PMID: 23406058

Renner O, Lutjohann D, Richter D, Strohmeyer A, Schimmel S, Muller O, Stange EF, Harsch S
Role of the ABCG8 19H risk allele in cholesterol absorption and gallstone disease.
BMC Gastroenterol. 2013 Feb 13;13:30. doi: 10.1186/1471-230X-13-30., [PubMed]
Sentences
No. Mutations Sentence Comment
0 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:0:332
status: NEW
view ABCG8 p.Asp19His details
RESEARCH ARTICLE Open Access Role of the ABCG8 19H risk allele in cholesterol absorption and gallstone disease Olga Renner1* , Dieter L&#fc;tjohann2 , Dominique Richter1 , Andr&#e9; Strohmeyer1 , Silke Schimmel1 , Oliver M&#fc;ller3 , Eduard F Stange3* and Simone Harsch1 Abstract Background: Gallstone disease is associated with p.D19H of ABCG8 as well as alterations of cholesterol and bile acid metabolism. Login to comment
8 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:8:26
status: NEW
view ABCG8 p.Asp19His details
Genotype frequencies of p.D19H were established using MALDI-TOF mass spectrometry. Login to comment
10 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:10:0
status: NEW
view ABCG8 p.Asp19His details
D19H was found to be significantly associated with gallstones (odds ratio [OR] = 2.9, P = 0.0220, 95% confidence interval [CI]:1.22-6.89), particularly in the overweight cohort (OR = 3.2, P = 0.0430, 95% CI:1.07-9.26). Login to comment
11 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:11:69
status: NEW
view ABCG8 p.Asp19His details
Cholesterol absorption was about 24% lower in individuals carrying p.D19H compared to wild type (Psitosterol = 0.0080, Pcampesterol = 0.0206). Login to comment
12 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:12:51
status: NEW
view ABCG8 p.Asp19His details
Moreover, irrespective of phenotype, carriers of p.D19H displayed a significant lower absorption than carriers of the major allele. Login to comment
14 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:14:102
status: NEW
view ABCG8 p.Asp19His details
Notably, ABCG5/8 and NPC1L1 expression was similar in gallstone carriers and controls regardless of p.D19H presence. Login to comment
15 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:15:42
status: NEW
view ABCG8 p.Asp19His details
Conclusions: Both gallstone disease and p.D19H of ABCG8 are associated with diminished cholesterol absorption. Login to comment
16 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:16:11
status: NEW
view ABCG8 p.Asp19His details
However, p.D19H is not responsible for the differences in small intestinal sterol transporter expression. Login to comment
34 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:34:58
status: NEW
view ABCG8 p.Asp19His details
Most prominently associated with gallstone disease is the D19H polymorphism of the ABCG8 gene [29]. Login to comment
35 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:35:28
status: NEW
view ABCG8 p.Asp19His details
In healthy individuals, the D19H polymorphism was associated with low cholesterol absorption [30]. Login to comment
37 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:37:178
status: NEW
view ABCG8 p.Asp19His details
Recently, the study of Krawczyk showed that cholesterol absorption was significantly lower and de novo synthesis higher in gallstone carriers [4] but this was independent of the D19H polymorphism. Login to comment
38 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:38:324
status: NEW
view ABCG8 p.Asp19His details
The present study therefore addressed the following questions: i) are both, low cholesterol absorption and increased de novo cholesterol synthesis indeed common in gallstone carriers, ii) is the expression of intestinal cholesterol transporters and their transcription factors different in gallstone carriers, iii) does the D19H polymorphism of the ABCG8 gene affect any of these parameters? Login to comment
83 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:83:15
status: NEW
view ABCG8 p.Asp19His details
Genotyping The D19H SNP analysis of ABCG8 was performed with blood DNA using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) of allele specific primer extension products as reported previously [34], applying the following primer sequences: 1st-primer: ACGTTGGATGAGGAGAGAGGGCTGC CGAAA, 2nd-primer: ACGTTGGATGACTTCCCATTGCTCA CTCAC and extension primer: TGCTCACTCACCGAGGTATG. Login to comment
84 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:84:15
status: NEW
view ABCG8 p.Asp19His details
Genotyping The D19H SNP analysis of ABCG8 was performed with blood DNA using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) of allele specific primer extension products as reported previously [34], applying the following primer sequences: 1st-primer: ACGTTGGATGAGGAGAGAGGGCTGC CGAAA, 2nd-primer: ACGTTGGATGACTTCCCATTGCTCA CTCAC and extension primer: TGCTCACTCACCGAGGTATG. Login to comment
