ABCA4 p.Cys1490Tyr
| ClinVar: |
c.4469G>A
,
p.Cys1490Tyr
D
, Pathogenic
c.4468T>A , p.Cys1490Ser ? , not provided |
| Predicted by SNAP2: | A: D (63%), D: D (80%), E: D (71%), F: D (66%), G: D (75%), H: D (66%), I: D (63%), K: D (71%), L: D (66%), M: D (66%), N: D (71%), P: D (75%), Q: D (75%), R: D (71%), S: D (95%), T: D (66%), V: D (53%), W: D (80%), Y: D (91%), |
| Predicted by PROVEAN: | A: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Ubiquitin-mediated proteasomal degradation of ABC ... J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12. Nakagawa H, Toyoda Y, Wakabayashi-Nakao K, Tamaki H, Osumi M, Ishikawa T
Ubiquitin-mediated proteasomal degradation of ABC transporters: a new aspect of genetic polymorphisms and clinical impacts.
J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12., [PMID:21567408]
Abstract [show]
The interindividual variation in the rate of drug metabolism and disposition has been known for many years. Pharmacogenomics dealing with heredity and response to drugs is a part of science that attempts to explain variability of drug responses and to search for the genetic basis of such variations or differences. Genetic polymorphisms of drug metabolizing enzymes and drug transporters have been found to play a significant role in the patients' responses to medication. Accumulating evidence demonstrates that certain nonsynonymous polymorphisms have great impacts on the protein stability and degradation, as well as the function of drug metabolizing enzymes and transporters. The aim of this review article is to address a new aspect of protein quality control in the endoplasmic reticulum and to present examples regarding the impact of nonsynonymous single-nucleotide polymorphisms on the protein stability of thiopurine S-methyltransferase as well as ATP-binding cassette (ABC) transporters including ABCC4, cystic fibrosis transmembrane conductance regulator (CFTR, ABCC7), ABCC11, and ABCG2. Furthermore, we will discuss the molecular mechanisms underlying posttranslational modifications (intramolecular and intermolecular disulfide bond formation and N-linked glycosylation) and ubiquitin-mediated proteasomal degradation of ABCG2, one of the major drug transporter proteins in humans.
Comments [show]
None has been submitted yet.
No. Sentence Comment
155 Effect of Mutations and Nonsynonymous SNPs on Protein Trafficking, Maturation, or ERAD of ABC Transporters Protein AA Mutation/SNP Effect on Protein Reference ABCA1 W590S Mutation Functional defect 115 R587W Mutation Impaired glycol processing 115 Q597R Mutation Impaired glycol processing, ERAD 115,116 Y1532C Mutation Altered protein trafficking 117 R1925Q Mutation Altered protein trafficking 118 ABCA3 R43L Mutation Altered protein trafficking 119 L101P Mutation Altered protein trafficking 119 R280C Mutation Altered protein trafficking 119 ABCA4 L541P Mutation Mislocalization 120 R602W Mutation Mislocalization 120 A1038V Mutation Mislocalization 120 C1490Y Mutation Mislocalization 120 ABCB1a G268V Mutation ERAD 121 G341C Mutation ERAD 121 I1196S Mutation Reduced glycosylation 122 ABCB4 I541F Mutation Accumulation in ER 123 ABCB11a E135K Mutation Reduced level of mature protein 124 L198P Mutation Reduced level of mature protein 124 E297G Mutation Reduced level of mature protein 124 L413W Mutation Reduced level of mature protein 124 R432T Mutation Reduced level of mature protein 124 D482G Mutation Immature protein in ER 124,125 N490D Mutation Reduced level of mature protein 124 A570T Mutation Reduced level of mature protein 124 T655I Mutation Reduced level of mature protein 124 Y818F SNP Moderate reduction of protein 124 G982R Mutation Retention in ER 125 R1153C Mutation ERAD 125 R1286Q Mutation Retention in ER 125 ABCC2a R768W Mutation Impaired protein trafficking 126 I1173F Mutation Impaired protein maturation 127 R1392 Mutation Impaired protein maturation 128 M1393 Mutation Impaired protein maturation 129 ABCC4a E757K SNP Altered protein trafficking 23 ABCC7 F508 Mutation Misfolding, ERAD 36-39,130 G85E Mutation Impaired protein maturation 130-132 G91R Mutation Impaired protein maturation 130-132 N1303K Mutation Impaired protein maturation 130-132 ABCC8 WT Wild type Ubiquitin-proteasome degradation 133 A116P Mutation Ubiquitin-proteasome degradation 133 V187D Mutation Ubiquitin-proteasome degradation 133 F1388 Mutation Impaired protein trafficking 134 L1544P Mutation Impaired protein trafficking 135,136 ABCC11a G180R SNP Ubiquitin-proteasome degradation 50 27 Mutation Ubiquitin-proteasome degradation 50 ABCG2a V12M SNP Altered protein localization 96 Q141K SNP Ubiquitin-proteasome degradation 102 F208S SNP Ubiquitin-proteasome degradation 78,99 S441N SNP Ubiquitin-proteasome degradation 78,99 Mutations of ABCA1, ABCA3, ABCA4, ABCB4, ABCB11, ABCC2, ABCC7 (CFTR), and ABCC8 are associated with Tangier disease, fatal surfactant deficiency, Stargardt disease, progressive familial intrahepatic cholestasis type 3 (PFIC-3), progressive familial intrahepatic cholestasis type 2 (PFIC-2), Dubin-Johnson syndrome, cystic fibrosis, and familial hyperinsulinism, respectively.
X
ABCA4 p.Cys1490Tyr 21567408:155:658
status: NEW[hide] Formation of two intramolecular disulfide bonds is... J Biol Chem. 2009 Apr 24;284(17):11293-300. Epub 2009 Mar 3. Hozoji M, Kimura Y, Kioka N, Ueda K
Formation of two intramolecular disulfide bonds is necessary for ApoA-I-dependent cholesterol efflux mediated by ABCA1.
J Biol Chem. 2009 Apr 24;284(17):11293-300. Epub 2009 Mar 3., [PMID:19258317]
Abstract [show]
ABCA1 plays a major role in cholesterol homeostasis and high density lipoprotein (HDL) metabolism. ABCA1 contains disulfide bond(s) between its N- and C-terminal halves, but it remains unclear whether disulfide bond formation is important for the functions of ABCA1 and which cysteines are involved in disulfide bond formation. To answer these questions, we constructed >30 ABCA1 mutants in which 16 extracellular domain (ECD) cysteines were replaced with serines and examined disulfide bond formation, apoA-I binding, and HDL formation in these mutants. From the single cysteine replacements, two cysteines (Cys(75) and Cys(309)) in ECD1 were found to be essential for apoA-I binding. In contrast, in ECD2, only Cys(1477) was found to be essential for HDL formation, and no single cysteine replacement impaired apoA-I binding. The concurrent replacement of two cysteines, Cys(1463) and Cys(1465), impaired apoA-I binding and HDL formation, suggesting that four of five extracellular cysteines (Cys(75), Cys(309), Cys(1463), Cys(1465), and Cys(1477)) are involved in these functions of ABCA1. Trypsin digestion experiments suggested that one disulfide bond is not sufficient and that two intramolecular disulfide bonds (between Cys(75) and Cys(309) in ECD1 and either Cys(1463) or Cys(1465) and Cys(1477) in ECD2) are required for ABCA1 to be fully functional.
Comments [show]
None has been submitted yet.
No. Sentence Comment
25 Indeed, the Tangier disease mutation C1477R has been reported to abolish apoA-I binding and HDL formation (15-17), and several missense mutations in cysteine residues within ECD1 (C54Y, C75G) and ECD2 (C1488R, C1490Y) of ABCA4 have been linked to Stargardt * Thisworkwassupportedbyagrant-in-aidforscientificresearch(S)fromthe Ministry of Education, Culture, Sports, Science, and Technology of Japan, by the Program for Promotion of Fundamental Studies in Health Sciences of the National Institute of Biomedical Innovation, and by the World Premier International Research Center Initiative, Ministry of Education, Culture, Sports, Science, and Technology of Japan.
X
ABCA4 p.Cys1490Tyr 19258317:25:210
status: NEW175 C13 and C14 are conserved among ABCA1, ABCA4, and ABCA7, and mutations of both C13 (C1488R) and C14 (C1490Y) of ABCA4 are linked to Stargardt disease (20), suggesting that these two cysteines are functionally important and cannot substitute for each other in ABCA4.
X
ABCA4 p.Cys1490Tyr 19258317:175:101
status: NEW173 C13 and C14 are conserved among ABCA1, ABCA4, and ABCA7, and mutations of both C13 (C1488R) and C14 (C1490Y) of ABCA4 are linked to Stargardt disease (20), suggesting that these two cysteines are functionally important and cannot substitute for each other in ABCA4.
X
ABCA4 p.Cys1490Tyr 19258317:173:101
status: NEW[hide] Membrane topology of the ATP binding cassette tran... J Biol Chem. 2001 Jun 29;276(26):23539-46. Epub 2001 Apr 24. Bungert S, Molday LL, Molday RS
Membrane topology of the ATP binding cassette transporter ABCR and its relationship to ABC1 and related ABCA transporters: identification of N-linked glycosylation sites.
J Biol Chem. 2001 Jun 29;276(26):23539-46. Epub 2001 Apr 24., [PMID:11320094]
Abstract [show]
ABCR is a member of the ABCA subclass of ATP binding cassette transporters that is responsible for Stargardt macular disease and implicated in retinal transport across photoreceptor disc membranes. It consists of a single polypeptide chain arranged in two tandem halves, each having a multi-spanning membrane domain followed by a nucleotide binding domain. To delineate between several proposed membrane topological models, we have identified the exocytoplasmic (extracellular/lumen) N-linked glycosylation sites on ABCR. Using trypsin digestion, site-directed mutagenesis, concanavalin A binding, and endoglycosidase digestion, we show that ABCR contains eight glycosylation sites. Four sites reside in a 600-amino acid exocytoplasmic domain of the N-terminal half between the first transmembrane segment H1 and the first multi-spanning membrane domain, and four sites are in a 275-amino acid domain of the C half between transmembrane segment H7 and the second multi-spanning membrane domain. This leads to a model in which each half has a transmembrane segment followed by a large exocytoplasmic domain, a multi-spanning membrane domain, and a nucleotide binding domain. Other ABCA transporters, including ABC1 linked to Tangier disease, are proposed to have a similar membrane topology based on sequence similarity to ABCR. Studies also suggest that the N and C halves of ABCR are linked through disulfide bonds.
Comments [show]
None has been submitted yet.
No. Sentence Comment
231 Several missense mutations in cysteine residues within ECD-1 (C54Y,C75G) and ECD-2 (C1488R,C1490Y) have been linked to Stargardt disease (13, 19, 38, 39).
X
ABCA4 p.Cys1490Tyr 11320094:231:91
status: NEW[hide] Correlation between photoreceptor layer integrity ... Invest Ophthalmol Vis Sci. 2012 Jul 3;53(8):4409-15. doi: 10.1167/iovs.11-8201. Print 2012 Jul. Testa F, Rossi S, Sodi A, Passerini I, Di Iorio V, Della Corte M, Banfi S, Surace EM, Menchini U, Auricchio A, Simonelli F
Correlation between photoreceptor layer integrity and visual function in patients with Stargardt disease: implications for gene therapy.
Invest Ophthalmol Vis Sci. 2012 Jul 3;53(8):4409-15. doi: 10.1167/iovs.11-8201. Print 2012 Jul., [PMID:22661472]
Abstract [show]
PURPOSE: To perform a clinical characterization of Stargardt patients with ABCA4 gene mutation, and to investigate the correlation between the inner and outer segment (IS/OS) junction morphology and visual acuity, fundus lesions, electroretinogram abnormalities, and macular sensitivity. METHODS: Sixty-one patients with Stargardt disease (STGD) were given a comprehensive ophthalmic examination. Inner-outer photoreceptor junction morphology evaluated by spectral-domain optical coherence tomography was correlated with visual acuity, fundus lesions, fundus autofluorescence, full-field and multifocal electroretinography responses, and microperimetric macular sensitivities. We classified STGD patients into three groups: (1) IS/OS junction disorganization in the fovea, (2) IS/OS junction loss in the fovea, and (3) extensive loss of IS/OS junction. Mutation analysis of the ABCA4 gene was carried out by sequencing the complete coding region. RESULTS: A significant difference in visual acuity was observed between IS/OS groups 1 and 2 and between IS/OS groups 2 and 3 (P < 0.0001). A significant difference in microperimetry sensitivity was observed between IS/OS groups 2 and 3, and between IS/OS groups 1 and 3 (P < 0.0001). There was also a statistically significant correlation between IS/OS abnormalities and the extent of fundus lesions (Spearman P </= 0.01), as well as with the type of ERG and multifocal ERG results (Spearman P </= 0.01). Finally, the degree of IS/OS junction preservation showed a statistically significant correlation with the extension of foveal abnormalities assessed by fundus autofluorescence imaging (Spearman P </= 0.01). The G1961E mutation was more frequent in the patients without extensive loss of IS/OS junction (P = 0.01) confirming its association with a milder STGD phenotype. CONCLUSIONS: The results of this study suggest that a comprehensive approach in the examination of Stargardt patients has the potential to improve the understanding of vision loss and may provide a sensitive measure to evaluate the efficacy of future experimental therapies in patients with STGD.
Comments [show]
None has been submitted yet.
No. Sentence Comment
66 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundus† FAF‡ ERG§ mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35þ2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35þ2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35þ2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45þ1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40þ5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35þ2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40þ5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35þ2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35þ2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40þ5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40þ5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35þ2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40þ5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45þ1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45þ1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35þ2t > c IVS40þ5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45þ1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram.
X
ABCA4 p.Cys1490Tyr 22661472:66:1160
status: NEW67 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundusߤ FAFߥ ERG&#a7; mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35&#fe;2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35&#fe;2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35&#fe;2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45&#fe;1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40&#fe;5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35&#fe;2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40&#fe;5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35&#fe;2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35&#fe;2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40&#fe;5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40&#fe;5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35&#fe;2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40&#fe;5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45&#fe;1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45&#fe;1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35&#fe;2t > c IVS40&#fe;5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45&#fe;1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram. Statistics Our set of data is described by continuous (BCVA, OCT foveal thickness, and macular sensitivities) and categorical (fundus, FAF, IS/ OS, ERG, and mfERG groups) variables.
X
ABCA4 p.Cys1490Tyr 22661472:67:1153
status: NEW[hide] Macular function in macular degenerations: repeata... Invest Ophthalmol Vis Sci. 2012 Feb 21;53(2):841-52. Print 2012 Feb. Cideciyan AV, Swider M, Aleman TS, Feuer WJ, Schwartz SB, Russell RC, Steinberg JD, Stone EM, Jacobson SG
Macular function in macular degenerations: repeatability of microperimetry as a potential outcome measure for ABCA4-associated retinopathy trials.
Invest Ophthalmol Vis Sci. 2012 Feb 21;53(2):841-52. Print 2012 Feb., [PMID:22247458]
Abstract [show]
PURPOSE: To measure macular visual function in patients with unstable fixation, to define the photoreceptor source of this function, and to estimate its test-retest repeatability as a prerequisite to clinical trials. METHODS: Patients (n = 38) with ABCA4-associated retinal degeneration (RD) or with retinitis pigmentosa (RP) were studied with retina-tracking microperimetry along the foveo-papillary profile between the fovea and the optic nerve head, and point-by-point test-retest repeatability was estimated. A subset with foveal fixation was also studied with dark-adapted projection perimetry using monochromatic blue and red stimuli along the horizontal meridian. RESULTS: Macular function in ABCA4-RD patients transitioned from lower sensitivity at the parafovea to higher sensitivity in the perifovea. RP patients had the inverse pattern. Red-on-red microperimetric sensitivities successfully avoided ceiling effects and were highly correlated with absolute sensitivities. Point-by-point test-retest limits (95% confidence intervals) were +/-4.2 dB; repeatability was not related to mean sensitivity, eccentricity from the fovea, age, fixation location, or instability. Repeatability was also not related to the local slope of sensitivity and was unchanged in the parapapillary retina. CONCLUSIONS: Microperimetry allows reliable testing of macular function in RD patients without foveal fixation in longitudinal studies evaluating natural disease progression or efficacy of therapeutic trials. A single estimate of test-retest repeatability can be used to determine significant changes in visual function at individual retinal loci within diseased regions that are homogeneous and those that are heterogeneous and also in transition zones at high risk for disease progression.
Comments [show]
None has been submitted yet.
No. Sentence Comment
42 Clinical and Molecular Characteristics of the ABCA4 Patients Patient Age (y)/Sex ABCA4 Mutation Clinical Diagnosis Visual Acuity* Kinetic Visual Field Extent (V-4e)†Allele 1 Allele 2 Foveal Fixation P1‡ 12/M N965S W821R STGD 20/20 97 P2‡ 17/F V989A IVS28ϩ5 GϾT STGD 20/100 90 P3 18/M G1961E R1129L§ STGD 20/100 105 P4 21/F R212C P68R STGD 20/125 101 P5 24/M P1511 del1ccgC R1705Q STGD 20/25 114 P6 31/M G863A R1108C STGD 20/25 105 P7 32/F IVS40ϩ5 GϾA V935A STGD 20/32 103 P8 34/M G1961E - CRD 20/32 98 P9 37/F R681X P309R STGD 20/20 109 P10 39/M G1961E C54Y§ STGD 20/40 101 P11‡ 42/F G1961E V256V STGD 20/32 105 P12‡ 46/F G1961E V256V STGD 20/32 106 P13 52/F G1961E P1380L STGD 20/40 105 P14 58/M D600E R18W§ STGD 20/40 84 Extrafoveal Fixation P15 11/M V256V T1526M CRD 20/200 102 P16 15/M C54Y IVS35ϩ2 TϾC STGD 20/200 96 P17‡ 16/F V989A IVS28ϩ5 GϾT STGD 20/100 100 P18‡ 16/M N965S W821R STGD 20/125 100 P19 19/F A1038V/L541P N965S STGD 20/400 90 P20 21/M G863A IVS35ϩ2 TϾC STGD 20/200 99 P21 22/F G1961E R152X STGD 20/50 104 P22 27/M G863A P1660S§ STGD 20/100 98 P23 27/F G1961E A1038V/L541P STGD 20/100 109 P24 29/M G1961E T1019M STGD 20/100 104 P25 33/M P1486L deletion of exon 7 STGD 20/400 98 P26 36/F G863A C1490Y STGD 20/100 93 P27 41/M A1038V/L541P - STGD 20/125 108 P28 49/F T1526M R2030Q STGD 20/125 98 P29 55/F W855X - STGD 20/160 87 P30 56/F G1961E IVS37ϩ1 GϾA§ STGD 20/125 89 P31 60/F G1961E M669 del2ccAT STGD 20/125 104 STGD, Stargardt disease; CRD, cone-rod dystrophy.
X
ABCA4 p.Cys1490Tyr 22247458:42:1332
status: NEWX
ABCA4 p.Cys1490Tyr 22247458:42:1342
status: NEW[hide] Phenotypic and genetic spectrum of Danish patients... Ophthalmic Genet. 2012 Dec;33(4):225-31. doi: 10.3109/13816810.2011.643441. Epub 2012 Jan 9. Duno M, Schwartz M, Larsen PL, Rosenberg T
Phenotypic and genetic spectrum of Danish patients with ABCA4-related retinopathy.
