ABCMdb

ABCG8 p.Asp19His

None has been submitted yet.

Publications

PMID: 11668628 [PubMed] Hubacek JA et al: "Mutations in ATP-cassette binding proteins G5 (ABCG5) and G8 (ABCG8) causing sitosterolemia."

No. Sentence Comment

6 Nine nonsynonymous polymorphisms are also reported: I523V, C600Y, Q604E, and M622V in ABCG5; and D19H, Y54C, T400K, A632V, and Y641F in ABCG8. Login to comment
36 Gene Exon NT change AA change Allele frequency RE ABCG5 ABCG8 ex. 11 ex. 13 ex. 13 ex. 13 ex. 1 ex. 2 ex. 8 ex. 13 ex. 13 c.1567 A>G c.1799 G>A c.1810 C>G c.1864 A>G c.52 G>C c.161 A>G c.1199 C>A c.1895 C>T c.1922 A>T I523V C600Y Q604E M622V D19H Y54C T400K A632V Y641F <1% <1% C=0.80/G=0.20 <1% G=0.94/C=0.06 A=0.61/G=0.39 C=0.80/A=0.20 C=0.83/T=0.17 A=0.99/T=0.01 XmnI TsrpI SexAI MseI NcoI MboII *The polymorphisms were found either in sitosterolemic probands or in genomic DNA from 24 individuals with high plasma cholesterol concentrations. Allele frequencies of the nonsynonymous sequence variants identified were determined in 50 unrelated Caucasians. Login to comment

PMID: 11893785 [PubMed] Berge KE et al: "Heritability of plasma noncholesterol sterols and relationship to DNA sequence polymorphism in ABCG5 and ABCG8."

No. Sentence Comment

125 Linkage disequilibrium between polymorphisms in ABCG5 and ABCG8 Locus 1 Locus 2 DЈ P ABCG5 Q604E ABCG8 D19H 0.47 0.001 ABCG8 Y54C 0.29 0.095 ABCG8 T400K 0.31 0.299 ABCG8 A632V 0.06 0.451 ABCG8 D19H ABCG8 Y54C 0.62 0.122 ABCG8 T400K 0.63 0.408 ABCG8 A632V 0.04 0.979 ABCG8 Y54C ABCG8 T400K 0.85 0 ABCG8 A632V 0.04 0.959 ABCG8 T400K ABCG8 A632V 0.69 0.016 Haplotypes were determined in 74 nuclear families. Login to comment
5 Two common sequence variations (D19H and T400K) in ABCG8, an ABC half-transporter defective in sitosterolemia, were associated with lower concentrations of plant sterols in parents, and in their offspring. Login to comment
109 The D19H polymorphism in exon 1 of ABCG8 was associated with the plasma cholestanol-cholesterol and campesterol-cholesterol ratios, and the T400K polymorphism in ABCG8 was associated with the plasma sitosterol-cholesterol ratio. Login to comment
159 Both analyses indicated an association between a polymorphism (D19H) in exon 1 of ABCG8 and the plasma concentrations of campesterol. Login to comment
161 The finding of a statistically significant association between plasma sitosterol concentrations and this nonconservative substitution suggests that the substitution of histidine for aspartic acid at amino acid 19 alters the function of ABCG8. Login to comment
164 Furthermore, we cannot exclude the possibility that the association observed is due to linkage disequilibrium with another polymorphism(s) at this locus, rather than to a direct effect of the D19H substitution. Login to comment
166 A common nonconservative substitution (T400K) was associated with the plasma concentrations of sitosterol, although the association of this polymorphism with plasma campesterol concentration was marginal. Login to comment
173 Effect of ABCG8 polymorphisms on plasma sterol-cholesterol ratios in siblings Cholesterol Cholestanol Desmosterol Lathosterol Sitosterol Campesterol ABCG8 D19H 0.097 0.08 0.005 0.001 0.13 0.045 ABCG8 T400K 0.29 0.02 0.34 0.24 0.05 0.03 ABCG8 A632V 0.018 0.29 0.18 0.39 0.26 0.22 The relationships between ABCG8 polymorphisms and plasma sterol-cholesterol ratios were assessed by comparing the plasma sterol levels of siblings with different genotypes. Login to comment
110 The D19H polymorphism in exon 1 of ABCG8 was associated with the plasma cholestanol-cholesterol and campesterol-cholesterol ratios, and the T400K polymorphism in ABCG8 was associated with the plasma sitosterol-cholesterol ratio. Login to comment
126 Linkage disequilibrium between polymorphisms in ABCG5 and ABCG8 Locus 1 Locus 2 D9 P ABCG5 Q604E ABCG8 D19H 0.47 0.001 ABCG8 Y54C 0.29 0.095 ABCG8 T400K 0.31 0.299 ABCG8 A632V 0.06 0.451 ABCG8 D19H ABCG8 Y54C 0.62 0.122 ABCG8 T400K 0.63 0.408 ABCG8 A632V 0.04 0.979 ABCG8 Y54C ABCG8 T400K 0.85 0 ABCG8 A632V 0.04 0.959 ABCG8 T400K ABCG8 A632V 0.69 0.016 Haplotypes were determined in 74 nuclear families. Login to comment
128 Mean plasma sterol concentrations and sterol-cholesterol ratios in unrelated men and women with different ABCG5 and ABCG8 genotypes ABCG8 D19H ABCG8 Y54C ABCG8 T400K ABCG8 A632V ABCG5 Q604E DD n 5 128 DH/HH n 5 14 YY n 5 54 YC/CC n 5 85 TT n 5 95 TK/KK n 5 48 AA n 5 94 VA/VV n 5 49 QQ n 5 91 QE/EE n 5 51 Plasma sterol concentrations Cholesterol 202 6 41 194 6 33 199 6 39 203 6 40 197 6 38 207 6 42 195 6 38 b 213 6 40 198 6 40 204 6 40 Cholestanol 420 6 110 b 340 6 72 400 6 104 419 6 114 410 6 115 418 6 103 400 6 97 437 6 131 411 6 114 416 6 105 Desmosterol 200 6 70 196 6 79 195 6 66 202 6 74 1916 67 221 6 79 197 6 75 210 6 68 197 6 74 208 6 70 Lathosterol 308 6 135 365 6 252 308 6 120 320 6 168 296 6 136 354 6 171 309 6 165 329 6 116 314 6 154 322 6 145 Sitosterol 257 6 105 b 177 6 53 231 6 93 261 6 109 256 6 114 238 6 83 239 6 87 274 6 130 250 6 107 250 6 104 Campesterol 338 6 147 b 233 6 72 310 6 133 339 6 152 332 6 149 324 6 144 308 6 124 a 375 6 177 328 6 154 332 6 136 Plasma sterol-cholesterol ratios (mg/mg) Cholestanol 2.09 6 0.40 c 1.76 6 0.31 2.02 6 0.37 2.07 6 0.39 2.09 6 0.44 2.01 6 0.31 2.06 6 0.41 2.05 6 0.39 2.08 6 0.40 2.04 6 0.42 Desmosterol 0.99 6 0.26 1.00 6 0.32 0.97 6 0.25 0.99 6 0.28 0.96 6 0.25 a 1.06 6 0.30 1.00 6 0.29 0.98 6 0.23 0.98 6 0.27 1.02 6 0.27 Lathosterol 1.53 6 0.60 1.84 6 1.06 1.57 6 0.60 1.57 6 0.70 1.48 6 0.57 a 1.73 6 0.78 1.57 6 0.70 1.56 6 0.57 1.57 6 0.67 1.58 6 0.63 Sitosterol 1.28 6 0.45 c 0.94 6 0.32 1.18 6 0.45 1.29 6 0.45 1.30 6 0.48 a 1.15 6 0.35 1.24 6 0.42 1.29 6 0.51 1.27 6 0.44 1.23 6 0.48 Campesterol 1.67 6 0.62 c 1.21 6 0.36 1.56 6 0.59 1.66 6 0.63 1.68 6 0.62 1.54 6 0.60 1.58 6 0.59 1.74 6 0.65 1.64 6 0.63 1.61 6 0.59 Values are means 6 SD. Plasma cholesterol concentrations are in mg/dl. Login to comment
169 Furthermore, we cannot exclude the possibility that the association observed is due to linkage disequilibrium with another polymorphism(s) at this locus, rather than to a direct effect of the D19H substitution. Login to comment
178 Effect of ABCG8 polymorphisms on plasma sterol-cholesterol ratios in siblings Cholesterol Cholestanol Desmosterol Lathosterol Sitosterol Campesterol ABCG8 D19H 0.097 0.08 0.005 0.001 0.13 0.045 ABCG8 T400K 0.29 0.02 0.34 0.24 0.05 0.03 ABCG8 A632V 0.018 0.29 0.18 0.39 0.26 0.22 The relationships between ABCG8 polymorphisms and plasma sterol-cholesterol ratios were assessed by comparing the plasma sterol levels of siblings with different genotypes. Login to comment

PMID: 14703505 [PubMed] Kajinami K et al: "ATP binding cassette transporter G5 and G8 genotypes and plasma lipoprotein levels before and after treatment with atorvastatin."

No. Sentence Comment

37 In the present study, five prevalent DNA polymorphisms, one in ABCG5 (Q604E) and four in ABCG8 (D19H, Y54C, T400K, and A632V), were studied using a PCR-restriction length polymorphism method. Login to comment
58 RESULTS Genotype, allele, haplotype frequencies, linkage disequilibrium Genotype distributions (wild-type allele homozygote, variant heterozygote, variant homozygote) in each polymorphism were as follows; Q604E (212, 112, 14), D19H (294, 43, 1), Y54C (138, 146, 54), T400K (196, 130, 12), and A632V (225, 96, 17). Login to comment
60 Allele frequencies (wild-type, variant) were Q604E (0.79, 0.21), D19H (0.93, 0.07), Y54C (0.62, 0.38), T400K (0.77, 0.23), and A632V (0.81, 0.19). Login to comment
63 Significant linkage disequilibrium was found in 5 out of 10 pairs of five polymorphisms: Q604E/D19H (D` ϭ 0.6503, P Ͻ 0.0001), Q604E/Y54C (-0.3461, 0.0244), D19H/Y54C (-0.9986, 0.0003), Y54C/T400K (-0.4957, 0.0003), and T400K/A632V (-0.5484, 0.0456). Login to comment
6 These results suggest that, in patients with hypercholesterolemia, the ABCG8 D19H variant is associated with greater LDLC-lowering response to atorvastatin therapy.-Kajinami, K., M. E. Brousseau, C. Nartsupha, J. M. Ordovas, and E. J. Schaefer. Login to comment
38 For the D19H polymorphism, a 131 bp fragment, including a G to C substitution site at codon 19 of the ABCG8 gene, was amplified using an oligonucleotide primer set (5Ј-GCTGGGTCTAAGAGAGCTGC-3Ј and 5Ј-CTTCCCATTGCT- CACTCACC-3Ј) with 35 cycles of amplification (95ЊC for 30 s, 60ЊC for 30 s, and 72ЊC for 30 s). Login to comment
50 Lipid and lipoprotein concentrations before and after atorvastatin treatment according to D19H polymorphism of ABCG8 gene All Subjects DD DH/HHa P No. Login to comment
64 Effects of genotype on lipid levels Among the five examined polymorphisms, only the D19H variant was significantly associated with pre-and post-treatment lipid levels. Login to comment
66 In addition, percent reductions of LDLC in carriers of D19H variant were significantly greater than that of noncarriers after adjustment for age and pretreatment LDLC levels, both of which are well-known as major determinants for statin response (Table 1). Login to comment
70 This analysis revealed that D19H genotype, in addition to age and pretreatment LDLC, was significantly and independently associated with posttreatment LDLC level. Login to comment
71 D19H genotype was also associated significantly and independently with the absolute and percent reduction of LDLC (data not shown). Login to comment
73 DISCUSSION The results of our study demonstrated that the ABCG8 D19H variant is significantly and independently associated with a greater LDL-lowering response to atorvastatin, while none of the remaining polymorphisms was associated with the response. Login to comment
77 Second, a previous study reported that the plasma cholestanol/cholesterol ratio in carriers of the D19H variant was significantly lower than that of noncarriers, while the difference in plasma cholesterol levels failed to reach statistical significance (15). Login to comment
80 Third, among the five polymorphisms examined, only the D19H variant was significantly associated with statin response. Login to comment
81 This strongly suggests that the D19H variant itself, or another as yet undefined linked variant, appears to have functional significance. Login to comment
84 In this regard, it is possible to speculate that the D19H variant may result in conformational changes, which may, ultimately, alter such functions as dimerization or ATP binding. Login to comment
87 However, we failed to find a specific ABCG5/8 haplotype that was more significantly associated with the response to atorvastatin therapy than D19H variant alone. Login to comment
89 Stepwise multiple regression coefficients and adjusted R square values for the posttreatment LDLC level by atorvastatina Variables Coefficient SE P Cumulative Adjusted R Square Pretreatment LDLC 0.363 0.042 Ͻ0.001 0.183 Age -0.282 0.082 0.001 0.204 D19H variant -5.529 2.774 0.047 0.211 a Stepwise multiple regression analysis was performed using seven variables (gender, age, BMI, pretreatment LDLC, pretreatment HDLC, log-transformed pretreatment TG, and D19H genotype). Login to comment
90 Male gender and homozygotes for wild-type allele of D19H polymorphism were assigned 1, and female gender and subjects carrying variant allele of D19H polymorphism were assigned 2, respectively. Login to comment
93 In the present study, E3/E4 subjects who also carried the D19H variant allele showed similar LDLC reductions (-39 Ϯ 8%) and a lower posttreatment level of LDLC (111 Ϯ 18 mg/dl), when compared with E3/ E3 subjects who also were D19H wild allele homozygotes (-38 Ϯ 10%, 116 Ϯ 20 mg/dl). Login to comment
94 This finding suggests that the D19H variant allele may compensate for the presence of the apoE4 allele in terms of LDLC lowering. Login to comment
95 In conclusion, in patients with hypercholesterolemia, the ABCG8 D19H variant is significantly and independently associated with greater LDLC response, but not with total cholesterol response, to atorvastatin therapy. Login to comment
39 For the D19H polymorphism, a 131 bp fragment, including a G to C substitution site at codon 19 of the ABCG8 gene, was amplified using an oligonucleotide primer set (5-GCTGGGTCTAAGAGAGCTGC-3 and 5-CTTCCCATTGCT- CACTCACC-3) with 35 cycles of amplification (95 C for 30 s, 60 C for 30 s, and 72 C for 30 s). Login to comment
51 Lipid and lipoprotein concentrations before and after atorvastatin treatment according to D19H polymorphism of ABCG8 gene All Subjects DD DH/HHa P No. of subjects 338 294 44 Age (years) 58 11 58 11 56 11 0.306 BMI (kg/m2) 27.0 3.0 27.0 3.0 26.8 2.6 0.685 Baseline (mg/dl) TC 272 26 273 25 264 28 0.030 LDLC 188 22 189 22 184 22 0.161 HDLC 50 11 50 11 47 9 0.088 TG 172 71 173 71 168 66 0.666 Treatment (mg/dl) TC 199 26 200 26 190 22 0.012 LDLC 118 19 119 19 112 18 0.028 HDLC 53 12 54 12 51 11 0.102 TG 137 58 137 59 136 57 0.957 % Change (adjusted) TC 27 8b 26.6 (25.7, 27.5) 28.8 (26.4, 31.2) 0.092 LDLC 37 10b 36.2 (35.4, 37.6) 39.7 (36.9, 42.4) 0.036 HDLC 8 13b 7.7 ( 6.3, 9.1) 6.9 ( 3.2, 10.6) 0.696 TG 17 30b 17.3 (14.0, 20.6) 16.2 (7.7, 24.7) 0.811 ABCG8, ATP binding cassette transporter G8; BMI, body mass index; TC, total cholesterol; LDLC, LDL cholesterol; HDLC, HDL cholesterol; TG, triglyceride. Login to comment

PMID: 15175352 [PubMed] Gylling H et al: "Polymorphisms in the ABCG5 and ABCG8 genes associate with cholesterol absorption and insulin sensitivity."

No. Sentence Comment

7 Low serum cholesterol and cholesterol absorption were linked to the D19H polymorphism of the ABCG8 gene, and characteristics of the insulin resistance syndrome in men were linked with the Q604E polymorphism of the ABCG5 gene.-Gylling, H., M. Hallikainen, J. Pihlajamäki, J. Ågren, M. Laakso, R. A. Rajaratnam, R. Rauramaa, and T. A. Miettinen. Login to comment
91 Because the D19H polymorphism of the ABCG8 gene and the Q604E polymorphism of the ABCG5 gene, the polymorphisms most strongly associated with cholesterol absorption and insulin action, were in linkage disequilibrium, we analyzed the effect of combined genotypes of these two polymorphisms on the levels of cholestanol (a marker of cholesterol absorption) and fasting insulin (a marker of insulin action). Login to comment
92 Figure 2 demonstrates that the D19H polymorphism of the G8 gene was associated more strongly with cholesterol absorption and the Q604E polymorphism of the G5 gene was associated with fasting insulin. Login to comment
97 The D19H polymorphism of the G8 gene was most strongly associated with cholesterol absorption, and the Q604E polymorphism of the G5 gene was associated with insulin action. Login to comment
122 Effect of the combined genotypes of the D19H and Q604E polymorphisms of the G8 and G5 genes on serum cholestanol-to-cholesterol ratio (102 ϫ mmol/mol cholesterol) and serum insulin level (mU/l) in the study population (n ϭ 262). Login to comment
18 Two sequence variations (D19H and T400K) in the G8 gene were shown to be associated with lower serum plant sterol levels in a normolipidemic family study (5). Login to comment
74 The D19H polymorphism of the G8 gene was unevenly distributed in the cholestanol tertiles (Chi square ϭ 15.292; P Ͻ 0.001), so that the 19H allele was more common in the first tertile compared with the other tertiles (Table 2). Login to comment
88 The metabolic variables were examined in the cholestanol tertiles in subjects with and without the D19H polymorphism of the G8 gene (Fig. 1). Login to comment
112 In a family study of a normal population by Berge et al. (5), the D19H substitution of the G8 gene resulted in a completely different situation: low serum cholestanol, sitosterol, and campesterol levels, suggesting limited sterol absorption. Login to comment
114 The authors also described the following two associations: the T400K polymorphism of the G8 gene was associated with high serum desmosterol and lathosterol ratios to cholesterol and low sitosterol ratios, and the A632V polymorphism of the G8 gene was associated with high serum total cholesterol value (5), none of which could be observed in the present study. Login to comment
115 Concerning the D19H polymorphism of the G8 gene, the present results confirmed the findings by Berge et al. (5) that serum absorption marker sterols were lower in subjects with this polymorphism. Login to comment
116 In addition, a novel finding in the present study was that the D19H polymorphism was more frequent in the first tertile than in the other cholestanol tertiles. Login to comment
125 morphism had low serum total and LDL cholesterol levels, supporting the hypothesis presented above that serum cholesterol level is also regulated by cholesterol absorption efficiency through the D19H polymorphism in noncoronary subjects with primary mild to moderate hypercholesterolemia. Login to comment
129 In the present study, the presence of the D19H polymorphic site seemed to prevent the increase of serum sitosterol ratio differently from the wild type in increasing cholestanol tertiles, suggesting an inhibitory effect on cholesterol absorption, and the compensatory increase in cholesterol synthesis in these subjects could be seen. Login to comment
6 Low serum cholesterol and cholesterol absorption were linked to the D19H polymorphism of the ABCG8 gene, and characteristics of the insulin resistance syndrome in men were linked with the Q604E polymorphism of the ABCG5 gene.-Gylling, H., M. Hallikainen, J. Pihlajam&#e4;ki, J. &#c5;gren, M. Laakso, R. A. Rajaratnam, R. Rauramaa, and T. A. Miettinen. Login to comment
17 Two sequence variations (D19H and T400K) in the G8 gene were shown to be associated with lower serum plant sterol levels in a normolipidemic family study (5). Login to comment
72 The D19H polymorphism of the G8 gene was unevenly distributed in the cholestanol tertiles (Chi square 15.292; P 0.001), so that the 19H allele was more common in the first tertile compared with the other tertiles (Table 2). Login to comment
86 The metabolic variables were examined in the cholestanol tertiles in subjects with and without the D19H polymorphism of the G8 gene (Fig. 1). Login to comment
89 Because the D19H polymorphism of the ABCG8 gene and the Q604E polymorphism of the ABCG5 gene, the polymorphisms most strongly associated with cholesterol absorption and insulin action, were in linkage disequilibrium, we analyzed the effect of combined genotypes of these two polymorphisms on the levels of cholestanol (a marker of cholesterol absorption) and fasting insulin (a marker of insulin action). Login to comment
90 Figure 2 demonstrates that the D19H polymorphism of the G8 gene was associated more strongly with cholesterol absorption and the Q604E polymorphism of the G5 gene was associated with fasting insulin. Login to comment
95 The D19H polymorphism of the G8 gene was most strongly associated with cholesterol absorption, and the Q604E polymorphism of the G5 gene was associated with insulin action. Login to comment
110 In a family study of a normal population by Berge et al. (5), the D19H substitution of the G8 gene resulted in a completely different situation: low serum cholestanol, sitosterol, and campesterol levels, suggesting limited sterol absorption. Login to comment
113 Concerning the D19H polymorphism of the G8 gene, the present results confirmed the findings by Berge et al. (5) that serum absorption marker sterols were lower in subjects with this polymorphism. Login to comment
120 Effect of the combined genotypes of the D19H and Q604E polymorphisms of the G8 and G5 genes on serum cholestanol-to-cholesterol ratio (102 mmol/mol cholesterol) and serum insulin level (mU/l) in the study population (n 262). Login to comment
123 morphism had low serum total and LDL cholesterol levels, supporting the hypothesis presented above that serum cholesterol level is also regulated by cholesterol absorption efficiency through the D19H polymorphism in noncoronary subjects with primary mild to moderate hypercholesterolemia. Login to comment
127 In the present study, the presence of the D19H polymorphic site seemed to prevent the increase of serum sitosterol ratio differently from the wild type in increasing cholestanol tertiles, suggesting an inhibitory effect on cholesterol absorption, and the compensatory increase in cholesterol synthesis in these subjects could be seen. Login to comment
73 The D19H polymorphism of the G8 gene was unevenly distributed in the cholestanol tertiles (Chi square 15.292; P 0.001), so that the 19H allele was more common in the first tertile compared with the other tertiles (Table 2). Login to comment
87 The metabolic variables were examined in the cholestanol tertiles in subjects with and without the D19H polymorphism of the G8 gene (Fig. 1). Login to comment
96 The D19H polymorphism of the G8 gene was most strongly associated with cholesterol absorption, and the Q604E polymorphism of the G5 gene was associated with insulin action. Login to comment
111 In a family study of a normal population by Berge et al. (5), the D19H substitution of the G8 gene resulted in a completely different situation: low serum cholestanol, sitosterol, and campesterol levels, suggesting limited sterol absorption. Login to comment
121 Effect of the combined genotypes of the D19H and Q604E polymorphisms of the G8 and G5 genes on serum cholestanol-to-cholesterol ratio (102 mmol/mol cholesterol) and serum insulin level (mU/l) in the study population (n 262). Login to comment
124 morphism had low serum total and LDL cholesterol levels, supporting the hypothesis presented above that serum cholesterol level is also regulated by cholesterol absorption efficiency through the D19H polymorphism in noncoronary subjects with primary mild to moderate hypercholesterolemia. Login to comment
128 In the present study, the presence of the D19H polymorphic site seemed to prevent the increase of serum sitosterol ratio differently from the wild type in increasing cholestanol tertiles, suggesting an inhibitory effect on cholesterol absorption, and the compensatory increase in cholesterol synthesis in these subjects could be seen. Login to comment

PMID: 15209530 [PubMed] Stefkova J et al: "ATP-binding cassette (ABC) transporters in human metabolism and diseases."

No. Sentence Comment

102 The analyses indicated an association between a polymorphism (D19H) in exon 1 of ABCG8 and the plasma concentrations of campesterol. Login to comment
103 The finding of an association between plasma sitosterol concentrations and this nonconservative substitution suggests that the substitution of histidine for aspartic acid at amino acid 19 alters the function of ABCG8. Login to comment

PMID: 15311998 [PubMed] Hubacek JA et al: "Polymorphisms in ABCG5 and ABCG8 transporters and plasma cholesterol levels."

No. Sentence Comment

5 Missence polymorphisms (Gln604Glu in the ABCG5 and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) in these genes have been described. Login to comment
7 Plasma lipid levels and changes in plasma lipid levels were independent of the Gln604Glu polymorphism in ABCG5 and Asp19His and the Ala632Val polymorphisms in ABCG8. Login to comment
23 To evaluate the role of the ABCG5 and ABCG8 variants in the genetic determination of plasma lipids, we analyzed non-synonymous polymorphisms in the ABCG5 (C1810G = Gln604Glu) and ABCG8 (G55C = Asp19His, A161G = Tyr54Cys, C1199A = Thr400Lys and C1895T = Ala632Val) genes, and searched for associations between the polymorphisms and plasma lipid levels, and between the polymorphisms and plasma lipid changes over a 8 years´ follow-up. Login to comment
33 Polymorphism Primer sequence PCR product Enzyme Size Allele ABCG8 5`atggccgggaaggcggcagaggagag 83 bp BamH I 83 C (His) Asp19His 5`acttcccattgctcactcaccgagggat 56 + 27 G (Asp) ABCG8 5`agggcctccaggatagattgttctcctc 128 bp Bgl I 128 A (Tyr) Tyr54Cys 5`ccttgaacccaggcgtgcgcctacctg 102 + 26 G (Cys) ABCG8 5`agatgcctggggcggtgcagcagctt 108 bp Afl II 108 C (Thr) Thr400Lys 5`ggcttaatgtgatatacaaagacttggg 81 + 27 A (Lys) ABCG8 5`atgtctgtgtctccagatcctcaggg 105 bp Hae III 105 T (Val) Ala632Val 5`tacaggaccatgaagccaccgctgacgcc 79 + 26 C (Ala) ABCG5 5`aaccacacctgacactgtcaatcttttcct 117 bp Xho I 117 G (Glu) Gln604Glu 5`gggcaggttttctcaatgaattgaattcctc 86 + 31 C (Gln) DNA analysis Three ml of blood collected into EDTA tubes for DNA isolation were diluted with sterile water at a 1:1 ratio and stored at -20 °C. DNA was isolated by a standard method (Miller et al. 1988). Login to comment
58 Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment
21 Recently, associations between the Asp19His and Thr400Lys polymorphisms and concentrations of plasma plant sterols (sitosterol and campesterol) have been described (Berge et al. 2002). Login to comment
55 ABCG8 polymorphisms and lipid parameters No association was detected between the Asp19His and Ala632Val polymorphisms in the ABCG8 gene and lipid levels either in the general population or in males and females, when analyzed separately. Login to comment
54 ABCG8 polymorphisms and lipid parameters No association was detected between the Asp19His and Ala632Val polymorphisms in the ABCG8 gene and lipid levels either in the general population or in males and females, when analyzed separately. Login to comment
57 Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment

PMID: 15520451 [PubMed] Plat J et al: "Common sequence variations in ABCG8 are related to plant sterol metabolism in healthy volunteers."

No. Sentence Comment

135 In a recent study, a statistically significant association was observed between the ABCG8 D19H polymorphism and the proportional reduction in LDL cholesterol during atorvastatin treatment (31). Login to comment
134 In a recent study, a statistically significant association was observed between the ABCG8 D19H polymorphism and the proportional reduction in LDL cholesterol during atorvastatin treatment (31). Login to comment

PMID: 15816807 [PubMed] Miwa K et al: "ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects."

No. Sentence Comment

21 Indeed, it was previously proposed that common sequence variants in ABCG5 (Q604E) and ABCG8 (D19H and T400K) are associated with plasma plant sterol and lipid levels in normocholesterolaemic or mildly hypercholesterolaemic European-American populations [10-12]. Login to comment
75 This result does not appear to be consistent with previous reports that the sequence variants in ABCG5 (Q604E) and ABCG8 (D19H and T400K) are associated with lower serum plant sterol levels in Western countries [10-12]. Login to comment
76 The results of our present study suggest that the frequencies of D19H and A632V variants of ABCG8 are rarer in Japanese than in European-American populations, and that these Q604E and T400K variants may not be as important in the regulation of non-cholesterol sterol levels in Japanese populations. Login to comment
50 For instance, the ABCG8 D19H variant was not Table 2 Clinical characteristics of the study subjects Values are means +- S.D. BMI, body mass index. Login to comment
91 A recent study has shown that there is a statistically significant association between the ABCG8 D19H polymorphism and the proportional reduction in LDL-C during atorvastatin treatment [25]. Login to comment

PMID: 16507104 [PubMed] Pandit B et al: "A detailed Hapmap of the Sitosterolemia locus spanning 69 kb; differences between Caucasians and African-Americans."

No. Sentence Comment

144 A number of studies have been implicated this locus in disease (or physiologi- Table 4: Results of pair-wise LD analyses Population M1 M2 ChiSq Pval ∆2 D' Caucasian INT1-21 INT1-7 20.01 1E-05 0.545 0.866 5'UTR-19 INT1-7 9.61 0.002 0.256 0.594 Q604E INT1-7 7.14 0.008 0.239 0.489 T400K A632V 6.13 0.013 0.125 1.000 5'UTR-19 T400K 5.84 0.016 0.153 1.000 Q604E D19H 5.02 0.025 0.174 1.000 INT1-7 T400K 4.94 0.026 0.111 1.000 R50C D19H 4.79 0.029 0.234 0.484 INT1-21 T400K 4.45 0.035 0.153 1.000 E238L INT10-50 4.42 0.036 0.238 1.000 INT1-7 C54Y 4.41 0.036 0.138 0.739 5'UTR-19 C54Y 4.24 0.040 0.134 0.619 T400K INT10-50 3.92 0.048 0.040 1.000 5'UTR-19 A565A 3.86 0.049 0.127 1.000 Q604E INT1-21 3.66 0.056 0.128 0.420 INT10-50 A632V 3.29 0.070 0.132 0.641 5'UTR-19 INT1-21 2.86 0.091 0.071 0.267 C54Y T400K 2.74 0.098 0.082 0.433 African-American 5'UTR-19 T400K 11.01 9E-04 0.080 1.000 INT1-7 A565A 8.09 0.004 0.085 0.587 R50C D19H 6.96 0.008 0.205 1.000 T400K A565A 6.56 0.010 0.088 0.557 Q604E INT1-21 5.82 0.016 0.119 0.505 5'UTR-19 A565A 5.10 0.024 0.059 0.460 C54Y A565A 3.93 0.047 0.053 0.270 5'UTR-19 C54Y 3.49 0.062 0.047 0.481 R50C INT1-7 3.05 0.081 0.044 1.000 INT1-7 A632V 3.05 0.081 0.044 1.000 Q604E D19H 3.01 0.083 0.038 1.000 M1 = 1st marker in pair of SNPs, M2 = 2nd marker in pair of SNPs, ChiSq = Value of chi-square test of association, Pval = Two-sided P-value corresponding to chi-square value in ChiSq column assuming 1 degree of freedom. Login to comment
177 SNP Allele Number of Disease Chromosomes* Number of Healthy Chromosomes* Frequency (disease chromosome) Frequency (healthy chromosome) Recombination Fraction Age Estimate (generations) R50C C 12 12 1 1 NA Q604E G 2 1 0.167 0.083 0.058833 17.7 5'UTR-19 T 11 10 0.917 0.833 0.033059 9.1 D19H G 12 12 1 1 NA NA INT1-21 C 12 7 1 0.583 0.005 0 INT1-7 C 11 11 0.917 0.917 NA C54Y A 9 5 0.75 0.417 0.02749 8.8 E238L G 12 12 1 1 NA T400K A 10 3 0.833 0.25 0.0002 2387 INT10-50 T 12 12 1 1 NA A565A C 12 12 1 1 NA G575R G 12 12 1 1 NA A632V C 11 10 0.917 0.833 0.005692 52.9 *Out of a total of 12 disease and 12 normal chromosomes, see Methods and ABCG8 are proposed to function as obligate heterodimers [54], and complete mutations in either gene seems to result in an identical phenotype [8], these genetic findings posit an enigma. Login to comment
85 Weinberg equilibrium (5' UTR-19, D19H, A259V, A565A) all of which are located in ABCG8. Login to comment
100 Of note, for the non-synonymous SNPs, R50C and D19H showed some LD in both populations, though the Ch-square statistic was only moderate (Table 4). Login to comment
169 Four SNPs, 5' UTR-19, D19H, A259V, and A565A, in ABCG8 were not in Hardy-Weinberg equilibrium for the African-Americans. Login to comment

PMID: 17002235 [PubMed] Chan YM et al: "Plasma concentrations of plant sterols: physiology and relationship with coronary heart disease."

No. Sentence Comment

71 Aside from the rare mutation of a homozygous form resulting in sitosterolemia, several common sequence variations have been described.71 Different studies have shown independently that the cross-sectional plant sterol-to-cholesterol ratio is associated with different ABCG5 and ABCG8 polymorphisms.10,27,72 Out of the five polymorphisms analyzed in relation to concentrations of plant sterols, D19H, Y54C, T400K, A632V, and Q604E, the polymorphisms D19H in exon 1 and T400K in exon 8 of ABCG8 show the most pronounced association. Login to comment
72 Carriers of the H allele of the D19H polymorphism in ABCG8 were found to have a lower plasma campesterol-to-cholesterol ratio10,27 and sitosterol-to-cholesterol ratio,10 suggesting a higher activity of this variant. Login to comment
73 A similar finding was observed for the K allele of the T400K polymorphism in exon 8 of ABCG8.27,72 Interestingly, no consistent cross-sectional associations between plasma cholesterol concentrations and any of these ABCG5 or ABCG8 polymorphisms have been described so far.10,27,72,73 In addition to these cross-sectional associations, genetic variations in these ABC transporters may also predict which subjects are prone to develop elevated plant sterol concentrations. Login to comment

PMID: 17827468 [PubMed] Santosa S et al: "Single nucleotide polymorphisms in ABCG5 and ABCG8 are associated with changes in cholesterol metabolism during weight loss."

