ABCMdb

ABCA4 p.Arg602Trp

ClinVar:	c.1805G>A , p.Arg602Gln ? , not provided c.1804C>T , p.Arg602Trp ? , not provided
Predicted by SNAP2:	A: D (59%), C: D (59%), D: D (59%), E: D (59%), F: D (59%), G: D (53%), H: N (66%), I: D (53%), K: N (78%), L: D (53%), M: D (53%), N: N (66%), P: D (59%), Q: D (71%), S: N (66%), T: N (66%), V: D (53%), W: D (85%), Y: N (53%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: N, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Ubiquitin-mediated proteasomal degradation of ABC ... J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12. Nakagawa H, Toyoda Y, Wakabayashi-Nakao K, Tamaki H, Osumi M, Ishikawa T
Ubiquitin-mediated proteasomal degradation of ABC transporters: a new aspect of genetic polymorphisms and clinical impacts.
J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12., [PMID:21567408]

Abstract [show]
The interindividual variation in the rate of drug metabolism and disposition has been known for many years. Pharmacogenomics dealing with heredity and response to drugs is a part of science that attempts to explain variability of drug responses and to search for the genetic basis of such variations or differences. Genetic polymorphisms of drug metabolizing enzymes and drug transporters have been found to play a significant role in the patients' responses to medication. Accumulating evidence demonstrates that certain nonsynonymous polymorphisms have great impacts on the protein stability and degradation, as well as the function of drug metabolizing enzymes and transporters. The aim of this review article is to address a new aspect of protein quality control in the endoplasmic reticulum and to present examples regarding the impact of nonsynonymous single-nucleotide polymorphisms on the protein stability of thiopurine S-methyltransferase as well as ATP-binding cassette (ABC) transporters including ABCC4, cystic fibrosis transmembrane conductance regulator (CFTR, ABCC7), ABCC11, and ABCG2. Furthermore, we will discuss the molecular mechanisms underlying posttranslational modifications (intramolecular and intermolecular disulfide bond formation and N-linked glycosylation) and ubiquitin-mediated proteasomal degradation of ABCG2, one of the major drug transporter proteins in humans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
155 Effect of Mutations and Nonsynonymous SNPs on Protein Trafficking, Maturation, or ERAD of ABC Transporters Protein AA Mutation/SNP Effect on Protein Reference ABCA1 W590S Mutation Functional defect 115 R587W Mutation Impaired glycol processing 115 Q597R Mutation Impaired glycol processing, ERAD 115,116 Y1532C Mutation Altered protein trafficking 117 R1925Q Mutation Altered protein trafficking 118 ABCA3 R43L Mutation Altered protein trafficking 119 L101P Mutation Altered protein trafficking 119 R280C Mutation Altered protein trafficking 119 ABCA4 L541P Mutation Mislocalization 120 R602W Mutation Mislocalization 120 A1038V Mutation Mislocalization 120 C1490Y Mutation Mislocalization 120 ABCB1a G268V Mutation ERAD 121 G341C Mutation ERAD 121 I1196S Mutation Reduced glycosylation 122 ABCB4 I541F Mutation Accumulation in ER 123 ABCB11a E135K Mutation Reduced level of mature protein 124 L198P Mutation Reduced level of mature protein 124 E297G Mutation Reduced level of mature protein 124 L413W Mutation Reduced level of mature protein 124 R432T Mutation Reduced level of mature protein 124 D482G Mutation Immature protein in ER 124,125 N490D Mutation Reduced level of mature protein 124 A570T Mutation Reduced level of mature protein 124 T655I Mutation Reduced level of mature protein 124 Y818F SNP Moderate reduction of protein 124 G982R Mutation Retention in ER 125 R1153C Mutation ERAD 125 R1286Q Mutation Retention in ER 125 ABCC2a R768W Mutation Impaired protein trafficking 126 I1173F Mutation Impaired protein maturation 127 R1392 Mutation Impaired protein maturation 128 M1393 Mutation Impaired protein maturation 129 ABCC4a E757K SNP Altered protein trafficking 23 ABCC7 F508 Mutation Misfolding, ERAD 36-39,130 G85E Mutation Impaired protein maturation 130-132 G91R Mutation Impaired protein maturation 130-132 N1303K Mutation Impaired protein maturation 130-132 ABCC8 WT Wild type Ubiquitin-proteasome degradation 133 A116P Mutation Ubiquitin-proteasome degradation 133 V187D Mutation Ubiquitin-proteasome degradation 133 F1388 Mutation Impaired protein trafficking 134 L1544P Mutation Impaired protein trafficking 135,136 ABCC11a G180R SNP Ubiquitin-proteasome degradation 50 27 Mutation Ubiquitin-proteasome degradation 50 ABCG2a V12M SNP Altered protein localization 96 Q141K SNP Ubiquitin-proteasome degradation 102 F208S SNP Ubiquitin-proteasome degradation 78,99 S441N SNP Ubiquitin-proteasome degradation 78,99 Mutations of ABCA1, ABCA3, ABCA4, ABCB4, ABCB11, ABCC2, ABCC7 (CFTR), and ABCC8 are associated with Tangier disease, fatal surfactant deficiency, Stargardt disease, progressive familial intrahepatic cholestasis type 3 (PFIC-3), progressive familial intrahepatic cholestasis type 2 (PFIC-2), Dubin-Johnson syndrome, cystic fibrosis, and familial hyperinsulinism, respectively. Login to comment

[hide] A point mutation in ABC1 gene in a patient with se... Atherosclerosis. 2001 Feb 15;154(3):599-605. Bertolini S, Pisciotta L, Seri M, Cusano R, Cantafora A, Calabresi L, Franceschini G, Ravazzolo R, Calandra S
A point mutation in ABC1 gene in a patient with severe premature coronary heart disease and mild clinical phenotype of Tangier disease.
Atherosclerosis. 2001 Feb 15;154(3):599-605., [PMID:11257260]

Abstract [show]
The proband is a 50 year-old woman born from a consanguineous marriage. She has been suffering from angina pectoris since the age of 38 and underwent coronary bypass surgery for three-vessel disease at 48. The presence of low plasma levels of total cholesterol and high density lipoprotein (HDL) cholesterol (2.4 and 0.1 mmol/l) and apo AI (<15 mg/dl), associated with corneal lesions and a mild splenomegaly suggested the diagnosis of Tangier disease. However, none of the other features of Tangier disease, including hepatomegaly, anemia and peripheral neuropathy, were present. The analysis of the dinucleotide microsatellites located in chromosome 9q31 region demonstrated that the proband was homozygous for the alleles of D9S53, D9S1784 and D9S1832. The mother and son of the proband, both with low levels of HDL cholesterol, shared one of the proband's haplotypes, whereas neither of these haplotypes was present in the normolipidemic proband's sister. The sequence of ATP-binding cassette transporter 1 (ABC1-1) cDNA obtained by reverse transcription-PCR (RT-PCR) of total RNA isolated from cultured fibroblasts showed that the proband was homozygous for a C>T transition in exon 13, which caused a tryptophane for arginine substitution (R527W). This mutation was confirmed by direct sequencing of exon 13 amplified from genomic DNA. It can be easily screened, as the nucleotide change introduces a restriction site for the enzyme Afl III. R527W substitution occurs in a highly conserved region of the NH2 cytoplasmic domain of ABC1 protein. R527W co-segregates with the low HDL phenotype in the family and was not found in 200 chromosomes from normolipidemic individuals.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 In this work we report the characterization of a new point mutation (R527W) in the ABC1 gene in a subject with severe hypoalphalipoproteinemia associated with a ''mild expression`` of the typical clinical phenotype of Tangier disease. It is likely that R527W substitution is the cause of Tangier disease in our patient for the following reasons: (1) it was not found in 200 chromosomes from normolipidemic individuals; (2) it co-segregates with the low HDL-cholesterol phenotype in proband`s family; (3) the arginine at position 527 appears to be highly conserved in the evolution, being present in the same position in mouse ABC1 protein [20]; (4) the presence of R602W mutation in the ABCR protein (a photoreceptor specific ATP-binding cassette protein expressed in human retina, which has a 50% homology with ABC1 protein) causes Stargardt disease (a recessive form of macular dystrophy) [21]. Login to comment
116 In this work we report the characterization of a new point mutation (R527W) in the ABC1 gene in a subject with severe hypoalphalipoproteinemia associated with a ''mild expression`` of the typical clinical phenotype of Tangier disease. It is likely that R527W substitution is the cause of Tangier disease in our patient for the following reasons: (1) it was not found in 200 chromosomes from normolipidemic individuals; (2) it co-segregates with the low HDL-cholesterol phenotype in proband`s family; (3) the arginine at position 527 appears to be highly conserved in the evolution, being present in the same position in mouse ABC1 protein [20]; (4) the presence of R602W mutation in the ABCR protein (a photoreceptor specific ATP-binding cassette protein expressed in human retina, which has a 50% homology with ABC1 protein) causes Stargardt disease (a recessive form of macular dystrophy) [21]. Login to comment

[hide] A subgroup of age-related macular degeneration is ... Invest Ophthalmol Vis Sci. 2012 Apr 30;53(4):2112-8. doi: 10.1167/iovs.11-8785. Print 2012 Apr. Fritsche LG, Fleckenstein M, Fiebig BS, Schmitz-Valckenberg S, Bindewald-Wittich A, Keilhauer CN, Renner AB, Mackensen F, Mossner A, Pauleikhoff D, Adrion C, Mansmann U, Scholl HP, Holz FG, Weber BH
A subgroup of age-related macular degeneration is associated with mono-allelic sequence variants in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2012 Apr 30;53(4):2112-8. doi: 10.1167/iovs.11-8785. Print 2012 Apr., [PMID:22427542]

