ABCMdb

PMID: 15816807

Miwa K, Inazu A, Kobayashi J, Higashikata T, Nohara A, Kawashiri M, Katsuda S, Takata M, Koizumi J, Mabuchi H
ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects.
Clin Sci (Lond). 2005 Aug;109(2):183-8., [PubMed]

Sentences

No. Mutations Sentence Comment

3 ABCG5 p.Gln604Glu ABCG5 p.Cys287Arg ABCG8 p.Thr400Lys ABCG8 p.Met429Val We identified a novel mutation [859T/C (C287R)] and a novel polymorphism [1285A/G (M429V)] at the ABCG5/ABCG8 loci, as well as four polymorphisms reported previously [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1895C/T (A632V)]. Login to comment 4 ABCG8 p.Met429Val In carriers of the novel M429V variant, the serum level of sitosterol and the sitosterol/cholesterol ratio were significantly higher than those in non-carriers (3.64 compared with 2.56 µg/ml, and 1.45 µg/mg compared with 1.00 µg/mg respectively; P < 0.01 for both), and serum lathosterol tended to be lower (1.95 µg/ml compared with 3.03 µg/ml; P = 0.08), whereas no significant difference was observed in other lipid profiles. Login to comment 6 ABCG8 p.Met429Val We conclude that, in 8% of patients with hypercholesterolaemia, the novel ABCG8 M429V variant was associated with higher cholesterol absorption efficiency. Login to comment 14 ABCG5 p.Gln604Glu ABCG5 p.Cys287Arg ABCG5 p.Cys287Arg ABCG8 p.Thr400Lys ABCG8 p.Thr400Lys ABCG8 p.Met429Val ABCG8 p.Met429Val Nucleotide Annealing Position Mutation change* Forward primer (5 → 3 ) Reverse primer (5 → 3 ) temperature (◦ C) Enzyme Size (bp) ABCG5 Exon 7 C287R 859T → C TCACACACTAACTACCTTCTGTTGTC ATGATGGGGAATGTGAAAGAAA 54 BstUI 191 Exon 13 Q604E 1810C → G ATCTAGATTCACAATGAACTTTCTA GTCCCTGCAAGTTGTAAGAG 53 XhoI 193 ABCG8 Exon 2 C54Y 161G → A GGAGGTCAGAGACCTCAAgT GCCCACCCTTTTATTTCCAC 56 RsaI 107 Exon 8 T400K 1199C → A ACACCTGTGTGGAAAGGTAAGGT GCGGGTTCAGTAATAAAATGACAG 57 MseI 216 Exon 9 M429V 1285A → G ATGCTGTTGCCTCAGCATCT AAGCTGTGTTCCTCTGAGCT 56 Tsp45I 306 Exon 13 A632V 1895C → T ATGTCTGTGTCTCCAGATCCTCAGgG TACAGGACCATGAAGCCACCGCTGAcGCC 63 HaeIII 105 sterols to cholesterol are known to be positively related to cholesterol absorption and negatively to cholesterol synthesis [1-4]. Login to comment 21 ABCG5 p.Gln604Glu ABCG8 p.Asp19His ABCG8 p.Thr400Lys Indeed, it was previously proposed that common sequence variants in ABCG5 (Q604E) and ABCG8 (D19H and T400K) are associated with plasma plant sterol and lipid levels in normocholesterolaemic or mildly hypercholesterolaemic European-American populations [10-12]. Login to comment 47 ABCG5 p.Cys287Arg ABCG8 p.Met429Val Genotype and allele frequencies A novel mutation of C287R and five SNPs (single nucleotide polymorphisms) (including a novel one ABCG8 M429V) were genotyped in our subjects. Login to comment 48 ABCG5 p.Gln604Glu ABCG5 p.Cys287Arg ABCG8 p.Thr400Lys ABCG8 p.Met429Val Frequency distributions for the genotypes in exon 7 (C287R) and exon 13 (Q604E) of ABCG5, and in exon 2 (C54Y), exon 8 (T400K), exon 9 (M429V) and exon 13 (A632V) of ABCG8 are shown in Table 