Ophthalmic Genet. 2012 Dec;33(4):225-31. doi: 10.3109/13816810.2011.643441. Epub 2012 Jan 9., [PMID:22229821]
Abstract [show]
Background: Pathogenic variations in the ABCA4 gene were originally recognized as genetic background for the autosomal recessive disorders Stargardt disease and fundus flavimaculatus, but have expanded to embrace a diversity of retinal diseases, giving rise to the new diagnostic term, ABCA4-related retinopathy. Diagnostic genotyping of ABCA4 is complicated by the large size of the gene and the existence of approximately 600 known pathogenic variations, along with numerous rare polymorphisms. A commercial diagnostic array-based assay has been developed targeting known mutations, however a conclusive genetic diagnosis must rely on a comprehensive genetic screening as the mutation spectrum of ABCA4-related retinopathies continues to expand. Material and methods: Among 161 patients with a Stargardt-related phenotype previously assessed with the commercial ABCA4 mutation microarray, we analyzed the ABCA4 gene with High-resolution melting (HRM) in patients in whom the array analysis identified either a heterozygous mutation (n = 50) or no mutation (n = 30). Results: The HRM method detected each of the already known mutations and polymorphisms. We identified the second ABCA4 mutation in 31 of 50 heterozygous patients (62%). Several novel mutations were identified of which four were identified multiple times. The recurrent novel mutations were subsequently assessed among the 30 patients with possible ABCA4-related diseases, previously found to be negative for known ABCA4 mutations by array analysis. In total, 30 different mutations were identified of which 21 have not been described before. Conclusion: Scandinavian patients with ABCA4-related retinopathy appear to have a distinct mutation spectrum, which can be identified in patients of diverse clinical phenotypes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
56 Table 1 Mutations identified by HRM in the initial 50 heterozygous patients Patient Mutation 1 (Asper) Mutation 2 (HRM) RefDNA Protein Exon/intron DNA Protein Exon/intron D043 c.2588G>C p.G863A 17 c.184 C>T p.P62S 3 New D069 c.3113C>T p.A1038V 21 c.1529 T>G p.L510R 11 New D050 c.2588G>C p.G863A 17 c.1529 T>G p.L510R 11 New D112 c.2894A>G p.N965S 19 c.1529 T>G p.L510R 11 New D099 c.6089G>A p.R2030Q 44 c.1529 T>G p.L510R 11 New D165 c.1822T>C p.F608L 13 c.2243 G>A p.C748Y 15 New D166 c.2588G>C p.G863A 17 c.2300 T>A p.V767D 15 Known D117 c.3191-2A>G na IVS21 c.2408delG na 16 New D135 c.2894A>G p.N965S 19 c.2408delG na 16 New D147 c.2894A>G p.N965S 19 c.2408delG na 16 New D173 c.4469G>A p.C1490Y 30 c.2915C>A p.T972N 19 Known D013* c.1622C>T p.L541P 12 c.1313C>T p.A1038V 21 Known D181 c.6089G>A p.R2030Q 44 c.3380 G>A p.G1127E 23 New D018 c.6449G>A p.C2150Y 47 c.3736 C>G p.L1246V 25 New D191 c.2588G>C p.G863A 17 c.4069 G>A p.A1357T 27 New D167 c.5461-10T>C na IVS38 c.4102 C>T p.R1368C 27 New D022 c.4462T>C p.C1488R 30 c.4102 C>T p.R1368C 27 New D108 c.1648G>A p.G550R 12 c.4102 C>T p.R1368C 27 New D414 c.2588G>C p.G863A 17 c.4653 G>A p.W1551X 32 New D027 c.2588G>C p.G863A 17 c.4668-2A>G na IVS32 New D136 c.
X
ABCA4 p.Cys1490Tyr 22229821:56:702
status: NEW58 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.5584 + 1G>A na IVS39 New D188 c.5461-10T>C na IVS38 c.5693G>A p.R1898H 40 Known D433 c.5882G>A p.G1961E 42 c.6005 + 1G>A na IVS43 Known D134 c.4667 + 2G>T na IVS32 c.6098 T>G p.L2033R 44 New D186 c.3322C>T p.R1108C 22 c.6386 + 1G>A na IVS46 New D182 c.6089G>A p.R2030Q 44 c.6386 + 1G>A na IVS46 New D189 c.2894A>G p.N965S 19 c.6478 A>G p.K2160E 47 New *p.L541P and p.A1038V might be located on the same allele.
X
ABCA4 p.Cys1490Tyr 22229821:58:619
status: NEW97 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773 + 5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005 + 1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773 + 3A>G* D110 p.[L541P+A1038V] c.5584 + 1G>A* D182 p.R2030Q c.6386 + 1G>A* D186 p.R1108C c.6386 + 1G>AA* D133 p.L510R IVS46 + 1G>A* Cone-rod dystrophy D134 c.4667 + 2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame.
X
ABCA4 p.Cys1490Tyr 22229821:97:657
status: NEW100 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773ߙ+ߙ5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005ߙ+ߙ1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773ߙ+ߙ3A>G* D110 p.[L541P+A1038V] c.5584ߙ+ߙ1G>A* D182 p.R2030Q c.6386ߙ+ߙ1G>A* D186 p.R1108C c.6386ߙ+ߙ1G>AA* D133 p.L510R IVS46ߙ+ߙ1G>A* Cone-rod dystrophy D134 c.4667ߙ+ߙ2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame.
X
ABCA4 p.Cys1490Tyr 22229821:100:653
status: NEW[hide] Stargardt macular dystrophy: common ABCA4 mutation... Mol Vis. 2012;18:280-9. Epub 2012 Feb 1. Roberts LJ, Nossek CA, Greenberg LJ, Ramesar RS
Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients.
Mol Vis. 2012;18:280-9. Epub 2012 Feb 1., [PMID:22328824]
Abstract [show]
PURPOSE: Based on the previous indications of founder ATP-binding cassette sub-family A member 4 gene (ABCA4) mutations in a South African subpopulation, the purpose was to devise a mechanism for identifying common disease-causing mutations in subjects with ABCA4-associated retinopathies (AARs). Facilitating patient access to this data and determining the frequencies of the mutations in the South African population would enhance the current molecular diagnostic service offered. METHODS: The majority of subjects in this study were of Caucasian ancestry and affected with Stargardt macular dystrophy. The initial cohort consisted of DNA samples from 181 patients, and was screened using the ABCR400 chip. An assay was then designed to screen a secondary cohort of 72 patients for seven of the most commonly occurring ABCA4 mutations in this population. A total of 269 control individuals were also screened for the seven ABCA4 mutations. RESULTS: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. The newly designed genetic assay identified two of the seven disease-associated mutations in 28/72 patients in a secondary patient cohort. In the control cohort, 12/269 individuals were found to be heterozygotes, resulting in an estimated background frequency of these mutations in this particular population of 4.46 per 100 individuals. CONCLUSIONS: The relatively high detection rate of seven ABCA4 mutations in the primary patient cohort led to the design and subsequent utility of a multiplex assay. This assay can be used as a viable screening tool and to reduce costs and laboratory time. The estimated background frequency of the seven ABCA4 mutations, together with the improved diagnostic service, could be used by counselors to facilitate clinical and genetic management of South African families with AARs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
6 Results: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency.
X
ABCA4 p.Cys1490Tyr 22328824:6:173
status: NEW52 Four of the mutations were detected with SNaPshot PCR (p.Cys1490Tyr, p.Arg602Trp, c.5461-10T>C, and p.Leu2027Phe mutations; Table 2, Figure 1, Figure 2, and Figure 3) using the SNaPshot® Multiplex Ready Reaction Mix (Applied Biosystems, Warrington, UK), resolved on the ABI 3100 Genetic Analyzer (Applied Biosystems) and subsequently analyzed using the GeneMapper 3.0 GeneScan software (Applied Biosystems).
X
ABCA4 p.Cys1490Tyr 22328824:52:57
status: NEW61 Exon (mutation) Primer 5'-3' Annealing temperature Mutation detection technique Exon 5 (p.Arg152*) F: gacccatttccccttcaac 60 °C dHPLC, Cycle sequencing using the reverse primer R: aggctgggtgcttccctc Exon 6 (c.768G>T) F: ggtgtctttcctaccacag 57.9 °C dHPLC, Cycle sequencing using the forward primer R: aggaatcaccttgcaattgg Exon 13 (p.Arg602Trp) F: agctatccaagcccgttcc 63 °C SNaPshot PCR R: ccattagcgtgtcatggag Exon 17 (p.Gly863Ala) F: ctgcggtaaggtaggataggg 60 °C Allele-specific PCR R: cacaccgtttacatagagggc Exon 30 (p.Cys1490Tyr) F: gtcagcaactttgaggctg 63 °C SNaPshot PCR R: tccctctgtggcaggcag Intron38/Exon39 (c.5461-10T>C) F: gccccacctgctgaagag 63 °C SNaPshot PCR R: tcccagctttggacccag Exon 44 (p.Leu2027Phe) F: gaagcttctccagccctagc 63 °C SNaPshot PCR R: tgcactctcatgaaacaggc TABLE 2.
X
ABCA4 p.Cys1490Tyr 22328824:61:533
status: NEW63 Exon (mutation) Primer length (bp) with tail Primer sequence (with tail, 5'-3')* 13 (p.Arg602Trp) 34 R: tgttccagtgccacgaacccgccccagatgtacc 30 (p.Cys1490Tyr) 32 R: cttcgtggttactgagcttctccctggtgctg 39 (Intron 38) (c.5461-10T>C) 37 F: ccgatgtagttgaccccgtttccaacagtcctacttc 44 (p.Leu2027Phe) 41 R: tactctggatcttagtaggtaaagatgttctcgtcctgtga *ThenucleotidesequenceinboldisthesequencedesignedtobindcomplementarytothegenomicDNAsequence.Thenucleotide sequence not written in bold is the random nucleotide tail added to the primer sequence. Figure 1.
X
ABCA4 p.Cys1490Tyr 22328824:63:145
status: NEW64 An electropherogram of the multiplex SNaPshot reaction shows the results obtained for a sample that is heterozygous for the p.Arg602Trp and p.Cys1490Tyr mutations.
X
ABCA4 p.Cys1490Tyr 22328824:64:142
status: NEW66 The p.Cys1490Tyr alleles are indicated by black and red peaks at 38 bp and 39 bp, respectively.
X
ABCA4 p.Cys1490Tyr 22328824:66:6
status: NEW73 However, seven mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a significantly higher frequency, compared to the other variants in the cohort (Table 4).
X
ABCA4 p.Cys1490Tyr 22328824:73:75
status: NEW88 Functional analysis of the p.Arg602Trp and p.Cys1490Tyr mutations showed that these missense alleles result in misfolding and mislocalization of the ABCA4 protein, as well as a marked reduction in ATPase activity [12].
X
ABCA4 p.Cys1490Tyr 22328824:88:45
status: NEW121 The p.Cys1490Tyr mutation was found to be the most frequently occurring mutation, detected in 19.44% of patient samples.
X
ABCA4 p.Cys1490Tyr 22328824:121:6
status: NEW139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9].
X
ABCA4 p.Cys1490Tyr 22328824:139:1091
status: NEW142 The results obtained from the control cohort screening indicate that the carrier frequency of the p.Cys1490Tyr, p.Arg602Trp, and p.Gly863Ala mutations is slightly higher compared to the other mutations (p.Leu2027Phe, c.768G>T, and p.Arg152*), with the c.5461-10T>C mutation not detected at all.
X
ABCA4 p.Cys1490Tyr 22328824:142:100
status: NEW166 Mutant alleles Cohort p.Cys1490Tyr p.Arg602Trp p.Leu2027Phe c.5461-10T>C c.768G>T p.Gly863Ala p.Arg152* Patient (n=72; 144 alleles) 16 (11.11%) 10 (6.94%) 12 (8.33%) 13 (9.03%) 13 (9.03%) 7 (4.86%) 7 (4.86%) Control (total; n=269; 538 alleles) 2 (0.
X
ABCA4 p.Cys1490Tyr 22328824:166:24
status: NEW[hide] Clinical utility of the ABCR400 microarray: basing... Arch Ophthalmol. 2009 Apr;127(4):549-54. Roberts LJ, Ramesar RS, Greenberg J
Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip.
Arch Ophthalmol. 2009 Apr;127(4):549-54., [PMID:19365039]
Abstract [show]
OBJECTIVES: To assess the clinical utility of ABCR400 microarray testing in patients with ABCA4-associated retinopathies and to report on possible issues that could arise should genetic results be delivered without validation. METHODS: One hundred thirty-two probands were genotyped with the microarray. Diagnostic assays were designed to verify all mutations identified in individuals in whom at least 2 causative mutations were found. Mutations were verified in the probands, and wherever possible cosegregation analysis was performed in additional family members. RESULTS: Eighty-five of the 132 probands (64.4%) genotyped with the microarray had 2 or more disease-associated mutations identified. Verification of the genotyping, however, resulted in only 80 families being able to benefit from genetic result delivery. The remaining families could not receive results owing to the confounding effect of multiple ABCA4 mutations or the incorrect identification of mutations. CONCLUSIONS: The ABCR400 microarray is useful for mutation screening; however, raw data cannot be delivered directly to patients. All mutations should be verified and, whenever possible, investigated in other family members. CLINICAL RELEVANCE: Validated ABCR400 results provide an unequivocal molecular diagnosis, allowing family members to be offered diagnostic, predictive, carrier, and prenatal testing. Use of the microarray can inform decision-making and identify candidates for future therapies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5-3 PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 3Ј; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 3Ј; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction.
X
ABCA4 p.Cys1490Tyr 19365039:31:199
status: NEW53 Het C1490Y (No IVS38-10T>C) Het C1490Y Het IVS38-10T>C Het C1490Y Het IVS38-10T>C (No C1490Y) Het IVS38-10T>C Figure 2. Pedigree of family RPS1011, showing the mutations cosegregating with disease.
X
ABCA4 p.Cys1490Tyr 19365039:53:4
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:53:32
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:53:59
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:53:86
status: NEW54 The common C1490Y mutation was identified as the second mutation in the proband`s father during cosegregation analysis.
X
ABCA4 p.Cys1490Tyr 19365039:54:11
status: NEW80 (No C1490Y) Het V256V Het C1490Y Het V256V Het C1490Y Het V256V Het C1490Y Het V256V Figure 4. Pedigree of family RPS165 in which the presence of a third mutation did not confound result delivery.
X
ABCA4 p.Cys1490Tyr 19365039:80:4
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:80:26
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:80:47
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:80:68
status: NEW55 Het C1490Y (No IVS38-10T>C) Het C1490Y Het IVS38-10T>C Het C1490Y Het IVS38-10T>C (No C1490Y) Het IVS38-10T>C Figure 2. Pedigree of family RPS1011, showing the mutations cosegregating with disease.
X
ABCA4 p.Cys1490Tyr 19365039:55:4
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:55:32
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:55:59
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:55:86
status: NEW56 The common C1490Y mutation was identified as the second mutation in the proband`s father during cosegregation analysis.
X
ABCA4 p.Cys1490Tyr 19365039:56:11
status: NEW82 (No C1490Y) Het V256V Het C1490Y Het V256V Het C1490Y Het V256V Het C1490Y Het V256V Figure 4. Pedigree of family RPS165 in which the presence of a third mutation did not confound result delivery.
X
ABCA4 p.Cys1490Tyr 19365039:82:4
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:82:26
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:82:47
status: NEWX
ABCA4 p.Cys1490Tyr 19365039:82:68
status: NEW[hide] ABCA4 mutations causing mislocalization are found ... Hum Mol Genet. 2005 Oct 1;14(19):2769-78. Epub 2005 Aug 15. Wiszniewski W, Zaremba CM, Yatsenko AN, Jamrich M, Wensel TG, Lewis RA, Lupski JR
ABCA4 mutations causing mislocalization are found frequently in patients with severe retinal dystrophies.
Hum Mol Genet. 2005 Oct 1;14(19):2769-78. Epub 2005 Aug 15., [PMID:16103129]
Abstract [show]
ABCA4, also called ABCR, is a retinal-specific member of the ATP-binding cassette (ABC) family that functions in photoreceptor outer segments as a flipase of all-trans retinal. Homozygous and compound heterozygous ABCA4 mutations are associated with various autosomal recessive retinal dystrophies, whereas heterozygous ABCA4 mutations have been associated with dominant susceptibility to age-related macular degeneration in both humans and mice. We analyzed a cohort of 29 arRP families for the mutations in ABCA4 with a commercial microarray, ABCR-400 in addition to direct sequencing and segregation analysis, and identified both mutant alleles in two families (7%): compound heterozygosity for missense (R602W) and nonsense (R408X) alleles and homozygosity for a complex [L541P; A1038V] allele. The missense mutations were analyzed functionally in the photoreceptors of Xenopus laevis tadpoles, which revealed mislocalization of ABCA4 protein. These mutations cause retention of ABCA4 in the photoreceptor inner segment, likely by impairing correct folding, resulting in the total absence of physiologic protein function. Patients with different retinal dystrophies harboring two misfolding alleles exhibit early age-of-onset (AO) (5-12 years) of retinal disease. Our data suggest that a class of ABCA4 mutants may be an important determinant of the AO of disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
26 Functional studies of missense alleles [L541P; A1038V], R602W and C1490Y in transgenic frogs demonstrate that they do not translocate to rod OSs (ROSs).
X
ABCA4 p.Cys1490Tyr 16103129:26:66
status: NEW80 (C-L) Microphotographs of 2-week-old X. laevis tadpoles expressing R602W (C and D), [L541P; A1038V] (E and F), L541P (G and H), A1038V (I and J) and C1490Y (K and L).
X
ABCA4 p.Cys1490Tyr 16103129:80:149
status: NEW97 Mutation C1490Y causes retention of ABCA4 to rod IS The ABCA4 C1490Y allele has been found in patients presenting with both STGD and CRD.
X
ABCA4 p.Cys1490Tyr 16103129:97:9
status: NEWX
ABCA4 p.Cys1490Tyr 16103129:97:62
status: NEW99 Therefore, we sought to explore the effect of C1490Y mutation on ABCA4 processing.
X
ABCA4 p.Cys1490Tyr 16103129:99:46
status: NEW100 We found that C1490Y causes retention of the mutated protein in the IS (Fig. 2K and L).
X
ABCA4 p.Cys1490Tyr 16103129:100:14
status: NEW104 We employed this assay to examine the effects of [L541P; A1038V], R602W and C1490Y mutations on in vitro ATP hydrolysis.
X
ABCA4 p.Cys1490Tyr 16103129:104:76
status: NEW108 In addition, we observed a marked decrease in ATP hydrolytic activity compared with wild-type in both R602W (21.6%) and C1490Y (21.4%) alleles.
X
ABCA4 p.Cys1490Tyr 16103129:108:120
status: NEW113 Mutations: R602W, [L541P; A1038V] and C1490Y are frequently detected in patients with retinal diseases Mislocalization mutations R602W, [L541P; A1038V] and C1490Y have been reported as disease-associated mutations in patients with RP, CRD and STGD (18,20,32,33).
X
ABCA4 p.Cys1490Tyr 16103129:113:38
status: NEWX
ABCA4 p.Cys1490Tyr 16103129:113:156
status: NEW119 WT and mutant constructs [L541P; A1038V], R602W and C1490Y ABCA4 were expressed in COS7 cells.
X
ABCA4 p.Cys1490Tyr 16103129:119:52
status: NEW137 We hypothesized that the disease-associated missense mutations [L541P; A1038V], R602W and C1490Y could exert a possible effect on protein processing as this mechanism, which prevents altered proteins from locating to its physiologic compartment, was documented for other ABC transporters in related diseases including cystic fibrosis (CFTR) and Tangier disease (ABCA1).
X
ABCA4 p.Cys1490Tyr 16103129:137:90
status: NEW138 To examine this hypothesis, we generated transgenic X. laevis tadpoles expressing WT, [L541P; A1038V], R602W and C1490Y mutants and documented that the three mutant alleles cause mislocalization of ABCA4.
X
ABCA4 p.Cys1490Tyr 16103129:138:113
status: NEW146 Genotype-phenotype correlations among patients bearing one and two mislocalization-mutations Two mislocalization-alleles One mislocalization-allele RP STGD Allele 1 Allele 2 AO Allele 1 Allele 2 AO [L541P; A1038V] [L541P; A1038V] 7 [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 9 [L541P; A1038V] R1108H 13 [L541P; A1038V] G1961E 16 CRD [L541P; A1038V] G1961E 28 Allele 1 Allele 2 AO [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 10 [L541P; A1038V] L2027F 12 [L541P; A1038V] C1490Y 12 [L541P; A1038V] P1380L 5 R602W R602W 7 [L541P; A1038V] T1019M 6 [L541P; A1038V] G1961E 7 STGD [L541P; A1038V] T1019M 6 Allele 1 Allele 2 AO R602W L2027F 9 [L541P; A1038V] [L541P; A1038V] 12 C1490Y G1961E 28 C1490Y C1490Y 7 C1490Y G1961E 13 C1490Y R602W 9 C1490Y L2027F 10 C1490Y R602W 10 C1490Y L2027F 18 C1490 L2027F 18 AO-age of onset (in years).
