ABCMdb

ABCA4 p.Arg1300Gln

ClinVar:	c.3898C>T , p.Arg1300* ? , not provided c.3899G>A , p.Arg1300Gln ? , not provided
Predicted by SNAP2:	A: D (66%), C: D (66%), D: D (71%), E: D (66%), F: D (71%), G: D (71%), H: D (59%), I: D (66%), K: N (61%), L: D (66%), M: D (66%), N: N (57%), P: D (71%), Q: D (66%), S: D (59%), T: D (75%), V: D (66%), W: D (80%), Y: D (63%),
Predicted by PROVEAN:	A: N, C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, S: N, T: N, V: N, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Stargardt macular dystrophy: common ABCA4 mutation... Mol Vis. 2012;18:280-9. Epub 2012 Feb 1. Roberts LJ, Nossek CA, Greenberg LJ, Ramesar RS
Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients.
Mol Vis. 2012;18:280-9. Epub 2012 Feb 1., [PMID:22328824]

Abstract [show]
PURPOSE: Based on the previous indications of founder ATP-binding cassette sub-family A member 4 gene (ABCA4) mutations in a South African subpopulation, the purpose was to devise a mechanism for identifying common disease-causing mutations in subjects with ABCA4-associated retinopathies (AARs). Facilitating patient access to this data and determining the frequencies of the mutations in the South African population would enhance the current molecular diagnostic service offered. METHODS: The majority of subjects in this study were of Caucasian ancestry and affected with Stargardt macular dystrophy. The initial cohort consisted of DNA samples from 181 patients, and was screened using the ABCR400 chip. An assay was then designed to screen a secondary cohort of 72 patients for seven of the most commonly occurring ABCA4 mutations in this population. A total of 269 control individuals were also screened for the seven ABCA4 mutations. RESULTS: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. The newly designed genetic assay identified two of the seven disease-associated mutations in 28/72 patients in a secondary patient cohort. In the control cohort, 12/269 individuals were found to be heterozygotes, resulting in an estimated background frequency of these mutations in this particular population of 4.46 per 100 individuals. CONCLUSIONS: The relatively high detection rate of seven ABCA4 mutations in the primary patient cohort led to the design and subsequent utility of a multiplex assay. This assay can be used as a viable screening tool and to reduce costs and laboratory time. The estimated background frequency of the seven ABCA4 mutations, together with the improved diagnostic service, could be used by counselors to facilitate clinical and genetic management of South African families with AARs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment

[hide] Transition zones between healthy and diseased reti... Invest Ophthalmol Vis Sci. 2011 Dec 20;52(13):9581-90. Print 2011. Lazow MA, Hood DC, Ramachandran R, Burke TR, Wang YZ, Greenstein VC, Birch DG
Transition zones between healthy and diseased retina in choroideremia (CHM) and Stargardt disease (STGD) as compared to retinitis pigmentosa (RP).
Invest Ophthalmol Vis Sci. 2011 Dec 20;52(13):9581-90. Print 2011., [PMID:22076985]

Abstract [show]
PURPOSE: To describe the structural changes across the transition zone (TZ) in choroideremia (CHM) and Stargardt disease (STGD) and to compare these to the TZ in retinitis pigmentosa (RP). METHODS: Frequency-domain (Fd)OCT line scans were obtained from seven patients with CHM, 20 with STGD, and 12 with RP and compared with those of 30 previously studied controls. A computer-aided manual segmentation procedure was used to determine the thicknesses of the outer segment (OS) layer, the outer nuclear layer plus outer plexiform layer (ONL+), the retinal pigment epithelium plus Bruch's membrane (RPE+BM), and the outer retina (OR). RESULTS: The TZ, while consistent within patient groups, showed differences across disease groups. In particular, (1) OS loss occurred before ONL+ loss in CHM and RP, whereas ONL+ loss occurred before OS loss in STGD; (2) ONL+ was preserved over a wider region of the retina in CHM than in RP; (3) RPE+BM remained normal across the RP TZ, but was typically thinned in CHM. In some CHM patients, it was abnormally thin in regions with normal OS and ONL+ thickness. In STGD, RPE+BM was thinned by the end of the TZ; and (4) the disappearances of the IS/OS and OLM were more abrupt in CHM and STGD than in RP. CONCLUSIONS: On fdOCT scans, patients with RP, CHM, and STGD all have a TZ between relatively healthy and severely affected retina. The patterns of changes in the receptor layers are similar within a disease category, but different across categories. The findings suggest that the pattern of progression of each disease is distinct and may offer clues for strategies in the development of future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20ϩ5 GϾA, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing. Login to comment
31 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20af9;5 Gb0e;A, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing. Login to comment

[hide] Outcome of ABCA4 microarray screening in routine c... Mol Vis. 2009 Dec 20;15:2841-7. Ernest PJ, Boon CJ, Klevering BJ, Hoefsloot LH, Hoyng CB
Outcome of ABCA4 microarray screening in routine clinical practice.
Mol Vis. 2009 Dec 20;15:2841-7., [PMID:20029649]