Abstract [show]
Purpose. Age-related macular degeneration (AMD) is a heterogeneous condition of high prevalence and complex etiology involving genetic as well as environmental factors. By fundus autofluorescence (FAF) imaging, AMD can be classified into several distinct phenotypes, with one subgroup characterized by fine granular pattern with peripheral punctate spots (GPS[+]). Some features of GPS[+] overlap with Stargardt disease (STGD1), a recessive macular dystrophy caused by biallelic sequence variants in the ATP-binding cassette transporter 4 (ABCA4) gene. The aim of this study was to investigate the role of ABCA4 in GPS[+]. Methods. The ABCA4 gene was sequenced in 25 patients with the GPS[+] phenotype and 29 with geographic atrophy (GA)-AMD but no signs of GPS (GPS[-]). In addition, frequencies of risk-increasing alleles at three known AMD susceptibility loci, including complement factor H (CFH), age-related maculopathy susceptibility 2 (ARMS2), and complement component 3 (C3), were evaluated. Results. We demonstrate that GPS[+] is associated significantly with monoallelic ABCA4 sequence variants. Moreover, frequencies of AMD risk-increasing alleles at CFH, ARMS2, and C3 are similar in GPS[+] and STGD1 patients, with risk allele frequencies in both subcategories comparable to population-based control individuals estimated from 3,510 individuals from the NHLBI Exome Sequencing Project. Conclusions. Our data suggest that the GPS[+] phenotype is accounted for by monoallelic variants in ABCA4 and unlikely by the well-established AMD risk-increasing alleles at CFH, ARMS2, and C3. These findings provide support for a complex role of ABCA4 in the etiology of a minor proportion of patients with AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 The patient carries a heterozygous, complex disease allele (c.1622T>C, p.L541P; c.3113C>T, p.A1038V) in the ABCA4 gene. Login to comment
90 Due to lack of DNA from further family members, segregation of variants c.3113C>T (p.A1038V) / c.3752delA (p.Glu1251fs) and c.1804C>T (p.R602W) / c.1928T>G (p.V643G) could not be assessed further (Supplementary Table S5). Login to comment

[hide] Stargardt macular dystrophy: common ABCA4 mutation... Mol Vis. 2012;18:280-9. Epub 2012 Feb 1. Roberts LJ, Nossek CA, Greenberg LJ, Ramesar RS
Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients.
Mol Vis. 2012;18:280-9. Epub 2012 Feb 1., [PMID:22328824]

Abstract [show]
PURPOSE: Based on the previous indications of founder ATP-binding cassette sub-family A member 4 gene (ABCA4) mutations in a South African subpopulation, the purpose was to devise a mechanism for identifying common disease-causing mutations in subjects with ABCA4-associated retinopathies (AARs). Facilitating patient access to this data and determining the frequencies of the mutations in the South African population would enhance the current molecular diagnostic service offered. METHODS: The majority of subjects in this study were of Caucasian ancestry and affected with Stargardt macular dystrophy. The initial cohort consisted of DNA samples from 181 patients, and was screened using the ABCR400 chip. An assay was then designed to screen a secondary cohort of 72 patients for seven of the most commonly occurring ABCA4 mutations in this population. A total of 269 control individuals were also screened for the seven ABCA4 mutations. RESULTS: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. The newly designed genetic assay identified two of the seven disease-associated mutations in 28/72 patients in a secondary patient cohort. In the control cohort, 12/269 individuals were found to be heterozygotes, resulting in an estimated background frequency of these mutations in this particular population of 4.46 per 100 individuals. CONCLUSIONS: The relatively high detection rate of seven ABCA4 mutations in the primary patient cohort led to the design and subsequent utility of a multiplex assay. This assay can be used as a viable screening tool and to reduce costs and laboratory time. The estimated background frequency of the seven ABCA4 mutations, together with the improved diagnostic service, could be used by counselors to facilitate clinical and genetic management of South African families with AARs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Results: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. Login to comment
52 Four of the mutations were detected with SNaPshot PCR (p.Cys1490Tyr, p.Arg602Trp, c.5461-10T>C, and p.Leu2027Phe mutations; Table 2, Figure 1, Figure 2, and Figure 3) using the SNaPshot® Multiplex Ready Reaction Mix (Applied Biosystems, Warrington, UK), resolved on the ABI 3100 Genetic Analyzer (Applied Biosystems) and subsequently analyzed using the GeneMapper 3.0 GeneScan software (Applied Biosystems). Login to comment
61 Exon (mutation) Primer 5'-3' Annealing temperature Mutation detection technique Exon 5 (p.Arg152*) F: gacccatttccccttcaac 60 °C dHPLC, Cycle sequencing using the reverse primer R: aggctgggtgcttccctc Exon 6 (c.768G>T) F: ggtgtctttcctaccacag 57.9 °C dHPLC, Cycle sequencing using the forward primer R: aggaatcaccttgcaattgg Exon 13 (p.Arg602Trp) F: agctatccaagcccgttcc 63 °C SNaPshot PCR R: ccattagcgtgtcatggag Exon 17 (p.Gly863Ala) F: ctgcggtaaggtaggataggg 60 °C Allele-specific PCR R: cacaccgtttacatagagggc Exon 30 (p.Cys1490Tyr) F: gtcagcaactttgaggctg 63 °C SNaPshot PCR R: tccctctgtggcaggcag Intron38/Exon39 (c.5461-10T>C) F: gccccacctgctgaagag 63 °C SNaPshot PCR R: tcccagctttggacccag Exon 44 (p.Leu2027Phe) F: gaagcttctccagccctagc 63 °C SNaPshot PCR R: tgcactctcatgaaacaggc TABLE 2. Login to comment
63 Exon (mutation) Primer length (bp) with tail Primer sequence (with tail, 5'-3')* 13 (p.Arg602Trp) 34 R: tgttccagtgccacgaacccgccccagatgtacc 30 (p.Cys1490Tyr) 32 R: cttcgtggttactgagcttctccctggtgctg 39 (Intron 38) (c.5461-10T>C) 37 F: ccgatgtagttgaccccgtttccaacagtcctacttc 44 (p.Leu2027Phe) 41 R: tactctggatcttagtaggtaaagatgttctcgtcctgtga *ThenucleotidesequenceinboldisthesequencedesignedtobindcomplementarytothegenomicDNAsequence.Thenucleotide sequence not written in bold is the random nucleotide tail added to the primer sequence. Figure 1. Login to comment
64 An electropherogram of the multiplex SNaPshot reaction shows the results obtained for a sample that is heterozygous for the p.Arg602Trp and p.Cys1490Tyr mutations. Login to comment
65 The p.Arg602Trp alleles are indicated by blue and green peaks at 36 bp and 37 bp, respectively. Login to comment
73 However, seven mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a significantly higher frequency, compared to the other variants in the cohort (Table 4). Login to comment
88 Functional analysis of the p.Arg602Trp and p.Cys1490Tyr mutations showed that these missense alleles result in misfolding and mislocalization of the ABCA4 protein, as well as a marked reduction in ATPase activity [12]. Login to comment
139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment
142 The results obtained from the control cohort screening indicate that the carrier frequency of the p.Cys1490Tyr, p.Arg602Trp, and p.Gly863Ala mutations is slightly higher compared to the other mutations (p.Leu2027Phe, c.768G>T, and p.Arg152*), with the c.5461-10T>C mutation not detected at all. Login to comment
166 Mutant alleles Cohort p.Cys1490Tyr p.Arg602Trp p.Leu2027Phe c.5461-10T>C c.768G>T p.Gly863Ala p.Arg152* Patient (n=72; 144 alleles) 16 (11.11%) 10 (6.94%) 12 (8.33%) 13 (9.03%) 13 (9.03%) 7 (4.86%) 7 (4.86%) Control (total; n=269; 538 alleles) 2 (0. Login to comment

[hide] Quantification of peripapillary sparing and macula... Invest Ophthalmol Vis Sci. 2011 Oct 10;52(11):8006-15. Print 2011. Burke TR, Rhee DW, Smith RT, Tsang SH, Allikmets R, Chang S, Lazow MA, Hood DC, Greenstein VC
Quantification of peripapillary sparing and macular involvement in Stargardt disease (STGD1).
Invest Ophthalmol Vis Sci. 2011 Oct 10;52(11):8006-15. Print 2011., [PMID:21873672]

