ABCMdb

ABCB1 p.Ser400Asn

None has been submitted yet.

Publications

PMID: 15882131 [PubMed] Lepper ER et al: "Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2."

No. Sentence Comment

90 A detailed analysis of the potential functional consequences of different ABCB1 variants has not yet been performed, except for the five most common non-synonymous coding SNPs (i.e., Asn21Asp, Phe103Leu, Ser400Asn, Ala893Ser/Thr, and Ala998Thr) as assessed by a vaccinia virus-based transient expression system [74]. Login to comment
106 Nonetheless, the association of the C3435T polymorphism with Table 2. Summary of common genetic variants in the ABCB1 gene cDNA position* Region‡ Wild-type allele Variant allele Amino acid Change§ -274 Intron -1 G A -223 Intron -1 C T -146 Intron -1 T C -60 Intron -1 A T -41 Intron -1 A G Non-coding -241 Exon 1 G A Non-coding -145 Exon 1 C G Non-coding -129 Exon 1 T C Non-coding -43 Exon 1 A G Non-coding +140 Intron 1 C A +237 Intron 1 G A -4 Exon 2 C T Non-coding -1 Exon 2 G A Non-coding 61 Exon 2 A G 21 Asn to Asp -8 Intron 3 C G 266 Exon 4 T C 89 Met to Thr 307 Exon 5 T C 103 Phe to Leu -25 Intron 4 G T +139 Intron 6 C T +145 Intron 6 C T 548 Exon 7 A G 183 Asn to Ser 729 Exon 8 A G 243 Syn 781 Exon 8 A G 261 Ile to Val -44 Intron 9 A G -41 Intron 10 T G 1199 Exon 11 G A 400 Ser to Asn -4 Intron 11 G A 1236¶ Exon 12 C T 412 Syn 1308 Exon 12 A G 436 Syn +17 Intron 12 G A +44 Intron 12 C T 1474 Exon 13 C T 492 Arg to Cys +24 Intron 13 C T 1617 Exon 14 C T 539 Syn +38 Intron 14 A G +38 Intron 15 G A 1985 Exon 16 T G 662 Leu to Arg 2005 Exon 16 C T 669 Arg to Cys -27 Intron 17 A G +8 Intron 20 C G *cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758 with an A as the reference at position 43. Login to comment

PMID: 16259577 [PubMed] Sakurai A et al: "Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications."

No. Sentence Comment

94 Kimchi-Sarfaty et al. [73] assessed the five most common coding SNPs (i.e., N21D, F103L, S400N, A893S and A999T) by using a vaccinia virus-based transient expression system. Login to comment
100 Woodahl et al. [74] evaluated functional consequences of S400N in LLC-PK1 cells stably expressing the wild-type or the S400N variant. Login to comment
101 Their cytotoxicity studies have shown that both wild-type and S400N variant exhibited similar resistance profiles toward doxorubicin, whereas LLC-PK1 cells expressing the S400N variant were more resistant to vincristine and vinblastine. Login to comment
102 The apparent transepithelial permeability of Rhodamine-123 in LLC-PK1 cells expressing the S400N variant was lower than that of the wild type. Login to comment
103 These results suggest that the functional consequence of the S400N substitution varies depending on the compounds tested. Login to comment
106 Position Allele Amino acid Allele frequency in Caucasian populations Allele frequency in Japanese populatins Allele frequency in African populations n % n % n % 61 A G 21 Asn 21 Asp 799 89.7 10.3 193 100 0 100 97.5 2.5 266 T C 89 Met 89 Thr 100 99.5 0.5 145 100 0 100 100 0 307 T C 103 Phe 103 Leu 546 99.9 0.1 48 100 0 ND ND ND 325 G A 108 Glu 108 Lys ND ND ND 37 95.9 4.1 ND ND ND 781 A G 261 Ile 261 Val 100 100 0 145 100 0 100 98.5 1.5 1199 G A 400 Ser 400 Asn 696 95.0 5.0 193 100 0 100 99 1 1985 T G 662 Leu 662 Arg 100 99.5 0.5 145 100 0 100 100 0 2005 C T 669 Arg 669 Cys 100 100 0 145 100 0 100 99 1 2485 A G 829 Ile 829 Val 185 99.2 0.8 ND ND ND ND ND ND 2547 A G 849 Ile 849 Met 100 99.5 0.5 145 100 0 100 100 0 2677 G T A 893 Ala 893 Ser 893 Thr 611 55.1 42.1 2.8 241 40.0 41.1 18.9 100 90 10 0.5 2956 A G 986 Met 986 Val ND ND ND 100 99.5 0.5 ND ND ND 3151 C G 1051 Pro 1051 Ala 100 100 0 145 100 0 100 99.5 0.5 3320 A C 1107 Gln 1107 Pro 461 99.8 0.2 ND ND ND ND ND ND 3322 T C 1108 Trp 1108 Arg 100 100 0 145 100 0 100 99.5 0.5 3421 T A 1141 Ser 1141 Thr 100 100 0 145 100 0 100 88.9 11.1 3751 G A 1251 Val 1251 Ile 100 100 0 145 99 1 100 100 0 3767 C A 1256 Thr 1256 Lys 100 99.5 0.5 145 100 0 100 100 0 Data from [31-38, 203]. Login to comment
115 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A) were generated by site-directed mutagenesis. Login to comment
124 The variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A), as well as the wild type, of ABCB1 exhibited the verapamil-enhanced ATPase activity. Login to comment
129 N21D M89T N44S H2N F103L E108K N183S G185V I261V S400N R492C A599T L662R R669C V801M A893S/T I829V I849M M986V A999T G1063A P1051A Q1107P W1108R I1145M S1141T V1251I T1256K COOH ATP-binding site ATP-binding site EXTRACELLULAR INTRACELLULAR A80E Figure 2. Login to comment

PMID: 16399366 [PubMed] Ishikawa T et al: "High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics."

No. Sentence Comment

167 For this purpose, we have prepared several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A, and G1063A) by site‐ directed mutagenesis. Login to comment

PMID: 16766035 [PubMed] Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."

No. Sentence Comment

761 0.09d c. 61 A>G N21D 0.11d IVS 5-35 G>C intronic 0.006c IVS 5-25 G>T intronic 0.16c IVS 6+139 C>T intronic 0.37d c. 548 A>G N183S 0.01e c. 1199 G>A S400N 0.05d c. 1236 C>T synonymous 0.41d IVS 12+44 C>T intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17-76 T>A intronic 0.46d IVS 17+137 A>G intronic 0.006c c. 2650 C>T synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T synonymous 0.54e c. 4030 G >C synonymous 0.005b c. 4036 A>G synonymous 0.30b a Taniguchi et al. (2003). Login to comment

PMID: 18154452 [PubMed] Sharom FJ et al: "ABC multidrug transporters: structure, function and role in chemoresistance."

No. Sentence Comment

325 The G1199A polymorphism (S400N) affected the trans-epithelial transport of five HIV protease inhibitors [140]. Login to comment

PMID: 18855611 [PubMed] Zhou SF et al: "Clinical pharmacogenetics and potential application in personalized medicine."

No. Sentence Comment

489 The 1199G>A polymorphism is located at exon 11, which changes Ser400 to Asn. Login to comment
532 Nucleotide change rs number Amino acid change 49T>C rs28381804 F17L 61A>G rs61615398; rs9282564 N21D 131A>G rs1202183 N44S 178A>C rs41315618 I60L 239C>A rs9282565 A80E 266T>C Rs35810889 M89T 431T>C rs61607171 I144T 502G>A rs61122623 V168I 548A>G rs60419673 N183S 554G>T rs1128501 G185V 781A>G rs36008564 I261V 1199G>A rs2229109 S400N 1696G>A rs28381902 E566K 1777C>T rs28381914 R593C 1778G>A rs56107566 R593H 1795G>A rs2235036 A599T 1837G>T rs57001392 D613Y 1985T>G rs61762047 L662R 2005C>T rs35023033 R669C 2207A>T rs41316450 I736K 2398G>A rs41305517 D800N 2401G>A rs2235039 V801M 2485A>G rs2032581 I829V 2506A>G rs28381967 I836V 2547A>G rs36105130 I849M 2677T>A/G rs2032582 S893A/T 2975G>A rs56849127 S992N 3151C>G rs28401798 P1051A 3188G>C rs2707944 G1063A 3262G>A rs57521326 D1088N 3295A>G rs41309225 K1099E 3320A>C rs55852620 Q1107P 3322T>C rs35730308 W1108R 3410G>T rs41309228 S1137I 3421T>A rs2229107 S1141T 3502A>G rs59241388 K1168E 3669A>T rs41309231 E1223D 3751G>A rs28364274 V1251I 3767C>A r35721439 T1256K Data are from NCBI dbSNP (access date: 2 August 2008). Login to comment

PMID: 19200005 [PubMed] Porcelli L et al: "Intracellular trafficking of MDR transporters and relevance of SNPs."

No. Sentence Comment

229 [113], who showed that HeLa cells transfected with either the wild-type or the ABCB1 polymorphisms A61G (N21D), T307C (F103L), G1199A (S400N), G2677T (A893S) and G2995A (A998T) expressed the transporter at the cell surface. Login to comment
230 Additionally, cells transfected with double mutants (N21D-S400N, N21D-A893S, and S400N-A893S) revealed similar ABCB1 cell surface expression [113]. Login to comment
231 Regarding the S400N SNP, Woodahl et al. Login to comment
232 [114] reported that LLC-PK1 cells transfected with wild-type and S400N ABCB1 expressed similar amounts of the transporter predominantly on the apical membrane. Login to comment

PMID: 19949922 [PubMed] Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."

No. Sentence Comment

52 Functional Significance of ABCB1 SNPs Table6.3 Frequency of ABCB1 genetic variants in Caucasians, position on DNA, putative effect, and frequencies (134) Position Amino acid or effect Frequency of the variant allele 5'-Flanking -2903 T>C 0.02a 5'-Flanking -2410 T>C 0.10a 5'-Flanking -2352 G>A 0.28a 5'-Flanking -1910 T>C 0.10a 5'-Flanking -1717 T>C 0.02a 5'-Flanking -1325 A>G 0.02a 5'-Flanking -934 A>G 0.10a 5'-Flanking -692 T>C 0.10a 5'-Flanking -41 A>G 0.09b IVS 1a -145 C>G 0.02b IVS 1b -129 T>C 0.06b IVS 1b 12 T>C 0.06c IVS 2 -1 G>A 0.09d c. 61 A>G N21D 0.11d IVS 5 -35 G>C Intronic 0.006c IVS 5 -25 G>T Intronic 0.16c IVS 6 +139 C>T Intronic 0.37d c. 548 A>G N183S 0.01e c. 1199 G>A S400N 0.05d c. 1236 C>T Synonymous 0.41d IVS 12 +44 C>T Intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17 -76 T>A Intronic 0.46d IVS 17 +137 A>G Intronic 0.006c c. 2650 C>T Synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T Synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T Synonymous 0.54d c. 4030 Synonymous 0.005b c. 4036 Synonymous 0.30b References: a [42], b [26], c [25], d [28], e [23] with lower activity or expression in Caucasians. Login to comment
62 A further rare missense SNP 1199 G>T (frequency 0.05 in Caucasians, (28)) leading to a Ser400Asn amino acid replacement is associated with lower activity and accordingly higher sensitivity against anticancer drugs. Login to comment
76 Table6.4 Functional significance of ABCB1 genetic variants and relevance for clinical outcome Position Amino acid exchange Effect of variant 5'-Flanking -2410 T>C Decreased mRNAa 5'-Flanking -692 T>C Decreased mRNAa c. 571 G>A G191R Reduced chemotherapy resistanceb c. 1199 G>A S400N Elevated activityc c. 1236 C>T Synonymous Increased imatinib disposition and therapy responsed c. 2677 G>T/A A893S/T In vitro increased vmax ,q no effect on vincristine,e increased imatinib response in CMLd c. 3435 C>T Synonymous Decreased mRNA and protein expression,f, g decreased invitro transport,h no effect on expression and bioavailability of talinolol,i no effect on invitro transport,j, k decreased digoxin bioavailability,l increased etoposid disposition,m no effect on AML or ALL outcome,k better prognosis of multiple myeloma,n better chemotherapy response in breast cancer,o no effect in colon cancerp References: a [42], b [69], c [38], d [53], e [51], f [23], g [64], h [31], i [39], j [135], k [65-67], l [40, 41], m [52], n [68], o [74], p [70, 71], q [36] As mentioned earlier, the first systematic study on ABCB1 genetic variability and its association to expression and bioavailability was the first one, showing an association of 3435C>T with digoxin plasma levels. Login to comment

PMID: 11258197 [PubMed] Kerb R et al: "ABC drug transporters: hereditary polymorphisms and pharmacological impact in MDR1, MRP1 and MRP2."

No. Sentence Comment

97 SNP Region N Frequency of SNPs (%) Effect Heterozygous Homozygous Observed Estimated T-12C E1 85 11.8 0 0.4 Non-coding G-1A E2 188 11.2 0 0.4 TL initiation A61G E2 188 17.6 0.5 0.81 Asn21Asp G-25T I4 85 26 3.5 2.3 G-35C I4 85 1.2 0 0.01 # T307C E5 85 1.2 0 0.01 Phe103Leu C+139T I5 85 48.2 16.5 16.8 C+145T I5 85 2.4 0 0.01 G1199A E11 85 12.9 0 0.4 Ser400Asn C1236T E12 188 48.9 13.3 14.4 Gly412Gly # C+44T I12 188 11.7 0 0.4 T-76A I16 85 45.9 22.4 20.3 A+137G I17 85 1.2 0 0.01 G2677T E21 83b 43.4 42.2 38.4 Ala893Ser G2995A E24 36b 11.1 38.4 Ala999Thr C3435T E26 537 47.7 26.4 24.1 Ile1145Ile C3396T E26 188 0.53 0 0.01 Wobble § MDR1 sequences gb:AC002457 and AC005068 are defined as 'wild type`. Login to comment

PMID: 16041239 [PubMed] Colombo S et al: "Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo."

No. Sentence Comment

101 or Ref sequence; locus Frequencies Fold-increase of nelfinavir AUCintracell Significance AA Aa aa Aa2 AA Aa aa Aa2 chi-squared P-value ABCB1 IVS 1 - 80delG rs3214119 27 1 1 1.0 0.03 0.85 c.61A > G (N21D) rs9282564 26 2 1 2.5 3.85 0.05 TAG1 rs3789243 7 17 3 1 0.8 0.6 1.23 0.54 c.1199G > A (S400N) rs2229109 24 2 1 0.9 0.62 0.43 TAG5 rs1128503 4 18 5 1 0.8 1.3 3.33 0.19 TAG6 rs2235046 6 18 3 1 0.6 0.7 4.43 0.11 c.2677G > T (A893S) rs2032582 4 17 5 1 1 1.0 1.7 1.2 6.42 0.09 IVS 21 + 49T > C rs2032583 19 8 1 0.6 3.45 0.06 TAG8, 3435C > T rs1045642 4 18 6 1 1.4 2.1 6.35 0.04 IVS 26 + 59T > G rs2235047 24 2 1 1.0 0.02 0.89 IVS 26 + 80T > C rs2235048 3 17 6 1 1.3 2.4 7.09 0.03 TAG11 rs1186746 16 10 1 1 1.1 0.3 2.46 0.29 TAG12 rs1186745 17 9 1 1 0.7 1.0 0.33 0.85 ABCC1 c.816G > A NM_004996; c.1012G > A 27 1 1 1.5 1.05 0.30 c.825T > C rs246221 13 11 3 1 1.5 0.7 3.99 0.14 c.1062T > C rs35587 13 11 3 1 1.5 0.7 3.02 0.22 IVS 9 + 8A > G rs35588 13 11 3 1 1.5 0.7 3.02 0.22 IVS 10 + 64C > T NC_000016; g.98791C > T 23 3 1 0.4 1.97 0.16 ABCC2 g. Login to comment
69 - 4 C > T exon 2 (50 UTR) Epidauros md-v-177 c.61A > G exon 2 p.N21D Hoffmeyer et al., 2000 md-v-017 rs9282564 IVS 2 + 23 T > C intron 2 Epidauros md-v-057 Tag 1 intron 3 Soranzo et al., 2004 rs3789243 IVS 11 - 40 T > G intron 10 Epidauros md-v-078 rs2235029 c.1137 C > G exon 11 p.P373A Epidauros md-v-079 c.1149 C > T exon 11 synonymous (p.H383H) Epidauros md-v-080 c.1199G > A exon 11 p.S400N Hoffmeyer et al., 2000 md-v-025 rs2229109 IVS11 + 48 T > A intron 11 Epidauros md-v-081 Tag 5 exon 12 Soranzo et al., 2004 rs1128503 Tag 6 intron 16 Soranzo et al., 2004 rs2235046 IVS 21 - 78 G > A intron 20 Epidauros md-v-228 IVS 21 - 43 A > T intron 20 Epidauros md-v-160 c.2547A > G exon 21 p.I849M Kroetz et al., 2003 md-v-222 c. Login to comment

PMID: 20368717 [PubMed] Bergmann TK et al: "Impact of CYP2C8*3 on paclitaxel clearance: a population pharmacokinetic and pharmacogenomic study in 93 patients with ovarian cancer."

No. Sentence Comment

135 This effect on clearance of a 'non-fixed` variable provides a competing and dynamic biological explanation for clearance that certainly should be Table 4 Clearance of unbound paclitaxel as function of observed genotypes Gene/allelea Effectb Reference homozygote Heterozygote Variant homozygote P-valuee SNP IDf Nc CLd (10th-90th) Nc CLd (10th-90th) Nc CLd (10th-90th) Candidate SNPs for confirmative analysis CYP2C8 1196A4G(*3) K399R 74 395 (297-490) 19 350 (238-458) 0.03* (0.04) rs10509681 ABCB1 1236C4T G412G 29 391 (270-569) 45 393 (299-490) 19 359 (291-437) 0.25 (0.25) rs1128503 2677G4T/Ag A893S/T 26 387 (270-490) 42(GT) 396 (299-490) 20(TT) 356 (294-437) 0.20 (0.26) rs2032582 3435C4T I1145I 11 403 (326-548) 44 387 (282-490) 38 378 (297-468) 0.83 (0.43) rs1045642 Candidate SNPs for exploratory analysis CYP2C8 792C4G(*4) I264M 86 391 (297-490) 7 321 (270-374) 0.04* (0.03) rs1058930 15577956G4T (*1B) - 49 395 (298-552) 43 373 (291-478) 1 461 0.75 (0.36) rs7909236 15578055A4C (*1C) - 69 382 (291-478) 24 393 (300-552) 0.48 (0.62) rs17110453 ABCB1 À1A4G - 1 458 29 396 (270-592) 63 379 (297-477) 0.56 (0.3) rs2214102 61A4G N21D 63 384 (282-490) 29 386 (298-478) 1 437 0.52 (0.77) rs9282564 1199G4A S400N 83 385 (291-490) 10 386 (322-461) 0.74 (0.99) rs2229109 CYP3A4 24616372T4C (*1B) - 85 383 (296-490) 7 397 (270-641) 0.67 (0.72) rs2740574 CYP3A5 219-237G4A Frameshift 84 388 (297-490) 9 360 (176-726) 0.30 (0.36) rs776746 SLCO1B3 699G4A M233I 1 326 19 377 (299-481) 73 388 (291-490) 0.99 (0.46) rs7311358 767G4C G256A 67 386 (298-481) 26 383 (291-490) 0.63 (0.89) rs60140950 CYP1B1 1294C4G (*3) V432L 30 389 (270-530) 36 401 (298-490) 27 361 (300-470) 0.77 (0.24) rs1056836 ABCC1 7356253C4G - 65 394 (297-548) 27 368 (291-470) 1 332 0.04* (0.15) rs504348 ABCC2 1249G4A V417I 67 381 (291-490) 24 396 (297-552) 2 415 (368-468) 0.21 (0.39) rs2273697 3563T4A V1188E 87 386 (296-490) 5 370 (176-569) 0.7 (0.7) rs17222723 4544G4A C1515Y 75 389 (296-490) 3 355 (176-569) 0.72 (0.52) rs8187710 ABCG2 421C4A Q141K 61 374 (291-478) 32 408 (315-548) 0.4 (0.09) rs2231142 34G4A V12M 87 385 (291-490) 4 395 (296-726) 0.68 (0.83) rs2231137 ABCC10 2759T4C I920T 46 386 (297-478) 43 386 (291-548) 4 373 (326-467) 0.88 (0.89) rs2125739 Abbreviations: CL, clearance of unbound paclitaxel; SNP, single-nucleotide polymorphism. Login to comment

PMID: 11240981 [PubMed] Cascorbi I et al: "Frequency of single nucleotide polymorphisms in the P-glycoprotein drug transporter MDR1 gene in white subjects."