No. Sentence Comment

32 More specifically, these SNPs include Q604E (RS6720173), I18427 (RS4148189), I7892 (RS4131229), and M216 (RS3806471) in ABCG5 and C54Y (RS4148211), D19H (RS11887534), T400K (RS4148217), and I14222 (RS6709904) in ABCG8 (11, 13, 16, 17). Login to comment
82 SNPs Q604E, I18429, I7892, and M216 in ABCG5 and C54Y, D19H, I14222, and T400K in ABCG8 were determined using PCR-based TaqMan allele discrimination assays (Applied Biosystems, Foster City, CA) (29). Login to comment
132 Individual subject genotypes for each SNP in ABCG5 and ABCG8 ABCG5 ABCG8 Q604E I18429 I7892 M216 C54Y D19H I14222 T400K 11 11 12 12 12 11 11 11 11 11 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 11 11 22 12 12 11 12 11 12 12 11 11 11 11 11 12 11 11 11 11 11 11 11 22 22 12 11 11 11 12 12 11 11 11 12 12 12 12 12 12 11 11 22 22 22 11 11 11 12 12 12 12 22 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 12 11 11 11 12 12 11 11 11 12 12 11 22 12 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 11 12 11 11 12 12 11 11 11 12 12 22 11 11 11 12 12 11 11 11 11 11 12 12 11 11 11 11 11 11 12 12 12 22 22 12 11 11 12 11 12 11 11 11 11 11 22 11 11 22 22 22 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 11 22 12 12 11 11 11 12 11 12 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 12 11 22 22 22 11 11 11 11 11 11 11 12 11 11 11 11 11 12 22 12 11 11 11 12 11 11 11 11 12 11 11 11 11 11 11 11 11 11 11 12 12 12 12 12 11 11 12 SNP, single nucleotide polymorphism. Login to comment
138 The Q604E SNP is located on exon 13 of the ABCG5 gene and is encoded on a loop that faces the luminal or cell surface (16). Login to comment
150 Cholesterol metabolism and change according to exon SNPs in ABCG5 and ABCG8 Cholesterol Biosynthesis Cholesterol Absorption Cholesterol Turnover SNP Initial Final Change Initial Final Change Initial Final Change %/day %/day %/day % % % % % % Q604E QQ 8.48 6 6.76 6.16 6 5.66 22.32 6 8.86 59.7 6 18.5a 65.7 6 13.7 5.94 6 18.3c 39.1 6 5.99 36.5 6 8.14 22.45 6 9.76 QE 13.9 6 9.05 6.48 6 3.95 27.39 6 9.36a 57.2 6 11.8b 64.5 6 18.0 7.33 6 15.6d 37.5 6 9.27 39.5 6 6.31 1.93 6 8.59 EE 7.91 6 4.91 9.60 6 5.09 1.69 6 10.0a 86.5 6 13.3a,b 55.7 6 13.5 230.8 6 1.90c,d 40.8 6 3.72 45.3 6 8.63 4.47 6 12.1 QE 1 EE 12.8 6 8.63 7.07 6 4.18 25.69 6 9.84 62.6 6 16.6 62.8 6 17.2 0.18 6 20.7 38.2 6 8.44 40.6 6 6.86 2.43 6 8.94 C54Y CC 9.96 6 8.83 5.18 6 4.88a 24.78 6 9.62 64.9 6 15.4 67.5 6 16.4 2.67 6 22.0 37.0 6 8.43 38.1 6 7.68 1.13 6 10.6 CY 8.95 6 5.34 8.79 6 5.35 20.17 6 7.60a 54.2 6 13.5 65.4 6 12.2 11.2 6 12.9 38.3 6 5.00 40.1 6 8.42 1.77 6 8.67 YY 14.1 6 9.07 5.99 6 3.74 28.09 6 10.3a 64.1 6 25.6 55.3 6 15.6 28.80 6 17.9 43.3 6 6.57 36.2 6 7.00 27.03 6 6.42 CY 1 YY 10.8 6 7.16 7.76 6 4.90a 23.08 6 9.28 57.9 6 18.8 61.7 6 14.0 3.85 6 17.5 40.0 6 5.87 38.8 6 8.00 21.17 6 8.89 D19H DD 10.1 6 6.68 6.54 6 5.28 23.55 6 8.28 58.8 6 15.9 61.8 6 13.3 3.00 6 17.2 39.1 6 6.00 38.2 6 7.59 20.70 6 8.41 DH 11.4 6 11.0 6.68 6 4.35 24.76 6 12.4 67.5 6 21.2 71.7 6 18.8 4.19 6 25.9 37.5 6 10.2 39.1 6 8.57 1.45 6 12.3 T400K TT 10.4 6 8.91 6.91 6 5.51 23.53 6 10.9 64.4 6 19.4 63.6 6 17.2 20.76 6 20.2 40.4 6 5.15 38.9 6 7.39 21.61 6 9.46 TK 1 KK 10.4 6 5.99 6.01 6 4.12 24.42 6 6.29 55.4 6 12.2 65.6 6 11.6 10.2 6 16.5 35.8 6 9.10 37.7 6 8.52 2.24 6 9.64 a,b Significant difference between groups (P , 0.05). Login to comment
153 Genotype distribution and frequency of SNPs in introns and exons of ABCG5 and ABCG8 in the studied population Homozygous Wild Type Heterozygous Homozygous Variant SNP n Age BMI n Age BMI n Age BMI % years kg/m2 % years kg/m2 % years kg/m2 ABCG5 Q604E 19 (54.3) 48.6 6 6.56 31.0 6 2.92 13 (37.1) 50.2 6 7.24 32.0 6 2.79 3 (8.6) 51.0 6 6.56 30.6 6 2.45 I18429 22 (62.9) 49.1 6 6.91 31.2 6 2.81 13 (37.1) 49.9 6 6.51 31.7 6 2.91 0 (0) I7892 15 (42.9) 50.1 6 7.09 30.6 6 2.55 13 (37.1) 46.9 6 6.59 32.1 6 3.02 7 (20.0) 52.3 6 4.96 31.5 6 2.98 M216 18 (51.4) 50.3 6 6.89 30.6 6 2.33a 10 (28.6) 45.0 6 5.19b 33.2 6 2.99a 7 (20.0) 53.1 6 5.21b 30.6 6 2.85 ABCG8 C54Y 16 (45.7) 50.4 6 7.10 30.8 6 2.42 12 (34.3) 46.9 6 6.33 31.5 6 2.28 7 (20.0) 51.3 6 5.88 32.5 6 4.26 D19H 26 (74.3) 48.9 6 7.06 31.7 6 3.00 9 (25.7) 50.8 6 5.89 30.3 6 2.01 0 (0) I14222 25 (71.4) 48.6 6 7.16 31.5 6 3.06 10 (28.6) 51.2 6 5.18 31.0 6 2.17 0 (0) T400K 22 (62.9) 50.6 6 5.67 31.2 6 3.03 11 (31.4) 46.6 6 8.43 31.9 6 2.40 2 (5.7) 50.5 6 3.54 31.0 6 3.82 BMI, body mass index. Login to comment
34 Observational data suggest that total cholesterol (TC) and low density lipoprotein cholesterol (LDL-C) concentrations are higher in individuals with the D19H wild type compared with individuals with at least one mutant variant (18). Login to comment
35 Again, focusing on the D19H SNP treatment with 10 mg of atorvastatin showed that individuals who had at least one variant allele had lower pretreatment TC concentration and lower posttreatment TC and LDL-C concentrations (15). Login to comment
139 Nonsynonymous SNPs on ABCG8, specifically, D19H, C54Y, and T400K, are located on exons 1, 2, and 8, respectively (33). Login to comment
142 In contrast with our results showing no relation between initial cholesterol kinetic levels and D19H, one study ascertained a connection with the D19H SNP, where the H19 allele was associated with higher cholesterol absorption (18). Login to comment
146 A trial by Chan et al. (35) that included 47 overweight men, however, resulted in observations consistent with those of the present investigation, in that they found no differences in sterol indicators of cholesterol absorption with respect to the D19H SNP. Login to comment
131 Individual subject genotypes for each SNP in ABCG5 and ABCG8 ABCG5 ABCG8 Q604E I18429 I7892 M216 C54Y D19H I14222 T400K 11 11 12 12 12 11 11 11 11 11 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 11 11 22 12 12 11 12 11 12 12 11 11 11 11 11 12 11 11 11 11 11 11 11 22 22 12 11 11 11 12 12 11 11 11 12 12 12 12 12 12 11 11 22 22 22 11 11 11 12 12 12 12 22 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 12 11 11 11 12 12 11 11 11 12 12 11 22 12 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 11 12 11 11 12 12 11 11 11 12 12 22 11 11 11 12 12 11 11 11 11 11 12 12 11 11 11 11 11 11 12 12 12 22 22 12 11 11 12 11 12 11 11 11 11 11 22 11 11 22 22 22 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 11 22 12 12 11 11 11 12 11 12 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 12 11 22 22 22 11 11 11 11 11 11 11 12 11 11 11 11 11 12 22 12 11 11 11 12 11 11 11 11 12 11 11 11 11 11 11 11 11 11 11 12 12 12 12 12 11 11 12 SNP, single nucleotide polymorphism. Login to comment
141 In contrast with our results showing no relation between initial cholesterol kinetic levels and D19H, one study ascertained a connection with the D19H SNP, where the H19 allele was associated with higher cholesterol absorption (18). Login to comment
145 A trial by Chan et al. (35) that included 47 overweight men, however, resulted in observations consistent with those of the present investigation, in that they found no differences in sterol indicators of cholesterol absorption with respect to the D19H SNP. Login to comment
149 Cholesterol metabolism and change according to exon SNPs in ABCG5 and ABCG8 Cholesterol Biosynthesis Cholesterol Absorption Cholesterol Turnover SNP Initial Final Change Initial Final Change Initial Final Change %/day %/day %/day % % % % % % Q604E QQ 8.48 6 6.76 6.16 6 5.66 22.32 6 8.86 59.7 6 18.5a 65.7 6 13.7 5.94 6 18.3c 39.1 6 5.99 36.5 6 8.14 22.45 6 9.76 QE 13.9 6 9.05 6.48 6 3.95 27.39 6 9.36a 57.2 6 11.8b 64.5 6 18.0 7.33 6 15.6d 37.5 6 9.27 39.5 6 6.31 1.93 6 8.59 EE 7.91 6 4.91 9.60 6 5.09 1.69 6 10.0a 86.5 6 13.3a,b 55.7 6 13.5 230.8 6 1.90c,d 40.8 6 3.72 45.3 6 8.63 4.47 6 12.1 QE 1 EE 12.8 6 8.63 7.07 6 4.18 25.69 6 9.84 62.6 6 16.6 62.8 6 17.2 0.18 6 20.7 38.2 6 8.44 40.6 6 6.86 2.43 6 8.94 C54Y CC 9.96 6 8.83 5.18 6 4.88a 24.78 6 9.62 64.9 6 15.4 67.5 6 16.4 2.67 6 22.0 37.0 6 8.43 38.1 6 7.68 1.13 6 10.6 CY 8.95 6 5.34 8.79 6 5.35 20.17 6 7.60a 54.2 6 13.5 65.4 6 12.2 11.2 6 12.9 38.3 6 5.00 40.1 6 8.42 1.77 6 8.67 YY 14.1 6 9.07 5.99 6 3.74 28.09 6 10.3a 64.1 6 25.6 55.3 6 15.6 28.80 6 17.9 43.3 6 6.57 36.2 6 7.00 27.03 6 6.42 CY 1 YY 10.8 6 7.16 7.76 6 4.90a 23.08 6 9.28 57.9 6 18.8 61.7 6 14.0 3.85 6 17.5 40.0 6 5.87 38.8 6 8.00 21.17 6 8.89 D19H DD 10.1 6 6.68 6.54 6 5.28 23.55 6 8.28 58.8 6 15.9 61.8 6 13.3 3.00 6 17.2 39.1 6 6.00 38.2 6 7.59 20.70 6 8.41 DH 11.4 6 11.0 6.68 6 4.35 24.76 6 12.4 67.5 6 21.2 71.7 6 18.8 4.19 6 25.9 37.5 6 10.2 39.1 6 8.57 1.45 6 12.3 T400K TT 10.4 6 8.91 6.91 6 5.51 23.53 6 10.9 64.4 6 19.4 63.6 6 17.2 20.76 6 20.2 40.4 6 5.15 38.9 6 7.39 21.61 6 9.46 TK 1 KK 10.4 6 5.99 6.01 6 4.12 24.42 6 6.29 55.4 6 12.2 65.6 6 11.6 10.2 6 16.5 35.8 6 9.10 37.7 6 8.52 2.24 6 9.64 a,b Significant difference between groups (P , 0.05). Login to comment
152 Genotype distribution and frequency of SNPs in introns and exons of ABCG5 and ABCG8 in the studied population Homozygous Wild Type Heterozygous Homozygous Variant SNP n Age BMI n Age BMI n Age BMI % years kg/m2 % years kg/m2 % years kg/m2 ABCG5 Q604E 19 (54.3) 48.6 6 6.56 31.0 6 2.92 13 (37.1) 50.2 6 7.24 32.0 6 2.79 3 (8.6) 51.0 6 6.56 30.6 6 2.45 I18429 22 (62.9) 49.1 6 6.91 31.2 6 2.81 13 (37.1) 49.9 6 6.51 31.7 6 2.91 0 (0) I7892 15 (42.9) 50.1 6 7.09 30.6 6 2.55 13 (37.1) 46.9 6 6.59 32.1 6 3.02 7 (20.0) 52.3 6 4.96 31.5 6 2.98 M216 18 (51.4) 50.3 6 6.89 30.6 6 2.33a 10 (28.6) 45.0 6 5.19b 33.2 6 2.99a 7 (20.0) 53.1 6 5.21b 30.6 6 2.85 ABCG8 C54Y 16 (45.7) 50.4 6 7.10 30.8 6 2.42 12 (34.3) 46.9 6 6.33 31.5 6 2.28 7 (20.0) 51.3 6 5.88 32.5 6 4.26 D19H 26 (74.3) 48.9 6 7.06 31.7 6 3.00 9 (25.7) 50.8 6 5.89 30.3 6 2.01 0 (0) I14222 25 (71.4) 48.6 6 7.16 31.5 6 3.06 10 (28.6) 51.2 6 5.18 31.0 6 2.17 0 (0) T400K 22 (62.9) 50.6 6 5.67 31.2 6 3.03 11 (31.4) 46.6 6 8.43 31.9 6 2.40 2 (5.7) 50.5 6 3.54 31.0 6 3.82 BMI, body mass index. Login to comment

PMID: 18457353 [PubMed] Kuo KK et al: "Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease."

No. Sentence Comment

125 Acalovschi and co-workers17 found that polymorphisms at D19H and Q604E were significantly associated with a lithogenic plasma lipid profile in siblings with gallstone disease. Login to comment
0 Original article Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease K.-K. Kuo1 , S.-J. Shin2 , Z.-C. Chen3 , Y.-H. C. Yang4 , J.-F. Yang5 and P.-J. Hsiao2 1 Division of Hepatobiliopancreatic Surgery, Department of Surgery and 2 Division of Endocrinology and Metabolism, Department of Internal Medicine, Kaohsiung Medical University Hospital, 3 Section of General Medicine, Chi-Mei Medical Centre, and 4 Statistical Analysis Laboratory, Department of Clinical Research and 5 Department of Preventive Medicine, Kaohsiung Medical University Hospital, Taiwan Correspondence to: Dr P.-J. Hsiao, Division of Endocrinology and Metabolism, Department of Internal Medicine, Kaohsiung Medical University Hospital, 100 Tzyou 1st Road, Kaohsiung 807, Taiwan (e-mail: pjhsiao@cc.kmu.edu.tw) Background: Adenosine triphosphate-binding cassette (ABC) transporters ABCG5 and ABCG8 are sterol export pumps regulating biliary cholesterol excretion. Login to comment
5 Five non-synonymous polymorphisms, E604Q (ABCG5), D19H, C54Y, T400K and A632V (ABCG8), were analysed using the TaqMan genotyping assay. Login to comment
7 604Q (CC) and D19H (GC) genotypes were significantly associated with gallstone disease, even when adjusted for age, sex and body mass index. Login to comment
9 The risk was greatly increased in subjects younger than 50 years with the D19H genotype and those of 50 years or more with the 604Q genotype. Login to comment
10 Conclusion: Carriers of ABCG5 604Q or ABCG8 D19H polymorphisms have an increased risk of gallstone disease independent of age, sex and body mass index. Login to comment
26 In previous studies, five non-synonymous polymorphisms in ABCG5 (E604Q) and ABCG8 (C54Y, D19H, T400K, A632V) have been linked to cholesterol homeostasis, especially in cholesterol absorption efficiency and cholesterol saturation of bile. Login to comment
44 Relevant non-synonymous polymorphisms of ABCG5 (E604Q) and ABCG8 (C54Y, D19H, T400K, A632V) associated with biliary cholesterol secretion were chosen for this study. Login to comment
46 The specific primers were designed using Primer 3 software according to SNP reference of GenBank mapping in the National Center for Biotechnology Information database (rs6720173 for E604Q, rs11887534 for D19H, rs4148211 for C54Y, rs4148217 for T400K, rs6544718 for A632V). Login to comment
56 Binary logistic regression gave odds ratios of having gallstones under the influence of genotypes E604Q (CC versus GG + GC), D19H (GC versus GG) and C54Y (AA versus GG + GA). Login to comment
57 For the crude odds ratio, the presence or absence of gallstones was the dependent variable, and the E604Q, D19H or C54Y genotype was the independent variable. Login to comment
67 Table 2 shows allele frequencies of the five nonsynonymous polymorphisms (ABCG5: E604Q; ABCG8: D19H, C54Y, T400K, A632V). Login to comment
70 The C allele of D19H was quite rare (1·4 per cent) and the CC (His19) genotype was absent in the study population. Login to comment
75 There was a significant correlation of gallstone disease with the genotype distribution of E604Q, D19H and C54Y polymorphisms. Login to comment
76 The minor alleles of E604Q, D19H and C54Y polymorphisms were overexpressed in patients with gallstones compared with controls. Login to comment
77 For example, in the E604Q polymorphism, the frequency of the CC genotype was 4 per cent in the gallstone group compared with 0·7 per cent in the stone-free group, and the frequency of the D19H (GC) variant was 8 per cent in the gallstone group compared with 2·1 per cent in the group without gallstones. Login to comment
80 The 604Q (CC) and D19H (GC) variant contributed a significant and independent risk of gallstone formation, even after adjusting for age, sex and BMI. Login to comment
83 *Two-sample Student`s t test, except †Pearson χ2 test. Table 2 Allele frequencies of the polymorphisms in ABCG5 and ABCG8 genes in 979 subjects Gene Allele NCBI SNP reference Ratio Frequency (%) ABCG5: E604Q G1810C rs 6720173 G : C 89·5 : 10·5 ABCG8: D19H G55C rs 11887534 G : C 98·6 : 1·4 ABCG8: C54Y G161A rs 4148211 G : A 90·3 : 9·7 ABCG8: T400K C1199A rs 4148217 C : A 92·0 : 8·0 ABCG8: A632V T1895C rs 6544718 T : C 0 : 100 NCBI, National Center for Biotechnology Information; SNP, single nucleotide polymorphism. Login to comment
84 Table 3 Association of genotype frequency of ABCG5 and ABCG8 with gallstone development No stones (n = 905) Gallstones (n = 74) P* Power (%) ABCG5: E604Q (G1810C) Genotype GG 691 (79·2) 52 (74) 0·011 18 GC 175 (20·1) 15 (21) CC 6 (0·7) 3 (4) ABCG8: D19H (G55C) Genotype GG 851 (97·9) 66 (92) 0·001 79 GC 18 (2·1) 6 (8) ABCG8: C54Y (G161A) Genotype GG 747 (82·5) 54 (73) 0·041 53 GA 152 (16·8) 18 (24) AA 6 (0·7) 2 (3) ABCG8: T400K (C1199A) Genotype CC 739 (84·5) 58 (79) 0·463 22 CA 134 (15·3) 15 (21) AA 2 (0·2) 0 (0) Values in parentheses are percentages. Login to comment
85 *Pearson χ2 test. Table 4 Gallstone risk associated with ABCG5 and ABCG8 polymorphisms Genotype Crude odds ratio P† Adjusted odds ratio* P† E604Q GG + GC 1·0 CC 6·5 (1·6, 26·4) 0·009 4·7 (1·1, 21·1) 0·042 D19H GG 1·0 GC 4·3 (1·7, 11·2) 0·003 3·5 (1·2, 9·6) 0·018 C54Y GG + GA 1·0 AA 4·1 (0·8, 20·9) 0·085 3·2 (0·6, 17·3) 0·170 Values in parentheses are 95 per cent confidence intervals. Login to comment
91 The gallstone risk associated with 604Q and D19H polymorphisms was further stratified into different age groups (Table 5). Login to comment
94 The result clearly demonstrated a significant risk of gallstone disease associated with 604Q in subjects older than 50 years and a greater risk associated with the D19H polymorphism in those younger than 50 years. Login to comment
95 Discussion This study found a significant correlation between the distribution of E604Q and D19H (GC) polymorphisms and gallstone disease in the Taiwanese population. Login to comment
96 In addition, after adjusting for other confounding risk factors (age, sex and BMI), the 604Q (CC) and D19H (GC) polymorphisms were still significant independent risk factors for developing gallstone disease. Login to comment
97 The risk associated with 604Q was stronger in older people, whereas the risk associated with D19H was greater in those younger than 50 years. Login to comment
98 The study also found that serum levels of total Table 5 Gallstone risk associated with ABCG5 and ABCG8 polymorphisms stratified by age Age < 50 years Age ≥ 50 years Genotype Crude odds ratio P‡ Adjusted odds ratio* P‡ Crude odds ratio P‡ Adjusted odds ratio* P‡ E604Q GG + GC 1·0 CC† 6·0 (1·3, 27·7) 0·022 6·4 (1·3, 30·7) 0·020 D19H GG 1·0 1·0 GC 6·4 (1·3, 32·7) 0·025 12·4 (1·7, 90·0) 0·013 2·8 (0·9, 9·2) 0·088 2·5 (0·8, 8·6) 0·133 Values in parentheses are 95 per cent confidence intervals. Login to comment
105 In this study population, polymorphism of 604Q or D19H and age were independently associated with gallstone disease in univariable analysis. Login to comment
110 In this large-scale ultrasonography study, carriers of 604Q and D19H variants retained their high risk of gallstone formation even after adjusting for age, sex and BMI status. Login to comment
111 The gallstone risk for D19H carriers was much greater in those younger than 50 years. Login to comment
112 Consistent with previous studies in Caucasians19,20, this finding supports the hypothesis that the D19H polymorphism may affect the transporter function resulting in gallstone formation in earlier life. Login to comment
114 One implication of this study is that 604Q and D19H polymorphisms could be considered as susceptible gene markers for gallstone disease in the Taiwanese population. Login to comment
135 Compared with the reports by Buch and colleagues19 and Gr¨unhage and co-workers20, the lower prevalence of the minor allele of D19H (1·4 versus 8·5 per cent) in the present study may explain the lower prevalence of gallstone formation (8·3 versus 21·4 per cent) in Taiwanese compared with Caucasian populations. Login to comment
136 Even the lower prevalence of the minor allele in the present population supports the previous suggestion that the D19H variant contributes to the genetic risk of gallstone disease, especially in the young. Login to comment

PMID: 18522623 [PubMed] Rudkowska I et al: "Polymorphisms in ABCG5/G8 transporters linked to hypercholesterolemia and gallstone disease."

No. Sentence Comment

3 Various polymorphisms (A632V, T400K, D19H, M429V, and C54Y) in the ABCG8 and ABCG5 (Q604E) gene have been found to be associated with several facets of cholesterol metabolism, including baseline cholesterol level, cholesterol kinetics, individual responsiveness of plasma cholesterol to dietary and pharmaceutical interventions for hypercholesterolemia, and increased risk of gallstones. Login to comment
21 Hubacek et al.12 reported that none of the polymorphisms examined, including ABCG5 Q604E, ABCG8 D19H and A632V, were related to plasma lipid levels or changes in plasma lipid levels in subjects after "evolutionary" dietary changes from a traditional high-fat Eastern European diet to a lower-fat diet based on nutritional advice. Login to comment
30 These findings in the Japanese group are not without exception; no difference was observed in lipid profiles in relation to common polymorphisms studied previously [ABCG8 (A632V, T400K, D19H, and C54Y) and ABCG5 (Q604E)],6,7,11,12 which might be explained by the fact that carriers of ABCG8 D19H and A632A polymorphisms are rare in the Japanese population compared to Western populations. Login to comment
47 Knowing this, it may be of interest to first determine if a relationship exists between cholesterol in the blood and cholesterol gallstones.Acalovschi et al.18 found that circulatory TC and triglyceride levels in gallstone patients were higher in carriers of the wild-type allele of the ABCG5 Q604E and ABCG8 D19H compared with mutant allele carriers. Login to comment
61 Overall, these studies identify a variety of polymorphisms in ABCG8 (A632V, T400K, D19H, and C54Y) and in ABCG5 (Q604E) that have been linked with baseline cholesterol levels, cholesterol absorption, or responsiveness to dietary intervention.3-12,15-17 In addition, genetic variations in the ABCG8 gene (D19H and T400K) may increase the risk of gallstone disease in certain populations.22-24 Table 1 summarizes potential SNPs and the effects of the mutant allele on baseline blood lipid concentrations, cholesterol kinetics, responsiveness to interventions, and gallstone disease risk. Login to comment
25 Gylling et al.9 found that carriers of a D19H mutation of the ABCG8 gene had low cholesterol absorption efficiency together with high cholesterol synthesis markers leading to suppressed plasma TC and LDL-C. Login to comment
26 Similarly, Berge et al.8 found that a D19H polymorphism of the ABCG8 gene was associated with lower cholesterol absorption markers; however, no changes in blood lipid concentrations were observed. Login to comment
35 Kaijnami et al.10 found that the carriers of the ABCG8 D19H mutant allele had a greater plasma LDL-C reduction after atorvastatin treatment, relative to the wild-type allele. Login to comment
36 It was previously reported that carriers of the ABCG8 D19H mutant allele exhibit an upregulated cholesterol synthesis,8,9 which might account for the superior efficiency of statin therapy in these subjects. Login to comment
50 Presence of gallstones was strongly linked to the D19H mutant allele of the ABCG8 gene.22 Furthermore, Buch et al.23 performed a whole genome scan association between individuals with gallstones and controls, adjusting for BMI, gender, and age. The presence of the D19H mutant allele of the ABCG8 gene was associated with cholesterol gallstones, suggesting that the mutated allele might confer a more efficient transport of cholesterol into bile, in turn causing cholesterol hypersaturation and promoting the formation of cholesterol gallstones.23 Therefore, plasma TC levels would be lower in subjects with mutant allele, corresponding to the study by Acalovschi et al.18 Support for this finding has also been observed in German and Chilean populations.23 Consistency across various studies argues strongly for a role for the D19H allele of the ABCG8 gene in the development of gallstone disease. Login to comment
52 As mentioned previously, D19H and A632V mutation alleles are rarely found in Asian populations, so they were not informative in this population. Login to comment
55 Overall, these studies on ABC gene polymorphisms and gallstone disease associations demonstrate that the mutant allele of D19H and T400K of ABCG8 might help to predict gallstone disease risk within a given individual. Login to comment

PMID: 18581044 [PubMed] Chen ZC et al: "Significant association of ABCG8:D19H gene polymorphism with hypercholesterolemia and insulin resistance."

No. Sentence Comment

5 Five nonsynonymous polymorphisms of Q604E (ABCG5), D19H, C54Y, T400 K and A632 V (ABCG8) were analyzed by TaqMan genotyping assay. Login to comment
42 Five nonsynonymous polymorphisms, including Q604E (rs6720173) of the ABCG5 gene and D19H (rs11887534), C54Y (rs4148211), T400K (rs4148217) and A632V (rs6544718) of the ABCG8 gene, were chosen for genotyping (http://www.ncbi.nlm.nih.gov/). Login to comment
64 The minor allele frequencies (MAFs) of Q604E (C:G); D19H (G:C), C54Y (G:A) and T400K (C:A) were 10.5, 1.4, 9.7 and 8.0%, respectively. Login to comment
72 This exhibited a significant trend with an increasing frequency of the C allele in Q604 (ABCG5) and D19H (ABCG8) genotypes from the Table 1 Serum cholesterol and LDL levels for the genotypes of ABCG5/ABCG8 Cholesterol (mg/dl) P LDL-C (mg/dl) P ABCG5: Q604E (C1810G) Genotype CC (n = 9) 225.9 ± 48.5 0.008 133.7 ± 40.0 0.733 CG (n = 203) 189.6 ± 37.6 130.1 ± 32.7 GG (n = 833) 187.2 ± 38.1 127.9 ± 35.9 ABCG8:D19H (G55C) Genotype GG (n = 1,016) 187.2 ± 37.9 0.005 127.8 ± 35.2 0.023 GC (n = 30) 207.1 ± 45.1 145.1 ± 40.6 CC (n = 0) - - ABCG8:C54Y (G161A) Genotype GG (n = 853) 187.3 ± 37.8 0.297 127.8 ± 35.4 0.671 GA (n = 189) 190.4 ± 40.0 130.0 ± 35.2 AA (n = 8) 171.6 ± 24.0 118.0 ± 23.8 ABCG8:T400 K (C1199A) Genotype CC (n = 885) 188.0 ± 38.2 0.869 128.3 ± 35.4 0.997 CA (n = 164) 186.9 ± 38.2 128.3 ± 34.3 AA (n = 2) 194.0 ± 22.6 131.0 ± 10.2 P values were obtained from a one-way ANOVA and the t test desirable to the moderately high and then to the high cholesterol category. Login to comment
83 In addition, subjects with the D19H variant were associated with an almost threefold higher risk of developing high total cholesterol and LDL-C levels Table 2 Genotype frequency of ABCG5/ABCG8 versus categorized cholesterol level Serum cholesterol (mg/dl) Desirable (\200) Moderately high (200-239) High (C240) P ABCG5: Q604E (C1810G) Genotype CC 3 (0.43%) 2 (0.84%) 4 (3.5%) 0.004 CG+GG 692 (99.6%) 235 (99.2%) 109 (96.5%) ABCG8:D19H (G55C) Genotype GG 682 (98.0%) 227 (96.6%) 104 (92.9%) 0.009 GC 14 (2.0%) 8 (3.4%) 8 (7.1%) ABCG8:C54Y (G161A) Genotype GG 576 (82.1%) 190 (80.5%) 87 (77.7%) 0.517 GA+AA 126 (17.9%) 46 (19.5%) 25 (22.3%) ABCG8:T400 K (C1199A) Genotype CC 592 (84.3%) 197 (83.5%) 96 (85.0%) 0.927 CA+AA 110 (15.7%) 39 (16.5%) 17 (15.0%) P values were obtained from the chi-square test Table 3 Comparison of the biochemical characteristics of subjects with D19 (GG) and D19H (GC) genotypes GG GC P Number 1,016 30 Sex (M:F) 870:146 24:6 0.39 Age (years) 49.1 ± 9.2 49.8 ± 11.4 0.09 BMI (kg/m2 ) 24.4 ± 3.3 25.4 ± 4.2 0.09 SBP (mmHg) 125.4 ± 16.5 124.3 ± 13.8 0.76 DBP (mmHg) 77.6 ± 11.1 78.6 ± 7.0 0.64 CHOL (mg/dl) 187.2 ± 37.9 207.1 ± 45.1 0.005 TG (mg/dl) 139.8 ± 146.3 124.5 ± 46.8 0.57 LDL-C (mg/dl) 127.8 ± 35.2 145.1 ± 40.6 0.023 HDL-C (mg/dl) 52.2 ± 13.2 53.1 ± 10.1 0.77 F-glucose (mg/dl) 96.7 ± 28.7 98.4 ± 25.2 0.76 HOMA-IR 1.12 ± 2.00 3.21 ± 7.84 0.026 Data are shown as as mean ± SD Student`s t test was used for statistical analysis and the Mann-Whitney U test was used for HOMA-IR BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; CHOL, cholesterol; TG, triglyceride; LDL-C, low-density lipoprotein; HDL-C, high-density lipoprotein; F-glucose, fasting glucose; HOMA-IR, homeostatic model assessment insulin resistance Table 4 Risk stratification for the ABCG8 genotypes (D19H vs. D19) in terms of serum cholesterol and LDL-C levels D19 D19H P Moderately high versus desirable cholesterol Crude odds ratio 1 1.72 (0.71-4.14) 0.23 Adjusted odds ratio 1 1.54 (0.62-3.83) 0.35 High versus desirable cholesterol Crude odds ratio 1 3.75 (1.53-9.15) 0.004 Adjusted odds ratio 1 3.44 (1.32-8.97) 0.012 Moderately high versus desirable LDL-C Crude odds ratio 1 1.92 (0.67-5.54) 0.227 Adjusted odds ratio 1 1.65 (0.55-4.89) 0.37 High versus desirable LDL-C Crude odds ratio 1 3.51 (1.25-9.85) 0.017 Adjusted odds ratio 1 3.29 (1.10-9.82) 0.033 Desirable cholesterol indicates \200 mg/dl; moderately high cholesterol indicates 200-239 mg/dl; high cholesterol indicates C240 mg/dl Desirable LDL-C indicates \130 mg/dl; moderately high LDL-C indicates 130-159 mg/dl; high LDL-C indicates C160 mg/dl Logistic regression analysis was used to estimate the odds ratio, by adjusting for age and sex. Login to comment
6 Analysis showed that the D19H polymorphism of the ABCG8 gene was significantly associated with serum total cholesterol, LDL-C levels and HOMA-IR index. Login to comment
7 Adjusting for sex and age, subjects with the D19H (GC) genotype were significantly associated with a threefold higher risk of high cholesterol and LDL-C levels than subjects with D19 (GG). Login to comment
8 These results suggest that the D19H polymorphism of ABCG8 could be considered a susceptible gene marker indicating an increased likelihood of developing high cholesterol and LDL-C levels in Taiwanese consuming an ordinary Chinese diet. Login to comment
9 It is supposed that the coexistence of higher insulin resistance and hypercholesterolemia for carriers of the D19H polymorphism may result in a greater risk of cardiovascular disease. Login to comment
41 However, D19H of the ABCG8 gene, which has a frequency of less than 5%, was also chosen because of its strong correlation to cholesterol homeostasis as reported in the literature (Gylling et al. 2004; Huba´cˇek et al. 2004; Kajinami et al. 2004a, 2004b). Login to comment
67 Our results showed that the minor C allele of D19H occurred with a lower frequency in Chinese than in Caucasians. Login to comment
70 The serum total cholesterol and the LDL-C level were significantly higher in subjects with the D19H (GC) genotype than those with D19 (GG). Login to comment
75 The relationships of the biochemical parameters to the genotypes of the D19 and D19H polymorphisms are shown in Table 3. Login to comment
76 Subjects with genotype D19H (GC) have significantly higher serum cholesterol and LDL-C levels than those with D19 (GG). Login to comment
77 Although there was no difference in metabolic biomarkers (BMI, blood pressure, fasting glucose) between these two genotypes, subjects with genotype D19H (GC) had a significantly higher HOMA-IR index than those with D19 (GG). Login to comment
78 The genotypic effect on serum cholesterol and LDL-C levels was tested for D19H (Table 4). Login to comment
79 The results showed that the subjects with the D19H genotype (i.e., the GC genotype) were significantly associated with a higher risk of raised cholesterol and LDL-C levels than subjects with D19 (GG). Login to comment
82 Our results demonstrated that subjects with the C allele of the D19H polymorphism had significantly higher total cholesterol and LDL-C levels compared with subjects that did not carry the C allele. Login to comment
85 Our finding implicated that the D19H polymorphism may have a functional consequence due to the substitution of aspartic acid by histidine, which results in a conformational change that alters the ability to export sterol and cholesterol homeostasis. Login to comment
86 It has been reported that the D19H polymorphism is linked to a lower plant sterol and cholesterol absorption efficiency. Login to comment
88 Berge and colleagues identified significantly reduced plant sterol absorption in carriers with the D19H polymorphism in a family study of a healthy normolipidemic population, but there was no association of the serum lipid level with this polymorphism (Berge et al. 2002). Login to comment
90 They found that D19H/19H (GC or CC) variants were more frequent in the lowest cholesterol absorption tertile. Login to comment
91 Serum total cholesterol (5.37 ± 0.15 mmol/l) and LDL-C levels (3.29 ± 0.14 mmol/l) were lower in subjects with D19H/19H (GC or CC) variants than in those (5.82 ± 0.07 mmol/l; 3.78 ± 0.07 mmol/l) with the D19 genotype (Gylling et al. 2004). Login to comment
92 Kajinami et al. found that hypercholesterolemic patients (LDL-C C160 mg/dl) with D19H/19H variants had a lower total cholesterol level at baseline. Login to comment
93 However, subjects with D19H/19H variants were noted to exhibit greater reductions in LDL-C levels with statin treatment under the NCEP step 1 diet throughout the study. Login to comment
94 The greater response of LDL-C to statin treatment could be explained by a compensatory increase in endogenous cholesterol synthesis in subjects with D19H/19H variants compared to the D19 variant (Kajinami et al. 2004a, 2004b). Login to comment
95 The discordance between our results for the serum total cholesterol and LDL-C levels in our subjects with D19H and previous results may be attributed to the following reasons: (1) the populations studied had different recruitment criteria for serum lipid levels; (2) dietary habits of different races; (3) different dietary interventions within the study period. Login to comment
97 These results clearly demonstrated that the D19H polymorphism, even though it was rare, significantly contributed to an independent genetic risk of developing high total cholesterol and LDL-C levels. Login to comment
98 As reports have shown previously, this points to the fact that subjects with D19H/19H (GC or CC) variants are disposed to having a lower cholesterol absorption efficiency (Gylling et al. 2004; Huba´cˇek et al. 2004; Kajinami et al. 2004a, 2004b). Login to comment
100 Since hepatic cholesterol biosynthesis has the greatest effect on cholesterol homeostasis (Lammert and Wang 2005; Wang 2007; Sehayek 2003; Temel et al. 2007), we can plausibly speculate that the compensatory hepatic cholesterol biosynthesis in subjects with D19H (GC) caused their higher serum total cholesterol and LDL-C levels than those observed with the D19 (GG) genotype in our results. Login to comment
110 Based on the findings of Gylling et al. (2004) and Kajinami et al. (2004a), subjects with D19H/19H have a lower cholesterol absorption efficiency but respond more to statin treatment than D19 subjects. Login to comment
111 Upon comparing our results with those in previous reports, we rationally assumed that consuming a higher ratio of plant sterols to cholesterol in the diet may influence the relative absorption efficiency of cholesterol in subjects with D19H variants, causing a much lower cholesterol absorption and therefore increasing hepatic cholesterol biosynthesis, thus resulting in higher serum total cholesterol and LDL-C levels than those of D19 variants. Login to comment
112 Our results indicated that subjects with D19H variants had greater insulin resistance (higher HOMA-IR index) than those with D19 variants, although they did not differ in terms of other metabolic biomarkers (BMI, blood pressure, serum triglyceride, plasma glucose). Login to comment
118 Therefore, the higher insulin resistance status of our subjects with the D19H polymorphism is reasonably explained by the effects of lower cholesterol absorption and higher cholesterol synthesis compared to those with D19 variants. Login to comment
119 Their higher serum total cholesterol and HOMA-IR may lead to a higher risk of progressive atherosclerosis and cardiovascular disease in people with the D19H polymorphism. Login to comment
120 It seems wise to start preventive intervention strategies for atherosclerosis earlier in carriers of the D19H polymorphism. Login to comment
122 D19H polymorphism could be regarded as a susceptible gene marker for developing high total cholesterol, high LDL-C levels and insulin resistance in people consuming a Chinese diet. Login to comment
123 Because of the limited number of D19H subjects in our population, this result can be regarded as intriguing but tentative, and will therefore require more study before any further application of it is made. Login to comment
43 Five nonsynonymous polymorphisms, including Q604E (rs6720173) of the ABCG5 gene and D19H (rs11887534), C54Y (rs4148211), T400K (rs4148217) and A632V (rs6544718) of the ABCG8 gene, were chosen for genotyping (http://www.ncbi.nlm.nih.gov/). Login to comment
65 The minor allele frequencies (MAFs) of Q604E (C:G); D19H (G:C), C54Y (G:A) and T400K (C:A) were 10.5, 1.4, 9.7 and 8.0%, respectively. Login to comment
68 Our results showed that the minor C allele of D19H occurred with a lower frequency in Chinese than in Caucasians. Login to comment
71 The serum total cholesterol and the LDL-C level were significantly higher in subjects with the D19H (GC) genotype than those with D19 (GG). Login to comment
73 This exhibited a significant trend with an increasing frequency of the C allele in Q604 (ABCG5) and D19H (ABCG8) genotypes from the Table 1 Serum cholesterol and LDL levels for the genotypes of ABCG5/ABCG8 Cholesterol (mg/dl) P LDL-C (mg/dl) P ABCG5: Q604E (C1810G) Genotype CC (n = 9) 225.9 &#b1; 48.5 0.008 133.7 &#b1; 40.0 0.733 CG (n = 203) 189.6 &#b1; 37.6 130.1 &#b1; 32.7 GG (n = 833) 187.2 &#b1; 38.1 127.9 &#b1; 35.9 ABCG8:D19H (G55C) Genotype GG (n = 1,016) 187.2 &#b1; 37.9 0.005 127.8 &#b1; 35.2 0.023 GC (n = 30) 207.1 &#b1; 45.1 145.1 &#b1; 40.6 CC (n = 0) - - ABCG8:C54Y (G161A) Genotype GG (n = 853) 187.3 &#b1; 37.8 0.297 127.8 &#b1; 35.4 0.671 GA (n = 189) 190.4 &#b1; 40.0 130.0 &#b1; 35.2 AA (n = 8) 171.6 &#b1; 24.0 118.0 &#b1; 23.8 ABCG8:T400 K (C1199A) Genotype CC (n = 885) 188.0 &#b1; 38.2 0.869 128.3 &#b1; 35.4 0.997 CA (n = 164) 186.9 &#b1; 38.2 128.3 &#b1; 34.3 AA (n = 2) 194.0 &#b1; 22.6 131.0 &#b1; 10.2 P values were obtained from a one-way ANOVA and the t test desirable to the moderately high and then to the high cholesterol category. Login to comment
80 The results showed that the subjects with the D19H genotype (i.e., the GC genotype) were significantly associated with a higher risk of raised cholesterol and LDL-C levels than subjects with D19 (GG). Login to comment
84 In addition, subjects with the D19H variant were associated with an almost threefold higher risk of developing high total cholesterol and LDL-C levels Table 2 Genotype frequency of ABCG5/ABCG8 versus categorized cholesterol level Serum cholesterol (mg/dl) Desirable (\200) Moderately high (200-239) High (C240) P ABCG5: Q604E (C1810G) Genotype CC 3 (0.43%) 2 (0.84%) 4 (3.5%) 0.004 CG+GG 692 (99.6%) 235 (99.2%) 109 (96.5%) ABCG8:D19H (G55C) Genotype GG 682 (98.0%) 227 (96.6%) 104 (92.9%) 0.009 GC 14 (2.0%) 8 (3.4%) 8 (7.1%) ABCG8:C54Y (G161A) Genotype GG 576 (82.1%) 190 (80.5%) 87 (77.7%) 0.517 GA+AA 126 (17.9%) 46 (19.5%) 25 (22.3%) ABCG8:T400 K (C1199A) Genotype CC 592 (84.3%) 197 (83.5%) 96 (85.0%) 0.927 CA+AA 110 (15.7%) 39 (16.5%) 17 (15.0%) P values were obtained from the chi-square test Table 3 Comparison of the biochemical characteristics of subjects with D19 (GG) and D19H (GC) genotypes GG GC P Number 1,016 30 Sex (M:F) 870:146 24:6 0.39 Age (years) 49.1 &#b1; 9.2 49.8 &#b1; 11.4 0.09 BMI (kg/m2 ) 24.4 &#b1; 3.3 25.4 &#b1; 4.2 0.09 SBP (mmHg) 125.4 &#b1; 16.5 124.3 &#b1; 13.8 0.76 DBP (mmHg) 77.6 &#b1; 11.1 78.6 &#b1; 7.0 0.64 CHOL (mg/dl) 187.2 &#b1; 37.9 207.1 &#b1; 45.1 0.005 TG (mg/dl) 139.8 &#b1; 146.3 124.5 &#b1; 46.8 0.57 LDL-C (mg/dl) 127.8 &#b1; 35.2 145.1 &#b1; 40.6 0.023 HDL-C (mg/dl) 52.2 &#b1; 13.2 53.1 &#b1; 10.1 0.77 F-glucose (mg/dl) 96.7 &#b1; 28.7 98.4 &#b1; 25.2 0.76 HOMA-IR 1.12 &#b1; 2.00 3.21 &#b1; 7.84 0.026 Data are shown as as mean &#b1; SD Student`s t test was used for statistical analysis and the Mann-Whitney U test was used for HOMA-IR BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; CHOL, cholesterol; TG, triglyceride; LDL-C, low-density lipoprotein; HDL-C, high-density lipoprotein; F-glucose, fasting glucose; HOMA-IR, homeostatic model assessment insulin resistance Table 4 Risk stratification for the ABCG8 genotypes (D19H vs. D19) in terms of serum cholesterol and LDL-C levels D19 D19H P Moderately high versus desirable cholesterol Crude odds ratio 1 1.72 (0.71-4.14) 0.23 Adjusted odds ratio 1 1.54 (0.62-3.83) 0.35 High versus desirable cholesterol Crude odds ratio 1 3.75 (1.53-9.15) 0.004 Adjusted odds ratio 1 3.44 (1.32-8.97) 0.012 Moderately high versus desirable LDL-C Crude odds ratio 1 1.92 (0.67-5.54) 0.227 Adjusted odds ratio 1 1.65 (0.55-4.89) 0.37 High versus desirable LDL-C Crude odds ratio 1 3.51 (1.25-9.85) 0.017 Adjusted odds ratio 1 3.29 (1.10-9.82) 0.033 Desirable cholesterol indicates \200 mg/dl; moderately high cholesterol indicates 200-239 mg/dl; high cholesterol indicates C240 mg/dl Desirable LDL-C indicates \130 mg/dl; moderately high LDL-C indicates 130-159 mg/dl; high LDL-C indicates C160 mg/dl Logistic regression analysis was used to estimate the odds ratio, by adjusting for age and sex. Login to comment
87 It has been reported that the D19H polymorphism is linked to a lower plant sterol and cholesterol absorption efficiency. Login to comment
89 Berge and colleagues identified significantly reduced plant sterol absorption in carriers with the D19H polymorphism in a family study of a healthy normolipidemic population, but there was no association of the serum lipid level with this polymorphism (Berge et al. 2002). Login to comment
96 The discordance between our results for the serum total cholesterol and LDL-C levels in our subjects with D19H and previous results may be attributed to the following reasons: (1) the populations studied had different recruitment criteria for serum lipid levels; (2) dietary habits of different races; (3) different dietary interventions within the study period. Login to comment
99 As reports have shown previously, this points to the fact that subjects with D19H/19H (GC or CC) variants are disposed to having a lower cholesterol absorption efficiency (Gylling et al. 2004; Huba &#b4;c c7;ek et al. 2004; Kajinami et al. 2004a, 2004b). Login to comment
101 Since hepatic cholesterol biosynthesis has the greatest effect on cholesterol homeostasis (Lammert and Wang 2005; Wang 2007; Sehayek 2003; Temel et al. 2007), we can plausibly speculate that the compensatory hepatic cholesterol biosynthesis in subjects with D19H (GC) caused their higher serum total cholesterol and LDL-C levels than those observed with the D19 (GG) genotype in our results. Login to comment
113 Our results indicated that subjects with D19H variants had greater insulin resistance (higher HOMA-IR index) than those with D19 variants, although they did not differ in terms of other metabolic biomarkers (BMI, blood pressure, serum triglyceride, plasma glucose). Login to comment
121 It seems wise to start preventive intervention strategies for atherosclerosis earlier in carriers of the D19H polymorphism. Login to comment
124 Because of the limited number of D19H subjects in our population, this result can be regarded as intriguing but tentative, and will therefore require more study before any further application of it is made. Login to comment

PMID: 18850127 [PubMed] Zhao HL et al: "Genetic variation in ABC G5/G8 and NPC1L1 impact cholesterol response to plant sterols in hypercholesterolemic men."