Abstract [show]
PURPOSE: To quantify and compare structure and function across the macula and peripapillary area in Stargardt disease (STGD1). METHODS: Twenty-seven patients (27 eyes) and 12 age-similar controls (12 eyes) were studied. Patients were classified on the basis of full-field electroretinogram (ERG) results: Fundus autofluorescence (FAF) and spectral domain-optical coherence tomography (SD-OCT) horizontal line scans were obtained through the fovea and peripapillary area. The thicknesses of the outer nuclear layer plus outer plexiform layer (ONL+), outer segment (OS), and retinal pigment epithelium (RPE) were measured through the fovea, and peripapillary areas from 1 degrees to 4 degrees temporal to the optic disc edge using a computer-aided, manual segmentation technique. Visual sensitivities in the central 10 degrees were assessed using microperimetry and related to retinal layer thicknesses. RESULTS: Compared to the central macula, the differences between controls and patients in ONL+, OS, and RPE layer thicknesses were less in the nasal and temporal macula. Relative sparing of the ONL+ and/or OS layers was detected in the nasal (i.e., peripapillary) macula in 8 of 13 patients with extramacular disease on FAF; relative functional sparing was also detected in this subgroup. All 14 patients with disease confined to the central macula, as detected on FAF, showed ONL+ and OS layer thinning in regions of normal RPE thickness. CONCLUSIONS: Relative peripapillary sparing was detected in STGD1 patients with extramacular disease on FAF. Photoreceptor thinning may precede RPE degeneration in STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 Summary of Clinical, Demographic, and Genetic Data Patient Sex Age at Exam (y) Eye VA BCEA 1 SD (deg 2 ) Eccentricity of PRL (deg) ERG Group FAF Abnormalities Allele 1 Allele 2 Allele 3 Distribution Peripapillary Area 1 F 43 OS 20/20 0.73 0 II M - A1799D ND ND 2 M 30 OS 20/150 3.21 6 I M - T1253M G1961E ND 3 F 55 OD 20/30 1.82 0 I EM - G863A IVS28af9;5 Gb0e;T ND 4 M 44 OD 20/25 0.65 0 I M - E161K ND ND 5.1 F 24 OD 20/200 1.57 1 I M - L541P/A1038V G1961E ND 5.2 F 22 OD 20/30 2.74 1 I M - L541P/A1038V G1961E ND 6.1 F 21 OD 20/150 2.01 1 I M - L541P/A1038V G1961E ND 6.2 F 18 OS 20/100 3.09 4 I M - L541P/A1038V G1961E ND 7 F 27 OS 20/400 2.97 9* II EM Peripapillary atrophy L2027F G851D ND 8 M 34 OS 20/100 2.16 4 I M - G1961E G1961E ND 9 M 20 OS 20/150 2.77 4 I M - IVS20af9;5 Gb0e;A G1961E ND 10 F 23 OS 20/150 9.05 5 I M - L541P/A1038V I1846T ND 11 M 59 OS 20/100 6.52 10 II EM - P1380L S1696N ND 12 M 49 OD 20/150 9.97 1 I EM Nasalaf9;temporal flecks R1108H P1380L ND 13 M 47 OS 20/80 5.62 7 I EM - G863A Y106X ND 14 F 42 OD 20/200 9.53 9 I EM Temporal flecks N965S ND ND 15 M 14 OD 20/200 23.84 1 II EM Nasal flecks IVS38-10 Tb0e;C IVS40af9;5 Gb0e;A ND 16 M 52 OS 20/20 1.3 0 I M - IVS38-10 Tb0e;C ND ND 17 M 34 OS 20/30 2.8 1 I M - L541P/A1038V G1961E ND 18 F 33 OD 20/100 6 6 I M - G1961E R2077W ND 19 F 22 OS 20/60 11 4 I M - A854T A1038V C2150Y 20 F 34 OS 20/200 14.2 14 I EM - G1961E ND ND 21 F 19 OD 20/200 3.7 12 I EM - R602W M18821 ND 22 F 27 OD 20/400 9.6 9 II EM Peripapillary atrophy P1380L P1380L ND 23 F 18 OS 20/50 4.9 5 I EM - R1640W V1693I ND 24 M 22 OS 20/150 10.5 2 I EM - C54Y ND ND 25 M 44 OS 20/150 9.1 5 I EM - R1640W ND ND VA, visual acuity; Rel. Login to comment

[hide] Further associations between mutations and polymor... Invest Ophthalmol Vis Sci. 2011 Aug 5;52(9):6206-12. Print 2011 Aug. Aguirre-Lamban J, Gonzalez-Aguilera JJ, Riveiro-Alvarez R, Cantalapiedra D, Avila-Fernandez A, Villaverde-Montero C, Corton M, Blanco-Kelly F, Garcia-Sandoval B, Ayuso C
Further associations between mutations and polymorphisms in the ABCA4 gene: clinical implication of allelic variants and their role as protector/risk factors.
Invest Ophthalmol Vis Sci. 2011 Aug 5;52(9):6206-12. Print 2011 Aug., [PMID:21330655]

Abstract [show]
PURPOSE: Mutations in ABCA4 have been associated with autosomal recessive Stargardt disease, autosomal recessive cone-rod dystrophy, and autosomal recessive retinitis pigmentosa. The purpose of this study was to determine (1) associations among mutations and polymorphisms and (2) the role of the polymorphisms as protector/risk factors. METHODS: A case-control study was designed in which 128 Spanish patients and 84 control individuals were analyzed. Patient samples presented one or two mutated alleles previously identified using ABCR400 microarray and sequencing. RESULTS: A total of 18 previously described polymorphisms were studied in patients and control individuals. All except one presented a polymorphisms frequency higher than 5% in patients, and five mutations were found to have a frequency >5%. The use of statistical methods showed that the frequency of the majority of polymorphisms was similar in patients and controls, except for the IVS10+5delG, p.Asn1868Ile, IVS48+21C>T, and p.Arg943Gln polymorphisms. In addition, IVS48+21C>T and p.Arg943Gln were found to be in linkage disequilibrium with the p.Gly1961Glu and p.Arg602Trp mutations, respectively. CONCLUSIONS: Although the high allelic heterogeneity in ABCA4 and the wide spectrum of many common and rare polymorphisms complicate the interpretation of clinical relevance, polymorphisms were identified that may act as risk factors (p.Asn1868Ile) and others that may act as protection factors (p.His423Arg and IVS10+5 delG).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 In addition, IVS48ϩ21CϾT and p.Arg943Gln were found to be in linkage disequilibrium with the p.Gly1961Glu and p.Arg602Trp mutations, respectively. Login to comment
72 Mutations and Polymorphisms in the Patient Cohort ABCA4 mutation screening demonstrated that the most frequent (Ͼ5%) disease-associated alleles were the following: p.Arg1129Leu, p.Gly1961Glu, p.Arg602Trp, c.3211insGT, and p.Leu2060Arg (Table 1; Fig. 1). Login to comment
83 Most Frequent ABCA4 Disease-Associated Alleles Identified in the Patient Cohort Exon Nucleotide Change Aminoacid Change Patients n (%) Allele Frequency n (%) Controls n (%) Allele Frequency n (%) P 23 c.3386GϾT p.Arg1129Leu 34 (26.6) 38 (14.8) 0 (0.0) 0 (0.0) 0.000 42 c.5882GϾA p.Gly1961Glu 18 (14.1) 18 (7.0) 1 (1.2) 1 (0.6) 0.001 13 c.1804CϾT p.Arg602Trp 8 (6.3) 9 (3.5) 0 (0.0) 0 (0.0) 0.020 22 c.3211insGT Frameshift 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 45 c.6179TϾG p.Leu2060Arg 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 Note that only the p.Gly1961Glu substitution was identified in both patients and control groups. Login to comment
88 p.Arg602Trp The p.Arg602Trp mutation was found to be the third most prevalent missense variant, with a frequency of 6.3% (Table 1). Login to comment
89 Using the Pearson`s ␹;2 test, a significant association was detected between this alteration and the p.Arg943Gln polymorphism (P Ͻ 0.001), since 62.5% of the patients showed both sequence variants. Login to comment
91 In contrast with this, the p.Leu1938Leu variant was less frequently detected among patients with p.Arg602Trp and had a frequency of 0% (P ϭ 0.05) (Table 3). Login to comment
94 p.Arg212H is p.Pro327Pro p.H is423Arg p.H is423H is IVS10+5delG p.Arg602Trp p.Arg943G ln c.3211insG T p.Arg1129Leu p.Pro1401Pro IVS33+48C >Tp.Leu1894Leu p-Leu1938Leu p.Pro1948Leu p.Pro1948Pro p.G ly1961G lup.Leu2060Argp.Asp2095Asp IVS48+21C >T - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - p.Asn1868Ile p.Ile2023Ile p.Ile2083Ile p.Ser2255Ile PATIENTSCONTROLS FIGURE 1. Login to comment
109 Association between the Most Frequent ABCA4 Polymorphisms and Mutations Patients Variants Frequency P Status Predicted Effect Mutation, n (%) p.Arg1129Leu 34 (26.6) Present polymorphisms p.His423Arg 94.1% 0.000 Associated Risk IVS33؉48C>T 100% 0.011 Associated Risk IVS10ϩ5delG 20.6% 0.049 Associated Protector p.Leu1938Leu 17.6% 0.033 Associated Protector p.Ser2255Ile 2.9% 0.054 Associated Protector Mutation, n (%) p.Gly1961Glu 18 (14.1) Present polymorphisms p.Pro1948Pro 94.7% 0.000 Associated Risk p.Leu1938Leu 89.5% 0.000 Associated Risk p.Asp2095Asp 78.9% 0.000 Associated Risk IVS48؉21C>T 70.0% 0.000 Associated Risk IVS10؉5delG 57.9% 0.008 Associated Risk p.His423Arg 31.6% 0.016 Associated Protector p.Asn1868Ile 18.7% 0.039 Associated Protector Mutation, n (%) p.Arg602Trp 8 (6.3%) Present polymorphisms p.Arg943Gln 62.5% 0.000 Associated Risk p.Pro1401Pro 25% 0.044 Associated Protector p.Leu1938Leu 0% 0.041 Associated Protector Mutation, n (%) c.3211insGT 7 (5.5%) Present polymorphisms p.His423Arg 100% 0.021 Associated Risk p.Asn1868Ile 100% 0.000 Associated Risk IVS10ϩ5delG 0% 0.047 Associated Protector Mutation, n (%) p.Leu2060Arg 7 (5.5%) Present polymorphisms p.Leu1938Leu 100% 0.000 Associated Risk p.Pro1948Leu 100% 0.000 Associated Risk p.His423Arg 14.3% 0.019 Associated Protector TABLE 4. Login to comment
129 The p.Arg943Gln polymorphism is in linkage disequilibrium with the p.Arg602Trp mutation in Spanish STGD (P Ͻ 0.001, Table 3). Login to comment
136 We found an association between p.Arg602Trp and p.Arg943Gln that has not been observed in other populations. Login to comment
73 Mutations and Polymorphisms in the Patient Cohort ABCA4 mutation screening demonstrated that the most frequent (b0e;5%) disease-associated alleles were the following: p.Arg1129Leu, p.Gly1961Glu, p.Arg602Trp, c.3211insGT, and p.Leu2060Arg (Table 1; Fig. 1). Login to comment
84 Most Frequent ABCA4 Disease-Associated Alleles Identified in the Patient Cohort Exon Nucleotide Change Aminoacid Change Patients n (%) Allele Frequency n (%) Controls n (%) Allele Frequency n (%) P 23 c.3386Gb0e;T p.Arg1129Leu 34 (26.6) 38 (14.8) 0 (0.0) 0 (0.0) 0.000 42 c.5882Gb0e;A p.Gly1961Glu 18 (14.1) 18 (7.0) 1 (1.2) 1 (0.6) 0.001 13 c.1804Cb0e;T p.Arg602Trp 8 (6.3) 9 (3.5) 0 (0.0) 0 (0.0) 0.020 22 c.3211insGT Frameshift 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 45 c.6179Tb0e;G p.Leu2060Arg 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 Note that only the p.Gly1961Glu substitution was identified in both patients and control groups. Login to comment
92 In contrast with this, the p.Leu1938Leu variant was less frequently detected among patients with p.Arg602Trp and had a frequency of 0% (P afd; 0.05) (Table 3). Login to comment
149 The p.Arg943Gln polymorphism is in linkage disequilibrium with the p.Arg602Trp mutation in Spanish STGD (P b0d; 0.001, Table 3). Login to comment
156 We found an association between p.Arg602Trp and p.Arg943Gln that has not been observed in other populations. Login to comment

