Thr 46/2 45/7 O1 3421TOA Exon 26 Ser1141Thr 0 0 10 3435COT Exon 26 Synonymous 56 40 10 IVSC21TOC Intron 28 0 8 0 AA, African American; AS, Asian; CA, Caucasian. Login to comment

[hide] MDR1 gene polymorphisms and clinical relevance. Yi Chuan Xue Bao. 2006 Feb;33(2):93-104. Li YH, Wang YH, Li Y, Yang L
MDR1 gene polymorphisms and clinical relevance.
Yi Chuan Xue Bao. 2006 Feb;33(2):93-104., [PMID:16529292]

Abstract [show]
In vivo and in vitro studies have demonstrated that P-glycoprotein (P-gp) plays a very significant role in the ADME processes (absorption, distribution, metabolism, excretion) and drug-drug interaction (DDI) of drugs in humans. P-gp is the product of multidrug resistance gene (MDR1/ABCB1). Pharmacogenomics and pharmacogenetics studies have revealed that genetic polymorphisms of MDR1 are associated with alteration in P-gp expression and function in different ethnicities and subjects. By now, 50 single nucleotide polymorphisms (SNPs) and 3 insertion/deletion polymorphisms have been found in the MDR1 gene. Some of them, such as C3435T, have been identified to be a risk factor for numerous diseases. It is believed that further understanding of the physiology and biochemistry of P-gp with respect to its genetic variations may be important for individualized pharmacotherapy. Therefore, based on the latest public information and our studies, this review focuses on the following four aspects: 1) the impact of P-gp on pharmacokinetics; 2) MDR1 genetic polymorphisms and their impacts on pharmacogenetics; 3) relationship between altered P-gp expression and function and the MDR1(C3435T) SNP, and 4) relevance of MDR1 polymorphisms to certain human diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp . Login to comment
46 The 16.18.19,35] B@%fW Acta Genetica Sinica Vo1.33 No.2 2006 nonsynonymous G1199A (Ser400Asn) in exon 11 brings about a significant size change, and depending on the pH and isoelectric environment of the residue, may lead to a charge change in the protein. Login to comment
52 Furthermore, Kimchi-Sarfaty and his colleagues carried out a study to characterize the functional consequences of five coding SNPs (Asn21Asp,Phel03Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system, but it was found that the distribution and function of P-gp in the cells were similar to wild-type P-gp in the human body'431.The mechanism of these contradictory results regarding the C2677T/A and C3435T polymorphisms function is unclear until now. Login to comment
49 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp . Login to comment
54 The 16.18.19,35] B@%fW Acta Genetica Sinica Vo1.33 No.2 2006 nonsynonymous G1199A (Ser400Asn) in exon 11 brings about a significant size change, and depending on the pH and isoelectric environment of the residue, may lead to a charge change in the protein. Login to comment
64 Furthermore, Kimchi-Sarfaty and his colleagues carried out a study to characterize the functional consequences of five coding SNPs (Asn21Asp,Phel03Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system, but it was found that the distribution and function of P-gp in the cells were similar to wild-type P-gp in the human body'431.The mechanism of these contradictory results regarding the C2677T/A and C3435T polymorphisms function is unclear until now. Login to comment

[hide] The influence of MDR1 polymorphisms on P-glycoprot... Adv Drug Deliv Rev. 2002 Nov 18;54(10):1295-310. Fromm MF
The influence of MDR1 polymorphisms on P-glycoprotein expression and function in humans.
Adv Drug Deliv Rev. 2002 Nov 18;54(10):1295-310., [PMID:12406646]