No. Sentence Comment

5 Results: Five amino acid exchanges were found with allelic frequencies of 11.2% for Asn21Asp and 5.5% for Ser400Asn. Login to comment
54 G1199A (Ser400Asn) appeared with a frequency of 5.5%. Login to comment

PMID: 12011154 [PubMed] Potocnik U et al: "Naturally occurring mutations and functional polymorphisms in multidrug resistance 1 gene: correlation with microsatellite instability and lymphoid infiltration in colorectal cancers."

No. Sentence Comment

264 To the best of our knowledge, this Table 2 Correlation between MDR1 polymorphisms and increased lymphoid infiltration in tumours Exon Genotype (polymorphism) Amino acid change No (%) of tumours with specific genotype (polymorphism)/No of tumours analysed No (%) of tumours with specific genotype (polymorphism) and lymphoid infiltration p* Promoter †Promoter +8 T/T 313/327 (96%) 152/313 (49%) Promoter Promoter +8 T/C Non-coding 14/327 (4%) 9/14 (64%) 0.036 Intron 1b IVS1-81 (G)4 311/327 (95%) 149/311 (48%) Intron 1b IVS1-81 (G)4/(G)3 Non-coding 16/327 (5%) 12/16 (75%) 0.010 Intron 1b ‡IVS-1 G/G 271/317 (85%) 127/271 (47%) Intron 1b IVS-1 G/A 45/317 (14%) 27/45(60%) NS Intron 1b IVS-1 A/A Non-coding 1/317 (<1%) 1/1 (100%) NS 2 ‡61 A/A 266/321 (83%) 125/266 (47%) 2 61 A/G Asn21Asp 51/321 (16%) 29/51 (57%) NS 2 61 G/G 4/321 (1%) 2/4 (50%) NS Intron 4 ‡IVS4-25 G/G 44/63 (70%) 19/44 (43%) Intron 4 IVS4-25 G/T Non-coding 15/63 (24%) 7/15 (47%) NS Intron 4 IVS4-25 T/T 4/63 (6%) 2/4 (50%) NS 11 1199 G/G 307/327 (94%) 152/307 (50%) 11 1199 G/A Ser400Asn 20/327 (6%) 11/20 (55%) NS 12 ‡1236 C/C 81/327 (25%) 39/81 (48%) 12 1236 C/T No change 163/327 (50%) 80/163 (49%) NS 12 1236 T/T 83/327 (25%) 42/83 (51%) NS Intron 16 IVS16+158 G/G 82/87 (94%) 41/82 (50%) Intron 16 IVS16+158 G/A Non-coding 5/87 (6%) 3/5 (60%) NS 21 §2677 G/G 14/41 (34%) 7/14 (50%) 21 2677 G/T Ala893Ser 17/41 (41%) 7/17 (41%) NS 21 2677 T/T 10/41 (24%) 4 /10 (40%) NS 26 ‡3435 C/C 44/159 (28%) 18/44 (41%) 26 3435 C/T No change 85/159 (53%) 46/85 (54%) NS 26 3435 T/T 30/159 (19%) 15/30 (50%) NS NS=not significant. Login to comment

PMID: 12065748 [PubMed] Kimchi-Sarfaty C et al: "Functional characterization of coding polymorphisms in the human MDR1 gene using a vaccinia virus expression system."

No. Sentence Comment

2 To determine whether common polymorphic forms of P-gp are likely to alter function of P-gp, we characterized five known MDR1 coding polymorphisms (N21D, F103L, S400N, A893S, and A998T) using a vaccinia virus-based transient expression system. Login to comment
7 Cell surface expression and function of double mutants including the more common polymorphisms (N21D-S400N, N21D-A893S, and S400N-A893S) showed no differences from wild-type. Login to comment
20 In this study, we examined the five most common P-gp coding polymorphisms previously reported in the literature (N21D, F103L, S400N, A893S, and A998T). Login to comment
30 Using the technique described by Kunkel et al. (1987), five different mutated sites were introduced into the MDR1 gene with the following primers: for the N21D (A3G) polymorphism, 5Ј TTT TTC ACT TTT ATC GTT CAG TTT AA 3Ј; for the F103L (C3T) polymorphism, 5Ј CAG ATT CAT GAA GAG CCC TGT ATC A 3Ј; for the S400N (G3T) polymorphism, 5Ј TCG AGA TGG GTA ATT GAA GTG AAC AT 3Ј; for the A893S (G3T) polymorphism, 5Ј AGC GAT CTT CCC AGA ACC TTC TAG TT 3Ј; and for the A998T (G3A) polymorphism, 5Ј TAT TTT GGC TTT GGT ATA GTC AGG AGC 3Ј. Login to comment
31 Double mutant MDR1s were generated using the NdeI and XhoI restriction enzymes on single mutant templates (N21D-S400N, N21D-A893S, and S400N-A893S). Login to comment
48 We have chosen HeLa cells for these studies because of their low level of endogenous P-gp expression, their ability to express high TABLE 1 Common MDR1 polymorphisms that change amino acids Location Polymorphic Variant Heterozygous Frequency Reference Exon Nucleotide % 2 61 N21D 17.6 Hoffmeyer et al. (2000) 11.2 Cascorbi et al. (2001) 5.7 Decleves et al. (2000) 5 307 F103L 1.2 Hoffmeyer et al. (2000) 10 1107 G369P 0.2 Cascorbi et al. (2001) 11 1199 S400N 12.9 Hoffmeyer et al. (2000) 5.5 Cascorbi et al. (2001) A893S 43.0 Mickley et al. (1998) A893T 41.6 Cascorbi et al. (2001) 21 2677 A893S 62.0a , 13.0b Kim et al. (2001) A893G 56.4 Cascorbi et al. (2001) 24 2995 A998T 11.0 Mickley et al. (1998) a European Americans. b African Americans. levels of wild-type and mutant P-gp after vaccinia infection/ transfection, and their relative ease of transfection (Hrycyna et al., 1998; Ramachandra et al., 1998; Gribar et al., 2000). Login to comment
63 HeLa cells were infected/transfected with the pTM1-MDR1 vector harboring the MDR1 polymorphisms N21D, F103L, S400N, A893S, and A998T (described in Table 1). Login to comment
70 All cells infected/ transfected with double mutants (N21D-S400N, N21D-A893S, and S400N-A893S) revealed results similar to those of the single mutants (data not shown). Login to comment
71 Discussion In this study a transient vaccinia expression system was used to determine the effect of five known coding human MDR1 polymorphisms on P-gp function: N21D, F103L, S400N, A893S, and A998T. Login to comment
113 Infected/transfected HeLa cells with wild-type pTM1-MDR1 (--), pTM1-MDR1-N21D (- -⅐- -⅐), pTM1-MDR1-F103L (⅐⅐⅐⅐), pTM1-MDR1-S400N (-⅐-⅐-), pTM1-MDR1-A998T (- - - -), and pTM1-MDR1-A893S (⅐⅐⅐-⅐⅐⅐) were incubated and analyzed by FACS as described under Materials and Methods, with MRK-16 or control IGg2a␬ monoclonal antibodies (-⅐-⅐-⅐) 13.5 h after infection/transfection. Login to comment
117 Cells were transfected with pTM1 (control), pTM1-MDR1, (wild-type P-gp), pTM1-MDR1- N21D, pTM1-MDR1-F103L, pTM1-MDR1-S400N, pTM1-MDR1-A893S, and pTM1-MDR1-A998T. Login to comment
119 with A, 0.5 ␮M Calcein-AM: wild-type (--), N21D (- -⅐- -⅐), and S400N (-⅐-⅐-), in the presence of an inhibitor, 5 ␮M cyclosporin A (- - -); B, 0.5 ␮M bodipy-FL-forskolin: wild-type (--), N21D (- -⅐- -⅐), F103L (⅐⅐⅐⅐), and S400N (-⅐-⅐-), in the presence of an inhibitor, 5 ␮M cyclosporin A (- - -); C, 0.5 ␮M bodipy-FL-verapamil: wild-type (--), N21D (- -⅐- -⅐), F103L (⅐⅐⅐⅐), and S400N (-⅐- ⅐-), in the presence of an inhibitor, 5 ␮M cyclosporin A (- - -); D, 0.1 ␮M bodipy-FL-paclitaxel: wild-type (--), A893S (- -⅐- -⅐), in the presence of an inhibitor, 5 ␮M cyclosporin A for the wild-type (- -), and for A893S (- - -). Login to comment

PMID: 12172213 [PubMed] Goto M et al: "C3435T polymorphism in the MDR1 gene affects the enterocyte expression level of CYP3A4 rather than Pgp in recipients of living-donor liver transplantation."

No. Sentence Comment

42 In the present study, the variants in exon 2 G-1A, A61G (Asn21 Asp) in exon 2, T307C (Phe103 Leu) in exon 5, G1199A (Ser400 Asn) in exon 11 and C+44T in intron 12 were not observed. Login to comment

PMID: 12357145 [PubMed] Lotsch J et al: "Does the A118G polymorphism at the mu-opioid receptor gene protect against morphine-6-glucuronide toxicity?"

No. Sentence Comment

106 33 T/T T/T MDR1 2 A61G Asn21Asp 11.2 20.6 9 A/G A/G Forward: 5Ј-AGG AGC AAA GAA GAA GAA CTT TTT TAA ACT GAT C-3Ј 9.3 17.6 8 Reverse: 5Ј-GAT TCC AAA GGC TAG CTT GC-3Ј 5 T307C Phe103Leu 0.6 1.2 9 T/T T/T Forward: 5Ј-GTG GTT GCA CAC AGT CAG CA-3Ј Reverse: 5Ј-GGA GGA TGT CTA ATT ACC TGG TCA-3Ј 11 G1199A Ser400Asn 5.5 11.1 9 G/G G/G Forward: 5Ј-CAG CTA TTC GAA GAG TGG GC-3Ј 6.5 12.9 8 Reverse: 5Ј-CCG TGA GAA AAA AAC TTC AAG G-3Ј 21 G2677T Ala893Ser 41.6 49.2 9 T/T T/T Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј 63.9 43.4 8 Reverse: 5Ј-GTT TGA CTC ACC TTC CCA G-3Ј 21 G2677A Ala893Thr 0.9 2 9 NA NA Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј Reverse: 5Ј-TTT AGT TTG ACT CAC CTT CCC G-3Ј 26 A3320C Gln1107Pro 0.2 0.4 9 A/A A/A 26 C3396T Ala1132Ala 0.3 0.5 8 C/C C/C Forward: 5Ј-ATC TGT GAA CTC TTG TTT TCA GC-3Ј 26 C3435T Ile1145Ile 50.3 47.7 8 T/T T/T Reverse: 5Ј-TCG ATG AAG GCA TGT ATG TTG-3Ј 53.9 50.5 9 - - MRP2 10 G1249A Val417Ile 12.5 20.8 34 G/G G/G Forward: 5Ј-GGG TCC TAA TTT CAA TCC TTA-3Ј Reverse: 5Ј-TAT TCT TCT GGG TGA CTT TTT-3Ј 18 C2302T Arg768Trp 1 2.1 34 C/C C/C Forward: 5Ј-GGA GTA GTG CTT AAT ATG AAT-3Ј 18 C2366T Ser789Phe 1 2.1 34 C/C C/C Reverse: 5Ј-CCC ACC CCA CCT TTA TAT CTT-3Ј 28 C3972T Ile132Ile 21.9 35.4 34 C/T C/T Forward: 5Ј-TGC TAC CCT TCT CCT GTT CTA-3Ј Reverse: 5Ј-ATC CAG GCC TTC CTT CAC TCC-3Ј 31 G4348A Ala1450Thr 1 2.1 34 G/G G/G Forward: 5Ј-AGG AGC TAA CAC ATG GTT GCT-3Ј Reverse: 5Ј-GGG TTA AGC CAT CCG TGT CAA-3Ј † Sequence is not translated. Login to comment

PMID: 12359865 [PubMed] Schwab M et al: "Genetic polymorphisms of the human MDR1 drug transporter."

No. Sentence Comment

50 Of the 15 identified SNPs, three polymorphisms resulted in protein alterations, one in exon 2 (Asn21Asp), in exon 5 (Phe103Leu), and in exon 11 (Ser400Asn). Login to comment
60 In a Northern Italian population, the extent of linkage disequilibrium TABLE 2 Summary of MDR1 genetic variants in different ethnic groups Location Position Allele Effect Reference promotor 5 flanking/-41a A (28) G exon 1a exon 1a/-145 C (28) G exon 1b exon 1b/-129 T (25, 33) C intron 1 exon 2/-4 C (29) T intron 1 exon 2/-1 G initiation of translation (25, 27, 29) A exon 2 exon 2/61 A Asn21Asp (25-27, 29) G intron 4 exon 5/-35 G (25) C intron 4 exon 5/-25 G (25) T exon 5 exon 5/307 T Phe103Leu (25) C intron 6 exon 6/+139 C (25, 27) T intron 6 exon 6/+145 C (25) T exon 7 exon 7/548 A Asn183Ser (29) G exon 11 exon 11/1199 G Ser400Asn (25, 27, 29) A exon 12 exon 12/1236 C wobble (23, 25, 27, 29) T (Gly412Gly) intron 12 exon 12/+44 C (25, 27) T exon 13 exon 13/1474 C Arg492Cys (29) T intron 16 exon 17/-76 T (25, 27) A intron 17 exon 17/137 A (25) G exon 21 exon 21/2650 C wobble (29) T (Leu884Leu) (Continued ) TABLE 2 (Continued) Location Position Allele Effect Reference exon 21 exon 21/2677 G (22, 23, 27, 29) T Ala893Ser A Ala893Thr exon 24 exon 24/2956 A Met986Val (33) G exon 24 exon 24/2995 G Ala999Thr (22) A exon 26 exon 26/3320 A Gln1107Pro (27) C exon 26 exon 26/3396 C wobble (25) T exon 26 exon 26/3421 T Ser1141Thr (29, 30) A exon 26 exon 26/3435 C wobble (23, 25, 29) T (Ile1145Ile) exon 28 exon 28/4030 G (33) C exon 28 exon 28/4036 A (23, 33) G The positions of the polymorphisms correspond to positions of MDR1 cDNA with the first base of the ATG start codon set to 1 (GenBank accession # M14758). Login to comment
71 The nonsynonymous G1199A SNP in exon 11 (Ser400Asn) results in a significant size change dependent on pH and isoelectric environment of the residue, leading possibly to a charge change in the protein. Login to comment
86 However, a recent publication characterized the functional consequences of five coding SNPs (Asn21Asp, Phe103Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system (40a). Login to comment

PMID: 12419946 [PubMed] Sakaeda T et al: "MDR1 genotype-related pharmacokinetics and pharmacodynamics."

No. Sentence Comment

52 Kim et al. defined 15 alleles based on the frequencies of 11 polymorphisms of C-4T (noncoding), G-1A (noncoding), A61G (Asn21Asp), A548G (Asn183Ser), G1199A (Ser400Asn), C1236T (silent), C1474T (Arg492Cys), C2650T (silent), G2677T (Ala893Ser), T3421A (Ser1141Thr) and C3435T (silent).54) Six of 11 accompanied an amino acid change, and the others were conservative mutations. Login to comment
56 In 2001, Hitzl et al. also indicated that healthy Caucasian subjects with T/T3435 had a more decreased efflux of rhodamine from CD56ϩ NK cells and a lower MDR1 mRNA expression in leukocytes than those with C/C3435 .65) In renal tissues, the C3435T polymorphism is reported to be associated with reduced MDR1 expression.31) However, Tanabe et al. suggested that C3435T had no effect on the placental MDR1 expression based on 89 subjects and Western blotting.53) We determined MDR1 mRNA levels in biopsy specimens of the duodenum obtained from 13 healthy Japanese subjects by real time quantitative RT-PCR and found that MDR1 mRNA expression was higher in T/T3435 than C/C3435 or C/T3435 (Fig. 1).66) The discrepancies between the reports might be ex- November 2002 1393 Table 2. Summary of Genetic Polymorphisms in MDR1 Position Location Effect A1a/-41G Intron Noncoding C-145G Exon 1a Noncoding T-129C (T12C) Exon 1b Noncoding C-4T Exon 2 Noncoding G-1A Exon 2 Noncoding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/ϩ139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/ϩ44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/ϩ137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent This list was based on the literature (refs. 49-54). Login to comment
61 Kim et al. indicated that cells transduced with a variant MDR1 containing Ser893 showed a reduced intracellular accumulation of [3 H]-digoxin compared with cells with the wild-type Ala893 , suggesting enhanced efflux by the polymorphism of Ala893Ser (G2677T).54) On the other hand, very recently, Kimchi-Sarfaty et al. indicated that the cell surface expression and function of double mutants including the more common polymorphisms (A61G (Asn21Asp) and G1199A (Ser400Asn), A61G (Asn21Asp) and G2677T (Ala893Ser), G1199A (Ser400Asn) and G2677T (Ala893Ser)) showed no differences from the wild-type.67) MDR1 Genotype-Related Pharmacokinetics The aim of the clinical study by Greiner et al.64) was to elucidate the role of intestinal MDR1 expression in the interaction of digoxin with rifampin, and plasma concentration-time profiles were monitored after oral and intravenous administration of digoxin at 1 mg before and after oral administration of rifampin once daily for 16 d. Using the digoxin plasma concentration data after MDR1 induction by rifampin, Hoffmeyer et al.50) suggested that intestinal absorption of digoxin was greater in the subjects with the T-allele at position 3435. Login to comment

PMID: 12426521 [PubMed] Siegmund W et al: "The effects of the human MDR1 genotype on the expression of duodenal P-glycoprotein and disposition of the probe drug talinolol."

No. Sentence Comment

32 The following 10 most frequent or putatively functional SNPs of the MDR1 gene were identified, as recently described19 : intron 1 (exon 2 -1) G/A, exon 2 A61G (amino acid exchange Asn21Asp), intron 6 (exon 6 ϩ139) C/T, exon 11 G1199A (Ser400Asn), exon 12 C1236T, intron 12 (exon 12 ϩ44) C/T, intron 16 (exon 17 -76) T/A, exon 21 G2677T (Ala893Ser), G2677A (Ala893Thr), and exon 26 C3435T. Login to comment
112 Other authors, however, did not observe any significant correlation between the MDR1 genotype and fexofenadine disposition35 ; furthermore, a study in human placenta trophoblasts obtained from 100 Japanese women revealed less placental P-glycoprotein (Western blotting) in individuals having the G2677A/T allele.20 The nonanonymous variants A61G (Asn21Asp) in exon 2 and G1199A (Ser400Asn) in exon 11 were also expected to have a functional impact on human P-glycoprotein. Login to comment
113 The Asn21Asp exchange is located close to the N-terminus and the Ser400Asn variant just preceding the first adenosine triphosphate-binding domain.22 However, both mutations in our study did not influence P-glycoprotein expression and talinolol disposition. Login to comment

PMID: 12769780 [PubMed] Toffoli G et al: "Pharmacogenetics of irinotecan."

No. Sentence Comment

261 Also T307C and G1199A are mutations causing a significant aminoacid change (Phe103Leu and Ser400Asn respectively) in important zones of the protein and possibly affecting the P-gp efficacy. Login to comment

PMID: 12831320 [PubMed] Sakaeda T et al: "Pharmacogenetics of MDR1 and its impact on the pharmacokinetics and pharmacodynamics of drugs."

No. Sentence Comment

75 Position Location Effect A1a/-41G Intron Non-coding C-145G Exon 1a Non-coding T-129C (T12C) Exon 1b Non-coding C-4T Exon 2 Non-coding G-1A Exon 2 Non-coding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/+139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/+44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/+137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent See references [34-39]. Login to comment

PMID: 12893986 [PubMed] Kroetz DL et al: "Sequence diversity and haplotype structure in the human ABCB1 (MDR1, multidrug resistance transporter) gene."