No. Sentence Comment

47 Analyses of ABCG5/G8 and NPC1L1 Genotype SNPs The ABCG5/G8 polymorphisms, 1950 G [ C (Q604E), 145 G [ C (D19H), 1289 C [ A (T400 K) and 1572 (A632 V), as well as the NPC1L1 polymorphisms, 872 C [ G (L272L) and 3929 G [ A (Y1291Y), were screened from the published SNP data demonstrating an established functional significance for cholesterol modulation. Login to comment
19 Berge et al. observed that lower baseline PS concentrations were associated with two common sequence variations, 145 G [ C (D19H) and 1289 C [ A (T400 K) of the ABCG8 half-transporter gene [11]. Login to comment
21 Further, variations in D19H may be associated with responsiveness to atorvastatin therapy [6]. Login to comment
77 Relation of ABCG5/G8 Gene Polymorphism Variations with Responsiveness to PS Intake The genotype frequencies of ABCG5/G8 common polymorphisms, T400 K, D19H and A632 V, were identified to abide with Hardy-Weinberg equilibrium [24]. Login to comment
98 L_PSb ABCG8 A632 V AA (68) 27 (59%)c 19 (41%)c 46 10 (45%)c 12 (55%)c 22 37 (54%)c 31 (46%)c VA (11) 2 (40%)c 3 (60%)c 5 2 (33%)c 4 (67%)c 6 4 (36%)c 7 (64%)c T400 K* TT (51) 20 (59%)c 14 (41%)c 34 11 (65%)c 6 (35%)c 17 31 (61%)c 20 (39%)c TK/KK (28) 9 (53%)c 8 (47%)c 17 1 (9%)c 10 (91%)c 11 11 (39%)c 17 (61%)c D19H DD (70) 25 (57%) 19 (43%) 44 12 (46%) 14 (54%) 26 37 (53%) 33 (47%) DH (9) 4 (57%) 3 (43%) 7 0 (0 %) 2 (100%) 2 4 (44%) 5 (56%) NPC1L1 L272L G/G (43) 15 (58%) 11 (42%) 26 7 (41%) 10 (59%) 17 22 (51%) 21 (49%) G/C,C/C (36) 14 (56%) 11 (44%) 25 5 (45%) 6 (55%) 11 19 (53%) 17 (47%) Y1291Y G/G (55) 19 (54%) 16 (46%) 35 7 (35%) 13 (65%) 20 26 (47%) 29 (53%) G/A,A/A (24) 10 (63%) 6 (37%) 16 5 (63%) 3 (37%) 8 15 (63%) 9 (37%) Distributions of responders and non-responders among subjects with high and low basal PS levels at different SNPs were analyzed by chi-square test, followed by one-side Fisher`s exact test, significant was considered at * p \ 0.05 a, b For description of responders vs. non-responders and H_PS (n = 41) and L_PS (n = 38), see Table 1 c Percentage in parenthesis represents the % of the stated subject numbers over the total subject numbers Relation of NPC1L1 Gene Polymorphism Variations with Cholesterol Responsiveness to PS Intake Two sets of NPC1L1 common polymorphisms, L272L and Y1291Y, were identified to abide with Hardy-Weinberg equilibrium and thus further analyzed. Login to comment
23 Berge et al. observed that lower baseline PS concentrations were associated with two common sequence variations, 145 G [ C (D19H) and 1289 C [ A (T400 K) of the ABCG8 half-transporter gene [11]. Login to comment
25 Further, variations in D19H may be associated with responsiveness to atorvastatin therapy [6]. Login to comment
51 Analyses of ABCG5/G8 and NPC1L1 Genotype SNPs The ABCG5/G8 polymorphisms, 1950 G [ C (Q604E), 145 G [ C (D19H), 1289 C [ A (T400 K) and 1572 (A632 V), as well as the NPC1L1 polymorphisms, 872 C [ G (L272L) and 3929 G [ A (Y1291Y), were screened from the published SNP data demonstrating an established functional significance for cholesterol modulation. Login to comment
81 Relation of ABCG5/G8 Gene Polymorphism Variations with Responsiveness to PS Intake The genotype frequencies of ABCG5/G8 common polymorphisms, T400 K, D19H and A632 V, were identified to abide with Hardy-Weinberg equilibrium [24]. Login to comment
102 L_PSb ABCG8 A632 V AA (68) 27 (59%)c 19 (41%)c 46 10 (45%)c 12 (55%)c 22 37 (54%)c 31 (46%)c VA (11) 2 (40%)c 3 (60%)c 5 2 (33%)c 4 (67%)c 6 4 (36%)c 7 (64%)c T400 K* TT (51) 20 (59%)c 14 (41%)c 34 11 (65%)c 6 (35%)c 17 31 (61%)c 20 (39%)c TK/KK (28) 9 (53%)c 8 (47%)c 17 1 (9%)c 10 (91%)c 11 11 (39%)c 17 (61%)c D19H DD (70) 25 (57%) 19 (43%) 44 12 (46%) 14 (54%) 26 37 (53%) 33 (47%) DH (9) 4 (57%) 3 (43%) 7 0 (0 %) 2 (100%) 2 4 (44%) 5 (56%) NPC1L1 L272L G/G (43) 15 (58%) 11 (42%) 26 7 (41%) 10 (59%) 17 22 (51%) 21 (49%) G/C,C/C (36) 14 (56%) 11 (44%) 25 5 (45%) 6 (55%) 11 19 (53%) 17 (47%) Y1291Y G/G (55) 19 (54%) 16 (46%) 35 7 (35%) 13 (65%) 20 26 (47%) 29 (53%) G/A,A/A (24) 10 (63%) 6 (37%) 16 5 (63%) 3 (37%) 8 15 (63%) 9 (37%) Distributions of responders and non-responders among subjects with high and low basal PS levels at different SNPs were analyzed by chi-square test, followed by one-side Fisher`s exact test, significant was considered at * p \ 0.05 a, b For description of responders vs. non-responders and H_PS (n = 41) and L_PS (n = 38), see Table 1 c Percentage in parenthesis represents the % of the stated subject numbers over the total subject numbers Relation of NPC1L1 Gene Polymorphism Variations with Cholesterol Responsiveness to PS Intake Two sets of NPC1L1 common polymorphisms, L272L and Y1291Y, were identified to abide with Hardy-Weinberg equilibrium and thus further analyzed. Login to comment
20 Berge et al. observed that lower baseline PS concentrations were associated with two common sequence variations, 145 G [ C (D19H) and 1289 C [ A (T400 K) of the ABCG8 half-transporter gene [11]. Login to comment
22 Further, variations in D19H may be associated with responsiveness to atorvastatin therapy [6]. Login to comment
48 Analyses of ABCG5/G8 and NPC1L1 Genotype SNPs The ABCG5/G8 polymorphisms, 1950 G [ C (Q604E), 145 G [ C (D19H), 1289 C [ A (T400 K) and 1572 (A632 V), as well as the NPC1L1 polymorphisms, 872 C [ G (L272L) and 3929 G [ A (Y1291Y), were screened from the published SNP data demonstrating an established functional significance for cholesterol modulation. Login to comment
78 Relation of ABCG5/G8 Gene Polymorphism Variations with Responsiveness to PS Intake The genotype frequencies of ABCG5/G8 common polymorphisms, T400 K, D19H and A632 V, were identified to abide with Hardy-Weinberg equilibrium [24]. Login to comment
99 L_PSb ABCG8 A632 V AA (68) 27 (59%)c 19 (41%)c 46 10 (45%)c 12 (55%)c 22 37 (54%)c 31 (46%)c VA (11) 2 (40%)c 3 (60%)c 5 2 (33%)c 4 (67%)c 6 4 (36%)c 7 (64%)c T400 K* TT (51) 20 (59%)c 14 (41%)c 34 11 (65%)c 6 (35%)c 17 31 (61%)c 20 (39%)c TK/KK (28) 9 (53%)c 8 (47%)c 17 1 (9%)c 10 (91%)c 11 11 (39%)c 17 (61%)c D19H DD (70) 25 (57%) 19 (43%) 44 12 (46%) 14 (54%) 26 37 (53%) 33 (47%) DH (9) 4 (57%) 3 (43%) 7 0 (0 %) 2 (100%) 2 4 (44%) 5 (56%) NPC1L1 L272L G/G (43) 15 (58%) 11 (42%) 26 7 (41%) 10 (59%) 17 22 (51%) 21 (49%) G/C,C/C (36) 14 (56%) 11 (44%) 25 5 (45%) 6 (55%) 11 19 (53%) 17 (47%) Y1291Y G/G (55) 19 (54%) 16 (46%) 35 7 (35%) 13 (65%) 20 26 (47%) 29 (53%) G/A,A/A (24) 10 (63%) 6 (37%) 16 5 (63%) 3 (37%) 8 15 (63%) 9 (37%) Distributions of responders and non-responders among subjects with high and low basal PS levels at different SNPs were analyzed by chi-square test, followed by one-side Fisher`s exact test, significant was considered at * p \ 0.05 a, b For description of responders vs. non-responders and H_PS (n = 41) and L_PS (n = 38), see Table 1 c Percentage in parenthesis represents the % of the stated subject numbers over the total subject numbers Relation of NPC1L1 Gene Polymorphism Variations with Cholesterol Responsiveness to PS Intake Two sets of NPC1L1 common polymorphisms, L272L and Y1291Y, were identified to abide with Hardy-Weinberg equilibrium and thus further analyzed. Login to comment

PMID: 20497293 [PubMed] Katsika D et al: "Gallstone disease in Swedish twins: risk is associated with ABCG8 D19H genotype."

No. Sentence Comment

11 ABCG5 Q604E and ABCG8 D19H genotyping was performed in 24 unique MZ and eight dizygotic (DZ) twins from concordant pairs. Login to comment
31 To further validate the contribution of the lithogenic ABCG5 Q604E and ABCG8 D19H variants to GD, we tested for these alleles in a twin-based association study after selected sampling from the Swedish Twin Registry(STR). Login to comment
74 Results The ABCG5 Q604E and ABCG8 D19H variants were successfully genotyped in all samples. Login to comment
76 Table 2 summarizes the allele and genotype distributions for the ABCG5 Q604E and ABCG8 D19H variants. Login to comment
78 Seven and six MZ twin pairs were heterozygous Q604E and D19H carriers, respectively. Login to comment
79 Concordance for GD was found in five twin pairs with Q604E or D19H variants, respectively. Login to comment
81 Discordant MZ twins were disregarded from further calculations, as they cannot be Table 2 Alleles and genotypes (count / frequency) for ABCG8 D19H (A) and ABCG5 Q604E (B) in all unique monozygotic, dizygotic andcontrolgenomesforSwedishtwins MZ DZ NoGD GD NoGD GD n % n % n % n % (A)AllelefrequenciesofABCG8 D19HinSwedishtwins Allele / genotype Totalscreeningpopulation GG 99 90.8 36 81.8 114 90.5 48 77.4 GC 9 8.3 8 18.2 11 8.7 13 21.0 CC 1 0.9 0 0 1 0.8 1 1.6 StockholmCountyscreeningpopulation GG 7 87.5 19 79.2 0 4 50.0 GC 1 12.5 5 20.8 0 3 37.5 CC 0 0 0 0 0 1 12.5 Nationwidescreeningpopulation GG 99 90.9 17 85.0 114 90.5 44 81.5 GC 9 8.3 3 15.0 11 8.7 10 18.5 CC 1 0.9 0 0 1 0.8 0 0.0 (B)AllelefrequenciesofABCG5Q604EinSwedishtwins Allele / genotype Totalscreeningpopulation GG 74 67.9 32 72.7 85 67.5 26 41.9 GC 32 29.4 11 25.0 33 26.2 32 51.6 CC 3 2.7 1 2.3 8 6.3 4 6.5 StockholmCountyscreeningpopulation GG 6 75.0 18 75.0 0 0 1 12.5 GC 2 25.0 5 20.8 0 0 7 87.5 CC 0 0 1 4.2 0 0 0 0 Nationwidescreeningpopulation GG 74 67.9 14 70.0 85 67.5 25 46.3 GC 32 29.4 6 30.0 33 26.2 25 46.3 CC 3 2.7 0 0 8 6.3 4 7.4 MZ,uniquegenomesinconcordantMZpairswithGDandstone-freeuniqueMZgenomes;DZ,twinsinconcordantDZpairswith GDandnonrelated stone-freeDZtwins. Login to comment
122 Moreover, such misclassification would be expected to bias the estimates to the null, which means that the relationship between D19H (and Q604E) and GD would be, if anything, underestimated. Login to comment
0 doi: 10.1111/j.1365-2796.2010.02249.x Gallstone disease in Swedish twins: risk is associated with ABCG8 D19H genotype D.Katsika1 ,P.Magnusson2 ,M.Krawczyk3 , F.Gru¨nhage3 ,P.Lichtenstein2 , C. Einarsson1 ,F.Lammert3 &H.-U.Marschall1 FromtheDepartmentsof1 MedicineatKarolinskaUniversityHospitalHuddingeand 2 MedicalEpidemiologyandBiostatistics, KarolinskaInstitutet, Stockholm,Sweden,and 3 DepartmentofMedicineII,SaarlandUniversity Hospital,Homburg,Germany Abstract. Login to comment
2 Gallstone disease in Swedish twins: risk is associated with ABCG8 D19H genotype. Login to comment
5 Recently, variants of the hepatocanalicular cholesterol hemitransporters ABCG5/8 were linked to gallstone disease; ABCG8 D19H in Caucasians andABCG5Q604E inChinese. Login to comment
15 Amongst the 341 twins, 20.8% carried at least one D19H allele as compared to 9.4% of stone-free controls. Login to comment
16 The association analysis showed that D19H positivity significantly increased the risk of gallstone disease [odds ratio (OR), 2.54; 95% confidence interval (CI), 1.33-4.82; P = 0.004]. Login to comment
19 Twins carrying a heterozygous or homozygous ABCG8 D19H genotype have a significantly increased risk of gallstone disease. Login to comment
20 Our study confirms the ABCG8 D19H genotype as a major risk factor for gallstone disease. Login to comment
29 A genome-wide association study of patients with gallstones from Germany and Chile [14] and a linkage study in affected sibling pairs from Germany and Romania [15] then identified the D19H variant of ABCG8, located on chromosome 2, as a susceptibility factor for human GD. Login to comment
68 For genotyping using TaqMan assays, we selected the functionally relevant nonsynonymous coding single-nucleotide polymorphisms (SNPs) ABCG5 rs672017 (c.1810G>C, p.E604Q) and ABCG8 rs11887534 (c.55G>C, D19H), as described [15]. Login to comment
88 There were 297 D19H wild-type subjects; 84 with GD and 213 without GD. Login to comment
89 Of the 41 heterozygous D19H carriers, 21 had GD and 20 did not. There were only three homozygous D91H carriers (one with GD). Login to comment
90 We observed that hetero- or homogeneous carriage of the D19H allele conferred a significantly increased risk of developing GD [odds ratio (OR), 2.54; 95% confidence interval (CI), 1.33-4.82; P = 0.004]. Login to comment
91 Amongst MZ cases, 18.2% were D19H carriers compared to 8.3% of MZ controls. Amongst the DZ cases, 22.6% were D19H carriers compared to 9.5% of DZ controls. Overall, 20.8% (22 of 106) of cases were positive for the D19H allele, compared to 9.4% (22 of 235) of controls. Login to comment
98 Gru¨nhage et al. demonstrated significant single-point linkage for the ABCG8 D19H variant but not for other ABCG5/ G8 SNPs [15]. Login to comment
103 Notwithstanding, in our Stockholm County population, 20.8% of concordant MZ pairs carried at least one D19H allele, which is in accordance with the results of Gru¨nhage et al. who found this allele in 21.4% of Caucasian patients with gallstones but only in 8.6% of controls [15]. Login to comment
104 The D19H variant was also reported to be a susceptibility factor for GD inChilean Hispanics [14] and in a Chinese population [16] in which D19H increased the risk of gallstones with an OR of 12.4 in predominantly male patients below 50 years of age. Login to comment
108 Considering the whole cohort of MZ and DZ cases and matched controls from the TwinGene database, we found that the ABCG8 D19H genotype was more common in both MZ and DZ twins with GD than in MZ and DZ controls. Overall, D19H positivity was significantly (P = 0.004) higher in cases (20.8%) than in controls (9.4%), which clearly points to a genetic impact, in accordance with previous publications [15] and our results from the Stockholm County population. Login to comment
109 Of note, despite the old age of the majority of the Stockholm County cohort, no twin with GD and ABCG8 D19H had an elevated level of serum total or low-density lipoprotein (LDL) cholesterol. Login to comment
110 This, at least, is not in contrast to previous studies [21-23] that have shown significantly lower levels of total and LDL cholesterol in D19H carriers. Login to comment
111 This finding led to the assumption that D19H increases the ABCG5/G8-mediatedtransferofcholesterol into bile, resulting in biliary cholesterol hypersaturation, which is the major pathogenetic defect in GD [1, 2]. Login to comment
125 In summary, our study in MZ and DZ twins confirms the ABCG8 D19H variant as a significant risk factor for GD. Login to comment

PMID: 20581104 [PubMed] Jakulj L et al: "ABCG5/G8 polymorphisms and markers of cholesterol metabolism: systematic review and meta-analysis."

No. Sentence Comment

141 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (␮g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 ± 0.76 4.05 ± 0.61 1.54 ± 0.40 1.09 [0.29-3.56] 1.45 ± 0.64 1.12 ± 0.53 1.49 ± 0.33 1.24 ± 0.49 QE/EE 72 6.23 ± 0.73 4.11 ± 0.63 1.49 ± 0.36 1.19 [0.47-3.93] 1.47 ± 0.88 1.16 ± 0.63 1.46 ± 0.38 1.28 ± 0.57 D19H DD 219 6.19 ± 0.75 4.08 ± 0.61 1.52 ± 0.40 1.10 [0.29-3.93] 1.49 ± 0.69 1.16 ± 0.55 1.49 ± 0.34 1.24 ± 0.49 DH/HH 24 6.04 ± 0.81 3.90 ± 0.63 1.60 ± 0.38 1.15 [0.47-1.97] 1.24 ± 0.82 0.92 ± 0.53 1.38 ± 0.34 1.35 ± 0.64 Y54C YY 73 6.32 ± 0.73 4.14 ± 0.64 1.58 ± 0.37 1.09 [0.45-3.93] 1.59 ± 0.76 1.22 ± 0.60 1.53 ± 0.33 1.24 ± 0.53 YC/CC 171 6.12 ± 0.76 4.03 ± 0.61 1.51 ± 0.41 1.11 [0.29-3.56] 1.41 ± 0.68 1.09 ± 0.53 1.46 ± 0.34 1.26 ± 0.50 T400K TT 183 6.16 ± 0.75 4.03 ± 0.60 1.55 ± 0.40 1.10 [0.29-3.93] 1.48 ± 0.69 1.14 ± 0.55 1.49 ± 0.35 1.25 ± 0.48 TK/KK 61 6.24 ± 0.76 4.19 ± 0.66 1.47 ± 0.37 1.14 [0.47-2.61] 1.38 ± 0.76 1.09 ± 0.59 1.45 ± 0.31 1.27 ± 0.59 A632V AA 139 6.22 ± 0.72 4.12 ± 0.60 1.51 ± 0.37 1.12 [0.33-2.90] 1.49 ± 0.72 1.16 ± 0.58 1.51 ± 0.37 1.21 ± 0.49 AV/VV 105 6.14 ± 0.79 3.99 ± 0.63 1.57 ± 0.43 1.07 [0.29-3.93] 1.42 ± 0.70 1.09 ± 0.52 1.44 ± 0.30 1.31 ± 0.52 Values shown are means ± SD. Triglycerides are shown as median [range]. Login to comment
145 TABLE3.Characteristicsofstudiesincludedinthemeta-analysis Reference Number of SubjectsAge Male/ Female BodyMass IndexEthnicitySingleNucleotidePolymorphismsLipidsNon-CholesterolSterols nyearsnkg/m 2 Berge,2002(5)14855±1174/74NotreportedCaucasianD19H,T400K,Y54C,Q604E,A632VTCCAMP,SITO,CHOLST,LATHO Weggemans,2002(7)48626.3±11.6257/22921.7±3.0CaucasianQ604ETC- Gylling,2004(13)26253.1±8.1143/11926.4±6.5CaucasianD19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TGCAMP,SITO,CHOLST,LATHO Plat,2005(11)a 11233±1641/7122.9±3.6CaucasianT400K,Q604E,A632VLDL-C,HDL-C,TGCAMP,SITO,LATHO Acalovschi,2006(27)72 e 56.3(36-80)30/4230.1±4.9CaucasianD19H,T400K,Y54C,Q604E,A632VTC,HDL-C,TG- Jakulj,etal. b 24558.4±7.5189/4825.8±3.0CaucasianD19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TGCAMP,SITO,CHOLST,LATHO Miwa,2005(28)10062.4±12.148/5223.0±3.5AsianT400K,Y54C,Q604E-SITO,LATHO Wang,2007(29) a,c 13454.1±8.1134/023.2±2.3AsianT400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Chen,2008(8) a 104647.0±9.3894/15224.9±2.4AsianD19H,T400K,Y54C,Q604E i TC,LDL-C,HDL-C,TG- Caamano,2008(30) d 10440±1058/4625.5±3.3HispanicY54C,Q604ETC,LDL-C,HDL-C,TG- 11844±771/4727.6±4.9HispanicY54C,Q604ETC,LDL-C,HDL-C,TG- Santosa,2007(31) a 3549.4±6.70/3531.4±2.8Mixed f D19H,T400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Rudkowska,2008(32)2659.6±9.615/1126.4±2.7Mixed f D19H,T400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Chan,2004(33) a 4754.5±8.447/032±3.6Notreported g D19H,T400KTC,LDL-C,HDL-C,TGCAMP,SITO,LATHO Kajinami,2004(12) a 33858±11203/13527.0±3.0Notreported h D19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TG- Herron,2006(9) a 9131.1±9.240/5124.8±4.7Notreported h Q604ETC,LDL-C,HDL-C- Total(WM)336446.7±10.52251/111323.9±3.5 Numberandcharacteristicsofstudiesincludedinthemeta-analysis.CAMP,campesterol/TCratio;CHOLST,cholestanol/TCratio;HDL-C,HDL-cholesterol;LATHO,lathosterol/TCratio;LDL-C, LDL-cholesterol;SITO,sitosterol/TCratio;TC,totalcholesterol;TG,triglyceride;WM,weightedmean. Login to comment
12 We first investigated associations between five common ABCG5/G8 polymorphisms (p.Q604E, p.D19H, p.Y54C, p. T400K, and p.A632V) and plasma sterol levels in 245 hypercholesterolaemic individuals. Login to comment
68 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
92 Analysis of the pooled data revealed that the minor allele of the p.D19H variant was associated with significantly reduced markers of cholesterol absorption and increased markers of cholesterol synthesis (Fig. 2); 83 subjects carrying the 19H allele showed decreased riers of the common variant. Login to comment
119 Although these studies mostly include common variants with a minor allele frequency (MAF) greater than 0.1, two studies described a significant association between the lesser common p.D19H variant and plasma LDL-C concentrations (36, 38), although associations were relatively weak. Login to comment
120 We did not find any association between the p.D19H variant and baseline LDL-C levels in 155 subjects with the minor allele versus 1,842 subjects carrying the common variant (supplementary Table II). Login to comment
125 However, in silico analysis by polyphen predicts p.D19H as a benign variant, and no relation was found between this SNP and ABCG8 mRNA expression levels in human liver tissue samples (38). Login to comment
134 The p.D19H variant was associated with changes in cholesterol absorption and cholesterol synthesis markers without affecting plasma cholesterol levels. Login to comment
155 This GWAS did not report associations between the five missense variants of our meta-analysis and CAD risk; however, the variant associated with reduced CAD risk was a SNP in close linkage disequilibrium with the p.D19H variant. Login to comment
159 One study evaluated associations between p.T400K and p.D19H polymorphisms and CVD risk in a cohort of 2,012 heterozygous FH patients (22). Login to comment
160 Neither of the two variants was independently associated with total CVD risk; however, when combined p.T400K and p.D19H gene scores were calculated, a positive correlation was found. Login to comment
166 Associations between the ABCG8 p.D19H variant and plasma non-cholesterol sterol levels. Login to comment
286 In conclusion, this meta-analysis shows a positive association of the ABCG8 p.D19H polymorphism with decreased plasma plant sterol levels and concomitantly increased plasma lathosterol levels. Login to comment
66 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
90 Analysis of the pooled data revealed that the minor allele of the p.D19H variant was associated with significantly reduced markers of cholesterol absorption and increased markers of cholesterol synthesis (Fig. 2); 83 subjects carrying the 19H allele showed decreased riers of the common variant. Login to comment
117 Although these studies mostly include common variants with a minor allele frequency (MAF) greater than 0.1, two studies described a significant association between the lesser common p.D19H variant and plasma LDL-C concentrations (36, 38), although associations were relatively weak. Login to comment
118 We did not find any association between the p.D19H variant and baseline LDL-C levels in 155 subjects with the minor allele versus 1,842 subjects carrying the common variant (supplementary Table II). Login to comment
123 However, in silico analysis by polyphen predicts p.D19H as a benign variant, and no relation was found between this SNP and ABCG8 mRNA expression levels in human liver tissue samples (38). Login to comment
124 Of note, in silico analyses of the remaining four variants predicted only the p.Y54C polymorphism to be damaging. Login to comment
132 The p.D19H variant was associated with changes in cholesterol absorption and cholesterol synthesis markers without affecting plasma cholesterol levels. Login to comment
139 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (òe;g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 &#b1; 0.76 4.05 &#b1; 0.61 1.54 &#b1; 0.40 1.09 [0.29-3.56] 1.45 &#b1; 0.64 1.12 &#b1; 0.53 1.49 &#b1; 0.33 1.24 &#b1; 0.49 QE/EE 72 6.23 &#b1; 0.73 4.11 &#b1; 0.63 1.49 &#b1; 0.36 1.19 [0.47-3.93] 1.47 &#b1; 0.88 1.16 &#b1; 0.63 1.46 &#b1; 0.38 1.28 &#b1; 0.57 D19H DD 219 6.19 &#b1; 0.75 4.08 &#b1; 0.61 1.52 &#b1; 0.40 1.10 [0.29-3.93] 1.49 &#b1; 0.69 1.16 &#b1; 0.55 1.49 &#b1; 0.34 1.24 &#b1; 0.49 DH/HH 24 6.04 &#b1; 0.81 3.90 &#b1; 0.63 1.60 &#b1; 0.38 1.15 [0.47-1.97] 1.24 &#b1; 0.82 0.92 &#b1; 0.53 1.38 &#b1; 0.34 1.35 &#b1; 0.64 Y54C YY 73 6.32 &#b1; 0.73 4.14 &#b1; 0.64 1.58 &#b1; 0.37 1.09 [0.45-3.93] 1.59 &#b1; 0.76 1.22 &#b1; 0.60 1.53 &#b1; 0.33 1.24 &#b1; 0.53 YC/CC 171 6.12 &#b1; 0.76 4.03 &#b1; 0.61 1.51 &#b1; 0.41 1.11 [0.29-3.56] 1.41 &#b1; 0.68 1.09 &#b1; 0.53 1.46 &#b1; 0.34 1.26 &#b1; 0.50 T400K TT 183 6.16 &#b1; 0.75 4.03 &#b1; 0.60 1.55 &#b1; 0.40 1.10 [0.29-3.93] 1.48 &#b1; 0.69 1.14 &#b1; 0.55 1.49 &#b1; 0.35 1.25 &#b1; 0.48 TK/KK 61 6.24 &#b1; 0.76 4.19 &#b1; 0.66 1.47 &#b1; 0.37 1.14 [0.47-2.61] 1.38 &#b1; 0.76 1.09 &#b1; 0.59 1.45 &#b1; 0.31 1.27 &#b1; 0.59 A632V AA 139 6.22 &#b1; 0.72 4.12 &#b1; 0.60 1.51 &#b1; 0.37 1.12 [0.33-2.90] 1.49 &#b1; 0.72 1.16 &#b1; 0.58 1.51 &#b1; 0.37 1.21 &#b1; 0.49 AV/VV 105 6.14 &#b1; 0.79 3.99 &#b1; 0.63 1.57 &#b1; 0.43 1.07 [0.29-3.93] 1.42 &#b1; 0.70 1.09 &#b1; 0.52 1.44 &#b1; 0.30 1.31 &#b1; 0.52 Values shown are means &#b1; SD. Triglycerides are shown as median [range]. Login to comment
144 Characteristics of studies included in the meta-analysis Reference Number of Subjects Age Male/ Female Body Mass Index Ethnicity Single Nucleotide Polymorphisms Lipids Non-Cholesterol Sterols n years n kg/m 2 Berge, 2002 (5) 148 55 &#b1; 11 74/74 Not reported Caucasian D19H, T400K, Y54C, Q604E, A632V TC CAMP, SITO, CHOLST, LATHO Weggemans, 2002 (7) 486 26.3 &#b1; 11.6 257/229 21.7 &#b1; 3.0 Caucasian Q604E TC - Gylling, 2004 (13) 262 53.1 &#b1; 8.1 143/119 26.4 &#b1; 6.5 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG CAMP, SITO, CHOLST, LATHO Plat, 2005 (11) a 112 33 &#b1; 16 41/71 22.9 &#b1; 3.6 Caucasian T400K, Q604E, A632V LDL-C, HDL-C, TG CAMP, SITO, LATHO Acalovschi, 2006 (27) 72 e 56.3 (36-80) 30/42 30.1 &#b1; 4.9 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, HDL-C, TG - Jakulj, et al. b 245 58.4 &#b1; 7.5 189/48 25.8 &#b1; 3.0 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG CAMP, SITO, CHOLST, LATHO Miwa, 2005 (28) 100 62.4 &#b1; 12.1 48/52 23.0 &#b1; 3.5 Asian T400K, Y54C, Q604E - SITO, LATHO Wang, 2007 (29) a , c 134 54.1 &#b1; 8.1 134/0 23.2 &#b1; 2.3 Asian T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Chen, 2008 (8) a 1046 47.0 &#b1; 9.3 894/152 24.9 &#b1; 2.4 Asian D19H, T400K, Y54C, Q604E i TC, LDL-C, HDL-C, TG - Caamano, 2008 (30) d 104 40 &#b1; 10 58/46 25.5 &#b1; 3.3 Hispanic Y54C, Q604E TC, LDL-C, HDL-C, TG - 118 44 &#b1; 7 71/47 27.6 &#b1; 4.9 Hispanic Y54C, Q604E TC, LDL-C, HDL-C, TG - Santosa, 2007 (31) a 35 49.4 &#b1; 6.7 0/35 31.4 &#b1; 2.8 Mixed f D19H, T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Rudkowska, 2008 (32) 26 59.6 &#b1; 9.6 15/11 26.4 &#b1; 2.7 Mixed f D19H, T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Chan, 2004 (33) a 47 54.5 &#b1; 8.4 47/0 32 &#b1; 3.6 Not reported g D19H, T400K TC, LDL-C, HDL-C, TG CAMP, SITO, LATHO Kajinami, 2004 (12) a 338 58 &#b1; 11 203/135 27.0 &#b1; 3.0 Not reported h D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG - Herron, 2006 (9) a 91 31.1 &#b1; 9.2 40/51 24.8 &#b1; 4.7 Not reported h Q604E TC, LDL-C, HDL-C - Total (WM) 3364 46.7 &#b1; 10.5 2251/ 1113 23.9 &#b1; 3.5 Number and characteristics of studies included in the meta-analysis. Login to comment
157 This GWAS did not report associations between the five missense variants of our meta-analysis and CAD risk; however, the variant associated with reduced CAD risk was a SNP in close linkage disequilibrium with the p.D19H variant. Login to comment
161 One study evaluated associations between p.T400K and p.D19H polymorphisms and CVD risk in a cohort of 2,012 heterozygous FH patients (22). Login to comment
162 Neither of the two variants was independently associated with total CVD risk; however, when combined p.T400K and p.D19H gene scores were calculated, a positive correlation was found. Login to comment
168 Associations between the ABCG8 p.D19H variant and plasma non-cholesterol sterol levels. Login to comment
287 In conclusion, this meta-analysis shows a positive association of the ABCG8 p.D19H polymorphism with decreased plasma plant sterol levels and concomitantly increased plasma lathosterol levels. We did not observe any substantial associations between ABCG5/G8 polymorphisms and plasma lipid levels. Login to comment
67 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
91 Analysis of the pooled data revealed that the minor allele of the p.D19H variant was associated with significantly reduced markers of cholesterol absorption and increased markers of cholesterol synthesis (Fig. 2); 83 subjects carrying the 19H allele showed decreased riers of the common variant. Login to comment
133 The p.D19H variant was associated with changes in cholesterol absorption and cholesterol synthesis markers without affecting plasma cholesterol levels. Login to comment
140 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (òe;g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 &#b1; 0.76 4.05 &#b1; 0.61 1.54 &#b1; 0.40 1.09 [0.29-3.56] 1.45 &#b1; 0.64 1.12 &#b1; 0.53 1.49 &#b1; 0.33 1.24 &#b1; 0.49 QE/EE 72 6.23 &#b1; 0.73 4.11 &#b1; 0.63 1.49 &#b1; 0.36 1.19 [0.47-3.93] 1.47 &#b1; 0.88 1.16 &#b1; 0.63 1.46 &#b1; 0.38 1.28 &#b1; 0.57 D19H DD 219 6.19 &#b1; 0.75 4.08 &#b1; 0.61 1.52 &#b1; 0.40 1.10 [0.29-3.93] 1.49 &#b1; 0.69 1.16 &#b1; 0.55 1.49 &#b1; 0.34 1.24 &#b1; 0.49 DH/HH 24 6.04 &#b1; 0.81 3.90 &#b1; 0.63 1.60 &#b1; 0.38 1.15 [0.47-1.97] 1.24 &#b1; 0.82 0.92 &#b1; 0.53 1.38 &#b1; 0.34 1.35 &#b1; 0.64 Y54C YY 73 6.32 &#b1; 0.73 4.14 &#b1; 0.64 1.58 &#b1; 0.37 1.09 [0.45-3.93] 1.59 &#b1; 0.76 1.22 &#b1; 0.60 1.53 &#b1; 0.33 1.24 &#b1; 0.53 YC/CC 171 6.12 &#b1; 0.76 4.03 &#b1; 0.61 1.51 &#b1; 0.41 1.11 [0.29-3.56] 1.41 &#b1; 0.68 1.09 &#b1; 0.53 1.46 &#b1; 0.34 1.26 &#b1; 0.50 T400K TT 183 6.16 &#b1; 0.75 4.03 &#b1; 0.60 1.55 &#b1; 0.40 1.10 [0.29-3.93] 1.48 &#b1; 0.69 1.14 &#b1; 0.55 1.49 &#b1; 0.35 1.25 &#b1; 0.48 TK/KK 61 6.24 &#b1; 0.76 4.19 &#b1; 0.66 1.47 &#b1; 0.37 1.14 [0.47-2.61] 1.38 &#b1; 0.76 1.09 &#b1; 0.59 1.45 &#b1; 0.31 1.27 &#b1; 0.59 A632V AA 139 6.22 &#b1; 0.72 4.12 &#b1; 0.60 1.51 &#b1; 0.37 1.12 [0.33-2.90] 1.49 &#b1; 0.72 1.16 &#b1; 0.58 1.51 &#b1; 0.37 1.21 &#b1; 0.49 AV/VV 105 6.14 &#b1; 0.79 3.99 &#b1; 0.63 1.57 &#b1; 0.43 1.07 [0.29-3.93] 1.42 &#b1; 0.70 1.09 &#b1; 0.52 1.44 &#b1; 0.30 1.31 &#b1; 0.52 Values shown are means &#b1; SD. Triglycerides are shown as median [range]. Login to comment
158 This GWAS did not report associations between the five missense variants of our meta-analysis and CAD risk; however, the variant associated with reduced CAD risk was a SNP in close linkage disequilibrium with the p.D19H variant. Login to comment
163 Neither of the two variants was independently associated with total CVD risk; however, when combined p.T400K and p.D19H gene scores were calculated, a positive correlation was found. Login to comment
169 Associations between the ABCG8 p.D19H variant and plasma non-cholesterol sterol levels. Login to comment
289 In conclusion, this meta-analysis shows a positive association of the ABCG8 p.D19H polymorphism with decreased plasma plant sterol levels and concomitantly increased plasma lathosterol levels. We did not observe any substantial associations between ABCG5/G8 polymorphisms and plasma lipid levels. Login to comment

PMID: 21039829 [PubMed] Yoon JH et al: "ABCG8 D19H polymorphism: a basis for the genetic prediction of cholesterol gallstone disease."

