ABCMdb

PMID: 22328824

Roberts LJ, Nossek CA, Greenberg LJ, Ramesar RS
Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients.
Mol Vis. 2012;18:280-9. Epub 2012 Feb 1., [PubMed]

Sentences

No. Mutations Sentence Comment

6 ABCA4 p.Gly863Ala ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp ABCA4 p.Leu2027Phe Results: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. Login to comment 52 ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp ABCA4 p.Leu2027Phe Four of the mutations were detected with SNaPshot PCR (p.Cys1490Tyr, p.Arg602Trp, c.5461-10T>C, and p.Leu2027Phe mutations; Table 2, Figure 1, Figure 2, and Figure 3) using the SNaPshot® Multiplex Ready Reaction Mix (Applied Biosystems, Warrington, UK), resolved on the ABI 3100 Genetic Analyzer (Applied Biosystems) and subsequently analyzed using the GeneMapper 3.0 GeneScan software (Applied Biosystems). Login to comment 54 ABCA4 p.Gly863Ala AS-PCR was used to screen for the p.Gly863Ala mutation (Table 3), and the PCR products were separated using non-denaturing dHPLC conditions on the WAVE® System (Figure 6). Login to comment 61 ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp ABCA4 p.Arg602Trp ABCA4 p.Leu2027Phe ABCA4 p.Leu2027Phe Exon (mutation) Primer 5'-3' Annealing temperature Mutation detection technique Exon 5 (p.Arg152*) F: gacccatttccccttcaac 60 °C dHPLC, Cycle sequencing using the reverse primer R: aggctgggtgcttccctc Exon 6 (c.768G>T) F: ggtgtctttcctaccacag 57.9 °C dHPLC, Cycle sequencing using the forward primer R: aggaatcaccttgcaattgg Exon 13 (p.Arg602Trp) F: agctatccaagcccgttcc 63 °C SNaPshot PCR R: ccattagcgtgtcatggag Exon 17 (p.Gly863Ala) F: ctgcggtaaggtaggataggg 60 °C Allele-specific PCR R: cacaccgtttacatagagggc Exon 30 (p.Cys1490Tyr) F: gtcagcaactttgaggctg 63 °C SNaPshot PCR R: tccctctgtggcaggcag Intron38/Exon39 (c.5461-10T>C) F: gccccacctgctgaagag 63 °C SNaPshot PCR R: tcccagctttggacccag Exon 44 (p.Leu2027Phe) F: gaagcttctccagccctagc 63 °C SNaPshot PCR R: tgcactctcatgaaacaggc TABLE 2. Login to comment 63 ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp ABCA4 p.Leu2027Phe Exon (mutation) Primer length (bp) with tail Primer sequence (with tail, 5'-3')* 13 (p.Arg602Trp) 34 R: tgttccagtgccacgaacccgccccagatgtacc 30 (p.Cys1490Tyr) 32 R: cttcgtggttactgagcttctccctggtgctg 39 (Intron 38) (c.5461-10T>C) 37 F: ccgatgtagttgaccccgtttccaacagtcctacttc 44 (p.Leu2027Phe) 41 R: tactctggatcttagtaggtaaagatgttctcgtcctgtga *ThenucleotidesequenceinboldisthesequencedesignedtobindcomplementarytothegenomicDNAsequence.Thenucleotide sequence not written in bold is the random nucleotide tail added to the primer sequence. Figure 1. Login to comment 64 ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp An electropherogram of the multiplex SNaPshot reaction shows the results obtained for a sample that is heterozygous for the p.Arg602Trp and p.Cys1490Tyr mutations. Login to comment 65 ABCA4 p.Arg602Trp The p.Arg602Trp alleles are indicated by blue and green peaks at 36 bp and 37 bp, respectively. Login to comment 66 ABCA4 p.Cys1490Tyr The p.Cys1490Tyr alleles are indicated by black and red peaks at 38 bp and 39 bp, respectively. Login to comment 73 ABCA4 p.Gly863Ala ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp ABCA4 p.Leu2027Phe However, seven mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a significantly higher frequency, compared to the other variants in the cohort (Table 4). Login to comment 88 ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp Functional analysis of the p.Arg602Trp and p.Cys1490Tyr mutations showed that these missense alleles result in misfolding and mislocalization of the ABCA4 protein, as well as a marked reduction in ATPase activity [12]. Login to comment 90 ABCA4 p.Gly863Ala The same study