No. Sentence Comment

141 Unauthorized reproduction of this article is prohibited. Table 1 Genetic variation in ABCB1 Allele frequencyd Variant cDNA NT DNA/AA AA Total CA AA AS ME PA No.a positionb changec position change (n ¼ 494) (n ¼ 200) (n ¼ 200) (n ¼ 60) (n ¼ 20) (n ¼ 14) 1.1Ã (À274) G to A Intron À1 0.006 0 0.016 0 0 0 1.2Ã (À223) C to T Intron À1 0.002 0.005 0 0 0 0 1.3Ã (À146) T to C Intron À1 0.002 0 0.005 0 0 0 1.4Ã (À60) A to T Intron À1 0.004 0 0.010 0 0 0 1.5 (À41) A to G Intron À1 0.002 0 0 0.017 0 0 1.6Ã À241 G to A Non-coding 0.002 0 0 0.017 0 0 1.7 À145 C to G Non-coding 0.002 0 0 0.017 0 0 1.8 À129 T to C Non-coding 0.060 0.051 0.071 0.036 0.100 0.071 1.9 À43 A to G Non-coding 0.012 0 0.020 0.036 0 0 1.10Ã (+140) C to A Intron 1 0.013 0.005 0.021 0 0 0.071 1.11Ã (+237) G to A Intron 1 0.004 0 0.010 0 0 0 2.1 À4 C to T Non-coding 0.004 0 0.010 0 0 0 2.2 À1 G to A Non-coding 0.036 0.080 0.005 0 0.050 0 2.3 61 A to G 21 Asn to Asp 0.045 0.080 0.025 0.017 0 0 4.1Ã (À8) C to G Intron 3 0.002 0.005 0 0 0 0 4.2Ã 266 T to C 89 Met to Thr 0.002 0.005 0 0 0 0 5.1 (À25) G to T Intron 4 0.210 0.158 0.300 0.067 0.200 0.286 8.1 729 A to G 243 Syn 0.002 0.005 0 0 0 0 8.2Ã 781 A to G 261 Ile to Val 0.006 0 0.015 0 0 0 10.1Ã (À44) A to G Intron 9 0.400 0.450 0.255 0.685 0.450 0.571 11.1Ã (À41) T to G Intron 10 0.002 0 0 0.017 0 0 11.2 1199 G to A 400 Ser to Asn 0.014 0.025 0.010 0 0 0 12.1Ã (À4) G to A Intron 11 0.002 0 0.005 0 0 0 12.2 1236 C to T 412 Syn 0.385 0.459 0.209 0.685 0.450 0.571 12.3Ã 1308 A to G 436 Syn 0.002 0 0.005 0 0 0 12.4Ã (+17) G to A Intron 12 0.008 0 0.020 0 0 0 12.5 (+44) C to T Intron 12 0.088 0.046 0.168 0 0 0 13.1 (+24) C to T Intron 13 0.530 0.521 0.542 0.540 0.450 0.571 14.1 1617 C to T 539 Syn 0.002 0.005 0 0 0 0 14.2 (+38) A to G Intron 14 0.540 0.505 0.540 0.683 0.450 0.500 15.1 (+38) G to A Intron 15 0.004 0.005 0.005 0 0 0 16.1Ã 1985 T to G 662 Leu to Arg 0.002 0.005 0 0 0 0 16.2Ã 2005 C to T 669 Arg to Cys 0.004 0 0.010 0 0 0 18.1Ã (À27) A to G Intron 17 0.008 0.010 0.005 0 0.050 0 20.1Ã (+8) C to G Intron 20 0.002 0 0.005 0 0 0 20.2 (+24) G to A Intron 20 0.126 0.121 0.150 0.067 0.200 0 20.3Ã (+40) C to T Intron 20 0.014 0 0.035 0 0 0 21.1Ã 2547 A to G 849 Ile to Met 0.002 0.005 0 0 0 0 21.2 2650 C to T 884 Syn 0.004 0.005 0.005 0 0 0 21.3a 2677 G to T 893 Ala to Ser 0.308 0.464 0.100 0.450 0.400 0.357 21.3b 2677 G to A 893 Ala to Thr 0.035 0.036 0.005 0.067 0 0.357 22.1 (+31) G to A Intron 22 0.002 0 0.005 0 0 0 25.1Ã 3151 C to G 1051 Pro to Ala 0.002 0 0.005 0 0 0 26.1Ã 3322 T to C 1108 Trp to Arg 0.002 0 0.005 0 0 0 26.2 3421 T to A 1141 Ser toThr 0.047 0 0.111 0 0.050 0 26.3 3435 C to T 1145 Syn 0.392 0.561 0.202 0.400 0.500 0.500 28.1 3751 G to A 1251 Val to Ile 0.002 0 0 0 0.050 0 28.2 3767 C to A 1256 Thr to Lys 0.002 0.005 0 0 0 0 28.3 (+21) T to C Intron 28 0.031 0 0.077 0 0 0 a Variants are numbered sequentially by exon. Login to comment
164 M89T I849M V1251I T1256K S1141TW1108R P1052AR669C A893S/T L662R Cytoplasm S400N I261V N21D Extracellular Fig. 1. Login to comment
301 Other non-synonymous variants (Asn21Asp, Phe103Leu, Ser400Asn, and Ala998Thr) have also been shown not to affect P-glycoprotein function [43]. Login to comment

PMID: 14576852 [PubMed] Ambudkar SV et al: "P-glycoprotein: from genomics to mechanism."

No. Sentence Comment

85 Kioka et al. (1989) showed a slight increase in resistance to doxorubicin, but no effect on colchicine or vinblastine Table 2 Common MDR1 exonic polymorphisms Exon number Polymorphic nucleotide variant Change in amino acid References 1 À145 - Ito et al. (2001) 1 À129 - Hoffmeyer et al. (2000); Tanabe et al. (2001) 2 61 N21D Cascorbi et al. (2001); Decleves et al. (2000); Hoffmeyer et al. (2000); Kim et al. (2001) 5 307 F103L Hoffmeyer et al. (2000) 7 548 N183S Kim et al. (2001) 10 1107 G369P Hoffmeyer et al. (2000) 11 1199 S400N Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001) 12 1236 Wobble Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 13 1474 R492C Kim et al. (2001) 21 2650 Wobble Kim et al. (2001) 21 2677 893A, S, or T Cascorbi et al. (2001); Kim et al. (2001); Kioka et al. (1989); Mickley et al. (1998) 24 2956 M986V Tanabe et al. (2001) 24 2995 A999T Mickley et al. (1998) 26 3320 Q1107P Cascorbi et al. (2001) 26 3396 Wobble Hoffmeyer et al. (2000) 26 3421 S1141T Kim et al. (2001) 26a 3435 Wobble Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 28 4030 - Tanabe et al. (2001) 28 4036 - Kioka et al. (1989); Tanabe et al. (2001) a The only polymorphism that correlates with changes in drug delivery and disposition P-glycoprotein SV Ambudkar et al resistance in the SNP located on exon 21, position 2677, Ser893 (Kioka et al., 1989). Login to comment
110 HeLa cells were infected/transfected with empty vector (pTM1), wild-type pTM1-MDR1, pTM1-MDR1-S400N, pTM1-MDR1-N21D, pTM1-MDR1-F103L, pTM1-MDR1-A998T, and pTM1-MDR1-A893S, and were analysed by FACS as described previously (Kimchi-Sarfaty et al., 2002) Table 3 Selected substrates and modulators of P-glycoprotein Substrates Modulators Vinca alkaloids Calcium channel blockers Vinblastine Verapamil Vincristine Dihydropyridines Anthracyclines Antiarrhythmics Daunorubicin Quinine Doxorubicin Antihypertensives Antibiotics Reserpine Dactinomycin Antibiotics Actinomycin D Cephalosporins Other cytotoxic agents Immunosuppressants Mitomycin Cyclosporin A Taxol Steroid hormones Colchicine Progesterone Puromycin HIV protease inhibitors Digoxin Saquinavir Alcoholism treatment drug Disulfiram Phytochemical Curcumin Moreover, most of these studies correlated the manifestation of this polymorphism with a change in drug delivery or disposition. Login to comment

PMID: 14646693 [PubMed] Sai K et al: "Haplotype analysis of ABCB1/MDR1 blocks in a Japanese population reveals genotype-dependent renal clearance of irinotecan."

No. Sentence Comment

103 746Pharmacogenetics2003,Vol13No12 Copyright(c)LippincottWilliams&Wilkins.Unauthorizedreproductionofthisarticleisprohibited. Table 3 Classification of major ABCB1 haplotypes Site Exon 2 Exon 5 Exon 7 Exon 11 Exon 12 Exon 13 Exon 21 Exon 21 Exon 21 Exon 26 Exon 26 Exon 27 Exon 28 PositionÃ Exon 1 Exon 1 61A.G 325G.A 548A.G 1199G.A 1236C.T 1474C.T 2650C.T 2677G.T 2677G.A 3421T.A 3435C.T 3587T.G 3751G.A Effect on protein À4C.T À1G.A N21D E109K N183S S400N G412G R492C L884L A893S A893T S1141T I1145I I1196S V1251I Classification by Kim et al. [12] Ã1 - - - - - - - - - - - Ã1A - - - - A - - - - - - Ã1B T - - - - - - - - - - Ã1C - - - - - - - - - A - Ã1D - - - G - - - - - - - Ã2 - - - - - T - - T - T Ã2A - - G - - T - - T - T Ã2B - - - - - T - T T - T Ã2C - - - - - T T - T - T Ã3 - - - - - - - - T - T Ã4 - - - - - T - - - - T Ã5 - A - - - - - - - - T Ã6 - - - - - - - - - - T Ã7 - - - - - - - - T - - Ã8 - - - - - T - - - - - Classification of haplotype group detected in this paperÃÃ Block 1 Ã1 - - - - Ã2 - - G - Block 2 Ã1 - - - - - - - - - Ã2 - - T - - T - - T Ã4 - - T - - - - - T Ã6 - - - - - - - - T Ã8 - - T - - - - - - Ã9 - - - - - - - - - Ã10 - - - - - - A - - Ã11 - - T - - - A - - Block 3 Ã1 - - Ã2 - A Ã3 G - ÃAdenine of the initiation codon ATG in exon 2 was numbered +1. Login to comment

PMID: 14676821 [PubMed] Wadelius M et al: "Warfarin sensitivity related to CYP2C9, CYP3A5, ABCB1 (MDR1) and other factors."

No. Sentence Comment

23 There are many known polymorphisms in ABCB1: for example, À12T4C in exon 1 in the 50 untranslated region, À1G4A at the initiation of translation in exon 2, 1199G4A in exon 11 leading to amino-acid change S400N, 1236C4T in exon 12 at a wobble position G412G, 2677G4T or G4A in exon 21 leading to A893S or T, and in exon 26 two polymorphisms at wobble positions, 3396C4T A1132A and 3435C4T I1145I.28,30 Polymorphisms of ABCB1 are suggested to be important for variability in drug bioavailability, but the pharmacological implication of these polymorphisms has not been fully established.30 Haemorrhage is the most common adverse reaction to coumarin anticoagulants, and a great under-reporting of these events is believed to exist.3,31 Swedish studies have shown that 4.5% of warfarin-treated patients experience major bleeding and 0.5% suffer fatal complications.31 The risk of bleeding is 10 times higher during the first month compared to after the first year.5 There is a clear relationship between haemorrhage and the intensity of treatment, with PT INR elevation being a strong predictor.3,5,10,32 Age, concurrent medication, specific comorbid conditions, especially cerebrovascular, kidney, heart and liver disease as well as prosthetic heart valves, are independent risk factors.5,32 Several studies suggest that patients with CYP2C9 variant alleles have a higher incidence of bleeding complications than carriers of the wild-type genotype.15,16,20,22 The risk of haemorrhage must always be weighed against the prevention of thromboembolism, and in most patients the preventive effect outweighs the risk of bleeding.4,32 The aim of the study was to identify factors that influence the effect of warfarin and the required dose. Login to comment
74 Table 5 Alignment and frequencies of predicted ABCB1 haplotypes in the dose requirement study ABCB1 haplotypes A B C D E F G Others Variable sites Exon 1 (À12T4C 50 untranslated region) T T T T T T T Exon 2 (À1G4A translation initiation) G G A G G G G Exon 11 (1199G4A S400N) G G G G A G G Exon 12 (1236C4T G412G) T C C C C C T Exon 21 (2677G4T/A A893S/T) T G G G G A T Exon 26 (3396C4T A1132A) C C C C C C C Exon 26 (3435C4T I1145I) T C T T C T C Frequencies in dose study (201 patients)a 40.8% 33.3% 10.0% 5.0% 3.5% 2.5% 1.0% p1.0% each Distribution of haplotypes in three dose groups Low dose/BW (o0.33 mg/kg) 33.3% 34.8% 24.3% 60.0% 30.8% 40.0% 25.0% Medium dose/BW (0.33-0.46 mg/kg) 35.7% 30.4% 29.7% 25.0% 23.1% 20.0% 25.0% High dose/BW (40.46 mg/kg) 31.0% 34.8% 46.0% 15.0% 46.2% 40.0% 50.0% P w2 0.5575 0.6016 0.1786 0.0242 0.5623 0.6564 0.7749 P Fischer`s exact 0.5769 0.6369 0.1821 0.0348 0.6778 0.7767 1.00 P trend 0.5888 1.00 0.0745 0.0094 0.4824 1.00 0.5362 a Two out of 201 were not genotyped for Exon 1 (À12T4C), and their haplotypes are estimated as B/B and A/F, respectively, according to the results from polymorphisms in Exon s 2, 11, 12, 21, 26 and 26. Login to comment

PMID: 14749689 [PubMed] Marzolini C et al: "Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance."

No. Sentence Comment

75 Summary of genetic polymorphisms in MDR1 Location Position Mutation Effect Mutant allele frequency (%) Hoffmeyer et al89 : C Cascorbi et al90 : C Siegmund et al91 : C Promotor 5' flanking/-41 A/G Noncoding Exon 1a Exon 1a/-145 C/G Noncoding Exon 1b Exon 1b/-129 T/C Noncoding 5.9 Intron 1 Exon 2/-4 C/T Noncoding Intron 1 Exon 2/-1 G/A Initial translation 5.6 9 3.7 Exon 2 Exon 2/61 A/G Asn21Asp 9.3 11.2 8.9 Intron 4 Exon 5/-35 G/C 0.6 Intron 4 Exon 5/-25 G/T 16.5 Exon 5 Exon 5/307 T/C Phe103Leu 0.6 0 Intron 6 Exon 6/ϩ139 C/T 40.6 37.2 35.8 Intron 6 Exon 6/ϩ145 C/T 1.2 Exon 7 Exon 7/548 A/G Asn183Ser Exon 11 Exon 11/1199 G/A Ser400Asn 6.5 5.5 2.9 Exon 12 Exon 12/1236 C/T Silent 37.8 41 34.3 Intron 12 Exon 12/ϩ44 C/T 5.9 4.9 7.5 Exon 13 Exon 13/1474 C/T Arg492Cys Intron 16 Exon 17/-76 T/A 45.3 46.2 49.3 Intron 17 Exon 17/ϩ137 A/G 0.6 Exon 21 Exon 21/2650 C/T Silent Exon 21 Exon 21/2677 G/T Ala893Ser 41.6 40.3 G/A Ala893Thr 1.9 3.7 Exon 24 Exon 24/2956 A/G Met986Val Exon 24 Exon 24/2995 G/A Ala999Thr Exon 26 Exon 26/3320 A/C Gln1107Pro 0.2 Exon 26 Exon 26/3396 C/T Silent 0.3 Exon 26 Exon 26/3421 T/A Ser1141Thr Exon 26 Exon 26/3435 C/T Silent 48.1 53.9 50.7 Exon 28 Exon 28/4030 G/C Exon 28 Exon 28/4036 A/G The positions of the polymorphisms were established with the first base of the ATG start codon set to 1. Login to comment

PMID: 15100388 [PubMed] Woodahl EL et al: "Multidrug resistance gene G1199A polymorphism alters efflux transport activity of P-glycoprotein."

No. Sentence Comment

0 Multidrug Resistance Gene G1199A Polymorphism Alters Efflux Transport Activity of P-Glycoprotein Erica L. Woodahl, Ziping Yang, Tot Bui, Danny D. Shen, and Rodney J. Y. Ho Department of Pharmaceutics, University of Washington, Seattle, Washington Received January 13, 2004; accepted April 20, 2004 ABSTRACT The significance of the human multidrug resistance gene (MDR1) G1199A polymorphism, resulting in a Ser400Asn modification in P-glycoprotein (P-gp), remains unclear. Login to comment

PMID: 15212152 [PubMed] Pauli-Magnus C et al: "Functional implications of genetic polymorphisms in the multidrug resistance gene MDR1 (ABCB1)."

No. Sentence Comment

28 6, June 2004 ((c) 2004) 9040724-8741/04/0600-0904/0 (c) 2004 Plenum Publishing Corporation Table I. MDR1 Coding Variants cDNA positiona NT change DNA/AA position AA change Allele frequencyb Total (n ‫ס‬ 494) CA (n ‫ס‬ 200) AA (n ‫ס‬ 200) AS (n ‫ס‬ 60) ME (n ‫ס‬ 20) PA (n ‫ס‬ 14) 61 A to G 21 Asn to Asp 0.045 0.080 0.025 0.017 0 0 266 T to C 89 Met to Thr 0.002 0.005 0 0 0 0 729 A to G 243 Syn 0.002 0.005 0 0 0 0 781 A to G 261 Ile to Val 0.006 0 0.015 0 0 0 1199 G to A 400 Ser to Asn 0.014 0.025 0.010 0 0 0 1236 C to T 412 Syn 0.385 0.459 0.209 0.685 0.450 0.571 1308 A to G 436 Syn 0.002 0 0.005 0 0 0 1617 C to T 539 Syn 0.002 0.005 0 0 0 0 1985 T to G 662 Leu to Arg 0.002 0.005 0 0 0 0 2005 C to T 669 Arg to Cys 0.004 0 0.010 0 0 0 2547 A to G 849 Ile to Met 0.002 0.005 0 0 0 0 2650 C to T 884 Syn 0.004 0.005 0.005 0 0 0 2677 G to T 893 Ala to Ser 0.308 0.464 0.100 0.450 0.400 0.357 2677 G to A 893 Ala to Thr 0.035 0.036 0.005 0.067 0 0.357 3151 C to G 1051 Pro to Ala 0.002 0 0.005 0 0 0 3322 T to C 1108 Trp to Arg 0.002 0 0.005 0 0 0 3421 T to A 1141 Ser to Thr 0.047 0 0.111 0 0.050 0 3435 C to T 1145 Syn 0.392 0.561 0.202 0.400 0.500 0.500 3751 G to A 1251 Val to Ile 0.002 0 0 0 0.050 0 3767 C to A 1256 Thr to Lys 0.002 0.005 0 0 0 0 a cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758. Login to comment

PMID: 15256718 [PubMed] Ishikawa T et al: "Pharmacogenomics of drug transporters: a new approach to functional analysis of the genetic polymorphisms of ABCB1 (P-glycoprotein/MDR1)."

No. Sentence Comment

79 For this purpose, the cDNA of ABCB1 was cloned from the human liver cDNA library, and several variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) were prepared by site-directed mutagenesis (see Fig. 4A for primers). Login to comment
94 The variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) exhibited the verapamil-enhanced ATPase activity, as did the wild type of ABCB1. Login to comment
118 Kinetic Parameters of the Wild Type and SNP Variants of ABCB1 Variant Km Vmax (mM) (nmol/min/mg protein) Wild type 2.190Ϯ0.150 13.14Ϯ1.95 N21D 0.502Ϯ0.126 45.26Ϯ11.33 N44S 0.580Ϯ0.148 31.03Ϯ4.65 F103L 1.100Ϯ0.078 36.34Ϯ8.33 G185V 0.831Ϯ0.102 56.76Ϯ6.76 S400N 0.327Ϯ0.025 13.74Ϯ2.08 A893S 0.441Ϯ0.042 17.24Ϯ6.72 A893T 0.904Ϯ0.244 10.77Ϯ1.35 M986V 0.419Ϯ0.062 22.69Ϯ6.84 The wild type and variants of ABCB1 were then expressed it in Sf9 cells using the pFASTBAC1 vector and recombinant baculoviruses. Login to comment

PMID: 15379652 [PubMed] Sakaeda T et al: "Pharmacogenetics of drug transporters and its impact on the pharmacotherapy."