No. Sentence Comment

11 Other studies have identified a variety of polymorphisms in ABCG8 (A632V, T400K, D19H, and C54Y) and in ABCG5 (Q604E) that have been linked to baseline plasma cholesterol levels, cholesterol absorption, or responsiveness to dietary intervention. Login to comment
13 Hubacek et al.10 reported that none of the polymorphisms examined, including ABCG5 Q604E, ABCG8 D19H, and ABCG8 A632V, were related to plasma lipid levels in patients after 'evolutionary`dietary changes from a traditional, high-fat Eastern European diet to a lower-fat diet based on nutritional advice. Login to comment
15 Wang et al.11 examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H,Y54C, T400K, A632V) genes in 287 patients with gallstone disease. Login to comment
0 EDITORIALSjgh_6484 1713..1717 ABCG8 D19H polymorphism: A basis for the genetic prediction of cholesterol gallstone disease Jai H Yoon,* Rahul Kuver† and Ho S Choi* *Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea; and † Division of Gastroenterology, University of Washington, Seattle, Washington, USA See article in J. Gastroenterol. Hepatol. 2010; 25: 1758-1762. Login to comment
2 Although a common and economically-relevant problem in developed countries, its pathogenesis remains undefined and is the subject of ongoing investigation.1 Cholesterol gallstone disease appears to be influenced by both genetic predisposition and environmental factors,2 and ethnic and geographical differences have indeed been found.3 Currently, there is active investigation regarding cholesterol gallstone susceptibility genes (Lith genes), as these genes have been found not only to be useful in treating gallstone disease, but also in diagnosing a 'prestone` state in patients.4 Recently, as the result of a genome-wide association scan, cholesterol transporter adenosine triphosphate-binding cassette (ABC) G8 was identified as a susceptibility factor for human cholesterol gallstone disease.5 Buch et al.5 showed that single-nucleotide polymorphism (SNP) A-1791411 in ABCG8 encoded the variant rs11887534 (D19H), and that the association of ABCG8 D19H with cholesterol gallstones was present in Germans and Chileans after adjusting for body mass index, sex, and age. Login to comment
3 The overall odds ratio for gallstone disease among D19H carriers in Germans and Chileans was 2.2 (95% confidence interval [CI]: 1.8-2.6). Login to comment
10 As mentioned previously, the presence of the D19H mutant allele of the ABCG8 gene is associated with cholesterol gallstones,5 suggesting that the mutated allele might confer more efficient transport of cholesterol into bile, in turn causing cholesterol supersaturation. Login to comment
12 In addition, genetic variations in the ABCG8 gene (D19H and T400K) might increase the risk of gallstone disease in certain populations.9 These sex- and population-specific gene polymorphisms, and the interactions between sex, genes, and diet also need to be considered in studies of polymorphisms of Lith genes. Login to comment
17 Katsika et al.12 demonstrated that twins carrying a heterozygous or homozygous ABCG8 D19H genotype have a significantly increased risk of gallstone disease. Login to comment
18 This result confirmed the ABCG8 D19H genotype as a major risk factor for gallstone disease in Swedish twins. Login to comment
19 Additionally, Chen et al. suggested that the D19H polymorphism of ABCG8 could be considered a susceptible gene marker by revealing an increased likelihood of developing high cholesterol and LDL-C with the D19H polymorphism in Taiwanese consuming an ordinary Chinese diet.13 In this issue of Journal of Gastroenterology and Hepatology, Srivastava et al.14 report that the ABCG8 D19H (rs11887534) variant, DH genotype, and H allele increase susceptibility to cholesterol gallstone disease in a north Indian population. Login to comment
20 They found that the risk of cholesterol gallstone disease due to the ABCG8 D19H variant was more prominent in females. Login to comment
28 A combination of these factors might lead to gallstone formation if a threshold of susceptibility is reached, since each susceptibility allele only confers a modest increase in risk.17 However, the D19H substitution of the ABCG8 gene resulted in a completely different situation: low serum cholestanol, sitosterol, and campesterol levels, suggesting limited sterol absorption,18 causing cholesterol supersaturation in bile and promoting the formation of cholesterol gallstones. Login to comment
35 How does the D19H polymorphism of ABCG8 interact with these factors in promoting cholesterol gallstones? Login to comment
36 In conclusion, the results of the population-specific study reported by Srivastava et al. confirm that the DH genotype and H allele of the ABCG8 D19H polymorphism are associated with a risk of gallstone susceptibility in a north Indian population. Login to comment

PMID: 21128988 [PubMed] Wei KK et al: "Interactions between CYP7A1 A-204C and ABCG8 C1199A polymorphisms on lipid lowering with atorvastatin."

No. Sentence Comment

27 Several previous studies have found that 5 nonsynonymous single-nucleotide polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) coding sequences may affect plasma plant sterol or cholesterol levels (16-19). Login to comment
23 More recently, the ABCG8 D19H polymorphism was found to be significantly associated with increased reduction in LDL-C level after atorvastatin treatment (14). Login to comment

PMID: 21157969 [PubMed] Dikkers A et al: "Biliary cholesterol secretion: more than a simple ABC."

No. Sentence Comment

127 With relevance to gallstone disease, recently specific mutations in ABCG5/G8, namely ABCG5 R50C and ABCG8 D19H, have been identified in humans and shown to increase the risk for cholesterol gallstone disease[81-83] . Login to comment

PMID: 21437027 [PubMed] Izar MC et al: "Phytosterols and phytosterolemia: gene-diet interactions."

No. Sentence Comment

127 Missense polymorphisms (Gln604Glu in the ABCG5, and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) were examined, and the Thr400Lys in the ABCG8 gene was associated with changes in lipid levels in response to reduced dietary animal fat and cholesterol intake. Login to comment
129 Missense polymorphisms (Gln604Glu in the ABCG5, and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) were examined, and the Thr400Lys in the ABCG8 gene was associated with changes in lipid levels in response to reduced dietary animal fat and cholesterol intake. Login to comment

PMID: 12446833 [PubMed] Sehayek E et al: "Loci on chromosomes 14 and 2, distinct from ABCG5/ABCG8, regulate plasma plant sterol levels in a C57BL/6J x CASA/Rk intercross."

No. Sentence Comment

159 ABCG8 D19H in 10% of the population had a 31% lower genotypic mean campesterol level, and ABCG8 T400K in 36% of the population had a 2% lower genotypic mean. Login to comment

PMID: 12671028 [PubMed] Kwiterovich PO Jr et al: "Response of obligate heterozygotes for phytosterolemia to a low-fat diet and to a plant sterol ester dietary challenge."

No. Sentence Comment

258 Berge et al. (50) have recently found that the plasma levels of campesterol and sitosterol are heritable, and that two common DNA sequence variations (D19H and T400K) in the ABCG8 gene are associated with lower concentrations of these plant sterols. Login to comment

PMID: 12897193 [PubMed] Sehayek E et al: "Genetic regulation of cholesterol absorption and plasma plant sterol levels: commonalities and differences."

No. Sentence Comment

109 Carriers of ABCG8 D19H in 10% of the population had a 31% lower genotypic mean in absolute campesterol level, and carriers of ABCG8 T400K in 36% of the population had a 2% lower genotypic mean. Login to comment
108 Carriers of ABCG8 D19H in 10% of the population had a 31% lower genotypic mean in absolute campesterol level, and carriers of ABCG8 T400K in 36% of the population had a 2% lower genotypic mean. Login to comment
107 Carriers of ABCG8 D19H in 10% of the population had a 31% lower genotypic mean in absolute campesterol level, and carriers of ABCG8 T400K in 36% of the population had a 2% lower genotypic mean. Login to comment

PMID: 15243210 [PubMed] Caslake MJ et al: "Phenotypes, genotypes and response to statin therapy."

No. Sentence Comment

7 Polymorphism in the promoter for the ABCG8 gene has been linked to variations in response to statins; individuals with the rarer D19H genotype exhibit a greater reduction in LDL-cholesterol. Login to comment
101 Carriers of the D19H variant in the ABCG8 gene exhibited greater percentage reductions in LDL-cholesterol on atorvastatin (39.7 versus 36.2%, P = 0.036) and lower achieved levels than those with the more common allele [44]. Login to comment

PMID: 15331430 [PubMed] Chan DC et al: "ATP-binding cassette transporter G8 gene as a determinant of apolipoprotein B-100 kinetics in overweight men."

No. Sentence Comment

10 No association was found with ABCG8 D19H. Login to comment
38 Plasma lathosterol, sitosterol, and campesterol concentrations were measured by gas-liquid chromatography and expressed in mmol/Lϫ102 per mol/L cholesterol.13,14 ABCG8 (T400K, D19H) and ApoE Genotyping ABCG8 (exon 1 D19H, exon 8 T400K) genotypes were determined by polymerase chain reaction amplification using as forward primer 5Ј AGG AAA CAG AGT GAA GAC ACT GG 3Ј and as reverse primer 5Ј AGA AAG GTT TGA TTT CTC CTA CCC 3Ј (T400K); and for D19H forward primer 5Ј ACA CCT GTG TGG AAA GGT AAG GT 3Ј and reverse primer 5Ј GCG GGT trichloroacetic acid GTA ATA AAA TGA CAG 3Ј as described by Hubacek et al.10 ApoE genotype was determined as described by Hixson and Vernier.15 Statistical Analysis All analyses were performed using SPSS 10.1 (SPSS). Login to comment
48 Allele frequencies of T400K were 0.86 (wild-type) and 0.14 (variant) and D19H were 0.92 (wild-type) and 0.08 (variant). Login to comment
49 Significant linkage disequilibrium was not found between T400K and D19H (DЈϭ0.44; Pϭ0.32). Login to comment
51 No significant influence of the ABCG8 D19H polymorphism on any lipid or anthropometric parameter was found. Login to comment
8 No association was found with ABCG8 D19H. Login to comment
35 Plasma lathosterol, sitosterol, and campesterol concentrations were measured by gas-liquid chromatography and expressed in mmol/Lϫ102 per mol/L cholesterol.13,14 ABCG8 (T400K, D19H) and ApoE Genotyping ABCG8 (exon 1 D19H, exon 8 T400K) genotypes were determined by polymerase chain reaction amplification using as forward primer 5Ј AGG AAA CAG AGT GAA GAC ACT GG 3Ј and as reverse primer 5Ј AGA AAG GTT TGA TTT CTC CTA CCC 3Ј (T400K); and for D19H forward primer 5Ј ACA CCT GTG TGG AAA GGT AAG GT 3Ј and reverse primer 5Ј GCG GGT trichloroacetic acid GTA ATA AAA TGA CAG 3Ј as described by Hubacek et al.10 ApoE genotype was determined as described by Hixson and Vernier.15 Statistical Analysis All analyses were performed using SPSS 10.1 (SPSS). Login to comment
45 Allele frequencies of T400K were 0.86 (wild-type) and 0.14 (variant) and D19H were 0.92 (wild-type) and 0.08 (variant). Login to comment
46 Significant linkage disequilibrium was not found between T400K and D19H (DЈϭ0.44; Pϭ0.32). Login to comment

PMID: 17058264 [PubMed] Tang W et al: "Plasma cholesterol is hyperresponsive to statin in ABCG5/ABCG8 transgenic mice."

No. Sentence Comment

20 (ABCG8) D19H variant is associated with greater LDL-cholesterol lowering response to atorvastatin therapy.15 ABCG8 heterodimerizes with ABCG5 to transport cholesterol from the hepatocytes into the bile and probably from enterocytes into intestinal lumen.16-18 Mutations in either ABCG5 or ABCG8 cause sitosterolemia,19,20 an autosomal recessive sterol disorder characterized by the increased plasma and tissue levels of sitosterol and campesterol, the two major plant sterols in diet, as a result of increased dietary absorption and impaired biliary secretion of these sterols.21-23 Mice lacking abcg5/abcg8 genes recapitulate the major phenotypes of human sitosterolemia.16 On the other hand, transgenic mice overexpressing human ABCG5/ABCG8 in the liver and small intestine (G5G8Tg mice) retain much less plant sterols in the body and have a compensatory upregulation of hepatic cholesterol synthesis rates due to increased biliary secretion and reduced intestinal absorption of cholesterol.17 In human subjects, carriers of the ABCG8 D19H variant have a significantly lower ratio of plasma cholestanol/cholesterol when compared to noncarriers,24 suggesting that D19H may be a "gain of function" variant of ABCG8 gene. Login to comment
129 Wild-type rodents are insensitive to statins, believed to be partly due to the feedback regulation of HMG-CoA reductase activity in the liver.27,28 We found in this study that lovastatin decreased plasma cholesterol in the G5G8Tg mice in spite of a much greater feedback upregulation of genes in the pathway of cholesterol synthesis, suggesting that the functional level of ABCG5/ABCG8 may also contribute to statin responsiveness, which is consistent with a clinical observation that ABCG8 D19H subjects are more responsive to atorvastatin therapy.15 Recent studies demonstrate that a SREBP-regulated gene, the proprotein convertase subtilisin/kexin type 9a (PCSK9), plays a critical role in modulating statin response in mice.37 Lovastatin administration to wild-type mice increases PCSK9 proteins in the liver through SREBP pathway, which in turn facilitates LDLR degradation.37 Disruption of PCSK9 in mice decreases plasma cholesterol and confers mice with statin hypersensitivity by raising LDLR levels.37 The molecular mechanism underlying statin hypersensitivity in G5G8Tg mice has yet to be elucidated. Login to comment

PMID: 17626266 [PubMed] Grunhage F et al: "Increased gallstone risk in humans conferred by common variant of hepatic ATP-binding cassette transporter for cholesterol."

No. Sentence Comment

5 In ASPs, gallstones were strongly linked to the D19H variant of the ABCG8 gene (NPL score ‫؍‬ 7.1; P ‫؍‬ 4.6 ؋ 10-13). Login to comment
7 Consistent with the mouse model, heterozygosity for the lithogenic ABCG8 allele was associated with gallstones in humans; 21.4% of gallstone patients carried the heterozygous D19H genotype, compared with 8.6% of controls (OR ‫؍‬ 2.954; P ‫؍‬ 0.026). Login to comment
86 The genetic linkage analysis of the ASPs revealed highly significant linkage between the presence of gallstones and carrying the D19H variant of the ABCG8 gene (NPL score ϭ 7.1). Login to comment
89 Therefore, we performed a sensitivity analysis for the D19H variant (Fig. 2, Tables 4 and 5). Login to comment
93 Finally, with 23% of cases phenotyped by ultrasound (Table 2), we determined linkage with ABCG8 D19H exclusively in cases confirmed by cholecystectomy (symptomatic patients), obtaining a single-point NPL score of 4.3 (P ϭ 1.78 ϫ 10-8). Login to comment
94 In contrast to ABCG8 D19H, no significant single-point linkage was detected for the other ABCG5/G8 SNPs (p.E604Q, p.Y54C, p.T400K, p.A632V). Login to comment
95 Genetic Association Study Confirmed Lithogenic Effects of ABCG8 Variant D19H. Login to comment
96 To obtain additional evidence that ABCG8 D19H represents a lithogenic risk factor, we performed an association (case-control) study. Login to comment
100 Sensitivity analysis of the ABCG8 D19H variant. Login to comment
105 Table 6 demonstrates that the ABCG8 D19H variant was significantly associated with the presence of gallstones in cases: the 19H (c.55C) allele was significantly more common in cases than in controls (OR ϭ 3.018; P ϭ 0.017; Table 6). Login to comment
107 Consistent with the mouse model,16 heterozygosity for the lithogenic ABCG8 allele is associated with gallstones in humans: 21.4% (18 of 84) of all gallstone patients carried the heterozygous D19H genotype, as compared with 8.6% (6 of 70) of the controls (OR ϭ 2.954; P ϭ 0.026). Login to comment
109 Because controls were significantly younger (P ϭ 0.024) and leaner (P Ͻ 0.001) than the affected patients, we analyzed the effects of the known lithogenic risk factors age, sex, and BMI as well as the D19H variant separately by logistic regression analysis in cases and controls. Login to comment
110 In univariate analysis, only age (OR ϭ 1.033; P ϭ 0.026; 95% CI 1.004-1.063), BMI (OR ϭ 1.244; P Ͻ 0.001; 95% CI 1.113-1.366), and D19H (OR ϭ 3.167; P ϭ 0.021; 95% CI 1.188-8.438) are significant risk factors for gallstones. Login to comment
111 We included these 3 risk factors as covariates in multiple logistic regression analysis and observed a significant effect for BMI (Exp[B] ϭ 1.244; P Ͻ 0.001; 95% CI 1.133-1.366), a trend for D19H (Exp[B] ϭ 2.651; P ϭ 0.063), and no effect for age. Login to comment
114 The PAF of ABCG8 D19H is 0.08, that is, the D19H variant contributed 8% to the total gallstone risk. Login to comment
115 This PAF is exactly in the range expected for polygenic traits such as gallstones, which are the result of the interaction between multiple genes and environmental factors.8 Discussion This combined linkage and association study provides strong evidence that the D19H variant in the first exon of Table 4. Login to comment
116 Sensitivity Analysis with GENEHUNTER-MODSCORE (GHM)- NPL Score for ABCG8 Variant D19H (Single-Point Analysis) Frequency of 19H (c.55C) allele Origin of data NPL score P 0.001 9.46451 1.10 ϫ 10-22 0.01 9.22681 1.35 ϫ 10-21 0.05 8.25925 1.86 ϫ 10-17 0.08 Entrez SNP database 7.51923 1.25 ϫ 10-14 0.10 7.20748 1.55 ϫ 10-13 0.11 84 ASP families 7.06879 4.60 ϫ 10-13 0.15 6.28671 1.23 ϫ 10-10 0.20 5.46859 2.03 ϫ 10-8 0.25 4.73440 1.03 ϫ 10-6 0.30 4.07076 0.000023 0.40 2.91714 0.001767 0.50 1.95043 0.025658 0.75 0.13854 0.442483 0.90 -0.61822 0.729508 0.95 -0.81959 0.792454 0.99 -0.96153 0.830702 0.999 -0.99102 0.840238 Table 5. Login to comment
117 Sensitivity Analysis with GENEHUNTER-MODSCORE (GHM)- NPL Score for ABCG8 Variant D19H (Multipoint Analysis) Frequency of 19H (c.55C) allele Origin of data NPL score P 0.001 8.66913 4.23 ϫ 10-19 0.01 6.76402 4.19 ϫ 10-12 0.05 4.85695 5.68 ϫ 10-7 0.08 Entrez SNP database 4.16629 0.000015 0.10 3.93152 0.000042 0.11 84 ASP families 3.83382 0.000063 0.15 .33767 0.000425 0.20 .88350 0.001975 0.25 2.50882 0.006153 0.30 2.18649 0.014481 0.40 1.64580 0.050166 0.50 1.19845 0.115047 0.75 0.33078 0.370026 0.90 -0.06949 0.527678 0.95 -0.18622 0.573232 0.99 -0.27374 0.605938 0.999 -0.29271 0.614403 Table 6. Login to comment
118 Distributions of Alleles and Genotypes for ABCG8 D19H in Cases with Gallstones and Stone-Free Controls and Tests for Association ABCG8 D19H (c.55G>C) allele/genotype Count (frequency) of alleles/genotypes Cases (2N ‫؍‬ 168) Controls (2N ‫؍‬ 140) G 148 (0.88) 134 (0.91) C 20 (0.12) 6 (0.09) GG 65 (0.77) 64 (0.91) GC 18 (0.21) 6 (0.09) CC 1 (0.01) 0 (0.00) Test for association ␹2 P Allele frequency difference test 5.735 0.017 Armitage`s trend test 5.783 0.016 OR statistics OR 95% CI [C] 7 [G] 3.018 1.177-7.740 [CC ϩ CG] 7 [GG] 3.118 1.170-8.313 [CG] 7 [GG] 2.954 1.102-7.920 ␹2 Statistics, P values, odds ratios (OR), and confidence intervals (CI) were determined using contingency table statistics. Login to comment
126 In fact, the significant linkage results for the ABCG8 D19H variant in symptomatic cases only (as defined by history of cholecystectomy) suggest that the variant is linked to the presence of both gallstones and gallbladder disease. Login to comment
130 To assess whether the association results for the D19H variant were affected by confounding risk factors for gallstones, we performed multivariate analysis that included the D19H variant and lithogenic risk factors. Login to comment
135 The association between serum plant sterol concentration and this nonconservative substitution suggests that the change from aspartic acid to the polar histidine at amino acid 19 alters ABCG5/G8 function.22 Because serum plant sterol levels are lower in 19H carriers, the predicted change would be expected to increase transporter expression or function, although effects on ABCG5/G8 function can only be determined after reconstitution in in vitro sterol transfer assays.44 Our previous study of siblings with gallstones25 and other reports23 have also observed significantly lower serum levels of total and LDL cholesterol in 19H carriers, indicating that D19H represents a gain-of-function variant that increases ABCG5/G8-mediated removal of plant sterols and cholesterol into bile and intestine. Login to comment
136 Hypersecretion of cholesterol from liver with cholesterol supersaturation of bile represents the common defect in patients with cholesterol gallstones.4,18,45 Furthermore, the 19H allele has also been associated with higher serum levels of cholesterol precursors (cholestanol, lathosterol),23 indicating increased cholesterol biosynthesis, as has been observed in obese gallstone patients.46,47 These findings taken together suggest low intestinal cholesterol absorption and high compensatory cholesterol biosynthesis in carriers of the ABCG8 D19H variant, as hypothesized previously by Gylling et al.23 Of note, the up-regulated cholesterol biosynthesis in these subjects explains the greater efficacy of HMG-CoA reductase inhibitors such as atorvastatin therapy in 19H carriers.28 In fact, statins are reported to decrease the cholesterol saturation index of duodenal bile and to dissolve gallstones in some patients48 but not in gallstone patients in general.49 We have proposed50 that the identification of common gallstone genes (LITH or GBD) should be based on complementary evidence from (1) genetic studies in mice and/or humans, (2) phenotypic characterization of genetically defined animal models (for example, knockout or transgenic mice), and (3) epidemiological studies defining the overall clinical relevance. Login to comment
138 Given the estimated PAF for the ABCG8 D19H variant of 8% and the estimation that genetic determinants account for 25% to 29% of the phenotypic variation in gallstone disease,10,11 approximately 30% of the genetic effects might be a result of this specific risk variant. Login to comment
52 Forgenotyping,weselectedfunctionallyrelevantnonsyn- onymous coding single-nucleotide polymorphisms (SNPs) of the ABCG5/G8 genes (Fig. 1): ABCG5 rs6720173 ϭ c.1810GϾC(p.E604Q);ABCG8rs11887534ϭc.55GϾC (p.D19H), rs4148211 ϭ c.161AϾG (p.Y54C), rs4148217 ϭ c.1199CϾA (p.T400K), and rs6544718 ϭ c.1895CϾT (p.A632V).22,23,25,28,29 All SNPs were genotyped using solution-phase hybridization reactions with 5Ј-nuclease and fluorescence detection (TaqMan assays) in a 7300 Real-Time polymerase chain reaction (PCR) system (Applera, Norwalk, CT). Login to comment

PMID: 17632509 [PubMed] Buch S et al: "A genome-wide association scan identifies the hepatic cholesterol transporter ABCG8 as a susceptibility factor for human gallstone disease."

No. Sentence Comment

2 A follow-up study of the 235 most significant SNPs in 1,105 affected individuals and 873 controls replicated the disease association of SNP A-1791411 in ABCG8 (allelic P value PCCA ¼ 4.1 Â 10-9), which was subsequently attributed to coding variant rs11887534 (D19H). Login to comment
4 The overall odds ratio for D19H carriership was 2.2 (95% confidence interval: 1.8-2.6, P ¼ 1.4 Â 10-14) in the full German sample. Login to comment
50 Using P o 0.01 in both the allelic and the genotypic test as a criterion for statistical significance, only the SNP responsible for D19H in the ABCG8 gene was significantly associated with gallstone disease (PCCA ¼ 8.8 Â 10-10, PCCG ¼ 3.0 Â 10-9 in panel B). Login to comment
51 We confirmed SNPlex genotyping of the SNP responsible for D19H using a TaqMan assay (100% genotype concordance in panel B). Login to comment
52 In a logistic regression analysis of panel B, no other SNP significantly improved the statistical model in the presence of D19H (P 4 0.05). Login to comment
54 We used an additional panel (C) of independent cases and controls partly overlapping with panel B (Table 1) for the fine mapping and replication of the D19H association. Login to comment
55 The strength and localization of the association signal, as well as the haplotype assignment of D19H, were replicated in a panel of 728 independent German affected individuals (panel C, Table 1, PCCA ¼ 2.8 Â 10-7, PCCG ¼ 9.2 Â 10-7) and in 167 affected individuals and 167 controls from Chile (panel D, Table 1, PCCA ¼ 0.02). Login to comment
63 Furthermore, none of the interaction terms was significant in the presence of D19H. Login to comment
81 This lack of concordance may be due to population differences or may reflect the lower power of nonparametric linkage analysis for a relatively infrequent genetic risk variant like D19H. Login to comment
88 The D19H variant is marked by an arrow. Login to comment
96 Although the genetic gallstone disease risk is clearly attributable to variant D19H in the ABCG8 gene in our study, we cannot exclude the possibility that other as-yet-unidentified variants at the ABCG5/ ABCG8 locus might also contribute to gallstone susceptibility. Login to comment
101 However, additional functional studies are needed to determine the effect of the D19H variant on the ABCG8/ABCG5 heterodimer. Login to comment
148 Table 3 Haplotype analysis of seven SNPs at the ABCG8 locus in panels B and C Fine mapping, panel B Fine mapping, panel C Haplotype fcases fcontrols ORcase-control PCOCAPHASE fcases fcontrols ORcase-control PCOCAPHASE C-G-A-T-G-T-C 0.340 0.382 0.8 0.01 0.349 0.392 0.8 0.02 T-G-G-T-G-T-G 0.342 0.325 1.1 0.24 0.340 0.325 1.1 0.38 C-G-G-T-G-T-G 0.066 0.071 0.9 0.53 0.077 0.069 1.1 0.42 C-G-A-T-G-T-G 0.067 0.068 1.0 0.89 0.060 0.068 0.9 0.33 C-C-A-C-A-T-C 0.097 0.045 2.3 7.75 Â 10-7 0.080 0.038 2.2 8.76 Â 10-7 C-G-A-T-G-A-C 0.023 0.043 0.5 5.73 Â 10-4 0.028 0.042 0.7 0.03 T-G-A-T-G-A-C 0.025 0.033 0.8 0.12 0.020 0.033 0.6 0.03 T-G-A-T-G-A-C 0.028 0.024 1.2 0.53 0.036 0.028 1.3 0.305 SNPs included in the haplotype analysis (rs4148187, rs11887534 (D19H), rs4148211 (Y54C), SNP_A-1791411, rs4953023, rs17424122 and rs17409589) are marked by an asterisk in Figure 1. Login to comment
150 Nonsynonymous SNP rs11887534 (D19H) is in boldface, and the risk allele is underlined. Login to comment

PMID: 18408466 [PubMed] Hoblinger A et al: "Genetics of biliary tract diseases: new insights into gallstone disease and biliary tract cancers."

No. Sentence Comment

20 Recently the first genome-wide association study in a large cohort of gallstone patients from Germany [18 ] and a linkage study in affected sib pairs [19 ] identified a common variant (D19H) of the hepatocanalicular cholesterol transporter ABCG5/G8 as a genetic risk factor for gallstones. Login to comment
24 The ABCG8 D19H variant confers an odds ratios (OR) of 2-3 and 7 for heterozygous and homozygous carriers, respectively, and 8-11% of the total gallstone risk can be attributed to this variant [18 ,19 ]. Login to comment
26 Since only 10% of the total gallstone risk is due to the ABCG8 D19H variant, other genetic factors are yet to be discovered. Login to comment

PMID: 19018975 [PubMed] Srivastava A et al: "Single nucleotide polymorphism in the ABCG8 transporter gene is associated with gallbladder cancer susceptibility."

No. Sentence Comment

4 A common genetic polymorphism D19H of ABCG8 associated with gallstone disease may be causatively related to the genetic predisposition of GBC. Login to comment
5 Aim: We aimed to examine the role of ABCG8 D19H (rs11887534) polymorphism in susceptibility to GBC. Login to comment
7 Genotyping for the ABCG8 D19H polymorphism was performed by the polymerase chain reaction-restriction fragment length polymorphism method. Login to comment
12 Conclusion: The results suggest that the DH genotype and the H allele of the ABCG8 D19H polymorphism are associated with GBC susceptibility. Login to comment
34 Buch et al. (19) identified a single nucleotide polymorphism (rs11887534) in the ABCG8 gene, conferring G 4 C transversion corresponding to asp19-to-his (D19H) substitution, which was significantly associated with gallstone disease. Login to comment
35 Considering the importance of the ABCG8 transporter in maintaining the cholesterol homeostasis and association of the D19H genetic variant with gallstone disease, we aimed to explore the role of the ABCG8 D19H polymorphism in susceptibility to GBC that arises against the background of gallstone disease. Login to comment
48 The ABCG8 D19H polymorphic site containing fragment was amplified by PCR. Login to comment
52 Thus, the BamHI restriction enzyme (New England Biolabs Inc., Beverly, MA, USA) was used to genotype the ABCG8 D19H polymorphism. Login to comment
55 Figure 1 shows the representative gel picture showing all the genotypes of the ABCG8 D19H polymorphism. Login to comment
65 Representative gel picture showing various genotypes of the ABCG8 D19H polymorphism. Login to comment
75 ABCG8 D19H polymorphism in the control group In our population, the observed genotype distribution of ABCG8 D19H polymorphism in healthy controls was consistent with Hardy-Weinberg equilibrium. Login to comment
77 ABCG8 D19H polymorphism in gallbladder cancer patients On comparing the genotype frequency distribution in GBC patients with that of healthy controls, the frequency of the heterozygous DH genotype was considerably higher (35.1%) in GBC patients than that in controls (22.6%). Login to comment
86 The frequency distribution of the ABCG8 D19H genotype in GBC patients with stones was 36.4%, while it was 22.6% in healthy controls. This difference was statistically significant (P = 0.027) and was conferring a risk (OR = 1.8; 95% CI = 1.0-3.1) for GBC patients who had a history of gallstone disease. Login to comment
94 Genotype and allele frequencies for the ABCG8 D19H (rs11887534) polymorphism in gallbladder cancer patients and healthy subjects Genotype/ allele GBC (171) HC (221) P-value OR (95% CI)n (%) n (%) DD 110 (64.3) 170 (76.9) - 1 (reference) DH 60 (35.1) 50 (22.6) 0.011 1.79 (1.1-2.8) HH 1 (0.6) 1 (0.5) 0.728 1.63 (0.1-26.5) D 281 (82.2) 391 (88.5) - 1 (reference) H 61 (17.8) 51 (11.5) 0.023 1.60 (1.2-2.4) Significant values are represented in bold. CI, confidence interval; GBC, gallbladder cancer; HC, healthy control; OR, odds ratio. Login to comment
111 We explored the role of the ABCG8 D19H polymorphism in GBC susceptibility and observed a significant association with the DH genotype and the H allele. Login to comment
114 Genotype and allele frequencies for the ABCG8 D19H (rs11887534) polymorphism after stratification of gallbladder cancer patients on the basis of presence and absence of gallstone Genotype/ allele GBC with stone vs healthy control GBC without stone vs healthy control GBC (88) HC (221) P-value OR (95% CI) GBC (83) HC (221) P-value OR (95% CI)n (%) n (%) n (%) n (%) DD 55 (62.5) 170 (76.9) - 1 (reference) 55 (66.3) 170 (76.9) - 1 (reference) DH 32 (36.4) 50 (22.6) 0.027 1.85 (1.3-3.1) 28 (33.7) 50 (22.6) 0.065 1.69 (0.9-2.9) HH 1 (1.1) 1 (0.5) 0.374 3.55 (0.2-8.1) 0 1 (0.5) - - D 143 (81.3) 391 (88.5) - 1 (reference) 138 (83.1) 391 (88.5) - 1 (reference) H 33 (18.7) 51 (11.5) 0.043 1.64 (1.2-2.6) 28 (16.9) 51 (11.5) 0.105 1.51 (0.9-2.5) Significant values are represented in bold. CI, confidence interval; GBC, gallbladder cancer; HC, healthy control; OR, odds ratio. Login to comment
116 The frequency distribution of genotype and allele of ABCG8 D19H (rs11887534) polymorphism in gallbladder cancer patients and healthy controls after sex stratification Genotype/ allele Male Female GBC (66) HC (94) P-value OR (95% CI) GBC (105) HC (127) P-value OR (95% CI)n (%) n (%) n (%) n (%) DD 43 (65.2) 72 (76.6) - 1 (reference) 67 (63.8) 98 (77.2) - 1 (reference) DH 23 (34.8) 21 (22.3) 0.086 1.85 (0.9-3.7) 37 (35.2) 29 (22.8) 0.071 1.71 (0.9-3.0) HH 0 (0.0) 1 (1.1) - - 1 (1.0) 0 (0) - - D 110 (83.3) 166 (88.3) - 1 (reference) 171 (81.4) 225 (88.6) - 1 (reference) H 22 (16.7) 22 (11.7) 0.192 1.53 (0.8-2.9) 39 (18.6) 29 (11.4) 0.057 1.67 (0.9-2.8) CI, confidence interval; GBC, gallbladder cancer; HC, healthy control; OR, odds ratio. Login to comment
118 The variant H allele of the ABCG8 D19H polymorphism is suggested to increase the expression or the function of the ABCG8 transporter, resulting in a positive correlation with high biliary cholesterol secretion and accumulation in the gallbladder, which serves as an initial step in gallstone formation (18, 22, 26). Login to comment
140 Individuals facing imbalance in cholesterol transport in the early stage because of the presence of this ABCG8 D19H polymorphism are more susceptible to GBC, which may lead to rapid manifestation of the disease. Login to comment
146 The frequency distribution of genotype and allele of ABCG8 D19H (rs11887534) polymorphism in gallbladder cancer patients and healthy control on the basis of age of onset of disease Genotype/ allele Early onset (subjects below 50 years) Late onset (subjects above 50 years) GBC (55) HC (73) P-value OR (95% CI) GBC (116) HC (148) P-value OR (95% CI)n (%) n (%) n (%) n (%) DD 33 (60.0) 59 (80.8) 1 (reference) 77 (66.4) 111 (75.0) 1 (reference) DH 21 (38.2) 14 (19.2) 0.016 2.60 (1.1-5.8) 39 (33.6) 36 (24.3) 0.124 1.52 (0.8-2.6) HH 1 (1.8) 0 (0) - - 0 (0) 1 (0.7) - - D 88 (80.0) 133 (91.1) 1 (reference) 193 (83.2) 258 (87.2) - 1 (reference) H 22 (20.0) 13 (8.9) 0.013 2.55 (1.2-5.3) 39 (16.8) 38 (12.8) 0.221 1.35 (0.8-2.2) Significant values are represented in bold. CI, confidence interval; GBC, gallbladder cancer; HC, healthy control; OR, odds ratio. Login to comment

PMID: 19060906 [PubMed] Kathiresan S et al: "Common variants at 30 loci contribute to polygenic dyslipidemia."

No. Sentence Comment

85 For example, we found the previously studied ABCG8 D19H variant to be associated with LDL cholesterol (rs11887534, P ¼ 1 Â 10À11) and found an even stronger common variant signal, a SNP in intron 2 of ABCG8 (rs6544713, 0.15 s.d. unit change per copy, P ¼ 2 Â 10À29; r2 ¼ 0.02 with ABCG8 D19H). Login to comment
86 Both D19H and a proxy for ABCG8 rs6544713 (rs4299376, r2 ¼ 1) were recently shown to affect risk for cholesterol gallstone disease30; for both the coding and intronic variants, the allele corresponding to lower plasma LDL cholesterol in the present study has been associated with higher risk of gallstones. Login to comment

PMID: 19306529 [PubMed] Sabeva NS et al: "The ABCG5 ABCG8 sterol transporter and phytosterols: implications for cardiometabolic disease."

No. Sentence Comment

100 The D19H polymorphism has been positively associated with the risk of cholesterol gallstones in three independent studies using multiple ethnicities [24-26]. Login to comment
122 A recent report in a heterozygous familial hypercholesterolemia cohort indicates that the D19H polymorphism in the ABCG8 gene is associated with increased risk of coronary heart disease [43]. Login to comment
123 In this same cohort, the presence of both D19H and T400K increased risk of coronary heart disease and cardiovascular disease . Login to comment

PMID: 20529992 [PubMed] Teupser D et al: "Genetic regulation of serum phytosterol levels and risk of coronary artery disease."