[hide] Molecular analysis of the ABCA4 gene for reliable ... Br J Ophthalmol. 2009 May;93(5):614-21. Epub 2008 Nov 21. Aguirre-Lamban J, Riveiro-Alvarez R, Maia-Lopes S, Cantalapiedra D, Vallespin E, Avila-Fernandez A, Villaverde-Montero C, Trujillo-Tiebas MJ, Ramos C, Ayuso C
Molecular analysis of the ABCA4 gene for reliable detection of allelic variations in Spanish patients: identification of 21 novel variants.
Br J Ophthalmol. 2009 May;93(5):614-21. Epub 2008 Nov 21., [PMID:19028736]

Abstract [show]
BACKGROUND/AIMS: Mutations in ABCA4 have been associated with autosomal recessive Stargardt disease (STGD), a few cases with autosomal recessive cone-rod dystrophy (arCRD) and autosomal recessive retinitis pigmentosa (arRP). The purpose of the study was threefold: to molecularly characterise families with no mutations or partially characterised families; to determine the specificity and sensitivity of the genotyping microarray; and to evaluate the efficiency of different methodologies. METHODS: 23 STGD, five arCRD and three arRP Spanish patients who were previously analysed with the ABCR400 microarray were re-evaluated. Results were confirmed by direct sequencing. In patients with either none or only one mutant allele, ABCA4 was further analysed by denaturing high-performance liquid chromatography (dHPLC) and multiplex ligation-dependent probe amplification (MLPA). Haplotype analysis was also performed. RESULTS: In the first analysis performed with the microarray, 27 ABCA4 variants (27/62; 43.5%) were found. By dHPLC scanning, 12 novel mutations were additionally identified. In addition, two previously described mutations, one false negative (1/62; 1.6%) and one false positive (1.6%), were detected. MLPA analysis did not reveal additional substitutions. The new strategy yielded an increment of 21% compared with the approach used in the first round. CONCLUSION: ABCA4 should be analysed by optimal combination of high-throughput screening techniques such as microarray, dHPLC and direct sequencing. To the best of our knowledge, this strategy yielded significant mutational spectrum identification in Spanish patients with ABCA4-associated phenotypes. Follow-up of patients, presenting an early onset of the disease and severe mutations, seems essential to perform accurate genotype-phenotype correlations and further characterisation of pathological ABCA4 alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Clinical science Br J Ophthalmol 2009;93:614-621. doi:10.1136/bjo.2008.145193 Table 1 Clinical findings of the Spanish patients with Stargardt disease (STGD), autosomal recessive cone-rod dystrophy and autosomal recessive retinitis pigmentosa Pedigree Age (years) Age (years) of onset Visual acuity Diagnosis Allele 1 Allele 2 Segregation OD OS Nucleotide changes (exons) Amino acid change Nucleotide changes (exons) Amino acid change ARDM-135 42 24 0.4 0.6 STGD c.5882G.A(42) p.Gly1961Glu c.1029_1030insT(8) p.Asn344fsX NP ARDM-240 15 13 0.2 0.16 STGD c.5882G.A(42) p.Gly1961Glu c.2285C.A(15) p.Ala762Glu Yes ARDM-225 32 25 0.25 0.50 STGD c.5882G.A(42) p.Gly1961Glu c.6559C.T(48) p.Gln2187X Yes ARDM-164 21 11 NA STGD c.3386G.T(23) p.Arg1129Leu c.700C.T(6) p.Gln234X Yes ARDM-162 50 16 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND Yes ARDM-198 27 19 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND NP ARDM-125 31 9 0.3 0.4 STGD c.3211insGT(22) FS p.KNLFA1876dup Yes ARDM-158 24 9 0.2 0.2 STGD c.3211insGT(22) FS c.4537delC(30) p.Gln1513fsX1525 NP ARDM-165 40 30 NA STGD c.3211insGT(22) FS ND ND NP ARDM-167 49 23 0.05 0.05 STGD c.3211insGT(22) FS ND ND NP ARDM-146 32 13 0.06 0.1 STGD c.3056C.T(21) p.Thr1019Met c.6140T.A(44) p.Ile2047Asn Yes ARDM-40 46 9 0.1 0.1 STGD c.3056C.T(21) p.Thr1019Met c.3943C.T(27) p.Gln1315X Yes ARDM-90 26 8 Hand moving STGD c.5929G.A (43) p.Gly1977Ser IVS21-2A.T Yes ARDM-181 57 16 0.1 0.09 STGD c.3323G.A (22) p.Arg1108His IVS38+5G.A Yes ARDM-197 35 15 0.1 0.1 STGD c.4793C.A(34) (false +) p.Ala1598Asp (false +) c.5172G.T(36) p.Trp1724Cys Yes ARDM-183 63 55 0.150 0.175 STGD c.6079C.T(44) p.Leu2027Phe c.5929G.A(43) (false -) p.Gly1977Ser (false -) NP ARDM-38 35 6 0.01 0.02 STGD c.1804C.T(13) p.Arg602Trp c.4739delT(33) p.Leu1580fs Yes ARDM-163 48 32 0.01 0.32 STGD c.4457C.T(30) p.Pro1486Leu ND ND Yes ARDM-166 42 39 NA STGD c.6320G.A(46) p.Arg2107His ND ND Yes ARDM-222 26 23 NA STGD c.2791G.A(19) p.Val931Met ND ND NP ARDM-160 30 5 0.25 0.1 STGD ND ND ND ND Yes ARDM-173 49 7 NA STGD ND ND ND ND Yes ARDM-205 NA NA NA STGD c.4919G.A(35) p.Arg1640Gln ND ND NP ARDM-247 30 12 0.05 0.1 CRD c.3386G.T(23) p.Arg1129Leu c.6410G.A(47) p.Cys2137Tyr Yes ARDM-99 59 46 0.05 0.05 CRD c.4297G.A(29) p.Val1433Ile ND ND NP ARDM-131 27 15 0.9 0.7 CRD c.2701A.G(18) p.Thr901Ala ND ND Yes ARDM-100 28 4 0.2 0.16 CRD ND ND ND ND Yes ARDM-142 30 25 0.8 0.5 CRD ND ND ND ND Yes RP-773 38 20 0.05 0.05 RP c.33N86G.T(23) p.Arg1129Leu ND ND NP RP-959 53 10 0.1 0.1 RP c.466A.G(5) p.Ile156Val ND ND Yes RP-1058 37 6 0.2 0.6 RP c.4297G.A(29) p.Val1433Ile ND ND NP Twenty-seven out of 31 subjects were found to be compound heterozygous for mutations in the ABCA4 gene detected by microarray. Login to comment

[hide] Clinical utility of the ABCR400 microarray: basing... Arch Ophthalmol. 2009 Apr;127(4):549-54. Roberts LJ, Ramesar RS, Greenberg J
Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip.
Arch Ophthalmol. 2009 Apr;127(4):549-54., [PMID:19365039]

Abstract [show]
OBJECTIVES: To assess the clinical utility of ABCR400 microarray testing in patients with ABCA4-associated retinopathies and to report on possible issues that could arise should genetic results be delivered without validation. METHODS: One hundred thirty-two probands were genotyped with the microarray. Diagnostic assays were designed to verify all mutations identified in individuals in whom at least 2 causative mutations were found. Mutations were verified in the probands, and wherever possible cosegregation analysis was performed in additional family members. RESULTS: Eighty-five of the 132 probands (64.4%) genotyped with the microarray had 2 or more disease-associated mutations identified. Verification of the genotyping, however, resulted in only 80 families being able to benefit from genetic result delivery. The remaining families could not receive results owing to the confounding effect of multiple ABCA4 mutations or the incorrect identification of mutations. CONCLUSIONS: The ABCR400 microarray is useful for mutation screening; however, raw data cannot be delivered directly to patients. All mutations should be verified and, whenever possible, investigated in other family members. CLINICAL RELEVANCE: Validated ABCR400 results provide an unequivocal molecular diagnosis, allowing family members to be offered diagnostic, predictive, carrier, and prenatal testing. Use of the microarray can inform decision-making and identify candidates for future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 3Ј; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 3Ј; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction. Login to comment

[hide] ABCA4 disease progression and a proposed strategy ... Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12. Cideciyan AV, Swider M, Aleman TS, Tsybovsky Y, Schwartz SB, Windsor EA, Roman AJ, Sumaroka A, Steinberg JD, Jacobson SG, Stone EM, Palczewski K
ABCA4 disease progression and a proposed strategy for gene therapy.
Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12., [PMID:19074458]