X
ABCA4 p.Cys1490Tyr 16103129:146:498
status: NEWX
ABCA4 p.Cys1490Tyr 16103129:146:698
status: NEWX
ABCA4 p.Cys1490Tyr 16103129:146:715
status: NEWX
ABCA4 p.Cys1490Tyr 16103129:146:722
status: NEWX
ABCA4 p.Cys1490Tyr 16103129:146:731
status: NEWX
ABCA4 p.Cys1490Tyr 16103129:146:748
status: NEWX
ABCA4 p.Cys1490Tyr 16103129:146:763
status: NEWX
ABCA4 p.Cys1490Tyr 16103129:146:780
status: NEWX
ABCA4 p.Cys1490Tyr 16103129:146:796
status: NEW150 The results of IF studies of rods expressing [L541P; A1038V], R602W and C1490Y mutants were quite distinct from those observed for WT and ABCA4 EGFP.
X
ABCA4 p.Cys1490Tyr 16103129:150:72
status: NEW165 Presumed folding mutations, especially [L541P; A1038V] and C1490Y, have been frequently detected in patients with autosomal recessive macular degenerations (18,20,32,33).
X
ABCA4 p.Cys1490Tyr 16103129:165:59
status: NEW199 To generate the retinal dystrophy associated ABCA4 alleles: [L541P; A1038V], L541P, A1038V, R602W and C1490Y ABCA4, the pXOP-ABCA4 plasmid was mutagenized with Quickchange PCR-based mutagenesis system (Biocrest, La Jolla, CA, USA).
X
ABCA4 p.Cys1490Tyr 16103129:199:102
status: NEW228 In particular, we searched for subjects with RP, CRD and STGD in whom two mislocalization-mutant alleles [L541P; A1038V], R602W and C1490Y] were detected.
X
ABCA4 p.Cys1490Tyr 16103129:228:132
status: NEW[hide] Denaturing HPLC profiling of the ABCA4 gene for re... Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10. Stenirri S, Fermo I, Battistella S, Galbiati S, Soriani N, Paroni R, Manitto MP, Martina E, Brancato R, Allikmets R, Ferrari M, Cremonesi L
Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations.
Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10., [PMID:15192030]
Abstract [show]
BACKGROUND: Mutations in the retina-specific ABC transporter (ABCA4) gene have been associated with several forms of macular degenerations. Because the high complexity of the molecular genotype makes scanning of the ABCA4 gene cumbersome, we describe here the first use of denaturing HPLC (DHPLC) to screen for ABCA4 mutations. METHODS: Temperature conditions were designed for all 50 exons based on effective separation of 83 samples carrying 86 sequence variations and 19 mutagenized controls. For validation, samples from 23 previously characterized Stargardt patients were subjected to DHPLC profiling. Subsequently, samples from a cohort of 30 patients affected by various forms of macular degeneration were subjected to DHPLC scanning under the same conditions. RESULTS: DHPLC profiling not only identified all 132 sequence alterations previously detected by double-gradient denaturing gradient gel electrophoresis but also identified 5 sequence alterations that this approach had missed. Moreover, DHPLC scanning of an additional panel of 30 previously untested patients led to the identification of 26 different mutations and 29 polymorphisms, accounting for 203 sequence variations on 29 of the 30 patients screened. In total, the DHPLC approach allowed us to identify 16 mutations that had never been reported before. CONCLUSIONS: These results provide strong support for the use of DHPLC for molecular characterization of the ABCA4 gene.
Comments [show]
None has been submitted yet.
No. Sentence Comment
35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations.
X
ABCA4 p.Cys1490Tyr 15192030:35:522
status: NEW34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations.
X
ABCA4 p.Cys1490Tyr 15192030:34:522
status: NEW[hide] Mutation spectrum and founder chromosomes for the ... Invest Ophthalmol Vis Sci. 2004 Jun;45(6):1705-11. September AV, Vorster AA, Ramesar RS, Greenberg LJ
Mutation spectrum and founder chromosomes for the ABCA4 gene in South African patients with Stargardt disease.
Invest Ophthalmol Vis Sci. 2004 Jun;45(6):1705-11., [PMID:15161829]
Abstract [show]
PURPOSE: To assess the mutation spectrum of ABCA4 underlying Stargardt disease (STGD) in South Africa (SA) and to determine whether there is a single or a few founder chromosomes in SA STGD families. METHODS: Sixty-four probands exhibiting the STGD phenotype were screened for mutations in the 50 exons of ABCA4 by single-strand conformational polymorphism-heteroduplex analysis sequencing and restriction fragment length polymorphism analysis. Microsatellite marker haplotyping was used to determine the ancestry in 10 families. RESULTS: Fifty-seven ABCA4 disease-associated alleles were identified that comprised 16 different sequence variants, of which two were novel, in 40 individuals of the cohort of 64 subjects. The most common variants identified included the C1490Y, L2027F, R602W, V256splice, R152X, and 2588G-->C mutations. The C1490Y variant was the most common disease-associated variant identified (19/64 subjects) and was absent in 392 control chromosomes. At least 10 ABCA4 disease-associated haplotypes were identified. Two of these haplotypes, which carried the C1490Y mutation, were identified in three unrelated families. CONCLUSIONS: Results suggest that ABCA4 is the major gene underlying STGD in the cohort investigated. Five of the six common sequence variants identified were at a higher frequency in the SA cohort than reported in published data on individuals of similar ancestry. The mutation and haplotype data suggests that there are several ancestral haplotypes underlying STGD in SA. There seems to be at least two different origins for the common C1490Y mutation, as well as two for the R602W mutation, thereby suggesting several founder effects for STGD in SA.
Comments [show]
None has been submitted yet.
No. Sentence Comment
7 The most common variants identified included the C1490Y, L2027F, R602W, V256splice, R152X, and 2588G3C mutations.
X
ABCA4 p.Cys1490Tyr 15161829:7:49
status: NEW8 The C1490Y variant was the most common disease-associated variant identified (19/64 subjects) and was absent in 392 control chromosomes.
X
ABCA4 p.Cys1490Tyr 15161829:8:4
status: NEW10 Two of these haplotypes, which carried the C1490Y mutation, were identified in three unrelated families.
X
ABCA4 p.Cys1490Tyr 15161829:10:43
status: NEW15 There seems to be at least two different origins for the common C1490Y mutation, as well as two for the R602W mutation, thereby suggesting several founder effects for STGD in SA.
X
ABCA4 p.Cys1490Tyr 15161829:15:64
status: NEW56 Restriction Fragment Length Polymorphism Analysis Restriction fragment length polymorphism (RFLP) analyses were performed by using the RsaI restriction endonuclease enzyme to screen for the C1490Y mutation.
X
ABCA4 p.Cys1490Tyr 15161829:56:190
status: NEW71 List of 16 Different Potential Disease-Associated Sequence Variants Identified in 64 SA Subjects with arSTGD Nucleotide Change Amino Acid Change Families (N ؍ 64) Exon Reference C454T R152X 4 5 3,33 G455A R152Q 1 5 35 C634T R212C 1 6 16,27 G768T (Splice donor) V256splice 5 6 15 C1885T R602W 6 13 9 2588G3C G863A 4 17 8 T3047C V989A 1 20 11 T4319C F1440S 1 29 9 G4328A* R1443H 1 29 This study G4469A C1490Y 19 30 15,9 G5077A V16931 1 36 36 C6079T L2027F 8 44 8 C6088A R2030X 1 44 9,37 C6112T R2038W 2 44 5 IVS45ϩ7G3A Splice donor 1 45 26 6352⌬A* Frameshift 1 46 This study No individuals positive for the R1443H variant were identified in 47 control individuals of Indian ancestry.
X
ABCA4 p.Cys1490Tyr 15161829:71:422
status: NEW72 The C1490Y variant was absent in 146 control individuals.
X
ABCA4 p.Cys1490Tyr 15161829:72:4
status: NEW78 The 6352⌬A sequence variant, which introduces a frameshift mutation that results in a premature termination codon, was identified in an individual of Afrikaner descent. The C1490Y sequence variant was the most frequently observed mutation in this study (19/64; 30%) but was absent in ethnically matched, unrelated, unaffected control individuals representative of the SA white (n ϭ 116), indigenous black (n ϭ 40), and mixed-ancestry (n ϭ 40) populations.
X
ABCA4 p.Cys1490Tyr 15161829:78:180
status: NEW82 In a large proportion of the individuals with the C1490Y variant, the AO was under the age of 20 years.
X
ABCA4 p.Cys1490Tyr 15161829:82:50
status: NEW83 The mean age of onset for individuals with the C1490Y mutation was 11.1 years with a standard deviation of 5.2.
X
ABCA4 p.Cys1490Tyr 15161829:83:47
status: NEW84 Of note, individual 209.1 and 113.3 were compound heterozygotes for the C1490Y and L2027F variations; however, their AOs differ considerably (18 and 10 years, respectively).
X
ABCA4 p.Cys1490Tyr 15161829:84:72
status: NEW93 Individual 219.1 in whom a single disease-associated allele carrying the C1490Y variant was identified, was diagnosed with STGD at an early age (AO of 5 years); bilateral extensive RPE atrophy was noted 4 years later (Table 3).
X
ABCA4 p.Cys1490Tyr 15161829:93:73
status: NEW97 Two disease-associated haplotypes were identified for the frequent C1490Y variant in three unrelated STGD families, suggesting several founder effects for STGD in SA (Fig.
X
ABCA4 p.Cys1490Tyr 15161829:97:67
status: NEW119 The C1490Y sequence variant was the most common disease-associated variant identified in this study (19/64; 30%), followed by the L2027F (8/64; 13%), the R602W variant (6/64; 9%), the V256splice variant (5/64; 8%), and the 2588G3C and R152X sequence variants occurred at equal frequencies (4/64; 6%).
X
ABCA4 p.Cys1490Tyr 15161829:119:4
status: NEW121 Five (C1490Y, L2027F, R602W, V256splice and R152X) of the six common sequence variants identified were at a higher frequency in the SA STGD cohort than in populations from Europe and the United States.
X
ABCA4 p.Cys1490Tyr 15161829:121:6
status: NEW122 Of interest, the C1490Y, R602W, V256splice, and R152X variants were found to be some of the rarer ABCA4 mutations observed in populations of Europe.
X
ABCA4 p.Cys1490Tyr 15161829:122:17
status: NEW125 AO (y) Phenotype Mutation 1 Mutation 2 224.1 9 STGD C1490Y R602W 170.2 10 STGD C1490Y R602W 241.1 9 STGD C1490Y 25883C 448.1 20 STGD C1490Y 2588G3C 113.3 10 STGD C1490Y L2027F 209.1 18 STGD C1490Y L2027F 165.4 10 STGD C1490Y V256splice 166.3 27 STGD C1490Y R152X 151.4 5 STGD C1490Y ND 219.1 5 (rapid clinical progression was observed by 9 years) STGD C1490Y ND 223.1 9 STGD C1490Y ND 307.1 9 STGD C1490Y ND 319.3 9 STGD C1490Y ND 385.1 10 STGD C1490Y ND 226.1 10 STGD C1490Y ND 142.2 10 STGD C1490Y ND 273.1 11 STGD C1490Y ND 382.1 12 STGD C1490Y ND 449.1 14 STGD C1490Y ND 344.2 ND STGD C1490Y ND 374.1 10 STGD L2027F 6352⌬A† 305.1 18 STGD L2027F R2038W 377.1 25 STGD L2027F R2038W 276.1 27 STGD L2027F R212C 204.4 8 STGD L2027F ND 135.4 13 STGD L2027F ND 446.1 9 STGD R602W ND 109.3 11 STGD R602W ND 110.7 13 STGD R602W ND 438.3 12 STGD R602W ND 123.1 9 STGD V256splice R152X 105.1* 10 STGD AND atypical RP V256splice R152X 24 129.3* 10 (rapid clinical progression was observed) STGD V256splice ND 163.22 10 STGD V256splice ND 173.1 8 STGD 2588G3C ND 9.4 27 STGD 2588G3C R152X 330.2 29 STGD R152Q V989A 372.1 31 STGD R1443H† R2030X 141.3 11 STGD F1440S IVS45ϩ7G3A (splice site mutation) 206.3 ND STGD V1693I ND Rows are arranged according to the age of onset (AO) starting with the earliest AO for the most common sequence variant.
X
ABCA4 p.Cys1490Tyr 15161829:125:52
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:79
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:105
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:133
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:162
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:190
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:218
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:250
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:276
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:352
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:375
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:398
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:421
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:445
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:469
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:493
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:517
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:541
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:565
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:125:589
status: NEW137 The 10 ABCA4 Disease-Associated Haplotypes Identified in the 10 STGD Families Investigated Family D1S188 Marker ABCA4 MutationD1S406 D1S236 166 14 6 12 C1490Y 170 15 4 9 C1490Y 151 15 4 9 C1490Y 204 9 5 14 L2027F 135 9 5 14 L2027F 105 8 4 14 V256splice 129 8 4 14 V256splice 170 10 5 12 R602W 110 16 6 3 R602W 9 7 5 14 2588G3C 9 16 5 4 R152X 105 16 5 4 R152X 166 16 5 4 R152X 141 8 3 6 F1440S 141 9 5 14 IVS45ϩ7G3A The numbers in column 1 denote the identity number of the family.
X
ABCA4 p.Cys1490Tyr 15161829:137:152
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:137:170
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:137:188
status: NEW145 Two haplotypes were identified for the C1490Y variant in three families: (a) 166, (b) 170, and (c) 151. equally to the severe clinical phenotype or whether the severity of the phenotype is determined by the effects of the V256splice mutation on the protein function.
X
ABCA4 p.Cys1490Tyr 15161829:145:39
status: NEW157 From the published data, the C1490Y mutation was noted to be present at a particularly low frequency (1%) in the European population.9 This is in contrast, to the notably high frequency (30%) observed in the SA Afrikaner population who are of Dutch, German, and French ancestry.
X
ABCA4 p.Cys1490Tyr 15161829:157:29
status: NEW159 However, the C1490Y variant was absent in the 196 ethnically unrelated, unaffected control individuals investigated.
X
ABCA4 p.Cys1490Tyr 15161829:159:13
status: NEW160 This absence in the control group and the high association with the affected cohort therefore suggests that the high frequency of the C1490Y sequence variant in the SA STGD cohort is due to a founder effect.
X
ABCA4 p.Cys1490Tyr 15161829:160:134
status: NEW162 The 16 different disease-associated sequence variants identified together with the high association of C1490Y with STGD in SA and its absence in 392 control chromosomes suggests the presence of several ancestral haplotypes underlying STGD in SA and, possibly, several founder effects for the C1490Y in the SA cohort of subjects.
X
ABCA4 p.Cys1490Tyr 15161829:162:103
status: NEWX
ABCA4 p.Cys1490Tyr 15161829:162:292
status: NEW164 Of note, two disease-associated haplotypes were identified for the frequent C1490Y variant in three unrelated families with STGD, suggesting several founder effects for STGD in SA.
X
ABCA4 p.Cys1490Tyr 15161829:164:76
status: NEW166 Recruitment of more subjects from SA families in whom the C1490Y variant has been identified will facilitate the interrogation of a founder effect for this mutation in the SA STGD cohort.
X
ABCA4 p.Cys1490Tyr 15161829:166:58
status: NEW169 More important, there seems to be at least two different origins for the same "disease-predisposing" allele carrying the common C1490Y mutation in this study population.
X
ABCA4 p.Cys1490Tyr 15161829:169:128
status: NEW[hide] Genotyping microarray (gene chip) for the ABCR (AB... Hum Mutat. 2003 Nov;22(5):395-403. Jaakson K, Zernant J, Kulm M, Hutchinson A, Tonisson N, Glavac D, Ravnik-Glavac M, Hawlina M, Meltzer MR, Caruso RC, Testa F, Maugeri A, Hoyng CB, Gouras P, Simonelli F, Lewis RA, Lupski JR, Cremers FP, Allikmets R
Genotyping microarray (gene chip) for the ABCR (ABCA4) gene.
Hum Mutat. 2003 Nov;22(5):395-403., [PMID:14517951]
Abstract [show]
Genetic variation in the ABCR (ABCA4) gene has been associated with five distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), and age-related macular degeneration (AMD). Comparative genetic analyses of ABCR variation and diagnostics have been complicated by substantial allelic heterogeneity and by differences in screening methods. To overcome these limitations, we designed a genotyping microarray (gene chip) for ABCR that includes all approximately 400 disease-associated and other variants currently described, enabling simultaneous detection of all known ABCR variants. The ABCR genotyping microarray (the ABCR400 chip) was constructed by the arrayed primer extension (APEX) technology. Each sequence change in ABCR was included on the chip by synthesis and application of sequence-specific oligonucleotides. We validated the chip by screening 136 confirmed STGD patients and 96 healthy controls, each of whom we had analyzed previously by single strand conformation polymorphism (SSCP) technology and/or heteroduplex analysis. The microarray was >98% effective in determining the existing genetic variation and was comparable to direct sequencing in that it yielded many sequence changes undetected by SSCP. In STGD patient cohorts, the efficiency of the array to detect disease-associated alleles was between 54% and 78%, depending on the ethnic composition and degree of clinical and molecular characterization of a cohort. In addition, chip analysis suggested a high carrier frequency (up to 1:10) of ABCR variants in the general population. The ABCR genotyping microarray is a robust, cost-effective, and comprehensive screening tool for variation in one gene in which mutations are responsible for a substantial fraction of retinal disease. The ABCR chip is a prototype for the next generation of screening and diagnostic tools in ophthalmic genetics, bridging clinical and scientific research.
Comments [show]
None has been submitted yet.
No. Sentence Comment
115 Mutations Detected in theTwoTest Populations by the ABCR400 Array,That Had Not Been Found by SSCP Number Nucleotide change Protein e¡ect Number of cases 1 161G4A C54Y 3 2 194G4A G65E 1 3 428C4T P143L 1 4 455G4A R152Q 1 5 514G4A G172S 1 6 635G4A R212H 1 7 656G4C R219T 1 8 768G4Ta Splice/V256V 3 9 1007C4G S336C 2 10 1268A4G H423R 4 11 1411G4A E471K 2 12 1622T4Ca L541P 8 13 1933G4A D645N 1 14 2041C4T R681X 5 15 2090G4A W697X 1 16 2471T4C I824T 1 17 2588G4Ca Splice/G863A 5 18 2828G4A R943Q 1 19 2966T4C V989A 1 20 2971G4C G991R 1 21 4139C4T P1380L 8 22 4195G4A E1399K 1 23 4328G4A R1443H 1 24 4457C4T P1486L 1 25 4462T4Ca C1488R 1 26 4469G4Aa C1490Y 1 27 4918C4Ta R1640W 2 28 IVS40+5G4A Splice 2 29 5537T4C I1846T 2 30 5882G4A G1961E 5 31 6089G4A R2030Q 1 32 6104T4C L2035P 1 33 6449G4A C2150Y 1 Mutation numbering is based on the cDNA sequence (GenBank NM_000350).
X
ABCA4 p.Cys1490Tyr 14517951:115:649
status: NEW[hide] Detailed analysis of allelic variation in the ABCA... Invest Ophthalmol Vis Sci. 2003 Jul;44(7):2868-75. Schmidt S, Postel EA, Agarwal A, Allen IC Jr, Walters SN, De la Paz MA, Scott WK, Haines JL, Pericak-Vance MA, Gilbert JR
Detailed analysis of allelic variation in the ABCA4 gene in age-related maculopathy.
Invest Ophthalmol Vis Sci. 2003 Jul;44(7):2868-75., [PMID:12824224]
Abstract [show]
PURPOSE: Age-related maculopathy (ARM) is one of the most common causes of blindness in older adults worldwide. Sequence variants in a gene coding for a retina-specific ATP-binding cassette (ABCA4) transporter protein, which is responsible for a phenotypically similar Mendelian form of retinal disease, were proposed to increase the risk of ARM. To examine the potential relationship of ABCA4 sequence variation and ARM risk in an independent data set, a clinically well-characterized population of 165 multiplex patients with ARM from 70 families, 33 unaffected relatives, and 59 unrelated control subjects with confirmed absence of ARM was screened for variants in any of the 50 exons and exon-intron boundaries of this gene. METHODS: A combination of denaturing high-performance liquid chromatography (DHPLC) and bidirectional sequencing was used to detect ABCA4 sequence variants. The data set was analyzed with both case-control and family-based association analysis methods. RESULTS: No evidence was found of significantly different allele frequencies of ABCA4 sequence variants in patients compared with control subjects, and no evidence for association or cosegregation with disease in family-based analyses. CONCLUSIONS: This study confirmed the very high degree of ABCA4 sequence polymorphism in the general population, which makes the detection of potential disease-associated alleles particularly challenging. While this study does not definitively exclude ABCA4 from contributing to a small or moderate fraction of ARM, it adds to the body of evidence suggesting that ABCA4 is not a major susceptibility gene for this disorder.