Abstract [show]
PURPOSE: To retrospectively analyze the clinical characteristics of patients who were screened for mutations with the ATP-binding cassette transporter gene ABCA4 (ABCA4) microarray in a routine clinical DNA diagnostics setting. METHODS: We performed a retrospective analysis of the medical charts of 65 patients who underwent an ABCA4 microarray screening between the years 2002 and 2006. An additional denaturing gradient gel electrophoresis (DGGE) was performed in these patients if less than two mutations were found with the microarray. We included all patients who were suspected of autosomal recessive Stargardt disease (STGD1), autosomal recessive cone-rod dystrophy (arCRD), or autosomal recessive retinitis pigmentosa at the time of microarray request. After a retrospective analysis of the clinical characteristics, the patients who were suspected of STGD1 were categorized as having either a typical or atypical form of STGD1, according to the age at onset, fundus appearance, fluorescein angiography, and electroretinography. The occurrence of typical clinical features for STGD1 was compared between patients with different numbers of discovered mutations. RESULTS: Of the 44 patients who were suspected of STGD1, 26 patients (59%) had sufficient data available for a classification in either typical (six patients; 23%) or atypical (20 patients; 77%) STGD1. In the suspected STGD1 group, 59% of all expected pathogenic alleles were found with the ABCA4 microarray. DGGE led to the finding of 12 more mutations, resulting in an overall detection rate of 73%. Thirty-one percent of patients with two or three discovered ABCA4 mutations met all typical STGD1 criteria. An age at onset younger than 25 years and a dark choroid on fluorescein angiography were the most predictive clinical features to find ABCA4 mutations in patients suspected of STGD1. In 18 patients suspected of arCRD, microarray screening detected 22% of the possible pathogenic alleles. CONCLUSIONS: In addition to confirmation of the diagnosis in typical STGD1, ABCA4 microarray screening is usually requested in daily clinical practice to strengthen the diagnosis when the disease is atypical. This study supports the view that the efficiency and accuracy of ABCA4 microarray screening are directly dependent upon the clinical features of the patients who are screened.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
143 DISCOVERED MUTATIONS IN THE ABCA4 GENE IN THE PATIENTS INCLUDED IN THIS STUDY Nucleotide change Effect Alleles References Mutations already included in the ABCA4 microarray c.286A>G p.Asn96Asp 2 [25] c.656G>C p.Arg219Thr 1 [10] c.740A>T p.Asn247Ile 1 This study* c.768G>T splice site 7 [13] c.899C>A p.Thr300Asn 1 [14] c.1805G>A p.Arg602Gln 1 [9] c.1822T>A p.Phe608Ile 2 [13] c.1853G>A p.Gly618Glu 1 [19] c.1938-1G>A splice site 1 [26] c.2588G>C p.DelGly863/Gly863Ala 8 [13] c.2919del exons20-22 deletion/frameshift 2 [13] c.3335C>A p.Thr1112Asn 1 [13] c.3874C>T p.Gln1292X 1 This study* c.3899G>A p.Arg1300Gln 1 [27] c.4297G>A p.Val1433Ile 1 [17] c.4462T>C p.Cys1488Arg 1 [17] c.4506C>A p.Cys1502X 1 This study* c.4539+1G>T splice site 1 [28] c.4774+1G>A splice site 1 [1] c.5161-5162delAC p.Thr1721fs 1 [27] c.5337C>A p.Tyr1779X 1 This study* c.5461-10T>C unknown 9 [9] c.5537T>C p.Ile1846Thr 1 [13] c.5693G>A p.Arg1898His 1 [1] c.5715+5G>A splice site 2 [28] c.5882G>A p.Gly1961Glu 10 [1] c.6088C>T p.Arg2030X 1 [14] c.6089G>A p.Arg2030Gln 1 [9] c.6238-6239delTC p.Ser2080fs 1 [29] c.6529G>A p.Asp2177Asn 1 [1] New mutations found with DGGE analysis c.303+4A>C splice site 1 c.872C>T p.Pro291Leu 1 c.2906A>G p.Lys969Arg 1 c.2947A>G p.Thr983Ala 1 c.3233G>A p.Gly1078Glu 1 c.3305A>T p.Asp1102Val 1 c.4353+1G>A splice site 1 c.5113C>T p.Arg1705Trp 1 c.5762_5763dup p.Ala1922fs 1 c.6411T>A p.Cys2137X 1 Total 74 Mutations are designated by their nucleotide change, followed by their effect on the protein and the number of alleles that were found with the mutation. Login to comment

[hide] Frequency of ABCA4 mutations in 278 Spanish contro... Br J Ophthalmol. 2009 Oct;93(10):1359-64. Epub 2008 Oct 31. Riveiro-Alvarez R, Aguirre-Lamban J, Lopez-Martinez MA, Trujillo-Tiebas MJ, Cantalapiedra D, Vallespin E, Avila-Fernandez A, Ramos C, Ayuso C
Frequency of ABCA4 mutations in 278 Spanish controls: an insight into the prevalence of autosomal recessive Stargardt disease.
Br J Ophthalmol. 2009 Oct;93(10):1359-64. Epub 2008 Oct 31., [PMID:18977788]

Abstract [show]
AIM: To determine the carrier frequency of ABCA4 mutations in order to achieve an insight into the prevalence of autosomal recessive Stargardt disease (arSTGD) in the Spanish population. METHODS: arSTGD patients (n = 133) were analysed using ABCR400 microarray and sequencing. Control subjects were analysed by two different strategies: 200 individuals were screened for the p.Arg1129Leu mutation by denaturing-HPLC and sequencing; 78 individuals were tested for variants with the microarray and sequencing. RESULTS: For the first strategy in control subjects, the p.Arg1129Leu variant was found in two heterozygous individuals, which would mean a carrier frequency for any variant of approximately 6.0% and a calculated arSTGD prevalence of 1:1000. For the second strategy, carrier frequency was 6.4% and therefore an estimated prevalence of the disease of 1:870. CONCLUSION: Calculated prevalence of arSTGD based on the ABCA4 carrier frequency could be considerably higher than previous estimation. This discrepancy between observed (genotypic) and estimated (phenotypic) prevalence could be due to the existence of non-pathological or low penetrance alleles, which may result in late-onset arSTGD or may be implicated in age-related macular degeneration. This situation should be regarded with special care when genetic counselling is given and further follow-up of these patients should be recommended.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
96 These Table 1 ABCA4 sequence variants identified in Spanish control population Mutant alleles Nucleotide change Amino acid change Number of cases Number of alleles Frequency (%) Homozygous individuals Mutations* c.661G.A p.Gly221Arg 1 1 0.64 None c.1140T.A p.Asn380Lys 1 1 0.64 None c.2588G.C p.Gly863Ala 1 1 0.64 None c.3113C.T p.Ala1038Val 1 1 0.64 None c.3899G.A p.Arg1300Gln 1 1 0.64 None c.5882G.A p.Gly1961Glu 1 1 0.64 None c.5908C.T p.Leu1970Phe 1 1 0.64 None c.6148G.C p.Val2050Leu 1 1 0.64 None c.6529G.A p.Asp2177Asn 2 2 1.28 None Total 10 Polymorphisms{ c.466A.G p.Ile156Val 5 5 3.2 None c.635G.A p.Arg212His 5 6 3.84 1 c.1268A.G p.His423Arg 43 48 30.7 5 c.1269C.T p.His423His 2 2 1.28 None IVS10+5delG 34 36 23 2 c.2828G.A p.Arg943Gln 1 1 0.64 None c.4203C.A p.Pro1401Pro 3 3 1.9 None IVS33+48C.T 59 75 48 16 c.5603A.T p.Asn1868Ile 4 4 2.5 None c.5682G.C p.Leu1894Leu 29 35 22.4 6 c.5814A.G p.Leu1938Leu 27 33 21.1 6 c.5843 C.T p.Pro1948Leu 9 10 6.4 1 c.5844A.G p.Pro1948Pro 27 32 20.5 5 c.6069C.T p.Ile2023Ile 11 12 7.7 1 c.6249C.T p.Ile2083Ile 12 14 8.9 2 c.6285T.C p.Asp2095Asp 24 26 16.6 2 c.6764G.T p.Ser2255Ile 12 13 8.3 1 *A total of 15 mutant alleles were detected. Login to comment
97 These Table 1 ABCA4 sequence variants identified in Spanish control population Mutant alleles Nucleotide change Amino acid change Number of cases Number of alleles Frequency (%) Homozygous individuals Mutations* c.661G.A p.Gly221Arg 1 1 0.64 None c.1140T.A p.Asn380Lys 1 1 0.64 None c.2588G.C p.Gly863Ala 1 1 0.64 None c.3113C.T p.Ala1038Val 1 1 0.64 None c.3899G.A p.Arg1300Gln 1 1 0.64 None c.5882G.A p.Gly1961Glu 1 1 0.64 None c.5908C.T p.Leu1970Phe 1 1 0.64 None c.6148G.C p.Val2050Leu 1 1 0.64 None c.6529G.A p.Asp2177Asn 2 2 1.28 None Total 10 Polymorphisms{ c.466A.G p.Ile156Val 5 5 3.2 None c.635G.A p.Arg212His 5 6 3.84 1 c.1268A.G p.His423Arg 43 48 30.7 5 c.1269C.T p.His423His 2 2 1.28 None IVS10+5delG 34 36 23 2 c.2828G.A p.Arg943Gln 1 1 0.64 None c.4203C.A p.Pro1401Pro 3 3 1.9 None IVS33+48C.T 59 75 48 16 c.5603A.T p.Asn1868Ile 4 4 2.5 None c.5682G.C p.Leu1894Leu 29 35 22.4 6 c.5814A.G p.Leu1938Leu 27 33 21.1 6 c.5843 C.T p.Pro1948Leu 9 10 6.4 1 c.5844A.G p.Pro1948Pro 27 32 20.5 5 c.6069C.T p.Ile2023Ile 11 12 7.7 1 c.6249C.T p.Ile2083Ile 12 14 8.9 2 c.6285T.C p.Asp2095Asp 24 26 16.6 2 c.6764G.T p.Ser2255Ile 12 13 8.3 1 *A total of 15 mutant alleles were detected. Login to comment