No. Sentence Comment

55 These included SNP rs4245791, which had initially violated quality criteria (call rate and Hardy-Weinberg equilibrium) on the 500K Array Set due to misgenotyping, and the 2 coding SNPs rs11887534 (D19H) and rs4148217 (T400K) not present on the 500K Array Set with known associations with serum phytosterol levels.9 SNPs were genotyped using the Sequenom assay. Login to comment
79 334 Circ Cardiovasc Genet August 2010 online-only Data Supplement Table VIII) revealed that rs41360247 was in close linkage disequilibrium (r2 ϭ0.93) with coding SNP rs11887534 (D19H), which has been associated with phytosterol levels in previous studies and is known to affect protein structure.9 In addition, SNP rs4952688 was identified by fine mapping as a proxy for rs4245791 (r2 ϭ0.89) with the lowest P values of association of all SNPs used for fine mapping. Login to comment
80 Haplotype analyses of the ABCG8 locus indicated that the effects of rs11887534 (D19H) and rs4952688 on phytosterol level SNPs were additive (online-only Data Supplement Figure II and online-only Data Supplement Tables IX and X). Login to comment
82 To test this hypothesis, we determined mRNA levels of these genes in 57 patient samples of normal human liver tissue and observed significantly reduced mRNA expression levels of these 2 genes in association with the T allele of rs4952688 (Figure 3) but not with rs41360247 or rs11887534 (D19H). Login to comment
92 SNP rs41360247 was in strong linkage disequilibrium with rs11887534 (D19H) (r2 ϭ0.93). Login to comment
113 ABCG8 is a plausible candidate for affecting the inherited variability of serum phytosterol levels, given that the gene encodes the ABC hemitransporter that carries phytosterols into the bile.1,2,5 Indeed, smaller studies previously reported an association between the coding variant D19H in this gene and serum phytosterols,9 a finding that was confirmed by our data. Login to comment
114 D19H also was found to affect the susceptibility for cholesterol gallstone disease.24 It was speculated that the 19H variant may increase the efficiency of sterol excretion into the bile lumen, causing hypersaturation of the bile and subsequently leading to gallstone formation.25 Indeed, there are published data about an association between the D19H variant and serum cholesterol levels.26,27 Moreover, recent genome-wide studies identified an association of LDL cholesterol with proxies to D19H and the other ABCG8 variant rs4245791.22,23 This effect could be confirmed in the present study (online-only Data Supplement Figure VI), albeit the association of D19H (and the other variants we identified) with serum cholesterol levels was only weak, and effects on phytosterols remained highly significant after normalization to cholesterol (Table) or adjustment to LDL cholesterol (online-only Data Supplement Table XVII). Login to comment
49 These included SNP rs4245791, which had initially violated quality criteria (call rate and Hardy-Weinberg equilibrium) on the 500K Array Set due to misgenotyping, and the 2 coding SNPs rs11887534 (D19H) and rs4148217 (T400K) not present on the 500K Array Set with known associations with serum phytosterol levels.9 SNPs were genotyped using the Sequenom assay. Login to comment
75 online-only Data Supplement Table VIII) revealed that rs41360247 was in close linkage disequilibrium (r2 ϭ0.93) with coding SNP rs11887534 (D19H), which has been associated with phytosterol levels in previous studies and is known to affect protein structure.9 In addition, SNP rs4952688 was identified by fine mapping as a proxy for rs4245791 (r2 ϭ0.89) with the lowest P values of association of all SNPs used for fine mapping. Login to comment
76 Haplotype analyses of the ABCG8 locus indicated that the effects of rs11887534 (D19H) and rs4952688 on phytosterol level SNPs were additive (online-only Data Supplement Figure II and online-only Data Supplement Tables IX and X). Login to comment
78 To test this hypothesis, we determined mRNA levels of these genes in 57 patient samples of normal human liver tissue and observed significantly reduced mRNA expression levels of these 2 genes in association with the T allele of rs4952688 (Figure 3) but not with rs41360247 or rs11887534 (D19H). Login to comment
88 SNP rs41360247 was in strong linkage disequilibrium with rs11887534 (D19H) (r2 ϭ0.93). Login to comment
108 ABCG8 is a plausible candidate for affecting the inherited variability of serum phytosterol levels, given that the gene encodes the ABC hemitransporter that carries phytosterols into the bile.1,2,5 Indeed, smaller studies previously reported an association between the coding variant D19H in this gene and serum phytosterols,9 a finding that was confirmed by our data. Login to comment
109 D19H also was found to affect the susceptibility for cholesterol gallstone disease.24 It was speculated that the 19H variant may increase the efficiency of sterol excretion into the bile lumen, causing hypersaturation of the bile and subsequently leading to gallstone formation.25 Indeed, there are published data about an association between the D19H variant and serum cholesterol levels.26,27 Moreover, recent genome-wide studies identified an association of LDL cholesterol with proxies to D19H and the other ABCG8 variant rs4245791.22,23 This effect could be confirmed in the present study (online-only Data Supplement Figure VI), albeit the association of D19H (and the other variants we identified) with serum cholesterol levels was only weak, and effects on phytosterols remained highly significant after normalization to cholesterol (Table) or adjustment to LDL cholesterol (online-only Data Supplement Table XVII). Login to comment
48 These included SNP rs4245791, which had initially violated quality criteria (call rate and Hardy-Weinberg equilibrium) on the 500K Array Set due to misgenotyping, and the 2 coding SNPs rs11887534 (D19H) and rs4148217 (T400K) not present on the 500K Array Set with known associations with serum phytosterol levels.9 SNPs were genotyped using the Sequenom assay. Login to comment
77 Haplotype analyses of the ABCG8 locus indicated that the effects of rs11887534 (D19H) and rs4952688 on phytosterol level SNPs were additive (online-only Data Supplement Figure II and online-only Data Supplement Tables IX and X). Login to comment
89 SNP rs41360247 was in strong linkage disequilibrium with rs11887534 (D19H) (r2 afd;0.93). Login to comment
110 ABCG8 is a plausible candidate for affecting the inherited variability of serum phytosterol levels, given that the gene encodes the ABC hemitransporter that carries phytosterols into the bile.1,2,5 Indeed, smaller studies previously reported an association between the coding variant D19H in this gene and serum phytosterols,9 a finding that was confirmed by our data. Login to comment
111 D19H also was found to affect the susceptibility for cholesterol gallstone disease.24 It was speculated that the 19H variant may increase the efficiency of sterol excretion into the bile lumen, causing hypersaturation of the bile and subsequently leading to gallstone formation.25 Indeed, there are published data about an association between the D19H variant and serum cholesterol levels.26,27 Moreover, recent genome-wide studies identified an association of LDL cholesterol with proxies to D19H and the other ABCG8 variant rs4245791.22,23 This effect could be confirmed in the present study (online-only Data Supplement Figure VI), albeit the association of D19H (and the other variants we identified) with serum cholesterol levels was only weak, and effects on phytosterols remained highly significant after normalization to cholesterol (Table) or adjustment to LDL cholesterol (online-only Data Supplement Table XVII). Login to comment

PMID: 20594224 [PubMed] Siddapuram SP et al: "Hepatic cholesterol transporter ABCG8 polymorphisms in gallstone disease in an Indian population."

No. Sentence Comment

3 Studies have identified single nucleotide polymorphisms (SNP) D19H and T400K in the cholesterol transporter gene ATP-binding cassette, subfamily G, member 8 (ABCG8) in patients with cholesterol gallstones. Login to comment
4 The aim of this study was to analyze the relationship between D19H and T400K polymorphisms in the ABCG8 gene and GSD in an Indian population, and the effects of these polymorphisms on cholesterol levels in sera and bile. Login to comment
7 The genotype of SNP D19H and T400K of ABCG8 was analyzed in 226 patients and 222 control samples. Login to comment
8 SNP D19H was analyzed by direct sequencing, and SNP T400K genotyping was assayed by the amplification refractory mutation system-polymerase chain reaction. Login to comment
9 Results: There was no significant difference in the allelic distribution of SNP T400K between the GSD and gallstone-free groups (P > 0.05), but the distribution of the SNP variant, D19H, was significantly higher (P = 0.017, odds ratio = 2.274) in patients compared to controls. Login to comment
11 Conclusion: SNP D19H, but not SNP T400K, in the ABCG8 gene is significantly associated with GSD in an Indian population. Login to comment
18 Principally, gallstones are composed of cholesterol monohydrate crystals.14 Previous studies have found that the single nucleotide polymorphism (SNP) D19H of ABCG8 was stronger in patients with cholesterol gallstones (odds ratio =3.3), suggesting that H19 might be associated with more efficient transport of cholesterol into the bile; SNP T400K is found in Chinese males.15,16 The present study was undertaken to investigate, for the first time, the relationship between these two polymorphisms and GSD within an Indian population and to analyze their association with cholesterol in sera and bile. Login to comment
38 ABCG8 D19H analysis The SNP D19H of ABCG8 was analyzed by direct sequencing, as the tetra-primerARMS-PCR assay did not give satisfactory results for this region. Login to comment
40 The primers (Table 1) amplified the 306-bp DNA fragment encompassing D19H of ABCG8. Login to comment
42 The PCR reaction mixture and PCR conditions described for T400K were similar to SNP D19H, with the exception of the annealing temperature, which was 68°C. Login to comment
45 Low-density lipoprotein (LDL) cholesterol was Table 1 Polymerase chain reaction primer details of single nucleotide polymorphisms D19H and T400K of the ABCG8 gene Polymorphisms Primer sequence Annealing temperature Amplicon size D19H Forward primer: 68°C 306 bp 5'-ACTCGCAGCCCTGTTTCTAG 3' Reverse primer: 5'-GATGGGCTTTCACCTTGTTG 3' T400K Forward inner primer (A allele): 5'-ATGCCTGGGGCGGTGCAGCAGTTCAA3' Reverse inner primer (C allele): 5'-AAATGACAGATAATTACCGGATCAGCGCCG3' Forward outer primer (5'-3'): 5'-ACATCCCCTGCTTGCAGTGGACCTGACC3' Reverse outer primer (5'-3'): 5'-AGATGGGCTTTCACCTTGTTGCCCAGGC3' 65°C 287 bp (A allele) 365 bp (C allele) 596 bp (from two outer primers) Genetic basis of gallstone disease in India SP Siddapuram et al. 1094 Journal of Gastroenterology and Hepatology 25 (2010) 1093-1098 calculated using the Friedewald formula: T/5 = very low density lipoprotein (VLDL) TC-(HDL + VLDL). Login to comment
59 Figure 2 Chromatogram showing the sequence of single nucleotide polymorphism D19H (c.55G>C) of ABCG8. Login to comment
69 Distribution of SNP T400K and D19H between the GSD and GSF groups In the present study, 226 patients and 222 controls were analyzed for two SNP: T400K and D19H of the ABCG8 gene. Login to comment
71 No significant difference was observed in the distribution of genotypic frequency of SNP T400K when compared to the GSD and GSF groups (P = 0.520), whereas the distribution of SNP D19H showed a significant difference between the patient and control groups (P = 0.046). Login to comment
74 No significant difference was noted in any allele distribution of SNP T400K between the GSD and GSF groups, but the distribution of the heterozygous variant allele of SNP D19H was significantly higher (P = 0.048, OR = 2.219, CI: 1.054-4.672) in the GSD patients compared to the GSF individuals (Table 4). Login to comment
75 Further, the mutant allelic (heterozygous + mutant homozygous) distribution of D19H was also assessed between the two groups, where the mutant alleles were statistically significant (P = 0.017, OR = 2.274, CI: 1.171-4.416) in the GSD cohort compared to the GSF group. Login to comment
76 Thus, in the present study, allelic distribution infers that the T400K genotype might not be associated with gallstone formation in our cohort, whereas SNP D19H was shown to be associated with the disease. Login to comment
78 A strong association between elevated bile cholesterol and SNP D19H (P < 0.001) was observed in the analysis, where the mean bile cholesterol for SNP T400K (heterozygous + homozygous variants) was 155.13 mg/dL, and that of SNP D19H (heterozygous + homozygous variants) was 385.37 mg/dL Table 2 Demography and plasma lipid profile of gallstone disease and gallstone-free individuals Parameter Patient group Control group P-value Mean SD Mean SD Age (years) 45.88 14.840 39.92 11.864 0.063 BMI (kg/m2 ) 26.430 10.830 24.727 5.003 0.018 Plasma CH CH (mg/dL) 182.623 55.996 224.979 0.352 0.0001 HDL-C (mg/dL) 32.168 9.130 39.081 9.771 0.0001 LDL-C (mg/dL) 120.305 43.311 138.896 39.712 0.0001 TG (mg/dL) 149.672 83.945 147.207 89.148 0.324 BMI, body mass index; CH, cholesterol; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; SD, standard deviation; TG, triglycerides. Login to comment
79 Table 3 Frequency of genotype distribution of single nucleotide polymorphisms T400K and D19H between gallstone disease and gallstone-free individuals Single nucleotide polymorphisms of ABCG8 Wild type Heterozygous Homozygous P-value T400K (patients/controls) 69.47%/67.56% 29.20%/31.98% 1.32%/0.45% 0.520 D19H (patients/controls) 86.72%/93.69% 10.17%/4.95% 3.09%/1.35% 0.046 Table 4 Statistical analysis of single nucleotide polymorphisms T400K and D19H of ABCG8 between the gallstone disease and gallstone-free groups for possible alleles Allele P-value c2 -test Odds ratio 95% confidence interval T400K TT vs TK 0.608 0.33 0.888 0.594-1.329 TT vs. Login to comment
80 TK + KK 0.685 0.18 0.916 0.614-1.364 D19H DD vs DH† 0.048 4.5 2.219 1.054-4.672 DD vs DH + HH‡ 0.017 6.1 2.274 1.171-4.416 Statistically-significant genotypes between the †gallstone disease and ‡gallstone-free groups. Login to comment
84 Discussion Genotyping The aim of present study was to determine whether SNP T400K and D19H of the ABCG8 gene were associated with GSD. Login to comment
85 Our results indicated that, of these common polymorphisms in the ABCG8 gene, D19H could be associated with GSD in an Indian population. Login to comment
87 A previous study mapped a susceptibility locus for gallstone formation to the murine ortholog of the ABCG5/ABCG8 genes, using a quantitative trait locus analysis in experimental crosses of inbred mouse strains.20 A recent linkage study of 715 individuals from 39 Mexican-American families with gallstone disease provided suggestive evidence of linkage to gallbladder disease on chromosome 2p21, the site of the ABCG5/ABCG8 genes.21 A genetic association study demonstrated that the ABCG8 D19H variant was significantly associated with the presence of gallstones in cases; the 19H (c.55C) allele was significantly more common in cases than in controls (OR = 3.018, P = 0.017).15 Carriers of the 19H allele, whether homozygous or heterozygous, were significantly overrepresented in the cases compared with the controls (OR = 3.118, P = 0.019), and in a case-control study, heterozygous 19H carriers (OR = 2.2) indicated a robust association of ABCG8 with gallstones in different populations.22 Previous studies have indicated the role of T400K polymorphisms in lipid parameters and the formation of gallstones.12 The frequencies of the K400 allele (12.4% vs 6.2%, P = 0.018) of ABCG8, and the TK/KK genotype (24.8% vs 12.4%, P = 0.025) were significantly higher in GSD groups than in GSF groups.23 In contrast, the present study frequencies of SNP genotypes T400K were not significantly different (Table 4) between patients and controls. Login to comment
88 Demography and lipid profile Several studies have reported that gallstones are more common in women than men and at all age groups, as the present study has indicated.24 In the present study, of the 226 patients, 56.7% (128) were females and 43.3% (98) were males. The demographic analysis in the present study showed a significantly higher BMI in GSD patients, which supports an earlier study.16 Hypersecretion of cholesterol from the liver and supersaturation of bile with cholesterol represents the common defects in patients with cholesterol gallstones.25,26 Another study suggested that the ABCG8 T400K polymorphism affects the reduction in total plasma cholesterol and LDL cholesterol levels.23 In earlier studies, researchers found a lower concentration of serum campesterol in 19H carriers, and hypothesized that the H allele leads to increased ABCG8transporter activity.10 Further, this hypothesis was supported by the observation that 19H carriership is associated with lower total serum cholesterol levels.27 Perhaps the basic function of both the T400K and D19H polymorphisms is the same to regulate cholesterol transport. Login to comment
89 Similarly, our lipid profile data showed an association between the D19H polymorphism and reduced total plasma cholesterol and LDL cholesterol levels in patients. Login to comment
90 Previous studies reported that low serum HDL cholesterol and high serum triglyceride concentrations are associated risk factors of GSD.28 In contrast, in a family study of a normal population, the D19H substitution of the ABCG8 gene resulted a different situation: no association with serum lipid levels was found, nor any compensatory upregulation of cholesterol synthesis.10 However, the present study shows similarity with earlier studies, where low serum HDL cholesterol and high serum triglyceride concentrations are associated with GSD. Login to comment
91 Although the GSD risk is clearly attributable to the D19H variant in the ABCG8 gene in the present study, the limitation of the study could be the possibility of other ABCG5/ ABCG8 SNP and other Lith genes that contribute to gallstone susceptibility, and the elucidation of different gallstones types. Login to comment
92 In conclusion, our study shows for the first time in India that the D19H SNP of ABCG8 was shown to have a strong association with GSD, whereas the T400K SNP of ABCG8 was not found to be significant with the disease in the study cohort. Login to comment
96 Our sincere thanks to Dr Jamuna Cherri (Asian Healthcare Foundation) for her constant help in the plasma lipid profile analysis. We are extremely thankful to Ms Mary Thomas and Ms Vasantha Rani (Asian Healthcare Foundation) for 3040N = Group D19hT400k Bilecholesterol 700 600 500 400 300 200 100 0 Figure 3 Distribution of bile cholesterol in gallstone patients between mutant alleles of single nucleotide polymorphisms T400K and D19H of ABCG8. Login to comment
25 DNA was isolated from lymphocytes using standard methods.17 Two SNP, rs 4148217 = c.1199C>A (p.T400K) and rs 11887534 = c.55G>C (p.D19H) in the ABCG8 gene were analyzed by the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR; tetra-primer based) and direct sequencing methods, respectively. Login to comment

PMID: 21039838 [PubMed] Srivastava A et al: "Role of ABCG8 D19H (rs11887534) variant in gallstone susceptibility in northern India."

No. Sentence Comment

0 GASTROENTEROLOGYjgh_6349 1758..1762 Role of ABCG8 D19H (rs11887534) variant in gallstone susceptibility in northern India Anshika Srivastava,* Anvesha Srivastava,* Kshitij Srivastava,* Gourdas Choudhuri† and Balraj Mittal* Departments of *Genetics and † Gastroenterology, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow, India Abstract Background and Aim: The excretion of cholesterol from the liver is regulated by the ATP-binding cassette transporter ABCG8. Login to comment
1 A common genetic polymorphism D19H of ABCG8 might be related to the genetic predisposition of gallstone disease, which is causatively related to supersaturation of cholesterol in bile. Login to comment
2 We aimed to examine the role of the ABCG8 D19H (rs11887534) polymorphism in susceptibility to gallstone disease in the northern Indian population. Login to comment
4 Genotyping for the ABCG8 D19H polymorphism was carried out using the PCR-RFLP method. Login to comment
7 The risk as a result of ABCG8 D19H variation was more pronounced in female gallstone patients at genotype (P = 0.026; OR = 3.01, 95% CI = 1.1-7.9) as well as allele level (P = 0.030; OR = 2.85; 95% CI = 1.17.3). Login to comment
9 Conclusion: Carriers of the DH genotype and H allele of the ABCG8 D19H polymorphism harbor a higher risk for gallstone susceptibility in the northern Indian population. Login to comment
18 Genetic analyses showed that despite the close proximity between these two genes, ABCG8 shows much greater genetic variability in comparison with ABCG5.13,14 ABCG8 contains 13 exons and spans approximately 28 kb.15 Linkage and association studies have proposed cholesterol transporter ABCG5/G8 as a potential candidate for the genetic determinant of gallstone formation, or LITH gene.16,17 Buch et al.,18 using genome wide association, identified a single nucleotide polymorphism (SNP) (rs11887534) in the ABCG8 gene, conferring G>C transversion corresponding to asp19-to-his (D19H) substitution, which was significantly associated with gallstone disease. Login to comment
20 Considering the importance of the ABCG8 transporter in maintaining the cholesterol homeostasis and the association of the D19H genetic variant with gallstone disease, we aimed to explore the role of the ABCG8 D19H polymorphism in susceptibility to gallstone disease in a high-risk northern Indian population. Login to comment
32 The ABCG8 D19H polymorphic site containing the fragment was amplified by PCR. Login to comment
33 The genotyping for the ABCG8 D19H polymorphism was carried out as described previously.22 To improve the genotyping quality and validation, 10% of the samples were genotyped by Taqman probes and no discrepancy in genotyping was observed. Login to comment
42 The false-positive report probability (FPRP) for statistically significant observations was estimated using the methods described by Wacholder et al.23 Evaluation of coding single nucleotide polymorphisms Polymorphism phenotyping algorithm (PolyPhen) (http:// www.bork.embl-eidelberg.de/PolyPhen/)24,25 was chosen for functional impact prediction of ABCG8 D19H. Login to comment
44 Predictions are based on a combination of phylogenetic, structural and sequence annotation information characterizing a substitution and its position in the protein.26 Molecular modeling of ABCG8 D19H polymorphism Molecular modeling studies were carried out to understand the effect of aspartate to histidine change (rs11887534) on the geometry of ABCG8 protein. Login to comment
49 Table 1 Characteristic profile of healthy controls and gallbladder cancer patients Characteristic Control subjects Gallstone patients n (%) n (%) Total 220 230 Sex Male 77 (35.0) 83 (36.1) Female 143 (65.0) 147 (63.9) Age at interview, years Ϯ SD 49.0 Ϯ 9.8 48.6 Ϯ 11.9 A Srivastava et al. ABCG8 D19H polymorphism and gallstone disease 1759Journal Type of stone analysis All the samples analyzed were of the cholesterol type (98.51%), except one that was of the pigment type (1.49%). Login to comment
51 ABCG8 D19H polymorphism in control group In our population, the observed genotype distribution of the ABCG8 D19H polymorphism in healthy controls was consistent with the Hardy-Weinberg equilibrium. Login to comment
53 ABCG8 D19H polymorphism in gallstone patients On comparing the genotype frequency distribution in gallstone patients with that of controls, the frequency of heterozygous DH genotype was considerably higher (10.4%) in gallstone patients than that of controls (5.0%). Login to comment
61 Molecular modeling of the ABCG8 D19H (rs11887534) polymorphism The general root mean square (RMS) deviation for the average structures of the wild-type and polymorphic proteins was only 0.22 A. Furthermore, at the site of the polymorphism at residue 19, there was a minimal deviation between the two structures (Fig. Login to comment
70 Various recent studies have identified the ABCG8 D19H variant as the first common susceptibility factor for cholesterol gallstones in humans.16,34,35 However, Wang et al.17 showed that the ABCG8 T400K polymorphism, not D19H, might play a role in the lipid metabolism and formation of gallstones in the Chinese population. Login to comment
72 Also, the results stood true when replicated in the Chilean population.18 The D19H variant confers OR of 2-3 and 7 for heterozygous and homozygous carriers, respectively, and therefore 8-11% of the total gallstone risk can be attributed to this variant.36 The molecular modeling of the ABCG8 D19H variant polymorphism, which leads to the substitution of a positively charged amino acid (aspartic acid) with a negatively charged amino acid (histidine), showed that the overall RMS deviation was negligible between the wild-type and polymorphic ABCG8 protein structures, and the D19H SNP was predicted by PolyPhen to be benign. Login to comment
74 It is well established that ABCG8 plays an important role in the secretion of cholesterol into intestinal lumen in enterocytes and the Table 2 Genotype and allele frequencies for the ABCG8 D19H (rs11887534) polymorphism in gallstone patients and healthy subjects Genotype/allele Gallstone Controls P-value OR (95% CI) n (%) (230) n (%) (220) DD 206 (89.6) 209 (95.0) - 1 (reference) DH/HH 24 (10.4) 11 (5.0) 0.038 2.20 (1.1-4.6) D 436 (94.8) 429 (97.5) - 1 (reference) H 24 (5.2) 11 (2.5) 0.043 2.12 (1.2-4.3) Significant values are represented in bold. CI, confidence interval; GBC, gallbladder cancer; HC, healthy control; OR, odds ratio. Login to comment
75 ABCG8 D19H polymorphism and gallstone disease A Srivastava et al. 1760 secretion of cholesterol into bile in hepatocytes.17,37 The protein encoded by ABCG8 functions along with ABCG5 as a heterodimer.,38 An aspartic acid at amino acid 19 in ABCG8 is highly conserved from plants to vertebrates, and its substitution to histidine results in the loss of negative charge. Login to comment
76 The variant H allele of the ABCG8 D19H polymorphism is suggested to increase the expression or function of the ABCG8 transporter, resulting in a positive correlation with high biliary cholesterol secretion and the accumulation in the gallbladder, which serves as an initial step in gallstone formation.17,39,40 Mice overexpressing human Abcg8 show reduced intestinal cholesterol absorption and hepatic cholesterol synthesis and biliary cholesterol secretion, thus leading to the supersaturation of bile with cholesterol.41,42 Biliary cholesterol level has also been directly related to gene copy number of the transgene ABCG8, and vice versa, in Abcg8 knockout mice.43,44 Establishing the role of the ABCG8 19H variant might be clinically relevant, because it would be possible to predict if HMG-CoA reductase inhibitors could be particularly effective in lowering biliary cholesterol levels in patients carrying the ABCG8 risk allele. Login to comment
77 The importance of our study lies in the fact that there is no data available exploring the role of the ABCG8 D19H variant in the high-risk population of northern India. Login to comment

PMID: 21062971 [PubMed] Xu HL et al: "Cholesterol metabolism gene polymorphisms and the risk of biliary tract cancers and stones: a population-based case-control study in Shanghai, China."

No. Sentence Comment

102 ABCG8 rs11887534, also called D19H, is a missense variation that causes an amino acid change from an acidic amino acid (aspartic acid) to a basic amino acid (histidine). Login to comment

PMID: 21190282 [PubMed] Stender S et al: "Sterol transporter adenosine triphosphate-binding cassette transporter G8, gallstones, and biliary cancer in 62,000 individuals from the general population."

No. Sentence Comment

1 To test the hypothesis that ABCG8 (adenosine triphosphate-binding cassette transporter G8) Asp19His (D19H) genotype predicted risk of gallstones and biliary cancer in the general population, we studied 62,279 white individuals from The Copenhagen City Heart Study and The Copenhagen General Population Study, randomly selected to reflect the adult Danish population aged 20 to 801 years. Login to comment
6 The fraction of all gallstones attributed to D19H was 11%. Login to comment
8 The fraction of all biliary cancers attributed to the D19H genotype was 27%. Login to comment
9 Finally, D19H genotype associated with stepwise increases in plasma levels of alanine aminotransferase and gamma glutamyltransferase of up to 14% and 25% in HH homozygotes, and with corresponding stepwise reductions in plasma levels of total and low-density lipoprotein cholesterol of up to 5% versus noncarriers (all comparisons, P for trend <0.001). Login to comment
10 Conclusion: In this general population cohort, ABCG8 D19H genotype was an important predictor of both symptomatic gallstone disease and biliary cancer. Login to comment
20 640 A recent genomewide association scan identified the sterol transporter adenosine triphosphate-binding cassette transporter G8 (ABCG8) as a susceptibility factor for gallstone disease in humans.6 The association was attributed to a common variant that leads to the substitution of aspartate with histidine at amino acid residue 19 (D19H; rs11887534). Login to comment
21 It has been hypothesized that D19H constitutes a gain-of-function variant that increases hepatobiliary cholesterol efflux, resulting in precipitation of cholesterol gallstones.6-8 Gallstone disease is a risk factor for biliary cancer, a rare but highly lethal disease.9 Whether D19H affects the risk of gallstone disease and biliary cancer in the general population is currently unknown. Login to comment
22 This question is clinically important because (1) genetic variants identified in case-control studies often overestimate risk compared to studies of the general population10,11 ; (2) D19H has the potential to become the first lithogenic genetic variant included in presymptomatic genetic screening for gallstone disease and/or biliary cancer in the general population; and (3) the identification of specific genetic variants predisposing to gallstones and biliary cancer might also lead to new nonsurgical interventions that extend our current limited strategies for the prevention of these diseases. Login to comment
23 We tested the clinical impact of the D19H genotype in 62,279 individuals from the Danish general population followed from January 1976 through May 2009, of whom 3124 developed symptomatic gallstone disease and 30 developed biliary cancer. Login to comment
25 First, we determined whether D19H predicted risk of symptomatic gallstone disease and/or biliary cancer in the general population; on the basis of these results, we calculated the population-attributable risk. Login to comment
26 Subsequently, we determined the absolute 10-year risk of symptomatic gallstone disease as a function of D19H genotype stratified by sex, age, and body mass index (BMI). Login to comment
27 Finally, to explore the effect of D19H genotype on liver and pancreas damage, and on the putative effects on cholesterol excretion, we determined the association of the D19H genotype with plasma liver biochemistry and with plasma lipid and lipoprotein levels. Login to comment
53 An ABI-Prism 7900HT Sequence Detection System (Applied Biosystems) and a TaqMan-based assay was used to genotype for ABCG8 D19H (rs11887534). Login to comment
64 For trend tests, subjects were classified according to D19H genotype and coded as 0 for noncarriers, 1 for heterozygotes and 2 for homozygotes. Login to comment
66 Kaplan-Meier curves and log-rank tests evaluated the cumulative incidence of symptomatic gallstone disease and biliary cancer as a function of age and ABCG8 D19H genotype. Login to comment
75 Interaction of D19H genotype with other risk factors for gallstones (age, sex, BMI, physical activity, parity, hormone replacement therapy, and alcohol intake) were evaluated by including two-factor interaction terms between genotype and other risk factors, one at a time, in the Cox regression model. Login to comment
76 Population-attributable risk was calculated as previously described.18 Absolute 10-year risks for symptomatic gallstone disease by ABCG8 D19H genotype, age (<40 years, 40-60 years, >60 years), and BMI (<25 kg/m2 [normal], 25-30 kg/m2 [overweight], >30 kg/m2 [obese]) were estimated with the use of the regression coefficients from a Poisson regression model for women and men separately, and presented as estimated incidence rates (number of events per 10 years) in percent.19,20 Results Clinical Characteristics. Login to comment
82 Risk factors for symptomatic gallstone disease did not differ by D19H genotype, and were thus unlikely to confound any association of D19H with risk of symptomatic gallstone disease (compare Table 1 with Table 2). Login to comment
84 The cumulative incidence of symptomatic gallstone disease as a function of age increased stepwise by D19H genotype, with HH homozygotes having the highest risk and DH heterozygotes an intermediate risk compared with noncarriers (Fig. 1; P for trend <0.001). Login to comment
87 HRs for symptomatic gallstone disease as a function of D19H genotype in the general population adjusted for age and sex were 1.9 (95% confidence interval [CI], 1.7-2.1) for DH heterozygotes and 3.3 (95% CI, 2.34.6) for HH homozygotes compared with noncarriers (Fig. 1). Login to comment
89 There were no significant interactions between D19H genotype and any of the abovementioned risk factors on risk of symptomatic gallstone disease. Login to comment
91 The HR for cholecystectomy as a function of D19H genotype in the general population adjusted for age and sex was 2.0 (95% CI, 1.8-2.3) for DH heterozygotes and 3.3 (95% CI, 2.2-4.9) for HH homozygotes Table 1. Characteristics of Individuals in the General Population* by Disease Status Characteristic No event Gallstone Disease Biliary Cancer Number of individuals (%) 59,155 (95) 3124 (5) 30 (0.05) Age (years) 57 (46-66) 60 (50-70)‡ 66 (61-72)‡ Women (%) 54 72‡ 57 BMI (kg/m2 ) 25 (23-28) 27 (24-30)‡ 27 (25-29)§ Physical activity (%) 46 36‡ 27§ Mean parity (number of births)† 1.8 2.0‡ 1.4 Hormone replacement therapy (%)† 13 20‡ 18 Alcohol consumption (%) 49 40‡ 50 Lipid-lowering therapy (%) 8 11‡ 0 Values are median (interquartile range) or percentage. Physical activity was 4 hours or more per week of light physical activity in leisure time. Alcohol consumption was at least twice weekly. P values as calculated by Mann-Whitney U test or Pearson`s chi-square test. Login to comment
96 Table 2. Characteristics of Individuals in the General Population* as a Function of ABCG8 D19H Genotype Characteristic DD Noncarriers DH Heterozygotes HH Homozygotes P Value Number of individuals (%) 54,526 (87.5) 7,506 (12.1) 247 (0.4) NA Age (years) 57 (46-67) 57 (47-67) 57 (45-68) 0.57 Women (%) 55 55 53 0.36 BMI (kg/m2 ) 26 (23-29) 26 (23-28) 26 (23-28) 0.83 Physical activity (%) 46 45 43 0.37 Mean parity (number of births)† 1.8 1.8 1.7 0.54 Hormone replacement therapy (%)† 14 13 11 0.71 Alcohol consumption (%) 48 49 48 0.72 Values are median (interquartile range) or percentage. Physical activity was 4 hours or more per week of light physical activity in leisure time. Alcohol consumption was at least twice weekly. P values as calculated by Kruskal-Wallis analysis of variance or Pearson`s chi-square test. Login to comment
100 D19H genotype did not associate with overall mortality. Login to comment
101 Based on the frequency of D19H and the observed HRs for symptomatic gallstone disease as a function of genotype, the fraction of all gallstones that could be attributed to D19H was 11%. Login to comment
102 Absolute 10-year risk of symptomatic gallstone disease increased from men to women, with increasing age, increasing BMI, and by D19H genotype (Fig. 2). Login to comment
106 The cumulative incidence of biliary cancer as a function of age increased by D19H genotype (Fig. 3; P < 0.001). Login to comment
107 The HR for biliary cancer as a function of D19H genotype adjusted for age and sex was 4.0 (95% CI, 1.9-8.4) for DH heterozygotes and HH homozygotes combined compared with noncarriers (Fig. 3) (3.8 [95% CI, 1.8-8.1] in DH heterozygotes and 10.3 [95% CI, 1.4-77.5] in HH homozygotes). Login to comment
110 The fraction of all biliary cancers attributed to D19H was 27% (for clinical characteristics of patients, see Table 3). Login to comment
112 D19H associated with stepwise increases in plasma levels of gamma glutamyltransferase and alanine aminotransferase of, respectively, 3% and 2% for heterozygotes, and 25% and 14% for homozygotes compared with noncarriers (Fig. 4; P for trend <0.001). Login to comment
113 Alcohol intake was equally distributed among the different D19H genotypes and therefore did not confound these associations (Table 2). Login to comment
116 D19H genotype associated with modest stepwise reductions in plasma levels of total cholesterol and LDL cholesterol of 1.6% and 2.4%, respectively, in DH heterozygotes, and of 3.5% and 4.5%, respectively, in homozygotes compared with noncarriers (Fig. 4; P for trend <0.001). Login to comment
120 Cumulative incidence of symptomatic gallstone disease (graph at top) and mean age at onset (table at bottom) as a function of ABCG8 D19H genotype in the general population. Login to comment
124 Absolute 10-year risk of developing gallstone disease as a function of ABCG8 D19H genotype, by sex, age (<40 years, 40-60 years, >60 years), and body mass index (<25 kg/m2 , normal weight; 25-30 kg/m2 , overweight; >30 kg/m2 , obese). Login to comment
127 There was no association of D19H with HDL cholesterol or triglycerides. Login to comment
128 Discussion The principal findings of this study of 62,279 individuals from the general population, of which 3124 developed symptomatic gallstone disease and 30 developed biliary cancer, are: (1) ABCG8 D19H genotype associated with an approximate 2-fold to 3.5-fold increase in risk of symptomatic gallstone disease in more than 12% of the general population. Login to comment
129 (2) D19H genotype associated with stepwise reductions in mean age at onset of symptomatic gallstone disease of up to 4 years in homozygotes. Login to comment
130 (3) A total of 11% of symptomatic gallstones in the general population could be attributed to D19H genotype. Login to comment
131 (4) Heterozygous and homozygous carriers for D19H had a four-fold Fig. 3. Login to comment
132 Cumulative incidence of biliary cancer in the general population as a function of ABCG8 D19H genotype. Login to comment
135 Table 3. Characteristics of the 30 Participants With Biliary Cancer Subject Number D19H Genotype Sex (F/M) BMI (kg/m2) Age at Baseline Examination Age at Diagnosis of Gallstone Disease Age at Cholecystectomy Age at Diagnosis of Biliary Cancer ICD-10 Code Age at Death 1 HH F 28 62 77 77 C24.9 77 2 DH F 24 52 57 57 C24.0 58 3 DH F 24 62 59 74 C24.0 75 4 DH F 33 67 71 C24.9 71 5 DH M 31 68 81 C23.9 81 6 DH F 27 71 82 82 83 C24.8 83 7 DH M 29 72 79 C24.0 80 8 DH F 29 73 76 76 77 C24.1 77 9 DH F 30 78 79 79 79 C24.9 81 10 DH F 22 85 87 C23.9 87 11 DH M 28 87 91 C23.9 91 12 DD M 27 45 48 C24.0 51 13 DD F 38 45 61 C24.0 14 DD M 28 46 48 58 C24.0 58 15 DD F 31 50 51 51 C24.0 51 16 DD M 25 50 66 C24.9 17 DD M 25 54 69 70 C23.9 71 18 DD M 27 61 68 C24.0 68 19 DD F 30 61 67 67 C23.9 68 20 DD F 20 62 75 C24.9 77 21 DD M 26 63 79 C24.9 22 DD F 25 63 66 C23.9 66 23 DD F 26 64 72 72 C24.0 72 24 DD F 26 67 77 C23.9 78 25 DD F 26 69 80 C24.0 82 26 DD M 28 72 74 C22.1 74 27 DD F 38 72 78 C24.9 79 28 DD M 29 78 80 80 C24.1 80 29 DD M 24 81 82 C24.1 86 30 DD M 28 82 89 C23.9 90 BMI is in kg/m2 . Login to comment
140 (5) A total of 27% of biliary cancers could be attributed to D19H. Login to comment
141 (6) D19H genotype associated with stepwise increases in plasma alanine aminotransferase and gamma glutamyltransferase, and with a modest stepwise decrease in total and LDL cholesterol levels. Login to comment
143 The incidence of symptomatic gallstone disease and biliary cancer, and the frequency of D19H, in our study are comparable to previous studies in Western countries.6,21,22 The incidence rates of mainly biliary cancer were lower in the CGPS compared to the CCHS. Login to comment
147 Possible explanations for this include a higher background risk of biliary cancer in India than in Western countries,9,21 a different etiology (bacterial infection of bile), and a frequency of D19H among controls of 23%, which is twice that reported in Western populations. Login to comment
148 We found that D19H associates with reductions in plasma total and LDL cholesterol levels. Login to comment
149 In hepatocytes, ABCG8 forms half of a transmembrane sterol transporter that effluxes sterols into bile.27 Because biliary supersaturation with cholesterol is a pivotal event in cholesterol gallstone formation and D19H is associated with gallstones, it has been hypothesized that D19H constitutes a gain-of-function variant that increases biliary cholesterol efflux.6-8 Overexpression of ABCG8 in mice leads to reduced levels of plasma sterols.28 By analogy, a stepwise reduction in levels of plasma cholesterol as a function of D19H genotype in humans would support the gain-of-function hypothesis. Login to comment
151 We detected a modest but statistically highly significant stepwise reduction in plasma LDL cholesterol levels as a function of D19H genotype. Login to comment
154 We found a modest stepwise reduction in use of lipid-lowering therapy as a function of D19H genotype. Login to comment
155 Regardless of whether we restricted the follow-up period to the period 1976-1990 (i.e., prior to the advent of statins) or excluded all participants on lipid-lowering therapy during the study, the hazard ratios for symptomatic gallstone disease as a function of D19H genotype were largely unchanged. Login to comment
156 Together, these results indicate that the increased risk of symptomatic gallstone disease observed in carriers of D19H could not be explained by their lower use of lipid-lowering therapy. Login to comment
158 Baseline liver parameters, plasma lipid and lipoprotein levels, and use of lipid-lowering therapy as a function of ABCG8 D19H genotype. Login to comment
165 Although functional studies aimed at testing whether D19H constitutes a gain-of-function variant that increases biliary cholesterol efflux are clearly warranted, a clinically interesting question is whether the putative increase in biliary cholesterol efflux can be counteracted medically. Login to comment
166 An affirmative answer to this question could resurrect the widely abandoned concept of nonsurgical treatment for gallstones, at least in the subset of D19H-positive patients. Login to comment
170 In conclusion, ABCG8 D19H is the first genetic variant to predict risk of symptomatic gallstone disease and biliary cancer in the general population. Login to comment
171 The clinical impact appears to be substantial in that 11% of all symptomatic gallstones and 27% of all biliary cancers in our study can be attributed to D19H genotype. Login to comment

PMID: 21274884 [PubMed] Stender S et al: "Sterol transporter adenosine triphosphate-binding cassette transporter G8, gallstones, and biliary cancer in 62,000 individuals from the general population."

No. Sentence Comment

PMID: 21285406 [PubMed] Benn M et al: "Low-density lipoprotein cholesterol and the risk of cancer: a mendelian randomization study."