Comments [show]
None has been submitted yet.
No. Sentence Comment
123 Polymorphisms and Rare Sequence Variants in Exons of the ABCA4 Gene Exon Nucleotide Change Effect Allele Frequency* P† P§ Referenceሻ Independent ARM (n ؍ 140) All ARM (n ؍ 330) Control Subjects (n ؍ 118) 6 589G3C Asp197Asn 0.000 0.000 0.009 0.46 0.12 - 6 635G3A Arg212His 0.030 0.026 0.000 0.13 0.11 W, R 10 1268A3G His423Arg 0.394 0.371 0.427 0.62‡ 0.34 W, R 10 1269C3T His423His(syn) 0.033 0.039 0.031 1.0 0.74 W 18 2701A3G Thr901Ala 0.000 0.003 0.000 NA 0.58 W, R 23 3495C3T Asn1165Asn(syn) 0.000 0.003 0.000 NA 0.75 - 30 4469G3A Cys1490Tyr 0.007 0.003 0.000 1.0 0.59 W 37 5206T3C Ser1736Pro 0.009 0.008 0.000 1.0 0.44 W 40 5603T3A Asn1868Ile 0.100 0.102 0.054 0.29 0.18 W 40 5682G3C Leu1894Leu(syn) 0.293 0.272 0.298 1.0 0.64 W 41 5814A3G Leu1938Leu(syn) 0.160 0.169 0.218 0.33 0.38 W 42 5843C3T Pro1948Leu 0.052 0.038 0.054 1.0 0.50 W 42 5844A3G Pro1948Pro(syn) 0.199 0.192 0.205 1.0 0.77 W 44 6069C3T Ile2023Ile(syn) 0.040 0.050 0.044 1.0 0.82 W 44 6079C3T Leu2027Phe 0.000 0.000 0.009 0.48 0.13 W * Actual n (number of chromosomes) varies, as frequencies were calculated relative to nonmissing data only.
X
ABCA4 p.Cys1490Tyr 12824224:123:625
status: NEW[hide] Macular pigment and visual acuity in Stargardt mac... Graefes Arch Clin Exp Ophthalmol. 2002 Oct;240(10):802-9. Epub 2002 Sep 14. Zhang X, Hargitai J, Tammur J, Hutchinson A, Allikmets R, Chang S, Gouras P
Macular pigment and visual acuity in Stargardt macular dystrophy.
Graefes Arch Clin Exp Ophthalmol. 2002 Oct;240(10):802-9. Epub 2002 Sep 14., [PMID:12397427]
Abstract [show]
PURPOSE: To test the hypothesis that macular pigment reflects foveal cone function and possibly the presence of foveal cones in recessive Stargardt macular dystrophy. METHODS: Sixteen patients (32 eyes) diagnosed to have Stargardt macular dystrophy by clinical criteria were studied with a scanning laser ophthalmoscope (SLO) comparing argon laser blue (488 nm), green (514), helium-neon laser red (633 nm) and infrared diode laser (780 nm) images for the presence or absence of macular pigment in the fovea. Fifteen of the patients were screened for mutations in the ABCR gene. Eyes were graded into three categories: those without foveal macular pigment, those with partial pigment and those with normal amounts of macular pigment. These categories were compared with visual acuity determined by the Snellen chart. RESULTS: All patients with a visual acuity of 20/200 or worse had no macular pigment in the fovea. All patients with visual acuity of 20/40 or better had a normal amount of macular pigment in the fovea. Patients with partial macular pigment had intermediary acuity values except for two eyes, one with 20/20 and another with 20/200 acuity. Infrared light revealed more retinal abnormalities than blue light at early stages of the disease. CONCLUSION: Foveal macular pigment is related to foveal cone acuity in Stargardt macular dystrophy and may be a marker for the presence of foveal cones. Infrared light is a sensitive monitor of early Stargardt macular dystrophy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
54 Blue light images (A, C); infrared images (B, D) Table 1 Visual acuity, macular pigment and ABCR mutations in patients with Stargardt dystrophy Patient Age/Sex Visual Acuity Macular Pigment Exon Allele 1 Exon Allele 2 OD OS OD OS 1 33F 0.67 0.38 + + ND ND 2 36F 1 0.5 + + ND ND 3 54F 0.48 0.6 + + 42 G1961E 42 G1061E 4 11M 0.8 1 + + NS NS 5 33F 0.67 0.4 +- + 20 V989A ND 6 12F 0.5 0.2 +- +- 30 C1490Y 40 GIVS+5A 7 47M 0.5 0.4 +- +- 17 G863A/R943Q 45 R2077W 8 53M 0.1 1 +- +- 14 W663X ND 9 29F 0.1 0.1 +- +- 26 3819insT ND 10 43M 0.005 0.005 - - 17 G863A/R943Q ND 11 32F 0.1 0.1 - - 19 N965S ND 12 29F 0.005 0.005 - - 23 R1129H ND 13 30F 0.1 0.1 - - 5 R152Q ND 14 63F 0.1 0.1 - - 42 G1961E ND 15 36M 0.07 0.1 - +- 13 Q636H 42 G1961E 16 41F 0.005 0.005 - - 12 L514P/A1038V ND NS: Not screened; ND: Not detected + Normal macular pigment; +- Partial macular pigment; - Absent macular pigment absorption of infrared light in the center of the macula where maximum absorption of blue light occurs, implying that the macula pigments in this subject`s foveas are normal.
X
ABCA4 p.Cys1490Tyr 12397427:54:394
status: NEW[hide] Mutational scanning of the ABCR gene with double-g... Hum Genet. 2001 Sep;109(3):326-38. Fumagalli A, Ferrari M, Soriani N, Gessi A, Foglieni B, Martina E, Manitto MP, Brancato R, Dean M, Allikmets R, Cremonesi L
Mutational scanning of the ABCR gene with double-gradient denaturing-gradient gel electrophoresis (DG-DGGE) in Italian Stargardt disease patients.
Hum Genet. 2001 Sep;109(3):326-38., [PMID:11702214]
Abstract [show]
Mutations in the retina-specific ABC transporter (ABCR) gene are responsible for autosomal recessive Stargardt disease (arSTGD). Mutation detection efficiency in ABCR in arSTGD patients ranges between 30% and 66% in previously published studies, because of high allelic heterogeneity and technical limitations of the employed methods. Conditions were developed to screen the ABCR gene by double-gradient denaturing-gradient gel electrophoresis. The efficacy of this method was evaluated by analysis of DNA samples with previously characterized ABCR mutations. This approach was applied to mutation detection in 44 Italian arSTGD patients corresponding to 36 independent genomes, in order to assess the nature and frequency of the ABCR mutations in this ethnic group. In 34 of 36 (94.4%) STGD patients, 37 sequence changes were identified, including 26 missense, six frameshift, three splicing, and two nonsense variations. Among these, 20 had not been previously described. Several polymorphisms were detected in affected individuals and in matched controls. Our findings extend the spectrum of mutations identified in STGD patients and suggest the existence of a subset of molecular defects specific to the Italian population. The identification of at least two disease-associated mutations in four healthy control individuals indicates a higher than expected carrier frequency of variant ABCR alleles in the general population. Genotype-phenotype analysis in our series showed a possible correlation between the nature and location of some mutations and specific ophthalmoscopic features of STGD disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
70 Mutated samples are: L541P (1622T→C) for exon 12; Y639X (1917C→A) for exon 13; R1098C (3292C→T) for exon 22; C1490Y (4469G→A) for exon 30; A1598D (4793C→A) for exon 34; R2149L (6446G→T) for exon 47 Table 2 Mutations detected in STGD patients and non-affected controls (Cases independent genomes analyzed).
X
ABCA4 p.Cys1490Tyr 11702214:70:130
status: NEW[hide] Mutations in ABCR (ABCA4) in patients with Stargar... Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36. Briggs CE, Rucinski D, Rosenfeld PJ, Hirose T, Berson EL, Dryja TP
Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.
Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36., [PMID:11527935]
Abstract [show]
PURPOSE: To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). METHODS: One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. RESULTS: The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. CONCLUSIONS: This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.
Comments [show]
None has been submitted yet.
No. Sentence Comment
89 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 ϩ 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 ϩ 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 ϩ 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 ϩ 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 ϩ 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 ϩ 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No.
X
ABCA4 p.Cys1490Tyr 11527935:89:5161
status: NEW88 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 af9; 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 af9; 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 af9; 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 af9; 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 af9; 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 af9; 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None IOVS, September 2001, Vol. 42, No. 10 ABCR in Stargardt Macular Degeneration Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. 10 TABLE 1 (continued).
X
ABCA4 p.Cys1490Tyr 11527935:88:5239
status: NEW[hide] An analysis of allelic variation in the ABCA4 gene... Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89. Webster AR, Heon E, Lotery AJ, Vandenburgh K, Casavant TL, Oh KT, Beck G, Fishman GA, Lam BL, Levin A, Heckenlively JR, Jacobson SG, Weleber RG, Sheffield VC, Stone EM
An analysis of allelic variation in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89., [PMID:11328725]
Abstract [show]
PURPOSE: To assess the allelic variation of the ATP-binding transporter protein (ABCA4). METHODS: A combination of single-strand conformation polymorphism (SSCP) and automated DNA sequencing was used to systematically screen this gene for sequence variations in 374 unrelated probands with a clinical diagnosis of Stargardt disease, 182 patients with age-related macular degeneration (AMD), and 96 normal subjects. RESULTS: There was no significant difference in the proportion of any single variant or class of variant between the control and AMD groups. In contrast, truncating variants, amino acid substitutions, synonymous codon changes, and intronic variants were significantly enriched in patients with Stargardt disease when compared with their presence in subjects without Stargardt disease (Kruskal-Wallis P < 0.0001 for each variant group). Overall, there were 2480 instances of 213 different variants in the ABCA4 gene, including 589 instances of 97 amino acid substitutions, and 45 instances of 33 truncating variants. CONCLUSIONS: Of the 97 amino acid substitutions, 11 occurred at a frequency that made them unlikely to be high-penetrance recessive disease-causing variants (HPRDCV). After accounting for variants in cis, one or more changes that were compatible with HPRDCV were found on 35% of all Stargardt-associated alleles overall. The nucleotide diversity of the ABCA4 coding region, a collective measure of the number and prevalence of polymorphic sites in a region of DNA, was found to be 1.28, a value that is 9 to 400 times greater than that of two other macular disease genes that were examined in a similar fashion (VMD2 and EFEMP1).
Comments [show]
None has been submitted yet.
No. Sentence Comment
102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ؍ 182) Control (n ؍ 96) STGD (n ؍ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ؍ 182) Control (n ؍ 96) STGD (n ؍ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution.
X
ABCA4 p.Cys1490Tyr 11328725:102:4021
status: NEW103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution.
X
ABCA4 p.Cys1490Tyr 11328725:103:3931
status: NEW[hide] Genotype/Phenotype analysis of a photoreceptor-spe... Am J Hum Genet. 1999 Feb;64(2):422-34. Lewis RA, Shroyer NF, Singh N, Allikmets R, Hutchinson A, Li Y, Lupski JR, Leppert M, Dean M
Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease.
Am J Hum Genet. 1999 Feb;64(2):422-34., [PMID:9973280]
Abstract [show]
Mutation scanning and direct DNA sequencing of all 50 exons of ABCR were completed for 150 families segregating recessive Stargardt disease (STGD1). ABCR variations were identified in 173 (57%) disease chromosomes, the majority of which represent missense amino acid substitutions. These ABCR variants were not found in 220 unaffected control individuals (440 chromosomes) but do cosegregate with the disease in these families with STGD1, and many occur in conserved functional domains. Missense amino acid substitutions located in the amino terminal one-third of the protein appear to be associated with earlier onset of the disease and may represent misfolding alleles. The two most common mutant alleles, G1961E and A1038V, each identified in 16 of 173 disease chromosomes, composed 18.5% of mutations identified. G1961E has been associated previously, at a statistically significant level in the heterozygous state, with age-related macular degeneration (AMD). Clinical evaluation of these 150 families with STGD1 revealed a high frequency of AMD in first- and second-degree relatives. These findings support the hypothesis that compound heterozygous ABCR mutations are responsible for STGD1 and that some heterozygous ABCR mutations may enhance susceptibility to AMD.
Comments [show]
None has been submitted yet.
No. Sentence Comment
76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift.
X
ABCA4 p.Cys1490Tyr 9973280:76:1316
status: NEW178 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET ע SD (YEARS)Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 ע 12.7 51961GrA AR307 10 A1038V AR290 16 5714ϩ5GrA AR314 25 5898ϩ1GrT AR336 39 A1038V R572P AR321 6 12.5 ע 6.9 S1071L AR358 6 L1970F AR428 6 5196ϩ2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 ע 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 ע 4.5 C75G AR427 12 C1490Y AR370 13 2160ϩ1GrC AR218 14 4253ϩ5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 ע 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade.
X
ABCA4 p.Cys1490Tyr 9973280:178:685
status: NEW77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift.
X
ABCA4 p.Cys1490Tyr 9973280:77:1322
status: NEW179 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET cf2; SD (YEARS) Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 cf2; 12.7 51961GrA AR307 10 A1038V AR290 16 5714af9;5GrA AR314 25 5898af9;1GrT AR336 39 A1038V R572P AR321 6 12.5 cf2; 6.9 S1071L AR358 6 L1970F AR428 6 5196af9;2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 cf2; 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 cf2; 4.5 C75G AR427 12 C1490Y AR370 13 2160af9;1GrC AR218 14 4253af9;5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 cf2; 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade.
X
ABCA4 p.Cys1490Tyr 9973280:179:606
status: NEW[hide] Allelic and phenotypic heterogeneity in ABCA4 muta... Ophthalmic Genet. 2011 Sep;32(3):165-74. doi: 10.3109/13816810.2011.565397. Epub 2011 Apr 21. Burke TR, Tsang SH
Allelic and phenotypic heterogeneity in ABCA4 mutations.
Ophthalmic Genet. 2011 Sep;32(3):165-74. doi: 10.3109/13816810.2011.565397. Epub 2011 Apr 21., [PMID:21510770]
Abstract [show]
Since the discovery of the ABCA4 gene as the cause of autosomal recessive Stargardt disease/fundus flavimaculatus much has been written of the phenotypic variability in ABCA4 retinopathy. In this review the authors discuss the findings seen on examination and the disease features detected using various clinical tests. Important differential diagnoses are presented and unusual presentations of ABCA4 disease highlighted.
Comments [show]
None has been submitted yet.
No. Sentence Comment
7 The most common, L541P/A1038V, has been reported as a founder mutation in Hungaro-German populations.14,16,17 Furthermore "ethnic group-specific" ABCA4 alleles have been described in other populations also, C1490Y and R602W in South African patients,18 and N965S in a Danish population19 among others.20 In an attempt to explain the variability seen in ABCA4 retinal phenotypes and to correlate this with individual mutation effect, a model was proposed which correlated disease severity with residual ABCA4 function.14,21 Maugeri classified ABCA4 mutant alleles as "mild", "moderate", and "severe" based on the predicted effect of the mutation on the transport function of the protein, ie, the more severe the effect of the mutation on ABCA4 function, the more aggressive the disease phenotype.
X
ABCA4 p.Cys1490Tyr 21510770:7:207
status: NEW[hide] Detection rate of pathogenic mutations in ABCA4 us... Arch Ophthalmol. 2012 Nov;130(11):1486-90. doi: 10.1001/archophthalmol.2012.1697. Downes SM, Packham E, Cranston T, Clouston P, Seller A, Nemeth AH
Detection rate of pathogenic mutations in ABCA4 using direct sequencing: clinical and research implications.
Arch Ophthalmol. 2012 Nov;130(11):1486-90. doi: 10.1001/archophthalmol.2012.1697., [PMID:23143460]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
28 In 5 of the 11 patients, the identification of 2 pathogenic mutations confirmed the historical diagnosis and all had chorioretinal atro- Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 1 1Ab0e;G M1V 2588Gb0e;C G863A In trans Unaffected parents carriers 30 STGD maf9;/0/0 R2030Q 3 PVs 2 161Gb0e;A C54Y 2588Gb0e;C G863A In trans Affected sibling with same mutations 12 STGD m/0/0 0 2 PVs 3 161Gb0e;A C54Y 5882Gb0e;A G1961E NK NK 18 STGD m/0/0 0 2 PVs 4 634Cb0e;T R212C 4457Cb0e;T P1486L In trans Unaffected parents carriers 17 STGD m/0/0 0 2 PVs 5 2588Gb0e;C G863A 4469Gb0e;A C1490Y NK NK 48 STGD maf9;/0/1 0 2 PVs 6 2971Gb0e;C G991R 4254-2Ab0e;G Splice NK NK 21 STGD m/0/0 0 2 PVs 7 2971Gb0e;C G991R 3602Tb0e;G L1201R NK NK 18 STGD maf9;af9;/NP/NP V643M (likely), G885E (likely), G1441D (unlikely), V2244V (highly likely) b0e;2 PVs 8 3322Cb0e;T R1108C 768Gb0e;T V256V NK NK 13 STGD maf9;af9;/1/1 0 2 PVs 9 3322Cb0e;T R1108C 6079Cb0e;T L2027F NK NK 26 STGD maf9;/0/0 0 2 PVs 10 3386Gb0e;T R1129L 4469Gb0e;A C1490Y In trans Unaffected parents carriers 15 STGD maf9;/0/0 R152Q (unlikely) 2 PVs (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1486 phy on current clinical examination, consistent with progression of the disorder.5 One of the 11 patients with chorioretinal atrophy (subject 40) had a single stop codon, again strongly supporting the original clinical diagnosis. Six of the 11 patients did not have pathogenic mutations in ABCA4.
X
ABCA4 p.Cys1490Tyr 23143460:28:813
status: NEWX
ABCA4 p.Cys1490Tyr 23143460:28:1295
status: NEW30 In 3 of the 6 patients with a historical diagnosis Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients (continued) Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 11 4139Cb0e;T P1380L 5714 af9; 5Gb0e;A Splice NK NK 19 STGD m/0/0 0 2 PVs 12 4457Cb0e;T P1486L 4457Cb0e;T P1486L In trans Unaffected sibling carries 1 mutation 25 STGD maf9;af9;/1/1 0 2 PVs 13 4537dupC Q1513fs 6391Gb0e;A E2131K In trans Unaffected parents carriers 10 STGD maf9;/0/0 R152Q in cis with Q1513fs, E2131K in cis with E471K 2 PVs 14 6079Cb0e;T L2027F 6079Cb0e;T L2027F In trans Unaffected sibling carrier 28 STGD maf9;af9;/0/0 0 2 PVs 15 5018 af9; 2Tb0e;C NA 6316Cb0e;T R2106C In trans Affected sibling with same mutations 17 STGD m/0/1 0 2 PVs 16 3004Cb0e;T R1002Wb 1957Cb0e;T R653C In trans NK 16 STGD m/0/1 0 2 PVs 17 1253Tb0e;C F418S 2588Gb0e;C G863A NK NK 52 STGD maf9;/0/0 0 2 PVs 18 6709Ab0e;C T2237Pb 3064Gb0e;A E1022K In trans 2 Affected siblings with same mutations 6 STGD maf9;af9;/0/0 0 2 PVs 19 5260Tb0e;G Y1754D 4469Gb0e;A C1490Y In trans NK 12 STGD maf9;af9;/0/0 0 2 PVs 20 551Cb0e;T S184Fb 4793Cb0e;A A1598D NK 2 Affected siblings with same mutations 58 STGD m/NP/NP 0 2 PVs 21 550-551TCb0e;CG S184Rb 5882Gb0e;A G1961E In trans Affected sibling with same mutations 25 STGD maf9;af9;/0/0 0 2 PVs 22 5313-3Cb0e;G Spliceb 5882Gb0e;A G1961E In trans Unaffected parents carriers 47 STGD m/0/1 0 2 PVs 23 2588Gb0e;C G863A 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans NA 26 STGD maf9;af9;/3/1 1 In cis with G863A 2 PVs 24 5537Tb0e;C I1846T 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected son carries I1846T only 17 STGD maf9;af9;/3/3 0 2 PVs 25 6089Gb0e;A R2030Q 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected sibling carries R2030Q 4 STGD m/NP/NP 0 2 PVs 26 6730-1Gb0e;C Spliceb 2588Gb0e;C G863A NK NK 15 STGD NP/NP/NP 0 2 PVs 27 3291Ab0e;T R1097Sb 3056Cb0e;T T1019M In trans NK 9 STGD NP/NP/NP 1 In cis with R1097S 2 PVs 28 498delT L167HisfsX2b Not present NA NA NK 28 STGD m/1/1 0 1 PV 29 2345Gb0e;A W782Xb Not present NA NA Unaffected mother carries mutation 25 STGD m/1/1 0 1 PV 30 2588Gb0e;C G863A 4326Cb0e;A N1442K NK NK 36 STGD maf9;/0/0 0 1 PV af9; N1442K (unlikely) 31 2966Tb0e;C V989A Not present NA NA NK 49 STGD m/1/1 0 1 PV (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1487 (c)2012 American Medical Association. All rights reserved. Downloaded From: http://archopht.jamanetwork.com/ by a Semmelweis University Budapest User on 12/06/2015 lopathy is genetically heterogeneous. A total of 10 novel mutations were identified (Table).