Abstract [show]
The MDR1 (ABCB1) gene product P-glycoprotein is a membrane protein, which functions as an ATP-dependent exporter of xenobiotics from cells. Its importance was first recognized because of its role in the development of multidrug resistance (MDR) of cultured tumor cells against various anticancer agents. It is now, however, well established that this transporter is not only expressed in tumor cells, but also in normal tissues with excretory function (intestine, liver, kidney). Since P-glycoprotein has a very broad substrate specificity, it determines disposition of a broad variety of drugs. Moreover, induction and inhibition of P-glycoprotein are new mechanisms for drug interactions in humans. Very recently, systematic screens of the MDR1 gene have identified multiple single nucleotide polymorphisms. Some of those appear to be associated with altered transporter function and expression. This review discusses the currently available data on the influence of MDR1 polymorphisms on P-glycoprotein tissue expression, drug disposition, treatment outcome and disease risk.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 The G1199A mutation (Ser400Asn) is located- ondansetron [30] - losartan [83] - morphine [68] in the cytoplasmic loop close to the first ATP- Antidiarrheal agents - phenytoin [30] binding domain. The most frequent SNP (G2677T/ - loperamide [30] - rifampin [41] A) leading to amino acid exchanges from Ala to Ser Table 3 Summary of currently known MDR1 genetic variants in Caucasians [ Location Position Allele Effect Allelic Genotype Genotype Ref. Frequency Frequency (%) (%) 1 exon 1b exon 1b/12 T 94.1 T/T 88.2 [21] C 5.9 T/C 11.8 C/C 0.0 2 intron 1 Exon 2-1 G initiation 91.0 G/G 82.0 [21-23] A of 9.0 G/A 18.0 translation A/A 0.0 3 exon 2 cDNA 61 A 21 Asn 88.8 A/A 78.5 [21-23,84] G 21 Asp 11.2 A/G 20.6 G/G 0.9 4 intron 4 exon 5-35 G 99.4 G/G 98.8 [21] C 0.6 G/C 1.2 C/C 0.0 5 intron 4 exon 5-25 G 83.5 G/G 70.5 [21] T 16.5 G/T 26.0 T/T 3.5 6 intron 6 exon 6 1 139 C 62.8 C/C 39.0 [21,22] T 37.2 C/T 47.5 T/T 13.4 7 intron 6 exon 6 1 145 C 98.8 C/C 97.6 [21] T 1.2 C/T 2.4 T/T 0.0 8 exon 7 cDNA 548 A 183 Asn 98.6 A/A n.a. [23] G 183 Ser 1.4 A/G n.a. G/G n.a. 9 exon 11 cDNA 1199 G 400 Ser 94.5 G/G 88.9 [21-23] A 400 Asn 5.5 G/A 11.1 A/A 0.0 10 exon 12 cDNA 1236 C wobble 59.0 C/C 34.4 [21-23] T 41.0 C/T 49.2 T/T 16.4 11 intron 12 exon 12 1 44 C 95.1 C/C 90.2 [21,22] T 4.9 C/T 9.8 T/T 0.0 12 exon 13 cDNA 1474 C 492Arg 98.6 C/C n.a. [23] T 492Cys 1.4 C/T n.a. T/T n.a. 13 intron 16 exon 17-76 T 53.8 T/T 28.4 [21,22] A 46.2 T/A 50.8 A/A 20.8 14 intron 17 exon 17 1 137 A 99.4 A/A 98.8 [21] G 0.6 A/G 1.2 G/G 0.0 15 exon 21 cDNA2650 C wobble 97.3 C/C n.a. [23] T 2.7 C/T n.a. T/T n.a. 16 exon 21 cDNA 2677 G 893 Ala 56.5 G/G 30.9 [22,23] T 893 Ser 41.6 G/T 49.2 A 893 Thr 1.9 T/T 16.1 G/A 2.0 T/A 1.8 A/A 0.0 Table 3. Login to comment

[hide] Effect of levothyroxine administration on intestin... Clin Pharmacol Ther. 2002 Sep;72(3):256-64. Siegmund W, Altmannsberger S, Paneitz A, Hecker U, Zschiesche M, Franke G, Meng W, Warzok R, Schroeder E, Sperker B, Terhaag B, Cascorbi I, Kroemer HK
Effect of levothyroxine administration on intestinal P-glycoprotein expression: consequences for drug disposition.
Clin Pharmacol Ther. 2002 Sep;72(3):256-64., [PMID:12235446]