135 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:135:15
status: NEW
view ABCG8 p.Asp19His details
ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:135:80
status: NEW
view ABCG8 p.Asp19His details
Association of D19H polymorphism with cholelithiasis Since individuals with the D19H polymorphism (rs11887534, c.52 G > c) in the ABCG8 gene are known to have a higher risk of developing gallstones [29,41], a genotype analysis of this polymorphism was performed in our cohort. Login to comment
136 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:136:15
status: NEW
view ABCG8 p.Asp19His details
ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:136:80
status: NEW
view ABCG8 p.Asp19His details
Association of D19H polymorphism with cholelithiasis Since individuals with the D19H polymorphism (rs11887534, c.52 G > c) in the ABCG8 gene are known to have a higher risk of developing gallstones [29,41], a genotype analysis of this polymorphism was performed in our cohort. Login to comment
139 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:139:34
status: NEW
view ABCG8 p.Asp19His details
Confirming prior reports [29,41], D19H was found to be significantly associated with gallstone disease in our total population with OR = 2.9 (P = 0.0220, 95% CI: 1.22-6.89). Login to comment
140 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:140:34
status: NEW
view ABCG8 p.Asp19His details
ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:140:62
status: NEW
view ABCG8 p.Asp19His details
Confirming prior reports [29,41], D19H was found to be significantly associated with gallstone disease in our total population with OR = 2.9 (P = 0.0220, 95% CI: 1.22-6.89). Login to comment
141 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:141:17
status: NEW
view ABCG8 p.Asp19His details
ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:141:62
status: NEW
view ABCG8 p.Asp19His details
ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:141:129
status: NEW
view ABCG8 p.Asp19His details
Notably, overweight simultaneous carriers of gallstones and p.D19H displayed a higher OR (OR = 3.2, P = 0.0430, 95% CI: 1.07-9.26) than the respective normal weight group (OR = 1.6, P = 0.6270, 95% CI: 0.30-8.77). Login to comment
142 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:142:17
status: NEW
view ABCG8 p.Asp19His details
ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:142:45
status: NEW
view ABCG8 p.Asp19His details
ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:142:129
status: NEW
view ABCG8 p.Asp19His details
Influence of the D19H polymorphism on cholesterol metabolism and intestinal ABCG8 expression Next, we analysed the effect of the D19H polymorphism in ABCG8 on cholesterol absorption and cholesterol synthesis. Login to comment
143 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:143:45
status: NEW
view ABCG8 p.Asp19His details
As shown in Figure 2A and B, carriers of the D19H gallstone risk allele were characterised by significantly reduced intestinal cholesterol absorption of about 24% (sitosterol P = 0.0080, campesterol P = 0.0206). Login to comment
151 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:151:42
status: NEW
view ABCG8 p.Asp19His details
Table 4 The frequency of the polymorphism D19H in the gallstone carriers and controls of the population from Stuttgart Group Controls (134) Gallstone carriers (34) (GG<>Gc) Genotype G/G G/c c/c G/G G/c c/c P-value OR (95% CI) Total 115 19 0 23 11 0 0.022 2.9(CI: 1.216 to 6.889) Normal weight 66 9 0 9 2 0 0.627 1.6(CI: 0.303 to 8.770) Overweight 49 10 0 14 9 0 0.043 3.2(CI: 1.071 to 9.264) G = major allele, c = minor allele, OR = odds ratio, CI = confidence interval. Login to comment
152 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:152:42
status: NEW
view ABCG8 p.Asp19His details
Table 4 The frequency of the polymorphism D19H in the gallstone carriers and controls of the population from Stuttgart Group Controls (134) Gallstone carriers (34) (GG<>Gc) Genotype G/G G/c c/c G/G G/c c/c P-value OR (95% CI) Total 115 19 0 23 11 0 0.022 2.9(CI: 1.216 to 6.889) Normal weight 66 9 0 9 2 0 0.627 1.6(CI: 0.303 to 8.770) Overweight 49 10 0 14 9 0 0.043 3.2(CI: 1.071 to 9.264) G = major allele, c = minor allele, OR = odds ratio, CI = confidence interval. Login to comment
155 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:155:196
status: NEW
view ABCG8 p.Asp19His details
The most pronounced effect on cholesterol absorption ratio was observed for serum campesterol levels (wild type controls to mutated controls 28%, P = 0.0347 and wild type controls to cases with p.D19H 37%, P = 0.0030). Login to comment
156 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:156:196
status: NEW
view ABCG8 p.Asp19His details