X
ABCA4 p.Cys1490Tyr 23143460:30:1246
status: NEW[hide] A longitudinal study of stargardt disease: clinica... Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15. Fujinami K, Lois N, Davidson AE, Mackay DS, Hogg CR, Stone EM, Tsunoda K, Tsubota K, Bunce C, Robson AG, Moore AT, Webster AR, Holder GE, Michaelides M
A longitudinal study of stargardt disease: clinical and electrophysiologic assessment, progression, and genotype correlations.
Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15., [PMID:23499370]
Abstract [show]
PURPOSE: To investigate the clinical and electrophysiologic natural history of Stargardt disease and correlate with the genotype. DESIGN: Cohort study of 59 patients. METHODS: Clinical history, examination, and electrophysiologic assessment were undertaken in a longitudinal survey. Patients were classified into 3 groups based on electrophysiologic findings, as previously published: Group 1 had dysfunction confined to the macula; Group 2 had macular and generalized cone system dysfunction; and Group 3 had macular and both generalized cone and rod system dysfunction. At baseline, there were 27 patients in Group 1, 17 in Group 2, and 15 in Group 3. Amplitude reduction of >50% in the relevant electroretinogram (ERG) component or a peak time shift of >3 ms for the 30 Hz flicker ERG or bright flash a-wave was considered clinically significant ERG deterioration. Molecular screening of ABCA4 was undertaken. RESULTS: The mean age at baseline was 31.7 years, with the mean follow-up interval being 10.5 years. A total of 22% of patients from Group 1 showed ERG group transition during follow-up, with 11% progressing to Group 2 and 11% to Group 3. Forty-seven percent of patients in Group 2 progressed to Group 3. There was clinically significant ERG deterioration in 54% of all subjects: 22% of Group 1, 65% of Group 2, and 100% of Group 3. At least 1 disease-causing ABCA4 variant was identified in 47 patients. CONCLUSIONS: All patients with initial rod ERG involvement demonstrated clinically significant electrophysiologic deterioration; only 20% of patients with normal full-field ERGs at baseline showed clinically significant progression. Such data assist counseling by providing more accurate prognostic information and are also highly relevant in the design, patient selection, and monitoring of potential therapeutic interventions.
Comments [show]
None has been submitted yet.
No. Sentence Comment
89 Clinical Data and Molecular Genetic Status of 59 Patients With Stargardt Disease Pt Onset (y) Age (y) logMAR VA Variants Identifieda BL FU BL FU 1 16 17 26 0.0/1.0 0.0/0.48 c.768G>T / p.Gly863Ala / p.Arg943Gln 2 15 17 25 0.78/0.78 1.0/1.0 p. Arg1443His 3 11 18 27 0.78/1.0 1.0/1.0 p.Trp439* / p.Gly863Ala / p.Leu1970Phe 4 19 21 32 0.78/0.78 1.0/1.0 p.Leu2027Phe 5 10 22 30 0.48/0.48 1.0/0.78 p.Gly863Ala / p.Arg943Gln / c.5461-10 T>C 6 18 26 37 0.78/1.0 1.0/1.0 p.Pro1380Phe 7 25 28 40 0.78/1.0 1.3/0.78 ND 8 24 29 38 1.0/0.78 1.0/1.0 p.Phe418Ser / p.Leu2027Phe 9 24 31 44 1.0/1.0 1.3/1.0 c.4253&#fe;5 G>T / p.Gly1507Arg 10 26 32 44 0.78/0.78 1.0/1.0 p.Cys1490Tyr / p.Arg2030Gln 11 31 34 46 0.18/0.3 0.6/0.7 ND 12 17 35 47 1.0/1.0 1.0/1.0 p.Asn96His 13 23 35 45 1.0/0.3 1.0/0.48 p.Gly1513Profs*1554 14 33 37 48 0.18/1.48 1.0/1.3 ND 15 38 40 51 0.18/0.78 1.0/1.0 p.Arg2107His 16 42 43 53 0.0/0.0 1.0/1.0 ND 17 22 48 59 1.0/1.0 1.0/1.0 p.Cys54Tyr 18 20 49 59 1.0/0.6 1.0/1.0 p.Pro1380Leu / p.Gly1961Glu 19 35 50 61 1.0/0.3 1.0/1.0 p.Arg1108Cys 20 25 56 67 1.3/0.18 1.0/1.0 p.Trp439* / p.Gly863Ala 21 48 59 71 1.0/0.78 1.0/1.0 p. Ile156 Val / p. Cys1455Arg / p. Phe1839Ser 22 21 22 31 0.3/1.0 1.0/1.0 p.Arg2107His 23 21 23 33 1.0/1.0 1.0/1.0 p.Gly863Ala 24 48 64 73 0.0/1.0 0.18/3.0 p.Tyr1652* 25 17 19 29 0.78/0.3 1.0/1.0 c.5461-10 T>C 26 17 21 33 1.0/0.78 1.0/1.0 ND 27 27 53 66 1.78/1.78 1.3/1.0 p.Ser1071Cysfs*1084 28 5 14 21 0.78/0.78 1.0/1.0 p.Arg408* / p.Val675lle 29 9 15 27 1.08/1.08 1.0/1.0 p.Cys2150Tyr 30 14 24 32 1.0/0.78 1.0/1.0 ND 31 18 28 39 1.0/1.0 1.0/1.0 p.Gly863Ala / p.Arg1108Cys / p.Arg943Gln 32 14 29 37 1.0/1.0 1.0/1.0 p.Arg653Cys / p.Arg2030Gln 33 19 29 40 1.0/1.0 1.0/1.08 ND 34 34 40 49 0.3/0.48 1.0/1.0 p.Gly863Ala / p.Glu1087Lys 35 25 43 54 1.0/1.0 1.0/1.0 p.Cys54Tyr / p.Gly863Ala 36 38 60 69 1.0/1.0 1.3/1.08 p.Val931Met / c.5461-10 T>C 37 10 11 20 1.0/0.78 1.3/1.3 p.Pro1380Leu 38 10 15 23 1.0/1.0 1.3/1.3 p.Ser1071Cysfs*1084 / p.Pro1380Leu 39 24 25 38 1.56/0.3 2.0/2.0 c.5461-10 T>C / c.5714&#fe;5 G>A 40 18 26 36 1.3/1.3 2.0/1.3 ND 41 32 33 45 0.48/0.48 1.0/1.0 ND 42 32 35 46 1.3/0.0 3.0/1.0 p.Cys54Tyr 43 30 35 45 0.48/0.48 2.0/1.3 ND 44 15 41 49 1.3/1.3 2.0/1.3 p.Asn965Ser 45 8 8 20 0.78/0.78 1.0/1.0 p.Thr1019Met 46 10 11 23 1.0/1.0 1.0/1.0 p.Thr1019Met 47 8 12 24 2.0/1.56 1.78/1.48 p.Cys2150Tyr 48 17 18 26 1.0/0.78 1.3/1.0 c.5461-10 T>C / p.Leu2027Phe 49 8 21 33 1.3/1.3 2.0/2.0 p.Asp574Aspfs*582 50 8 27 39 2.0/1.56 1.78/1.48 c.5461-10 T>C 51 24 31 43 1.18/1.18 1.08/1.3 p.Arg1640Trp / p.Leu2027Phe Continued on next page respective electrophysiologic traces appear in Figure 2.
X
ABCA4 p.Cys1490Tyr 23499370:89:653
status: NEW[hide] Stargardt disease: towards developing a model to p... Eur J Hum Genet. 2013 Oct;21(10):1173-6. doi: 10.1038/ejhg.2013.92. Epub 2013 May 22. Heathfield L, Lacerda M, Nossek C, Roberts L, Ramesar RS
Stargardt disease: towards developing a model to predict phenotype.
Eur J Hum Genet. 2013 Oct;21(10):1173-6. doi: 10.1038/ejhg.2013.92. Epub 2013 May 22., [PMID:23695285]
Abstract [show]
Stargardt disease is an ABCA4-associated retinopathy, which generally follows an autosomal recessive inheritance pattern and is a frequent cause of macular degeneration in childhood. ABCA4 displays significant allelic heterogeneity whereby different mutations can cause retinal diseases with varying severity and age of onset. A genotype-phenotype model has been proposed linking ABCA4 mutations, purported ABCA4 functional protein activity and severity of disease, as measured by degree of visual loss and the age of onset. It has, however, been difficult to verify this model statistically in observational studies, as the number of individuals sharing any particular mutation combination is typically low. Seven founder mutations have been identified in a large number of Caucasian Afrikaner patients in South Africa, making it possible to test the genotype-phenotype model. A generalised linear model was developed to predict and assess the relative pathogenic contribution of the seven mutations to the age of onset of Stargardt disease. It is shown that the pathogenicity of an individual mutation can differ significantly depending on the genetic context in which it occurs. The results reported here may be used to identify suitable candidates for inclusion in clinical trials, as well as guide the genetic counselling of affected individuals and families.
Comments [show]
None has been submitted yet.
No. Sentence Comment
13 This study considers a South African cohort of 118 individuals who express biallelic combinations of seven founder mutations in ABCA4 (c.454C4T (p.Arg152*), c.768G4T (p.Val256Val), c.1804C4T (p.Arg602Trp), c.2588G4C (p.Gly863Ala), c.4469G4A (p.Cys1490Tyr), c.5461-10T4C, c.6079C4T (p.Leu2027Phe)), which collectively account for 36% of STGD cases studied to date in South Africa.19,20 These data, together with clinical information for each patient, were used to test the genotype-phenotype model.
X
ABCA4 p.Cys1490Tyr 23695285:13:244
status: NEW27 The c.4469G4A (p.Cys1490Tyr) mutation, in combination with either itself or another mutation, was the most common, as it was detected in 64 of the 118 patient samples (54%).
X
ABCA4 p.Cys1490Tyr 23695285:27:17
status: NEW30 To illustrate the utility of this model, consider the population of individuals expressing the mutation pair c.4469G4A (p.Cys1490Tyr) and c.1804C4T (p.Arg602Trp).
X
ABCA4 p.Cys1490Tyr 23695285:30:122
status: NEW31 The average AOO for this group of individuals is predicted as (0.0460 &#fe; 0.0528&#fe; 0.04680.0295)1 &#bc; 8.61 years, where 0.0460 is the intercept term, 0.0528 is the regression coefficient for c.4469G4A (p.Cys1490Tyr), 0.0468 is the regression coefficient for c.1804C4T (p.Arg602Trp) and 0.0295 is the regression coefficient for c.4469G4A (p.Cys1490Tyr): c.1804C4T (p.Arg602Trp).
X
ABCA4 p.Cys1490Tyr 23695285:31:213
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:31:350
status: NEW33 Table 1 A summary of the 23 mutation combinations observed in 118 patients with STGD, showing the number of patients per combination and the average and median AOO (in years) per combination Mutation 1 Mutation 2 Number of patients Average AOO (years) Median AOO (years) c.5461-10T4C c.768G4T (p.Val256Val) 1 6 6 c.5461-10T4C c.5461-10T4C 2 6.5 6.5 c.1804C4T (p.Arg602Trp) c.768G4T (p.Val256Val) 3 6.7 6 c.5461-10T4C c.454C4T (p.Arg152*) 3 7 8 c.4469G4A (p.Cys1490Tyr) c.454C4T (p.Arg152*) 6 7.8 8 c.768G4T (p.Val256Val) c.454C4T (p.Arg152*) 4 8 9 c.768G4T (p.Val256Val) c.768G4T (p.Val256Val) 1 8 8 c.4469G4A (p.Cys1490Tyr) c.4469G4A (p.Cys1490Tyr) 9 8.1 8 c.6079C4T (p.Leu2027Phe) c.454 C4T (p.Arg152*) 7 8.2 7 c.4469G4A (p.Cys1490Tyr) c.1804C4T (p.Arg602Trp) 13 8.6 8 c.4469G4A (p.Cys1490Tyr) c.5461-10T4C 13 8.8 9 c.4469G4A (p.Cys1490Tyr) c.768G4T (p.Val256Val) 10 10.3 9 c.4469G4A (p.Cys1490Tyr) c.6079C4T (p.Leu2027Phe) 12 10.3 9.5 c.6079C4T (p.Leu2027Phe) c.5461-10T4C 3 11 10 c.1804C4T (p.Arg602Trp) c.5461-10T4C 1 11 11 (c.1804C4T (p.Arg602Trp) c.6079C4T (p.Leu2027Phe) 8 12 11 c.6079C4T (p.Leu2027Phe) c.768G4T (p.Val256Val) 6 12.5 13 c.768G4T (p.Val256Val) c.2588G4C (p.Gly863Ala) 3 16.7 18 c.1804C4T (p.Arg602Trp) c.2588G4C (p.Gly863Ala) 2 17.5 17.5 c.4469G4A (p.Cys1490Tyr) c.2588G4C (p.Gly863Ala) 4 18.5 19 c.5461-10T4C c.2588G4C (p.Gly863Ala) 1 20 20 c.6079C4T (p.Leu2027Phe) c.6079C4T (p.Leu2027Phe) 2 28 28 c.2588G4C (p.Gly863Ala) c.454C4T (p.Arg152*) 4 28 30 In some cases, the average AOO of a given mutation differed significantly depending on the mutational context in which it occurred.
X
ABCA4 p.Cys1490Tyr 23695285:33:457
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:33:613
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:33:638
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:33:726
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:33:784
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:33:831
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:33:889
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:33:1275
status: NEW35 For example, the average AOO is significantly lower among individuals who are homozygous for the Cys1490Tyr mutation compared to individuals who express a single Cys1490Tyr mutation and the Leu2027Phe mutation.
X
ABCA4 p.Cys1490Tyr 23695285:35:97
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:35:162
status: NEW45 Table 2 Covariates included in the generalised linear model (with inverse link function) with their respective coefficients, standard errors and P-values Covariate Coefficient Standard error P-value (Intercept) 0.0460 0.0106 3.53e 05 c.4469G4A (p.Cys1490Tyr) 0.0528 0.0076 2.71e 10 c.1804C4T (p.Arg602Trp) 0.0468 0.0085 2.33e 07 c.6079C4T (p.Leu2027Phe) 0.0090 0.0089 0.3117 c.5461-10T4C 0.0562 0.0106 6.59e 07 c.768G4T (p.Val256Val) 0.0507 0.0083 2.06e 08 c.2588G4C (p.Gly863Ala) 0.0413 0.0081 1.58e 06 c.454C4T (p.Arg152*) 0.0311 0.0080 0.0002 c.4469G4A (p.Cys1490Tyr) (homozygous) 0.0336 0.0144 0.0214 c.4469G4A (p.Cys1490Tyr): c.5461-10T4C 0.0419 0.0146 0.0049 c.4469G4A (p.Cys1490Tyr): c.1804C4T (p.Arg602Trp) 0.0295 0.0145 0.0442 c.4469G4A (p.Cys1490Tyr): c.768G4T (p.Val256Val) 0.0520 0.0134 0.0002 c.6079C4T (p.Leu2027Phe): c.454C4T (p.Arg152*) 0.0519 0.0158 0.0013 Figure 1 Graph depicting the actual and predicted average AOO with 95% confidence bands for each mutation combination observed in five or more patients.
X
ABCA4 p.Cys1490Tyr 23695285:45:248
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:45:567
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:45:626
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:45:687
status: NEWX
ABCA4 p.Cys1490Tyr 23695285:45:759
status: NEW50 For example, consider again the population of individuals expressing the mutation combination c.4469G4A (p.Cys1490Tyr) and c.1804C4T (p.Arg602Trp).
X
ABCA4 p.Cys1490Tyr 23695285:50:107
status: NEW52 However, if the regression coefficient for c.4469G4A (p.Cys1490Tyr):c.1804C4T (p.Arg602Trp) ( 0.0295) was not included, ie, (0.0460 &#fe; 0.0528 &#fe; 0.0468)1 &#bc; 6.868, the predicted average AOO would be an underestimation of the true value.
X
ABCA4 p.Cys1490Tyr 23695285:52:56
status: NEW[hide] Clinical and molecular analysis of Stargardt disea... Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003. Fujinami K, Sergouniotis PI, Davidson AE, Wright G, Chana RK, Tsunoda K, Tsubota K, Egan CA, Robson AG, Moore AT, Holder GE, Michaelides M, Webster AR
Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function.
Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003., [PMID:23953153]
Abstract [show]
PURPOSE: To describe a cohort of patients with Stargardt disease who show a foveal-sparing phenotype. DESIGN: Retrospective case series. METHODS: The foveal-sparing phenotype was defined as foveal preservation on autofluorescence imaging, despite a retinopathy otherwise consistent with Stargardt disease. Forty such individuals were ascertained and a full ophthalmic examination was undertaken. Following mutation screening of ABCA4, the molecular findings were compared with those of patients with Stargardt disease but no foveal sparing. RESULTS: The median age of onset and age at examination of 40 patients with the foveal-sparing phenotype were 43.5 and 46.5 years. The median logMAR visual acuity was 0.18. Twenty-two patients (22/40, 55%) had patchy parafoveal atrophy and flecks; 8 (20%) had numerous flecks at the posterior pole without atrophy; 7 (17.5%) had mottled retinal pigment epithelial changes; 2 (5%) had multiple atrophic lesions, extending beyond the arcades; and 1 (2.5%) had a bull's-eye appearance. The median central foveal thickness assessed with spectral-domain optical coherence tomographic images was 183.0 mum (n = 33), with outer retinal tubulation observed in 15 (45%). Twenty-two of 33 subjects (67%) had electrophysiological evidence of macular dysfunction without generalized retinal dysfunction. Disease-causing variants were found in 31 patients (31/40, 78%). There was a higher prevalence of the variant p.Arg2030Gln in the cohort with foveal sparing compared to the group with foveal atrophy (6.45% vs 1.07%). CONCLUSIONS: The distinct clinical and molecular characteristics of patients with the foveal-sparing phenotype are described. The presence of 2 distinct phenotypes of Stargardt disease (foveal sparing and foveal atrophy) suggests that there may be more than 1 disease mechanism in ABCA4 retinopathy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
47 6089 G>A, p.Arg2030Gln/c.6118 C>T, p.Arg2040*] 8 39 44 0.1 0.1 4 297 230 U 3 A A NA NA [c.71 G>A, p.Arg24His/c.4577 C>T, p. Thr1526Met] 9 35* 35 0.18 0.18 2 142 154 3 ND ND NA NA [c.658 C>T, p.p.Arg220Cys/c.2588 G>C, p. Gly863Ala] 10 45 54 0.48 0.18 1 102 116 3 ND A NA NA [c.1957 C>T, p.Arg653Cys/c.5693 G>A, p.Arg1898His] 11 43 43 0.1 0 2 170 185 1 A A 2 2 [c.2588 G>C, p. Gly863Ala/c.4139 C>T, p.Ala1038Val] 12 36** 38 0.3 0 1 220 212 U 1 A A 1 1 [c.4139 C>T, p.Ala1038Val/c.4594 G>T, p.Asp1532Asn] 13 62 68 0.1 0.48 1 196 189 U 1 N N 2 2 [c.4222 T>C, p.Trp1408Arg/c.4918 C>T, p.Arg1640Trp] 14 36 44 0.48 0.48 3 79 89 1 A A NA NA [c.4222 T>C, p.Trp1408Arg/c.4918 C>T, p.Arg1640Trp] 15 46* 46 0.1 0.1 3 NA NA 1 A A NA NA [c.4469 G>A, p.Cys1490Tyr/c.