No. Sentence Comment

127 Position Location Effect A1a/-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G G5/-25T G5/-35C exon 2 intron intron Asn21Asp T307C C6/+139T exon 5 intron Phe103Leu A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T C12/+44T exon 12 intron silent C1474T T17/-76A A17/+137G exon 13 intron intron Arg492Cys C2650T exon 21 silent G2677(A,T) exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent The list was based on the reports [67,68,71-74]. Login to comment

PMID: 15499164 [PubMed] Ishikawa T et al: "Functional evaluation of ABCB1 (P-glycoprotein) polymorphisms: high-speed screening and structure-activity relationship analyses."

No. Sentence Comment

78 For this purpose, the cDNA of ABCB1 was cloned from the human liver cDNA library, and several variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) were prepared by site-directed mutagenesis (see Fig. 2A for primers). Login to comment
86 The variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) exhibited the verapamil-enhanced ATPase activity, as did the wild type of ABCB1. Login to comment
105 Kinetic parameters of the wild type and SNP variants of ABCB1 Variant Km Vmax (mM) (nmolWminWmg protein) Wild type 2.190±0.150 13.14±1.95 N21D 0.502±0.126 45.26±11.33 N44S 0.580±0.148 31.03±4.65 F103L 1.100±0.078 36.34±8.33 G185V 0.831±0.102 56.76±6.76 S400N 0.327±0.025 13.74±2.08 A893S 0.441±0.042 17.24±6.72 A893T 0.904±0.244 10.77±1.35 M986V 0.419±0.062 22.69±6.84 The wild type and variants of ABCB1 were then expressed it in Sf9 cells using the pFASTBAC1 vector and recombinant baculoviruses. Login to comment

PMID: 15499174 [PubMed] Ozawa S et al: "Ethnic differences in genetic polymorphisms of CYP2D6, CYP2C19, CYP3As and MDR1/ABCB1."

No. Sentence Comment

85 Ethnic dierences in nonsynonymous SNPs of ABCB1W MDR1 cDNA positiona Position and amino acid change C AA AS J 61AÀG N21D 0.080 0.025 0.017 0 266TÀC M89T 0.005 0 0 0 781AÀG I261V 0 0.015 0 0 1199GÀA S400N 0.025 0.010 0 0 1985TÀG L662R 0.005 0 0 0 2005CÀT R669C 0 0.010 0 0 2547AÀG I849M 0.005 0 0 0 2677GÀT A893S 0.464 0.100 0.450 0.403 2677GÀA A893T 0.036 0.005 0.067 0.200 3151CÀG P1051A 0 0.005 0 0 3322TÀC W1108R 0 0.005 0 0 3421TÀA S1141T 0 0.111 0 0 3751GÀA V1251I 0 0 0 0.010 3767CÀA T1256K 0.005 0 0 0 C, 100 Caucasians; AA, 100 African-Americans; AS, 30 Asians; J, 145 Japanese (our study 116) ). Login to comment

PMID: 15618700 [PubMed] Honda T et al: "Polymorphism of MDR1 gene in healthy japanese subjects: a novel SNP with an amino acid substitution (Glu108Lys)."

No. Sentence Comment

13 To date, the following SNPs in the MDR1 gene leading to amino acid substitutions have been identiˆed: A61G (Asn21Asp) in exon 2, T307C (Phe103Leu) in exon 5, G1199A (Ser400Asn) in exon 11, G2677T (Ala893Ser) in exon 21, G2677A (Ala893Thr) in exon 21 and A2956G (Met986Val) in exon 24. Login to comment

PMID: 15618713 [PubMed] Itoda M et al: "Twelve novel single nucleotide polymorphisms in ABCB1/MDR1 among Japanese patients with ventricular tachycardia who were administered amiodarone."

No. Sentence Comment

18 Much eort has been taken to uncover polymorphisms in the ABCB1WMDR1 gene since a synonymous SNP, which correlated with diminished MDR1 expression levels in the human duodenum, was reported by Homeyer et al.7) To date, information on 19 single nucleotide polymorphisms (SNPs) including 7 nonsynonymous ones (N21D, F103L, S400N, A893S, A893T, A999T and Q1107P) for ABCB1WMDR1 have been reported in Caucasians.8,9) ABCB1WMDR1 gene SNPs including intronic10) and 2 nonsynonymous SNPs (E108K, M986V)11,12) were also reported in Japanese population. Login to comment
78 Moreover, the reported nonsynonymous polymorphisms, N21D, F103L, S400N, A893S and A999T have been shown not to substantially aect the activity of P-glycoprotein14) . Login to comment

PMID: 15692830 [PubMed] Allabi AC et al: "Single nucleotide polymorphisms of ABCB1 (MDR1) gene and distinct haplotype profile in a West Black African population."

No. Sentence Comment

66 AA amino acid, n number of chromosomes examined, ND not detected Variant no.a cDNA positionb NT changec DNA/AA position AA change Allele frequencyd (n=222) 2.1 À4 C to T Non-coding 0.0045 2.2 À1 G to A Non-coding 0 2.3 61 A to G 21 Asn to Asp 0 6.1 139 C to T Intron 6 0.17 9.0* À57 del A Intron 9 0.009 10.1 À44 A to G Intron 9 0.18 10.0* À8 T to A Intron 9 0.0045 11.1 À41 T to G Intron 10 0 11.2 1199 G to A 400 Ser to Asn 0 12.2 1236 C to T 412 Syn 0.15 14.1 1617 C to T 539 Syn 0 14.0* 1662 G to C 554 Syn 0.009 14.2 38 A to G Intron 14 0.49 17.1 À76 T to A Intron 16 0.347 21.2 2650 C to T 884 Syn 0 21.3a 2677 G to T 893 Ala to Ser 0.009 21.3b 2677 G to A 893 Ala to Thr 0 26.2 3421 T to A 1141 Ser to Thr 0.054 26.3 3435 C to T 1145 Syn 0.14 a Variants are numbered sequentially by exon. Login to comment

PMID: 15910652 [PubMed] Owen A et al: "The implications of P-glycoprotein in HIV: friend or foe?"

No. Sentence Comment

83 Increased in TT homozygotesCD4 response Singh et al. (2003) [84] 71 (11% Caucasian; 23% Hispanic; 66% Black) 8 weeks NFV, EFV NFV level Lower in CC homozygotes CD4 response No difference Petersen et al. (2003) [85] 142 (Caucasian, African-American or Hispanic) 48 weeks NFV, EFV CD4 response No difference Verstuyft et al. (2003) [86] 76 (Not given) 72 weeks IDV Drug level No difference Maher et al. (2003) [87] 12 (Caucasian) 1 dose IDV Cmax Higher in CC homozygotes Brumme et al. (2003) [88] 461 (Predominantly Caucasian and Aboriginal) 192 weeks Not Specified CD4 response No difference Nasi et al. (2003) [89] 149 (Caucasian) 24 weeks Not specified CD4 and virological response to PIs No difference CD4 response to NNRTIs Higher in TT homozygotes Ifergan et al. (2003) [90] 137 (Caucasian) N/A N/A HIV-1 infectivity No difference Chandler et al. (2003) [44] 16 (Caucasian) N/A N/A P-gp inducibility No difference Haas et al. (2003) [91] 31 (84% Caucasian) 24 weeks RTV Ctrough No difference CD4 and virological response No difference Winzer et al. (2003) [92] 67 (Caucasian) LPV 53 weeks; EFV 105 weeks LPV, EFV LPV Ctrough No difference EFV C12 No difference Bleiber et al. (2004) [53] 411 (Predominantly Caucasian) 8 years Not specified CD4+ response No difference van der Ende et al. (2004) [93] 186 (61% Caucasian; 30% Black) 12 weeks NVP Drug levels No difference Hulgan et al. (2004) [94] 205 (72% Caucasian; 28% Black) During routine care Not specified P-gp efflux activity Lower in TT homozygotes CD4 and virological response No difference Anderson et al. (2004) [95] 33 (79% Caucasian; 21% Black) 72 weeks IDV CL/F No difference Owen et al. (2004) [96] 108 (>80% Caucasian) 48 weeks IDV, SQV, RTV Ctrough No difference serine to asparagine at position 400 of the protein. Login to comment

PMID: 16004559 [PubMed] Hung CC et al: "Complex haplotypic effects of the ABCB1 gene on epilepsy treatment response."

No. Sentence Comment

40 The following 10 SNPs of the ABCB1 gene were identified by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) [15]: intron 1 (exon 2 -1) G/A, exon 2 A61G (amino acid exchange Asn21Asp), intron 6 (exon 6 +139) C/T, exon 11 G1199A (Ser400Asn), exon 12 C1236T, intron 12 (exon 12 +44) C/T, intron 16 (exon 17 -76) T/A, exon 21 G2677T (Ala893Ser), G2677A (Ala893Thr), and exon 26 C3435T. Login to comment

PMID: 16184031 [PubMed] Woodahl EL et al: "MDR1 G1199A polymorphism alters permeability of HIV protease inhibitors across P-glycoprotein-expressing epithelial cells."

No. Sentence Comment

0 MDR1 G1199A polymorphism alters permeability of HIV protease inhibitors across P-glycoprotein-expressing epithelial cells Erica L. Woodahl, Ziping Yang, Tot Bui, Danny D. Shen and Rodney J.Y. Ho Objective: To evaluate the impact of the human multidrug resistance gene (MDR1) G1199A polymorphism (amino acid change Ser400Asn) on P-glycoprotein (P-gp)- dependent transepithelial permeability and uptake kinetics of HIV protease inhibitors (PI), by using recombinant epithelial cells expressing wild-type MDR1 (MDR1wt ) or the G1199A variant (MDR11199A). Login to comment
29 G1199A results in a serine to asparagine transition at amino acid 400 (Ser400Asn) in a cytoplasmic domain of P-gp, with an allelic frequency of approximately 5.5% in Caucasians [26-28]. Login to comment
135 The mechanisms by which G1199A alters P-gp activity are not yet known. The G1199A polymorphism causes a Ser400Asn, which lies adjacent to the first ATP-binding domain of P-gp and to transmembrane domain 6, one of the transmembrane domains important in substrate binding [32,33]. Login to comment
136 However, because a crystal structure for P-gp is not yet available, the exact orientation of Ser400Asn relative to the substrate-binding regions or ATP-binding domain of P-gp is not known. The G1199A polymorphism may affect ATPase activity of P-gp, altering ATP hydrolysis necessary for substrate efflux. Login to comment

PMID: 16370938 [PubMed] Dey S et al: "Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition."

No. Sentence Comment

106 The G1199A SNP is located in the cytoplasmic loop close to the first ATP-binding domain and changes the amino acid from Ser to Asn (Ser400Asn). Login to comment
123 Location Position Mutation Effect Promoter 5`/-41 A→G Noncoding Exon 1a Exon 1a/-145 C→G Noncoding Exon 1b Exon 1b/-129 T→C Noncoding Intron 1 Exon 2/-4 C→T Noncoding Intron 1 Exon 2/-1 G→A Initiation of translation Exon 2 Exon 2/61 A→G Asn21Asp Intron 4 Exon 5/-35 G→C Intron 4 Exon 5/-25 G→T Exon 5 Exon 5/307 T→C Phe103Leu Intron 6 Exon 6/+139 C→T Intron 6 Exon 6/+145 C→T Exon 7 Exon 7/548 A→G Asn183Ser Exon 11 Exon 11/1119 G→A Ser400Asn Exon 12 Exon 12/1236 C→T Silent base change Intron 12 Exon 12/+44 C→T Exon 13 Exon 13/1474 C→T Arg492Cys Intron 16 Exon 17/-76 T→A Intron 17 Exon 17/+137 A→G Exon 21 Exon 21/2650 C→T Silent base change Exon 21 Exon 21/2677 G→T G→A Ala893Ser Ala893Thr Exon 24 Exon 24/2956 A→G Met986Val Exon 24 Exon 24/2995 G→A Ala999Thr Exon 26 Exon 26/3320 A→C Gln1107Pro Exon 26 Exon 26/3396 C→T Silent base change Exon 26 Exon 26/3421 T→A Ser1141Thr Exon 26 Exon 26/3435 C→T Silent base change Exon 28 Exon 28/4030 G→C Exon 28 Exon 28/4036 A→G The positions of the polymorphism are from the first base of the ATG start codon set to 1. Login to comment

PMID: 16415525 [PubMed] Sakaeda T et al: "MDR1 genotype-related pharmacokinetics: fact or fiction?"

No. Sentence Comment

29 Representative genetic polymorphisms in MDR1 Position Location EŠect A1aW-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G exon 2 Asn21Asp G5W-25T intron G5W-35C intron T307C exon 5 Phe103Leu C6W＋139T intron C6W＋145T intron A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T exon 12 silent C12W＋44T intron C1474T exon 13 Arg492Cys T17W-76A intron A17W＋137G intron C2650T exon 21 silent G2677A,T exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent See references 27, 32-36. Login to comment

PMID: 16708052 [PubMed] Leschziner G et al: "Exon sequencing and high resolution haplotype analysis of ABC transporter genes implicated in drug resistance."

No. Sentence Comment

117 444 SNPs, rs2229109, a non-synonymous SNP (S400N), and rs9282563. Login to comment

PMID: 17001288 [PubMed] Owen A et al: "Pharmacogenetics of HIV therapy."

No. Sentence Comment

69 Another polymorphism that has been studied in the context of PI disposition is the G1199A SNP that results in an amino acid change (Ser400Asn) in P-glycoprotein. Login to comment
171 Pharmacogenetics of HIV therapy Owen et al. 699 Table 1 Polymorphisms that have been studied within the context of metabolism, transport and toxicity (but not progression and response) along with the reference ID (where available), the genotypic consequence and the observed phenotype for antiretroviral drugs Gene SNP (haplotype) Reference SNP Genotypic consequence Phenotypic consequence Confirmation CYP3A4 A - 392G (CYP3A4*1B) rs2740574 Promoter; altered expression No effect on nelfinavir or efavirenz Yes for nelfinavir; controversial for efavirenz T878C (CYP3A4*18) rs4986909 L293P; altered activity No effect on efavirenz No CYP3A5 A6986G (CYP3A5*3) rs776746 Splice defect No effect on nelfinavir, saquinavir or efavirenz AUC but altered urinary metabolic ratio of saquinavir Yes for efavirenz G14690A (CYP3A5*6) rs10264272 Splice defect No effect on nelfinavir or efavirenz Yes CYP2C19 G681A (CYP2C19*2) rs4244285 Truncated protein Higher nelfinavir AUC and trend toward decreased virological failure; no effect on efavirenz Yes for efavirenz; controversial for nelfinavir CYP2D6 A2549del (CYP2D6*3) NT21914757 Frameshift Trend to higher plasma levels of nelfinavir and efavirenz No G1846A (CYP2D6*4) rs3892097 Splice defect Trend to higher plasma levels of nelfinavir and efavirenz No T1707del (CYP2D6*6) rs5030655 Frameshift Higher plasma nelfinavir concentrations No CYP2B6 G516 T (CYP2B6*6, *7, *9, *13, *19 and *20) rs3745274 Q172H Higher plasma and intracellular efavirenz AUCs and increased neurotoxicity Yes, numerous studies C1459T (CYP2B6*5 and *7) rs3211371 R487C No effect on nelfinavir or efavirenz No ABCB1 IVS1 - 80delG rs3214119 N/A No influence on cellular nelfinavir No A61G rs9282564 N21D No influence on cellular nelfinavir No TAG1 rs3789243 N/A No influence on cellular nelfinavir No G1199A rs2229109 S400N No influence on cellular nelfinavir No TAG5 rs1128503 N/A No influence on cellular nelfinavir No TAG6 rs2235046 N/A No influence on cellular nelfinavir No IVS21 + T49C rs2032583 N/A No influence on cellular nelfinavir No C3435T rs1045642 Synonymous Some evidence of an influence on plasma and intracellular nelfinavir; decreased efavirenz plasma concentrations; currently under debate; increase in HDL cholesterol with efavirenz Controversial G2677T rs2032582 Ala893Ser No effect on efavirenz, ritonavir, nelfinavir, indinavir or viral decay and CD4 count Yes IVS26 + T59G rs2235047 N/A No influence on cellular nelfinavir No IVS26 + T80C rs2235048 N/A Increased intracellular nelfinavir concentrations No TAG11 rs1186746 N/A No influence on cellular nelfinavir No TAG12 rs1186745 N/A No influence on cellular nelfinavir No ABCC1 G816A P272P No influence on cellular nelfinavir No T825C rs246221 V275V No influence on cellular nelfinavir No T1062C rs35587 Synonymous No influence on cellular nelfinavir No IVS9 + A8G rs35588 N/A No influence on cellular nelfinavir No IVS10 + C64T N/A No influence on cellular nelfinavir No ABCC2 C - 24T rs717620 N/A No influence on cellular nelfinavir No G1249A rs2273697 V417I No influence on cellular nelfinavir No C1436G Synonymous No influence on cellular nelfinavir No IVS16 - G47A N/A No influence on cellular nelfinavir No T3563A rs8187694 V1188E No influence on cellular nelfinavir No C4488T rs8187707 Synonymous No influence on cellular nelfinavir No IVS31 + G12A rs8187708 N/A No influence on cellular nelfinavir No IVS31 + C74T N/A No influence on cellular nelfinavir No G4544A rs8187710 C1515Y No influence on cellular nelfinavir No G + 259T N/A No influence on cellular nelfinavir No ABCG2 - 19571_ - 19568delT- CAC rs4148162 Deletion No influence on cellular nelfinavir No A-19541G N/A No influence on cellular nelfinavir No G34A rs2231137 V12M No influence on cellular nelfinavir No IVS2 + 35G rs4148152 N/A No influence on cellular nelfinavir No C421A rs2231142 Q141K No influence on cellular nelfinavir No APOCIII C-482T Pending Promoter Hyperlipidaemia in presence of ritonavir Yes T-455C Pending Promoter Hyperlipidaemia in presence of ritonavir Yes C3238G rs5128 30 UTR variant Hyperlipidaemia in presence of ritonavir Yes APOE 2060T/2198T (APOEe2) rs429358 R112C/R158C Hyperlipidaemia in presence of ritonavir Yes 2060T/2198C (APOEe3) rs7412 R112C/R158R Hyperlipidaemia in presence of ritonavir Yes TNFa G - 238A rs361525 Promoter Rapid development of lipoatrophy Controversial SPINK-1 C112T rs17107315 N34S Associated with risk of pancreatitis Yes, in general population CFTR G1717 - 1A Splice defect Associated with risk of pancreatitis Yes, in general population IVS8 5T Splice defect Associated with risk of pancreatitis Yes, in general population HLA-B HLA-B*57.1 N/A Abacavir hypersensitivity Yes, but not in all populations HLA-DR HLA-DRB1*0101 N/A Nevirapine hypersensitivity No HSPA1L C2437T rs2227956 M493T Abacavir hypersensitivity No UGT1A1 A(TA)7TAA, - 43_ - 42in- sTA (UGT1A1*28) rs8175347 Promoter; insertion at TATA box Gilberts syndrome, hyperbilirubinaemia in presence of atazanavir and indinavir but not saquinavir Yes MT-CO1 C7028T Synonymous Haplogroup T associated with greater incidence of peripheral neuropathy No 700 Pharmacogenetics and Genomics 2006, Vol 16 No The NNRTI nevirapine can also cause a hypersensitivity syndrome characterized by a rash with systemic symptoms; occasionally liver injury may be part of the clinical picture, or alternatively, may actually be the only manifestation. Login to comment

PMID: 17301692 [PubMed] Nordgard SH et al: "ABCB1 and GST polymorphisms associated with TP53 status in breast cancer."

No. Sentence Comment

5 Results Chi-square analyses revealed a significant association between TP53 mutation status and both the GA genotype of ABCB1 exon 11 (Ser400Asn) and the GG genotype of GSTP1 (Ile105Val; P<0.01 and P<0.05, respectively). Login to comment
164 The polymorphism in exon 11 replaces Ser-400 to asparagine, thereby changing the size of the side chain of the protein and generating a new phosphorylation site. Login to comment

PMID: 17376299 [PubMed] Zhang WX et al: "Effect of MDR1 gene polymorphism on progression of end-stage renal disease."

No. Sentence Comment

86 The substitution of G to A in the position 1199 of MDR1 results in a serine-to-asparagine substitution at amino acid 400 in a cytoplasmic domain of P-gp. Login to comment

PMID: 17559192 [PubMed] Sakurai A et al: "Quantitative structure--activity relationship analysis and molecular dynamics simulation to functionally validate nonsynonymous polymorphisms of human ABC transporter ABCB1 (P-glycoprotein/MDR1)."