3. Login to comment 50 ABCG8 p.Asp19His For instance, the ABCG8 D19H variant was not Table 2 Clinical characteristics of the study subjects Values are means +- S.D. BMI, body mass index. Login to comment 51 ABCG5 p.Gln604Glu ABCG5 p.Gln604Glu ABCG5 p.Cys287Arg ABCG5 p.Cys287Arg ABCG8 p.Thr400Lys ABCG8 p.Thr400Lys ABCG8 p.Met429Val ABCG8 p.Met429Val Parameters Value Age (years) 62.4 +- 12.1 Gender (men/women) 48/52 BMI (kg/m2 ) 23.0 +- 3.5 Total cholesterol (mg/dl) 261 +- 48 Triacylglycerol (mg/dl) 135 +- 69 HDL-C (mg/dl) 56 +- 16 LDL-C (mg/dl) 179 +- 48 Sitosterol (µg/ml) 2.63 +- 1.0 Lathosterol (µg/ml) 3.00 +- 1.3 Table 3 Genotype distribution and allele frequencies of the polymorphisms in the ABCG5/ABCG8 gene Gene Mutation Nucleotide change Polymorphism Allele frequency ABCG5 Exon 7 C287R 859T → C T 0.99 C 0.01 Exon 13 Q604E 1810C → G C 0.89 G 0.11 ABCG8 Exon 2 C54Y 161G → A G 0.82 A 0.18 Exon 8 T400K 1199C → A C 0.88 A 0.12 Exon 9 M429V 1285A → G A 0.96 G 0.04 Exon 13 A632V 1895C → T C 0.995 T 0.005 found and the A632V variant was rare in our Japanese subjects. Login to comment 53 ABCG5 p.Cys287Arg Of the six mutation/ polymorphisms, one novel mutation (C287R) and one reported variant (A632V) were excluded from the study because of their rarity (allele frequency 0.01). Login to comment 55 ABCG8 p.Met429Val The novel M429V variant of ABCG8 was found to be positively associated with both higher sitosterol concentrations and their ratio to cholesterol (P < 0.01 for both). Login to comment 57 ABCG5 p.Gln604Glu ABCG5 p.Gln604Glu ABCG8 p.Thr400Lys ABCG8 p.Thr400Lys ABCG8 p.Met429Val ABCG8 p.Met429Val Sitosterol Lathosterol Sitosterol/chol Polymorphism Genotype n (µg/ml) P value (µg/ml) P value (µg/mg) P value Lathosterol/chol (µg/mg) P value ABCG5 Exon 13 Q604E (1810C → G) QQ 78 2.63 +- 1.06 0.81 2.97 +- 1.36 0.73 1.03 +- 0.3 0.97 1.19 +- 0.55 0.84 QE 21 2.69 +- 0.72 3.09 +- 1.12 1.03 +- 0.40 1.16 +- 0.38 EE 1 1.2 3.2 0.6 1.57 ABCG8 Exon 2 C54Y (161G → A) CC 67 2.69 +- 0.98 0.19 2.82 +- 1.11 0.06 1.05 +- 0.36 0.06 1.12 +- 0.45 0.2 CY 30 2.57 +- 1.06 3.20 +- 1.33 1.02 +- 0.43 1.27 +- 0.57 YY 3 1.93 +- 0.31 4.23 +- 3.17 0.65 +- 0.12 1.38 +- 0.98 ABCG8 Exon 8 T400K (1199C → A) TT 76 2.64 +- 0.98 0.85 2.87 +- 1.10 0.14 1.03 +- 0.37 0.96 1.14 +- 0.45 0.17 TK 24 2.60 +- 1.07 3.34 +- 1.70 1.03 +- 0.44 1.31 +- 0.66 KK 0 ABCG8 Exon 9 M429V (1285A → G) MM 92 2.56 +- 0.94 0.003 3.03 +- 1.30 0.08 1.00 +- 0.36 0.002 1.19 +- 0.51 0.16 MV 8 3.64 +- 1.26 1.95 +- 0.53 1.45 +- 0.56 0.84 +- 0.36 VV 0 Table 5 Effect of the four polymorphism haplotypes in the ABCG5/ABCG8 gene on serum non-cholesterol levels Values are means +- S.D. The haplotype effects on serum non-cholesterol levels were assigned in all individuals using PHASE in 94 individuals. Login to comment 63 ABCG5 p.Cys287Arg In the two rare cases with the C287R mutation, their serum sitosterol and sitosterol/cholesterol levels were not significantly elevated (2.6 µg/ml and 3.1 µg/ml, and 0.97 µg/mg and 1.48 µg/mg respectively). Login