Abstract [show]
Autosomal recessive retinal diseases caused by mutations in the ABCA4 gene are being considered for gene replacement therapy. All individuals with ABCA4-disease show macular degeneration, but only some are thought to progress to retina-wide blindness. It is currently not predictable if or when specific ABCA4 genotypes will show extramacular disease, and how fast it will progress thereafter. Early clinical trials of focal subretinal gene therapy will aim to arrest disease progression in the extramacular retina. In 66 individuals with known disease-causing ABCA4 alleles, we defined retina-wide disease expression by measuring rod- and cone-photoreceptor-mediated vision. Serial measurements over a mean period of 8.7 years were consistent with a model wherein a normal plateau phase of variable length was followed by initiation of retina-wide disease that progressed exponentially. Once initiated, the mean rate of disease progression was 1.1 log/decade for rods and 0.45 log/decade for cones. Spatio-temporal progression of disease could be described as the sum of two components, one with a central-to-peripheral gradient and the other with a uniform retina-wide pattern. Estimates of the age of disease initiation were used as a severity metric and contributions made by each ABCA4 allele were predicted. One-third of the non-truncating alleles were found to cause more severe disease than premature truncations supporting the existence of a pathogenic component beyond simple loss of function. Genotype-based inclusion/exclusion criteria and prediction of the age of retina-wide disease initiation will be invaluable for selecting appropriate candidates for clinical trials in ABCA4 disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
151 Estimated severity of ABCA4 alleles and their properties ABCA4 allele Delay of retina-wide disease initiation (years)a In vitro or in vivo studiesb Molecular structural localizationc C2150Y 225.8 NBD-2 A1038V;L541P 214.0 35, 38 ECD-1/NBD-1 IVS38-10 T.C 211.1 L244P 25.7 ECD-1 E1122K 23.5 NBD-1 C54Y 22.1 35 ECD-1 IVS35þ2 T.C 22.1 R602W 21.8 38 ECD-1 V1896D 21.8 TM12 L1940P 21.4 NBD-2 Truncation mutationsd 0.0 E1087D 2.8 NBD-1 R220C 3.9 ECD-1 A1598D 3.9 ECD-2 R1640Q 3.9 ECD-2 R1098C 4.9 NBD-1 P1380L 7.4 35 TM7 N965S 7.6 35 NBD-1 V1433I 8.6 ECD-2 R1108C 10.4 35 NBD-1 T1526M 14.5 35 ECD-2 R2030Q 14.5 NBD-2 L2027F 15.1 35,37 NBD-2 G818E 17.3 35 TM5/TM6 S100P 18.2 ECD-1 L1201R 18.2 NBD-1 R18W 18.5 Nt D600E 18.5 ECD-1 L11P 21.7 Nt D654N 25.3 36 ECD-1 K2172R 27.9 NBD-2 IVS40þ5 G.A 28.1 G1961E 37.9 35 NBD-2 G1961R 44.0 NBD-2 a Delay of retina-wide disease initiation relative to the standard of age 10.6 years. Login to comment

[hide] ABCA4 mutations in Portuguese Stargardt patients: ... Mol Vis. 2009;15:584-91. Epub 2009 Mar 25. Maia-Lopes S, Aguirre-Lamban J, Castelo-Branco M, Riveiro-Alvarez R, Ayuso C, Silva ED
ABCA4 mutations in Portuguese Stargardt patients: identification of new mutations and their phenotypic analysis.
Mol Vis. 2009;15:584-91. Epub 2009 Mar 25., [PMID:19365591]

Abstract [show]
PURPOSE: To resolve the spectrum of causative retina-specific ATP-binding cassette transporter gene (ABCA4) gene mutations in Portuguese Stargardt (STGD) patients and compare allele frequencies obtained in this cohort with those of previous population surveys. METHODS: Using a microarray technique (ABCR400 gene chip), we screened all previously reported ABCA4 gene mutations in the genomic DNA of 27 patients from 21 unrelated Stargardt families whose phenotypes had been clinically evaluated using psychophysics and electrophysiological measurements. Furthermore, we performed denaturing high performance liquid chromatography whenever one or both mutant alleles failed to be detected using the ABCR gene chip. RESULTS: A total of 36 mutant alleles (out of the 54 tested) were identified in STGD patients, resulting in a detection rate of 67%. Two mutant alleles were present in 12 out of 21 STGD families (57%), whereas in four out of 21 (19%) of the families, only one mutant allele was found. We report the presence of 22 putative pathogenic alterations, including two sequence changes not found in other populations, c.2T>C (p.Met1Thr) and c.4036_4037delAC (p.Thr1346fs), and two novel disease-associated variants, c.400C>T (p.Gln134X) and c.4720G>T (p.Glu1574X). The great majority of the mutations were missense (72.7%). Seven frameshift variants (19.4%), three nonsense mutations (8.3%), and one splicing sequence change (2.7%) were also found in STGD chromosomes. The most prevalent pathologic variant was the missense mutation p.Leu11Pro. Present in 19% of the families, this mutation represents a quite high prevalence in comparison to other European populations. In addition, 23 polymorphisms were also identified, including four novel intronic sequence variants. CONCLUSIONS: To our knowledge, this study represents the first report of ABCA4 mutations in Portuguese STGD patients and provides further evidence of different mutation frequency across populations. Phenotypic characterization of novel putative mutations was addressed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Family Patient CFC Onset (age) VA (OD/OS) Nucleotide changes (exons) Effect changes [references] 1 4427 S 7 1/10 / 1/10 c.286A>G(3) / c.4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 4413 S 14 1/10 / 0.5/10 c.286A>G(3) / c.4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 4454 S 11 1/10 / 1/10 c.286A>G(3) / c. Login to comment
69 4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 2 4458 Mi 5 8/10 / 6/10 ND / ND ND/ND 4455 S 8 1/10 / 8/10 ND / ND ND/ND 3 4431 Mo 6 1,6/10 / 1,6/10 c.1804C>T(13) / c.IVS+5G>A(40) p.Arg602Trp [30]/SPLICE [11] 4 4626 S 6 FC / FC c.3211_3212insGT(22) / c.3211_3212insGT(22) p.Asp1048fs [5]/p.Asp1048fs [5] 5 4514 S 12 1/10 / 1/10 c.32T>C(1) / c. Login to comment

[hide] ABCA4 mutations causing mislocalization are found ... Hum Mol Genet. 2005 Oct 1;14(19):2769-78. Epub 2005 Aug 15. Wiszniewski W, Zaremba CM, Yatsenko AN, Jamrich M, Wensel TG, Lewis RA, Lupski JR
ABCA4 mutations causing mislocalization are found frequently in patients with severe retinal dystrophies.
Hum Mol Genet. 2005 Oct 1;14(19):2769-78. Epub 2005 Aug 15., [PMID:16103129]

Abstract [show]
ABCA4, also called ABCR, is a retinal-specific member of the ATP-binding cassette (ABC) family that functions in photoreceptor outer segments as a flipase of all-trans retinal. Homozygous and compound heterozygous ABCA4 mutations are associated with various autosomal recessive retinal dystrophies, whereas heterozygous ABCA4 mutations have been associated with dominant susceptibility to age-related macular degeneration in both humans and mice. We analyzed a cohort of 29 arRP families for the mutations in ABCA4 with a commercial microarray, ABCR-400 in addition to direct sequencing and segregation analysis, and identified both mutant alleles in two families (7%): compound heterozygosity for missense (R602W) and nonsense (R408X) alleles and homozygosity for a complex [L541P; A1038V] allele. The missense mutations were analyzed functionally in the photoreceptors of Xenopus laevis tadpoles, which revealed mislocalization of ABCA4 protein. These mutations cause retention of ABCA4 in the photoreceptor inner segment, likely by impairing correct folding, resulting in the total absence of physiologic protein function. Patients with different retinal dystrophies harboring two misfolding alleles exhibit early age-of-onset (AO) (5-12 years) of retinal disease. Our data suggest that a class of ABCA4 mutants may be an important determinant of the AO of disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 We analyzed a cohort of 29 arRP families for the mutations in ABCA4 with a commercial microarray, ABCR-400 in addition to direct sequencing and segregation analysis, and identified both mutant alleles in two families (7%): compound heterozygosity for missense (R602W) and nonsense (R408X) alleles and homozygosity for a complex [L541P; A1038V] allele. Login to comment
26 Functional studies of missense alleles [L541P; A1038V], R602W and C1490Y in transgenic frogs demonstrate that they do not translocate to rod OSs (ROSs). Login to comment
36 Sequence analysis of patient AR689-03 revealed compound heterozygosity for the missense ABCA4 alteration R602W and a nonsense allele, R408X. Login to comment
44 A WT 168-05 24 20/25 OD; 20/30 OS;VF , 308 OU RP N/A N/A 168-06 26 N/A RP N/A N/A AR192 192-03 9 20/20 OD; 20/25 OS;VF , 58 OU RP D2177N WT 192-04 19 20/30 OD; 20/40 OS;VF , 58 OU RP WT WT 192-05 19 20/30 OD; 20/40 OS;VF , 58 OU RP WT WT AR194 194-03 30 N/A RP D2177N WT 194-05 Childhood 20/25 OD; 20/40 OS RP N/A N/A 194-06 5 N/A RP D2177N WT 194-07 4 or 5 20/80 OU RP N/A N/A AR197 197-05 7 CF 3 feet OD; CF 2 feet OS RP [L541P; A1038V] [L541P; A1038V] 197-06 9 CF 5 feet OD; HM OS RP [L541P; A1038V] [L541P; A1038V] AR554 554-03 2 10/12 20/60 OU RP V2050L WT 554-04 1 9/12 N/A RP N/A N/A AR591 591-03 20 20/25 OU RP N/A N/A 591-04 8 20/20 OD; 20/25 OS;VF , 108 OU RP G1961E WT AR689 689-03 7 N/A RP R408X R602W 689-08 7 N/A RP N/A N/A OD, right eye; OS, left eye; OU, both eyes; VF, visual field; RP, retinitis pigementosa, WT, wild type; N/A, not available; CF, counting fingers; HM, hand motions. Login to comment
80 (C-L) Microphotographs of 2-week-old X. laevis tadpoles expressing R602W (C and D), [L541P; A1038V] (E and F), L541P (G and H), A1038V (I and J) and C1490Y (K and L). Login to comment
88 RP-associated mutants are misfolded and retained in the rod IS To investigate effects of the presumably severe arRP-associated R602W missense allele on ABCA4 localization, transgenic tadpoles were generated with the R602W construct. Login to comment
89 IF analysis of the retina demonstrated the retention of transgenic R602W in the IS (Fig. 2C and D). Login to comment
92 Functional studies of the arRP-associated complex allele [L541P; A1038V] also showed abnormal localization to rod IS although the IF studies revealed a different staining pattern than R602W, because the mutant protein forms fine aggregates in the IS (Fig. 2E and F). Login to comment
93 The aggregate formation suggests a mechanism distinct from that observed for R602W may be responsible for the retention of [L541P; A1038V] in the IS. Login to comment
101 Similar to the staining pattern found in R602W, the IS compartment was stained homogenously suggesting impaired folding. Login to comment
104 We employed this assay to examine the effects of [L541P; A1038V], R602W and C1490Y mutations on in vitro ATP hydrolysis. Login to comment
108 In addition, we observed a marked decrease in ATP hydrolytic activity compared with wild-type in both R602W (21.6%) and C1490Y (21.4%) alleles. Login to comment
113 Mutations: R602W, [L541P; A1038V] and C1490Y are frequently detected in patients with retinal diseases Mislocalization mutations R602W, [L541P; A1038V] and C1490Y have been reported as disease-associated mutations in patients with RP, CRD and STGD (18,20,32,33). Login to comment
119 WT and mutant constructs [L541P; A1038V], R602W and C1490Y ABCA4 were expressed in COS7 cells. Login to comment
136 Co-segregating compound heterozygous mutant alleles (R602W/R408X) and a homozygous complex allele [L541P; A1038V] were identified in two (AR689 and AR197) arRP families (Table 1). Login to comment
137 We hypothesized that the disease-associated missense mutations [L541P; A1038V], R602W and C1490Y could exert a possible effect on protein processing as this mechanism, which prevents altered proteins from locating to its physiologic compartment, was documented for other ABC transporters in related diseases including cystic fibrosis (CFTR) and Tangier disease (ABCA1). Login to comment
138 To examine this hypothesis, we generated transgenic X. laevis tadpoles expressing WT, [L541P; A1038V], R602W and C1490Y mutants and documented that the three mutant alleles cause mislocalization of ABCA4. Login to comment
146 Genotype-phenotype correlations among patients bearing one and two mislocalization-mutations Two mislocalization-alleles One mislocalization-allele RP STGD Allele 1 Allele 2 AO Allele 1 Allele 2 AO [L541P; A1038V] [L541P; A1038V] 7 [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 9 [L541P; A1038V] R1108H 13 [L541P; A1038V] G1961E 16 CRD [L541P; A1038V] G1961E 28 Allele 1 Allele 2 AO [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 10 [L541P; A1038V] L2027F 12 [L541P; A1038V] C1490Y 12 [L541P; A1038V] P1380L 5 R602W R602W 7 [L541P; A1038V] T1019M 6 [L541P; A1038V] G1961E 7 STGD [L541P; A1038V] T1019M 6 Allele 1 Allele 2 AO R602W L2027F 9 [L541P; A1038V] [L541P; A1038V] 12 C1490Y G1961E 28 C1490Y C1490Y 7 C1490Y G1961E 13 C1490Y R602W 9 C1490Y L2027F 10 C1490Y R602W 10 C1490Y L2027F 18 C1490 L2027F 18 AO-age of onset (in years). Login to comment
150 The results of IF studies of rods expressing [L541P; A1038V], R602W and C1490Y mutants were quite distinct from those observed for WT and ABCA4 EGFP. Login to comment
179 Shown is a proposed topological model of ABCA4 with its membrane spanning domains and the mutations: L541P, R602W, A1038V and C1490 analyzed. Login to comment
199 To generate the retinal dystrophy associated ABCA4 alleles: [L541P; A1038V], L541P, A1038V, R602W and C1490Y ABCA4, the pXOP-ABCA4 plasmid was mutagenized with Quickchange PCR-based mutagenesis system (Biocrest, La Jolla, CA, USA). Login to comment
228 In particular, we searched for subjects with RP, CRD and STGD in whom two mislocalization-mutant alleles [L541P; A1038V], R602W and C1490Y] were detected. Login to comment