No. Sentence Comment

1 To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells. Login to comment
38 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis. Login to comment
53 SNP data were obtained from the NCBI dbSNP database and recent publications: S400N (6, 7, 29, 31); R492C (7); R669C (16); I849M (16); A893P (NCBI dbSNP, rs2032582); A893S (8, 16, 23, 29-31); A893T (8, 16, 23, 29-31); M986V (30); A999T (28); P1051A (16); G1063A (NCBI dbSNP, rs2707944). Login to comment
80 Briefly, seventy-two hours after Table 1: Data on Oligonucleotide Primers Used for Site-Directed Mutagenesis and Experimental Conditionsa SNP amino acid cDNA F/R primers primer sequence (5' f 3') primer length (bases) % GC Tm (°C) S400N 1199G > A F CAGAAATGTTCACTTCAATTACCCATCTCGAAAAG 35 36.5 77.2 R CTTTTCGAGATGGGTAATTGAAGTGAACATTTCTG 35 36.5 77.2 R492C 1474C > T F TGAAAACATTCGCTATGGCTGTGAAAATGTCACCATGG 38 42.1 81.0 R CCATGGTGACATTTTCACAGCCATAGCGAATGTTTTCA 38 42.1 81.0 R669C 2005C > T F TCTAATAAGAAAAAGATCAACTTGTAGGAGTGTCCGTGGATC 42 37.9 80.9 R GATCCACGGACACTCCTACAAGTTGATCTTTTTCTTATTAGA 42 37.9 80.9 I849M 2547A > G F GGGACAGGAATAATTATGTCCTTCATCTATGGTTGGCA 38 34.5 77.9 R TGCCAACCATAGATGAAGGACATAATTATTCCTGTCCC 38 34.5 77.9 A893P 2677G > C F AGAAAGAACTAGAAGGTCCTGGGAAGATCGCTAC 34 47.1 80.9 R GTAGCGATCTTCCCAGGACCTTCTAGTTCTTTCT 34 47.1 80.9 A893S 2677G > T F GAAAGAACTAGAAGGTTCTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGAACCTTCTAGTTCTTTC 33 45.4 79.6 A893T 2677G > A F GAAAGAACTAGAAGGTACTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGTACCTTCTAGTTCTTTC 33 45.4 79.6 M986V 2956A > G F GTCTTTGGTGCCGTGGCCGTGGGGC 25 73.8 84.7 R GCCCCACGGCCACGGCACCAAAGAC 25 73.8 84.7 A999T 2995G > A F GTTCATTTGCTCCTGACTATACCAAAGCCAAAATATCAGCAG 42 40.5 82.0 R CTGCTGATATTTTGGCTTTGGTATAGTCAGGAGCAAATGAAC 42 40.5 82.0 P1051A 3151C > G F CGACCGGACATCGCAGTGCTTCAGGG 26 60.0 80.1 R CCCTGAAGCACTGCGATGTCCGGTCG 26 60.0 80.1 G1063A 3188G > C F GAGGTGAAGAAGGCCCAGACGCTGGCTC 28 64.3 83.7 R GAGCCAGCGTCTGGGCCTTCTTCACCTC 28 64.3 83.7 a F, forward; R, reverse. Login to comment
142 On the basis of the ABCB1 (WT) cDNA cloned from a human liver cDNA library, those variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis as described in Experimental Procedures. Login to comment
180 Figure 3 depicts the verapamil-stimulated ATPase activity of ABCB1 WT, S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A, where the verapamil-stimulated ATPase activities are normalized by considering the ABCB1 protein amounts. Login to comment
186 Sf9 plasma membranes (2 µg of protein) expressing ABCB1 WT and variants (S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were incubated with ATP (2 mM) and verapamil at different concentrations (0, 1, 2, 5, 10, 20, 50, and 100 µM) at 37 °C for 30 min. After the incubation, the amount of liberated phosphate was measured as described in Experimental Procedures. All activities are expressed as mean values ( SD (n ) 6). Login to comment
187 Table 2: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Verapamila SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 ] Vmax/Km WT 5.8 ( 2.3 62.4 ( 7.8 10.8 S400N 5.8 ( 2.8 46.7 ( 5.3** 8.0 R492C 5.6 ( 1.9 49.6 ( 10.0* 8.9 R669C 3.2 ( 1.6* 64.7 ( 6.9 20.1 I849M 1.5 ( 0.7** 80.3 ( 9.5** 51.8 A893P 1.5 ( 0.5** 405.2 ( 16.5** 274.6 A893S 11.1 ( 5.4 43.1 ( 7.1** 3.9 A893T 4.3 ( 1.4 98.9 ( 9.5** 22.9 M986V 5.1 ( 1.1 114.9 ( 13.6** 22.5 A999T 2.0 ( 0.8** 143.1 ( 21.2** 70.9 P1051A 6.2 ( 3.0 52.1 ( 13.6 8.4 G1063A 6.2 ( 3.7 117.9 ( 16.4** 19.0 a Data are expressed as mean ( SD, n ) 6. Login to comment
189 Table 3: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Nicardipinea SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 Vmax/Km WT 1.1 ( 0.6 45.2 ( 8.7 41.0 S400N 1.7 ( 0.8 39.1 ( 9.1 23.4 R492C 1.1 ( 0.5 46.6 ( 6.4 43.5 R669C 0.3 ( 0.3** 53.5 ( 13.1 164.6 I849M 0.8 ( 0.9 80.2 ( 9.6** 102.9 A893P 0.1 ( 0.0** 341.2 ( 36.6** 4858.4 A893S 2.0 ( 0.6 39.2 ( 6.0 19.5 A893T 0.4 ( 0.2** 77.0 ( 16.9** 207.8 M986V 0.7 ( 0.4 89.7 ( 17.7** 129.9 A999T 0.3 ( 0.3** 115.4 ( 21.2** 393.6 P1051A 0.9 ( 0.3 33.1 ( 8.8* 36.3 G1063A 0.8 ( 0.4 93.2 ( 27.6** 121.4 a Data are expressed as mean ( SD, n ) 6. Login to comment
240 On the other hand, the benzene structure linked to the other ring by a single or double bond (CFC ) M113) negatively contributed to the drug-stimulated ATPase activity of M986V, G1063A, A999T, S400N, and A893S variants and WT, whereas the activity of the other variants was not affected by this structural component. Login to comment
269 The present study addresses the impact of nonsynonymous polymorphisms of ABCB1 (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) on its function. Login to comment
273 Table 5: ABCB1 WT and Variant-Specific Descriptors and Corresponding Coefficients Deduced from QSAR Analysisa coefficients (95% reliability) for ABCB1 WT and vatiants descriptor WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 21.2 18.5 35.9 52.7 169.8 14.0 61.2 39.4 63.0 13.9 52.1 (3.76) (5.81) (5.87) (7.68) (11.30) (18.84) (4.03) (7.75) (8.76) (9.39) (4.78) (10.94) M132 21.5 14.1 13.6 32.8 61.4 135.6 11.2 52.8 38.2 65.9 7.6 24.3 (3.89) (5.34) (5.78) (6.89) (12.66) (22.95) (4.06) (7.16) (8.62) (8.44) (5.71) (10.46) C-CHN-BT 3.3 3.8 1.7 3.5 5.7 11.6 1.2 6.1 7.1 7.3 2.0 2.8 (0.72) (0.95) (0.87) (1.08) (1.55) (2.48) (0.65) (1.29) (1.43) (1.44) (0.66) (1.86) ESTR -10.1 -12.5 (4.93) (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 -4.4 (7.86) (1.73) RT -8.9 -17.7 (4.21) (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 -11.7 -7.7 -22.8 -16.4 -16.5 (3.69) (5.30) (3.70) (8.75) (8.19) (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 14.4 (5.46) (7.91) M392 73.3 10.3 (25.03) (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 24.0 (4.01) (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) constant -12.2 -5.5 -0.2 -2.3 -24.0 -7.1 1.3 -4.3 0.9 9.0 0.6 -11.2 R2 0.934 0.847 0.853 0.906 0.893 0.981 0.782 0.954 0.915 0.956 0.836 0.831 FO(6, 29) 68.9 26.8 28.1 46.4 40.5 254.5 17.3 100.3 51.8 106.2 24.6 23.7 Q2 0.883 0.710 0.767 0.729 0.826 0.968 0.572 0.923 0.828 0.909 0.617 0.760 a R2 , correlation coefficient; FO, Fisher value (level of statistical significance). Login to comment
293 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are the same as those shown in Table 5. Login to comment
316 Other nonsynonymous polymorphisms, such as S400N, R492C, R669C, P1051A, and G1063A occurring in intracellular loops as well as I849M, M986V, and A999T alterations in transmembrane domains, exhibited moderate changes in the kinetic properties of ABCB1. Login to comment
340 of samples allele frequency (%) allele frequency (%) ref S400N 1199 G > A African 111 G 100.0 A 0.0 23 African-American 100 G 99.0 A 1.0 16 German 461 G 94.5 A 5.5 29 Caucasian 85 G 87.1 A 12.9 6 Caucasian 50 G 98.0 A 2.0 31 Caucasian 100 G 97.5 A 2.5 16 Mexican-American 10 G 100.0 A 0.0 16 Asian-American 30 G 100.0 A 0.0 16 Pacific Islander 7 G 100.0 A 0.0 16 R492C 1474 C > T African-American 23 C 100.0 T 0.0 7 Caucasian 37 C 98.6 T 1.4 7 R669C 2005 C > T African-American 100 C 99.0 T 1.0 16 Caucasian 100 C 100.0 T 0.0 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 I849M 2547 A > G African-American 100 C 100.0 T 0.0 16 Caucasian 100 C 99.5 T 0.5 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 A893P/S/T 2677 G > T/A/C African (Beninese) 111 G 99.1 T 0.9 23 A 0.0 African-American 100 G 89.5 T 10.0 16 A 0.5 Caucasian 100 G 50.0 T 46.5 16 A 3.5 Caucasian 50 G 52.0 T 38.0 31 A 10.0 German 461 G 56.5 T 41.6 29 A 1.9 Mexican-American 10 G 60.0 T 40.0 16 A 0.0 Asian-American 30 G 33.3 T 45.0 16 A 21.7 Japanese 117 G 44.0 T 35.5 8 A 20.5 Japanese (placenta) 100 G 43.0 T 39.0 30 A 18.0 Japanese 48 G 36.5 T 41.7 30 A 21.8 Pacific Islander 7 G 28.6 T 35.7 16 A 35.7 ND ND G ND C ND NCBI dbSNP (rs2032582) M986V 2956 A > G Japanese (placenta) 100 A 99.5 G 0.5 30 Japanese 48 A 100.0 G 0.0 30 A999T 2995 G > A cell lines 36 G 94.4 A 5.6 28 P1051A 3151 C > G African-American 100 C 99.5 G 0.5 16 Caucasian 100 C 100.0 G 0.0 16 Mexican-American 10 C 100.0 G 0.0 16 Asian-American 30 C 100.0 G 0.0 16 Pacific Islander 7 C 100.0 G 0.0 16 G1063A 3188 G > A ND ND G ND A ND NCBI dbSNP (rs2707944) a ND, not determined. Login to comment

PMID: 17700595 [PubMed] Woodahl EL et al: "Pharmacogenomic associations in ABCB1 and CYP3A5 with acute kidney injury and chronic kidney disease after myeloablative hematopoietic cell transplantation."

No. Sentence Comment

22 We also evaluated two nonsynonymous SNPs; the tri-allelic non-synonymous SNP at nucleotide position 2677, which results in a 2677G4T (Ala893Ser) or a 2677G4A (Ala893Thr) transition, and the 1199G4A SNP (Ser400Asn) that we have shown to cause a functional alteration in P-gp activity.10,11 Because significant linkage disequilibrium (LD) exists in ABCB1, we also evaluated the associated risk of ABCB1 haplotypes.12-14 Understanding the influence of genetic variability in the intrarenal concentrations of CNIs in post-HCT patients may allow for the a priori identification of patients at high risk of CNI-induced renal dysfunction who would be candidates for non-CNI containing regimens. Login to comment
71 ABCB1 is highly polymorphic and displays considerable LD and several SNPs have been associated with changes in the expression and activity of P-gp.9 The first ABCB1 polymorphism found to be associated with alterations in P-gp was the synonymous SNP 3435C4T.16 Subsequently, it was reported that 3435C4T is in LD with two other ABCB1 SNPs; a tri-allelic non-synonymous SNP at nucleotide position 2677, which results in a 2677G4T (Ala893Ser) and a 2677G4A (Ala893Thr) transition, as well as 1236C4T, another synonymous SNP.13 In addition, we have recently observed a functional alteration in P-gp activity due to another non-synonymous ABCB1 polymorphism, 1199G4A (Ser400Asn).10,11 The in vivo significance of ABCB1 polymorphisms has been conflicting as to their functional effect on renal P-gp expression.22-24 Since significant linkage exists in the ABCB1 gene, it is important to understand the role of ABCB1 haplotypes in pharmacogenomic association studies. Login to comment

PMID: 18056183 [PubMed] Seedhouse CH et al: "Sequential influences of leukemia-specific and genetic factors on p-glycoprotein expression in blasts from 817 patients entered into the National Cancer Research Network acute myeloid leukemia 14 and 15 trials."

No. Sentence Comment

34 This includes data on three single nucleotide polymorphisms: G2677T (Ala893 Ser), C3435T (synonymous), and G1199A (Ser400 Asn). Login to comment

PMID: 18287207 [PubMed] Gow JM et al: "Substrate-dependent effects of human ABCB1 coding polymorphisms."

No. Sentence Comment

135 The representative histogram of APC fluorescence for empty vector (gray, dotted), NBD mutant (gray), reference (black), and variant-transfected cells (N21D, yellow; S400N, cyan; R669C, purple; A893S, green; A893T, orange; S1141T, pink; V1251I, blue; 1236CϾT/A893S/3435CϾT, brown; and N21D/1236CϾT/A893S/3435CϾT, red) shows P-gp expression based on the intensity of APC fluorescence, as indicated on the x-axis. Login to comment
156 The N21D, S400N, R669C, and A893T variants and the 1236CϾT/A893S/3435CϾT haplotype were within 5% of the reference (Fig. 3c). Login to comment
163 Six of 13 previously described nonsynonymous variants were chosen for study based on an allele frequency Ͼ2%: N21D, S400N, A893S, A893T, S1141T, and V1251I. Login to comment
193 Previous work consistent with the current findings has shown that N21D, S400N, and A893S do not change calcein-AM transport (Kimchi-Sarfaty et al., 2002; Kroetz et al., 2003). Login to comment
198 This suggests that the S400N variation alters P-gp function in a substrate-specific manner. Login to comment
202 The ABCB1 S400N variant has been shown to confer higher drug resistance to paclitaxel, but the stable cell line overexpressing this P-gp was selected for G418 resistance (Crouthamel et al., 2006). Login to comment
206 In one study, the N21D, F103L, S400N, A893S, and A998T SNPs and three double mutants (N21N/S400N, N21D/A893S, and S400N/ A893S) were investigated using a vaccinia virus expression system with BODIPY-FL-paclitaxel, and no differences in function were noted among the variant and reference P-gps (Kimchi-Sarfaty et al., 2002). Login to comment
207 Our results are similar for N21D and S400N, but we found that A893S and N21D/A893S have decreased transport of BODIPY-FL-paclitaxel (Table 3). Login to comment

PMID: 18300948 [PubMed] Vaclavikova R et al: "Single nucleotide polymorphisms in the multidrug resistance gene 1 (ABCB1): effects on its expression and clinicopathological characteristics in breast cancer patients."

No. Sentence Comment

79 Six SNPs in ABCB1 [( - 1)G > A, rs2214102; 61A > G, Asn21Asp, rs9282564; 1199G> A, Ser400Asn, rs2229109; 1236C> T, Gly412Gly, rs1128503; ( + 44)C > T, rs2032588 and 3435C > T, Ile1145Ile, rs1045642] were detected on the NanoChip Molecular Biology Workstation (Nanogen Inc.). Login to comment
154 Age, menopausal status, staging, tumor size, nodal status and histological type and grade of tumor did not significantly associate either with frequencies of Table 3 Distribution of ABCB1 genotypes and allele frequencies in breast cancer patients ABCB1 genotypea Nb Allele frequency ( - 1)G > A, rs2214102 G/G 77 (88.5) G (93.1) G/A 8 (9.2) A (6.9) A/A 2 (2.3) Total 87 61A > G, Asn21Asp, rs9282564 Asn/Asn 75 (84.3) Asn (91.6) Asn/Asp 13 (14.6) Asp (8.4) Asp/Asp 1 (1.1) Total 89 1199G > A, Ser400Asn, rs2229109 Ser/Ser 86 (95.6 Ser (97.8) Ser/Asn 4 (4.4) Asn (2.2) Asn/Asn 0 (0) Total 90 1236C > T, Gly412Gly, rs1128503 C/C 32 (35.6) C (61.7) C/T 47 (52.2) T (38.3) T/T 11 (12.2) Total 90 12( + 44)C > T, rs2032588 C/C 79 (89.8) C (93.8) C/T 7 (8.0) T (6.2) T/T 2 (2.2) Total 88 3435C > T, Ile1145Ile, rs1045642 C/C 17 (19.5) C (46.0) T/C 46 (52.9) T (54.0) T/T 24 (27.6) Total 87 a Protein positions are displayed for nonsynonymous single nucleotide polymorphisms (SNPs) in exons. Login to comment

PMID: 18334915 [PubMed] Crettol S et al: "Influence of ABCB1 genetic polymorphisms on cyclosporine intracellular concentration in transplant recipients."

No. Sentence Comment

136 In contrast, the 1199G > A (S400N) and 3435C > T SNPs significantly influenced cyclosporine concentration in opposite directions. Login to comment

PMID: 18668431 [PubMed] Zhou SF et al: "Structure, function and regulation of P-glycoprotein and its clinical relevance in drug disposition."

No. Sentence Comment

298 A G1199A polymorphism is located at exon 11, which changes Ser-400 to Asn. Login to comment

PMID: 19123050 [PubMed] Woodahl EL et al: "MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents."

No. Sentence Comment

0 DOI 10.1007/s00280-008-0906-4 123 SHORT COMMUNICATION MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents Erica L. Woodahl · Matthew H. Crouthamel · Tot Bui · Danny D. Shen · Rodney J. Y. Ho Received: 11 August 2008 / Accepted: 14 December 2008 / Published online: 4 January 2009 (c) Springer-Verlag 2009 Abstract Purpose P-glycoprotein (P-gp), encoded by MDR1 (or ABCB1), is important in anticancer drug delivery and resistance. Login to comment
18 The model for this recombinant cell expression system was expression of the MDR1 G1199A SNP, which results in a serine to asparagine transition at amino acid 400 (Ser400Asn) in a cytoplasmic domain of P-gp (allelic frequency »5.5% in Caucasians) [3, 4]. Login to comment

PMID: 19197249 [PubMed] Tripodi G et al: "Steroid biosynthesis and renal excretion in human essential hypertension: association with blood pressure and endogenous ouabain."

No. Sentence Comment

60 A = 0.17; G = 0.83 SLCO4C1 rs3811976 5q21.1 101599098 Untranslated 3'-UTR A = 0.82; G = 0.08 SLCO4C1 rs6596425 5q21.1 101603285 Intron C = 0.18; G = 0.82 SLCO4C1 rs10515323 5q21.1 101611553 Intron C = 0.13; G = 0.87 SLCO4C1 rs174414 5q21.1 101620640 Intron A = 0.35; G = 0.65 SLCO4C1 rs370176 5q21.1 101623456 Intron A = 0.78; G = 0.22 SLCO4C1 rs2600831 5q21.1 101633969 Intron A = 0.58;T = 0.42 SLCO4C1 rs2548724 5q21.1 101648072 Intron A = 0.20; G = 0.80 SLCO4C1 rs709369 5q21.1 101652234 Intron A = 0.52; G = 0.48 SLCO4C1 rs841922 5q21.1 101658594 Intron A = 0.27; C = 0.73 MDR1 rs17064 7q21.12 86971405 Untranslated 3'-UTR A = 0.07;T = 0.93 MDR1 rs1045642 7q21.12 86976580 Synonymous Ile1145 T = 0.52; C = 0.48 MDR1 rs2032582 7q21.12 86998553 Nonsynonymous Ala893Ser G = 0.54;T = 0.46 MDR1 rs2229109 7q21.12 87017744 Nonsynonymous Ser400Asn A = 0.05; G = 0.95 SNP ID is a GenBank ID number (NCBI), gene map position and SNP function were taken from the most recent human genome sequence assembly hg18 (NCBI Build 36.1). Login to comment

PMID: 19401306 [PubMed] Hamidovic A et al: "Clinical significance of ABCB1 genotyping in oncology."