Abstract [show]
OBJECTIVE: Thyroid function alters the pharmacokinetics of many drugs; one example is the cardiac glycoside digoxin. Because digoxin disposition is affected by intestinal expression of P-glycoprotein, we hypothesized that thyroid hormones may regulate P-glycoprotein and influence disposition of P-glycoprotein substrates. METHODS: Duodenal expression of P-glycoprotein measured by reverse transcriptase-polymerase chain reaction of MDR1 messenger ribonucleic acid (mRNA) and by immunohistochemical examination was studied in 8 healthy volunteers (4 men and 4 women; age range, 22-29 years; body weight, 59-89 kg) before and after coadministration with levothyroxine (200 microg orally for 17 days), which resulted in suppression of thyroid-stimulating hormone. The pharmacokinetics of the P-glycoprotein substrate talinolol was assessed after intravenous (30 mg) and oral (100 mg) administration. RESULTS: Duodenal MDR1 mRNA expression and immunoreactive P-glycoprotein were increased 1.4-fold (not significant; P =.078) and 3.8-fold (P <.01), respectively, after administration of levothyroxine. The changes in P-glycoprotein expression were associated with minor alterations in talinolol half-life after both oral and intravenous administration. CONCLUSIONS: Expression of intestinal P-glycoprotein in humans appears to be influenced by thyroid hormones. The functional consequences need to be addressed in patients with hyperthyroidism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 MDR1 genotyping The following 10 most frequent or putatively functional single nucleotide polymorphisms of the MDR1 gene were identified as described recently: exon 2 G-1A, A61G (amino acid exchange Asn21Asp), T307C (Phe103Leu), exon 6 Cϩ139T, G1199A (Ser400Asn), C1236T, exon 17 T-76A, G2677T/A (Ala893Ser/Thr), and C3435T.18 In brief, the deoxyribonucleic acid (DNA) of venous blood was extracted by use of a standard phenol-chloroform procedure. Login to comment

[hide] Pharmacogenetics of the human drug-transporter gen... Drug Discov Today. 2001 Aug 15;6(16):835-839. Brinkmann U, Roots I, Eichelbaum M
Pharmacogenetics of the human drug-transporter gene MDR1: impact of polymorphisms on pharmacotherapy.
Drug Discov Today. 2001 Aug 15;6(16):835-839., [PMID:11495756]

Abstract [show]
The blood- and tissue-concentrations, and thus the activity, of many drugs are influenced by factors that are subject to inter-individual variation. Variables that influence blood levels are metabolizing enzymes and transporters. Transporters control drug uptake, distribution and elimination. Transport by efflux pumps such as MDR1-encoded P-glycoprotein can influence the bioavailability of drugs. Knowledge of the transporter 'status' might allow for compensation of differences in drug uptake, such as by dose adjustment, which is important for drugs with narrow therapeutic windows. So far, intestinal expression of MDR1 has been determined by cumbersome methods, such as biopsies, although recently a functional polymorphism has been identified, which discriminates individual high or low-expressor alleles. As a result, clinical trials and therapy can be adapted to the 'MDR1-status' of individual patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Single nucleotide polymorphisms (SNPs) in the MDR1 gene SNP Region Number Frequency of SNPsa [%] Effect Heterozygous Homozygous Observed Estimated T-12C E1 85 11.8 0 0.4 Non-coding G-1A E2 188 11.2 0 0.4 Translation initiation A61G E2 188 17.6 0.5 0.81 Asn21Asp G-25T I4 85 26.0 3.5 2.3 G-35C I4 85 1.2 0 0.01 T307C E5 85 1.2 0 0.01 Phe103Leu C+139T I5 85 48.2 16.5 16.8 C+145T I5 85 2.4 0 0.01 G1199A E11 85 12.9 0 0.4 Ser400Asn C1236T E12 188 48.9 13.3 14.4 Gly412Gly C+44T I12 188 11.7 0 0.4 T-76A I16 85 45.9 22.4 20.3 A+137G I17 85 1.2 0 0.01 G2677T E21 83b 43.4 42.2 38.4 Ala893Ser G2995A E24 36b 11.1 0 Ala999Thr C3435T E26 537 47.7 26.4 24.1 Ile1145Ile C3396T E26 188 0.53 0 0.01 Wobble aMDR1 sequences Genbank (gb) accession numbers AC002457 and AC005068 are defined as wildtype. Login to comment