[hide] Mutation spectrum and founder chromosomes for the ... Invest Ophthalmol Vis Sci. 2004 Jun;45(6):1705-11. September AV, Vorster AA, Ramesar RS, Greenberg LJ
Mutation spectrum and founder chromosomes for the ABCA4 gene in South African patients with Stargardt disease.
Invest Ophthalmol Vis Sci. 2004 Jun;45(6):1705-11., [PMID:15161829]

Abstract [show]
PURPOSE: To assess the mutation spectrum of ABCA4 underlying Stargardt disease (STGD) in South Africa (SA) and to determine whether there is a single or a few founder chromosomes in SA STGD families. METHODS: Sixty-four probands exhibiting the STGD phenotype were screened for mutations in the 50 exons of ABCA4 by single-strand conformational polymorphism-heteroduplex analysis sequencing and restriction fragment length polymorphism analysis. Microsatellite marker haplotyping was used to determine the ancestry in 10 families. RESULTS: Fifty-seven ABCA4 disease-associated alleles were identified that comprised 16 different sequence variants, of which two were novel, in 40 individuals of the cohort of 64 subjects. The most common variants identified included the C1490Y, L2027F, R602W, V256splice, R152X, and 2588G-->C mutations. The C1490Y variant was the most common disease-associated variant identified (19/64 subjects) and was absent in 392 control chromosomes. At least 10 ABCA4 disease-associated haplotypes were identified. Two of these haplotypes, which carried the C1490Y mutation, were identified in three unrelated families. CONCLUSIONS: Results suggest that ABCA4 is the major gene underlying STGD in the cohort investigated. Five of the six common sequence variants identified were at a higher frequency in the SA cohort than reported in published data on individuals of similar ancestry. The mutation and haplotype data suggests that there are several ancestral haplotypes underlying STGD in SA. There seems to be at least two different origins for the common C1490Y mutation, as well as two for the R602W mutation, thereby suggesting several founder effects for STGD in SA.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 The most common variants identified included the C1490Y, L2027F, R602W, V256splice, R152X, and 2588G3C mutations. Login to comment
15 There seems to be at least two different origins for the common C1490Y mutation, as well as two for the R602W mutation, thereby suggesting several founder effects for STGD in SA. Login to comment
71 List of 16 Different Potential Disease-Associated Sequence Variants Identified in 64 SA Subjects with arSTGD Nucleotide Change Amino Acid Change Families (N ‫؍‬ 64) Exon Reference C454T R152X 4 5 3,33 G455A R152Q 1 5 35 C634T R212C 1 6 16,27 G768T (Splice donor) V256splice 5 6 15 C1885T R602W 6 13 9 2588G3C G863A 4 17 8 T3047C V989A 1 20 11 T4319C F1440S 1 29 9 G4328A* R1443H 1 29 This study G4469A C1490Y 19 30 15,9 G5077A V16931 1 36 36 C6079T L2027F 8 44 8 C6088A R2030X 1 44 9,37 C6112T R2038W 2 44 5 IVS45ϩ7G3A Splice donor 1 45 26 6352⌬A* Frameshift 1 46 This study No individuals positive for the R1443H variant were identified in 47 control individuals of Indian ancestry. Login to comment
99 Likewise, two STGD-associated haplotypes for the R602W variant were identified in two unrelated families. Login to comment
119 The C1490Y sequence variant was the most common disease-associated variant identified in this study (19/64; 30%), followed by the L2027F (8/64; 13%), the R602W variant (6/64; 9%), the V256splice variant (5/64; 8%), and the 2588G3C and R152X sequence variants occurred at equal frequencies (4/64; 6%). Login to comment
121 Five (C1490Y, L2027F, R602W, V256splice and R152X) of the six common sequence variants identified were at a higher frequency in the SA STGD cohort than in populations from Europe and the United States. Login to comment
122 Of interest, the C1490Y, R602W, V256splice, and R152X variants were found to be some of the rarer ABCA4 mutations observed in populations of Europe. Login to comment
125 AO (y) Phenotype Mutation 1 Mutation 2 224.1 9 STGD C1490Y R602W 170.2 10 STGD C1490Y R602W 241.1 9 STGD C1490Y 25883C 448.1 20 STGD C1490Y 2588G3C 113.3 10 STGD C1490Y L2027F 209.1 18 STGD C1490Y L2027F 165.4 10 STGD C1490Y V256splice 166.3 27 STGD C1490Y R152X 151.4 5 STGD C1490Y ND 219.1 5 (rapid clinical progression was observed by 9 years) STGD C1490Y ND 223.1 9 STGD C1490Y ND 307.1 9 STGD C1490Y ND 319.3 9 STGD C1490Y ND 385.1 10 STGD C1490Y ND 226.1 10 STGD C1490Y ND 142.2 10 STGD C1490Y ND 273.1 11 STGD C1490Y ND 382.1 12 STGD C1490Y ND 449.1 14 STGD C1490Y ND 344.2 ND STGD C1490Y ND 374.1 10 STGD L2027F 6352⌬A† 305.1 18 STGD L2027F R2038W 377.1 25 STGD L2027F R2038W 276.1 27 STGD L2027F R212C 204.4 8 STGD L2027F ND 135.4 13 STGD L2027F ND 446.1 9 STGD R602W ND 109.3 11 STGD R602W ND 110.7 13 STGD R602W ND 438.3 12 STGD R602W ND 123.1 9 STGD V256splice R152X 105.1* 10 STGD AND atypical RP V256splice R152X 24 129.3* 10 (rapid clinical progression was observed) STGD V256splice ND 163.22 10 STGD V256splice ND 173.1 8 STGD 2588G3C ND 9.4 27 STGD 2588G3C R152X 330.2 29 STGD R152Q V989A 372.1 31 STGD R1443H† R2030X 141.3 11 STGD F1440S IVS45ϩ7G3A (splice site mutation) 206.3 ND STGD V1693I ND Rows are arranged according to the age of onset (AO) starting with the earliest AO for the most common sequence variant. Login to comment
137 The 10 ABCA4 Disease-Associated Haplotypes Identified in the 10 STGD Families Investigated Family D1S188 Marker ABCA4 MutationD1S406 D1S236 166 14 6 12 C1490Y 170 15 4 9 C1490Y 151 15 4 9 C1490Y 204 9 5 14 L2027F 135 9 5 14 L2027F 105 8 4 14 V256splice 129 8 4 14 V256splice 170 10 5 12 R602W 110 16 6 3 R602W 9 7 5 14 2588G3C 9 16 5 4 R152X 105 16 5 4 R152X 166 16 5 4 R152X 141 8 3 6 F1440S 141 9 5 14 IVS45ϩ7G3A The numbers in column 1 denote the identity number of the family. Login to comment
165 Likewise, two STGD-associated haplotypes for the R602W variant were identified in two unrelated families. Login to comment