No. Sentence Comment

17 Individuals were genotyped for PCSK9 R46L (rs11591147), ABCG8 D19H (rs11887534), and APOE R112C (rs429358) and R158C (rs7412) polymorphisms, all of which are associated with lifelong reduced plasma LDL cholesterol levels. Login to comment
55 Genotype Analyses We used a Prism 7900HT Sequence Detection System (Applied Biosystems, Inc, Foster City, CA) to genotype four coding single-nucleotide polymorphisms in three genes: PCSK9 R46L (rs11591147) (24), ABCG8 D19H (rs11887534) (25), and APOE R112C (rs429358) and R158C (rs7412) (26). Login to comment
59 Forward (F) and reverse (R) primer sequences and VIC- and 6-FAM-labeled probe sequences, all in the 5' to 3' direction, were as follows (the variant is underlined in the probe sequences): PCSK9 R46L (rs11591147), F = GACGAGGACGGCGACTAC, R = CC GTGCTCGGGTGCTT, VIC = TGCTAGCCTTGCGTTC, 6-FAM = CTAGCCTTGCTTTC; ABCG8 D19H (rs11887534), F = AGAGGGCTGCCGAAAGG, R = CGACTTCCCATTG CTCACTCA, VIC = ACTCCCCAGGATACCT, 6-FAM = CT CCCCAGCATACCT; APOE R112C (rs429358), F = GGAAC TGGAGGAACAACTGACC,R=ACCTCGCCGCGGTACTG, VIC = ATGGAGGACGTGTGC, 6-FAM = TGGAGGACG TGCGC; and APOE R158C (rs7412), F = TCCGCGATGCC GATGAC, R = CCCCGGCCTGGTACAC, VIC = CAGGCG CTTCTGC, 6-FAM = CAGGCACTTCTGC. Login to comment
99 Compared with the corresponding noncarriers, PCSK9 R46L homozygotes had a 20% reduction (95% CI = 1% to 39% reduction) in plasma LDL cholesterol levels (Ptrend across genotypes < .001) and ABCG8 D19H homozygotes had a 5% reduction (95% CI = 1% to 8% reduction) (Ptrend across genotypes < .001). Login to comment
101 Sixty percent of PCSK9 R46L homozygotes, 24% of ABCG8 D19H homozygotes, and 66% of APOE ε22 genotype carriers had a plasma LDL cholesterol level below 100 mg/dL, corresponding to the lowest ATP group. Login to comment
102 PCSK9 R46L, ABCG8 D19H, and APOE ε genotypes contributed 0.4%, 0.1%, and 5.9%, respectively, to the total variation in plasma LDL cholesterol (P < .001; Table 2). Login to comment
105 However, the observed risk of cancer as a function of genotype in the CCHS and CGPS combined did not differ statistically significantly from 1.0 for the ABCG8 D19H genotype (Ptrend = .78) or the APOE genotype (Ptrend = .96) (Figure 3, right panel). Login to comment
120 F statistics was 131 for PCSK9 R46L genotype, 23 for ABCG8 D19H genotype, 844 for APOE genotypes, and 474 for all genotypes combined (Table 2). Login to comment
141 Table 2.Studies summary of the causal effect of reduced low-density lipoprotein (LDL) cholesterol on increased risk of cancer* Model F R2 , % Relative risk† (95% CI) of cancer for a 50% reduction in LDL cholesterol level P‡ P§ Observational estimate - - 1.10 (1.01 to 1.21) .003 - Instrumental variable estimate All genotypes combined 474 6.5 0.96 (0.87 to 1.05) .31 .03 PCSK9 R46L 131 0.4 1.33 (0.59 to 2.97) .30 .42 ABCG8 D19H 23 0.1 2.28 (0.43 to 12.11) .73 .23 APOE genotype 844 5.9 0.92 (0.75 to 1.10) .39 .02 * F statistics (evaluation of strength of instrument) and R2 (contribution of genotype to variation in LDL cholesterol levels in percent) are from the first-stage regression analysis. Login to comment
183 Homozygosity for the ABCG8 D19H variant is associated with an increased risk of biliary tract cancer (25), probably due to an increased concentration of cholesterol in the gall bladder; however, the magnitude of this problem in this study is likely to be limited because of the low frequency of ABCG8 D19H homozygotes (ie, 0.4% = 252/62 786; Figure 3) in the study population. Login to comment

PMID: 21353662 [PubMed] Van Erpecum KJ et al: "Pathogenesis of cholesterol and pigment gallstones: an update."

No. Sentence Comment

91 Recently, variants of ABCG5/8 were linked to gallstone disease; ABCG8 D19H in Caucasians and ABCG5 Q604E in Chinese populations [35,36]. Login to comment
90 Recently, variants of ABCG5/8 were linked to gallstone disease; ABCG8 D19H in Caucasians and ABCG5 Q604E in Chinese populations [35,36]. Login to comment

PMID: 20494111 [PubMed] Marschall HU et al: "The genetic background of gallstone formation: an update."

No. Sentence Comment

33 The genome-wide association study of gallstone patients from Germany and Chile [12] and a linkage study in affected sib pairs from Germany and Romania [13] then identified the D19H variant of ABCG8, located on chromosome 2, as a susceptibility factor for human gallstone disease. Login to comment
36 The D19H variant was replicated as a susceptibility factor for gallstone diseases in China, where D19H increased the gallstone risk in patients younger than 50 years of age (OR, 12.4; 95% CI, 1.7-90) [14]. Login to comment
38 We recently confirmed D19H as a risk factor for symptomatic gallstone disease (OR, 2.5; CI, 1.3-4.8) in 341 Swedish twins where 20.8% of gallstone cases carried at least one D19H allele as compared to 9.4% in stone-free controls [16]. Login to comment
40 American and European carriers of the D19H variant were found to have decreased intestinal cholesterol absorption and increased hepatic synthesis of cholesterol [17,18], leading to lower total and LDL-cholesterol [18]. Login to comment
41 Lower total cholesterol and triglyceride levels were also found in another study in Caucasian gallstone siblings, in this case both for carriers of the ABCG5 Q604E or ABCG8 D19H variants [19]. Login to comment
42 Consistent with upregulated cholesterol synthesis, D19H carriers had a significantly more effective reduction of LDL-cholesterol during treatment with statins, which might be of clinical relevance [20]. Login to comment
45 Taken together, these findings support the assumption that D19H increases the ABCG5/G8 mediated transfer of cholesterol into bile, which conversely results in biliary cholesterol hypersaturation. Login to comment
46 However, a recent study in healthy non-obese Chinese provided discordant data, i.e., a significant association of D19H gene polymorphism with elevated total and LDL-cholesterol [23], which might be attributed to different ethnic background and dietary habits. Login to comment
53 We also recently identified a co-inheritance of a novel ABCB4 mutation (c.2960C>T) and the ABCG8 D19H variant in a Swedish monozygotic twin pair where both sisters suffered from juvenile onset gallstone disease, oral contraceptive and pregnancy aggravated cholestatic liver disease, and progressive liver fibrosis [31]. Login to comment

PMID: 19408031 [PubMed] Acalovschi M et al: "Common variants of ABCB4 and ABCB11 and plasma lipid levels: a study in sib pairs with gallstones, and controls."

No. Sentence Comment

65 The polymorphism rs11887534 (p.D19H) of the ABCG8 gene, which encodes the hepatobiliary cholesterol hemitransporter, is the first identified susceptibility factor for gallstones in humans [22, 23]. Login to comment

PMID: 20367534 [PubMed] Rodrigues AC et al: "Efflux and uptake transporters as determinants of statin response."

No. Sentence Comment

138 And, recently, it was reported by Kajinami et al. that the variant allele of the ABCG8 D19H polymorphism was significantly associated with higher reductions in LDL cholesterol (-39.7 vs -36.2%) after atorvastatin therapy [60]. Login to comment

PMID: 21392722 [PubMed] Hoenig MR et al: "The C3435T polymorphism in ABCB1 influences atorvastatin efficacy and muscle symptoms in a high-risk vascular cohort."

No. Sentence Comment

67 For example, the apoE4/4 genotype, which is associated with lesser percent LDL-C reduction with atorvastatin compared to the apoE3/3 genotype,14 is also associated with greater cholesterol absorption and lower cholesterol synthesis.15,16 Similarly, the D19H polymorphism in ABCG8, which is associated with lower cholesterol absorption,17 may be a predictor of increased LDL-C response to atorvastatin.18 However, a limitation of using cholesterol metabolism markers to predict atorvastatin response is that this strategy does not take into account variation in drug metabolism and drug disposition.3 In this context, our finding that the C3435T polymorphisms in ABCB1, which has been associated with altered atorvastatin pharmacokinetics,8 is associated with variation in atorvastatin efficacy independently of variation in cholesterol metabolism raises the possibility that it may be possible to use pharmacogenomic strategies to complement a cholesterol metabolism marker strategy. Login to comment

PMID: 22898925 [PubMed] von Kampen O et al: "Genetic and functional identification of the likely causative variant for cholesterol gallstone disease at the ABCG5/8 lithogenic locus."

No. Sentence Comment

17 Subsequent mutation detection and genotyping yielded two disease-associated variants ABCG5-R50C (p=4.94×10-9 ) and ABCG8-D19H (p=1.74×10-10 ) in high pair-wise LD (r2 =0.95). Login to comment
28 However, although coding variant ABCG8-D19H has often been used as the major tagging SNP in both, the discovery and the replication studies in humans, its causative role is by no means clear. Login to comment
47 The different versions of both transporters, defined by the respective alleles of R50C and D19H, were introduced by site-directed mutagenesis (QuickChange Lightning Site-Directed Mutagenesis Kit, Agilent Technologies, Santa Clara, CA, USA) according to the Page 10 manufacturer`s protocol. HEK cells were transfected using Effectene Transfection Reagent (Qiagen, Hilden, Germany) according to the manufacturer`s protocol. Login to comment
49 In brief, HEK cells transiently expressing different allelic variants of ABCG5-R50C and ABCG8-D19H were incubated in 24 well cell culture plates with 0.5 ml DMEM supplemented with 10 mM HEPES, pH 7.4, 30 mg/ml cholesterol, 0.5 mCi/ml [³H]-cholesterol and 0.2% fatty acid free BSA for 24 h. Login to comment
67 In a single point analysis (Supplementary Table 1), the most significant disease associations were observed in an allele-based test for variants rs11887534 (ABCG8-D19H, p=1.7×10-10 ), rs72875462 (ABCG8 intronic, p=2.1×10-10 ) and rs56132765 (ABCG8-V151V p=3.9×10-10 ). Login to comment
79 ABCG8-D19H and ABCG5-R50C are the only functional candidates in the disease interval Owing to the absence of allelic imbalance and allele-dependent splicing, disease mechanisms such as differential transcription efficiency (caused by promoter polymorphisms or variable intronic enhancers) as well as differential transcript structure or stability could be safely ruled out. Login to comment
84 ABCG8-D19H, but not ABCG5-R50C leads to increased cholesterol transport Of all coding SNPs investigated in the disease-associated region, only rs6756629 (ABCG5-R50C; ORallelic=1.96, 95% CI: 1.56-2.47) and rs11887534 (ABCG8-D19H; ORallelic=2.07, 95% CI: 1.65-2.60) were found to be significantly associated with cholelithiasis in our Page 14 mapping panel. Login to comment
96 Whether ABCG5-50R or ABCG5-50C was present in the construct did not influence cholesterol efflux, given the respective ABCG8-D19H allele. Login to comment
98 ABCG8-D19H but not ABCG5-R50C captures the genetic risk across populations In addition to the functional experiments, nested logistic regression analyses were performed to evaluate statistically the causative role of individual variants in the disease-associated region. Login to comment
99 In the German mapping panel, none of the coding SNPs listed in Supplementary Table 1 significantly improved the allelic risk model over the inclusion of ABCG8-D19H alone. Login to comment
100 When ABCG5-R50C was included as a mandatory explanatory variable, ABCG8-D19H significantly improved the model fit (p=0.0175) thereby suggesting again that ABCG8-D19H is the major causative variant in the region. Login to comment
101 To confirm this result, rs6756629 (ABCG5-R50C) and rs11887534 (ABCG8-D19H) were also genotyped in additional case-controls samples of German, Chilean, Danish, Indian and Chinese origin (Table 2). Login to comment
103 In each of the samples, ABCG8-D19H consistently showed an equal or higher allelic odds ratio as compared to ABCG5-R50C, thereby supporting the above conclusion. Login to comment
104 Moreover, logistic regression analysis containing ABCG8-D19H and other tagging SNPs (Supplementary Page 16 Table 1) were performed in the German and Chilean mapping panels also revealing no significant improvement over ABCG8-D19H alone (all p>0.1). Login to comment
113 More specifically, we could show that the histidine-encoding allele of rs11887534 (ABCG8-D19H) is associated with an increased allelic cholesterol transport efficiency of the ABCG5/8 heterodimer, thereby contributing to biliary cholesterol hypersecretion and supersaturation and, most likely, to a predisposition to gallstone formation. Login to comment
114 This increased biliary cholesterol transport may also contribute to the lower serum cholesterol and phytosterol levels observed previously in carriers of ABCG8-D19H (44,45). Login to comment
121 After extensive genotyping, only two candidate variants remained: ABCG5-R50C and ABCG8-D19H, both with similar allelic odds ratios (Supplementary Table 1, Table 2). Login to comment
122 Since the two SNPs were in high LD, formal genetic differentiation of the two variants was achieved only in three out of the six investigated patient samples from Germany, Denmark, Chile, India and China implicating rs11887534 (ABCG8-D19H) as the likely risk factor. Login to comment
124 In line with these statistical results, only ABCG8-D19H was found to yield a functional effect in in vitro co-expression experiments. Login to comment
126 However, in a logistic regression analysis, none of the known common tagging SNPs improved the model fit significantly over rs11887534 (ABCG8-D19H) which implies that there is probably not much "missing heritability" left at this locus. Login to comment
128 In this report, we genetically establish rs11887534 (ABCG8-D19H) through thorough transcript mapping, mutation detection and association analysis in ethnically different populations as the likely causative variant for gallstone susceptibility. Login to comment
129 Further, we show that rs11887534 (ABCG8-D19H) increases the transport efficiency of cholesterol of the sterolin heterodimer, thereby drawing a link between the known basic pathomechanism of cholesterol gallstone formation to this specific genetic variant. Login to comment

PMID: 22869156 [PubMed] von Schonfels W et al: "Recurrence of gallstones after cholecystectomy is associated with ABCG5/8 genotype."

No. Sentence Comment

31 We observed an association between risk variant ABCG8-D19H and post-surgery gallstone disease with a similar allelic odds ratio as for pre-cholecystectomy populations, thereby confirming the central pathophysiological role of this locus in the formation of gallstones. Login to comment
68 An allele-based test of association was performed between rs11887534 (ABCG8-D19H) and gallstone recurrence, which yielded a p value of 0.034 in a two-sided Fisher exact test and an allelic odds ratio of 1.97 (95 % CI 1.12-?). Login to comment
75 In a logistic regression analyses including all clinical variables except scheduling and type of surgery, only the ABCG8-D19H genotype remained a significant predictor of gallstone recurrence (likelihood ratio test p = 0.024). Login to comment
76 When repeated including only those 1,650 patients for whom the type and scheduling of surgery was available, logistic regression analysis revealed both ABCG8-D19H (p = 0.020) and the type of surgery (p = 0.0035) as significant influential variables, thereby confirming that rs11887534 is an independent predictor of gallstone recurrence irrespective of the type of surgery. Login to comment
77 Discussion We have shown that ABCG8-D19H is a predictor of gallstone recurrence after cholecystectomy. Login to comment
93 This notwithstanding, Table 1 Analysis of rs11887534 (ABCG8-D19H) as a predictor of gallstone recurrence after cholecystectomy The significance of the allelic genotype-phenotype association was assessed using Fisher`s exact test. Login to comment
96 %) Laparoscopic surgery 25 (1.7 %) 1,477 (98.3 %) 0.007 ABCG8-D19H could be identified as a risk factor because the corresponding effect size was comparatively large for a complex trait. Login to comment
100 Importantly, ABCG8-D19H remained a statistically significant predictor of gallstone recurrence even if the type of surgery is adjusted for, despite the reduced number of individuals available for analysis (N = 1,650 vs. N = 1,908). Login to comment
103 In addition, the association between ABCG8-D19H genotype and post-surgery gallstone recurrence underlines the central role of the sterolin transporters in the pathogenesis of gallstone disease, thereby furthering our understanding of the etiology of this disorder. Login to comment
32 We observed an association between risk variant ABCG8-D19H and post-surgery gallstone disease with a similar allelic odds ratio as for pre-cholecystectomy populations, thereby confirming the central pathophysiological role of this locus in the formation of gallstones. Login to comment
69 An allele-based test of association was performed between rs11887534 (ABCG8-D19H) and gallstone recurrence, which yielded a p value of 0.034 in a two-sided Fisher exact test and an allelic odds ratio of 1.97 (95 % CI 1.12-?). Login to comment
78 Discussion We have shown that ABCG8-D19H is a predictor of gallstone recurrence after cholecystectomy. Login to comment
94 This notwithstanding, Table 1 Analysis of rs11887534 (ABCG8-D19H) as a predictor of gallstone recurrence after cholecystectomy The significance of the allelic genotype-phenotype association was assessed using Fisher`s exact test. Login to comment

PMID: 22271308 [PubMed] Portincasa P et al: "Intestinal absorption, hepatic synthesis, and biliary secretion of cholesterol: where are we for cholesterol gallstone formation?"

No. Sentence Comment

32 The ABCG8 p.D19H and p.T400K coding variants might play a role as putative susceptibility variants for gallstone formation in humans.14-16 Despite much evidence in this respect, the authors could not confirm such an interesting hypothesis, possibly due to the small cohort size. Login to comment
93 J Biol Chem 2004;279:33586-33592. 14. Katsika D, Magnusson P, Krawczyk M, Grunhage F, Lichtenstein P, Einarsson C, et al. Gallstone disease in Swedish twins: risk is associated with ABCG8 D19H genotype. Login to comment

PMID: 22213168 [PubMed] Krawczyk M et al: "Phytosterol and cholesterol precursor levels indicate increased cholesterol excretion and biosynthesis in gallstone disease."

No. Sentence Comment

23 Although the precise source of cholesterol (i.e., exogenous or endogenous) present in gallstones has not been fully clarified, the ongoing working hypothesis is that the underlying molecular mechanism leading to cholesterol hypersecretion is a gain of sterol transport activity at the canalicular level.11,12 Indeed, a recent genome-wide association study (GWAS) and the analysis of sib-pairs with gallstones have demonstrated that the common ABCG8 variant p.D19H is a major determinant of gallstone formation in humans, presumably by gain-of- function of the transporter.13,14 Furthermore, carriers of other rare loss-of-function mutations in ABCG5/8 suffer from phytosterolemia, a disease characterized by intestinal hyperabsorption and diminished biliary secretion of phytosterols and cholesterol. Login to comment
39 All studied individuals were genotyped for the ABCG5 p.Q604E (rs6720173, c__29001998_10) and ABCG8 p.D19H (rs11887534, c__26135643_10), Address reprint requests to: Prof. Dr. Frank Lammert, Department of Medicine II, Saarland University Medical Center, Saarland University, Kirrberger Str. Login to comment
48 The ABCG8 p.D19H and p.T400K coding variants have been described previously as putative susceptibility variants for gallstone formation in humans.13-15 Measurement of Sterols and Clinical Chemical Parameters. Login to comment
99 The p.Y53C variant in the Chilean cohort, the p.D19H variant in Chilean controls, and the p.A632V variant in German cases depart from Hardy-Weinberg equilibrium. Login to comment
102 As shown in Supporting Table 3A, German carriers of the ABCG8 p.D19H gallstone risk allele [C]13,14 are characterized by a trend to elevated serum lathosterol as well as lower phytosterol (sitosterol, campesterol) levels, indicating increased hepatic synthesis and lower intestinal absorption of cholesterol. Login to comment
184 In fact, previous studies showed that an increased expression of these proteins enhances biliary cholesterol output and reduces intestinal absorption.29 Our previous genetic studies in large cohorts have shown that the common lithogenic variant p.D19H of the ABCG8 transporter predisposes to GSD.13,14 However, the overall genetic association does not reach statistical significance in the present study, most likely due to the smaller cohort size. Login to comment

PMID: 22655090 [PubMed] Li Q et al: "ATP-binding cassette transporter G5 and G8 polymorphisms and several environmental factors with serum lipid levels."

No. Sentence Comment

182 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment
212 The association of ABCG8 D19H and LDL-C levels was recently replicated in a GWA study (P = 1610211 ) [11]. Login to comment
214 Decreased LDL-C levels of atorvastatin treatment were not associated with the ABCG8 D19H SNP [57]. Login to comment
226 The remaining SNPs (Q604E, D19H, Y54C, and T400K) were not associated with plasma lipid levels [60]. Login to comment
231 Based on the HapMap CEU data, these SNPs are in complete LD with each other and with D19H that showed similar association result. Login to comment
241 020 0.062 2.509 0.012 Systolic blood pressure 0.001 0.001 0.066 2.590 0.010 ApoA1/ApoB Waist circumference 20.019 0.002 20.198 27.862 0.000 Age 20.005 0.001 20.089 23.544 0.000 Han TC Waist circumference 0.019 0.005 0.131 3.767 0.000 Age 0.009 0.003 0.126 3.443 0.001 Alcohol consumption 0.302 0.057 0.179 5.286 0.000 Diastolic blood pressure 0.017 0.004 0.168 4.661 0.000 Blood glucose 0.066 0.024 0.095 2.723 0.007 TG Waist circumference 0.075 0.013 0.254 5.661 0.000 Cigarette smoking 0.805 0.165 0.185 4.889 0.000 Blood glucose 0.265 0.049 0.186 5.407 0.000 Diastolic blood pressure 0.030 0.007 0.147 4.120 0.000 Age 20.017 0.005 20.113 23.114 0.002 Alcohol consumption 0.269 0.132 0.078 2.040 0.042 Body mass index 20.065 0.030 20.096 22.157 0.031 HDL-C Waist circumference 20.011 0.002 20.155 24.279 0.000 Gender 0.130 0.046 0.120 2.825 0.005 Alcohol consumption 0.111 0.034 0.138 3.317 0.001 LDL-C Age 0.012 0.002 0.212 6.219 0.000 Body mass index 0.026 0.012 0.101 2.222 0.027 Waist circumference 0.013 0.005 0.115 2.471 0.014 Cigarette smoking 20.310 0.072 20.187 24.227 0.000 hypercholesterolaemic Japanese subjects, Miwa et al. [42] reported that carriers of the ABCG8 M429V or a specific haplotype (wild-type allele of ABCG5 Q604E, and wild-type alleles of ABCG8 C54Y, T400K, and M429V) had higher cholesterol absorption efficiency than non-carriers. Login to comment
242 However, no difference was observed in serum lipid profiles in relation to common SNPs studied previously in Caucasian populations (ABCG5 Q604E and ABCG8 A632V, T400K, D19H and C54Y). Login to comment
243 This might be explained by the fact that carriers of ABCG8 D19H and A632V SNPs are rare among Japanese compared to Caucasian populations. Login to comment
244 Interestingly, in 1046 Chinese, Chen et al. [43] observed that the heterozygote of ABCG8 D19H had higher serum total and LDL-C levels than homozygote DD, which is opposite to the effect observed in Caucasian populations. Login to comment
254 Recently, in 845 self-identified Puerto Ricans from Boston, Junyent et al. [38] reported that ABCG5/G8 (i7892T.C, rs4131229; 5U145A.C, rs3806471; Y54C; T400K) SNPs were significantly associated with HDL-C concentrations. Login to comment
257 Carriers of the minor alleles at ABCG5/G8 (Q604E, D19H, i14222 A.G, rs6709904) SNPs displayed lower levels of HDL-C only if they were smokers. Login to comment
180 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment
210 The association of ABCG8 D19H and LDL-C levels was recently replicated in a GWA study (P = 1610211 ) [11]. Login to comment
224 The remaining SNPs (Q604E, D19H, Y54C, and T400K) were not associated with plasma lipid levels [60]. Login to comment
229 Based on the HapMap CEU data, these SNPs are in complete LD with each other and with D19H that showed similar association result. Login to comment
240 However, no difference was observed in serum lipid profiles in relation to common SNPs studied previously in Caucasian populations (ABCG5 Q604E and ABCG8 A632V, T400K, D19H and C54Y). Login to comment
255 Carriers of the minor alleles at ABCG5/G8 (Q604E, D19H, i14222 A.G, rs6709904) SNPs displayed lower levels of HDL-C only if they were smokers. Login to comment
181 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment
211 The association of ABCG8 D19H and LDL-C levels was recently replicated in a GWA study (P = 1610211 ) [11]. Login to comment
213 Decreased LDL-C levels of atorvastatin treatment were not associated with the ABCG8 D19H SNP [57]. Login to comment
225 The remaining SNPs (Q604E, D19H, Y54C, and T400K) were not associated with plasma lipid levels [60]. Login to comment
230 Based on the HapMap CEU data, these SNPs are in complete LD with each other and with D19H that showed similar association result. Login to comment

PMID: 21862702 [PubMed] Calandra S et al: "Mechanisms and genetic determinants regulating sterol absorption, circulating LDL levels, and sterol elimination: implications for classification and disease risk."

No. Sentence Comment

93 GLGC(32)1)rs2072183 (rs41279633) c.816C>G(L272L)G(0.25)Z=-6.527,(P=7×10-11 )Totalcholesterol,-2.01mg/dlpercopy (Z=-6.636,P=3×10 -11 ) 2)rs17655652c.-133A>GG(NA)Z=-5.083,(P=4×10 -7 )Totalcholesterol,Z=-4.778,(P=2×10 -6 ) ABCG8142healthyAmericans(94)1)rs11887534c.55G>C(D19H)CNotdeterminedCarriers(n=14)lowerplasmaphytosterol (Ca233versus338␮g/dl,Si177versus 257␮g/dl,P<0.01). Login to comment
94 262Finnishwithmildto moderatehypercholesterolemia (95) 1)rs11887534c.55G>C(D19H)C(0.15)-13%incarriers(P<0.05)Increasedfrequencyinlow(0.26)versus intermediate(0.13)/highcholesterol 'absorbers`(0.06)(P<0.001) Meta-analysisoffourstudies: healthyindividuals,primarily Caucasianorigin(96) 1)rs11887534c.55G>C(D19H)C(0.12)NotdeterminedLowerCa:cholesterolratio(~cholesterol absorption)incarriers(n=83)versus noncarriers(n=591),(WMD -0.50µg/mg,[95%CI-0.80to -0.20µg/mg],P=0.001).Higher La:cholesterolratio(~cholesterol synthesis)incarriers(n=79)versus noncarriers(n=541),(WMD+0.26µg/mg, [95%CI0.10to0.41µg/mg],P=0.001). Login to comment
98 96Germangallstonedisease (GD)casesand205controls/ Replicationin1105cases and873controls(98) 1)rs11887534c.55G>C(D19H)C(0.18/ 0.05/0.10/0.05) NotdeterminedAssociatedwithGD(P=2x10 -6 / P=4x10 -9 ).CarrierORcombinedsamples, 2.2[95%CI1.8-2.6],P=1.14×10 -14 . Login to comment
100 226IndianGDpatientsplus 222controls(102) 1)rs11887534c.55G>C(D19H)C(0.08/0.04)NotdeterminedAssociatedwithGD(P=0.017). Login to comment
102 GeneSample(Reference)TypedVariant(Proxy)a Positionb (Effect)Allelec (MAF)EffectonLDL-COtherAssociatedTraits/Comments Danishpopulationstudy (n=62,279)withmean follow-upperiodof31years fordevelopmentofgallstone disease(103) 1)rs11887534c.55G>C(D19H)C(0.06)G/C-1.6%andC/C-2.4% versusnoncarriers(P<0.001) Totalcholesterol-3.5%(G/C)and-4.5% (C/C)versusnoncarriers(P<0.001).11% ofallgallstonesattributabletoD19H.HR, 1.9[95%CI1.7-2.1]forG/C,3.3[95%CI 2.3-4.6]forC/C. Login to comment
103 GLGC(32)1)rs11887534c.55G>C(D19H)C(NA)Z=-11.715(P=1x10- 31 ) +2.75mg/dlpercopy (Z=14.476,P=2×10 -47 ) Totalcholesterol,Z=-11.13(P=9×10 -29 ) Totalcholesterol+3.01mg/dl percopy(Z=14.076,P=4×10 -45 ) 2)rs4299376 (rs4245791) c.166-718G>TG(0.30) CYP7A1GLGC(32)1)rs2081687~14kbdownstreamT(0.35)Z=5.64,(P=2×10 -8 )Totalcholesterol+1.23mg/dlperallele (Z=7.037,P=2×10 -12 ) a Independentvariants/associationsarenumbered."Proxy"variantisinstronglinkagedisequilibriumwithgenotypedvariant. Login to comment
192 Prior to GLGC (32), three small studies had indicated that the D19H ABCG8 variant (or allele in strong LD (e.g., rs41360247), represents a gain-of-function (94- 96) as 19H carriers had plasma sterol profiles suggestive of increased sterol efflux plus a compensatory rise in de novo cholesterol synthesis (Table 1). Login to comment

PMID: 21538282 [PubMed] Krawczyk M et al: "Dissecting the genetic heterogeneity of gallbladder stone formation."

No. Sentence Comment

56 The most informative SNP proved to be the coding variant p.D19H of the heterodimeric cholesterol transporter ABCG8. Login to comment
57 The odds ratio of developing gallstones among heterozygous carriers of the p.D19H risk variant was 2.2 (95% CI, 1.8-2.6; P ¼ 1.4 Â 10 À14 ). Login to comment
60 The NPL score demonstrated significant (NPL score ¼ 7.1, P ¼ 4.6 Â 10À13 ) linkage between the ABCG8 p.D19H variant and gallstone disease.69 As shown in detail in Table 2, the association between the ABCG8 variant and gallstones has subsequently been replicated in other cohorts, including the Swedish Twin Registry.70-73 The most recent study from Denmark72 illustrated that the absolute 10-year risk for symptomatic gallstone disease increases from men to women, with increasing age, with increasing BMI, and by p.D19H genotype (Fig. 3). Login to comment
61 Of note, the orthologous murine genes encoding the cholesterol transporter (Abcg5/g8) were previously also identified as lithogenic genes (Lith9) in inbred Figure 3 Absolute 10-year risk of gallstone disease as a function of gender, age, body mass index (BMI) and ABCG8 p.D19H risk genotype (from72 with permission John Wiley and Sons, Inc.). Login to comment
62 Table 2 Studies Investigating the Role of ABCG8 p.D19H in Gallstone Disease Year Population N Odds Ratio Risk Allele Frequency % Buch et al68 2007 Germany 1.832 2.2, 7.1** 5.0 Chile 167 1.9 7.0 Gru¨nhage et al69 2007 Romania 178 3.0 8.5 Kuo et al71 2008 China 74 3.5 1.4 Katsika et al70 2010 Sweden 341 2.5 6.8 Siddapuram et al73 2010 India 226 2.3 8.2 Stender et al72 2011 Denmark 3.124 1.9*, 3.3** 6.4 OR values are given for the carriership of the 19H risk allele, except for *carriers of the heterozygous genotype DH, and **homozygous carriers of the HH genotype. Login to comment
84 In the future, common risk factors conferring moderate gallstone risk such as ABCG8 p.D19H might be genotyped in individual patients to stratify their gallstone risk (see below), but these tests are currently only used in the setting of diagnostic or epidemiologic studies. Login to comment

PMID: 20172523 [PubMed] Garcia-Rios A et al: "Genetic variations at ABCG5/G8 genes modulate plasma lipids concentrations in patients with familial hypercholesterolemia."

No. Sentence Comment

22 Another study examined the relationship between SNPs in the ABCG8 gene (D19H and T400K) and plasma cholesterol concentrations in patients with heterozygous FH [12]. Login to comment
145 In this context, Koeijvoets et al. [12] explored the effect of two common ABCG8 (D19H and T400K) SNPs on lipids and CVD in 2,012 patients with heterozygous FH but did not find significant associations with plasma lipid concentrations. Login to comment
151 Consistent with both studies [11,12] we did not find associations between D19H, T400K and C54Y SNPs and plasma lipid concentrations. Login to comment
152 However, in contrast to Miwa et al. our data showed association between Q604E SNP and VLDL-C and TG concentrations. Login to comment
154 Additionally, Santosa et al. [10] examined the association of four SNPs at ABCG5 (Q604E, i7892, i18429 and M216) and four ABCG8 (C54Y, D19H, i14222 and T400K) with plasma lipids concentrations in 35 young women with mildly hypercholesterolemia. Login to comment
155 They found that C54Y and Q604E SNPs were associated with the response of cholesterol metabolism to weight loss. Login to comment
146 In this context, Koeijvoets et al. [12] explored the effect of two common ABCG8 (D19H and T400K) SNPs on lipids and CVD in 2,012 patients with heterozygous FH but did not find significant associations with plasma lipid concentrations. Login to comment
21 Another study examined the relationship between SNPs in the ABCG8 gene (D19H and T400K) and plasma cholesterol concentrations in patients with heterozygous FH [12]. Login to comment
143 In this context, Koeijvoets et al. [12] explored the effect of two common ABCG8 (D19H and T400K) SNPs on lipids and CVD in 2,012 patients with heterozygous FH but did not find significant associations with plasma lipid concentrations. Login to comment
149 Consistent with both studies [11,12] we did not find associations between D19H, T400K and C54Y SNPs and plasma lipid concentrations. Login to comment

PMID: 19932478 [PubMed] Lu Y et al: "The potential influence of genetic variants in genes along bile acid and bile metabolic pathway on blood cholesterol levels in the population."

No. Sentence Comment

1748 Several polymorphisms in ABCG5 (Q604E, rs6720173) and ABCG8 (T400K, rs4148217; D19H, rs11887534; A632V, rs6544718; and Y54C, rs4148211) have been found to be associated with several facets of cholesterol metabolism, including cholesterol level, cholesterol kinetics, and individual responsiveness of blood cholesterol to dietary and pharmaceutical intervention [41]. Login to comment
1768 The finding of a consistent association between D19H and cholesterol metabolic kinetics (baseline cholesterol levels, cholesterol absorption and synthesis) suggests that the substitution of histidine for aspartic acid at amino acid 19 alters the function of ABCG8. Login to comment
1791 Based on the HapMap CEU data, these SNPs are in complete LD with each other and with D19H that showed similar association result. Login to comment
1796 However, no difference was observed in serum lipid profiles in relation to common polymorphisms studied previously in Caucasian populations [ABCG5 (Q604E) and ABCG8 (A632V, T400K, D19H and C54Y)]. Login to comment
1797 This might be explained by the fact that carriers of ABCG8 D19H and A632V polymorphisms are rare among Japanese compared to Caucasian populations. Login to comment
1798 Interestingly, in 1046 Chinese, Chen et al. [57] observed that the heterozygote D19H of ABCG8 had a higher serum total and LDL cholesterol levels than homozygote DD, which is opposite to the effect observed in Caucasian populations. Login to comment
1805 Carriers of the minor alleles at ABCG5/G8 (Q604E; D19H; i14222A > G, rs6709904) SNPs displayed lower levels of HDL cholesterol only if they were smokers. Login to comment
1858 No difference in LDL-C among the genotypes Hofman et al. [20] 715 male Dutch patients with coronary atherosclerosis No difference in TC, LDL-C and HDL-C among the genotypes, but lower reduction in serum TC in C allele carriers than AA in response to pravastatin Hegele et al. [21] 594 Hutterites Higher HDL-C and apoA-I levels in C allele carriers than AA Hegele et al. [21] 190 Keewatin Inuit subjects Lower TC and LDL-C in major C allele carriers than AA Hegele et al. [21] 325 OjiCree subjects No association was observed Han et al. [22] 1102 Micronesians Higher apoA-I levels in rare CC than AA Kajinami et al. [24] 324 hypercholesterolemic subjects, mainly Caucasians Less LDL-C reduction in C allele carriers after atorvastatin treatment, more striking in men and in ␧2 or ␧4 carriers of APOE Kajinami et al. [25] 337 hypercholesterolemic subjects, mainly Caucasians Less LDL-C reduction in C allele carriers after atorvastatin treatment only in ABCG8 D19H variant carriers or ABCG8 homozygote (54CC, 400TT, and 632AA) Hofman et al. [27] 209 Caucasians for TC response and 179 Caucasians for HDL-C response Higher response of plasma TC and HDL-C in C allele carriers after an increase in dietary cholesterol intake Kovar et al. [28] 11 healthy Czech men (6 CC homozygotes and 5 AA homozygotes) Increased serum TC and LDL-C in CC after a high-fat diet challenge, which was not observed in AA. Login to comment
1861 Genes Genetic variant Reference Study population Observed associationb ABCG8 D19H (rs11887534, G > C) Gylling et al. [45] 262 mildly to moderately hypercholesterolemic Finnish subjects Lower TC and LDL-C in H allele carriers than DD, no difference in HDL-C Junyent et al. [47] 845 self-identified Puerto Ricans Lower TC and LDL-C in H allele carriers than DD, no difference in HDL-C Santosa et al. [48] 42 overweight/obese Canadian women Lower TC and LDL-C in H allele carriers than DD Acalovschi et al. [49] 68 Romanian siblings with gallstone disease Lower TC in H allele carriers than DD, no difference in HDL-C Kajinami et al. [52] 338 hypercholesterolemic subjects, mainly Caucasians Lower TC in H allele carriers than DD, no difference in LDL-C and HDL-C Koeijvoets et al. [53] 2012 Dutch patients with heterozygous familial hypercholesteroemia No difference in TC, LDL-C and HDL-C Kajinami et al. [25] 337 hypercholesterolemic subjects, mainly Caucasians Larger reduction in LDL-C in H allele carriers than DD in response to atorvastatin Kajinami et al. [52] 338 hypercholesterolemic subjects, mainly Caucasians Larger reduction in LDL-C in H allele carriers than DD in response to atorvastatin, no difference in change of TC and HDL-C Gylling et al. [45] 262 mildly to moderately hypercholesterolemic Finnish subjects H allele more common in the low cholesterol absorption tertile compared with intermediate and high absorption group Berge et al. [44] 142 healthy American Caucasians Lower cholesterol absorption marker sterols (serum cholesterol adjusted campesterol, sitosterol, and cholestanol levels) in H allele carriers than DD Chen et al. [57] 1046 Chinese recruited from the general population Higher TC and LDL-C in heterozygote D19H than homozygote DD, no difference in HDL-C Gylling et al. [45] 262 mildly to moderately hypercholesterolemic Finnish subjects Lower cholesterol absorption marker sterols (serum cholesterol adjusted campesterol, sitosterol, and cholestanol levels) and higher cholesterol synthesis marker sterols (serum cholesterol adjusted cholestenol and lathosterol levels) in H allele carriers than DD ABCG8 T400K(rs4148217, C > A) Berge et al. [44] 143 healthy American Caucasians No difference in TC. Login to comment

PMID: 19917453 [PubMed] Torres N et al: "Reduction of serum lipids by soy protein and soluble fiber is not associated with the ABCG5/G8, apolipoprotein E, and apolipoprotein A1 polymorphisms in a group of hyperlipidemic Mexican subjects."

No. Sentence Comment

148 It has been observed in a previous study that hypercholesterolemic subjects with the ABCG8 52 G/C polymorphism (ABCG8 D19H) had a better response to statin treatment than did subjects with the wild-type genotype [22]. Login to comment

PMID: 19217458 [PubMed] Gylling H et al: "The metabolism of plant sterols is disturbed in postmenopausal women with coronary artery disease."

No. Sentence Comment

34 Sequence variations in D19H [18,19] and T400K [18] of ABCG8 were associated with low serum plant sterol [18,19] and high serum synthesis marker [19] ratios to cholesterol in earlier studies. Login to comment

PMID: 19071091 [PubMed] Jiang ZY et al: "Increased NPC1L1 and ACAT2 expression in the jejunal mucosa from Chinese gallstone patients."

No. Sentence Comment

78 Although two of the polymorphisms, D19H and A632V, frequently are occurring among Caucasian populations [23], they are rare in ethnic Chinese [24]. Login to comment
125 Polymorphisms within the ABCG5 and ABCG8 genes have been reported to associate with gallstone disease, as the frequency of D19H in the latter was higher in German and Chilean patients [23,34]. Login to comment

PMID: 18641716 [PubMed] Rudkowska I et al: "Association between non-responsiveness to plant sterol intervention and polymorphisms in cholesterol metabolism genes: a case-control study."

No. Sentence Comment

122 Furthermore, two studies showed an association between the ABCG8 D19H (rs11887534) polymorphism and the proportional reduction in LDL-C during statin intervention (Kajinami et al. 2004b; Gylling et al. 2004). Login to comment

PMID: 17612515 [PubMed] Wang Y et al: "ATP binding cassette G8 T400K polymorphism may affect the risk of gallstone disease among Chinese males."