[hide] Genetic variability in drug transport, metabolism ... BMC Pharmacol Toxicol. 2015 Feb 27;16:2. doi: 10.1186/s40360-015-0001-5. Lambrechts S, Lambrechts D, Despierre E, Van Nieuwenhuysen E, Smeets D, Debruyne PR, Renard V, Vroman P, Luyten D, Neven P, Amant F, Leunen K, Vergote I
Genetic variability in drug transport, metabolism or DNA repair affecting toxicity of chemotherapy in ovarian cancer.
BMC Pharmacol Toxicol. 2015 Feb 27;16:2. doi: 10.1186/s40360-015-0001-5., [PMID:25881102]

Abstract [show]
BACKGROUND: This study aimed to determine whether single nucleotide polymorphisms (SNPs) in genes involved in DNA repair or metabolism of taxanes or platinum could predict toxicity or response to first-line chemotherapy in ovarian cancer. METHODS: Twenty-six selected SNPs in 18 genes were genotyped in 322 patients treated with first-line paclitaxel-carboplatin or carboplatin mono-therapy. Genotypes were correlated with toxicity events (anemia, neutropenia, thrombocytopenia, febrile neutropenia, neurotoxicity), use of growth factors and survival. RESULTS: The risk of anemia was increased for variant alleles of rs1128503 (ABCB1, C > T; p = 0.023, OR = 1.71, 95% CI = 1.07-2.71), rs363717 (ABCA1, A > G; p = 0.002, OR = 2.08, 95% CI = 1.32-3.27) and rs11615 (ERCC1, T > C; p = 0.031, OR = 1.61, 95% CI = 1.04-2.50), while it was decreased for variant alleles of rs12762549 (ABCC2, C > G; p = 0.004, OR = 0.51, 95% CI = 0.33-0.81). Likewise, increased risk of thrombocytopenia was associated with rs4986910 (CYP3A4, T > C; p = 0.025, OR = 4.99, 95% CI = 1.22-20.31). No significant correlations were found for neurotoxicity. Variant alleles of rs2073337 (ABCC2, A > G; p = 0.039, OR = 0.60, 95% CI = 0.37-0.98), rs1695 (ABCC1, A > G; p = 0.017, OR = 0.55, 95% CI 0.33-0.90) and rs1799793 (ERCC2, G > A; p = 0.042, OR = 0.63, 95% CI 0.41-0.98) associated with the use of colony stimulating factors (CSF), while rs2074087 (ABCC1, G > C; p = 0.011, OR = 2.09, 95% CI 1.18-3.68) correlated with use of erythropoiesis stimulating agents (ESAs). Homozygous carriers of the rs1799793 (ERCC2, G > A) G-allele had a prolonged platinum-free interval (p = 0.016). CONCLUSIONS: Our data reveal significant correlations between genetic variants of transport, hepatic metabolism, platinum related detoxification or DNA damage repair and toxicity or outcome in ovarian cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 rs2229109,c.1199G>A, Ser400Asn Variant allele carriers: correlation with in vitro resistance to paclitaxel [22]. Login to comment

[hide] The MDR1 (ABCB1) gene polymorphism and its clinica... Clin Pharmacokinet. 2004;43(9):553-76. Ieiri I, Takane H, Otsubo K
The MDR1 (ABCB1) gene polymorphism and its clinical implications.
Clin Pharmacokinet. 2004;43(9):553-76., [PMID:15217301]