X
ABCA4 p.Cys1490Tyr 23953153:47:744
status: NEW127 2588G>C, p.Gly863Ala 4 Het Allikmets46 Intol. 0.01 PRD 0.996 No change 68/13006 db SNP (rs76157638) 21 c.3113C>T, p.Ala1038Val 1 Het Webster53 Tol. NA Benign 0.014 Donor 43.5 70 New site (&#fe;61.72) 22/13006 db SNP (rs61751374) 24 c.3602T>G, p.Leu1201Arg 2 Het Lewis48 Tol. NA Benign 0.052 Donor 61.3 74 New site (&#fe;20.08) 416/13006 db SNP (rs61750126) 27 c.3898C>T, p.Arg1300* 1 Het Rivera49 NA NA ND 28 c.4139C>T, p.Pro1380Leu 2 Het Lewis48 Intol. 0.01 Benign 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4222 T>C, p.Trp1408Arg 2 Het Lewis48 Tol. NA PRD 0.845 No change ND dbSNP (rs61750135) 29 c.4319T>C, p.Phe1440Ser 1 Het Lewis48 Tol. NA PRD 0.744 No change ND dbSNP (rs61750141) 30 c.4469G>A, p.Cys1490Tyr 1 Het Webster53 Intol. 0.03 PRD 0.994 No change ND dbSNP (rs61751402) 31 c.4577C>T, p.Thr1526Met 1 Het Lewis48 Intol. 0.00 PRD 0.91 No change ND db SNP (rs61750152) 31 c.4594G>T, p.Asp1532Asn 3 Het Lewis48 Tol. NA PRD 0.853 No change ND 33 c.4685T>C, p.Ile1562Thr 1 Het Allikmets46 Tol. NA Benign 0.034 No change 18/13006 db SNP (rs1762111) 35 c.4956T>G, p.Tyr1652* 1 Het Fumagalli52 NA NA Acceptor 43 72 New site (&#fe;67.36) ND 35 c.4918C>T, p.Arg1640Trp 2 Het Rozet47 Intol. 0.00 PRD 1 No change ND dbSNP (rs61751404) 35 c.4926C>G, p.Ser1642Arg 1 Het Birch50 Tol. 0.68 Benign 0.116 No change ND db SNP (rs61753017) Int 35 c.5018&#fe;2T>C, Splice site 1 Het Fumagalli52 NA NA Donor 81.2 54 WT site broken (33.07) ND Int 38 c.5461-10T>C 3 Het Briggs50 NA NA No change 3/13006 db SNP (rs1800728) 40 c.5693G>A, p.Arg1898His 2 Het Allikmets46 NA Benign 0.00 No change 25/13006 db SNP (rs1800552) 42 c.5882G>A, p.Gly1961Glu 1 Het Allikmets46 Tol. 0.18 PRD 1 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T, p.Leu2027Phe 4 Homo Lewis48 Intol. 0.02 PRD 0.999 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A, p.Arg2030Gln 4 Het Lewis48 Tol. NA PRD 0.995 No change 8/13006 db SNP (rs61750641) 44 c.6118C>T, p.Arg2040* 1 Het Rosenberg54 NA NA ND 46 c.6320G>A, p.Arg2107His 1 Het Fishman8 Intol. 0.00 PRD 0.996 No change 91/13006 db SNP (rs62642564) EVS &#bc; Exome Variant Server; HSF &#bc; Human Splicing Finder program; Hum var score &#bc; Human var score; Int &#bc; intron; Intol &#bc; intolerant; Mt CV &#bc; mutant consensus value; NA &#bc; not applicable; ND &#bc; not detected; PRD &#bc; probably damaging; Pred. &#bc; prediction; SIFT &#bc; Sorting Intolerant from Tolerance program; Tol. &#bc; tolerant; Wt CV &#bc; wild-type consensus value.
X
ABCA4 p.Cys1490Tyr 23953153:127:709
status: NEW141 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency 2 c.71G>A, p.Arg24His 1 0.36% 2 c.161G>A, p.Cys54Tyr 3 1.07% 3 c.223T>G, p.Cys75Gly 1 0.36% 5 c.455G>A, p.Arg152Gln 1 0.36% 5 c.454C>T, p.Arg152* 1 0.36% 5 c.466 A>G, p.Ile156Val 2 0.71% 6 c.634C>T, p. Arg212Cys 3 1.07% 6 c.656G>C, p.Arg219Thr 1 0.36% 6 c.666_678delAAAGACGGTGCGC, p.Lys223_Arg226delfs 2 0.71% 6 c.768G>T, Splicing site 4 1.42% 8 c.1037A>C, p.Lys346Thr 1 0.36% 10 c.1222C>T, p.Arg408* 3 1.07% 12 c.1622T>C, p.Leu541Pro 2 0.71% 12 c.1648 G>T, p.Gly550* 1 0.36% 13 c.1804C>T, p.Arg602Trp 1 0.36% 13 c.1817G>A, p.Gly606Asp 1 0.36% 13 c.1922G>C, p.Cys641Ser 1 0.36% Int 13 c.1937&#fe;1G>A, Splicing site 2 0.71% 14 c.1957C>T, p.Arg653Cys 2 0.71% 17 c.2588G>C, p.Gly863Ala 19 6.79% 18 c.2701A>G, p.Thr901Ala 1 0.36% 19 c.2791G>A, p.Val931Met 2 0.71% 19 c.2894A>G, p.Asn965Ser 1 0.36% 20 c.2966T>C, p.Vla989Ala 3 1.07% 20 c.2971G>C, p.Gly991Arg 2 0.71% 21 c.3056C>T, p.Thr1019Met 1 0.36% 21 c.3113C>T, p.Ala1038Val 3 1.07% 21 c.3064G>A, p.Glu1022Lys 2 0.71% 22 c.3211_3212insGT, p.Ser1071Cysfs 6 2.14% 22 c.3259G>A, p.Glu1087Lys 4 1.43% 22 c.3292C>T, p.Arg1098Cys 1 0.36% 22 c.3322C>T, p.Arg1108Cys 5 1.79% 22 c.3323G>A, p.Arg1108His 1 0.36% 23 c.3364G>A, p.Glu1122Lys 1 0.36% 23 c.3386G>A, p.Arg1129His 1 0.36% 24 c.3602T>G, p.Leu1201Arg 3 1.07% 27 c.3898C>T, p.Arg1300* 2 0.71% 28 c.4139C>T, p.Pro1380Leu 14 5.00% 28 c.4222T>C, p.Trp1408Arg 1 0.36% 28 c.4234C>T, p.Gly1412* 1 0.36% 28 c.4253&#fe;5G>T, Splice site 1 0.36% 28 c.4253&#fe;4C>T, Splice site 1 0.36% 29 c.4283C>T, p.Thr1428Met 1 0.36% 29 c.4319T>C, p.Phe1440Ser 1 0.36% 29 c.4462T>C, p.Cys1488Arg 1 0.36% 30 c.4469G>A, p.Cys1490Tyr 5 1.79% 30 c.4537_4538insC, p.Gly1513Profs 1 0.36% 31 c.4577C>T, p.Thr1526Met 2 0.71% 33 c.4715C>T, p.Thr1572Met 1 0.36% Continued on next page TABLE 3.
X
ABCA4 p.Cys1490Tyr 23953153:141:1868
status: NEW[hide] ABCA4 gene screening by next-generation sequencing... Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570. Fujinami K, Zernant J, Chana RK, Wright GA, Tsunoda K, Ozawa Y, Tsubota K, Webster AR, Moore AT, Allikmets R, Michaelides M
ABCA4 gene screening by next-generation sequencing in a British cohort.
Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570., [PMID:23982839]
Abstract [show]
PURPOSE: We applied a recently reported next-generation sequencing (NGS) strategy for screening the ABCA4 gene in a British cohort with ABCA4-associated disease and report novel mutations. METHODS: We identified 79 patients with a clinical diagnosis of ABCA4-associated disease who had a single variant identified by the ABCA4 microarray. Comprehensive phenotypic data were obtained, and the NGS strategy was applied to identify the second allele by means of sequencing the entire coding region and adjacent intronic sequences of the ABCA4 gene. Identified variants were confirmed by Sanger sequencing and assessed for pathogenicity by in silico analysis. RESULTS: Of the 42 variants detected by prescreening with the microarray, in silico analysis suggested that 34, found in 66 subjects, were disease-causing and 8, found in 13 subjects, were benign variants. We detected 42 variants by NGS, of which 39 were classified as disease-causing. Of these 39 variants, 31 were novel, including 16 missense, 7 splice-site-altering, 4 nonsense, 1 in-frame deletion, and 3 frameshift variants. Two or more disease-causing variants were confirmed in 37 (47%) of 79 patients, one disease-causing variant in 36 (46%) subjects, and no disease-causing variant in 6 (7%) individuals. CONCLUSIONS: Application of the NGS platform for ABCA4 screening enabled detection of the second disease-associated allele in approximately half of the patients in a British cohort where one mutation had been detected with the arrayed primer extension (APEX) array. The time- and cost-efficient NGS strategy is useful in screening large cohorts, which will be increasingly valuable with the advent of ABCA4-directed therapies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 1 c.161G>A p.C54Y DC c.2297G>T p.G766V DC 2 2 c.223T>G p.C75G DC c.5088C>G p.S1696R DC 2 3 c.740A>C p.N247T DC c.1433T>C p.I478T B c.2345G>A p.W782* DC 2 4 c.768G>T Splice site DC 1 5 c.1222C>T p.R408* DC c.2568C>A p.Y856* DC 2 6 c.1804C>T p.R602W DC c.859-9T>C Splice site PDC 2 7 c.1805G>A p.R602Q DC c.5113C>T p.R1705W DC 2 8 c.1922G>C p.C641S DC 1 9 c.1957C>T p.R653C DC 1 10 c.1957C>T p.R653C DC 1 11 c.2588G>C p.G863A DC c.655A>T p.R219* DC 2 Allele 2 (p.R219*) was APEX-false-negative 12 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 13 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 14 c.2588G>C p.G863A DC 1 15 c.2588G>C p.G863A DC 1 16 c.2894A>G p.N965S DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 17 c.3064G>A p.E1022K DC c.6729&#fe;4_&#fe;18delAGTTGGCCCTGGGGC Splice site DC 2 18 c.3064G>A p.E1022K DC 1 19 c.3208_3209insGT p.S1071fs DC c.2942C>T p.P981L DC c.6529G>A p.D2177N B 2 20 c.3208_3209insGT p.S1071fs DC c.1519G>T p.D507Y DC 2 21 c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 2 22 c.3208_3209insGT p.S1071fs DC 1 23 c.3292C>T p.R1098C DC c.3299T>A p.I1100N DC 2 24 c.3322C>T p.R1108C DC c.4978delC p.L1661* DC 2 25 c.3386G>A p.R1129H DC c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 3 Allele 2 (p.S1071fs) was APEX false-negative and allele 1 (p.R1129H) was NGS false-negative 26 c.4139C>T p.P1380L DC c.3191-1G>T Splice site DC 2 27 c.4139C>T p.P1380L DC c.3398T>C p.I1133T PDC 2 28 c.4139C>T p.P1380L DC c.4070C>A p.A1357E DC 2 29 c.4139C>T p.P1380L DC c.4773G>C Splice site DC 2 30 c.4139C>T p.P1380L DC 1 31 c.4139C>T p.P1380L DC 1 32 c.4139C>T p.P1380L DC 1 33 c.4234C>T p.Q1412* DC 1 34 c.4319T>C p.F1440S DC 1 35 c.4328G>A p.R1443H DC c.180delG p.M61fs DC 2 36 c.4469G>A p.C1490Y DC c.1726G>C p.D576H DC 2 37 c.4469G>A p.C1490Y DC 1 38 c.4537_4538insC p.Q1513fs DC c.5578C>T p.R1860W DC 2 Allele 1 (p.Q1513fs) was NGS-false-negative 39 c.4577C>T p.T1526M DC 1 T ABLE 2. Continued Pt Allele 1 Detected by APEX Allele 2 Detected by NGS Allele 3 Detected by NGS Total N of DC Variants Comments DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho.
X
ABCA4 p.Cys1490Tyr 23982839:55:1736
status: NEWX
ABCA4 p.Cys1490Tyr 23982839:55:1784
status: NEW62 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 3 c.161G>A p.C54Y 1 1 [ [ Lewis RA, et al. 11 Tol. 0.11 PRD 0.994 No change 1/13006 db SNP (rs150774447) 3 c.223T>G p.C75G 1 2 [ [ Lewis RA, et al. 11 Del. NA POD 0.603 No change ND 5 c.466A>G p.I156V 2 77, 78 [ [ Papaioannou M, et al. 16 Tol. 0.46 B 0.003 No change 16/13006 db SNP (rs112467008) Benign 6 c.655A>T p.R219* 1 11 [ Xi Q, et al. 27 ND 6 c.740A>C p.N247T 1 3 [ [ APEX Del. NA B 0.135 No change ND 6 c.768G>T Splice site 1 4 [ [ Klevering BJ, et al. 22 Tol. 0.56 NA Don. 70.4 58 Site broken (17.51) ND 9 c.1222C>T p.R408* 1 5 [ [ Webster AR, et al. 7 ND 12 c.1726G>C p.D576H 1 36 [ Downs K, et al. 25 POD 0.688 Acc. 68.1 39.1 Site broken (42.54) 1/13006 13 c.1804C>T p.R602W 1 6 [ [ Lewis RA, et al. 11 Del. 0.00 B 0.129 No change ND db SNP (rs 6179409) 13 c.1805G>A p.R602Q 1 7 [ [ Webster AR, et al. 7 Del. 0.04 PRD 0.513 Acc. 48.9 77.9 New site (&#fe;59.14) 2/13006 db SNP (rs61749410) 13 c.1906C>T p.Q636* 3 12, 13, 60 [ Zernant J, et al. 5 No change 1/13006 db SNP (rs145961131) 13 c.1922G>C p.C641S 1 8 [ [ Stenirri S, et al. 24 Del. 0.00 No change ND db SNP (rs61749416) 14 c.1957C>T p.R653C 2 9, 10 [ [ Rivera A, et al. 17 Del. 0.00 PRD 0.999 No change ND db SNP (rs61749420) 17 c.2588G>C p.G863A/ p.DelG863 5 11, 12, 13, 14, 15 [ [ Lewis RA, et al. 11 / Maugeri A, et al. 29 Del. 0.00 PRD 0.996 No change 68/13006 db SNP (rs76157638) 18 c.2701A>G p.T901A 1 74 [ [ APEX Tol. 0.82 B 0.008 23/13006 db SNP (rs139655975) Benign 19 c.2894A>G p.N965S 1 16 [ [ Lewis RA, et al. 11 Del. 0.03 PRD 0.981 Acc. 53.4 82.3 New site (&#fe;54.26) ND db SNP (rs201471607) 20 c.2971G>C p.G991R 1 67 [ [ Yatsenko AN, et al. 13 Del. 0.02 PRD 0.999 No change 28/13006 db SNP (rs147484266) Benign 22 c.3064G>A p.E1022K 2 17, 18 [ [ Webster AR, et al. 7 Del. 0.00 PRD 1.000 No change ND db SNP (rs61749459) 22 c.3208_3209insGT p.S1071fs 5 19, 20, 21, 22, 25 [ [ APEX ND False-negative in APEX in patient 25 22 c.3292C>T p.R1098C 1 23 [ [ Rivera A, et al. 17 Del. NA PRD 0.999 No change ND 22 c.3322C>T p.R1108C 3 16, 24, 61 [ [ Rozet JM, et al. 10 Del. 0.00 PRD 0.986 No change 1/13006 db SNP (rs61750120) False-negative in APEX in patients 16 and 61 23 c.3386G>A p.R1129H 1 25 [ Zernant J, et al. 5 PRD 0.989 No change ND False-negative in NGS in patient 25 24 c.3602T>G p.L1201R 4 72, 73, 74, 79 [ [ Lewis RA, et al. 11 Tol. 0.37 B 0.052 Don. 61.3 73.7 New site (20.08) 416/13006 db SNP (rs61750126) Benign 28 c.4139C>T p.P1380L 7 30, 31, 32, 33, 34, 35, 36 [ [ Lewis RA, et al. 11 Del. 0.01 B 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4234C>T p.Q1412* 1 33 [ [ Rivera A, et al. 17 ND db SNP (rs61750137) 29 c.4283C>T p.T1428M 1 76 [ [ APEX Tol. 0.15 B 0.010 No change 2/13006 db SNP (rs1800549) Benign 29 c.4319T>C p.F1440S 1 34 [ [ Lewis RA, et al. 11 Del. 0.00 POD 0.744 No change ND dbSNP (rs61750141) 29 c.4326C>A p.N1442K 1 64 [ Zernant J, et al. 5 Tol. NA POD 0.374 No change ND 29 c.4328G>A p.R1443H 1 35 [ [ Rivera A, et al. 17 Del. 0.02 PRD 0.999 No change 1/13006 dbSNP (rs61750142) IVS29 c.4352&#fe;1G>A Splice site 1 73 [ Zernant J, et al. 5 Don. 82.3 55.4 WT site broken (32.62) ND 30 c.4469G>A p.C1490Y 2 36, 37 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.994 No change ND dbSNP (rs61751402) 30 c.4538A>G p.Q1513R 1 67 [ Webster AR, et al. 7 Tol. NA Benign 0.043 Acc. 91.7 62.8 Site broken (31.55) ND T ABLE 3. Continued Exon/ IVS Nucleotide Substitution Protein Change/ Effect N of Alleles Identified Pt Method Previous Report SIFT Polyphen 2 HSF Matrix Allele Freq. by EVS Reference Comment APEX NGS Pred. Tol. Index (0-1) Pred.
X
ABCA4 p.Cys1490Tyr 23982839:62:3173
status: NEW[hide] Identification of three ABCA4 sequence variations ... Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4. Utz VM, Chappelow AV, Marino MJ, Beight CD, Sturgill-Short GM, Pauer GJ, Crowe S, Hagstrom SA, Traboulsi EI
Identification of three ABCA4 sequence variations exclusive to African American patients in a cohort of patients with Stargardt disease.
Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4., [PMID:24011517]
Abstract [show]
PURPOSE: To describe the clinical and molecular findings in ten unrelated African American patients with Stargardt disease. DESIGN: Retrospective, observational case series. METHODS: We reviewed the clinical histories, examinations, and genotypes of 85 patients with molecular diagnoses of Stargardt disease. Three ABCA4 sequence variations identified exclusively in African Americans were evaluated in 300 African American controls and by in silico analysis. RESULTS: ABCA4 sequence changes were identified in 85 patients from 80 families, of which 11 patients identified themselves as African American. Of these 11 patients, 10 unrelated patients shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). The minor allele frequencies in the African American control population for each variation were 7.5%, 6.3%, and 2%, respectively. This is comparable to the allele frequency in African Americans in the Exome Variant Server. In contrast, the allele frequency of all three of these variations was less than or equal to 0.05% in European Americans. Although both c.3602T>G and c.3899G>A have been reported as likely disease-causing variations, one of our control patients was homozygous for each variant, suggesting that these are nonpathogenic. In contrast, the absence of c.6320G>A in the control population in the homozygous state, combined with the results of bioinformatics analysis, support its pathogenicity. CONCLUSIONS: Three ABCA4 sequence variations were identified exclusively in 10 unrelated African American patients: p.L1201R and p.R1300Q likely represent nonpathogenic sequence variants, whereas the p.R2107H substitution appears to be pathogenic. Characterization of population-specific disease alleles may have important implications for the development of genetic screening algorithms.
Comments [show]
None has been submitted yet.