[hide] Clinical utility of the ABCR400 microarray: basing... Arch Ophthalmol. 2009 Apr;127(4):549-54. Roberts LJ, Ramesar RS, Greenberg J
Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip.
Arch Ophthalmol. 2009 Apr;127(4):549-54., [PMID:19365039]

Abstract [show]
OBJECTIVES: To assess the clinical utility of ABCR400 microarray testing in patients with ABCA4-associated retinopathies and to report on possible issues that could arise should genetic results be delivered without validation. METHODS: One hundred thirty-two probands were genotyped with the microarray. Diagnostic assays were designed to verify all mutations identified in individuals in whom at least 2 causative mutations were found. Mutations were verified in the probands, and wherever possible cosegregation analysis was performed in additional family members. RESULTS: Eighty-five of the 132 probands (64.4%) genotyped with the microarray had 2 or more disease-associated mutations identified. Verification of the genotyping, however, resulted in only 80 families being able to benefit from genetic result delivery. The remaining families could not receive results owing to the confounding effect of multiple ABCA4 mutations or the incorrect identification of mutations. CONCLUSIONS: The ABCR400 microarray is useful for mutation screening; however, raw data cannot be delivered directly to patients. All mutations should be verified and, whenever possible, investigated in other family members. CLINICAL RELEVANCE: Validated ABCR400 results provide an unequivocal molecular diagnosis, allowing family members to be offered diagnostic, predictive, carrier, and prenatal testing. Use of the microarray can inform decision-making and identify candidates for future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 Homozygous R1300Q Heterozygous R1300Q Heterozygous R1300Q ? Login to comment
94 A homozygous R1300Q mutation was identified in the proband; however, 2 affected siblings are heterozygous mutation carriers. Login to comment
96 (No R1640W) (No W1408R) Het R1640W Het W1408R Het R1640W Het W1408R Figure 7. Pedigree of family RPS593 in which both mutations in the proband were found to be transmitted on a single parental (paternal) allele. Login to comment

[hide] Macular pigment and lutein supplementation in ABCA... Invest Ophthalmol Vis Sci. 2007 Mar;48(3):1319-29. Aleman TS, Cideciyan AV, Windsor EA, Schwartz SB, Swider M, Chico JD, Sumaroka A, Pantelyat AY, Duncan KG, Gardner LM, Emmons JM, Steinberg JD, Stone EM, Jacobson SG
Macular pigment and lutein supplementation in ABCA4-associated retinal degenerations.
Invest Ophthalmol Vis Sci. 2007 Mar;48(3):1319-29., [PMID:17325179]