No. Sentence Comment

2 To investigate a possible association between transporter gene polymorphism and gallstone formation, we examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) genes in patients with gallstone disease (GS). Login to comment
24 Of these variants, it is suggested that 5 non-synonymous single nucleotide polymorphisms (SNPs) in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) coding sequences may effect plasma plant sterol or cholesterol levels [11-14]. Login to comment
42 Polymorphism of ABCG8 D19H was analyzed using real-time PCR (Taqman MGB assay). Login to comment
72 Table 2 Linkage disequilibrium in 5 common polymorphisms of ABCG5 and ABCG8 genes D' Locus Q604E D19H Y54C T400K A632V r2 Q604E - 0.368 0.007 0.477 0.087 D19H 0.009 - 0.843 0.718 1.000 Y54C 0.000 0.045 - 0.824 0.211 T400K 0.003 0.000 0.579 - 1.000 A632V 0.000 0.000 0.000 0.001 - D' and r2 were calculated from all 506 subjects in the study. Login to comment
78 Because mutation alleles D19H and A632V were rare in this study, the estimated D' values of these alleles and other SNPs may be inflated as suggested by Ardlie et al. [19]. Login to comment
79 Thus, only the Y54C and T400K SNPs showed strong linkage disequilibrium (D'N0.8, r2 N1/3) [19]. Login to comment
82 No differences were observed when the frequencies of ABCG5 Q604E, ABCG8 D19H, and Y54C and A632V were compared between GS and Table 3 Frequency distribution of the different genotypes and alleles of 5 common ABCG5 and ABCG8 polymorphisms in GS and GSF Polymorphism All (%) Men (%) Women (%) GS GSF GS GSF GS GSF (n=287) (n=219) (n=121) (n=105) (n=166) (n=114) ABCG5:Q604E QQ 78.7 80.4 78.5 78.1 78.9 82.5 QE 20.9 18.7 21.5 20.0 20.5 17.5 EE 0.3 0.9 0 1.9 0.6 0 E allele 10.8 10.3 10.7 11.9 10.8 8.8 OR [95% CI]a 0.95 [0.63~1.42] 1.12 [0.63~2.01] 0.79 [0.45~1.41] ABCG8:D19H DD 98.3 98.6 99.2 99.0 97.6 98.2 DH 1.7 1.4 0.8 1.0 2.4 1.8 HH 0 0 0 0 0 0 H allele 0.9 0.7 0.4 0.5 1.2 0.9 OR [95% CI] 1.27 [0.30~5.36] 0.87 [0.05~13.95] 1.38 [0.25~7.59] ABCG8:Y54C YY 77.4 79.9 76.0 83.8 78.3 76.3 YC 22.3 18.3 24.0 14.3 21.1 21.9 CC 0.3 1.8 0 1.9 0.6 1.8 C allele 11.5 11.0 12.0 9.0 11.1 12.7 OR [95% CI] 1.06 [0.71~1.57] 1.369 [0.74~2.52] 0.861 [0.51~1.45] ABCG8:T400K TT 79.1 83.1 75.2 87.6 81.9 78.9 TK 20.6 16.4 24.8b 12.4 17.5 20.2 KK 0.3 0.5 0 0 0.6 0.9 K allele 10.6 8.7 12.4c 6.2 9.3 11.0 OR [95% CI] 1.25 [0.82~1.92] 2.14 [1.09~4.23] 0.83 [0.48~1.46] ABCG8:A632V AA 99.0 99.1 99.2 100.0 98.8 98.2 AV 1.0 0.9 0.8 0 1.2 1.8 VV 0 0 0 0 0 0 V allele 0.5 0.5 0.4 0 2(0.6) 0.9 OR [95% CI] 0.87 [0.14~5.27] 0.382 [0.02~9.44]d 1.46 [0.20~10.44] a Odds ratio (OR) statistics and 95% confidence intervals (95% CI) were calculated from allele distributions. Login to comment
93 For simplicity, the haplotype inference followed the same direction from ABCG5 D19H to ABCG8 A632V which is shown in Table 5. Login to comment
98 Plasma and biliary lipid analysis Since the ABCG8 D19H and A632V mutation alleles were rare in our study (frequencyb1%), we only compared plasma and biliary lipid levels between the alleles of the other 3 polymorphisms. Login to comment
99 Due to limited number of subjects, heterozygous and homozygous carriers of the genetic variants were combined as follows: ABCG5 Q604E (QE+EE), ABCG8 Y54C (YC+CC), and ABCG8 (TK+KK). Login to comment
125 Berge et al. [11] were the first to report that the ABCG8 D19H and T400K polymorphisms were associated with a lower concentration of plant sterols in both parents and their offspring. Login to comment
73 Table 2 Linkage disequilibrium in 5 common polymorphisms of ABCG5 and ABCG8 genes D' Locus Q604E D19H Y54C T400K A632V r2 Q604E - 0.368 0.007 0.477 0.087 D19H 0.009 - 0.843 0.718 1.000 Y54C 0.000 0.045 - 0.824 0.211 T400K 0.003 0.000 0.579 - 1.000 A632V 0.000 0.000 0.000 0.001 - D' and r2 were calculated from all 506 subjects in the study. Login to comment
83 No differences were observed when the frequencies of ABCG5 Q604E, ABCG8 D19H, and Y54C and A632V were compared between GS and Table 3 Frequency distribution of the different genotypes and alleles of 5 common ABCG5 and ABCG8 polymorphisms in GS and GSF Polymorphism All (%) Men (%) Women (%) GS GSF GS GSF GS GSF (n=287) (n=219) (n=121) (n=105) (n=166) (n=114) ABCG5:Q604E QQ 78.7 80.4 78.5 78.1 78.9 82.5 QE 20.9 18.7 21.5 20.0 20.5 17.5 EE 0.3 0.9 0 1.9 0.6 0 E allele 10.8 10.3 10.7 11.9 10.8 8.8 OR [95% CI]a 0.95 [0.63~1.42] 1.12 [0.63~2.01] 0.79 [0.45~1.41] ABCG8:D19H DD 98.3 98.6 99.2 99.0 97.6 98.2 DH 1.7 1.4 0.8 1.0 2.4 1.8 HH 0 0 0 0 0 0 H allele 0.9 0.7 0.4 0.5 1.2 0.9 OR [95% CI] 1.27 [0.30~5.36] 0.87 [0.05~13.95] 1.38 [0.25~7.59] ABCG8:Y54C YY 77.4 79.9 76.0 83.8 78.3 76.3 YC 22.3 18.3 24.0 14.3 21.1 21.9 CC 0.3 1.8 0 1.9 0.6 1.8 C allele 11.5 11.0 12.0 9.0 11.1 12.7 OR [95% CI] 1.06 [0.71~1.57] 1.369 [0.74~2.52] 0.861 [0.51~1.45] ABCG8:T400K TT 79.1 83.1 75.2 87.6 81.9 78.9 TK 20.6 16.4 24.8b 12.4 17.5 20.2 KK 0.3 0.5 0 0 0.6 0.9 K allele 10.6 8.7 12.4c 6.2 9.3 11.0 OR [95% CI] 1.25 [0.82~1.92] 2.14 [1.09~4.23] 0.83 [0.48~1.46] ABCG8:A632V AA 99.0 99.1 99.2 100.0 98.8 98.2 AV 1.0 0.9 0.8 0 1.2 1.8 VV 0 0 0 0 0 0 V allele 0.5 0.5 0.4 0 2(0.6) 0.9 OR [95% CI] 0.87 [0.14~5.27] 0.382 [0.02~9.44]d 1.46 [0.20~10.44] a Odds ratio (OR) statistics and 95% confidence intervals (95% CI) were calculated from allele distributions. Login to comment
94 For simplicity, the haplotype inference followed the same direction from ABCG5 D19H to ABCG8 A632V which is shown in Table 5. Login to comment
126 Berge et al. [11] were the first to report that the ABCG8 D19H and T400K polymorphisms were associated with a lower concentration of plant sterols in both parents and their offspring. Login to comment

PMID: 17543849 [PubMed] Gylling H et al: "Cholesterol synthesis prevails over absorption in metabolic syndrome."

No. Sentence Comment

23 In addition, weight reduction in type 2 diabetes increases the fractional absorption of cholesterol.8 Regarding the genetic regulation, the D19H polymorphism of the ABCG8 gene is more frequent in subjects with low than high absorption of cholesterol.10 These results suggest that cholesterol metabolism is interrelated to body weight and insulin action, and one possible regulatory pathway might be through the adenosine triphosphate cassette transporter system. Login to comment
111 Polymorphisms of the different genes tested were evenly distributed between MBO and controls (heterozygotesϩhomozygotes/wild type: ABCG8: D19H, MBO 16/56, controls 13/61; T400K, MBO 29/ 43, controls 26/48; A632V, MBO 27/45, controls 27/ 47; ABCG5: Q604E, MBO 16/56, controls 16/58). Login to comment
144 It has been shown earlier that the genetic polymorphisms of ABCG510 and ABCG810,20 were associated with variables of cholesterol metabolism, and the D19H polymorphism of the ABCG8 gene was overrepresented in subjects with low cholesterol absorption.10 In this study, the distribution of the common polymorphisms of these genes did not differ between MBO and controls. Login to comment
22 In addition, weight reduction in type 2 diabetes increases the fractional absorption of cholesterol.8 Regarding the genetic regulation, the D19H polymorphism of the ABCG8 gene is more frequent in subjects with low than high absorption of cholesterol.10 These results suggest that cholesterol metabolism is interrelated to body weight and insulin action, and one possible regulatory pathway might be through the adenosine triphosphate cassette transporter system. Login to comment
110 Polymorphisms of the different genes tested were evenly distributed between MBO and controls (heterozygotesaf9;homozygotes/wild type: ABCG8: D19H, MBO 16/56, controls 13/61; T400K, MBO 29/ 43, controls 26/48; A632V, MBO 27/45, controls 27/ 47; ABCG5: Q604E, MBO 16/56, controls 16/58). Login to comment
143 It has been shown earlier that the genetic polymorphisms of ABCG510 and ABCG810,20 were associated with variables of cholesterol metabolism, and the D19H polymorphism of the ABCG8 gene was overrepresented in subjects with low cholesterol absorption.10 In this study, the distribution of the common polymorphisms of these genes did not differ between MBO and controls. Login to comment

PMID: 17098593 [PubMed] Acalovschi M et al: "Are plasma lipid levels related to ABCG5/ABCG8 polymorphisms? A preliminary study in siblings with gallstones."

No. Sentence Comment

7 Triglyceride levels were higher in carriers of the common alleles for ABCG5 Q604E and ABCG8 D19H sequence variants, and HDL-cholesterol was lower in carriers of the common alleles for ABCG5 Q604E than in carriers of the rare alleles. Login to comment
54 Genotype analysis The patients were genotyped for the ABCG5 single nucleotide polymorphism (SNP) Q604E and the ABCG8 SNPs D19H, Y54C, T400K, and A632V [5,11,12] by TaqMan allelic discrimination. Login to comment
78 Triglyceride levels in the carriers of the common alleles were higher than in the carriers of the rare alleles for the ABCG5 Q604E ( p=0.002), ABCG8 D19H ( p=0.058), and ABCG8 Y54C ( p=0.050) sequence variants (Table 4). Login to comment
79 The cholesterol levels, although within normal ranges, were higher in carriers of the common versus rare alleles for the ABCG5 Q604E polymorphism ( p=0.011) and for the ABCG8 D19H polymorphism ( p=0.052). Login to comment
109 Variation in plasma concentrations of non-cholesterol sterols has been demonstrated to be highly heritable, and D19H and T400K polymorphisms in ABCG8 have been found to contribute to genetic variations in the plasma concentrations of plant sterols [10]. Login to comment
110 Other polymorphisms in ABCG8 (A632V [10], T400K, and Y54C [27]) and in ABCG5 (Q604E [28]) have been suggested to be associated with plasma cholesterol levels. Login to comment
111 In our siblings with gallstones we found significantly higher plasma triglyceride levels in carriers of the common alleles for the polymorphisms Q604E in ABCG5 and D19H and Y54C in ABCG8 than in carriers of the rare alleles. Login to comment
112 HDL-cholesterol levels were lower in carriers of the common alleles of the Q604E polymorphism in ABCG5. Login to comment
113 Cholesterol levels were higher in carriers of the common alleles of the Q604E polymorphism in ABCG5 and the D19H variant in ABCG8. Login to comment
114 Because the Q604E polymorphism in the ABCG5 gene was associated with the most significant plasma lipid changes in the affected siblings, our results suggest that this polymorphism might be responsible for an altered function of the ABCG5 transporter in gallstone patients. Login to comment
115 Similarly, the D19H polymorphism in the ABCG8 gene could alter the function of the ABCG8 transporter and might also be linked to cholesterol gallstone susceptibility. Login to comment
119 Plasma lipids in affected siblings Table 4 Plasma triglycerides, cholesterol, and HDL-cholesterol in the 68 siblings with gallstones in relation to ABCG5/G8 genotypes (bold indicates pb0.05) Triglycerides (mg/dl) Cholesterol (mg/dl) HDL cholesterol (mg/dl) ABCG8 A632V CT/TT=28 155.5±57.3 205.7±32.6 48.1±13.2 CC=44 154.1±67.3 204.6±39.2 45.6±18.2 T400K CA/AA=30 168.5±76.9 209.9±37.5 46.0±17.3 CC=42 144.7±50.1 201.5±35.8 48.2±14.4 Y54C AG/GG=44 144.5±58.4 202.7±39.6 44.9±17.0 AA=28 170.6±68.3 210.3±32.8 48.0±15.6 D19H GC/CC=12 130.9±52.6 192.5±27.3 49.0±19.5 GG=60 159.4±64.5 208.3±38.4 46.0±16.0 ABCG5 Q604E CG/GG=24 127.4±51.9 191.7±35.1 55.9±12.9 CC=48 168.2±64.5 212.7±36.3 42.7±15.7 did not correlate with those in controls. Login to comment
53 Genotype analysis The patients were genotyped for the ABCG5 single nucleotide polymorphism (SNP) Q604E and the ABCG8 SNPs D19H, Y54C, T400K, and A632V [5,11,12] by TaqMan allelic discrimination. Login to comment
77 Triglyceride levels in the carriers of the common alleles were higher than in the carriers of the rare alleles for the ABCG5 Q604E ( p=0.002), ABCG8 D19H ( p=0.058), and ABCG8 Y54C ( p=0.050) sequence variants (Table 4). Login to comment
108 Variation in plasma concentrations of non-cholesterol sterols has been demonstrated to be highly heritable, and D19H and T400K polymorphisms in ABCG8 have been found to contribute to genetic variations in the plasma concentrations of plant sterols [10]. Login to comment
118 Plasma lipids in affected siblings Table 4 Plasma triglycerides, cholesterol, and HDL-cholesterol in the 68 siblings with gallstones in relation to ABCG5/G8 genotypes (bold indicates pb0.05) Triglycerides (mg/dl) Cholesterol (mg/dl) HDL cholesterol (mg/dl) ABCG8 A632V CT/TT=28 155.5&#b1;57.3 205.7&#b1;32.6 48.1&#b1;13.2 CC=44 154.1&#b1;67.3 204.6&#b1;39.2 45.6&#b1;18.2 T400K CA/AA=30 168.5&#b1;76.9 209.9&#b1;37.5 46.0&#b1;17.3 CC=42 144.7&#b1;50.1 201.5&#b1;35.8 48.2&#b1;14.4 Y54C AG/GG=44 144.5&#b1;58.4 202.7&#b1;39.6 44.9&#b1;17.0 AA=28 170.6&#b1;68.3 210.3&#b1;32.8 48.0&#b1;15.6 D19H GC/CC=12 130.9&#b1;52.6 192.5&#b1;27.3 49.0&#b1;19.5 GG=60 159.4&#b1;64.5 208.3&#b1;38.4 46.0&#b1;16.0 ABCG5 Q604E CG/GG=24 127.4&#b1;51.9 191.7&#b1;35.1 55.9&#b1;12.9 CC=48 168.2&#b1;64.5 212.7&#b1;36.3 42.7&#b1;15.7 did not correlate with those in controls. Login to comment

PMID: 15530894 [PubMed] Kajinami K et al: "Pharmacogenetics of HMG-CoA reductase inhibitors: exploring the potential for genotype-based individualization of coronary heart disease management."

No. Sentence Comment

1340 In 338 subjects with hypercholesterolemia, the variant allele of the ABCG8 D19H polymorphism was significantly associated with a greater reduction in LDL-C, 40% versus 36%, in response to atorvastatin 10 mg. Login to comment
1341 Berge et al. [76] have previously reported a significant relationship between the D19H variant and concentrations of plasma cholestanol, a marker for intestinal cholesterol absorption. Login to comment
1423 Combination analysis of ABCG8 D19H and CYP7A1 promoter polymorphisms (A-204C) was more informative (absolute difference across groups was 8.5%), in terms of categorizing patients by treatment response than is the analysis of each polymorphism individually (3.0% in ABCG8 and 4.2% in CYP7A1) [112]. Login to comment
1339 In 338 subjects with hypercholesterolemia, the variant allele of the ABCG8 D19H polymorphism was significantly associated with a greater reduction in LDL-C, 40% versus 36%, in response to atorvastatin 10 mg. Login to comment
1422 Combination analysis of ABCG8 D19H and CYP7A1 promoter polymorphisms (A-204C) was more informative (absolute difference across groups was 8.5%), in terms of categorizing patients by treatment response than is the analysis of each polymorphism individually (3.0% in ABCG8 and 4.2% in CYP7A1) [112]. Login to comment

PMID: 15262185 [PubMed] Kajinami K et al: "Interactions between common genetic polymorphisms in ABCG5/G8 and CYP7A1 on LDL cholesterol-lowering response to atorvastatin."

No. Sentence Comment

4 Combination analysis of these polymorphisms explained a greater percentage of LDL cholesterol response variation (8.5% difference across subgroups) than did single polymorphism analysis (4.2% in CYP7A1 and 3.0% in ABCG8 D19H). Login to comment
26 Very recently, we reported that the ABCG8 D19H polymorphism was significantly and independently associated with a greater LDL cholesterol reduction after atorvastatin treatment [15], which raises the possibility that this variant is associated with a gain of function of the ABCG8 protein. Login to comment
43 The set of polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and CYP7A1 (A-204C) was examined in 337 subjects from the atorvastatin (10 mg per day) arm. The means (±S.D.) of age and BMI were 58 ± 11 years old and 27.0 ± 3.0 kg/m2, respectively [15]. Login to comment
53 The interaction between two genotypes was tested using two-way ANOVA and repeated measures of ANOVA for K.Kajinamietal./Atherosclerosis175(2004)287-293289 Table 1 Associations between ABCG8 D19H/CYP7A1 A-204C and the LDL-lowering response to atorvastatin* ABCG8 D19H All subjects CYP7A1 P-values among CYP7A1 genotype† Unadjusted Adjusted AA AC CC Additive Dominant Recessive Whole subjects DD 36.7 ± 10.1 36.6, 35.5-37.6 (293) 38.2, 36.2-40.2 (84) 36.6, 35.1-38.1 (142) 34.5, 32.3-36.8 (67) 0.078 0.078 0.054 DH + HH 38.9 ± 8.0 39.6, 36.9-42.4 (44) 42.7, 38.2-47.2 (16) 38.4, 34.7-42.2 (23) 34.7, 26.6-42.8 (5) 0.049 0.043 0.065 P-values among ABCG8 genotype 0.171 0.043 0.048 0.404 0.901 - - - All Adjusted - - 38.9, 37.1-40.7 (100) 36.9, 35.4-38.3 (165) 34.5, 32.4-36.7 (72) 0.010 0.014 0.013 Unadjusted 37.0 ± 9.8 (337) - 39.2 ± 8.9 37.0 ± 9.7 33.7 ± 10.7 0.001 0.006 0.001 Men DD 36.0 ± 10.7 35.8, 34.3-37.2 (173) 37.8, 35.2-40.4 (54) 35.7, 33.7-37.8 (83) 32.9, 29.8-36.1 (36) 0.089 0.084 0.063 DH + HH 37.3 ± 7.7 38.9, 35.4-42.5 (29) 41.9, 35.2-48.6 (8) 38.7, 34.2-43.3 (17) 33.0, 23.5-42.5 (4) 0.096 0.433 0.029 P-values among ABCG8 genotype 0.544 0.109 0.241 0.288 0.974 - - - All Adjusted - - 38.4, 36.0-40.7 (62) 36.3, 34.4-38.1 (100) 32.8, 29.8-35.8 (40) 0.020 0.039 0.015 Unadjusted 36.2 ± 10.3 (202) - 38.7 ± 9.2 36.5 ± 10.6 31.8 ± 10.1 0.004 0.022 0.002 Women DD 37.6 ± 9.0 37.6, 36.1-39.2 (120) 38.5, 35.3-40.1 (30) 37.9, 35.6-40.1 (59) 36.4, 33.3-39.5 (31) 0.644 0.562 0.372 DH + HH 41.9 ± 8.0 41.6, 37.1-46.0 (15) 44.8, 38.7-50.9 (8) 37.1, 30.1-44.2 (6) 42.8, 25.6-59.9 (1) 0.188 0.077 0.915 P-values among ABCG8 genotype 0.083 0.101 0.049 0.826 0.539 - - - All Adjusted - - 39.8, 37.0-42.6 (38) 37.8, 35.7-39.9 (65) 36.6, 33.6-39.7 (32) 0.312 0.161 0.294 Unadjusted 38.1 ± 9.0 (135) - 40.1 ± 8.3 37.9 ± 8.0 36.1 ± 11.1 0.179 0.108 0.154 P-values in testing genotype interaction between ABCG8 and CYP7A1 were 0.585, 0.669, and 0.532 in whole subjects, when additive, dominant, and recessive models for CYP7A1 genotype were used, respectively. Login to comment
62 Interaction between the ABCG8 D19H and CYP7A1 A-204C polymorphisms The mean percent reductions of LDL cholesterol according to genotype combination are shown in Tables 1-3. Login to comment
63 After adjustment for age and pretreatment LDL cholesterol levels, the D19H variant allele was significantly associated with a greater reduction of LDL cholesterol after atorvastatin treatment, as compared to wild type allele homozygotes (39.6% versus 36.6%, P = 0.043) (Table 1). Login to comment
66 In contrast, the CYP7A1 A-204C variant allele has diminishing effects on LDL cholesterol response, regardless of ABCG8 D19H genotype. Login to comment
67 Direct interaction between these two polymorphisms tested by two-way ANOVA failed to reach statistical significance due to small number of homozygotes for the CYP7A1 A-204C variant allele who also carried the ABCG8 D19H variant allele (n = 5). Login to comment
68 As for mean percent increase of HDL cholesterol from baseline value, no significant differences were observed across CYP7A1 A-204C genotypes (7.9, 6.6, and 9.4% in wild type allele homozygotes, variant allele heterozygotes, and homozygotes, respectively), and ABCG8 D19H genotypes (7.6 and 7.3% increase in wild type allele homozygotes and variant allele carriers, respectively). Login to comment
72 In addition, the differences in LDL cholesterol reduction across these four groups, as defined by two polymorphism analyses (8.5%), were more than two-fold greater than those observed across the groups defined by single polymorphism analysis (4.2% in CYP7A1 A-204C and 3.0% in ABCG8 D19H). Login to comment
92 Additionally, ABCG8 D19H genotype nearly reached statistical significance (P = 0.075, regression coefficient = 0.092). Login to comment
94 Interaction between other ABCG5/G8 polymorphisms and the CYP7A1 A-204C polymorphism Among the remaining four polymorphisms in ABCG5/G8 (Tables 2 and 3), only Y54C showed a potential interaction with the CYP7A1 A-204C polymorphism. Login to comment
97 We again reclassified subjects to test cumulative allele effects, as we had done for the ABCG8 D19H variant. Login to comment
98 In this case, the differences in LDL cholesterol reduction across the newly categorized groups were 5.5% in a dominant model for Y54C, and 7.5% in a recessive model, both of which were smaller than those observed for the D19H polymorphism (8.5%, Fig. 1). Login to comment
99 Stepwise multiple regression analysis also failed to show any significant association between LDL cholesterol reduction and Y54C genotype in any type of model (data not shown). Login to comment
102 Our chief observations were that: (1) among five polymorphisms tested in ABCG5/G8, only D19H has the potential to influence the effects of the CYP7A1 A-204C polymorphism (enhancing the drug response), and (2) combination analysis of these two polymorphisms enabled us to identify a subgroup showing a more striking response to treatment, as compared to single locus analysis. Login to comment
106 In addition, the fact that the difference in LDL cholesterol reduction between non-carriers and carriers of the ABCG8 D19H variant allele decreased in accordance with the number of CYP7A1 A-204C variant alleles (Table 1) raises the possibility that unaffected promoter activity of CYP7A1 is important for the expression of gain of function variant in ABCG8. Login to comment
107 In our study subjects, there were no significant differences in pretreatment LDL cholesterol levels among groups defined by CYP7A1 A-204C genotype, those defined by ABCG8 D19H genotype, or those defined by the combination of both genotypes. Login to comment
113 As observed in Fig. 1, subjects who are homozygous for both CYP7A1 A-204C variant allele and ABCG8 D19H wild type allele would be expected as poor responder. Login to comment
27 Very recently, we reported that the ABCG8 D19H polymorphism was significantly and independently associated with a greater LDL cholesterol reduction after atorvastatin treatment [15], which raises the possibility that this variant is associated with a gain of function of the ABCG8 protein. Login to comment
44 The set of polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and CYP7A1 (A-204C) was examined in 337 subjects from the atorvastatin (10 mg per day) arm. The means (&#b1;S.D.) of age and BMI were 58 &#b1; 11 years old and 27.0 &#b1; 3.0 kg/m2, respectively [15]. Login to comment
54 The interaction between two genotypes was tested using two-way ANOVA and repeated measures of ANOVA for Table 1 Associations between ABCG8 D19H/CYP7A1 A-204C and the LDL-lowering response to atorvastatin* ABCG8 D19H All subjects CYP7A1 P-values among CYP7A1 genotypeߤ Unadjusted Adjusted AA AC CC Additive Dominant Recessive Whole subjects DD 36.7 &#b1; 10.1 36.6, 35.5-37.6 (293) 38.2, 36.2-40.2 (84) 36.6, 35.1-38.1 (142) 34.5, 32.3-36.8 (67) 0.078 0.078 0.054 DH + HH 38.9 &#b1; 8.0 39.6, 36.9-42.4 (44) 42.7, 38.2-47.2 (16) 38.4, 34.7-42.2 (23) 34.7, 26.6-42.8 (5) 0.049 0.043 0.065 P-values among ABCG8 genotype 0.171 0.043 0.048 0.404 0.901 - - - All Adjusted - - 38.9, 37.1-40.7 (100) 36.9, 35.4-38.3 (165) 34.5, 32.4-36.7 (72) 0.010 0.014 0.013 Unadjusted 37.0 &#b1; 9.8 (337) - 39.2 &#b1; 8.9 37.0 &#b1; 9.7 33.7 &#b1; 10.7 0.001 0.006 0.001 Men DD 36.0 &#b1; 10.7 35.8, 34.3-37.2 (173) 37.8, 35.2-40.4 (54) 35.7, 33.7-37.8 (83) 32.9, 29.8-36.1 (36) 0.089 0.084 0.063 DH + HH 37.3 &#b1; 7.7 38.9, 35.4-42.5 (29) 41.9, 35.2-48.6 (8) 38.7, 34.2-43.3 (17) 33.0, 23.5-42.5 (4) 0.096 0.433 0.029 P-values among ABCG8 genotype 0.544 0.109 0.241 0.288 0.974 - - - All Adjusted - - 38.4, 36.0-40.7 (62) 36.3, 34.4-38.1 (100) 32.8, 29.8-35.8 (40) 0.020 0.039 0.015 Unadjusted 36.2 &#b1; 10.3 (202) - 38.7 &#b1; 9.2 36.5 &#b1; 10.6 31.8 &#b1; 10.1 0.004 0.022 0.002 Women DD 37.6 &#b1; 9.0 37.6, 36.1-39.2 (120) 38.5, 35.3-40.1 (30) 37.9, 35.6-40.1 (59) 36.4, 33.3-39.5 (31) 0.644 0.562 0.372 DH + HH 41.9 &#b1; 8.0 41.6, 37.1-46.0 (15) 44.8, 38.7-50.9 (8) 37.1, 30.1-44.2 (6) 42.8, 25.6-59.9 (1) 0.188 0.077 0.915 P-values among ABCG8 genotype 0.083 0.101 0.049 0.826 0.539 - - - All Adjusted - - 39.8, 37.0-42.6 (38) 37.8, 35.7-39.9 (65) 36.6, 33.6-39.7 (32) 0.312 0.161 0.294 Unadjusted 38.1 &#b1; 9.0 (135) - 40.1 &#b1; 8.3 37.9 &#b1; 8.0 36.1 &#b1; 11.1 0.179 0.108 0.154 P-values in testing genotype interaction between ABCG8 and CYP7A1 were 0.585, 0.669, and 0.532 in whole subjects, when additive, dominant, and recessive models for CYP7A1 genotype were used, respectively. Login to comment
64 After adjustment for age and pretreatment LDL cholesterol levels, the D19H variant allele was significantly associated with a greater reduction of LDL cholesterol after atorvastatin treatment, as compared to wild type allele homozygotes (39.6% versus 36.6%, P = 0.043) (Table 1). Login to comment
69 As for mean percent increase of HDL cholesterol from baseline value, no significant differences were observed across CYP7A1 A-204C genotypes (7.9, 6.6, and 9.4% in wild type allele homozygotes, variant allele heterozygotes, and homozygotes, respectively), and ABCG8 D19H genotypes (7.6 and 7.3% increase in wild type allele homozygotes and variant allele carriers, respectively). Login to comment
73 In addition, the differences in LDL cholesterol reduction across these four groups, as defined by two polymorphism analyses (8.5%), were more than two-fold greater than those observed across the groups defined by single polymorphism analysis (4.2% in CYP7A1 A-204C and 3.0% in ABCG8 D19H). Login to comment
100 In this case, the differences in LDL cholesterol reduction across the newly categorized groups were 5.5% in a dominant model for Y54C, and 7.5% in a recessive model, both of which were smaller than those observed for the D19H polymorphism (8.5%, Fig. 1). Login to comment
104 Our chief observations were that: (1) among five polymorphisms tested in ABCG5/G8, only D19H has the potential to influence the effects of the CYP7A1 A-204C polymorphism (enhancing the drug response), and (2) combination analysis of these two polymorphisms enabled us to identify a subgroup showing a more striking response to treatment, as compared to single locus analysis. Login to comment
108 In addition, the fact that the difference in LDL cholesterol reduction between non-carriers and carriers of the ABCG8 D19H variant allele decreased in accordance with the number of CYP7A1 A-204C variant alleles (Table 1) raises the possibility that unaffected promoter activity of CYP7A1 is important for the expression of gain of function variant in ABCG8. Login to comment
109 In our study subjects, there were no significant differences in pretreatment LDL cholesterol levels among groups defined by CYP7A1 A-204C genotype, those defined by ABCG8 D19H genotype, or those defined by the combination of both genotypes. Login to comment
115 As observed in Fig. 1, subjects who are homozygous for both CYP7A1 A-204C variant allele and ABCG8 D19H wild type allele would be expected as poor responder. Login to comment

PMID: 11452359 [PubMed] Lu K et al: "Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively."

No. Sentence Comment

169 OF IDENTIFIED POLYMORPHISMS HARDY-WEINBERG EQUILIBRIUM?ϩ/ϩ ϩ/- -/- ABCG5: 167CrT (Pro9Pro) Gain of BstNI … … … … 1950CrG (Gln604Glu) Loss of SmlI 46 25 1 Yes ABCG8: Exon 1 141CrT (Pro17Pro) … 49 1 0 Yes Exon 1 145GrC (Asp19His) Loss of BaeI 74 3 1 No Exon 2 251GrA (Cys54Tyr) Gain of SexAI 21 23 23 No Exon 6 802GrA (Glu238Lys) … 10 1 0 Yes Exon 6 866CrT (Ala259Val) Loss of HaeIII 0 5 0 … Exon 8 1289CrA (Thr400Lys) Gain of MseI 116 53 4 Yes Exon 11 1785CrT (Ala565Ala) Loss of MnlI 20 7 1 Yes Exon 11 1813GrC (Gly575Arg) Gain of HhaI 188 6 4 No Exon 13 1984CrT (Ala632Val) Loss of StyI 107 50 13 No 5 UTR -15ArC Gain of BstEII 47 4 0 Yes 5 UTR -19TrG Loss of Tsp451 38 42 29 No 5 UTR -41CrT Loss of DdeI 7 2 4 No Intron 1 -7CrT Loss of BsmAI 21 23 4 Yes Intron 1 -21CrA Loss of MnlI 20 23 4 Yes Intron 9 -19CrT … 1 3 4 … Intron 10 IVS10 ϩ34delCC … 3 1 4 … Intron 10 -50CrT … 4 4 2 … cohort of patients with sitosterolemia. Login to comment
170 af9;/af9; af9;/afa; afa;/afa; ABCG5: 167CrT (Pro9Pro) Gain of BstNI ߪ ߪ ߪ ߪ 1950CrG (Gln604Glu) Loss of SmlI 46 25 1 Yes ABCG8: Exon 1 141CrT (Pro17Pro) ߪ 49 1 0 Yes Exon 1 145GrC (Asp19His) Loss of BaeI 74 3 1 No Exon 2 251GrA (Cys54Tyr) Gain of SexAI 21 23 23 No Exon 6 802GrA (Glu238Lys) ߪ 10 1 0 Yes Exon 6 866CrT (Ala259Val) Loss of HaeIII 0 5 0 ߪ Exon 8 1289CrA (Thr400Lys) Gain of MseI 116 53 4 Yes Exon 11 1785CrT (Ala565Ala) Loss of MnlI 20 7 1 Yes Exon 11 1813GrC (Gly575Arg) Gain of HhaI 188 6 4 No Exon 13 1984CrT (Ala632Val) Loss of StyI 107 50 13 No 5 UTR afa;15ArC Gain of BstEII 47 4 0 Yes 5 UTR afa;19TrG Loss of Tsp451 38 42 29 No 5 UTR afa;41CrT Loss of DdeI 7 2 4 No Intron 1 afa;7CrT Loss of BsmAI 21 23 4 Yes Intron 1 afa;21CrA Loss of MnlI 20 23 4 Yes Intron 9 afa;19CrT ߪ 1 3 4 ߪ Intron 10 IVS10 af9;34delCC ߪ 3 1 4 ߪ Intron 10 afa;50CrT ߪ 4 4 2 ߪ cohort of patients with sitosterolemia. Login to comment
171 af9;/af9; af9;/afa; afa;/afa; ABCG5: 167CrT (Pro9Pro) Gain of BstNI ߪ ߪ ߪ ߪ 1950CrG (Gln604Glu) Loss of SmlI 46 25 1 Yes ABCG8: Exon 1 141CrT (Pro17Pro) ߪ 49 1 0 Yes Exon 1 145GrC (Asp19His) Loss of BaeI 74 3 1 No Exon 2 251GrA (Cys54Tyr) Gain of SexAI 21 23 23 No Exon 6 802GrA (Glu238Lys) ߪ 10 1 0 Yes Exon 6 866CrT (Ala259Val) Loss of HaeIII 0 5 0 ߪ Exon 8 1289CrA (Thr400Lys) Gain of MseI 116 53 4 Yes Exon 11 1785CrT (Ala565Ala) Loss of MnlI 20 7 1 Yes Exon 11 1813GrC (Gly575Arg) Gain of HhaI 188 6 4 No Exon 13 1984CrT (Ala632Val) Loss of StyI 107 50 13 No 5 UTR afa;15ArC Gain of BstEII 47 4 0 Yes 5 UTR afa;19TrG Loss of Tsp451 38 42 29 No 5 UTR afa;41CrT Loss of DdeI 7 2 4 No Intron 1 afa;7CrT Loss of BsmAI 21 23 4 Yes Intron 1 afa;21CrA Loss of MnlI 20 23 4 Yes Intron 9 afa;19CrT ߪ 1 3 4 ߪ Intron 10 IVS10 af9;34delCC ߪ 3 1 4 ߪ Intron 10 afa;50CrT ߪ 4 4 2 ߪ cohort of patients with sitosterolemia. Login to comment

PMID: 18977479 [PubMed] Koeijvoets KC et al: "ABCG8 gene polymorphisms, plasma cholesterol concentrations, and risk of cardiovascular disease in familial hypercholesterolemia."

