ABCMdb

PMID: 15311998

Hubacek JA, Berge KE, Stefkova J, Pitha J, Skodova Z, Lanska V, Poledne R
Polymorphisms in ABCG5 and ABCG8 transporters and plasma cholesterol levels.
Physiol Res. 2004;53(4):395-401., [PubMed]

Sentences

No. Mutations Sentence Comment

5 ABCG5 p.Gln604Glu ABCG8 p.Asp19His ABCG8 p.Thr400Lys ABCG8 p.Tyr54Cys Missence polymorphisms (Gln604Glu in the ABCG5 and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) in these genes have been described. Login to comment 7 ABCG5 p.Gln604Glu ABCG8 p.Asp19His Plasma lipid levels and changes in plasma lipid levels were independent of the Gln604Glu polymorphism in ABCG5 and Asp19His and the Ala632Val polymorphisms in ABCG8. Login to comment 8 ABCG8 p.Tyr54Cys The Tyr54Cys polymorphism influenced the degree of reduction in total plasma cholesterol (∆ -0.49 mmol/l in Tyr54 homozygotes vs. ∆ +0.12 mmol/l in Cys54 homozygotes, p<0.04) and LDL-cholesterol (∆ -0.57 mmol/l in Tyr54 homozygotes vs. ∆ +0.04 mmol/l in Cys54 homozygotes, p<0.03) levels between 1988 and 1996 in females, but not in males. Login to comment 11 ABCG8 p.Thr400Lys ABCG8 p.Tyr54Cys We conclude that Tyr54Cys and Thr400Lys variations in the ABCG8 gene may play a role in the genetic determination of plasma cholesterol levels and could possibly influence the gender-specific response of plasma cholesterol levels after dietary changes. Login to comment 21 ABCG8 p.Asp19His ABCG8 p.Thr400Lys Recently, associations between the Asp19His and Thr400Lys polymorphisms and concentrations of plasma plant sterols (sitosterol and campesterol) have been described (Berge et al. 2002). Login to comment 22 ABCG5 p.Gln604Glu Another two polymorphisms, Ala632Val (Berge et al. 2002) and Gln604Glu (Weggemans et al. 2002), have been suggested to have an effect on plasma cholesterol levels. Login to comment 23 ABCG5 p.Gln604Glu ABCG8 p.Asp19His ABCG8 p.Thr400Lys ABCG8 p.Tyr54Cys To evaluate the role of the ABCG5 and ABCG8 variants in the genetic determination of plasma lipids, we analyzed non-synonymous polymorphisms in the ABCG5 (C1810G = Gln604Glu) and ABCG8 (G55C = Asp19His, A161G = Tyr54Cys, C1199A = Thr400Lys and C1895T = Ala632Val) genes, and searched for associations between the polymorphisms and plasma lipid levels, and between the polymorphisms and plasma lipid changes over a 8 years´ follow-up. Login to comment 33 ABCG5 p.Gln604Glu ABCG8 p.Asp19His ABCG8 p.Thr400Lys ABCG8 p.Tyr54Cys Polymorphism Primer sequence PCR product Enzyme Size Allele ABCG8 5`atggccgggaaggcggcagaggagag 83 bp BamH I 83 C (His) Asp19His 5`acttcccattgctcactcaccgagggat 56 + 27 G (Asp) ABCG8 5`agggcctccaggatagattgttctcctc 128 bp Bgl I 128 A (Tyr) Tyr54Cys 5`ccttgaacccaggcgtgcgcctacctg 102 + 26 G (Cys) ABCG8 5`agatgcctggggcggtgcagcagctt 108 bp Afl II 108 C (Thr) Thr400Lys 5`ggcttaatgtgatatacaaagacttggg 81 + 27 A (Lys) ABCG8 5`atgtctgtgtctccagatcctcaggg 105 bp Hae III 105 T (Val) Ala632Val 5`tacaggaccatgaagccaccgctgacgcc 79 + 26 C (Ala) ABCG5 5`aaccacacctgacactgtcaatcttttcct 117 bp Xho I 117 G (Glu) Gln604Glu 5`gggcaggttttctcaatgaattgaattcctc 86 + 31 C (Gln) DNA analysis Three ml of blood collected into EDTA tubes for DNA isolation were diluted with sterile water at a 1:1 ratio and stored at -20 °C. DNA was isolated by a standard method (Miller et al. 1988). Login to comment 39 ABCG8 p.Thr400Lys In 13 individuals, the Thr400Lys polymorphism at the ABCG8 locus was unsuccessfully genotyped even when repeated 3 times. Login to comment 52 ABCG5 p.Gln604Glu ABCG5 polymorphism and lipid parameters No association was found between the Gln604Glu polymorphism in the ABCG5 gene and lipid levels either in the general population or in males or females separately (both in 1988 and 1996). Login to comment 53 ABCG5 p.Gln604Glu ABCG5 polymorphism and lipid parameters No association was found between the Gln604Glu polymorphism in the ABCG5 gene and lipid levels either in the general population or