Abstract [show]
There has been an increasing appreciation of the role of drug transporters in the pharmacokinetic and pharmacodynamic profiles of certain drugs. Among various drug transporters, P-glycoprotein, the MDR1 gene product, is one of the best studied and characterised. P-glycoprotein is expressed in normal human tissues such as liver, kidney, intestine and the endothelial cells of the blood-brain barrier. Apical (or luminal) expression of P-glycoprotein in these tissues results in reduced drug absorption from the gastrointestinal tract, enhanced drug elimination into bile and urine, and impeded entry of certain drugs into the central nervous system. The clinical relevance of P-glycoprotein depends on the localisation in human tissues (i.e. vectorial or directional movement), the therapeutic index of the substrate drug and the inherent inter- and intra-individual variability. With regard to the variability, polymorphisms of the MDR1 gene have recently been reported to be associated with alterations in disposition kinetics and interaction profiles of clinically useful drugs, including digoxin, fexofenadine, ciclosporin and talinolol. In addition, polymorphism may play a role in patients who do not respond to drug treatment. Moreover, P-glycoprotein is an important prognostic factor in malignant diseases, such as tumours of the gastrointestinal tract.A growing number of preclinical and clinical studies have demonstrated that polymorphism of the MDR1 gene may be a factor in the overall outcome of pharmacotherapy for numerous diseases. We believe that further understanding the physiology and biochemistry of P-glycoprotein with respect to its genetic variations will be important to establish individualised pharmacotherapy with various clinically used drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
162 [94] Recently, a new mechanism for the drug- Sarfaty et al.[89] also investigated functional conse- grapefruit juice interaction has been reported; the quences of MDR1 polymorphisms (Asn21Asp, bioavailability and serum concentrations of fex- Phe103Leu, Ser400Asn, Ala893Ser, and ofenadine were reduced when grapefruit juice was Ala998Thr) using a vaccinia virus-based transient taken. Login to comment

[hide] Genetic polymorphisms of drug-metabolising enzymes... Clin Pharmacokinet. 2006;45(3):253-85. Bosch TM, Meijerman I, Beijnen JH, Schellens JH
Genetic polymorphisms of drug-metabolising enzymes and drug transporters in the chemotherapeutic treatment of cancer.
Clin Pharmacokinet. 2006;45(3):253-85., [PMID:16509759]

Abstract [show]
There is wide variability in the response of individuals to standard doses of drug therapy. This is an important problem in clinical practice, where it can lead to therapeutic failures or adverse drug reactions. Polymorphisms in genes coding for metabolising enzymes and drug transporters can affect drug efficacy and toxicity. Pharmacogenetics aims to identify individuals predisposed to a high risk of toxicity and low response from standard doses of anti-cancer drugs. This review focuses on the clinical significance of polymorphisms in drug-metabolising enzymes (cytochrome P450 [CYP] 2C8, CYP2C9, CYP2C19, CYP2D6, CYP3A4, CYP3A5, dihydropyrimidine dehydrogenase, uridine diphosphate glucuronosyltransferase [UGT] 1A1, glutathione S-transferase, sulfotransferase [SULT] 1A1, N-acetyltransferase [NAT], thiopurine methyltransferase [TPMT]) and drug transporters (P-glycoprotein [multidrug resistance 1], multidrug resistance protein 2 [MRP2], breast cancer resistance protein [BCRP]) in influencing efficacy and toxicity of chemotherapy. The most important example to demonstrate the influence of pharmacogenetics on anti-cancer therapy is TPMT. A decreased activity of TPMT, caused by genetic polymorphisms in the TPMT gene, causes severe toxicity with mercaptopurine. Dosage reduction is necessary for patients with heterozygous or homozygous mutation in this gene. Other polymorphisms showing the influence of pharmacogenetics in the chemotherapeutic treatment of cancer are discussed, such as UGT1A1*28. This polymorphism is associated with an increase in toxicity with irinotecan. Also, polymorphisms in the DPYD gene show a relation with fluorouracil-related toxicity; however, in most cases no clear association has been found for polymorphisms in drug-metabolising enzymes and drug transporters, and pharmacokinetics or pharmacodynamics of anti-cancer drugs. The studies discussed evaluate different regimens and tumour types and show that polymorphisms can have different, sometimes even contradictory, pharmacokinetic and pharmacodynamic effects in different tumours in response to different drugs. The clinical application of pharmacogenetics in cancer treatment will therefore require more detailed information of the different polymorphisms in drug-metabolising enzymes and drug transporters. Larger studies, in different ethnic populations, and extended with haplotype and linkage disequilibrium analysis, will be necessary for each anti-cancer drug separately.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2327 Characteristics of drug transporter genes (with the most important polymorphisms)[167-169] Gene Location Protein Exons Amino Polymorphisms Location Effect (chromosome) acids (exon) ABCB1 7q21 P-gp/MDR1 29 1280 *6 (C3435T) 26 Silent *7 (G2677T/A) 21 A893S *8 (C1236T) 12 Silent G1199A 11 S400N ABCC2 10q24 MRP2 32 1545 C-24T 5'-UTR Unknown C1249A 10 V417I C2302T 18 R768W C2366T 18 S789F T2439+2C 18 Splice site ND 26 W1254Y,A,C,F C3972T 28 Silent A4145G 29 Q1382R G4348A 31 G1440S ABCG2 4q22 BCRP 16 655 G34A 2 V12M C8825A 5 Q141K BCRP = breast cancer resistance protein; MDR1 = multidrug resistance 1; MRP2 = multidrug resistance protein 2; ND = no data; P-gp = P-glycoprotein. Login to comment