No. Sentence Comment
121 Population-Specific ABCA4 Alleles in Patients with Stargardt Disease References Population Allele Protein Rivera et al.28 Hargitai et al.12 Hungaro-German c.1622T>C/c.3113C>T p.L541P/p.A1038V September et al.47 Afrikaner c.4469G>A p.C1490Y September et al.47 Afrikaner c.1804C>T p.R602W Rosenberg et al.48 Danish c.2894A>G p.N965S Maugeri et al.27 Western European c.2588G>C p.G863A Maia-Lopes et al.49 Portuguese c.32T>C p.L11P Valverde et al.29 Spanish c.5882G>A p.R1129L Fumagalli et al.50 Italian c.2099G>A p.W700X VOL. 156, NO. 6 ALL AUTHORS HAVE COMPLETED AND SUBMITTED THE ICMJE FORM FOR DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST, and the following were reported.
X
ABCA4 p.Cys1490Tyr 24011517:121:233
status: NEW[hide] Inner and outer retinal changes in retinal degener... Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768. Huang WC, Cideciyan AV, Roman AJ, Sumaroka A, Sheplock R, Schwartz SB, Stone EM, Jacobson SG
Inner and outer retinal changes in retinal degenerations associated with ABCA4 mutations.
Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768., [PMID:24550365]
Abstract [show]
PURPOSE: To investigate in vivo inner and outer retinal microstructure and effects of structural abnormalities on visual function in patients with retinal degeneration caused by ABCA4 mutations (ABCA4-RD). METHODS: Patients with ABCA4-RD (n = 45; age range, 9-71 years) were studied by spectral-domain optical coherence tomography (OCT) scans extending from the fovea to 30 degrees eccentricity along horizontal and vertical meridians. Thicknesses of outer and inner retinal laminae were analyzed. Serial OCT measurements available over a mean period of 4 years (range, 2-8 years) allowed examination of the progression of outer and inner retinal changes. A subset of patients had dark-adapted chromatic static threshold perimetry. RESULTS: There was a spectrum of photoreceptor layer thickness changes from localized central retinal abnormalities to extensive thinning across central and near midperipheral retina. The inner retina also showed changes. There was thickening of the inner nuclear layer (INL) that was mainly associated with regions of photoreceptor loss. Serial data documented only limited change in some patients while others showed an increase in outer nuclear layer (ONL) thinning accompanied by increased INL thickening in some regions imaged. Visual function in regions both with and without INL thickening was describable with a previously defined model based on photoreceptor quantum catch. CONCLUSIONS: Inner retinal laminar abnormalities, as in other human photoreceptor diseases, can be a feature of ABCA4-RD. These changes are likely due to the retinal remodeling that accompanies photoreceptor loss. Rod photoreceptor-mediated visual loss in retinal regionswith inner laminopathy at the stages studied did not exceed the prediction from photoreceptor loss alone.
Comments [show]
None has been submitted yet.
No. Sentence Comment
74 Characteristics of the ABCA4-Related Retinal Disease Patients Patient Age at Visits, y Sex Allele 1 Allele 2 Previous Report*ߤ P1 9, 12 M E341G F608I P2 9, 15 M R681X C2150Y P28* P3ߥ 12 M N965S W821R P1ߤ P4 13, 16 M V256V T1526M P21*, P15ߤ P5 14, 20 F W1408R IVS40&#fe;5 G>A P49* P6ߥ 16 F V989A IVS28&#fe;5 G>T P17ߤ P7ߥ 16 M N965S W821R P18ߤ P8 18, 20 F Y362X IVS38-10 T>C P9ߥ 18 F V989A IVS28&#fe;5 G>T P10 18, 22 M G1961E R1129L P3ߤ P11 20 M R1640Q c.5174_5175insG P12ߥ 20 M G1961E G1961E/P68L P13 22, 25 M G863A IVS35&#fe;2 T>C P20ߤ P14 22, 24 F G1961E R152X P12*, P21ߤ P15ߥ 23 M G1961E G1961E/P68L P16 25, 27 M G1961E R152X P11* P17 26, 32 F L1940P R1129L P64* P18 27, 34 F R1925G A1038V/L541P P19 27, 29 M c.4530_4531insC R1705Q P52*, P5ߤ P20 28, 30 F G1961E A1038V/L541P P23ߤ P21 31, 35 M T1019M G1961E P34* P22ߥ 32, 37 M P1486L Deletion of exon 7 P25ߤ P23 33, 35 M G863A R1108C P29*, P6ߤ P24 34, 37 F IVS40&#fe;5 G>A V935A P32*, P7ߤ P25 34 M G1961E &#a7; P8ߤ P26 37, 43 F C54Y G863A P4* P27 39, 44 F G863A C1490Y P30*, P26ߤ P28 40 M G1961E C54Y P7*, P10ߤ P29 41 F IVS38-10 T>C E1087D P59* P30ߥ 43, 47 F G1961E V256V P23*, P11ߤ P31ߥ 47, 51 F P1486L Deletion of exon 7 P32 47 M Y245X Y245X P20* P33ߥ 48, 51 F G1961E V256V P22*, P12ߤ P34 48, 50 F c.3208_3209insTG IVS40&#fe;5 G>A P35 50, 54 M V1433I L2027F P50* P36ߥ 52, 55 F T1526M R2030Q P55*, P28ߤ P37 53, 59 F G1961E P1380L P47*, P13ߤ P38ߥ 53, 61 M L1940P IVS40&#fe;5 G>A P61* P39 58 M D600E R18W P2*, P14ߤ P40 59, 62 M E1122K G1961E P44* P41 59, 62 F R1640Q G1961E P58* P42ߥ 62 F T1526M R2030Q P54* P43ߥ 64, 68 M L1940P IVS40&#fe;5 G>A P62* P44 68 F R1108C IVS40&#fe;5 G>A P42* P45 71 F IVS38-10 T>C &#a7; Novel variants are bold and italicized.
X
ABCA4 p.Cys1490Tyr 24550365:74:1139
status: NEW[hide] Generalized choriocapillaris dystrophy, a distinct... Invest Ophthalmol Vis Sci. 2014 Apr 29;55(4):2766-76. doi: 10.1167/iovs.13-13391. Bertelsen M, Zernant J, Larsen M, Duno M, Allikmets R, Rosenberg T
Generalized choriocapillaris dystrophy, a distinct phenotype in the spectrum of ABCA4-associated retinopathies.
Invest Ophthalmol Vis Sci. 2014 Apr 29;55(4):2766-76. doi: 10.1167/iovs.13-13391., [PMID:24713488]
Abstract [show]
PURPOSE: We describe a particular form of autosomal recessive generalized choriocapillaris dystrophy phenotype associated with ABCA4 mutations. METHODS: A cohort of 30 patients with identified ABCA4 mutations and a distinct phenotype was studied. A retrospective review of history, fundus photographs, electroretinography, visual field testing, dark adaptometry, and optical coherence tomography was performed. Genetic analyses were performed by ABCA4 microarray analysis, high resolution melting, and/or next generation sequencing of all protein-coding sequences of the ABCA4 gene. RESULTS: The earliest recorded manifestation of ABCA4-associated disease was a central bull's eye type of macular dystrophy that progressed to chorioretinal atrophy of the macula with coarse rounded hyperpigmentations and expanding involvement of the periphery. The mean age at first presentation was 10.3 years, the longest follow-up was 61 years. All patients had two ABCA4 mutations identified, confirming the molecular genetic diagnosis of an ABCA4-associated disease. Most patients harbored at least one mutation classified as "severe," the most common of which was the p.N965S variant that had been found previously at a high frequency among patients with ABCA4-associated retinal dystrophies in Denmark. CONCLUSIONS: Generalized choriocapillaris dystrophy is a progressive ABCA4-associated phenotype characterized by early-onset macular dystrophy that disperses and expands to widespread end-stage chorioretinal atrophy with profound visual loss. All cases in this study were confirmed as harboring two ABCA4 mutations. Most of the ABCA4 mutations were classified as "severe" explaining the early onset, panretinal degeneration, and fast progression of the disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
123 Summary of Detected Potential Pathogenic Variants (Known and Novel [in Bold Face]) Found in the ABCA4 Gene of Patients With Generalized Choriocapillaris Dystrophy Patient Method Mutation 1 Mutation 2 Nucleotide Protein Nucleotide Protein D513 NGS c.203C>T p.P68L c.2894A>G p.N965S D514 Microarray, NGS c.2894A>G p.N965S c.5461-10T>C - D516 NGS c.4926C>G p.S1642R c.5041_5055del p.V1681_C1685del D517 NGS c.5169C>G p.Y1723* c.6079C>T p.L2027F D137 Microarray, NGS c.2894A>G p.N965S c.2894A>G p.N965S D801 Microarray, NGS c.6386&#fe;1G>A Aberrant splicing c.4234C>T p.Q1412* D109 Microarray c.2894A>G p.N965S c.4234C>T p.Q1412* D040 Microarray c.6229C>T p.R2077W c.6229C>T p.R2077W D159 Microarray c.3113C>T p.L541P/A1038V c.3113C>T p.L541P/A1038V D129 Microarray c.2894A>G p.N965S c.3322C>T p.R1108C D115 Microarray c.2894A>G p.N965S c.3113C>T p.L541P/A1038V D033 Microarray c.2894A>G p.N965S c.2041C>T p.R681* D023 Microarray c.203C>T p.P68L c.3329-2A>G Aberrant splicing D001 Microarray c.666_678del p.K223_R226delfs c.4667&#fe;2T>C Aberrant splicing D147 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D162 Microarray c.3329-2A>G Aberrant splicing c.6089G>A p.R2030Q D022 Microarray, HRM c.4462T>C p.C1488R c.4102C>T p.R1368C D112 Microarray, HRM c.2894A>G p.N965S c.1529T>G p.L510R D108 Microarray, HRM c.1648G>A p.G550R c.4102C>T p.R1368C D107 Microarray c.666_678del p.K223_R226delfs c.2588G>C p.G863A D070 Microarray c.2588G>C p.G863A c.2588G>C p.G863A D116 Microarray c.2300T>A p.V767D c.5461-10T>C - D135 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D117 Microarray, HRM c.3191-2A>G Aberrant splicing c.2408delG p.G803fs D186 Microarray, HRM c.3322C>T p.R1108C c.6386&#fe;1G>A Aberrant splicing D173 Microarray, HRM c.4469G>A p.C1490Y c.2915C>A p.T972N TABLE 3.
X
ABCA4 p.Cys1490Tyr 24713488:123:1752
status: NEW124 In Silico Analysis of ABCA4 Variants Detected in This Study Using Alamut 2.2 Software cDNA Variant Protein Variant Effect on Protein Function AGVGD Class SIFT Prediction Effect on Protein PPH2 Prediction Effect on Protein TASTER Prediction Effect on Splicing Missense variants c.203C>T p.P68L C65 Deleterious Probably damaging Disease causing c.1529T>G p.L510R C65 Deleterious Benign Polymorphism c.1622T>C p.L541P Reduced ATP binding mislocali- zation26,27 C65 Deleterious Probably damaging Disease causing c.1648G>A p.G550R C65 Deleterious Possibly damaging Disease causing New acceptor site c.2300T>A p.V767D Reduced protein28 C65 Deleterious Benign Disease causing c.2588G>C p.G863A Reduced protein level, reduced ATP binding, reduced ATPase activity26 C55 Deleterious Possibly damaging Disease causing Predicted change at acceptor site 1 bp upstream: 11.1%, creating a new stronger acceptor 3 bp downstream c.2894A>G p.N965S Reduced ATP binding26 C45 Deleterious Probably damaging Disease causing New acceptor site c.2915C>A p.T972N C55 Deleterious Probably damaging Disease causing c.3113C>T p.A1038V Reduced ATP binding, reduced ATP hydrolysis26 C65 Deleterious Benign Disease causing c.3322C>T p.R1108C Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing c.4102C>T p.R1368C C65 Deleterious Probably damaging Disease causing c.4462T>C p.C1488R C65 Deleterious Possibly damaging Disease causing c.4469G>A p.C1490Y Misfolding, mislocali- zation27 C65 Deleterious Probably damaging Disease causing Cryptic donor strongly activated c.4926C>G p.S1642R C25 Deleterious Benign Disease causing c.6079C>T p.L2027F Reduced ATP binding26,29 C15 Deleterious Probably damaging Disease causing c.6089G>A p.R2030Q C35 Deleterious Probably damaging Disease causing c.6229C>T p.R2077W Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing Deletion/frame-shift/stop variants c.666_678del p.K223_ R226delfs c.2041C>T p.R681* c.2408delG p.G803fs c.4234C>T p.Q1412* c.5041_5055del p.V1681_ C1685del c.5169C>G p.Y1723* Splicing affecting variants c.3191-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.3329-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.4667&#fe;2T>C Predicted change at donor site 2 bps upstream: 100% generalized choriocapillaris dystrophy have the occasional hallmarks of early Stargardt disease, such as vermillion fundus, fundus hyperautofluorescence, and a dark choroid on fluorescein angiograms.
X
ABCA4 p.Cys1490Tyr 24713488:124:1434
status: NEW[hide] Molecular diagnostic testing by eyeGENE: analysis ... Invest Ophthalmol Vis Sci. 2014 Jul 31;55(9):5510-21. doi: 10.1167/iovs.14-14359. Alapati A, Goetz K, Suk J, Navani M, Al-Tarouti A, Jayasundera T, Tumminia SJ, Lee P, Ayyagari R
Molecular diagnostic testing by eyeGENE: analysis of patients with hereditary retinal dystrophy phenotypes involving central vision loss.
Invest Ophthalmol Vis Sci. 2014 Jul 31;55(9):5510-21. doi: 10.1167/iovs.14-14359., [PMID:25082885]
Abstract [show]
PURPOSE: To analyze the genetic test results of probands referred to eyeGENE with a diagnosis of hereditary maculopathy. METHODS: Patients with Best macular dystrophy (BMD), Doyne honeycomb retinal dystrophy (DHRD), Sorsby fundus dystrophy (SFD), or late-onset retinal degeneration (LORD) were screened for mutations in BEST1, EFEMP1, TIMP3, and CTRP5, respectively. Patients with pattern dystrophy (PD) were screened for mutations in PRPH2, BEST1, ELOVL4, CTRP5, and ABCA4; patients with cone-rod dystrophy (CRD) were screened for mutations in CRX, ABCA4, PRPH2, ELOVL4, and the c.2513G>A p.Arg838His variant in GUCY2D. Mutation analysis was performed by dideoxy sequencing. Impact of novel variants was evaluated using the computational tool PolyPhen. RESULTS: Among the 213 unrelated patients, 38 had BMD, 26 DHRD, 74 PD, 8 SFD, 6 LORD, and 54 CRD; six had both PD and BMD, and one had no specific clinical diagnosis. BEST1 variants were identified in 25 BMD patients, five with novel variants of unknown significance (VUS). Among the five patients with VUS, one was diagnosed with both BMD and PD. A novel EFEMP1 variant was identified in one DHRD patient. TIMP3 novel variants were found in two SFD patients, PRPH2 variants in 14 PD patients, ABCA4 variants in four PD patients, and p.Arg838His GUCY2D mutation in six patients diagnosed with dominant CRD; one patient additionally had a CRX VUS. ABCA4 mutations were identified in 15 patients with recessive CRD. CONCLUSIONS: Of the 213 samples, 55 patients (26%) had known causative mutations, and 13 (6%) patients had a VUS that was possibly pathogenic. Overall, selective screening for mutations in BEST1, PRPH2, and ABCA4 would likely yield the highest success rate in identifying the genetic basis for macular dystrophy phenotypes. Because of the overlap in phenotypes between BMD and PD, it would be beneficial to screen genes associated with both diseases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
39 Mutations and Unknown Variants Detected in Patients With Central Vision Loss Patient Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Molecular Diagnosis Late-onset retinal degeneration NA CTRP5 NA NA NA NA NA NA Sorsby fundus dystrophy Patient 1 TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 Positive Patient 2 TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 Positive Patient 3 TIMP3 5 c.610A>T p.Ser204Cys Het Mut Positive Doyne honeycomb dystrophy Patient 1 EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut Positive Patient 2 EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut Positive Patient 3 EFEMP1 IVS10 c.IVS10-14C>T None Het vAR/us NA NA Unconfirmed Best macular dystrophy Patient 1 BEST1 2 c.28G>A p.Ala10Thr Het Mut Positive Patient 2 BEST1 2 c.47C>T p.Ser16Phe Het Mut Positive Patient 3 BEST1 2 c.72G>T p.Trp24Cys Het Mut Positive Patient 4 BEST1 3 c.240C>A p.Phe80Leu Het Mut Positive Patient 5 BEST1 3 c.240C>A p.Phe80Leu Het Mut Positive Patient 6 BEST1 4 c.248G>C p.Gly83Ala Het vAR/us Probably damaging 1 Positive Patient 7 BEST1 4 c.277T>C p.Trp93Arg Het vAR/us Probably damaging 1 Positive Patient 8 BEST1 4 c.279G>C p.Trp93Cys Het Mut Positive Patient 9 BEST1 6 c.652C>T p.Arg218Cys Het Mut Positive Patient 10 BEST1 6 c.652C>T p.Arg218Cys Het Mut Positive Patient 11 BEST1 6 c.680A>G p.Tyr227Cys Het Mut Positive Patient 12 BEST1 6 c.741G>A p.Arg218His Het Mut Positive Patient 13 BEST1 6 c.741G>A p.Arg218His Het Mut Positive Patient 14 BEST1 7 c.727G>A p.Ala243Thr Het Mut Positive Patient 15 BEST1 7 c.727G>A p.Ala243Thr Het Mut Positive Patient 16 BEST1 7 c.728C>T p.Ala243Val Het Mut Positive Patient 17 BEST1 7 c.728C>T p.Ala243Val Het Mut Positive Patient 18 BEST1 8 c.880C>T p.Leu294Phe Het vAR/us Probably damaging 1 Positive Patient 19 BEST1 8 c.887A>G p.Asn296Ser Het Mut Positive Patient 20 BEST1 8 c.903T>G p.Asp301Glu Het Mut Positive Patient 21 BEST1 8 c.903T>G p.Asp301Glu Het Mut Positive Patient 22 BEST1 8 c.910G>A p.Asp304Asn Het Mut Positive Patient 23 BEST1 8 c.925T>C p.Trp309Arg Het vAR/us Probably damaging 1 Positive Patient 24 BEST1 8 c.929T>C p.Ile310Thr Het Mut Positive Patient 25, case 3 BEST1 4 c.250T>G p.Phe84Val Het vAR/us Probably damaging 1 Positive Pattern dystrophy Patient 1 ABCA4 6 c.634C>T p.Arg212Cys Het Mut Positive ABCA4 30 c.4469G>A p.Cys1490Tyr Het Mut Patient 2 ABCA4 17 c.2588G>C p.Gly863Ala Het Mut Unconfirmed Patient 3 ABCA4 IVS26 c.3862&#fe;3A>G Abnormal splicing Het vAR/us Unconfirmed Patient 4 PRPH2 1 c.271T>A p.Tyr91Asn Het vAR/us Probably damaging 0.909 Positive PRPH2 1 c.310-313del(AT) p.Ile104Val Het Mut Patient 5, case 6 PRPH2 1 c.422A>G p.Tyr141Cys Het Mut Positive Patient 6 PRPH2 1 c.422A>G p.Tyr141Cys Het Mut Positive Patient 7 PRPH2 1 c.515G>A p.Arg172Gln Het Mut Positive Patient 8 PRPH2 2 c.583C>T p.Arg195Stop Het Mut Positive Patient 9 PRPH2 2 c.629C>G p.Pro210Arg Het Mut Positive Patient 10 PRPH2 2 c.635G>C p.Ser212Thr Het Mut Positive Patient 11 PRPH2 2 c.683C>T p.Thr228Ile Het Mut Positive Patient 12 PRPH2 2 c.708C>G p.Tyr236Stop Het Mut Positive Patient 13, case 4 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive TABLE 2. Continued Patient Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Molecular Diagnosis Patient 14 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 15 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 16 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 17, case 2 ABCA4 IVS38 c.5461-10T>C None Het Mut Unconfirmed Patient 18 PRPH2 2 c.584G>A p.Arg195Gln Het vAR/us Probably damaging 1 Positive Cone-rod dystrophy Patient 1, dominant GUCY2D 13 c.2512C>T p.Arg838Cys Het Mut Positive Patient 2, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 3, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 4, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 5, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive CRX 3 c.607T>C p.Ser213Pro Het vAR/us Probably damaging 0.999 Patient 6, recessive ABCA4 2 c.156T>G p.His52Gln Het vAR/us Probably damaging 0.998 Positive ABCA4 3 c.161G>A p.Cys54Tyr Het Mut ABCA4 28 c.4169T>C p.Leu1390Pro Het Mut Patient 7, recessive ABCA4 16 c.2385C>T p.Ser795Arg Het vAR/us Probably damaging 0.99 Positive ABCA4 IVS40 c.5714&#fe;5G>A Splice Het Mut Patient 8, recessive ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut Positive ABCA4 45 c.6221G>T p.Gly2074Val Het vAR/us Probably damaging 1 Patient 9, recessive ABCA4 IVS42 c.5898&#fe;1G<A Splice Het Mut Positive ABCA4 IVS42 c.5899-2delA Splice Het Mut Patient 10, recessive ABCA4 5 c.559C>T p.Arg187Cys Het Mut Positive ABCA4 40 c.5645T>C p.Met1882Thr Het Mut Patient 11, recessive ABCA4 6 c.768G>T p.Val256Val (abnlspl) Het Mut Positive ABCA4 31 c.4577C>T p.Thr1526Met Het Mut Patient 12, recessive ABCA4 12 c.1622T>C p.Leu541Pro Het Mut Positive ABCA4 21 c.3113C>T p.Ala1038Val Het Mut ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut ABCA4 22 c.3322C>T p.Arg1108Cys Het Mut Patient 13, recessive ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut Positive ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut Patient 14, recessive ABCA4 13 c.1927G>A p.Val643Met Het Mut Positive ABCA4 24 c.3602T>G p.Leu1201Arg Het Mut ABCA4 36 c.5186T>C p.Leu1729Pro Het Mut Patient 15, recessive ABCA4 23 c.3364G>A p.Glu1122Lys Het Mut Positive ABCA4 48 c.6529G>A p.Asp2177Asn Het Mut Patient 16, recessive ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut Positive ABCA4 28 c.4222T>C p.Trp1408Arg Het Mut Patient 17, recessive ABCA4 11 c.1532G>A p.Arg511His Het Mut Unconfirmed Patient 18, recessive ABCA4 27 c.3899G>A p.Arg1300Gln Het vAR/us Benign 0.143 Unconfirmed Patient 19, recessive ABCA4 13 c.1933G>A p.Asp645Asn Het Mut Unconfirmed Patient 20, recessive ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut Unconfirmed Patient 21, recessive ABCA4 IVS7 c.859-9T>C Unknown Hom vAR/us NA NA Unconfirmed Molecular Diagnostic Testing by eyeGENE IOVS j September 2014 j Vol. 55 j No. 9 j were screened for the p.Arg838His mutation in GUCY2D, and mutations in the CRX, ELOVL4, PRPH2, and/or ABCA4 genes.