The most pronounced effect on cholesterol absorption ratio was observed for serum campesterol levels (wild type controls to mutated controls 28%, P = 0.0347 and wild type controls to cases with p.D19H 37%, P = 0.0030). Login to comment
157 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:157:142
status: NEW
view ABCG8 p.Asp19His details
To study whether this polymorphism affected intestinal transporter expression, the intestinal expression of the ABCG8 gene was related to the D19H subgroups. Login to comment
158 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:158:142
status: NEW
view ABCG8 p.Asp19His details
To study whether this polymorphism affected intestinal transporter expression, the intestinal expression of the ABCG8 gene was related to the D19H subgroups. Login to comment
162 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:162:60
status: NEW
view ABCG8 p.Asp19His details
Third, in the cohort of gallstone carriers and controls the D19H polymorphism of the ABCG8 gene was associated with a low cholesterol absorption but not with altered de novo synthesis. Login to comment
163 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:163:60
status: NEW
view ABCG8 p.Asp19His details
Third, in the cohort of gallstone carriers and controls the D19H polymorphism of the ABCG8 gene was associated with a low cholesterol absorption but not with altered de novo synthesis. Login to comment
176 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:176:112
status: NEW
view ABCG8 p.Asp19His details
Moreover, in the current study a diminished cholesterol absorption ratio Figure 2 Influence of the polymorphism D19H on markers of cholesterol metabolism. Login to comment
177 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:177:112
status: NEW
view ABCG8 p.Asp19His details
Moreover, in the current study a diminished cholesterol absorption ratio Figure 2 Influence of the polymorphism D19H on markers of cholesterol metabolism. Login to comment
181 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:181:49
status: NEW
view ABCG8 p.Asp19His details
(GG) = wild type individual; (Gc) = carrier of p.D19H; (GG) = 93 and (Gc) = 25. Login to comment
182 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:182:49
status: NEW
view ABCG8 p.Asp19His details
(GG) = wild type individual; (Gc) = carrier of p.D19H; (GG) = 93 and (Gc) = 25. Login to comment
190 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:190:98
status: NEW
view ABCG8 p.Asp19His details
In line with the observation of Masson [53], the levels of Figure 3 Influence of the polymorphism D19H on markers of cholesterol metabolism in gallstone disease. Login to comment
191 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:191:98
status: NEW
view ABCG8 p.Asp19His details
In line with the observation of Masson [53], the levels of Figure 3 Influence of the polymorphism D19H on markers of cholesterol metabolism in gallstone disease. Login to comment
196 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:196:79
status: NEW
view ABCG8 p.Asp19His details
GG genotype (wild type individual): C = 75, GS = 14; Gc genotype (carrier of p.D19H): C = 18, GS = 11. Login to comment
197 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:197:79
status: NEW
view ABCG8 p.Asp19His details
GG genotype (wild type individual): C = 75, GS = 14; Gc genotype (carrier of p.D19H): C = 18, GS = 11. Login to comment
202 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:202:17
status: NEW
view ABCG8 p.Asp19His details
The polymorphism D19H of sterol exporter ABCG8 was associated with gallstones in various populations and different ethnic groups [29,41,57-61]. Login to comment
203 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:203:17
status: NEW
view ABCG8 p.Asp19His details
The polymorphism D19H of sterol exporter ABCG8 was associated with gallstones in various populations and different ethnic groups [29,41,57-61]. Login to comment
206 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:206:49
status: NEW
view ABCG8 p.Asp19His details
In contrast to the study of Srivastava [59], the D19H relative risk was more pronounced in males than in females (Additional file 1: Table S2). Login to comment
207 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:207:49
status: NEW
view ABCG8 p.Asp19His details
In contrast to the study of Srivastava [59], the D19H relative risk was more pronounced in males than in females (Additional file 1: Table S2). Login to comment
208 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:208:60
status: NEW
view ABCG8 p.Asp19His details
Despite these descriptive studies about the relationship of D19H to the abnormalities in the lipid profile or to gallstones [29,41,62,63], there are no direct cell culture studies on the functional influence of the polymorphism on transporter expression or activity so far. Login to comment