Abstract [show]
PURPOSE: To determine macular pigment (MP) optical density (OD) in patients with ABCA4-associated retinal degenerations (ABCA4-RD) and the response of MP and vision to supplementation with lutein. METHODS: Patients with Stargardt disease or cone-rod dystrophy and known or suspected disease-causing mutations in the ABCA4 gene were included. All patients had foveal fixation. MPOD profiles were measured with heterochromatic flicker photometry. Serum carotenoids, visual acuity, foveal sensitivity, and retinal thickness were quantified. Changes in MPOD and central vision were determined in a subset of patients receiving oral supplementation with lutein for 6 months. RESULTS: MPOD in patients ranged from normal to markedly abnormal. As a group, patients with ABCA4-RD had reduced foveal MPOD, and there was a strong correlation with retinal thickness. Average foveal tissue concentration of MP, estimated by dividing MPOD by retinal thickness, was normal in patients, whereas serum concentration of lutein and zeaxanthin was significantly lower than normal. After oral lutein supplementation for 6 months, 91% of the patients showed significant increases in serum lutein, and 63% of the patients' eyes showed a significant augmentation in MPOD. The retinal responders tended to be female and to have lower serum lutein and zeaxanthin, lower MPOD, and greater retinal thickness at baseline. Responding eyes had significantly lower baseline MP concentration than did nonresponding eyes. Central vision was unchanged after the period of supplementation. CONCLUSIONS: MP is strongly affected by the stage of ABCA4 disease leading to abnormal foveal architecture. MP could be augmented by supplemental lutein in some patients. There was no change in central vision after 6 months of lutein supplementation. Long-term influences of this supplement on the natural history of these macular degenerations require further study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Clinical and Molecular Characteristics of the Patients Patient Age (y)/Gender ABCA4 Mutation Visual Acuity* Refraction† Kinetic Visual Field Extent (V-4e)‡ Lutein Trial Participant?RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 -0.50 -0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 -1.00 -1.25 103 104 N 3 18/M ࿣ 20/20 20/125 -1.00 -1.00 126 105 N 4§ 19/F R1129L/L1940P 20/40 20/50 ϩ0.25 ϩ0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 -0.75 -0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 -1.25 -1.50 112 105 Y 7§ 26/M ࿣ 20/40 20/32 ϩ1.00 ϩ0.75 86 88 Y 8 30/F ࿣ 20/50 20/40 ϩ2.25 ϩ1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 -2.25 -3.50 99 93 Y 10 32/F V935A/IVS40ϩ5G3A 20/32 20/40 -0.75 -1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 -1.50 -1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 -3.00 -2.00 99 105 Y 13¶ 38/F V256V/G1961E 20/25 20/25 -1.00 -1.25 106 101 Y 14¶ 42/F V256V/G1961E 20/25 20/32 -0.50 -0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 ϩ0.75 ϩ0.25 108 103 N 16§ 49/M ࿣ 20/32 20/32 -4.50 -4.50 84 79 Y 17 56/M G1977S 20/25 20/25 -5.50 -5.50 99 109 N * Best corrected visual acuity. Login to comment
62 RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 afa;0.50 afa;0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 afa;1.00 afa;1.25 103 104 N 3 18/M $f3; 20/20 20/125 afa;1.00 afa;1.00 126 105 N 4&#a7; 19/F R1129L/L1940P 20/40 20/50 af9;0.25 af9;0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 afa;0.75 afa;0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 afa;1.25 afa;1.50 112 105 Y 7&#a7; 26/M $f3; 20/40 20/32 af9;1.00 af9;0.75 86 88 Y 8 30/F $f3; 20/50 20/40 af9;2.25 af9;1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 afa;2.25 afa;3.50 99 93 Y 10 32/F V935A/IVS40af9;5G3A 20/32 20/40 afa;0.75 afa;1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 afa;1.50 afa;1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 afa;3.00 afa;2.00 99 105 Y 13&#b6; 38/F V256V/G1961E 20/25 20/25 afa;1.00 afa;1.25 106 101 Y 14&#b6; 42/F V256V/G1961E 20/25 20/32 afa;0.50 afa;0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 af9;0.75 af9;0.25 108 103 N 16&#a7; 49/M $f3; 20/32 20/32 afa;4.50 afa;4.50 84 79 Y 17 56/M G1977S 20/25 20/25 afa;5.50 afa;5.50 99 109 N * Best corrected visual acuity. Login to comment

[hide] Early-onset macular degeneration with drusen in a ... Invest Ophthalmol Vis Sci. 2005 Feb;46(2):683-91. Umeda S, Ayyagari R, Allikmets R, Suzuki MT, Karoukis AJ, Ambasudhan R, Zernant J, Okamoto H, Ono F, Terao K, Mizota A, Yoshikawa Y, Tanaka Y, Iwata T
Early-onset macular degeneration with drusen in a cynomolgus monkey (Macaca fascicularis) pedigree: exclusion of 13 candidate genes and loci.
Invest Ophthalmol Vis Sci. 2005 Feb;46(2):683-91., [PMID:15671300]

Abstract [show]
PURPOSE: To describe hereditary macular degeneration observed in the cynomolgus monkey (Macaca fascicularis), which shares phenotypic features with age-related macular degeneration in humans, and to test the involvement of candidate gene loci by mutation screening and linkage analysis. METHODS: Ophthalmic examinations with fundus photography, fluorescein angiography (FA), indocyanine green angiography (IA), electroretinography (ERG), and histologic studies were performed on both affected and unaffected monkeys in the pedigree. The monkey orthologues of the human ABCA4, VMD2, EFEMP1, TIMP3, and ELOVL4 genes were cloned and screened for mutations by single-strand conformation polymorphism (SSCP) analysis or denaturing high-performance liquid chromatography (DHPLC) and direct sequencing in six affected and five unaffected monkeys from the pedigree and in six unrelated, unaffected monkeys. Subsequently, 13 human macular degeneration loci including these five genes were analyzed to test for linkage with the disease. Nineteen affected and seven unaffected monkeys in the pedigree were analyzed by using human microsatellite markers linked to the 13 loci. RESULTS: Yellowish white spots were observed in the macula and fovea centralis, and in some cases the spots scattered to the peripheral retina along the blood vessels. FA showed hyperfluorescence corresponding to the dots except in the foveola. No anomalies were found by IA and ERG. Histologic studies demonstrated that the spots were drusen. Mutation analysis of the ABCA4, VMD2, EFEMP1, TIMP3, and ELOVL4 genes identified a few sequence variants, but none of them segregated with the disease. Linkage analysis with markers linked to these five genes and an additional eight human macular degeneration loci failed to establish linkage. Haplotype analysis excluded the involvement of the 13 candidate loci for harboring the gene associated with macular degeneration in the monkeys. CONCLUSIONS: Significant homology was identified between monkey and human orthologues of the five macular degeneration genes. Thirteen loci associated with macular degeneration in humans or harboring macular degeneration genes were excluded as causal of early-onset macular degeneration in the monkeys. It is likely that none of these loci, but rather a novel gene, is involved in causing the observed phenotype in this monkey pedigree.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 Surprisingly, the Lys223Gln and Arg1300Gln changes reported to be associated with Stargardt disease in humans were observed in the homozygous state in TABLE 3. Login to comment
180 In the ABCA4 sequence of a normal monkey, we found two amino acid replacements (K223Q and R1300Q) that are associated with Stargardt disease in humans. Login to comment
182 One explanation of this discrepancy could be that K223Q and R1300Q are not causing the disease phenotype in humans, but rather represent markers linked to disease-causing mutations somewhere else in the gene. Login to comment
102 Surprisingly, the Lys223Gln and Arg1300Gln changes reported to be associated with Stargardt disease in humans were observed in the homozygous state in TABLE 3. Login to comment

[hide] Denaturing HPLC profiling of the ABCA4 gene for re... Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10. Stenirri S, Fermo I, Battistella S, Galbiati S, Soriani N, Paroni R, Manitto MP, Martina E, Brancato R, Allikmets R, Ferrari M, Cremonesi L
Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations.
Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10., [PMID:15192030]

Abstract [show]
BACKGROUND: Mutations in the retina-specific ABC transporter (ABCA4) gene have been associated with several forms of macular degenerations. Because the high complexity of the molecular genotype makes scanning of the ABCA4 gene cumbersome, we describe here the first use of denaturing HPLC (DHPLC) to screen for ABCA4 mutations. METHODS: Temperature conditions were designed for all 50 exons based on effective separation of 83 samples carrying 86 sequence variations and 19 mutagenized controls. For validation, samples from 23 previously characterized Stargardt patients were subjected to DHPLC profiling. Subsequently, samples from a cohort of 30 patients affected by various forms of macular degeneration were subjected to DHPLC scanning under the same conditions. RESULTS: DHPLC profiling not only identified all 132 sequence alterations previously detected by double-gradient denaturing gradient gel electrophoresis but also identified 5 sequence alterations that this approach had missed. Moreover, DHPLC scanning of an additional panel of 30 previously untested patients led to the identification of 26 different mutations and 29 polymorphisms, accounting for 203 sequence variations on 29 of the 30 patients screened. In total, the DHPLC approach allowed us to identify 16 mutations that had never been reported before. CONCLUSIONS: These results provide strong support for the use of DHPLC for molecular characterization of the ABCA4 gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment
34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment

[hide] Mutations in ABCR (ABCA4) in patients with Stargar... Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36. Briggs CE, Rucinski D, Rosenfeld PJ, Hirose T, Berson EL, Dryja TP
Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.
Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36., [PMID:11527935]

Abstract [show]
PURPOSE: To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). METHODS: One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. RESULTS: The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. CONCLUSIONS: This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 ϩ 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 ϩ 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 ϩ 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 ϩ 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 ϩ 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 ϩ 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. Login to comment
88 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 af9; 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 af9; 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 af9; 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 af9; 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 af9; 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 af9; 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None IOVS, September 2001, Vol. 42, No. 10 ABCR in Stargardt Macular Degeneration Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. 10 TABLE 1 (continued). Login to comment

[hide] Identification of three ABCA4 sequence variations ... Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4. Utz VM, Chappelow AV, Marino MJ, Beight CD, Sturgill-Short GM, Pauer GJ, Crowe S, Hagstrom SA, Traboulsi EI
Identification of three ABCA4 sequence variations exclusive to African American patients in a cohort of patients with Stargardt disease.
Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4., [PMID:24011517]

Abstract [show]
PURPOSE: To describe the clinical and molecular findings in ten unrelated African American patients with Stargardt disease. DESIGN: Retrospective, observational case series. METHODS: We reviewed the clinical histories, examinations, and genotypes of 85 patients with molecular diagnoses of Stargardt disease. Three ABCA4 sequence variations identified exclusively in African Americans were evaluated in 300 African American controls and by in silico analysis. RESULTS: ABCA4 sequence changes were identified in 85 patients from 80 families, of which 11 patients identified themselves as African American. Of these 11 patients, 10 unrelated patients shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). The minor allele frequencies in the African American control population for each variation were 7.5%, 6.3%, and 2%, respectively. This is comparable to the allele frequency in African Americans in the Exome Variant Server. In contrast, the allele frequency of all three of these variations was less than or equal to 0.05% in European Americans. Although both c.3602T>G and c.3899G>A have been reported as likely disease-causing variations, one of our control patients was homozygous for each variant, suggesting that these are nonpathogenic. In contrast, the absence of c.6320G>A in the control population in the homozygous state, combined with the results of bioinformatics analysis, support its pathogenicity. CONCLUSIONS: Three ABCA4 sequence variations were identified exclusively in 10 unrelated African American patients: p.L1201R and p.R1300Q likely represent nonpathogenic sequence variants, whereas the p.R2107H substitution appears to be pathogenic. Characterization of population-specific disease alleles may have important implications for the development of genetic screening algorithms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 RESULTS: ABCA4 sequence changes were identified in 85 patients from 80 families, of which 11 patients identified themselves as African American.Of these 11 patients, 10 unrelated patients shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). Login to comment
10 CONCLUSIONS: Three ABCA4 sequence variations were identified exclusively in 10 unrelated African American patients: p.L1201R and p.R1300Q likely represent nonpathogenic sequence variants, whereas the p.R2107H substitution appears to be pathogenic. Login to comment
37 For p.R1300Q, exon 27 was amplified by PCR and analyzed. The forward primer sequence was 59 GGCATTA GAGATCCAGACCTTATAGGCA 39 and the reverse primer sequence was 59 TAAAGAGGGTGCTCCTTGCT GAGT 3. Login to comment
68 The c.4537delC reportedly causes a premature stop codon 12 amino acids downstream in the protein product.40 The c.5077G>A (p.V1693I) variation has been previously detected in Stargardt disease patients but not in controls.25 Patients 4, 5 and 6 possessed a c.3899G>A sequence variation located in exon 27 (p.R1300Q). Login to comment
82 DISCUSSION IN THE PRESENT STUDY, 10 UNRELATED AFRICAN AMERICAN patients with Stargardt disease shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). Login to comment
85 Three Sequence Variations Specific to African American Patients with Stargardt Disease Sequence Variation Exon Protein Age of Onset (y) Age of Presentation (y) LogMAR BCVA (Snellen) c.3602T>G 24 p.L1201R 33.3 6 12.6 37.3 6 12.5 0.583 6 0.385 (z20/75) c.3899G>A 27 p.R1300Q 20.0 6 12.8 37.7 6 6.3 0.783 6 0.189 (z20/120) c.6320G>A 46 p.R2017H 24.5 6 14.2 26.8 6 14.2 0.473 6 0.401 (z20/60) BCVA &#bc; best-corrected visual acuity; logMAR &#bc; logarithm of minimum angle of resolution; Y &#bc; years. Login to comment
87 Molecular Characteristics of Individual African American Patients with Stargardt Disease: Percentage of the Remaining Population, with the Specific Sequence Variations Identified Pt cDNA (Protein Product) % Popn (n &#bc; 75) cDNA (Protein Product) % Popn (n &#bc; 75) cDNA (Protein Product) % Popn (n &#bc; 75) 1 c.3602T>G (p.L1201R 0 c.3322C>T (p.R1108C) 4 2 c.3602T>G (p.L1201R) 0 3 c.3602T>G (p.L1201R) 0 c.4537delC (p.Q1513fsX1525) 0 c.5077G>A (p.V1693I) 0 4 c.3899G>A (p.R1300Q) 0 5 c.3899G>A (p.R1300Q) 0 c.618C>T (p.S207S) 0 c.2546T>C (p.V849A) 0 6 c.3899G>A (p.R1300Q) 0 c. Login to comment
89 VOL. 156, NO. 6 The two sequence variants, c.3601T>G (p.L1291R)20,44,45 and c.3899G>A (p.R1300Q),30,44 are reported in the literature as being likely to cause disease. Login to comment
97 Allele Frequency of Sequence Variations Found in African American patients with Stargardt Disease in a Local African American Control Population and Corresponding Population Frequency in Those of African American and European Ancestry per the Exome Variant Server35 Sequence Variation and Amino Acid Substitution Allele Frequency in Control AA Patients (CEI) Allele Frequency in AA Population (EVS) Allele Frequency in European American Population (EVS) c.3602T>G (p.L1201R) 7.50% (n &#bc; 305) 9.35% (n &#bc; 2203) 0.05% (n &#bc; 4300) c.3899G>A (p.R1300Q) 6.30% (n &#bc; 301) 6.17% (n &#bc; 2203) 0.05% (n &#bc; 4300) c.6320G>A (p.R2107H) 2.00% (n &#bc; 294) 2.04% (n &#bc; 2203) 0.01% (n &#bc; 4300) AA &#bc; African American; CEI &#bc; Cole Eye Institute; EVS &#bc; Exome Variant Server; N &#bc; number of alleles tested. Login to comment
116 In contrast to previous reports of potential pathogenicity, our study of controls and bioinformatic analyses suggests that c.3602T>G (p.L1201R) and c.3899G>A (p.R1300Q) are not directly pathogenic, whereas c.6320G>A (p.R2107H) likely alters protein structure and therefore is pathogenic. Login to comment
119 In Silico Analysis of ABCA4 Missense Variants Identified in African American Patients with Stargardt Disease Sequence Variation (Amino Acid Substitution) Polymorphism Phenotyping V2 PMut Sorting Intolerant from Tolerant Human Var Score Prediction NN output Reliability Prediction Score Prediction c.3602T>G (p.L1201R) 0.031 Benign 0.7702 5 Pathologic 0.52 Tolerant c.3899G>A (p.R1300Q) 0.143 Benign 0.6548 3 Pathologic 0.61 Tolerant c.6320G>A (p.R2107H) 1.00 Probably damaging 0.8993 7 Pathologic 0.00 Intolerant NN &#bc; neural network; V &#bc; version; Var &#bc; variability. Login to comment