[hide] An analysis of allelic variation in the ABCA4 gene... Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89. Webster AR, Heon E, Lotery AJ, Vandenburgh K, Casavant TL, Oh KT, Beck G, Fishman GA, Lam BL, Levin A, Heckenlively JR, Jacobson SG, Weleber RG, Sheffield VC, Stone EM
An analysis of allelic variation in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89., [PMID:11328725]

Abstract [show]
PURPOSE: To assess the allelic variation of the ATP-binding transporter protein (ABCA4). METHODS: A combination of single-strand conformation polymorphism (SSCP) and automated DNA sequencing was used to systematically screen this gene for sequence variations in 374 unrelated probands with a clinical diagnosis of Stargardt disease, 182 patients with age-related macular degeneration (AMD), and 96 normal subjects. RESULTS: There was no significant difference in the proportion of any single variant or class of variant between the control and AMD groups. In contrast, truncating variants, amino acid substitutions, synonymous codon changes, and intronic variants were significantly enriched in patients with Stargardt disease when compared with their presence in subjects without Stargardt disease (Kruskal-Wallis P < 0.0001 for each variant group). Overall, there were 2480 instances of 213 different variants in the ABCA4 gene, including 589 instances of 97 amino acid substitutions, and 45 instances of 33 truncating variants. CONCLUSIONS: Of the 97 amino acid substitutions, 11 occurred at a frequency that made them unlikely to be high-penetrance recessive disease-causing variants (HPRDCV). After accounting for variants in cis, one or more changes that were compatible with HPRDCV were found on 35% of all Stargardt-associated alleles overall. The nucleotide diversity of the ABCA4 coding region, a collective measure of the number and prevalence of polymorphic sites in a region of DNA, was found to be 1.28, a value that is 9 to 400 times greater than that of two other macular disease genes that were examined in a similar fashion (VMD2 and EFEMP1).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment

[hide] An analysis of ABCR mutations in British patients ... Invest Ophthalmol Vis Sci. 2000 Jan;41(1):16-9. Papaioannou M, Ocaka L, Bessant D, Lois N, Bird A, Payne A, Bhattacharya S
An analysis of ABCR mutations in British patients with recessive retinal dystrophies.
Invest Ophthalmol Vis Sci. 2000 Jan;41(1):16-9., [PMID:10634594]

Abstract [show]
PURPOSE: Several reports have shown that mutations in the ABCR gene can lead to Stargardt disease (STGD)/fundus flavimaculatus (FFM), autosomal recessive retinitis pigmentosa (arRP), and autosomal recessive cone-rod dystrophy (arCRD). To assess the involvement of ABCR in these retinal dystrophies, the gene was screened in a panel of 70 patients of British origin. METHODS: Fifty-six patients exhibiting the STGD/FFM phenotype, 6 with arRP, and 8 with arCRD, were screened for mutations in the 50 exons of the ABCR gene by heteroduplex analysis and direct sequencing. Microsatellite marker haplotyping was used to determine ancestry. RESULTS: In the 70 patients analyzed, 31 sequence changes were identified, of which 20 were considered to be novel mutations, in a variety of phenotypes. An identical haplotype was associated with the same pair of in-cis alterations in 5 seemingly unrelated patients and their affected siblings with STGD/FFM. Four of the aforementioned patients were found to carry three alterations in the coding sequence of the ABCR gene, with two of them being in-cis. CONCLUSIONS: These results suggest that ABCR is a relatively polymorphic gene. Because putative mutations have been identified thus far only in 25 of 70 patients, of whom only 8 are compound heterozygotes, a large number of mutations have yet to be ascertained. The disease haplotype seen in the 5 patients carrying the same "complex" allele is consistent with the presence of a common ancestor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 Neither of these putative TABLE 1. List of Mutations Found in 70 Patients of British Origin Nucleotide Change Amino Acid Change No. of Patients (/70) Phenotype No. of Controls (/96) G161A Cys-54-Tyr 1 STG/FFM NF A286G Asn-96-Asp 1 STG/FFM NF A286C Asn-96-His 1 STG/FFM NF A466G Ile-156-Val 1 STG/FFM NF C1220T Ala-407-Val 6 STG/FFM, arCRD NF T1271C Val-424-Ala 2 STG/FFM, arRP NF C1335G Ser-445-Arg 1 STG/FFM NF C1804T Arg-602-Trp 1 STG/FFM NF C2337A Cys-779-Ter 1 STG/FFM NF *G2588C Gly-863-Ala 5 STG/FFM 2/176 3392delC 1147 Ter 1 STG/FFM NF T4286C Val-1429-Ala 1 STG/FFM NF 4774-2A3C Splice acceptor 2 STG/FFM NF †C4918T Arg-1640-Trp 1 STG/FFM NF C5107G Gln-1703-Lys 1 STG/FFM NF 5161delAC Frameshift 1 STG/FFM NF C5337G Tyr-1779-Ter 1 STG/FFM NF C6088T Arg-2030-Ter 1 arCRD NF 6282ϩ7G3A Splice donor 1 STG/FFM NF G6449A Cys-2150-Tyr 2 arCRD NF A6479G Lys-2160-Arg 1 STG/FFM NF * Independently reported by Allikmets et al.6 † Independently reported by Rozet et al.8 NF, not found in 96 ethnically matched control individuals. Login to comment

[hide] Genotype/Phenotype analysis of a photoreceptor-spe... Am J Hum Genet. 1999 Feb;64(2):422-34. Lewis RA, Shroyer NF, Singh N, Allikmets R, Hutchinson A, Li Y, Lupski JR, Leppert M, Dean M
Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease.
Am J Hum Genet. 1999 Feb;64(2):422-34., [PMID:9973280]

Abstract [show]
Mutation scanning and direct DNA sequencing of all 50 exons of ABCR were completed for 150 families segregating recessive Stargardt disease (STGD1). ABCR variations were identified in 173 (57%) disease chromosomes, the majority of which represent missense amino acid substitutions. These ABCR variants were not found in 220 unaffected control individuals (440 chromosomes) but do cosegregate with the disease in these families with STGD1, and many occur in conserved functional domains. Missense amino acid substitutions located in the amino terminal one-third of the protein appear to be associated with earlier onset of the disease and may represent misfolding alleles. The two most common mutant alleles, G1961E and A1038V, each identified in 16 of 173 disease chromosomes, composed 18.5% of mutations identified. G1961E has been associated previously, at a statistically significant level in the heterozygous state, with age-related macular degeneration (AMD). Clinical evaluation of these 150 families with STGD1 revealed a high frequency of AMD in first- and second-degree relatives. These findings support the hypothesis that compound heterozygous ABCR mutations are responsible for STGD1 and that some heterozygous ABCR mutations may enhance susceptibility to AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift. Login to comment
178 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET ‫ע‬ SD (YEARS)Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 ‫ע‬ 12.7 51961GrA AR307 10 A1038V AR290 16 5714ϩ5GrA AR314 25 5898ϩ1GrT AR336 39 A1038V R572P AR321 6 12.5 ‫ע‬ 6.9 S1071L AR358 6 L1970F AR428 6 5196ϩ2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 ‫ע‬ 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 ‫ע‬ 4.5 C75G AR427 12 C1490Y AR370 13 2160ϩ1GrC AR218 14 4253ϩ5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 ‫ע‬ 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment
77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift. Login to comment
179 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET cf2; SD (YEARS) Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 cf2; 12.7 51961GrA AR307 10 A1038V AR290 16 5714af9;5GrA AR314 25 5898af9;1GrT AR336 39 A1038V R572P AR321 6 12.5 cf2; 6.9 S1071L AR358 6 L1970F AR428 6 5196af9;2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 cf2; 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 cf2; 4.5 C75G AR427 12 C1490Y AR370 13 2160af9;1GrC AR218 14 4253af9;5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 cf2; 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment

[hide] Allelic and phenotypic heterogeneity in ABCA4 muta... Ophthalmic Genet. 2011 Sep;32(3):165-74. doi: 10.3109/13816810.2011.565397. Epub 2011 Apr 21. Burke TR, Tsang SH
Allelic and phenotypic heterogeneity in ABCA4 mutations.
Ophthalmic Genet. 2011 Sep;32(3):165-74. doi: 10.3109/13816810.2011.565397. Epub 2011 Apr 21., [PMID:21510770]

Abstract [show]
Since the discovery of the ABCA4 gene as the cause of autosomal recessive Stargardt disease/fundus flavimaculatus much has been written of the phenotypic variability in ABCA4 retinopathy. In this review the authors discuss the findings seen on examination and the disease features detected using various clinical tests. Important differential diagnoses are presented and unusual presentations of ABCA4 disease highlighted.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 The most common, L541P/A1038V, has been reported as a founder mutation in Hungaro-German populations.14,16,17 Furthermore "ethnic group-specific" ABCA4 alleles have been described in other populations also, C1490Y and R602W in South African patients,18 and N965S in a Danish population19 among others.20 In an attempt to explain the variability seen in ABCA4 retinal phenotypes and to correlate this with individual mutation effect, a model was proposed which correlated disease severity with residual ABCA4 function.14,21 Maugeri classified ABCA4 mutant alleles as "mild", "moderate", and "severe" based on the predicted effect of the mutation on the transport function of the protein, ie, the more severe the effect of the mutation on ABCA4 function, the more aggressive the disease phenotype. Login to comment