[hide] ABCB1 1199G>A genetic polymorphism (Rs2229109) inf... PLoS One. 2014 Mar 12;9(3):e91555. doi: 10.1371/journal.pone.0091555. eCollection 2014. Dessilly G, Elens L, Panin N, Capron A, Decottignies A, Demoulin JB, Haufroid V
ABCB1 1199G>A genetic polymorphism (Rs2229109) influences the intracellular accumulation of tacrolimus in HEK293 and K562 recombinant cell lines.
PLoS One. 2014 Mar 12;9(3):e91555. doi: 10.1371/journal.pone.0091555. eCollection 2014., [PMID:24621983]

Abstract [show]
OBJECTIVE: ATP-binding cassette, subfamily B, member 1 (ABCB1) transporter, or P-glycoprotein, is an efflux protein implicated in the absorption and the distribution of various compounds, including tacrolimus and cyclosporine A. In vivo studies suggest an association between the ABCB1 1199G>A single nucleotide polymorphism (SNP) and tacrolimus intracellular accumulation. The aim of the present experimental study was to clarify in vitro the impact of the coding ABCB1 1199G>A SNP on ABCB1 transport activity towards both immunosuppressive drugs. METHOD: Two recombinant cell lines, i.e. Human Embryonic Kidney (HEK293) and Human Myelogenous Leukemia (K562) cells, overexpressing ABCB1 carrying either the wild-type allele (1199G) or its mutated counterpart (1199A), were generated. The impact of the 1199G>A SNP on ABCB1 activity towards rhodamine (Rh123), doxorubicin, vinblastine, tacrolimus and cyclosporine A was assessed by accumulation, cytotoxicity and/or kinetic experiments. RESULTS: Tacrolimus accumulation was strongly decreased in cells overexpressing the wild-type protein (1199G) compared to control cells, confirming the ability of ABCB1 to transport tacrolimus. By contrast, overexpression of the variant protein (1199A) had nearly no effect on tacrolimus intracellular accumulation whatever the model used and the concentration tested. Unlike tacrolimus, our results also indicate that cyclosporine A, Rh123 and doxorubicin are transported in a similar extent by the wild-type and variant ABCB1 proteins while the variant protein seems to be more efficient for the transport of vinblastine. CONCLUSION: ABCB1 encoded by the 1199G wild-type allele transports more efficiently tacrolimus in comparison to the 1199A variant protein. This observation indicates that the amino-acid substitution (Ser400Asn) encoded by the 1199A allele drastically decreases the ability of ABCB1 to drive the efflux of tacrolimus in a substrate-specific manner, in agreement with our previously published clinical data. Our study emphasizes the importance of the ABCB1 1199G>A polymorphism for ABCB1 activity and its potential to explain differences in drug response.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
9 This observation indicates that the amino-acid substitution (Ser400Asn) encoded by the 1199A allele drastically decreases the ability of ABCB1 to drive the efflux of tacrolimus in a substrate-specific manner, in agreement with our previously published clinical data. Login to comment
149 Overexpression of the 1199A variant allele had no effect on Tac accumulation when compared to control cell lines (p.0.05), suggesting that substitution of serine 400 for asparagine strongly reduces ABCB1-mediated Tac efflux in HEK293 and K562 cell lines. Login to comment
206 The differential activity of ABCB1 1199G.A SNP towards Rh123, doxorubicin, vinblastine, Tac and CsA could be explained by the fact that the ABCB1 Ser400Asn substitution is located in a cytoplasmic loop involved in substrate recognition. Login to comment
279 Neoplasma 56: 202-207. 13. Woodahl EL, Crouthamel MH, Bui T, Shen DD, Ho RJ (2009) MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents. Login to comment