No. Sentence Comment

39 Pgp substrates clinically relevant to oncology Anti-cancer agents6,9,13-16 Actinomycin D Mithramycin Bisantrene Mitomycin C Colchicine Mitoxantrone Daunorubicin Paclitaxel Docetaxel Temozolomide Doxorubicin Teniposide Epirubicin Topotecan Etoposide Vinblastine Irinotecan Vincristine Methotrexate Vindesine Examples of MDR-reversal agents in clinical trials15 Verapamil Tamoxifen Cyclosporine A Azidopine Quinidine 40 ABCB1 gene, respectively.11 The SNPs represent the three most frequent ABCB1 SNPs in the Caucasian population and have been shown to be in linkage disequilibrium.19 G2677T/A is at a wobble position which results in an Ala to Ser/Thr change at position 893.20 C1236T is a synonymous mutation resulting in a Ser to Asn change at position 400.21 C3435T is also a synonymous mutation at a wobble position but does not change the amino acid from an Ile at position 1145.22 The allelic frequencies of these three SNPs are highly variable between ethnicities.11,19,22 (Table 2). Login to comment

PMID: 19694740 [PubMed] Keskitalo JE et al: "No significant effect of ABCB1 haplotypes on the pharmacokinetics of fluvastatin, pravastatin, lovastatin, and rosuvastatin."

No. Sentence Comment

21 In addition, participants were genotyped for the ABCB1 c.1199G→A (p.Ser400Asn; rs2229109), CYP3A5*3 (g.6986A→G; rs776746), CYP2C9*3 (c.1075A→C, p.Ile359Thr; rs1057910) and SLCO1B1 c.521T→C (p.Val174Ala; rs4149056) alleles [18-21]. Login to comment

PMID: 19916993 [PubMed] Mukonzo JK et al: "A novel polymorphism in ABCB1 gene, CYP2B6*6 and sex predict single-dose efavirenz population pharmacokinetics in Ugandans."

No. Sentence Comment

119 785 A→G rs2279343 CYP2B6*4, *6, *7, *13, *16 *19, *20 K262R Reduced expression and activity 36.4 c.516 G→T rs3745274 CYP2B6*6, *7, *9, *13, *19, *20 Q172H Reduced expression and activity 35.6 c.136A→G rs35303484 CYP2B6*11 M46V Phenotypic null allele 13.6 c.983 T→C rs28399499 CYP2B6*16, *18 I328T Phenotypic null allele 10.4 c.64 C→T rs8192709 CYP2B6*2 R22C Phenotypic null allele 8.0 c.1282 C→T rs35010098 CYP2B6*21 P428T Phenotypic null allele 1.1 exon 8/-6 C→T rs35449271 New SNP Undetermined 32.0 296 G→A rs36060847 CYP2B6*12 G99E Reduced expression 3.6 1375 A→G rs3211369 CYP2B6*23 M459V Unknown 24.0 c.1172 T→A rs35979566 CYP2B6*15 I391N Reduced expression 7.7 CYP3A5 g.27289C→A rs28365083 CYP3A5*2 T398N Unknown 0 g.6986A→G rs776746 CYP3A5*3 Splicing defect Phenotypic null allele 18.2 g.14665A→G CYP3A5*4 Q200R Unknown 8.6 g.14690G→A CYP3A5*6 Splicing defect Phenotypic null allele 17.2 g.27131-27132insT rs241303343 CYP3A5*7 346 frame shift Phenotypic null allele 18.4 g.3699C→T rs28371764 CYP3A5*8 R28C Phenotypic null allele 0 g.19386G→A rs28383479 CYP3A5*9 A337T Decreased activity 11.4 ABCB1 c.1236 C→T rs1128503 Gly412Gly Phenotypic null allele 11.9 c.2677 G/A→T rs2032582 Ala/Thr893 Ser Phenotypic null allele 3.7 c.3435 T/C rs1045642 Ile1145Ile Phenotypic null allele 4.8 c.4036 A/G rs3842 New SNP 3' UTR Undetermined 16.8 c.1659 G→C rs2235012 Leu554Leu 1.1 exon 6/+139 C→T rs1202168 New SNP - Undetermined 18.6 exon 19/-88 T→C rs4728699 New SNP - Undetermined 7.7 c.781A→G rs36008564 Ile261Val 6.9 c.239C→A rs9282565 Ala80Glu 2.8 exon 12/+44 C→T rs20328588 New SNP Intron 13 Undetermined 5.1 c.1199G→A rs2229109 Ser400Asn 2.6 c.1795C→T rs2235036 Ala599Thr 7.0 exon 20/+24 G→A rs2235040 New SNP - Undetermined 4.6 *Position based on cDNA numbering (c. Login to comment

PMID: 20336065 [PubMed] Eyal S et al: "Regional P-glycoprotein activity and inhibition at the human blood-brain barrier as imaged by positron emission tomography."

No. Sentence Comment

307 43. Woodahl, E.L., Crouthamel, M.H., Bui,T., Shen, D.D. & Ho, R.J. MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability andsensitivity to anticancer agents. Login to comment
304 43. Woodahl, E.L., Crouthamel, M.H., Bui,T., Shen, D.D. & Ho, R.J. MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents. Login to comment

PMID: 20357698 [PubMed] Mukonzo JK et al: "Genetic variations in ABCB1 and CYP3A5 as well as sex influence quinine disposition among Ugandans."

No. Sentence Comment

79 T rs2032582 Ala/Thr893 Ser Altered activity 3.7 c.3435 C/T rs1045642 Ile1145Ile Altered activity 4.8 c.4036 A/G rs3842 New SNP 3` UTR Undetermined 16.8 c.1659 G.C rs2235012 Leu554Leu Detected only in blacks 1.1 Exon 6/ +139 C.T rs1202168 New SNP - Undetermined 18.6 Exon 19/-88 T.C rs4728699 - Undetermined 7.7 c.781A.G rs36008564 Ile261Val 6.9 c.239C.A rs9282565 Ala80Glu 2.8 Exon 12/+44 C.T rs20328588 New SNP Intron 13 Undetermined 5.1 c.1199G.A rs2229109 Ser400Asn 2.6 c.1795C.T rs2235036 Ala599Thr 7.0 Exon 20/+24 G.A rs2235040 New SNP - Undetermined 4.6 CYP3A5 g.27289C.A rs28365083 CYP3A5*2 T398N Unknown 0 g.6986A.G rs776746 CYP3A5*3 Splicing defect Phenotypic null allele 18.2 g.14665A.G CYP3A5*4 Q200R Unknown 6.7 g.14690G.A CYP3A5*6 Splicing defect Phenotypic null allele 17.2 g.27131-27132insT rs241303343 CYP3A5*7 346 frame shift Phenotypic null allele 11.4 g.3699C.T rs28371764 CYP3A5*8 R28C Phenotypic null allele 0 g.19386G.A rs28383479 CYP3A5*9 A337T Decreased activity 9.6 *Position based on cDNA numbering (c. Login to comment

PMID: 20496145 [PubMed] Tapaninen T et al: "Effect of ABCB1 haplotypes on the pharmacokinetics and renin-inhibiting effect of aliskiren."

No. Sentence Comment

27 To minimize variability in aliskiren pharmacokinetics due to other genetic variants, all subjects were genotyped for the functionally significant ABCB1 c.1199G > A (p.Ser400Asn; rs2229109) [17] and CYP3A5*3 (g.6986A>G; rs776746) [26] alleles and only noncarriers of the ABCB1 c.1199A and CYP3A5 g.6986A (CYP3A5 expressor) alleles were recruited. Login to comment

PMID: 21103972 [PubMed] Cascorbi I et al: "P-glycoprotein: tissue distribution, substrates, and functional consequences of genetic variations."

No. Sentence Comment

13 Absence of the gene, as being the case in double-knockout mice, is conformable N21D S400N A893S/T Q1107P 3435C>T1236T>C N183S R492C S1141T NBD1 NBD2 Intracellular (e.g. lymphocyte) Extracellular M986V Fig. 1 Two-dimensional structure of ABCB1 with locations of amino acid replacements and two frequent synonymous SNPs, NBD ¼ nucleotide binding domain [adapted from Cascorbi and Haenisch (2010)] Inducer intra cellular ABCB1 Transkription Translation ABCB1 (P-gp) luminal Fig. 2 Induction of ABCB1 via the nuclear PXR/RXR receptor leading to accelerated extrusion of P-glycoprotein substrates with life. Login to comment
78 The rare missense SNP 1199G>T (Ser400Asn) was associated with lower transport capacity in vitro leading to putatively higher sensitivity against cytostatics. Login to comment
81 Table 2 Frequency of ABCB1 genetic variants in Caucasians, position on DNA, putative effect, and frequencies [according to Cascorbi (2006) and Cascorbi and Haenisch (2010)] Position Amino acid or effect Frequency of the variant allele Association to expression, kinetics or drug response 50 -flanking À2903 T>C 0.02a 50 -flanking À2410 T>C 0.10a Decreased mRNAa 50 -flanking À2352 G>A 0.28a 50 -flanking À1910 T>C 0.10a 50 -flanking À1717 T>C 0.02a 50 -flanking À1325 A>G 0.02a 50 -flanking À934 A>G 0.10a 50 -flanking À692 T>C 0.10a Decreased mRNAa 50 -flanking À41 A>G 0.09b IVS 1a À145 C>G 0.02b IVS 1b À129 T>C 0.06b IVS 1b 12 T>C 0.06c IVS 2 À1 G>A 0.09d c. 61 A>G N21D 0.11d IVS 5 À35 G>C Intronic 0.006c IVS 5 À25 G>T Intronic 0.16c IVS 6 þ139 C>T Intronic 0.37d c. 548 A>G N183S 0.01e c. 571 G>A G191R 0.07f Reduced chemotherapy resistancef c. 1199 G>A S400N 0.05d c. 1199 C>T S400I 0.02g Elevated activityg c. 1236 C>T Synonymous 0.41d Increased imatinib disposition and therapy responseh IVS 12 þ44 C>T Intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17 À76 T>A Intronic 0.46d IVS 17 þ137 A>G Intronic 0.006c c. 2650 C>T Synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d In vitro increased vmax,i increased imatinib response in CMLh c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T Synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T Synonymous 0.54d Decreased mRNA and protein expression,e, k decreased in vitro transport,l no effect on expression and bioavailability of talinolol,m no effect on in vitro transport,n, o decreased digoxin (continued) 4.2.1 Digoxin The heart glycoside digoxin is widely accepted as typical P-glycoprotein substrate. Login to comment

PMID: 21490239 [PubMed] Rudolph A et al: "Modification of menopausal hormone therapy-associated colorectal cancer risk by polymorphisms in sex steroid signaling, metabolism and transport related genes."

No. Sentence Comment

119 Table 2 Genotype frequencies and colorectal cancer risk estimates of polymorphisms in genes related to sex steroid signaling, transport, and metabolism in the female postmenopausal DACHS study population Gene Variant Genotype Effect estimate dbSNP rs# Amino acid substitution and functional consequence MAF Genotype N Co/N Ca OR (95% CI)a P trend ABCB1 rs1045642 I1145I, T allele associated with lower protein expression (Hoffmeyer et al. 2000) 49% T/T 183/190 1.00 T/C 329/336 1.04 (0.77-1.40) C/C 167/156 0.98 (0.69-1.39) 0.914 ABCB1 rs2229109 S400N, functional consequences unknown 6% G/G 596/614 1.00 G/A 86/64 0.69 (0.47-1.03) A/A 1/1 1.00 (0.03-33.9) 0.078 ABCB1 rs1202168 Intronic, functional consequences unknown, in high LD interval (Soranzo et al. 2004) 40% C/C 249/218 1.00 C/T 312/337 1.08 (0.82-1.42) T/T 119/127 1.02 (0.71-1.46) 0.829 ABCB1 rs9282564 N21D, results in a net charge change of the protein (Brinkmann and Eichelbaum 2001) 10% A/A 545/544 1.00 A/G 117/124 1.05 (0.76-1.45) G/G 12/9 0.73 (0.23-2.27) 0.997 ABCB1 rs2214102 50 -UTR, located at a translation initiation site (Hoffmeyer et al. 2000) 7% G/G 593/580 1.00 G/A 81/97 1.33 (0.91-1.92) A/A 6/6 0.96 (0.26-3.51) 0.208 SHBG rs6259 D356N, A allele is associated with reduced clearance of SHBG (Cousin et al. 1998) 11% G/G 525/549 1.00 G/A 141/115 0.69 (0.50-0.95) A/A 6/10 1.13 (0.36-3.60) 0.061 ESR2 rs1255998 30 -UTR, functional consequences unknown, G allele associated with endometrial cancer risk (Ashton et al. 2009) 12% C/C 519/547 1.00 C/G 138/114 0.76 (0.55-1.04) G/G 14/5 0.33 (0.11-1.01) 0.015 ESR2 rs928554 30 -UTR, G allele might create new acceptor splice site (MARIE-GENICA-Consortium 2010a) 40% A/A 246/222 1.00 A/G 316/317 1.19 (0.90-1.56) G/G 111/133 1.48 (1.03-2.13) 0.032 ESR2 rs4986938 30 -UTR, potentially affects pre-mRNA splicing (Zheng et al. 2003) 38% G/G 260/264 1.00 G/A 310/306 0.97 (0.74-1.27) A/A 99/106 1.02 (0.70-1.48) 0.997 ESR2 rs1271572 50 -UTR, might modulate binding of transcription factors (MARIE-GENICA-Consortium 2010a) 42% G/G 231/208 1.00 G/T 329/330 1.29 (0.97-1.70) T/T 120/138 1.40 (0.98-2.00) 0.046 ESR1 rs851984 50 -UTR, functional consequences unknown, T allele associated with breast cancer risk (MARIE-GENICA-Consortium 2010a) 41% C/C 221/231 1.00 C/T 341/314 0.95 (0.72-1.25) T/T 103/122 1.07 (0.74-1.55) 0.833 ESR1 rs2881766 50 -UTR, functional consequences unknown, G allele associated with breast cancer risk (MARIE-GENICA-Consortium 2010a) 18% T/T 461/453 1.00 T/G 190/195 1.02 (0.77-1.35) G/G 25/22 0.95 (0.48-1.87) 0.989 ESR1 rs2071454 50 -UTR, functional consequences unknown 11% T/T 536/551 1.00 T/G 132/120 0.81 (0.59-1.12) G/G 5/8 1.75 (0.51-6.03) 0.467 ESR1 rs2077647 S10S, potentially affects mRNA structure (Tanaka et al. 2003) 47% A/A 183/187 1.00 A/G 347/349 0.97 (0.73-1.30) G/G 140/135 0.93 (0.65-1.33) 0.697 ESR1 rs827421 Intronic, functional consequences unknown 48% T/T 172/178 1.00 T/C 350/355 1.02 (0.76-1.37) C/C 151/143 0.91 (0.64-1.30) 0.620 ESR1 rs2234693 Intronic, C allele introduces a binding site for transcription factor B-myb, leading to altered transcription (Herrington et al. 2002) 46% T/T 188/209 1.00 T/C 348/341 0.93 (0.70-1.24) C/C 136/120 0.87 (0.61-1.24) 0.429 ESR1 rs9340799 Intronic, functional consequences unknown, may lead to altered transcription or splicing (Schuit et al. 2004) 36% A/A 274/287 1.00 A/G 319/317 1.01 (0.78-1.32) G/G 83/72 0.94 (0.63-1.42) 0.864 ESR1 rs3798577 30 -UTR, functional consequences unknown 45% T/T 203/189 1.00 T/C 328/330 1.14 (0.86-1.52) C/C 139/154 1.27 (0.89-1.80) 0.181 Table 2 continued Gene Variant Genotype Effect estimate dbSNP rs# Amino acid substitution and functional consequence MAF Genotype N Co/N Ca OR (95% CI)a P trend ESR1 rs910416 30 near gene, functional consequences unknown, modified estrogen monotherapy- associated breast cancer risk (MARIE-GENICA-Consortium 2010a) 48% T/T 178/188 1.00 T/C 338/314 0.81 (0.61-1.10) C/C 148/159 0.92 (0.65-1.31) 0.599 PGR rs1042838 V660L, SNP possibly affects receptor dimerization, nuclear localization, ligand binding, cofactor interaction (Agoulnik et al. 2004) 15% C/C 495/478 1.00 C/A 154/181 1.32 (0.99-1.76) A/A 24/16 0.91 (0.44-1.88) 0.202 PGR rs1379130 G393G, functional consequences unknown 36% G/G 272/298 1.00 G/A 311/268 0.74 (0.56-0.96) A/A 88/108 1.01 (0.69-1.47) 0.412 PGR rs10895068 50 -UTR, creates new transcription start site, increasing expression of PR-B isoform (De Vivo et al. 2002) 4% G/G 615/619 1.00 G/A 58/59 0.89 (0.58-1.38) A/A 1/1 1.94 (0.05-80.6) 0.670 PGR rs518162 50 -UTR, SNP is located between PR-B and PR-A transcription start sites, potentially affecting PR-A/B expression (De Vivo et al. 2002) 7% G/G 580/586 1.00 G/A 93/88 1.06 (0.74-1.53) A/A 3/4 1.23 (0.21-7.06) 0.710 NR1I2 rs1523127 50 -UTR, belongs to a haplotype incl. SNPs that introduce new transcription factor binding sites (Zhang et al. 2001) 39% A/A 245/258 1.00 A/C 326/317 0.89 (0.68-1.17) C/C 98/88 0.89 (0.61-1.32) 0.450 NR1I2 rs2276706 Intronic, belongs to a haplotype incl. SNPs that introduce new transcription factor binding sites (Zhang et al. 2001) 38% G/G 251/267 1.00 G/A 329/324 0.92 (0.70-1.20) A/A 95/83 0.89 (0.60-1.31) 0.474 NR1I2 rs1464603 Intronic, functional consequences unknown 32% T/T 303/307 1.00 T/C 310/291 1.05 (0.80-1.36) C/C 65/78 1.11 (0.73-1.69) 0.608 NR1I2 rs6785049 Intronic, G allele associated with increased induction of CYP3A (Zhang et al. 2001) 38% A/A 260/264 1.00 A/G 323/313 1.00 (0.77-1.31) G/G 94/101 1.10 (0.75-1.60) 0.698 NR1I2 rs2276707 Intronic, T allele associated with increased induction of CYP3A (Zhang et al. 2001) 17% C/C 446/439 1.00 C/T 180/190 1.00 (0.75-1.32) T/T 21/24 1.19 (0.58-2.44) 0.794 NR1I2 rs1054191 30 -UTR, A allele associated with decreased induction of CYP3A (Zhang et al. 2001) 14% G/G 499/518 1.00 G/A 161/143 0.95 (0.70-1.28) A/A 17/12 0.80 (0.35-1.87) 0.581 NR1I2 rs3814057 30 -UTR, C allele associated with decreased induction of P-glycoprotein (Zhang et al. 2001) 17% A/A 458/440 1.00 A/C 177/201 1.15 (0.87-1.52) C/C 22/24 1.20 (0.60-2.41) 0.307 COMT rs4680 V158M, A allele leads to thermo-labile protein and 2-3 fold lower catalytic activity (Dawling et al. 2001) 49% G/G 171/177 1.00 A/G 343/327 0.88 (0.66-1.19) A/A 162/175 1.05 (0.74-1.48) 0.802 HSD17B1 rs605059 G313S, functional consequences unknown, C allele has been associated with lower estradiol levels (Setiawan et al. 2004) 46% T/T 199/167 1.00 T/C 330/340 1.30 (0.97-1.75) C/C 144/170 1.41 (0.99-2.01) 0.051 CYP1B1 rs1800440 N453S, G allele leads to enzyme which catalyzes hydroxylation of estradiol more efficiently (Hanna et al. 2000) 19% A/A 452/467 1.00 A/G 202/187 0.89 (0.68-1.18) G/G 26/22 0.81 (0.40-1.62) 0.342 CYP1B1 rs1056836 L432V, G allele leads to enzyme with increased activity (Shimada et al. 1999) 41% C/C 224/220 1.00 C/G 339/320 1.00 (0.75-1.32) G/G 106/128 1.31 (0.91-1.88) 0.209 CYP1B1 rs1056827 A119S, T allele leads to enzyme which catalyzes hydroxylation of estradiol more efficiently (Hanna et al. 2000) 31% G/G 317/323 1.00 G/T 304/297 0.90 (0.70-1.17) T/T 57/55 0.85 (0.54-1.35) 0.362 continued gene ESR1 (interaction ORZ1.49, 95% CI 1.04-2.13, P interactionZ0.03). Login to comment

PMID: 21625253 [PubMed] Wolf SJ et al: "An update on ABCB1 pharmacogenetics: insights from a 3D model into the location and evolutionary conservation of residues corresponding to SNPs associated with drug pharmacokinetics."