[hide] Molecular diagnostic testing by eyeGENE: analysis ... Invest Ophthalmol Vis Sci. 2014 Jul 31;55(9):5510-21. doi: 10.1167/iovs.14-14359. Alapati A, Goetz K, Suk J, Navani M, Al-Tarouti A, Jayasundera T, Tumminia SJ, Lee P, Ayyagari R
Molecular diagnostic testing by eyeGENE: analysis of patients with hereditary retinal dystrophy phenotypes involving central vision loss.
Invest Ophthalmol Vis Sci. 2014 Jul 31;55(9):5510-21. doi: 10.1167/iovs.14-14359., [PMID:25082885]

Abstract [show]
PURPOSE: To analyze the genetic test results of probands referred to eyeGENE with a diagnosis of hereditary maculopathy. METHODS: Patients with Best macular dystrophy (BMD), Doyne honeycomb retinal dystrophy (DHRD), Sorsby fundus dystrophy (SFD), or late-onset retinal degeneration (LORD) were screened for mutations in BEST1, EFEMP1, TIMP3, and CTRP5, respectively. Patients with pattern dystrophy (PD) were screened for mutations in PRPH2, BEST1, ELOVL4, CTRP5, and ABCA4; patients with cone-rod dystrophy (CRD) were screened for mutations in CRX, ABCA4, PRPH2, ELOVL4, and the c.2513G>A p.Arg838His variant in GUCY2D. Mutation analysis was performed by dideoxy sequencing. Impact of novel variants was evaluated using the computational tool PolyPhen. RESULTS: Among the 213 unrelated patients, 38 had BMD, 26 DHRD, 74 PD, 8 SFD, 6 LORD, and 54 CRD; six had both PD and BMD, and one had no specific clinical diagnosis. BEST1 variants were identified in 25 BMD patients, five with novel variants of unknown significance (VUS). Among the five patients with VUS, one was diagnosed with both BMD and PD. A novel EFEMP1 variant was identified in one DHRD patient. TIMP3 novel variants were found in two SFD patients, PRPH2 variants in 14 PD patients, ABCA4 variants in four PD patients, and p.Arg838His GUCY2D mutation in six patients diagnosed with dominant CRD; one patient additionally had a CRX VUS. ABCA4 mutations were identified in 15 patients with recessive CRD. CONCLUSIONS: Of the 213 samples, 55 patients (26%) had known causative mutations, and 13 (6%) patients had a VUS that was possibly pathogenic. Overall, selective screening for mutations in BEST1, PRPH2, and ABCA4 would likely yield the highest success rate in identifying the genetic basis for macular dystrophy phenotypes. Because of the overlap in phenotypes between BMD and PD, it would be beneficial to screen genes associated with both diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Mutations and Unknown Variants Detected in Patients With Central Vision Loss Patient Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Molecular Diagnosis Late-onset retinal degeneration NA CTRP5 NA NA NA NA NA NA Sorsby fundus dystrophy Patient 1 TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 Positive Patient 2 TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 Positive Patient 3 TIMP3 5 c.610A>T p.Ser204Cys Het Mut Positive Doyne honeycomb dystrophy Patient 1 EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut Positive Patient 2 EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut Positive Patient 3 EFEMP1 IVS10 c.IVS10-14C>T None Het vAR/us NA NA Unconfirmed Best macular dystrophy Patient 1 BEST1 2 c.28G>A p.Ala10Thr Het Mut Positive Patient 2 BEST1 2 c.47C>T p.Ser16Phe Het Mut Positive Patient 3 BEST1 2 c.72G>T p.Trp24Cys Het Mut Positive Patient 4 BEST1 3 c.240C>A p.Phe80Leu Het Mut Positive Patient 5 BEST1 3 c.240C>A p.Phe80Leu Het Mut Positive Patient 6 BEST1 4 c.248G>C p.Gly83Ala Het vAR/us Probably damaging 1 Positive Patient 7 BEST1 4 c.277T>C p.Trp93Arg Het vAR/us Probably damaging 1 Positive Patient 8 BEST1 4 c.279G>C p.Trp93Cys Het Mut Positive Patient 9 BEST1 6 c.652C>T p.Arg218Cys Het Mut Positive Patient 10 BEST1 6 c.652C>T p.Arg218Cys Het Mut Positive Patient 11 BEST1 6 c.680A>G p.Tyr227Cys Het Mut Positive Patient 12 BEST1 6 c.741G>A p.Arg218His Het Mut Positive Patient 13 BEST1 6 c.741G>A p.Arg218His Het Mut Positive Patient 14 BEST1 7 c.727G>A p.Ala243Thr Het Mut Positive Patient 15 BEST1 7 c.727G>A p.Ala243Thr Het Mut Positive Patient 16 BEST1 7 c.728C>T p.Ala243Val Het Mut Positive Patient 17 BEST1 7 c.728C>T p.Ala243Val Het Mut Positive Patient 18 BEST1 8 c.880C>T p.Leu294Phe Het vAR/us Probably damaging 1 Positive Patient 19 BEST1 8 c.887A>G p.Asn296Ser Het Mut Positive Patient 20 BEST1 8 c.903T>G p.Asp301Glu Het Mut Positive Patient 21 BEST1 8 c.903T>G p.Asp301Glu Het Mut Positive Patient 22 BEST1 8 c.910G>A p.Asp304Asn Het Mut Positive Patient 23 BEST1 8 c.925T>C p.Trp309Arg Het vAR/us Probably damaging 1 Positive Patient 24 BEST1 8 c.929T>C