[hide] Single nucleotide polymorphisms in ABCB1 and CBR1 ... Haematologica. 2015 May;100(5):e204-6. doi: 10.3324/haematol.2014.120113. Epub 2015 Jan 30. Jordheim LP, Ribrag V, Ghesquieres H, Pallardy S, Delarue R, Tilly H, Haioun C, Jardin F, Demangel D, Salles GA, Dumontet C
Single nucleotide polymorphisms in ABCB1 and CBR1 can predict toxicity to R-CHOP type regimens in patients with diffuse non-Hodgkin lymphoma.
Haematologica. 2015 May;100(5):e204-6. doi: 10.3324/haematol.2014.120113. Epub 2015 Jan 30., [PMID:25637052]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
14 rs2229109 (Ser400Asn) in ABCB1 was associated with increased risk of high-grade diarrhea (P=0.007) and haematologica 2015; 100:e204 LETTERS TOߘTHE EDITOR Table 1. Login to comment

[hide] Impact of Genetic Polymorphisms of ABCB1 (MDR1, P-... Clin Pharmacokinet. 2015 Jul;54(7):709-35. doi: 10.1007/s40262-015-0267-1. Wolking S, Schaeffeler E, Lerche H, Schwab M, Nies AT
Impact of Genetic Polymorphisms of ABCB1 (MDR1, P-Glycoprotein) on Drug Disposition and Potential Clinical Implications: Update of the Literature.
Clin Pharmacokinet. 2015 Jul;54(7):709-35. doi: 10.1007/s40262-015-0267-1., [PMID:25860377]

Abstract [show]
ATP-binding cassette transporter B1 (ABCB1; P-glycoprotein; multidrug resistance protein 1) is an adenosine triphosphate (ATP)-dependent efflux transporter located in the plasma membrane of many different cell types. Numerous structurally unrelated compounds, including drugs and environmental toxins, have been identified as substrates. ABCB1 limits the absorption of xenobiotics from the gut lumen, protects sensitive tissues (e.g. the brain, fetus and testes) from xenobiotics and is involved in biliary and renal secretion of its substrates. In recent years, a large number of polymorphisms of the ABCB1 [ATP-binding cassette, sub-family B (MDR/TAP), member 1] gene have been described. The variants 1236C>T (rs1128503, p.G412G), 2677G>T/A (rs2032582, p.A893S/T) and 3435C>T (rs1045642, p.I1145I) occur at high allele frequencies and create a common haplotype; therefore, they have been most widely studied. This review provides an overview of clinical studies published between 2002 and March 2015. In summary, the effect of ABCB1 variation on P-glycoprotein expression (messenger RNA and protein expression) and/or activity in various tissues (e.g. the liver, gut and heart) appears to be small. Although polymorphisms and haplotypes of ABCB1 have been associated with alterations in drug disposition and drug response, including adverse events with various ABCB1 substrates in different ethnic populations, the results have been majorly conflicting, with limited clinical relevance. Future research activities are warranted, considering a deep-sequencing approach, as well as well-designed clinical studies with appropriate sample sizes to elucidate the impact of rare ABCB1 variants and their potential consequences for effect sizes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Only a few reports have described the functional consequences of rare variants in cell models, e.g. variants 266T[C (rs35810889, p.M89T), 1199G[A/T/C (rs2229109, p.S400N/I/T), 1985T[G (rs35657960, p.L662R), 2005C[T (rs35023033, p.R669C), 3322T[C (rs35730308, p.T1108R) and 3751G[A (rs28364274, p.V1251I) [50-52]. Login to comment