No. Sentence Comment

48 Four of the 12 associated nsSNPs (E3/61A4G, E5/266C4T, E17/1985T4C and E17/2005C4T) cannot be mapped to the mouse crystal Table 1 Genetic conservation of amino acids corresponding to ABCB1 coding region SNPs 1 - rs28381804 E3/49T>C (F17L) F17 W16 S16 Y17 Y35 F39 - A42 - - G11 - - 2 - rs41304191 E3/55C>T (L19L) L19 M18 M18 I19 G37 P41 - E44 - - L13 - - 3 - rs76199854 E3/57G>A (L19L) L19 M18 M18 I19 G37 P41 - E44 - - L13 - - --51I--64H-34K93N12N02K02K12N)D12N(G>A16/3E4652829sr-4 7.832.8105P12A01K88D61D18T07T55S34G34N44N)S44N(G>A131/5E3812021sr1sn5 6 ns2 rs41315618 E5/178A>C (I60L) I60 I59 I59 A71 I86 A97 G32 G104 K26 N37 L66 27.3 46.6 1.924.6368N75G64N421Y25G711I601I19V97A97A08A)E08A(A>C932/5E5652829sr3sn7 8 - rs35810889 E5/266C>T (M89T) - M89 F89 S85 T96 I112 - - - - - - - - 9 ns4 rs61607171 E7/431T>C (I144T) TM2 I144 I145 I140 V152 N168 I176 A98 A172 L93 V97 L124 36.4 40.9 2.645.45841G121T711V691A221T002S291S671A461V961V861V)I861V(A>G205/7E32622116sr5sn01 11 s1 rs1128500 E8/540C>T (S180S) S180 S181 S176 S188 E204 S212 L136 N208 E129 E133 E160 27.3 42.0 12 ns6 rs60419673 E8/548A>G (N183S) N183 N184 N179 N191 K207 E215 Q139 Q211 K132 A136 S163 27.3 39.9 9.045.54561G831S431F312G141F712G902G391G181G681G581G)V581G(T>G455/8E1058211sr7sn31 14 s2 rs1128502 E8/555A>T (G185G) G185 G186 G181 G193 G209 G217 F141 G213 F134 S138 G165 45.5 40.9 15 s3 rs2235022 E9/729A>G (E243E) E243 E244 E239 E251 E267 E275 I199 Q271 R192 M196 S223 18.2 33.3 16 s4 rs28381867 E9/738G>A (A246A) A246 A247 A242 A254 R270 M278 E202 V274 A195 T199 Y226 9.1 34.5 17 ns8 rs36008564 E9/781A>G (I261V) C-NBD (Internal) I261 I262 I257 V267 I285 I293 V217 I289 I210 H214 I241 36.4 50.3 18 s5 rs80153317 E10/879T>C (I293I) TM5 I293 I294 I289 I301 L317 M325 L249 I321 R242 S246 F273 18.2 36.3 19 ns9 rs2229109 E12/1199G>A (S400N) N-NBD (Internal) S400 S401 S396 N408 T424 Q439 T355 V428 Q348 T350 H386 18.2 60.7 20 s6 rs1128503 E13/1236C>T (G412G) N-NBD (External) G412 G413 G408 G420 G436 K451 D367 N440 D359 N361 D398 27.3 55.9 21 s7 rs35068177 E13/1308A>G (T436T) T436 T437 T432 T44 I460 C475 V391 I464 L383 I385 I422 54.5 64.6 22 s8 rs41311775 E15/1326G>A (R442R) R442 R443 R438 R450 R466 R481 R397 R470 R389 R391 R428 100.0 54.5 23 s9 rs35633772 E15/1617C>T (I539I) I539 I540 I535 I547 I563 I578 I494 I576 L486 I489 I571 90.9 65.8 24 s10 rs60247941 E15/1632C>T (A544A) A544 A545 A540 A552 A568 A583 A499 A581 I491 A494 A576 63.6 65.1 25 s11 rs2235012 E15/1662G>C (L554L) L554 L555 L550 L562 L578 L593 L509 L591 L501 L504 L586 100.0 73.6 26 s12 rs56871767 E15/1674G>A (T558T) T558 T559 T554 T566 T582 T597 T513 T595 T505 T508 T590 100.0 78.7 27 s13 rs59697741 E15/1695C>T (S565S) S565 S566 S561 S573 S589 S604 S520 S602 S512 S515 S597 100.0 75.4 28 ns10 rs28381902 E15/1696G>A (E566K) E566 E567 E562 E574 E590 E605 E521 E603 E513 E516 E598 100.0 76.6 29 ns11 rs28381914 E16/1777C>T (R593C) R593 R594 R589 R601 R617 R632 R548 R630 T540 E543 R627 54.5 67.3 30 ns12 rs56107566 E16/1778G>A (R593H ) R593 R594 R589 R601 R617 R632 R548 R630 T540 E543 R627 54.5 67.3 31 s14 rs28381915 E16/1794C>T (I598I) I598 I599 I594 I606 I622 I637 I553 I635 I545 I548 I632 100.0 65.5 32 ns13 rs2235036 E16/1795G>A (A599T) A599 A600 A595 A607 I623 V638 C554 V636 V546 V549 F633 54.5 63.6 33 ns14 rs57001392 E16/1837G>T (D613Y) N-NBD (External) D613 D614 D609 S621 R637 Q652 E568 N650 R560 N563 D677 45.5 60.5 -0.0637E--807A516E896K496M176E856L366L266L)R266L(C>T5891/71E06975653sr-43 35 - rs35023033 E17/2005C>T (R669C) R669 R670 R665 R678 I702 D705 S662 T715 - - N743 0.0 - 36 - rs59340265 E17/2037C>T (D679D) D679 D680 D675 N688 D712 N715 S632 N725 - - E753 9.1 - 37 ns15 rs41316450 E18/2207T>A (I736K) TM7 I736 I737 V732 I745 M779 I771 V682 I820 I37 L48 V814 72.7 36.7 38 ns16 rs77144566 E19/2281A>C (A761S) TM8 A761 V763 I757 A769 V802 I796 G706 I844 I647 G655 L836 63.6 42.1 39 ns17 rs41305517 E21/2398G>A (D800N) C-NBD (Internal) D800 D801 D796 D808 H841 D835 E745 D883 S108 P112 E875 9.1 45.4 40 ns18 rs2235039 E21/2401G>A (V801M) C-NBD (External) V801 V802 V797 M809 I842 V836 V746 V884 A109 V113 M876 63.6 47.6 2.035.54409L931S531I219S447V468T078I738T528T038I928I)V928I(G>A5842/22E1852302sr91sn14 42 s15 rs28381966 E22/2505A>G (V835V) V835 V836 V831 L843 T876 T870 L780 T918 N141 T145 F911 45.5 33.0 43 ns20 rs28381967 E22/2506A>G (I836V) I836 I837 I832 I844 V877 I871 L781 V919 I142 V146 F911 63.6 28.5 7.448.18429M951M551I239L497I488D098I758I548I058I948I)M948I(G>A7452/22E03150163sr12sn44 45 s16 rs9282563 E22/2650C>T (L884L) L884 L885 L880 K892 V925 M919 R829 E967 R190 K194 I959 27.3 31.2 7.535.54289P302V991V679S838S829C439S109A988S498A398S)T/A398S(A/T>G7762/22E2852302sr22sn64 4.834.631801M203T892V5701F739G7201L5301T0001S889S399S299S)N299S(A>G5792/52E72194865sr32sn74 5.633.729801E903Q503T2801T449V4301Q2401A7001A599A0001A999A)T999A(A>G5992/52E48725527sr42sn84 49 s17 rs2235044 E26/3084G>A (P1028P) P1028 P1029 P1024 P1036 - P1063 P973 V1111 P332 V334 I1117 0.0 33.0 50 ns25 rs28401798 E26/3151C>G (P1051A) P1051 P1052 P1047 K1059 E1093 Q1086 I996 K1135 P355 P357 P1142 18.2 57.6 51 ns26 rs2707944 E26/3188G>C (G1063A) G1063 G1064 G1059 G1071 G1105 G1098 G1008 G1147 G367 G369 K1154 45.5 53.8 52 s18 rs2707943 E26/3189C>G (G1063G) G1063 G1064 G1059 G1071 G1105 G1098 G1008 G1147 G367 G369 K1154 45.5 53.8 53 ns27 rs74755520 E26/3222A>C (C1074W) C-NBD (Internal) C1074 C1075 C1070 C1082 C1116 C1109 S1019 C1158 G378 S380 S1165 63.6 67.8 54 ns28 rs57521326 E26/3262G>A (D1088N) D1088 D1089 D1084 D1096 D1130 D1123 D1033 D1172 D392 D394 D1179 100.0 53.9 55 ns29 rs41309225 E27/3295A>G (K1099E) K1099 K1100 K1095 I1107 S1141 C1134 R1044 V1183 H403 H405 I1237 18.2 38.5 56 ns30 rs55852620 E27/3320A>C (Q1107P) Q1107 Q1108 Q1103 Q1115 E1149 T1142 R1052 N1191 G411 A413 R1245 27.3 43.7 57 ns31 rs35730308 E27/3322T>C (W1108R) W1108 Q1109 W1104 Q1116 H1150 N1143 S1053 D1192 S412 S414 D1246 27.3 43.5 58 s19 rs34748655 E27/3396C>T (A1132A) C-NBD (Internal) A1132 A1133 A1128 A1140 I1174 S1167 M1077 V1216 L436 A438 K1270 27.3 56.8 59 ns32 rs41309228 E27/3410G>T (S1137I ) S1137 S1138 S1133 S1145 P1179 A1172 S1082 S1220 P440 E443 - 18.2 41.8 60 ns33 rs2229107 E27/3421T>A (S1141T) S1141 S1142 S1137 S1149 T1183 T1176 D1086 S1224 D444 R447 T1277 45.5 50.9 61 s20 rs1045642 E27/3435C>T (I1145I) C-NBD (Internal) I1145 I1146 I1141 I1153 V1187 I1180 I1090 M1228 V447 I450 V1281 72.7 57.6 62 ns34 rs59241388 E28/3502A>G (K1168E) K1168 R1169 R1164 R1176 R1210 R1203 C1113 L1251 E470 V473 N1304 27.3 61.9 63 ns35 rs41309231 E29/3669A>T (E1223D) E1223 E1224 E1219 E1231 E1265 E1258 V1168 Q1306 K525 K528 D1359 27.3 60.2 64 s21 rs2235051 E29/3747C>G (G1249G) C-NBD (Internal) G1249 G1250 G1245 G1257 G1291 G1284 G1194 G1332 G551 G554 T1392 63.6 63.0 65 ns36 rs45456698 E29/3751G>A (V1251I) V1251 V1252 V1247 V1259 I1293 V1286 V1196 I1334 I553 I556 V1394 81.8 59.2 4.957.279931T165T855T9331T1021N1921D8921T4621T2521T7521T6521T)K6521T(A>C7673/92E93412753sr73sn66 C-NBD (External) C-NBD (External) C-NBD (External) C-NBD (External) TM4 - TM9 TM10 - TM1 S. aureus TM12 N-NBD (Internal) N-NBD (External) N-NBD (Internal) C-NBD (External) TM3 C. elegans D. melanoga ster A. thaliana S. pombe # SNP (amino acid substitution) Mapped to Abcb1a domain (internal/external surface) rsNo Conservation (%)a H. Sapiens C. l. Familiaris M. Musculus G. gallus P. falciparum Amino acid residue housing SNP Individual Regional 3 structure E. coli a The conservation of residues corresponding to all coding regions SNPs was obtained following multiple sequence alignment of 11 confirmed ABCB1 homolog protein sequences. Login to comment
109 The evolutionary non-conserved E12/1199G4A (S400N), which alters drug pharmacokinetics and response, resides in an evolutionary conserved region SNP E12/1199G4A (S400N) (#ns9 in Figure 2b), which occurs at o4% in Caucasians and Africans but is not found in Asians (Supplementary Table 2) represents another nsSNP that has been associated with drug pharmacokinetics. Login to comment
110 Through cell-based experiments using limited substrates, Kimchi-Sarfaty et al.42 inferred that substrate specificity was not significantly influenced by the any of the nonsynonymous coding SNPs including S400N. Login to comment
113 Cellular uptake and permeability of five HIV protease inhibitors, especially ritonavir and saquinavir, was increased in cells carrying the minor allele.44 This SNP was also reported to confer resistance to vinblastine, vincristine, paclitaxel and etoposide, but not doxorubicin.45,46 Interestingly, a novel T allele of this SNP (E12/1199G4A (S400N)) coding for the amino acid, isoleucine (I), was identified in 2.3% of leukemia patients. Login to comment
116 Although only two patients with heterozygous (G/A) genotype were identified, their mean progression-free survival was only 2 months compared with 19 months for patients who are homozygous for the G allele.48 From the 3D crystal structure, this polymorphism (S400N) was found to lie in the same turn region between two b-sheets as Gly412, which corresponds to the codon housing the synonymous SNP E13/1236C4T (Figure 4b) (see flash movie at http://pfs.nus.edu.sg/demo_src/abcb1.html). Login to comment
125 This Figure 4 Location and conservation of (a) E8/554G4T (G185V), (b) E12/1199G4A (S400N), (c) E26/3151C4G (P1051A), (d) E27/3322T4C (W1108R), (e) E27/3421T4A (S1141T), (f) E29/3751G4A (V1251I). Login to comment
129 It resides within a turn region between two opposing b-sheets in an almost similar fashion to that of #ns9 E12/1199G4A (S400N) (Figure 4b), close to the well-conserved A-loop (Tyrosine 1040) and Walker A motif that is crucial for ATP activity.15,18 This residue has an individual conservation score of just 18.2% but have a regional conservation score of B60% (Table 1, Figure 4c) suggesting that during the evolution of the protein, there is also considerable tolerance of variation at this residue but not of the surrounding residues. Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."

No. Sentence Comment

6832 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/ Localization ABCB1 MDR1 A61G N21D ↔ N.D. T307C F103L N.D. N.D. G1199A S400N 1↔ Normal C2005T R669C ↔ N.D. G2677T A893S 21↔ Normal G2677A A893T 1↔ Notmal T3421A S1141T 2↔ N.D. C3435T I1145I 2↔ N.D. G3751A V1251I 2 N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment

PMID: 22565165 [PubMed] Grover S et al: "Genetic association analysis of transporters identifies ABCC2 loci for seizure control in women with epilepsy on first-line antiepileptic drugs."

No. Sentence Comment

87 - 330-21247T > C Intron 1 0.005 6 rs4148731 chr7:87239329 c.-330 - 8935C > T Intron 1 0.000 7 rs9282564 chr7:87229440 c.61A > G Exon 3 (Asn21Asp) 0.000 8 rs9282565 chr7:87214875 c.239C > A Exon 5 (Ala80Glu) 0.000 9 rs28381826 chr7:87214531 c.286 + 297G > A Intron 5 0.000 10 rs1989830 chr7:87205663 c.287 - 6124C > T Intron 5 0.135 11 rs2520464 chr7:87201086 c.287 - 1547A > G Intron 5 0.409 12 rs2235023 chr7:87190452 c.827+ 127G > A Intron 9 0.000 13 rs10276036 chr7:87180198 c.1000 - 44C > T Intron 10 0.401 14 rs2229109 chr7:87179809 c.1199G > A Exon 12 (Ser400Asn) 0.000 15 rs1128503 chr7:87179601 c.1236T > C Exon 13 (Gly412Gly) 0.390 16 rs2235036 chr7:87175271 c.1795G > A Exon 16 (Ala599Thr) 0.000 17 rs2235039 chr7:87165854 c.2401G > A Exon 21 (Val801Met) 0.000 18 rs2235040 chr7:87165750 c.2481 + 24G > A Intron 21 0.155 19 rs2032581 chr7:87160810 c.2485A > G Exon 22 (Ile829Val) 0.000 20 rs2032582 chr7:87160618 c.2677T/A > G Exon 22 (Ser/Thr893Ala) 0.318 21 rs7779562 chr7:87144816 c.3085 -72G > C Intron 25 0.043 22 rs2707944 chr7:87144641 c.3188C > G Exon 26 (Ala1063Gly) 0.000 23 rs2229107 chr7:87138659 c.3421A > T Exon 27 (Thr1141Ser) 0.000 24 rs1045642 chr7:87138645 c.3435T > C Exon 27 (Ile1145Ile) m Expression and activity [28] m mRNA expression [29] Altered substrate specificity [30] 0.375 25 rs2235048 chr7:87138511 c.3489 + 80C > T Intron 27 0.381 26 rs17064 chr7:87133470 c.3932A > T 30 UTR 0.000 ABCC1 1 rs504348 chr16:16043174 rs50438C > G Near gene region k Promoter activity [31] 0.135 2 rs215106 chr16:16047542 c.48 + 3886A > G Intron 1 0.210 3 rs215049 chr16:16070768 c.48 + 27112G > C Intron 1 0.245 4 rs246220 chr16:16082128 c.49 - 19545C > G Intron 1 0.118 5 rs119774 chr16:16086833 c.49 - 14840G > A Intron 1 0.089 6 rs246217 chr16:16090354 c.49 - 11319C > A Intron 1 0.118 7 rs2014800 chr16:16099966 c.49 - 1707C > T Intron 1 0.398 8 rs41494447 chr16:16101842 c.218C > T Exon 2 (Thr73Ile) 0.000 9 rs4781712 chr16:16103232 c.226 - 401A > G Intron 2 0.355 10 rs246240 chr16:16119024 c.616 -7942A > G Intron 5 0.114 11 rs924135 chr16:16123459 c.616 - 3507A > T Intron 5 0.412 12 rs903880 chr16:16130514 c.809 + 54C > A Intron 7 0.147 13 rs8187852 chr16:16139709 c.1057G > A Exon 9 (Met353Val) 0.000 14 rs35587 chr16:16139714 c.1062T > C Exon 9 (Asn354Asn) 0.182 15 rs35592 chr16:16141823 c.1219 - 176T > C Intron 9 0.172 16 rs60782127 chr16:16142079 c.1299G > T Exon 10 (Arg433Ser) k Transport of leukotriene C4 and estrone sulfate [32] 0.008 17 rs3765129 chr16:16149901 c.1474 - 48C > T Intron 11 0.032 18 rs35597 chr16:16158034 c.1678 - 3979G > A Intron 12 0.320 19 rs35621 chr16:16168608 c.1913 - 1575C > T Intron 14 0.103 20 rs45511401 chr16:16173232 c.2012G > T Exon 16 (Gly671Val) 0.024 21 rs4148356 chr16:16177275 c.2168G > A Exon 17 (Arg723Gln) 0.000 22 rs3851713 chr16:16184873 c.2644 + 428A > T Intron 19 0.340 23 rs2239995 chr16:16192565 c.2645 - 3919G > A Intron 19 0.324 24 rs11864374 chr16:16201885 c.2871 + 1155G > A Intron 21 0.338 25 rs35529209 chr16:16205325 c.2965G > A Exon 22 (Thr989Ala) k Transport of estradiol 17b-glucuronide [32] 0.000 26 rs3887893 chr16:16205501 c.3079 + 62G > A Intron 22 0.448 27 rs13337489 chr16:16208683 c.3140G > C Exon 23 (Ser1047Cys) 0.000 28 rs2299670 chr16:16220858 c.3819 + 1090A > G Intron 26 0.399 29 rs8057331 chr16:16230411 c.4202C > T Exon 29 (Thr1401Met) 0.000 30 rs212090 chr16:16236004 c.5462T > A 30 UTR 0.357 31 rs212093 chr16:16237754 rs212093G > A Near gene region 0.429 32 rs4148382 chr16:16238494 rs4148382G > A Near gene region 0.034 ABCC2 1 g.-1774G > delG chr10:101535688 g.-1774G > delG Near gene region k Promoter activity [33] 0.000 2 rs1885301 chr10:101541053 c.-1549G > A Near gene region k Promoter activity [haplotype containing (- 1549A)-(- 24T)] [33] k Clearance of irinotecan (ABCC2*2 containing the G allele) [34] 0.379 450 Pharmacogenetics and Genomics 2012, Vol 22 No 6 Table 2 (continued) N dbSNP ida Positionb Allelesc Gene location (effect) Function MAF 3 rs2804402 chr10:101541583 c. Login to comment

PMID: 22835948 [PubMed] De Meyer M et al: "Donor age and ABCB1 1199G>A genetic polymorphism are independent factors affecting long-term renal function after kidney transplantation."