X
ABCA4 p.Cys1490Tyr 25082885:39:2346
status: NEW116 Mutations or Unknown Variants Detected in Patients With Central Vision Loss Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Frequency* Variant ID Late-onset retinal degeneration CTRP5 NA NA NA NA NA NA NA NA NA Sorsby fundus dystrophy TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 2 TIMP3 5 c.610A>T p.Ser204Cys Het Mut 1 CM941325/ rs137853298 Doyne honeycomb dystrophy EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut 2 CM990504 EFEMP1 IVS10 c.IVS10-14C>T None Het vAR/us NA NA 1 Best macular dystrophy BEST1 2 c.28G>A p.Ala10Thr Het Mut 1 CM982017 BEST1 2 c.47C>T p.Ser16Phe Het Mut 1 CM010520 BEST1 2 c.72G>T p.Trp24Cys Het Mut 1 CM982018 BEST1 3 c.240C>A p.Phe80Leu Het Mut 2 CM004423 BEST1 4 c.248G>C p.Gly83Ala Het vAR/us Probably damaging 1 1 BEST1 4 c.277T>C p.Trp93Arg Het vAR/us Probably damaging 1 1 BEST1 4 c.279G>C p.Trp93Cys Het Mut 1 rs28940273/ CM982021 BEST1 6 c.652C>T p.Arg218Cys Het Mut 2 CM982023 BEST1 6 c.680A>G p.Tyr227Cys Het Mut 1 CM982024 BEST1 6 c.741G>A p.Arg218His Het Mut 2 CM003486 BEST1 7 c.727G>A p.Ala243Thr Het Mut 2 CM004434 BEST1 7 c.728C>T p.Ala243Val Het Mut 2 rs28940570/ CM00841 BEST1 8 c.880C>T p.Leu294Phe Het vAR/us Probably damaging 1 1 BEST1 8 c.887A>G p.Asn296Ser Het Mut 1 CM010524 BEST1 8 c.903T>G p.Asp301Glu Het Mut 2 CM991243 BEST1 8 c.910G>A p.Asp304Asn Het Mut 1 CM024219 BEST1 8 c.925T>C p.Trp309Arg Het vAR/us Probably damaging 1 1 BEST1 8 c.929T>C p.Ile310Thr Het Mut 1 CM000843 BEST1 4 c.250T>G p.Phe84Val Het vAR/us Probably damaging 1 1 Pattern dystrophy ABCA4 6 c.634C>T p.Arg212Cys Het Mut 1 rs61750200 ABCA4 17 c.2588G>C p.Gly863Ala Het Mut 1 CM970003/ rs76157638 ABCA4 IVS26 c.3862&#fe;3A>G Abnormal splicing Het vAR/us 1 NA ABCA4 30 c.4469G>A p.Cys1490Tyr Het Mut 1 CM990056/ rs61751402 ABCA4 IVS38 c.5461-10T>C None Het Mut 1 CS057513 PRPH2 1 c.271T>A p.Tyr91Asn Het vAR/us Probably damaging .909 1 PRPH2 1 c.310-313del(AT) p.Ile104Val Het Mut 1 NA/Deletion PRPH2 1 c.422A>G p.Tyr141Cys Het Mut 2 CM010125/ rs61755781 PRPH2 1 c.515G>A p.Arg172Gln Het Mut 1 CM930637/ rs61755792 PRPH2 2 c.583C>T p.Arg195Stop Het Mut 1 CM032999 PRPH2 2 c.629C>G p.Pro210Arg Het Mut 1 CM941210 PRPH2 2 c.635G>C p.Ser212Thr Het Mut 1 CM971289/ rs61755801 PRPH2 2 c.683C>T p.Thr228Ile Het Mut 1 TMP_ESP_6_ 42672248 PRPH2 2 c.708C>G p.Tyr236Stop Het Mut 1 rs61755813 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut 4 CS010139 PRPH2 2 c.584G>A p.Arg195Gln Het vAR/us Probably damaging 1 1 TABLE 3. Continued Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Frequency* Variant ID Cone-rod dystrophy ABCA4 2 c.156T>G p.His52Gln Het vAR/us Probably damaging 0.998 1 ABCA4 3 c.161G>A p.Cys54Tyr Het Mut 1 CM990012/ rs150774447 ABCA4 28 c.4169T>C p.Leu1390Pro Het Mut 1 CM014810/ rs61752430 ABCA4 16 c.2385C>T p.Ser795Arg Het vAR/us Probably damaging 0.99 1 ABCA4 IVS40 c.5714&#fe;5G>A Splice Het Mut 1 CS982057 ABCA4 27 c.3899G>A p.Arg1300Gln Het vAR/us Benign 0.143 1 ABCA4 32 c.4661A>G p.Glu1554Gly Het vAR/us Benign 0.326 1 ABCA4 30 c.4383G>A p.Trp1461Stop Het Mut 1 Stop/NA ABCA4 IVS38 c.5461-10T>C None Het Mut NA NA 2 CS057513 ABCA4 22 c.3259G>A p.Glu1087Lys Het Mut 1 CM970008/ rs61751398 ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut 2 CM970016/ rs1800553 ABCA4 45 c.6221G>T p.Gly2074Val Het vAR/us Probably damaging 1 1 ABCA4 IVS42 c.5898&#fe;1G<A Splice Het Mut 1 CS011524 ABCA4 IVS42 c.5899-2delA Splice Het Mut 1 rs3112831 CRX 3 c.607T>C p.Ser213Pro Het vAR/us Probably damaging 0.999 1 ABCA4 5 c.559C>T p.Arg187Cys Het Mut 1 COSM913472 ABCA4 40 c.5645T>C p.Met1882Thr Het Mut 1 rs4147830 ABCA4 6 c.768G>T p.Val256Val (abnlspl) Het Mut 1 CM990057/ rs61750152 ABCA4 31 c.4577C>T p.Thr1526Met Het Mut 1 rs62645944 ABCA4 11 c.1532G>A p.Arg511His Het Mut 1 rs140482171 ABCA4 12 c.1622T>C p.Leu541Pro Het Mut 1 CM990022/ rs61751392 ABCA4 21 c.3113C>T p.Ala1038Val Het Mut 1 CM970006/ rs61751374 ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut 2 CM990022/ rs61751392 ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut 2 CM970006/ rs61751374 ABCA4 22 c.3322C>T p.Arg1108Cys Het Mut 1 CM990039/ rs61750120 ABCA4 13 c.1927G>A p.Val643Met Het Mut 1 CM014293/ rs61749417/ rs143548435 ABCA4 24 c.3602T>G p.Leu1201Arg Het Mut 1 CM990042/ rs61750126 ABCA4 36 c.5186T>C p.Leu1729Pro Het Mut 1 CM990062/ rs61750567 ABCA4 13 c.1933G>A p.Asp645Asn Het Mut 1 rs617494181933 ABCA4 23 c.3364G>A p.Glu1122Lys Het Mut 1 CM990041 ABCA4 48 c.6529G>A p.Asp2177Asn Het Mut 1 CM970023/ rs1800555 ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut 2 CM983728/ rs61751404 ABCA4 28 c.4222T>C p.Trp1408Arg Het Mut 1 CM990048/ rs61750135 GUCY2D 13 c.2512C>T p.Arg838Cys Het Mut 1 rs61750172 GUCY2D 13 c.2513G>A p.Arg838His Het Mut 5 CM012606/ rs61750173 ABCA4 IVS7 c.859-9T>C Unknown Hom vAR/us NA NA 1 ABCA4 42 c.5882G>A p.Gly1961Glu Hom Mut 1 CM970016/ rs1800553 ABCA4 43 c.5917delG Deletion Hom Mut 1 RISN_ABCR: c.5917delG Molecular Diagnostic Testing by eyeGENE IOVS j September 2014 j Vol. 55 j No. 9 j Six patients with late-onset retinal pathology and drusen had well-characterized clinical data.
X
ABCA4 p.Cys1490Tyr 25082885:116:1754
status: NEW[hide] Flecks in Recessive Stargardt Disease: Short-Wavel... Invest Ophthalmol Vis Sci. 2015 Jul;56(8):5029-39. doi: 10.1167/iovs.15-16763. Sparrow JR, Marsiglia M, Allikmets R, Tsang S, Lee W, Duncker T, Zernant J
Flecks in Recessive Stargardt Disease: Short-Wavelength Autofluorescence, Near-Infrared Autofluorescence, and Optical Coherence Tomography.
Invest Ophthalmol Vis Sci. 2015 Jul;56(8):5029-39. doi: 10.1167/iovs.15-16763., [PMID:26230768]
Abstract [show]
PURPOSE: We evaluated the incongruous observation whereby flecks in recessive Stargardt disease (STGD1) can exhibit increased short-wavelength autofluorescence (SW-AF) that originates from retinal pigment epithelium (RPE) lipofuscin, while near-infrared AF (NIR-AF), emitted primarily from RPE melanin, is usually reduced or absent at fleck positions. METHODS: Flecks in SW- and NIR-AF images and spectral-domain optical coherence tomography (SD-OCT) scans were studied in 19 STGD1 patients carrying disease-causing ABCA4 mutations. Fleck spatial distribution and progression were recorded in serial AF images. RESULTS: Flecks observed in SW-AF images typically colocalized with darkened foci in NIR-AF images; the NIR-AF profiles were larger. The decreased NIR-AF signal from flecks preceded apparent changes in SW-AF. Spatiotemporal changes in fleck distribution usually progressed centrifugally, but in one case centripetal expansion was observed. Flecks in SW-AF images corresponded to hyperreflective deposits that progressively traversed photoreceptor-attributable bands in SD-OCT images. Outer nuclear layer (ONL) thickness negatively correlated with expansion of flecks from outer to inner retina. CONCLUSIONS: In the healthy retina, RPE lipofuscin fluorophores form in photoreceptor cells but are transferred to RPE; thus the SW-AF signal from photoreceptor cells is negligible. In STGD1, NIR-AF imaging reveals that flecks are predominantly hypofluorescent and larger and that NIR-AF darkening occurs prior to heightened SW-AF signal. These observations indicate that RPE cells associated with flecks in STGD1 are considerably changed or lost. Spectral-domain OCT findings are indicative of ongoing photoreceptor cell degeneration. The bright SW-AF signal of flecks likely originates from augmented lipofuscin formation in degenerating photoreceptor cells impaired by the failure of RPE.
Comments [show]
None has been submitted yet.
No. Sentence Comment
49 [571-1G>T 10* M 13.89 Caucasian 0.4 0.4 p. [L541P; A1038V]; [L2027F] 11* F 20.20 Caucasian 0.9 0.9 p. [P1380L]; [G1961E] 12 M 27.61 African-Arab 0 0 p. [R1300*]; [R2106C] 13* M 46.93 Caucasian 0.3 0.4 p. [C1490Y]; [G1961E] 14* M 26.82 Caucasian 0 0 c.
X
ABCA4 p.Cys1490Tyr 26230768:49:205
status: NEW[hide] Quantitative Fundus Autofluorescence and Optical C... Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7274-85. doi: 10.1167/iovs.15-17371. Duncker T, Stein GE, Lee W, Tsang SH, Zernant J, Bearelly S, Hood DC, Greenstein VC, Delori FC, Allikmets R, Sparrow JR
Quantitative Fundus Autofluorescence and Optical Coherence Tomography in ABCA4 Carriers.
Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7274-85. doi: 10.1167/iovs.15-17371., [PMID:26551331]
Abstract [show]
PURPOSE: To assess whether carriers of ABCA4 mutations have increased RPE lipofuscin levels based on quantitative fundus autofluorescence (qAF) and whether spectral-domain optical coherence tomography (SD-OCT) reveals structural abnormalities in this cohort. METHODS: Seventy-five individuals who are heterozygous for ABCA4 mutations (mean age, 47.3 years; range, 9-82 years) were recruited as family members of affected patients from 46 unrelated families. For comparison, 57 affected family members with biallelic ABCA4 mutations (mean age, 23.4 years; range, 6-67 years) and two noncarrier siblings were also enrolled. Autofluorescence images (30 degrees , 488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference. The gray levels (GLs) of each image were calibrated to the reference, zero GL, magnification, and normative optical media density to yield qAF. Horizontal SD-OCT scans through the fovea were obtained and the thicknesses of the outer retinal layers were measured. RESULTS: In 60 of 65 carriers of ABCA4 mutations (age range, 9-60), qAF levels were within normal limits (95% confidence level) observed for healthy noncarrier subjects, while qAF levels of affected family members were significantly increased. Perifoveal fleck-like abnormalities were observed in fundus AF images in four carriers, and corresponding changes were detected in the outer retinal layers in SD-OCT scans. Thicknesses of the outer retinal layers were within the normal range. CONCLUSIONS: With few exceptions, individuals heterozygous for ABCA4 mutations and between the ages of 9 and 60 years do not present with elevated qAF. In a small number of carriers, perifoveal fleck-like changes were visible.
Comments [show]
None has been submitted yet.
No. Sentence Comment
75 [W1408R;R1640W] 1.00 1.00 n/a n/a P 33.1&#a7; M 23.0 White p.R2030Q p.G1961E 1.00 1.00 334 347 P 34.1 M 46.9 White p.C1490Y p.G1961E 0.40 0.30 376 384 P 35.1ߥ M 24.8 White c.3050&#fe;5G>A p.G1961E 0.00 0.00 381 451 P 36.1ߥ F 29.3 Hispanic p.L541P p.G1961E 0.40 0.40 479 487 P 37.1ߤ F 24.7 White p.G1961E p.C2150R 0.88 0.88 405 396 P 38.1&#a7; M 11.7 White p.W821R p.C2150Y 0.40 0.40 306 n/a P 39.1 F 12.8 White p.P1380L c.5714&#fe;5G>A 0.60 0.40 558 573 P 39.2 M 14.1 White p.P1380L c.5714&#fe;5G>A 0.88 0.88 395 462 P 40.1ߤ F 16.2 White p.K1547* p.R2030Q 0.70 0.40 481 513 P 41.1 F 19.0 White p.C54Y 0.88 0.88 n/a n/a P 42.1ߤ F 13.0 White p.R1108C p.Q1412* 1.30 1.00 511 528 P 43.1ߤ M 17.4 White p.A1773V p.G1961E 0.88 0.88 340 366 P 44.1 M 14.0 Asian p.R408* c.4248_4250del 1.30 1.30 n/a n/a P 44.2 F 7.0 Asian p.R408* c.4248_4250del 1.30 1.30 n/a n/a P 45.1 F 42.4 White p.N965Y p.P1486L 0.10 0.40 n/a n/a BCVA, best-corrected visual acuity; logMAR, logarithm of the minimum angle of resolution; OD, right eye; OS, left eye; qAF8, average quantitative autofluorescence of the 8 measurement sites from all available images per eye; n/a, not available.
X
ABCA4 p.Cys1490Tyr 26551331:75:117
status: NEW[hide] Next-generation sequencing of ABCA4: High frequenc... Exp Eye Res. 2015 Nov 22;145:93-99. doi: 10.1016/j.exer.2015.11.011. Sciezynska A, Ozieblo D, Ambroziak AM, Korwin M, Szulborski K, Krawczynski M, Stawinski P, Szaflik J, Szaflik JP, Ploski R, Oldak M
Next-generation sequencing of ABCA4: High frequency of complex alleles and novel mutations in patients with retinal dystrophies from Central Europe.
Exp Eye Res. 2015 Nov 22;145:93-99. doi: 10.1016/j.exer.2015.11.011., [PMID:26593885]
Abstract [show]
Variation in the ABCA4 locus has emerged as the most prevalent cause of monogenic retinal diseases. The study aimed to discover causative ABCA4 mutations in a large but not previously investigated cohort with ABCA4-related diseases originating from Central Europe and to refine the genetic relevance of all identified variants based on population evidence. Comprehensive clinical studies were performed to identify patients with Stargardt disease (STGD, n = 76) and cone-rod dystrophy (CRD, n = 16). Next-generation sequencing targeting ABCA4 was applied for a widespread screening of the gene. The results were analyzed in the context of exome data from a corresponding population (n = 594) and other large genomic databases. Our data disprove the pathogenic status of p.V552I and provide more evidence against a causal role of four further ABCA4 variants as drivers of the phenotype under a recessive paradigm. The study identifies 12 novel potentially pathogenic mutations (four of them recurrent) and a novel complex allele p.[(R152*; V2050L)]. In one third (31/92) of our cohort we detected the p.[(L541P; A1038V)] complex allele, which represents an unusually high level of genetic homogeneity for ABCA4-related diseases. Causative ABCA4 mutations account for 79% of STGD and 31% of CRD cases. A combination of p.[(L541P; A1038V)] and/or a truncating ABCA4 mutation always resulted in an early disease onset. Identification of ABCA4 retinopathies provides a specific molecular diagnosis and justifies a prompt introduction of simple precautions that may slow disease progression. The comprehensive, population-specific study expands our knowledge on the genetic landscape of retinal diseases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
32 Some of them have a high prevalence in certain ethnic groups, such as p.C1490Y in South Africans (September et al., 2004), p.A1773V in Mexicans (Chacon-Camacho et al., 2013) and a number of other mutations specific for different European populations (Rivera et al., 2000; Valverde et al., 2006; Maugeri et al., 1999; Rosenberg et al., 2007), which underlines the need of genotyping patients of various ethnicities.
X
ABCA4 p.Cys1490Tyr 26593885:32:72
status: NEW