to comment 67 ABCG5 p.Gln604Glu ABCG8 p.Thr400Lys ABCG8 p.Met429Val Of the 16 possible four-polymorphism haplotypes [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1285A/G (M429V)], six haplotypes were estimated to be present. Login to comment 70 ABCG5 p.Cys287Arg ABCG8 p.Met429Val ABCG8 p.Met429Val DISCUSSION The main findings of the present study performed in Japanese hypercholesterolaemic subjects are as follows: (i) two novel mutants or polymorphisms, C287R in ABCG5 and M429V in ABCG8, have been identified, and (ii) the M429V polymorphism is positively associated with serum sitosterol and sitosterol/cholesterol levels, whereas the other three polymorphisms are not associated with serum non-cholesterol levels. Login to comment 74 ABCG8 p.Met429Val Among the four polymorphisms examined, only the M429V variant was significantly associated with sitosterol concentration and its ratio to cholesterol. Login to comment 75 ABCG5 p.Gln604Glu ABCG8 p.Asp19His ABCG8 p.Thr400Lys This result does not appear to be consistent with previous reports that the sequence variants in ABCG5 (Q604E) and ABCG8 (D19H and T400K) are associated with lower serum plant sterol levels in Western countries [10-12]. Login to comment 76 ABCG5 p.Gln604Glu ABCG8 p.Asp19His ABCG8 p.Thr400Lys The results of our present study suggest that the frequencies of D19H and A632V variants of ABCG8 are rarer in Japanese than in European-American populations, and that these Q604E and T400K variants may not be as important in the regulation of non-cholesterol sterol levels in Japanese populations. Login to comment 91 ABCG8 p.Asp19His A recent study has shown that there is a statistically significant association between the ABCG8 D19H polymorphism and the proportional reduction in LDL-C during atorvastatin treatment [25]. Login to comment 93 ABCG8 p.Met429Val In the present study, the novel M429V variant may have similar therapeutic implications of statins. Login to comment 94 ABCG8 p.Met429Val Finally, we did not find a specific ABCG5/ABCG8 haplotype that was more significantly associated with non-cholesterol sterol concentrations than the M429V variant alone. Login to comment 95 ABCG8 p.Met429Val This strongly suggests that the novel M429V variant itself, or another as yet undefined linked variant, has functional significance. Login to comment 96 ABCG8 p.Met429Val In terms of putative topology, M429V is predicted to be located in the first transmembrane domain of an N-terminal site. Login to comment 97 ABCG8 p.Met429Val From this point of view, the M429V variant is the marker rather than the cause of higher serum sitosterol concentration. Login to comment 98 ABCG8 p.Met429Val In conclusion, in 8% of Japanese patients with primary hypercholesterolaemia, the novel ABCG8 M429V variant is associated with higher serum sitosterol concentrations (probably due to higher cholesterol absorption efficiency), whereas no relationships with serum lipid concentrations are observed under dietary restriction. Login to comment