No. Sentence Comment

3 Therefore, we examined associations between the D19H and T400K polymorphisms in the ABCG8 gene and CVD in a large cohort study of 2012 patients with heterozygous familial hypercholesterolemia (FH). Login to comment
4 A total of 244 individuals carried one or two alleles of the D19H variant and 568 individuals the T400K variant. Login to comment
6 In a Cox proportional hazard regression model adjusted for relevant cardiovascular risk factors, the D19H polymorphism was not associated with total CVD risk (p = 0.2), but there was evidence of an association with higher risk of CHD (RR 1.42, CI 1.04-1.95; p = 0.03). Login to comment
42 Since the D19H and T400K polymorphisms in the ABCG8 gene showed the strongest relationship with cholesterol standardized serum plant sterol concentrations [15,16], we decided to evaluate associations with these ABCG8 variants. Login to comment
69 This resulted in the selection of two polymorphisms in ABCG8: D19H (substitution of histidine for aspartic acid at amino acid 19 in exon 1) and T400K (substitution of thyrosine for lysine at amino acid 400 in exon 8) that resulted both in lower cholesterol standardized plasma plant sterol concentrations [15,16]. Login to comment
71 Taqman SNP Genotyping Assay ID for the D19H was C 26135643 10 and for the T400K C 375061 10 (Applied Biosystems). Login to comment
76 Genotyping was successful in 2053 (95.7%) patients for the T400K polymorphism, and in 2065 (96.3%) patients for the D19H polymorphism. Login to comment
86 The association between the D19H and T400K polymorphisms in ABCG8 and the occurrence of CVD or CHD was assessed using a Cox proportional hazard regression analysis. Login to comment
98 For the D19H polymorphism, we observed homozygosity (HH) in seven (0.3%) patients, heterozygosity (DH) in 237 (11.8%) patients, and 1768 (87.9%) patients were homozygous for the wild type allele (DD). Login to comment
101 Using chi-square analyses, ABCG8 genotype distributions were similar between individuals without and with a history of CVD (D19H, p = 0.9; T400K, p = 0.1) 3.2. Login to comment
102 ABCG8 genotypes and plasma cholesterol concentrations Plasma cholesterol concentrations according to D19H and T400K genotypes are presented in Table 3. Login to comment
103 No significant differences in plasma lipid concentrations among D19H and T400K genotypes were found. Login to comment
109 The percentage of D19H and T400K carriers that were Table 2 Genotype and allele distributions for D19H and T400K polymorphisms in ABCG8. Login to comment
110 D19H T400K Total CVD- CVD+ Total CVD- CVD+ N (%) N (%) N (%) N (%) N (%) N (%) Genotypes Wild type (DD or TT) 1768 (87.9) 1198 (87.8) 570 (88.0) 1444 (71.8) 965 (70.7) 479 (73.9) Heterozygous (DH or TK) 237 (11.8) 161 (11.8) 76 (11.7) 523 (26.0) 372 (27.3) 151 (23.3) Homozygous (HH or KK) 7 (0.3) 5 (0.4) 2 (0.3) 45 (2.2) 27 (2.0) 18 (2.8) Total 2012 (100.0) 1364 (100.0) 648 (100.0) 2012 (100.0) 1364 (100.0) 648 (100.0) Alleles Wild type allele (D or T) 3773 (93.8) 2557 (93.7) 1216 (93.8) 3411 (84.8) 2302 (84.4) 1109 (85.6) Minor allele (H or K) 251 (6.2) 171 (6.3) 80 (6.2) 613 (15.2) 426 (15.6) 187 (14.4) Total 4024 (100.0) 2728 (100.0) 1296 (100.0) 4024 (100.0) 2728 (100.0) 1296 (100.0) CVD+ indicates history of cardiovascular disease, CVD- indicates no cardiovascular disease. Login to comment
111 Table 3 Plasma cholesterol concentrations according to D19H and T400K genotypes. Login to comment
112 Polymorphism Genotype Total cholesterol LDL cholesterol HDL cholesterol Triglycerides D19H DD 9.50 (±1.99) 7.32 (±1.91) 1.22 (±0.36) 1.81 (±1.04) DH/HH 9.50 (±1.92) 7.40 (±1.87) 1.22 (±0.36) 1.75 (±1.04) T400K TT 9.50 (±2.00) 7.32 (±1.91) 1.21 (±0.34) 1.82 (±1.04) TK/KK 9.51 (±1.94) 7.36 (±1.92) 1.24 (±0.39) 1.78 (±1.07) LDL indicates low-density lipoprotein HDL indicates high-density lipoprotein. Login to comment
121 As shown in Table 5, we found no evidence for associations of the D19H or T400K polymorphisms with total CVD risk. Login to comment
124 Although we found no significant relationship between the ABCG8 variants and CVD overall, the effect estimates seemed opposite for the D19H and T400K polymorphisms (Table 5). Login to comment
126 The risk genotype for the D19H variant was the DH/HH genotype ("carriers" of the D19H polymorphism) and the risk genotype for the T400K variant was the frequent TT genotype ("non-carriers" of the T400K polymorphism). Login to comment
136 The D19H polymorphism was associated with increased risk of CHD, but only after adjustment for year of birth, gender, smoking, diabetes, HDL cholesterol, and triglycerides levels in multiple Cox regression analyses (model 2, Table 5). Login to comment
144 Model 1 Model 2 Model 3 Polymorphism RR (95% CI) p RR (95% CI) p RR (95% CI) p ABCG8 D19H CVD 1.13 (0.89-1.46) 0.3 1.26 (0.93-1.71) 0.1 1.27 (0.93-1.72) 0.1 CHD 1.27 (0.98-1.64) 0.07 1.42 (1.04-1.95) 0.03 1.42 (1.04-1.95) 0.03 ABCG8 T400K CVD 0.88 (0.73-1.05) 0.2 0.87 (0.70-1.08) 0.2 0.87 (0.69-1.08) 0.2 CHD 0.87 (0.72-1.06) 0.2 0.84 (0.66-1.06) 0.1 0.83 (0.65-1.05) 0.1 RR indicates relative risk, CI indicates confidence interval, CVD indicates cardiovascular disease, CHD indicates coronary heart disease. Login to comment
151 Discussion In this large cohort study of FH patients with a high-risk of CVD, we found that the D19H polymorphism was not significantly associated with plasma cholesterol levels nor with total CVD risk, but there was evidence of an association with higher risk of CHD. Login to comment
157 Heterozygous and homozygous carriers of the D19H polymorphism had a slightly higher risk of CHD than carriers of the wild type. Login to comment
159 Hence, it was speculated that the substitution of histidine for aspartic acid at amino acid 19 increases the transporter function of ABCG8. Login to comment
162 Data showing the relationship of the D19H polymorphism with plasma cholesterol levels were more contradicting: one study has found an association of the 19H allele with lower plasma total and LDL cholesterol levels [16], whereas other genetic association studies have failed to confirm this relationship [15,19]. Login to comment
163 Based on the association with lower plasma plant sterol concentrations, we had a priori expected that carriers of the D19H variant would have had a decreased risk of cardiovascular events. Login to comment
169 Previous studies have shown that this polymorphism was associated with lower sitosterol to cholesterol ratios, but these findings were not as consistent as for the D19H variant [15-17]. Login to comment
190 In conclusion, in this large, multicenter, cohort study amongst high-risk individuals with FH, we found a modest effect of the ABCG8 D19H gene variant on risk of CHD, but we did not observe a relationship between the ABCG8 T400K polymorphism and cardiovascular endpoints. Login to comment

PMID: 20456485 [PubMed] Wang HH et al: "Transgenic overexpression of Abcb11 enhances biliary bile salt outputs, but does not affect cholesterol cholelithogenesis in mice."

No. Sentence Comment

22 Furthermore, genome-wide association and family studies have identified the common ABCG8 polymorphism p.D19H as a susceptibility gene for gallstone disease in humans [15,16]. Login to comment

PMID: 24914347 [PubMed] Jirsa M et al: "ABCB4 mutations underlie hormonal cholestasis but not pediatric idiopathic gallstones."

No. Sentence Comment

99 Interestingly, the ABCB4 variation c.523A>G (p. Thr175Ala), found in three index patients with LPAC, Patient. Login to comment
25 In our previous study[10] we focused on the role of the common variants c.523A>G (p.Thr175Ala) and c.1954A>G (p.Arg652Gly) in ABCB4, c.1331T>C (p.Val444Ala) in ABCB11 and c.55 G>C (p.Asp19His) in ABCG8 in pediatric gallstone disease. Login to comment

PMID: 23179156 [PubMed] Yoon JH et al: "ATP-binding cassette sterol transporters are differentially expressed in normal and diseased human gallbladder."

No. Sentence Comment

106 Buch et al. showed that the ABCG8 gene carrying a single nucleotide polymorphism, A-1791411, encoded the variant rs11887534 (D19H), and that there was a correlation between presence of ABCG8 D19H and cholesterol gallstones in Germans and Chileans after adjusting for BMI, gender, and age [21]. Login to comment
111 *P \ 0.05. Lane 1 Normal gallbladder, lanes 2, 3 gallbladder with cholesterol polyps, lanes 4, 5 gallbladder with cholesterol gallstones and cholecystitis, lanes 6, 7 gallbladder with cholesterolosis (D19H) through thorough transcript mapping, mutation detection, and association analysis in ethnically different populations as the likely causative variant for gallstone susceptibility [22]. Login to comment
112 Other studies have identified a variety of polymorphisms in ABCG8 (A632 V, T400 K, D19H, and C54Y) and in ABCG5 (Q604E) that have been linked to baseline plasma cholesterol levels, cholesterol absorption, or responsiveness to dietary intervention [23-25]. Login to comment
113 In addition, some genetic variations in the ABCG8 gene (D19H and T400 K) may increase the risk of gallstone disease in certain populations [26]. Login to comment

PMID: 23340007 [PubMed] Krawczyk M et al: "Genetics of biliary lithiasis from an ethnic perspective."

No. Sentence Comment

35 The analysis which encompassed over 2000 cases and 1400 gallstone-free controls, revealed a strong association between gallstone phenotype and the single nucleotide variant p.D19H within the hepatobiliary cholesterol hemitransporter ABCG5/8: carriers of the p.19H variant demonstrated an increased risk of gallbladder stones (OR = 2.2, 95% CI = 1.8-2.6, P = 1.4 &#d7; 10-14 ) [12]. Login to comment
39 For this study, common ABCG5 (p.Q604E) and ABCG8 (p.D19H, p.Y54C, p.T400K, p.A632V) variants were selected and the nonparametric linkage (NPL) as well as case-control analyses were performed. Login to comment
43 The above results were subsequently replicated in other European cohorts from Sweden (OR = 2.5, 95% CI = 1.3-4.8, P = 0.004) [17] and Denmark (OR = 1.9, 95% CI = 1.7-2.1, P < 0.001) [18], which renders the ABCG8 variant p.D19H the common genetic determinant for increased gallstone risk in European populations. Login to comment
47 This case-control analysis in over 2500 European Europe Native and Hispanic America Asia (India) SLC10A2 26,28 (rs9514089) ABCG8 12,16-18,54-56 (p.D19H) UGT1A1 11,24,25 (Gilbert) FXR 27 (NR1H4_1) CYP7A1 57,59 (c.-204A>C) SLC01B1 11,52 (p.V174A, p.P155T) Figure 1 Venn diagram illustrating common polymorphisms associated with the risk of gallstone formation in European, American and Asian populations. Login to comment
90 Moreover, we demonstrated that the minor allele frequencies of the ABCG8 p.D19H [12] and the UGT1A1 Gilbert variants [9] were similar to the European population (8.4% and 11.7%, respectively), conditioning a genetic gallstone risk of similar magnitude. Login to comment
108 In view of recent population-based and genome-wide association studies that highlighted ABCG8 p.D19H as a major gallstone susceptibility variant in Europe and America, we replicated this association in North Indian populations and observed that the heterozygous genotype was significantly more common in gallstone patients (OR = 2.20; 95% CI = 1.1-4.6, P = 0.038) as compared to healthy controls. Login to comment
110 A significant (P = 0.017) association between the ABCG8 p.D19H variant and an enhanced risk of gallstones (OR = 2.27) was also detected in an Indian study by Siddapuram et al. [55] when comparing 226 gallstone cases and 222 controls [55]. Login to comment
111 Interestingly, Kuo et al. [56] demonstrated that the ABCG8 p.D19H variant increases the incidence of gallstones in Chinese individuals as well. Login to comment
121 The statistical approaches above, which calculated the overall risk of developing GSD, suggested that ABCG8 p.D19H, ESR1 IVS1-397C>T and ADRB3 c.190T>C contribute to GSD risk in the Indian population (unpublished data). Login to comment

PMID: 23406058 [PubMed] Renner O et al: "Role of the ABCG8 19H risk allele in cholesterol absorption and gallstone disease."

No. Sentence Comment

0 RESEARCH ARTICLE Open Access Role of the ABCG8 19H risk allele in cholesterol absorption and gallstone disease Olga Renner1* , Dieter L&#fc;tjohann2 , Dominique Richter1 , Andr&#e9; Strohmeyer1 , Silke Schimmel1 , Oliver M&#fc;ller3 , Eduard F Stange3* and Simone Harsch1 Abstract Background: Gallstone disease is associated with p.D19H of ABCG8 as well as alterations of cholesterol and bile acid metabolism. Login to comment
8 Genotype frequencies of p.D19H were established using MALDI-TOF mass spectrometry. Login to comment
10 D19H was found to be significantly associated with gallstones (odds ratio [OR] = 2.9, P = 0.0220, 95% confidence interval [CI]:1.22-6.89), particularly in the overweight cohort (OR = 3.2, P = 0.0430, 95% CI:1.07-9.26). Login to comment
11 Cholesterol absorption was about 24% lower in individuals carrying p.D19H compared to wild type (Psitosterol = 0.0080, Pcampesterol = 0.0206). Login to comment
12 Moreover, irrespective of phenotype, carriers of p.D19H displayed a significant lower absorption than carriers of the major allele. Login to comment
14 Notably, ABCG5/8 and NPC1L1 expression was similar in gallstone carriers and controls regardless of p.D19H presence. Login to comment
15 Conclusions: Both gallstone disease and p.D19H of ABCG8 are associated with diminished cholesterol absorption. Login to comment
16 However, p.D19H is not responsible for the differences in small intestinal sterol transporter expression. Login to comment
34 Most prominently associated with gallstone disease is the D19H polymorphism of the ABCG8 gene [29]. Login to comment
35 In healthy individuals, the D19H polymorphism was associated with low cholesterol absorption [30]. Login to comment
37 Recently, the study of Krawczyk showed that cholesterol absorption was significantly lower and de novo synthesis higher in gallstone carriers [4] but this was independent of the D19H polymorphism. Login to comment
38 The present study therefore addressed the following questions: i) are both, low cholesterol absorption and increased de novo cholesterol synthesis indeed common in gallstone carriers, ii) is the expression of intestinal cholesterol transporters and their transcription factors different in gallstone carriers, iii) does the D19H polymorphism of the ABCG8 gene affect any of these parameters? Login to comment
84 Genotyping The D19H SNP analysis of ABCG8 was performed with blood DNA using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) of allele specific primer extension products as reported previously [34], applying the following primer sequences: 1st-primer: ACGTTGGATGAGGAGAGAGGGCTGC CGAAA, 2nd-primer: ACGTTGGATGACTTCCCATTGCTCA CTCAC and extension primer: TGCTCACTCACCGAGGTATG. Login to comment
136 Association of D19H polymorphism with cholelithiasis Since individuals with the D19H polymorphism (rs11887534, c.52 G > c) in the ABCG8 gene are known to have a higher risk of developing gallstones [29,41], a genotype analysis of this polymorphism was performed in our cohort. Login to comment
140 Confirming prior reports [29,41], D19H was found to be significantly associated with gallstone disease in our total population with OR = 2.9 (P = 0.0220, 95% CI: 1.22-6.89). Login to comment
141 Notably, overweight simultaneous carriers of gallstones and p.D19H displayed a higher OR (OR = 3.2, P = 0.0430, 95% CI: 1.07-9.26) than the respective normal weight group (OR = 1.6, P = 0.6270, 95% CI: 0.30-8.77). Login to comment
142 Influence of the D19H polymorphism on cholesterol metabolism and intestinal ABCG8 expression Next, we analysed the effect of the D19H polymorphism in ABCG8 on cholesterol absorption and cholesterol synthesis. Login to comment
143 As shown in Figure 2A and B, carriers of the D19H gallstone risk allele were characterised by significantly reduced intestinal cholesterol absorption of about 24% (sitosterol P = 0.0080, campesterol P = 0.0206). Login to comment
152 Table 4 The frequency of the polymorphism D19H in the gallstone carriers and controls of the population from Stuttgart Group Controls (134) Gallstone carriers (34) (GG<>Gc) Genotype G/G G/c c/c G/G G/c c/c P-value OR (95% CI) Total 115 19 0 23 11 0 0.022 2.9(CI: 1.216 to 6.889) Normal weight 66 9 0 9 2 0 0.627 1.6(CI: 0.303 to 8.770) Overweight 49 10 0 14 9 0 0.043 3.2(CI: 1.071 to 9.264) G = major allele, c = minor allele, OR = odds ratio, CI = confidence interval. Login to comment
156 The most pronounced effect on cholesterol absorption ratio was observed for serum campesterol levels (wild type controls to mutated controls 28%, P = 0.0347 and wild type controls to cases with p.D19H 37%, P = 0.0030). Login to comment
158 To study whether this polymorphism affected intestinal transporter expression, the intestinal expression of the ABCG8 gene was related to the D19H subgroups. Login to comment
163 Third, in the cohort of gallstone carriers and controls the D19H polymorphism of the ABCG8 gene was associated with a low cholesterol absorption but not with altered de novo synthesis. Login to comment
177 Moreover, in the current study a diminished cholesterol absorption ratio Figure 2 Influence of the polymorphism D19H on markers of cholesterol metabolism. Login to comment
182 (GG) = wild type individual; (Gc) = carrier of p.D19H; (GG) = 93 and (Gc) = 25. Login to comment
191 In line with the observation of Masson [53], the levels of Figure 3 Influence of the polymorphism D19H on markers of cholesterol metabolism in gallstone disease. Login to comment
197 GG genotype (wild type individual): C = 75, GS = 14; Gc genotype (carrier of p.D19H): C = 18, GS = 11. Login to comment
203 The polymorphism D19H of sterol exporter ABCG8 was associated with gallstones in various populations and different ethnic groups [29,41,57-61]. Login to comment
207 In contrast to the study of Srivastava [59], the D19H relative risk was more pronounced in males than in females (Additional file 1: Table S2). Login to comment
209 Despite these descriptive studies about the relationship of D19H to the abnormalities in the lipid profile or to gallstones [29,41,62,63], there are no direct cell culture studies on the functional influence of the polymorphism on transporter expression or activity so far. Login to comment
211 In our study carriers of p.D19H were characterised by significantly reduced intestinal cholesterol absorption irrespective of the presence or absence of gallstones and the polymorphism did not affect intestinal ABCG8 expression. Login to comment
215 Conclusions In summary, both the presence of gallstones and the ABCG8 polymorphism D19H were related to diminished cholesterol absorption but the polymorphism did not affect ileal expression of ABCG8, suggesting a gain-of -function of the mutated transporter. Login to comment
219 Detailed comparison of intestinal cholesterol Figure 4 Correlation of ABCG8 expression to the frequency of the polymorphism D19H in the Stuttgart cohort. Login to comment
224 (GG) = wild type individual; (Gc) = carrier of p.D19H. Login to comment
226 (B) Representative Western blot images of ABCG8 protein and villin in ileal mucosa of control individuals and gallstone carriers, with and without p.D19H. Login to comment
232 The frequency of the variant D19H in the gallstone carriers and controls of the population from Stuttgart (with subgroups). Login to comment
421 Srivastava A, Srivastava A, Srivastava K, Choudhuri G, Mittal B: Role of ABCG8 D19H (rs11887534) variant in gallstone susceptibility in northern India. Login to comment
427 Kuo KK, Shin SJ, Chen ZC, Yang YH, Yang JF, Hsiao PJ: Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease. Login to comment
83 Genotyping The D19H SNP analysis of ABCG8 was performed with blood DNA using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) of allele specific primer extension products as reported previously [34], applying the following primer sequences: 1st-primer: ACGTTGGATGAGGAGAGAGGGCTGC CGAAA, 2nd-primer: ACGTTGGATGACTTCCCATTGCTCA CTCAC and extension primer: TGCTCACTCACCGAGGTATG. Login to comment
135 Association of D19H polymorphism with cholelithiasis Since individuals with the D19H polymorphism (rs11887534, c.52 G > c) in the ABCG8 gene are known to have a higher risk of developing gallstones [29,41], a genotype analysis of this polymorphism was performed in our cohort. Login to comment
139 Confirming prior reports [29,41], D19H was found to be significantly associated with gallstone disease in our total population with OR = 2.9 (P = 0.0220, 95% CI: 1.22-6.89). Login to comment
151 Table 4 The frequency of the polymorphism D19H in the gallstone carriers and controls of the population from Stuttgart Group Controls (134) Gallstone carriers (34) (GG<>Gc) Genotype G/G G/c c/c G/G G/c c/c P-value OR (95% CI) Total 115 19 0 23 11 0 0.022 2.9(CI: 1.216 to 6.889) Normal weight 66 9 0 9 2 0 0.627 1.6(CI: 0.303 to 8.770) Overweight 49 10 0 14 9 0 0.043 3.2(CI: 1.071 to 9.264) G = major allele, c = minor allele, OR = odds ratio, CI = confidence interval. Login to comment
155 The most pronounced effect on cholesterol absorption ratio was observed for serum campesterol levels (wild type controls to mutated controls 28%, P = 0.0347 and wild type controls to cases with p.D19H 37%, P = 0.0030). Login to comment
157 To study whether this polymorphism affected intestinal transporter expression, the intestinal expression of the ABCG8 gene was related to the D19H subgroups. Login to comment
162 Third, in the cohort of gallstone carriers and controls the D19H polymorphism of the ABCG8 gene was associated with a low cholesterol absorption but not with altered de novo synthesis. Login to comment
176 Moreover, in the current study a diminished cholesterol absorption ratio Figure 2 Influence of the polymorphism D19H on markers of cholesterol metabolism. Login to comment
181 (GG) = wild type individual; (Gc) = carrier of p.D19H; (GG) = 93 and (Gc) = 25. Login to comment
190 In line with the observation of Masson [53], the levels of Figure 3 Influence of the polymorphism D19H on markers of cholesterol metabolism in gallstone disease. Login to comment
196 GG genotype (wild type individual): C = 75, GS = 14; Gc genotype (carrier of p.D19H): C = 18, GS = 11. Login to comment
202 The polymorphism D19H of sterol exporter ABCG8 was associated with gallstones in various populations and different ethnic groups [29,41,57-61]. Login to comment
206 In contrast to the study of Srivastava [59], the D19H relative risk was more pronounced in males than in females (Additional file 1: Table S2). Login to comment
208 Despite these descriptive studies about the relationship of D19H to the abnormalities in the lipid profile or to gallstones [29,41,62,63], there are no direct cell culture studies on the functional influence of the polymorphism on transporter expression or activity so far. Login to comment
210 In our study carriers of p.D19H were characterised by significantly reduced intestinal cholesterol absorption irrespective of the presence or absence of gallstones and the polymorphism did not affect intestinal ABCG8 expression. Login to comment
214 Conclusions In summary, both the presence of gallstones and the ABCG8 polymorphism D19H were related to diminished cholesterol absorption but the polymorphism did not affect ileal expression of ABCG8, suggesting a gain-of -function of the mutated transporter. Login to comment
218 Detailed comparison of intestinal cholesterol Figure 4 Correlation of ABCG8 expression to the frequency of the polymorphism D19H in the Stuttgart cohort. Login to comment
223 (GG) = wild type individual; (Gc) = carrier of p.D19H. Login to comment
225 (B) Representative Western blot images of ABCG8 protein and villin in ileal mucosa of control individuals and gallstone carriers, with and without p.D19H. Login to comment
231 The frequency of the variant D19H in the gallstone carriers and controls of the population from Stuttgart (with subgroups). Login to comment
419 Srivastava A, Srivastava A, Srivastava K, Choudhuri G, Mittal B: Role of ABCG8 D19H (rs11887534) variant in gallstone susceptibility in northern India. Login to comment
425 Kuo KK, Shin SJ, Chen ZC, Yang YH, Yang JF, Hsiao PJ: Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease. Login to comment

PMID: 23577061 [PubMed] Srivastava A et al: "Multi-analytic approach elucidates significant role of hormonal and hepatocanalicular transporter genetic variants in gallstone disease in North Indian population."

No. Sentence Comment

4 Results: Single locus analysis by logistic regression showed association of ESR1 IVS1-397C.T (rs2234693), IVS1-351A.G (rs9340799) PGR ins/del (rs1042838) ADRB3-190 T.C (rs4994) ABCG8 D19H (rs11887534), SLCO1B1 Exon4 C.A (rs11045819) and SREBP2 1784G.C (rs2228314) with CGD risk. Login to comment
5 However, the MDR and CART analysis revealed ESR1 IVS1-397C.T (rs2234693) ADRB3-190 T.C (rs4994) and ABCG8 D19H (rs11887534) polymorphisms as the best polymorphic signature for discriminating between cases and controls. Login to comment
32 Therefore, we have extended our previous work on CGD susceptibility by jointly investigating 13 SNP genotypes in 9 genes belonging to hormonal pathway [ESR1 IVS1-397C.T (rs2234693), IVS1-351A.G (rs9340799), Ex4-122C.G (rs1801132), ESR2 -789 A.C (rs1271572), 1082 G.A (rs1256049) PGR ins/del (rs1042838) ADRB3-190 T.C (rs4994) and ADRA2A (rs1800544)], hepatocanalicular transporter pathway [ABCG8 D19H (rs11887534), SLCO1B1 Exon4 C.A (rs11045819), Ex6+40T.C (rs4149056)] and adipogenesis differentiation pathway [PPAR c2 C.G (rs1801282) SREBP2 1784G.C (rs2228314)], avoiding the problem of dimensionality and multiple comparisons. Login to comment
34 Allelic Distribution of Studied Polymorphisms in Controls The genotypic and allelic distribution of ESR1 IVS1-397C.T, IVS1-351A.G, Ex4-122C.G, ESR2 -789 A.C, 1082 G.A PGR ins/del ADRB3-190 T.C and ADRA2A -1291 C.G in hormonal pathway, ABCG8 D19H, SLCO1B1 Exon4 C.A, Ex6+40T.C in hepatocanalicular transporter pathway and PPAR c2 C.G SREBP2 1784G.C in adipogenesis differentiation pathway are shown in Table 2, 3 and 4. Login to comment
101 In hepatocanalicular transporter pathway ABCG8 D19H and SLCO1B1 Exon4 C.A conferred increased risk for CGD At haplotypes level, we found that the gallstones subjects who carry ESR1 haplotypes IVS1- 397T, IVS1-351G, Ex4-122C and SLCO1B1 haplotypes Exon4A, Ex6+40T conferred increased risk for gallstones. Login to comment
137 A genome wide scan carried out by Buch et al., [33] identified a variant D19H in the hepatic cholesterol transporter (ABCG8) as major susceptibility factor for human gallstone disease. Login to comment
213 8. Katsika D, Magnusson P, Krawczyk M, Grunhage F, Lichtenstein P, et al. (2010) Gallstone disease in Swedish twins: risk is associated with ABCG8 D19H genotype. Login to comment
245 Srivastava A, Srivastava K, Choudhuri G, Mittal B (2010) Role of ABCG8 D19H (rs11887534) variant in gallstone susceptibility in northern India. Login to comment

PMID: 23583734 [PubMed] Hirschfield GM et al: "The genetics of complex cholestatic disorders."

No. Sentence Comment

122 GWAS in Gallstone Disease The first GWAS for gallstones found a highly significant association with the p.D19H variant of ABCG8 (odds ratio, 2.2; population attributable fraction, 11%),57 which had been previously identified as a risk factor in animal models.58 This risk factor was confirmed globally.57,59-66 The ABCG5/G8 hepatocanalicular heterodimeric transporter for cholesterol is a member of the adenosine triphosphate-binding cassette (ABC) transporters. Login to comment
125 Subsequent studies showed that obese women older than 60 years of age homozygous with the p.D19H risk allele had a 13% absolute 10-year risk of symptomatic gallstone disease compared with a range of 2% to 4% in noncarriers in the same risk stratum.66 It is likely that decreased intestinal cholesterol absorption and increased hepatic cholesterol synthesis represent the primary defect intensifying the susceptibility for the development of stones.67 This indicates that the lithogenic ABCG8 p.D19H variant confers decreased cholesterol absorption, higher cholesterol synthesis, and a trend toward lower serum cholesterol levels as well as a better response to statins. Login to comment
126 Accordingly, ABCG8 p.D19H might represent a "gain-of-function" mutation that increases clearance of sterol from the body.68-70 As a corollary, this genotype has also been shown to be protective against the development of atheromatous vascular disease by lowering cholesterol levels.71,72 Preliminary data from 2 other GWAS for gallstone disease have identified additional lithogenic candidate genes (Table 1).59,60 Data from a genome-wide association study of 4300 Sardinian subjects with increased serum bilirubin levels was used to identify the Gilbert syndrome variant in the promoter of the UGT1A1 gene as a candidate gene for gallstone disease73 that was verified in 2800 German and Chilean patients with gallstones.74 The link of diminished bilirubin conjugation with gallstone formation reinforces the concept of nucleation in supersaturated bile, because cholesterol gallstones usually contain small amounts of bilirubin pigment. Login to comment

PMID: 24252657 [PubMed] Yu XH et al: "ABCG5/ABCG8 in cholesterol excretion and atherosclerosis."

No. Sentence Comment

746 It is found that cholesterol absorption is about 24% lower in individuals carrying the p.D19H allele of ABCG8 compared to wild type although there is no significant difference in ABCG5 and ABCG8 expression levels, indicating an important role for the ABCG8 19H allele in promoting cholesterol excretion [28]. Login to comment

PMID: 24498041 [PubMed] Jiang ZY et al: "Association of three common single nucleotide polymorphisms of ATP binding cassette G8 gene with gallstone disease: a meta-analysis."

No. Sentence Comment

5 In the genotype model, the overall association between genotype with gallstone was significant for D19H (OR = 2.43, 95%CI: 2.23-2.64, P,0.001), and for Y54C (OR = 1.36, 95%CI: 1.01-1.83, P = 0.044), or T400K (OR = 1.17, 95%CI: 0.96-1.43. Login to comment
7 In allele model, minor alleles of D19H polymorphism (allele D: OR = 2.25, 95%CI: 2.10-2.42, P,0.001) and of T400K polymorphism (allele K: OR = 1.18, 95%CI: 1.061.31, P,0.001) were related with an increased risk of gallstone disease. Login to comment
12 Conclusions: Our study showed strong association of D19H polymorphism with gallstone disease. Login to comment
32 The most studied loci are D19H, T400K and Y54C. Login to comment
37 The aims of our study are: 1) to evaluate the association between polymorphisms at D19H, T400K and Y54C and gallstone disease using meta-analysis; 2) to compare the hepatic ABCG5/G8 mRNA expression and biliary lipids composition in patients with different genotypes of T400K and Y54C. Methods Literature Search Publication were searched via public database PubMed (http:// www.ncbi.nlm.nih. Login to comment

PMID: 24657684 [PubMed] Hancock-Cerutti W et al: "Opposing effects of ABCG5/8 function on myocardial infarction and gallstone disease."

No. Sentence Comment

20 The best studied of the 6 variants was the D19H variant in ABCG8, a known gain-of-function variant that had previously been shown to be a monogenic determinant of gallstone disease risk (25,26). Login to comment
21 Importantly, the relationship of genotype score to MI and gallstone disease persisted when a genotype score was calculated independently of the D19H See page 2121 *Editorials published in the Journal of the American College of Cardiology reflect the views of the authors and do not necessarily represent the views of JACC or the American College of Cardiology. Login to comment

PMID: 24657701 [PubMed] Stender S et al: "The ABCG5/8 cholesterol transporter and myocardial infarction versus gallstone disease."

No. Sentence Comment

40 From the 5 genotypes that were individually associated with reductions in LDL cholesterol levels, we generated combined, weighted genotype scores based on the percentage reductions in LDL cholesterol compared to the reference genotype: ABCG8 D19H, DD &#bc; 0, DH &#bc; 2.7, HH &#bc; 5.8; IVS3&#fe;981 T>C, CC &#bc; 0, TC &#bc; 2.5, TT &#bc; 4.5; Y54C, YY &#bc; 0, YC &#bc; 0.2, CC &#bc; 1.1; T400K, TT &#bc; 0, TK &#bc; 0.9, KK &#bc; 2.9; A632V, VV &#bc; 0, AV &#bc; 0.9, AA &#bc; 1.1. Login to comment
45 In analyses stratified on ABCG8 D19H, a weighted genotype score without D19H was constructed (i.e., including IVS3&#fe;981, Y54C, T400K, and A632V). Login to comment
51 To test whether the associations were independent of ABCG8 D19H, a known gain-of-function variant strongly associated with increased risk of gallstones, analyses were also stratified on D19H genotype (9,11,12). Login to comment
56 ABCG5 R50C and ABCG8 D19H were in almost complete linkage disequilibrium in Abbreviations and Acronyms ABC = adenosine triphosphate-binding cassette transporter CI = confidence interval LDL = low-density lipoprotein MI = myocardial infarction OR = odds ratio the CCHS (D` &#bc; 0.98; r2 &#bc; 0.94), as previously described (11), and therefore only D19H was genotyped in the CGPS and the CIHDS studies (Online Fig. 1). Login to comment
78 For the individual genotypes, ORs for MI ranged from 0.83 (95% CI: 0.76 to 0.92) for IVS3&#fe;981 TT to 1.07 (95% CI: 0.91 to 1.25) for T400K KK versus noncarriers, while ORs for gallstone disease ranged from 3.82 (95% CI: 2.66 to 5.49) for D19H HH to 1.11 (95% CI: 0.99 to 1.23) for Y54C CC versus noncarriers (Online Fig. 3). Login to comment
83 Stratification on ABCG8 D19H genotype. Login to comment
84 As previously shown in this cohort (9), the H-allele of D19H was a strong risk factor for symptomatic gallstone disease, with stepwise increased ORs of up to 3.82 (95% CI: 2.66 to 5.49) for HH versus DD-homozygotes (p for trend: 7 10-56 ) (Online Fig. 3). Login to comment
85 Therefore, to assess whether the other ABCG5/8 variants were independently associated with LDL cholesterol, and with risk of MI and/or symptomatic gallstones, we tested this on a D19H DD wild-type background (Fig. 6). Login to comment
86 Among ABCG8 D19H DD-homozygotes (n &#bc; 52,769, or 88% of the population), a genotype score constructed from the remaining LDL-lowering variants was associated with stepwise decreases in LDL cholesterol of up to 4.1% (0.14 mmol/l) for individuals with a genotype score of 6.0 versus <2.0 (p for trend: 5 10-22 ) (Fig. 6). Login to comment
87 The corresponding multifactorially adjusted ORs for MI and symptomatic gallstone disease were 0.88 (95% CI: 0.80 to 0.98), and 1.74 (95% CI: 1.48 to 2.05), respectively (p for trend Figure 2 Lipid and Lipoprotein Levels as a Function of ABCG5/8 Genotypes, Individually and Combined The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test. Login to comment
90 The power to detect associations was naturally low in the smaller subgroup of D19H DH-heterozygotes and HH- homozygotes combined (n &#bc; 7,470, or 12% of the population) (Online Fig. 6). Login to comment
96 Fourth, it is firmly established that ABCG8 D19H constitutes a risk factor for gallstone disease (12). Login to comment
105 Figure 3 Cumulative Incidence of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of Age and ABCG5/8 Genotype Score The genotype score was constructed by summation of weighted low-density lipoprotein cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are by log-rank trend test. Login to comment
122 For instance, a common intronic ABCG8 variant was recently used together with Figure 4 Risk of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of ABCG5/8 Genotype Score The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test, or for trend tests of odds ratios (ORs). Login to comment
133 The H-allele of ABCG8 D19H is a strong risk factor for gallstone disease, comparable in magnitude towell-known risk factors such as female sex and obesity (7,9,12). Login to comment
134 The H-allele of D19H increases the transport activity of ABCG5/8 approximately 3-fold in vitro, indicating that the variant likely confers a gain of function that increases cholesterol efflux from the liver into the gallbladder (11). Login to comment
136 Apart from D19H, other genetic variants in ABCG5/8 have not been consistently associated with risk of gallstones. Login to comment
137 Although 3 smaller studies (287 gallstone cases) have reported associations for ABCG5 Q604E and ABCG8 T400K with risk of gallstone disease, the large genome-wide association study (n &#bc; 2,280 cases) that initially identified ABCG8 D19H did not report other risk variants in ABCG5/8 (27-30). Login to comment
139 We found that ABCG8 IVS&#fe;981 and T400K, as well as ABCG5 Q604E, were individually associated with risk of symptomatic gallstone disease independent of D19H genotype. Login to comment
140 In other words, these data, and the results from the studies mentioned previously (27-30), suggest that D19H is not the only lithogenic variant at the ABCG5/8 locus. Login to comment
141 By which mechanisms might the non-D19H variants promote the formation of gallstones? Login to comment
143 This resembles the association seen for D19H, suggesting that gain-of-function effects similar to the H-allele of D19H might underlie the associations for IVS3&#fe;981 and T400K. Login to comment
156 However, this has only been shown experimentally for the H-allele of D19H (11). Login to comment
159 However, other cohorts with measurements of both LDL cholesterol and plant sterols may be better suited to directly assess the LDL cholesterol Figure 6 Risk of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of ABCG5/8 Genotype Score on a D19H DD Background The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering alleles of adenosine triphosphate-binding cassette transporter G8 (ABCG8) IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test, or for trend tests of odds ratios (ORs). Login to comment

PMID: 24691589 [PubMed] Wu G et al: "ABCG5/8 variants are associated with susceptibility to coronary heart disease."

No. Sentence Comment

161 Furthermore, neither ABCG8 T400K nor D19H polymorphisms are independently associated with the risk of CHD in a cohort containing 2,012 heterozygous FH patients (37). Login to comment

PMID: 25804128 [PubMed] Nicolas A et al: "ABCG8 polymorphisms and renal disease in type 2 diabetic patients."

No. Sentence Comment

2 The ATP-binding cassette transporters G5 and G8 (ABCG5 and ABCG8) play an important role in intestinal sterol absorption and bile acid secretion. The aim of our study was to assess the associations between two ABCG8 coding polymorphisms, T400K and D19H, and the incidence of renal events in type 2 diabetic subjects. Login to comment
12 No significant association was found between the D19H polymorphism and the risk of diabetic nephropathy. Login to comment
33 In particular, the variants of ABCG8 D19H (rs11887534, G>C, exon 1) and ABCG8 T400K (rs4148217, C>A, exon 8) have been the most frequently reported to be associated with phenotypic variability. Login to comment
35 In the present investigation, we assessed associations of D19H and T400K variants in the coding region of ABCG8 with the incidence of severe kidney outcomes in the prospective DIABHYCAR cohort of French type 2 diabetic patients [27-30]. Login to comment
54 Polymorphism determination Polymorphisms T400K (rs4148217, C>A, exon 8) and D19H (rs11887534, G>C, exon 1) were genotyped using the Kaspar method (LGC Genomics, Hoddesdon, UK). Login to comment
75 No significant association was found between the D19H polymorphism and the incidence of renal events (Table 2). Login to comment
107 Since FXR is a bile acid receptor, it might interact with ABCG8 involved in bile acid secretion. The D19H polymorphism was not significantly associated with renal disease in our study, although its effects on plasma plant sterols and bile acid secretion seem of greater magnitude than those of T400K [22]. Login to comment
111 Polymorphism Renal event Statistics Without, n (%) With, n (%) Incidence, % P c7;2 unadjusted Hazard ratio (95% CI) Model 1 Model 2 a T400K (C>A) TT 1948 (64.9) 39 (52.0) 2.0 2 df: 0.018 Additive: 0.007 Dominant (CA + AA vs CC): 0.022 1.75 (1.20-2.56), P = 0.003 1.52 (1.05-2.21), P = 0.03 TK 953 (31.8) 30 (40.0) 3.1 KK 100 (3.3) 6 (8.0) 5.7 MAF 0.192 0.280 D19H (G>C) DD 2,615 (87.2) 69 (93.2) 2.6 2 df: 0.29 Additive: 0.13 Dominant (GC + CC vs GG): 0.14 0.53 (0.21-1.31), P = 0.16 0.53 (0.21-1.33), P = 0.18 DH 372 (12.4) 5 (6.8) 1.3 HH 11 (0.4) 0 (0) 0.0 MAF 0.066 0.034 MAF: minor allele frequency. a Cox regression analysis for the additive model, model 1: adjustment for sex, age, BMI, TG, total and HDL cholesterol, CRP, HbA1c, glycemia, diabetes duration, and prior myocardial infarction; model 2: idem + eGFR, UAE, SBP, DBP at baseline. Login to comment

PMID: 25920552 [PubMed] Rodriguez S et al: "Lipids, obesity and gallbladder disease in women: insights from genetic studies using the cardiovascular gene-centric 50K SNP array."

No. Sentence Comment

137 Our leading SNP, rs4953023:G4A (P = 7.41&#d7; 10-47, effect size = 0.734) is in perfect LD with the previously reported rs11887534:G4C (NM_022437.2(ABCG8): c.55G4C (p.Asp19His). Login to comment

PMID: 26358204 [PubMed] Castro-Torres IG et al: "Future therapeutic targets for the treatment and prevention of cholesterol gallstones."

No. Sentence Comment

1440 An experiment assessed the association of genetic alterations with biliary lithiasis and with elevated levels of blood lipids; it determined that some alleles of these transporters present in subjects with gallstones (Q604E for ABCG5 and D19H for ABCG8) are associated with increased levels of plasma lipids (cholesterol and triglycerides), as well as with a decrease in HDL cholesterol (Acalovschi et al., 2006). Login to comment
1442 In the latter two countries, genetic mapping identified segments of about 250 kilobases, which can be mapped to the locus of ABCG5/8, ABCG5-R50C (p&#bc;4.94 10(9)) and ABCG8-D19H (p&#bc;1.74 10(10)). Login to comment

PMID: 24256507 [PubMed] Goodloe R et al: "Lipid trait-associated genetic variation is associated with gallstone disease in the diverse Third National Health and Nutrition Examination Survey (NHANES III)."

No. Sentence Comment

90 Replication in European-descent populations ABCG5 rs6756629 (R50C) is in strong linkage disequilibrium with rs11887534 (D19H), a variant previously associated with gallstone disease risk in populations of European-descent [20]. Login to comment
105 Recent statistical and functional data suggest that ABCG5 rs11887534 (D19H) is likely the functional variant responsible for the association with gallstone disease risk while rs6756629 is likely a tagSNP [24]. Login to comment
211 18. Katsika D, Magnusson P, Krawczyk M, Grunhage F, Lichtenstein P, Einarsson C, Lammert F, Marschall HU: Gallstone disease in Swedish twins: risk is associated with ABCG8 D19H genotype. Login to comment
256 Kuo KK, Shin SJ, Chen ZC, Yang Y-HC, Yang JF, Hsiao PJ: Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease. Login to comment