showed that the p.Gly863Ala mutation, which occurs in the first nucleotide and hence the splice acceptor site of exon 17, Figure 2. Login to comment 91 ABCA4 p.Leu2027Phe An electropherogram of the multiplex SNaPshot reaction showing the results obtained for a sample that is heterozygous for the p.Leu2027Phe mutation. Login to comment 95 ABCA4 p.Leu2027Phe The p.Leu2027Phe alleles are represented by blue and green peaks at 45 bp and 46 bp, respectively. Login to comment 101 ABCA4 p.Leu2027Phe Functional analysis of the Nucleotide Binding Domain 2 of ABCA4, which contains the p.Leu2027Phe mutation, has indicated that mutations in this domain cause inhibition of ATP hydrolysis [14]. Login to comment 121 ABCA4 p.Cys1490Tyr The p.Cys1490Tyr mutation was found to be the most frequently occurring mutation, detected in 19.44% of patient samples. Login to comment 127 ABCA4 p.Gly863Ala INFORMATION PERTAINING TO THE PRIMERS DESIGNED FOR AS-PCR FOR GLY863ALA MUTATION DETECTION. Login to comment 128 ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala Exon (mutation) Primer name (bp) Primer length Primer sequence* (5'-3') 17 Gly863Ala-Rc 26 tttttgaagtggggttccatagtcag Gly863Ala-Rg 36 gcgtgcttggggtatgaagtggggttccatagtcac Gly863Ala-Rc: The AS-PCR primer designed specifically to bind to the nucleotide, cytosine (C), when exon 17 does not contain the p.Gly863Ala mutation, and is therefore known as the wild type primer. Login to comment 129 ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala Gly863Ala-Rg: The AS-PCR primer designed specifically to bind to the nucleotide, guanine (G), when exon 17 contains the p.Gly863Ala mutation, and is therefore known as the mutation-specific primer. Login to comment 132 ABCA4 p.Gly863Ala A chromatogram, generated using denaturing high-performance liquid chromatography following allele-specific PCR, shows the wild type profile and the profile obtained when a heterozygous p.Gly863Ala mutation is present. Login to comment 133 ABCA4 p.Gly863Ala Of the seven ABCA4 mutations, p.Arg152* and p.Gly863Ala occurred least frequently; each was detected in seven (9.72%) patient samples. Login to comment 139 ABCA4 p.Gly1961Glu ABCA4 p.Ala1038Val ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Arg212Cys ABCA4 p.Leu541Pro ABCA4 p.Thr1019Met ABCA4 p.Arg2107His ABCA4 p.Arg1640Trp ABCA4 p.Cys54Tyr ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp ABCA4 p.Asn965Ser ABCA4 p.Arg2038Trp ABCA4 p.Val989Ala ABCA4 p.Arg653Cys ABCA4 p.Leu2027Phe ABCA4 p.Val767Asp ABCA4 p.Ala1598Asp ABCA4 p.Arg1443His ABCA4 p.Arg1108Cys ABCA4 p.Arg2030Gln ABCA4 p.Pro1380Leu ABCA4 p.Cys2150Tyr ABCA4 p.Leu1201Arg ABCA4 p.Pro1948Leu ABCA4 p.Gly991Arg ABCA4 p.Val643Met ABCA4 p.Arg1300Gln ABCA4 p.Glu1087Lys ABCA4 p.Val931Met ABCA4 p.Ser1642Arg ABCA4 p.Lys223Gln ABCA4 p.Gly172Ser ABCA4 p.Arg152Gln ABCA4 p.Phe1440Ser ABCA4 p.Gln1513Pro ABCA4 p.Arg2118Glu ABCA4 p.Ala538Asp ABCA4 p.Trp1408Arg ABCA4 p.Pro291Leu of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment 142 ABCA4 p.Gly863Ala ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp ABCA4 p.Leu2027Phe The results obtained from the control cohort screening indicate that the carrier frequency of the p.Cys1490Tyr, p.Arg602Trp, and p.Gly863Ala mutations is slightly higher compared to the other mutations (p.Leu2027Phe, c.768G>T, and p.Arg152*), with the c.5461-10T>C mutation not detected at all. Login to comment 166 ABCA4 p.Gly863Ala ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp ABCA4 p.Leu2027Phe Mutant alleles Cohort p.Cys1490Tyr p.Arg602Trp p.Leu2027Phe c.5461-10T>C c.768G>T p.Gly863Ala p.Arg152* Patient (n=72; 144 alleles) 16 (11.11%) 10 (6.94%) 12 (8.33%) 13 (9.03%) 13 (9.03%) 7 (4.86%) 7 (4.86%) Control (total; n=269; 538 alleles) 2 (0. Login to comment