p.Ile310Thr Het Mut Positive Patient 25, case 3 BEST1 4 c.250T>G p.Phe84Val Het vAR/us Probably damaging 1 Positive Pattern dystrophy Patient 1 ABCA4 6 c.634C>T p.Arg212Cys Het Mut Positive ABCA4 30 c.4469G>A p.Cys1490Tyr Het Mut Patient 2 ABCA4 17 c.2588G>C p.Gly863Ala Het Mut Unconfirmed Patient 3 ABCA4 IVS26 c.3862&#fe;3A>G Abnormal splicing Het vAR/us Unconfirmed Patient 4 PRPH2 1 c.271T>A p.Tyr91Asn Het vAR/us Probably damaging 0.909 Positive PRPH2 1 c.310-313del(AT) p.Ile104Val Het Mut Patient 5, case 6 PRPH2 1 c.422A>G p.Tyr141Cys Het Mut Positive Patient 6 PRPH2 1 c.422A>G p.Tyr141Cys Het Mut Positive Patient 7 PRPH2 1 c.515G>A p.Arg172Gln Het Mut Positive Patient 8 PRPH2 2 c.583C>T p.Arg195Stop Het Mut Positive Patient 9 PRPH2 2 c.629C>G p.Pro210Arg Het Mut Positive Patient 10 PRPH2 2 c.635G>C p.Ser212Thr Het Mut Positive Patient 11 PRPH2 2 c.683C>T p.Thr228Ile Het Mut Positive Patient 12 PRPH2 2 c.708C>G p.Tyr236Stop Het Mut Positive Patient 13, case 4 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive TABLE 2. Continued Patient Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Molecular Diagnosis Patient 14 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 15 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 16 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 17, case 2 ABCA4 IVS38 c.5461-10T>C None Het Mut Unconfirmed Patient 18 PRPH2 2 c.584G>A p.Arg195Gln Het vAR/us Probably damaging 1 Positive Cone-rod dystrophy Patient 1, dominant GUCY2D 13 c.2512C>T p.Arg838Cys Het Mut Positive Patient 2, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 3, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 4, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 5, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive CRX 3 c.607T>C p.Ser213Pro Het vAR/us Probably damaging 0.999 Patient 6, recessive ABCA4 2 c.156T>G p.His52Gln Het vAR/us Probably damaging 0.998 Positive ABCA4 3 c.161G>A p.Cys54Tyr Het Mut ABCA4 28 c.4169T>C p.Leu1390Pro Het Mut Patient 7, recessive ABCA4 16 c.2385C>T p.Ser795Arg Het vAR/us Probably damaging 0.99 Positive ABCA4 IVS40 c.5714&#fe;5G>A Splice Het Mut Patient 8, recessive ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut Positive ABCA4 45 c.6221G>T p.Gly2074Val Het vAR/us Probably damaging 1 Patient 9, recessive ABCA4 IVS42 c.5898&#fe;1G<A Splice Het Mut Positive ABCA4 IVS42 c.5899-2delA Splice Het Mut Patient 10, recessive ABCA4 5 c.559C>T p.Arg187Cys Het Mut Positive ABCA4 40 c.5645T>C p.Met1882Thr Het Mut Patient 11, recessive ABCA4 6 c.768G>T p.Val256Val (abnlspl) Het Mut Positive ABCA4 31 c.4577C>T p.Thr1526Met Het Mut Patient 12, recessive ABCA4 12 c.1622T>C p.Leu541Pro Het Mut Positive ABCA4 21 c.3113C>T p.Ala1038Val Het Mut ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut ABCA4 22 c.3322C>T p.Arg1108Cys Het Mut Patient 13, recessive ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut Positive ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut Patient 14, recessive ABCA4 13 c.1927G>A p.Val643Met Het Mut Positive ABCA4 24 c.3602T>G p.Leu1201Arg Het Mut ABCA4 36 c.5186T>C p.Leu1729Pro Het Mut Patient 15, recessive ABCA4 23 c.3364G>A p.Glu1122Lys Het Mut Positive ABCA4 48 c.6529G>A p.Asp2177Asn Het Mut Patient 16, recessive ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut Positive ABCA4 28 c.4222T>C p.Trp1408Arg Het Mut Patient 17, recessive ABCA4 11 c.1532G>A p.Arg511His Het Mut Unconfirmed Patient 18, recessive ABCA4 27 c.3899G>A p.Arg1300Gln Het vAR/us Benign 0.143 Unconfirmed Patient 19, recessive ABCA4 13 c.1933G>A p.Asp645Asn Het Mut Unconfirmed Patient 20, recessive ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut Unconfirmed Patient 21, recessive ABCA4 IVS7 c.859-9T>C Unknown Hom vAR/us NA NA Unconfirmed Molecular Diagnostic Testing by eyeGENE IOVS j September 2014 j Vol. 55 j No. 9 j were screened for the p.Arg838His mutation in GUCY2D, and mutations in the CRX, ELOVL4, PRPH2, and/or ABCA4 genes. Login to comment
93 These variants included p.Arg1300Gln and p.Glu1554Gly. Login to comment