209 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:209:60
status: NEW
view ABCG8 p.Asp19His details
Despite these descriptive studies about the relationship of D19H to the abnormalities in the lipid profile or to gallstones [29,41,62,63], there are no direct cell culture studies on the functional influence of the polymorphism on transporter expression or activity so far. Login to comment
210 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:210:27
status: NEW
view ABCG8 p.Asp19His details
In our study carriers of p.D19H were characterised by significantly reduced intestinal cholesterol absorption irrespective of the presence or absence of gallstones and the polymorphism did not affect intestinal ABCG8 expression. Login to comment
211 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:211:27
status: NEW
view ABCG8 p.Asp19His details
In our study carriers of p.D19H were characterised by significantly reduced intestinal cholesterol absorption irrespective of the presence or absence of gallstones and the polymorphism did not affect intestinal ABCG8 expression. Login to comment
214 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:214:83
status: NEW
view ABCG8 p.Asp19His details
Conclusions In summary, both the presence of gallstones and the ABCG8 polymorphism D19H were related to diminished cholesterol absorption but the polymorphism did not affect ileal expression of ABCG8, suggesting a gain-of -function of the mutated transporter. Login to comment
215 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:215:83
status: NEW
view ABCG8 p.Asp19His details
Conclusions In summary, both the presence of gallstones and the ABCG8 polymorphism D19H were related to diminished cholesterol absorption but the polymorphism did not affect ileal expression of ABCG8, suggesting a gain-of -function of the mutated transporter. Login to comment
218 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:218:124
status: NEW
view ABCG8 p.Asp19His details
Detailed comparison of intestinal cholesterol Figure 4 Correlation of ABCG8 expression to the frequency of the polymorphism D19H in the Stuttgart cohort. Login to comment
219 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:219:124
status: NEW
view ABCG8 p.Asp19His details
Detailed comparison of intestinal cholesterol Figure 4 Correlation of ABCG8 expression to the frequency of the polymorphism D19H in the Stuttgart cohort. Login to comment
223 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:223:49
status: NEW
view ABCG8 p.Asp19His details
(GG) = wild type individual; (Gc) = carrier of p.D19H. Login to comment
224 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:224:49
status: NEW
view ABCG8 p.Asp19His details
(GG) = wild type individual; (Gc) = carrier of p.D19H. Login to comment
225 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:225:149
status: NEW
view ABCG8 p.Asp19His details
(B) Representative Western blot images of ABCG8 protein and villin in ileal mucosa of control individuals and gallstone carriers, with and without p.D19H. Login to comment
226 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:226:149
status: NEW
view ABCG8 p.Asp19His details
(B) Representative Western blot images of ABCG8 protein and villin in ileal mucosa of control individuals and gallstone carriers, with and without p.D19H. Login to comment
231 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:231:29
status: NEW
view ABCG8 p.Asp19His details
The frequency of the variant D19H in the gallstone carriers and controls of the population from Stuttgart (with subgroups). Login to comment
232 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:232:29
status: NEW
view ABCG8 p.Asp19His details
The frequency of the variant D19H in the gallstone carriers and controls of the population from Stuttgart (with subgroups). Login to comment
419 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:419:79
status: NEW
view ABCG8 p.Asp19His details
Srivastava A, Srivastava A, Srivastava K, Choudhuri G, Mittal B: Role of ABCG8 D19H (rs11887534) variant in gallstone susceptibility in northern India. Login to comment
421 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:421:79
status: NEW
view ABCG8 p.Asp19His details
Srivastava A, Srivastava A, Srivastava K, Choudhuri G, Mittal B: Role of ABCG8 D19H (rs11887534) variant in gallstone susceptibility in northern India. Login to comment
425 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:425:102
status: NEW
view ABCG8 p.Asp19His details
Kuo KK, Shin SJ, Chen ZC, Yang YH, Yang JF, Hsiao PJ: Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease. Login to comment
427 ABCG8 p.Asp19His
X
ABCG8 p.Asp19His 23406058:427:102
status: NEW
view ABCG8 p.Asp19His details
Kuo KK, Shin SJ, Chen ZC, Yang YH, Yang JF, Hsiao PJ: Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease. Login to comment