in males or females separately (both in 1988 and 1996). Login to comment 54 ABCG8 p.Asp19His ABCG8 polymorphisms and lipid parameters No association was detected between the Asp19His and Ala632Val polymorphisms in the ABCG8 gene and lipid levels either in the general population or in males and females, when analyzed separately. Login to comment 55 ABCG8 p.Asp19His ABCG8 polymorphisms and lipid parameters No association was detected between the Asp19His and Ala632Val polymorphisms in the ABCG8 gene and lipid levels either in the general population or in males and females, when analyzed separately. Login to comment 57 ABCG5 p.Gln604Glu ABCG8 p.Asp19His ABCG8 p.Thr400Lys ABCG8 p.Tyr54Cys Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment 58 ABCG5 p.Gln604Glu ABCG8 p.Asp19His ABCG8 p.Thr400Lys ABCG8 p.Tyr54Cys Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment 60 ABCG8 p.Tyr54Cys Tyr54Cys polymorphism in ABCG8 in females, their plasma levels of total cholesterol (T-C) and LDL-cholesterol (LDL-C) in 1988 and 1996 and the changes in T-C levels between 1988 and 1996. Login to comment 61 ABCG8 p.Tyr54Cys ABCG8 p.Tyr54Cys Tyr54Cys polymorphism in ABCG8 in females, their plasma levels of total cholesterol (T-C) and LDL-cholesterol (LDL-C) in 1988 and 1996 and the changes in T-C levels between 1988 and 1996. Login to comment 62 ABCG8 p.Tyr54Cys ABCG8 p.Tyr54Cys Tyr54Tyr Tyr54Cys Cys54Cys N 43 68 28 Years 1988 1996 1988 1996 1988 1996 T-C 6.0±1.0 5.5±1.1 5.8±1.1 5.5±1.1 5.6±1.1 5.7±1.3 LDL-C 3.7±1.0 3.2±1.0 3.6±0.9 3.3±1.0 3.4±1.0 3.4±1.0 ∆ T-C* -9.1 % -5.5 % +1.8 % ∆ LDL-C** -15.4 % -9.7 % +1.2 % Data are in mmol/l, means ± S.D., * p<0.04, ** p<0.03. Login to comment 63 ABCG8 p.Tyr54Cys The Tyr54Cys polymorphism was not associated with lipid levels in either 1988 or 1996 While no significant change in LDL-cholesterol (∆ +0.04 mmol/l, +1.2 %) was found in females homozygous for the Cys54 allele, a marked decrease was observed in Tyr/Tyr homozygotes (∆ -0.57 mmol/l, -15.4 %) with heterozygotes showing an intermediate decrease (∆ -0.35 mmol/l, -9.7 %) (p<0.03, Table 4). Login to comment 65 ABCG8 p.Thr400Lys However, the Thr400Lys polymorphism in ABCG8 was associated with lipid level changes in males only. Login to comment 66 ABCG8 p.Thr400Lys However, the Thr400Lys polymorphism in ABCG8 was associated with lipid level changes in males only. Login to comment 70 ABCG8 p.Thr400Lys Thr400Lys polymorphism in ABCG8 and plasma levels of total cholesterol (T-C) and LDL-cholesterol (LDL-C) in 1988 and 1996 in males changes of T-C between 1988 and 1996. Login to comment 71 ABCG8 p.Thr400Lys Thr400Lys polymorphism in ABCG8 and plasma levels of total cholesterol (T-C) and LDL-cholesterol (LDL-C) in 1988 and 1996 in males changes of T-C between 1988 and 1996. Login to comment 96 ABCG8 p.Thr400Lys In males, a similar pattern was observed for the Thr400Lys polymorphism at the ABCG8 locus. Login to comment 97 ABCG8 p.Thr400Lys In males, a similar pattern was observed for the Thr400Lys polymorphism at the ABCG8 locus. Login to comment 102 ABCG8 p.Thr400Lys ABCG8 p.Tyr54Cys In this sample, variations in the ABCG8 gene loci (Tyr54Cys and Thr400Lys polymorphisms) were found to play a role in gender-specific reduction in plasma lipid levels as a response to reduced dietary animal fat and cholesterol intake. Login to comment 103 ABCG8 p.Thr400Lys ABCG8 p.Thr400Lys ABCG8 p.Tyr54Cys ABCG8 p.Tyr54Cys In this sample, variations in the ABCG8 gene loci (Tyr54Cys and Thr400Lys polymorphisms) were found to play a role in gender-specific reduction in plasma lipid levels as a response to reduced dietary animal fat and cholesterol intake. Login to comment 104 ABCG8 p.Thr400Lys ABCG8 p.Tyr54Cys Our results suggest that the Tyr54Cys and Thr400Lys polymorphisms in ABCG8 might play a role in the genetic determination of plasma lipids in a gender-specific gene-nutrition manner. Login to comment