116 Mutations or Unknown Variants Detected in Patients With Central Vision Loss Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Frequency* Variant ID Late-onset retinal degeneration CTRP5 NA NA NA NA NA NA NA NA NA Sorsby fundus dystrophy TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 2 TIMP3 5 c.610A>T p.Ser204Cys Het Mut 1 CM941325/ rs137853298 Doyne honeycomb dystrophy EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut 2 CM990504 EFEMP1 IVS10 c.IVS10-14C>T None Het vAR/us NA NA 1 Best macular dystrophy BEST1 2 c.28G>A p.Ala10Thr Het Mut 1 CM982017 BEST1 2 c.47C>T p.Ser16Phe Het Mut 1 CM010520 BEST1 2 c.72G>T p.Trp24Cys Het Mut 1 CM982018 BEST1 3 c.240C>A p.Phe80Leu Het Mut 2 CM004423 BEST1 4 c.248G>C p.Gly83Ala Het vAR/us Probably damaging 1 1 BEST1 4 c.277T>C p.Trp93Arg Het vAR/us Probably damaging 1 1 BEST1 4 c.279G>C p.Trp93Cys Het Mut 1 rs28940273/ CM982021 BEST1 6 c.652C>T p.Arg218Cys Het Mut 2 CM982023 BEST1 6 c.680A>G p.Tyr227Cys Het Mut 1 CM982024 BEST1 6 c.741G>A p.Arg218His Het Mut 2 CM003486 BEST1 7 c.727G>A p.Ala243Thr Het Mut 2 CM004434 BEST1 7 c.728C>T p.Ala243Val Het Mut 2 rs28940570/ CM00841 BEST1 8 c.880C>T p.Leu294Phe Het vAR/us Probably damaging 1 1 BEST1 8 c.887A>G p.Asn296Ser Het Mut 1 CM010524 BEST1 8 c.903T>G p.Asp301Glu Het Mut 2 CM991243 BEST1 8 c.910G>A p.Asp304Asn Het Mut 1 CM024219 BEST1 8 c.925T>C p.Trp309Arg Het vAR/us Probably damaging 1 1 BEST1 8 c.929T>C p.Ile310Thr Het Mut 1 CM000843 BEST1 4 c.250T>G p.Phe84Val Het vAR/us Probably damaging 1 1 Pattern dystrophy ABCA4 6 c.634C>T p.Arg212Cys Het Mut 1 rs61750200 ABCA4 17 c.2588G>C p.Gly863Ala Het Mut 1 CM970003/ rs76157638 ABCA4 IVS26 c.3862&#fe;3A>G Abnormal splicing Het vAR/us 1 NA ABCA4 30 c.4469G>A p.Cys1490Tyr Het Mut 1 CM990056/ rs61751402 ABCA4 IVS38 c.5461-10T>C None Het Mut 1 CS057513 PRPH2 1 c.271T>A p.Tyr91Asn Het vAR/us Probably damaging .909 1 PRPH2 1 c.310-313del(AT) p.Ile104Val Het Mut 1 NA/Deletion PRPH2 1 c.422A>G p.Tyr141Cys Het Mut 2 CM010125/ rs61755781 PRPH2 1 c.515G>A p.Arg172Gln Het Mut 1 CM930637/ rs61755792 PRPH2 2 c.583C>T p.Arg195Stop Het Mut 1 CM032999 PRPH2 2 c.629C>G p.Pro210Arg Het Mut 1 CM941210 PRPH2 2 c.635G>C p.Ser212Thr Het Mut 1 CM971289/ rs61755801 PRPH2 2 c.683C>T p.Thr228Ile Het Mut 1 TMP_ESP_6_ 42672248 PRPH2 2 c.708C>G p.Tyr236Stop Het Mut 1 rs61755813 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut 4 CS010139 PRPH2 2 c.584G>A p.Arg195Gln Het vAR/us Probably damaging 1 1 TABLE 3. Continued Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Frequency* Variant ID Cone-rod dystrophy ABCA4 2 c.156T>G p.His52Gln Het vAR/us Probably damaging 0.998 1 ABCA4 3 c.161G>A p.Cys54Tyr Het Mut 1 CM990012/ rs150774447 ABCA4 28 c.4169T>C p.Leu1390Pro Het Mut 1 CM014810/ rs61752430 ABCA4 16 c.2385C>T p.Ser795Arg Het vAR/us Probably damaging 0.99 1 ABCA4 IVS40 c.5714&#fe;5G>A Splice Het Mut 1 CS982057 ABCA4 27 c.3899G>A p.Arg1300Gln Het vAR/us Benign 0.143 1 ABCA4 32 c.4661A>G p.Glu1554Gly Het vAR/us Benign 0.326 1 ABCA4 30 c.4383G>A p.Trp1461Stop Het Mut 1 Stop/NA ABCA4 IVS38 c.5461-10T>C None Het Mut NA NA 2 CS057513 ABCA4 22 c.3259G>A p.Glu1087Lys Het Mut 1 CM970008/ rs61751398 ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut 2 CM970016/ rs1800553 ABCA4 45 c.6221G>T p.Gly2074Val Het vAR/us Probably damaging 1 1 ABCA4 IVS42 c.5898&#fe;1G<A Splice Het Mut 1 CS011524 ABCA4 IVS42 c.5899-2delA Splice Het Mut 1 rs3112831 CRX 3 c.607T>C p.Ser213Pro Het vAR/us Probably damaging 0.999 1 ABCA4 5 c.559C>T p.Arg187Cys Het Mut 1 COSM913472 ABCA4 40 c.5645T>C p.Met1882Thr Het Mut 1 rs4147830 ABCA4 6 c.768G>T p.Val256Val (abnlspl) Het Mut 1 CM990057/ rs61750152 ABCA4 31 c.4577C>T p.Thr1526Met Het Mut 1 rs62645944 ABCA4 11 c.1532G>A p.Arg511His Het Mut 1 rs140482171 ABCA4 12 c.1622T>C p.Leu541Pro Het Mut 1 CM990022/ rs61751392 ABCA4 21 c.3113C>T p.Ala1038Val Het Mut 1 CM970006/ rs61751374 ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut 2 CM990022/ rs61751392 ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut 2 CM970006/ rs61751374 ABCA4 22 c.3322C>T p.Arg1108Cys Het Mut 1 CM990039/ rs61750120 ABCA4 13 c.1927G>A p.Val643Met Het Mut 1 CM014293/ rs61749417/ rs143548435 ABCA4 24 c.3602T>G p.Leu1201Arg Het Mut 1 CM990042/ rs61750126 ABCA4 36 c.5186T>C p.Leu1729Pro Het Mut 1 CM990062/ rs61750567 ABCA4 13 c.1933G>A p.Asp645Asn Het Mut 1 rs617494181933 ABCA4 23 c.3364G>A p.Glu1122Lys Het Mut 1 CM990041 ABCA4 48 c.6529G>A p.Asp2177Asn Het Mut 1 CM970023/ rs1800555 ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut 2 CM983728/ rs61751404 ABCA4 28 c.4222T>C p.Trp1408Arg Het Mut 1 CM990048/ rs61750135 GUCY2D 13 c.2512C>T p.Arg838Cys Het Mut 1 rs61750172 GUCY2D 13 c.2513G>A p.Arg838His Het Mut 5 CM012606/ rs61750173 ABCA4 IVS7 c.859-9T>C Unknown Hom vAR/us NA NA 1 ABCA4 42 c.5882G>A p.Gly1961Glu Hom Mut 1 CM970016/ rs1800553 ABCA4 43 c.5917delG Deletion Hom Mut 1 RISN_ABCR: c.5917delG Molecular Diagnostic Testing by eyeGENE IOVS j September 2014 j Vol. 55 j No. 9 j Six patients with late-onset retinal pathology and drusen had well-characterized clinical data. Login to comment