No. Sentence Comment

209 [20] Woodahl EL, Crouthamel MH, Bui T, et al. MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents. Login to comment
205 [20] Woodahl EL, Crouthamel MH, Bui T, et al. MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents. Login to comment

PMID: 20138191 [PubMed] Ishikawa T et al: "Emerging new technologies in Pharmacogenomics: rapid SNP detection, molecular dynamic simulation, and QSAR analysis methods to validate clinically important genetic variants of human ABC Transporter ABCB1 (P-gp/MDR1)."

No. Sentence Comment

478 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
500 SNP Km Vmax Vmax / Km (µM) (nmol/min/mg protein) WT 5.8±2.3 62.4±7.8 10.8 S400N 5.8±2.8 46.7±5.3⁎⁎ 8.0 R492C 5.6±1.9 49.6±10.0⁎ 8.9 R669C 3.2±1.6⁎ 64.7±6.9 20.1 I849M 1.5±0.7⁎⁎ 80.3±9.5⁎⁎ 51.8 A893P 1.5±0.5⁎⁎ 405.2±16.5⁎⁎ 274.6 A893S 11.1±5.4 43.1±7.1⁎⁎ 3.9 A893T 4.3±1.4 98.9±9.5⁎⁎ 22.9 M986V 5.1±1.1 114.9±13.6⁎⁎ 22.5 A999T 2.0±0.8⁎⁎ 143.1±21.2⁎⁎ 70.9 P1051A 6.2±3.0 52.1±13.6 8.4 G1063A 6.2±3.7 117.9±16.4⁎⁎ 19.0 Data are expressed as mean±S.D., n=6. Login to comment
533 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment
476 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
498 SNP Km Vmax Vmax / Km (&#b5;M) (nmol/min/mg protein) WT 5.8&#b1;2.3 62.4&#b1;7.8 10.8 S400N 5.8&#b1;2.8 46.7&#b1;5.3Ìe;Ìe; 8.0 R492C 5.6&#b1;1.9 49.6&#b1;10.0Ìe; 8.9 R669C 3.2&#b1;1.6Ìe; 64.7&#b1;6.9 20.1 I849M 1.5&#b1;0.7Ìe;Ìe; 80.3&#b1;9.5Ìe;Ìe; 51.8 A893P 1.5&#b1;0.5Ìe;Ìe; 405.2&#b1;16.5Ìe;Ìe; 274.6 A893S 11.1&#b1;5.4 43.1&#b1;7.1Ìe;Ìe; 3.9 A893T 4.3&#b1;1.4 98.9&#b1;9.5Ìe;Ìe; 22.9 M986V 5.1&#b1;1.1 114.9&#b1;13.6Ìe;Ìe; 22.5 A999T 2.0&#b1;0.8Ìe;Ìe; 143.1&#b1;21.2Ìe;Ìe; 70.9 P1051A 6.2&#b1;3.0 52.1&#b1;13.6 8.4 G1063A 6.2&#b1;3.7 117.9&#b1;16.4Ìe;Ìe; 19.0 Data are expressed as mean&#b1;S.D., n=6. Login to comment
502 Descriptor Coefficients (95% reliability) for ABCB1 WT and vatiants WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 (3.76) 21.2 (5.81) 18.5 (5.87) 35.9 (7.68) 52.7 (11.30) 169.8 (18.84) 14.0 (4.03) 61.2 (7.75) 39.4 (8.76) 63.0 (9.39) 13.9 (4.78) 52.1 (10.94) M132 21.5 (3.89) 14.1 (5.34) 13.6 (5.78) 32.8 (6.89) 61.4 (12.66) 135.6 (22.95) 11.2 (4.06) 52.8 (7.16) 38.2 (8.62) 65.9 (8.44) 7.6 (5.71) 24.3 (10.46) C-CHN-BT 3.3 (0.72) 3.8 (0.95) 1.7 (0.87) 3.5 (1.08) 5.7 (1.55) 11.6 (2.48) 1.2 (0.65) 6.1 (1.29) 7.1 (1.43) 7.3 (1.44) 2.0 (0.66) 2.8 (1.86) ESTR -10.1 (4.93) -12.5 (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 (7.86) -4.4 (1.73) RT -8.9 (4.21) -17.7 (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 (3.69) -11.7 (5.30) -7.7 (3.70) -22.8 (8.75) -16.4 (8.19) -16.5 (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 (5.46) 14.4 (7.91) M392 73.3 (25.03) 10.3 (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 (4.01) 24.0 (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) Const. Login to comment
534 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment

PMID: 19819348 [PubMed] Benish RL et al: "Comparative description of haplotype structure and genetic diversity of MDR1 (ABCB1) in HIV-positive and HIV-negative populations."

No. Sentence Comment

155 Thus, it is important to determine whether these interethnic genetic differences in MDR1, together with other potentially significant polymorphisms in the MDR1 coding, 1199G>A (Ser400Asn) (Woodahl et al., 2005), 571G>A (Gly191Arg) (Yang et al., 2008), and 3421T>A (Ser1141Thr) (Kroetz et al., 2003), as well as regulatory regions (Taniguchi et al., 2003; Loeuillet et al., 2007), are associated with different outcomes of protease inhibitor-based HIV/AIDS treatment. Login to comment

PMID: 19285158 [PubMed] Fung KL et al: "A synonymous polymorphism in a common MDR1 (ABCB1) haplotype shapes protein function."

No. Sentence Comment

152 A study in our lab showed that common polymorphisms of MDR1 at 61ANG (N21D), 307TNC (F103L), 1199GNA (S400N), 2677GNT (A893S) and 2995GNA (A999T) do not change the transport of four MDR1 substrates when expressed at high levels in human cells [66]. Login to comment
153 A recent study by Gow et al. suggested that all of the SNPs they tested (N21D, S400N, R669C, A893S, A893T, S1141T, V1251I) produced small changes which in most cases are not statistically significant [59]. Login to comment
342 Several amino acid residues around this SNP (e.g., Y401, S400N) are essential for ATP-binding and ATP hydrolysis [42,49]. Login to comment
151 A study in our lab showed that common polymorphisms of MDR1 at 61ANG (N21D), 307TNC (F103L), 1199GNA (S400N), 2677GNT (A893S) and 2995GNA (A999T) do not change the transport of four MDR1 substrates when expressed at high levels in human cells [66]. Login to comment
341 Several amino acid residues around this SNP (e.g., Y401, S400N) are essential for ATP-binding and ATP hydrolysis [42,49]. Login to comment

PMID: 16504381 [PubMed] Kerb R et al: "Implications of genetic polymorphisms in drug transporters for pharmacotherapy."

No. Sentence Comment

76 Table 3 Overview of the 15 most common ABCB1 (MDR1) genetic variants Position Location Effect Allelic frequency (%) CA AS AA K129TOC 50 UTR Non-coding 5 4 7 K1GOA 50 UTR Non-coding 8 5 0 61AOG Exon 2 Asn21Asp 8 2 2.5 Exon 5-25GOT Intron 4 16 7 30 Exon 10-44AOG Exon 10 Intron 9 45 69 26 1199GOA Exon 11 Ser400Asn 2.5 0 !1 1236COT Exon 12 Synonymous 46 69 21 Exon 11C44COT Intron 12 5 0 17 Exon 12C24COT Intron 13 52 54 54 Exon 13C38AOG Intron 14 50 68 54 Exon 19C24GOA Intron 20 12 7 15 2677GOT/A Exon 21 Ala893Ser/Thr 46/2 45/7 O1 3421TOA Exon 26 Ser1141Thr 0 0 10 3435COT Exon 26 Synonymous 56 40 10 IVSC21TOC Intron 28 0 8 0 AA, African American; AS, Asian; CA, Caucasian. Login to comment
75 Table 3 Overview of the 15 most common ABCB1 (MDR1) genetic variants Position Location Effect Allelic frequency (%) CA AS AA K129TOC 50 UTR Non-coding 5 4 7 K1GOA 50 UTR Non-coding 8 5 0 61AOG Exon 2 Asn21Asp 8 2 2.5 Exon 5-25GOT Intron 4 16 7 30 Exon 10-44AOG Exon 10 Intron 9 45 69 26 1199GOA Exon 11 Ser400Asn 2.5 0 !1 1236COT Exon 12 Synonymous 46 69 21 Exon 11C44COT Intron 12 5 0 17 Exon 12C24COT Intron 13 52 54 54 Exon 13C38AOG Intron 14 50 68 54 Exon 19C24GOA Intron 20 12 7 15 2677GOT/A Exon 21 Ala893Ser/Thr 46/2 45/7 O1 3421TOA Exon 26 Ser1141Thr 0 0 10 3435COT Exon 26 Synonymous 56 40 10 IVSC21TOC Intron 28 0 8 0 AA, African American; AS, Asian; CA, Caucasian. Login to comment

PMID: 16529292 [PubMed] Li YH et al: "MDR1 gene polymorphisms and clinical relevance."

No. Sentence Comment

42 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp . Login to comment
46 The 16.18.19,35] B@%fW Acta Genetica Sinica Vo1.33 No.2 2006 nonsynonymous G1199A (Ser400Asn) in exon 11 brings about a significant size change, and depending on the pH and isoelectric environment of the residue, may lead to a charge change in the protein. Login to comment
52 Furthermore, Kimchi-Sarfaty and his colleagues carried out a study to characterize the functional consequences of five coding SNPs (Asn21Asp,Phel03Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system, but it was found that the distribution and function of P-gp in the cells were similar to wild-type P-gp in the human body'431.The mechanism of these contradictory results regarding the C2677T/A and C3435T polymorphisms function is unclear until now. Login to comment
49 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp . Login to comment
54 The 16.18.19,35] B@%fW Acta Genetica Sinica Vo1.33 No.2 2006 nonsynonymous G1199A (Ser400Asn) in exon 11 brings about a significant size change, and depending on the pH and isoelectric environment of the residue, may lead to a charge change in the protein. Login to comment
64 Furthermore, Kimchi-Sarfaty and his colleagues carried out a study to characterize the functional consequences of five coding SNPs (Asn21Asp,Phel03Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system, but it was found that the distribution and function of P-gp in the cells were similar to wild-type P-gp in the human body'431.The mechanism of these contradictory results regarding the C2677T/A and C3435T polymorphisms function is unclear until now. Login to comment

PMID: 12406646 [PubMed] Fromm MF et al: "The influence of MDR1 polymorphisms on P-glycoprotein expression and function in humans."

No. Sentence Comment

59 The G1199A mutation (Ser400Asn) is located- ondansetron [30] - losartan [83] - morphine [68] in the cytoplasmic loop close to the first ATP- Antidiarrheal agents - phenytoin [30] binding domain. The most frequent SNP (G2677T/ - loperamide [30] - rifampin [41] A) leading to amino acid exchanges from Ala to Ser Table 3 Summary of currently known MDR1 genetic variants in Caucasians [ Location Position Allele Effect Allelic Genotype Genotype Ref. Frequency Frequency (%) (%) 1 exon 1b exon 1b/12 T 94.1 T/T 88.2 [21] C 5.9 T/C 11.8 C/C 0.0 2 intron 1 Exon 2-1 G initiation 91.0 G/G 82.0 [21-23] A of 9.0 G/A 18.0 translation A/A 0.0 3 exon 2 cDNA 61 A 21 Asn 88.8 A/A 78.5 [21-23,84] G 21 Asp 11.2 A/G 20.6 G/G 0.9 4 intron 4 exon 5-35 G 99.4 G/G 98.8 [21] C 0.6 G/C 1.2 C/C 0.0 5 intron 4 exon 5-25 G 83.5 G/G 70.5 [21] T 16.5 G/T 26.0 T/T 3.5 6 intron 6 exon 6 1 139 C 62.8 C/C 39.0 [21,22] T 37.2 C/T 47.5 T/T 13.4 7 intron 6 exon 6 1 145 C 98.8 C/C 97.6 [21] T 1.2 C/T 2.4 T/T 0.0 8 exon 7 cDNA 548 A 183 Asn 98.6 A/A n.a. [23] G 183 Ser 1.4 A/G n.a. G/G n.a. 9 exon 11 cDNA 1199 G 400 Ser 94.5 G/G 88.9 [21-23] A 400 Asn 5.5 G/A 11.1 A/A 0.0 10 exon 12 cDNA 1236 C wobble 59.0 C/C 34.4 [21-23] T 41.0 C/T 49.2 T/T 16.4 11 intron 12 exon 12 1 44 C 95.1 C/C 90.2 [21,22] T 4.9 C/T 9.8 T/T 0.0 12 exon 13 cDNA 1474 C 492Arg 98.6 C/C n.a. [23] T 492Cys 1.4 C/T n.a. T/T n.a. 13 intron 16 exon 17-76 T 53.8 T/T 28.4 [21,22] A 46.2 T/A 50.8 A/A 20.8 14 intron 17 exon 17 1 137 A 99.4 A/A 98.8 [21] G 0.6 A/G 1.2 G/G 0.0 15 exon 21 cDNA2650 C wobble 97.3 C/C n.a. [23] T 2.7 C/T n.a. T/T n.a. 16 exon 21 cDNA 2677 G 893 Ala 56.5 G/G 30.9 [22,23] T 893 Ser 41.6 G/T 49.2 A 893 Thr 1.9 T/T 16.1 G/A 2.0 T/A 1.8 A/A 0.0 Table 3. Login to comment

PMID: 12235446 [PubMed] Siegmund W et al: "Effect of levothyroxine administration on intestinal P-glycoprotein expression: consequences for drug disposition."

No. Sentence Comment

38 MDR1 genotyping The following 10 most frequent or putatively functional single nucleotide polymorphisms of the MDR1 gene were identified as described recently: exon 2 G-1A, A61G (amino acid exchange Asn21Asp), T307C (Phe103Leu), exon 6 Cϩ139T, G1199A (Ser400Asn), C1236T, exon 17 T-76A, G2677T/A (Ala893Ser/Thr), and C3435T.18 In brief, the deoxyribonucleic acid (DNA) of venous blood was extracted by use of a standard phenol-chloroform procedure. Login to comment

PMID: 11495756 [PubMed] Brinkmann U et al: "Pharmacogenetics of the human drug-transporter gene MDR1: impact of polymorphisms on pharmacotherapy."

No. Sentence Comment

68 Single nucleotide polymorphisms (SNPs) in the MDR1 gene SNP Region Number Frequency of SNPsa [%] Effect Heterozygous Homozygous Observed Estimated T-12C E1 85 11.8 0 0.4 Non-coding G-1A E2 188 11.2 0 0.4 Translation initiation A61G E2 188 17.6 0.5 0.81 Asn21Asp G-25T I4 85 26.0 3.5 2.3 G-35C I4 85 1.2 0 0.01 T307C E5 85 1.2 0 0.01 Phe103Leu C+139T I5 85 48.2 16.5 16.8 C+145T I5 85 2.4 0 0.01 G1199A E11 85 12.9 0 0.4 Ser400Asn C1236T E12 188 48.9 13.3 14.4 Gly412Gly C+44T I12 188 11.7 0 0.4 T-76A I16 85 45.9 22.4 20.3 A+137G I17 85 1.2 0 0.01 G2677T E21 83b 43.4 42.2 38.4 Ala893Ser G2995A E24 36b 11.1 0 Ala999Thr C3435T E26 537 47.7 26.4 24.1 Ile1145Ile C3396T E26 188 0.53 0 0.01 Wobble aMDR1 sequences Genbank (gb) accession numbers AC002457 and AC005068 are defined as wildtype. Login to comment

PMID: 25881102 [PubMed] Lambrechts S et al: "Genetic variability in drug transport, metabolism or DNA repair affecting toxicity of chemotherapy in ovarian cancer."

No. Sentence Comment

79 rs2229109,c.1199G>A, Ser400Asn Variant allele carriers: correlation with in vitro resistance to paclitaxel [22]. Login to comment

PMID: 15217301 [PubMed] Ieiri I et al: "The MDR1 (ABCB1) gene polymorphism and its clinical implications."

No. Sentence Comment

162 [94] Recently, a new mechanism for the drug- Sarfaty et al.[89] also investigated functional conse- grapefruit juice interaction has been reported; the quences of MDR1 polymorphisms (Asn21Asp, bioavailability and serum concentrations of fex- Phe103Leu, Ser400Asn, Ala893Ser, and ofenadine were reduced when grapefruit juice was Ala998Thr) using a vaccinia virus-based transient taken. Login to comment

PMID: 16509759 [PubMed] Bosch TM et al: "Genetic polymorphisms of drug-metabolising enzymes and drug transporters in the chemotherapeutic treatment of cancer."

No. Sentence Comment

2327 Characteristics of drug transporter genes (with the most important polymorphisms)[167-169] Gene Location Protein Exons Amino Polymorphisms Location Effect (chromosome) acids (exon) ABCB1 7q21 P-gp/MDR1 29 1280 *6 (C3435T) 26 Silent *7 (G2677T/A) 21 A893S *8 (C1236T) 12 Silent G1199A 11 S400N ABCC2 10q24 MRP2 32 1545 C-24T 5'-UTR Unknown C1249A 10 V417I C2302T 18 R768W C2366T 18 S789F T2439+2C 18 Splice site ND 26 W1254Y,A,C,F C3972T 28 Silent A4145G 29 Q1382R G4348A 31 G1440S ABCG2 4q22 BCRP 16 655 G34A 2 V12M C8825A 5 Q141K BCRP = breast cancer resistance protein; MDR1 = multidrug resistance 1; MRP2 = multidrug resistance protein 2; ND = no data; P-gp = P-glycoprotein. Login to comment

PMID: 24621983 [PubMed] Dessilly G et al: "ABCB1 1199G>A genetic polymorphism (Rs2229109) influences the intracellular accumulation of tacrolimus in HEK293 and K562 recombinant cell lines."

No. Sentence Comment

9 This observation indicates that the amino-acid substitution (Ser400Asn) encoded by the 1199A allele drastically decreases the ability of ABCB1 to drive the efflux of tacrolimus in a substrate-specific manner, in agreement with our previously published clinical data. Login to comment
149 Overexpression of the 1199A variant allele had no effect on Tac accumulation when compared to control cell lines (p.0.05), suggesting that substitution of serine 400 for asparagine strongly reduces ABCB1-mediated Tac efflux in HEK293 and K562 cell lines. Login to comment
206 The differential activity of ABCB1 1199G.A SNP towards Rh123, doxorubicin, vinblastine, Tac and CsA could be explained by the fact that the ABCB1 Ser400Asn substitution is located in a cytoplasmic loop involved in substrate recognition. Login to comment
279 Neoplasma 56: 202-207. 13. Woodahl EL, Crouthamel MH, Bui T, Shen DD, Ho RJ (2009) MDR1 (ABCB1) G1199A (Ser400Asn) polymorphism alters transepithelial permeability and sensitivity to anticancer agents. Login to comment

PMID: 25637052 [PubMed] Jordheim LP et al: "Single nucleotide polymorphisms in ABCB1 and CBR1 can predict toxicity to R-CHOP type regimens in patients with diffuse non-Hodgkin lymphoma."

No. Sentence Comment

14 rs2229109 (Ser400Asn) in ABCB1 was associated with increased risk of high-grade diarrhea (P=0.007) and haematologica 2015; 100:e204 LETTERS TOߘTHE EDITOR Table 1. Login to comment

PMID: 25860377 [PubMed] Wolking S et al: "Impact of Genetic Polymorphisms of ABCB1 (MDR1, P-Glycoprotein) on Drug Disposition and Potential Clinical Implications: Update of the Literature."

No. Sentence Comment

67 Only a few reports have described the functional consequences of rare variants in cell models, e.g. variants 266T[C (rs35810889, p.M89T), 1199G[A/T/C (rs2229109, p.S400N/I/T), 1985T[G (rs35657960, p.L662R), 2005C[T (rs35023033, p.R669C), 3322T[C (rs35730308, p.T1108R) and 3751G[A (rs28364274, p.V1251I) [50-52]. Login to comment