[hide] ABCA4 mutational spectrum in Mexican patients with... Exp Eye Res. 2013 Apr;109:77-82. doi: 10.1016/j.exer.2013.02.006. Epub 2013 Feb 16. Chacon-Camacho OF, Granillo-Alvarez M, Ayala-Ramirez R, Zenteno JC
ABCA4 mutational spectrum in Mexican patients with Stargardt disease: Identification of 12 novel mutations and evidence of a founder effect for the common p.A1773V mutation.
Exp Eye Res. 2013 Apr;109:77-82. doi: 10.1016/j.exer.2013.02.006. Epub 2013 Feb 16., [PMID:23419329]

Abstract [show]
The aim of this study was to assess the mutational spectrum of the ABCA4 gene in a cohort of patients with Stargardt disease from Mexico, a previously uncharacterized population. Clinical diagnosis in each patient was supported by a complete ophthalmological assessment that included visual acuity measurement, a slit lamp examination, a fundus examination and photography, electroretinography, fluorescein angiography, and computerized visual fields testing. Molecular analysis was performed by PCR amplification and direct nucleotide sequence of the 50 exons of the ABCA4 gene in genomic DNA. A total of 31 unrelated subjects with the disease were enrolled in the study. Molecular analysis in the total group of 62 alleles allowed the identification of 46 mutant ABCA4 alleles carrying 29 different pathogenic disease-associated mutations. Two ABCA4 mutant alleles were detected in 20 of the 31 patients (64.5%), a single disease allele was identified in six (19.4%), and no mutant alleles were detected in five of the cases (16.1%). Most patients with two ABCA4 mutations (11/20, 55%) were compound heterozygotes. Twelve variants were novel ABCA4 mutations. Nucleotide substitutions were the most frequent type of variation, occurring in 26 out of 29 (89.7%) different mutations. The two most common mutations in our study were the missense changes p.A1773V and p.G818E, which were identified in eight (17%) and seven (15%) of the total 46 disease-associated alleles, respectively. Haplotype analyses of intragenic SNPs in four subjects carrying the p.A1773V mutation supported a common origin for this mutation. In conclusion, this is the first report of ABCA4 molecular screening in Latin American Stargardt disease patients. Our results expand the mutational spectrum of the disease by adding 12 novel ABCA4 pathogenic variants and support the occurrence of a founder effect for the p.A1773V mutation in the Mexican population. The identification of recurrent mutations in our cohort will direct future ABCA4 molecular screening in patients from this ethnic group.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 Allele 1 Allele 2 Genotype Exon Nucleotide change Polypeptide change Exon Nucleotide change Polypeptide change Familial case # 1 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous 2 e NI e e NI e e 3 6 c.634C>T p.R212C (D) 38 c.5318C>T p.A1773V (D) Compound heterozygous 4 23 c.3386G>T p.R1129L (D) 28 c.4139C>T p.P1380L (D) Compound heterozygous 5 e NI e e NI e e 6 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous 7 e NI e e NI e e 8 16 c.2453G>A p.G818E (D) 28 c.4249_4251 delTTC p.F1417del (D; N) Compound heterozygous 9 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous Sporadic case # 1 8 c.868C>T p.R290W (D) e IVS8&#fe;1G>A Splicing (D; N) Compound heterozygous 2 38 c.5318C>T p.A1773V (D) - NI - Heterozygous 3 20 c.3041T>G p.L1014R (D) 1; 49 c.52C>T; c.6764G>T p.R18W (D); p.S2255I (B) Compound heterozygous 4 13; 19 c.1804C>T; c.2828G>A p.R602W (D); p.R943Q (U) 16 c.2453G>A p.G818E (D) Compound heterozygous 5 38 c.5324T>A p. I1775N (D; N) 38 c.5324T>A p.I1775N (D; N) Homozygous 6 e NI e e NI e e 7 49 c.6764G>T p.S2255I (B) 49 c.6764 G>T p.S2255I (B) Homozygous 8 19; 40 c.2828 G>A; c.5503A>T p.R943Q (U); p.N1868I (U) 3 c.265G>T p.E89* (D; N) Compound heterozygous 9 38 c.5335T>C p.Y1779H (D;N) 38 c.5335T>C p.Y1779H (D;N) Homozygous 10 16 c.2453G>A p.G818E (D) 16 c.2453G>A p.G818E (D) Homozygous 11 6 c.723A>T p.E241D (D;N) 36 c.5114G>A p.R1705Q (D) Compound heterozygous 12 2 c.71G>A (D) p.R24H e NI e Heterozygous 13 30 c.4537_4538insC p.Q1513Pfs*41 (D; N) e NI e Heterozygous 14 32 c.4667G>C p.R1556T (D; N) 32 c.4667G>C p.R1556T (D; N) Homozygous 15 45 c.6221G>T p.G2074V (D; N) 16 c.2453G>A p.G818E (D) Compound heterozygous 16 16; 41 c.2453G>A; c.5824G>C p. G818E (D); p. E1942Q (B;N) 46 c.6384A>G p.H2128R (D) Compound heterozygous 17 16 c.2453G>A p. G818E (D) e NI e Heterozygous 18 32 c.4653G>A p. W1551* (D; N) e NI e Heterozygous 19 23 c.3386G>T p. R1129L (D) e NI e Heterozygous 20 36 c.5045_5059del GTTGCCATCTGCGTG p.V1682_ V1686del (D; N) 29; 49 c.4328G>A; c.6764G>T p.R1443H (D); p.S2255I (B) Compound heterozygous 21 19 c.2894A>G p.N965S (D) 19 c.2894A>G p.N965S (D) Homozygous 22 e NI e e NI e e STGD accounts for approximately 7% of all retinal dystrophies; it is one of the most common genetic forms of juvenile or early adult onset macular degeneration. Login to comment
119 ABCA4 Exon # Nucleotide change Predicted protein effect Number of alleles Population genotypic frequency in EVS Population allelic frequency in EVS (%) 1 c.52C>T p.R18W 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 2 c.71G>A p.R24H 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 3 c.265G>T p.E89* (N) 1 NR NR 6 c.634C>T p.R212C 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 6 c.723A>T p.E241D (N) 1 NR NR 8 c.868C>T p.R290W 1 NR NR IVS8 IVS8 &#fe; 1G>A Splicing mutation (N) 1 NR NR 13 c.1804C>T p.R602W 1 NR NR 16 c.2453G>A p.G818E 7 NR NR 19 c.2828G>A p.R943Q 2 AA &#bc; 8/AG &#bc; 400/GG &#bc; 6095 A &#bc; 3.199/G &#bc; 96.801 19 c.2894A>G p.N965S 2 GG &#bc; 0/GA &#bc; 1/AA &#bc; 6502 G &#bc; 0.008/A &#bc; 99.992 20 c.3041T>G p.L1014R 1 NR NR 23 c.3386G>T p.R1129L 2 NR NR 28 c.4139C>T p.P1380L 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 28 c.4249_4251del TTC p.F1417del (N) 1 NR NR 29 c.4328G>A p.R1443H 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 30 c.4537_4538insC p.Q1513Pfs*41 (N) 1 NR NR 32 c.4653G>A p.W1551* (N) 1 NR NR 32 c.4667G>C p.R1556T (N) 2 NR NR 36 c.5044_5058del GTTGCCATCTGCGTG p.V1682_V1686del (N) 1 NR NR 36 c.5114G>A p.R1705Q 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 38 c.5318C>T p.A1773V 8 NR NR 38 c.5324T>A p.I1775N (N) 2 NR NR 38 c.5335T>C p.Y1779H (N) 2 NR NR 40 c.5503A>T p.N1868I 1 TT &#bc; 16/TA &#bc; 589/AA &#bc; 5898 T &#bc; 4.775/A &#bc; 95.225 41 c.5824G>C p.E1942Q (N) 1 NR NR 45 c.6221G>T p.G2074V (N) 1 NR NR 46 c.6384A>G p.H2128R 1 NR NR 49 c.6764G>T p.S2255I 4 TT &#bc; 516/TG &#bc; 1473/GG &#bc; 4514 T &#bc; 19.26/G &#bc; 80.74 gold standard for ABCA4 mutational screening. Login to comment
126 Interestingly, five out of 46 mutant alleles (11%) were complex alleles (p.R18W &#fe; p.S2255I; p.R602W &#fe; p.R943W; p.R943W &#fe; p.N1868I; p.G818E &#fe; p.E1942Q; and p.R1443H &#fe; p.S2255I), a frequency that is in agreement with previous reports (Lewis et al., 1999; Shroyer et al., 2001; Zernant et al., 2011). Login to comment

[hide] Stargardt disease: towards developing a model to p... Eur J Hum Genet. 2013 Oct;21(10):1173-6. doi: 10.1038/ejhg.2013.92. Epub 2013 May 22. Heathfield L, Lacerda M, Nossek C, Roberts L, Ramesar RS
Stargardt disease: towards developing a model to predict phenotype.
Eur J Hum Genet. 2013 Oct;21(10):1173-6. doi: 10.1038/ejhg.2013.92. Epub 2013 May 22., [PMID:23695285]

Abstract [show]
Stargardt disease is an ABCA4-associated retinopathy, which generally follows an autosomal recessive inheritance pattern and is a frequent cause of macular degeneration in childhood. ABCA4 displays significant allelic heterogeneity whereby different mutations can cause retinal diseases with varying severity and age of onset. A genotype-phenotype model has been proposed linking ABCA4 mutations, purported ABCA4 functional protein activity and severity of disease, as measured by degree of visual loss and the age of onset. It has, however, been difficult to verify this model statistically in observational studies, as the number of individuals sharing any particular mutation combination is typically low. Seven founder mutations have been identified in a large number of Caucasian Afrikaner patients in South Africa, making it possible to test the genotype-phenotype model. A generalised linear model was developed to predict and assess the relative pathogenic contribution of the seven mutations to the age of onset of Stargardt disease. It is shown that the pathogenicity of an individual mutation can differ significantly depending on the genetic context in which it occurs. The results reported here may be used to identify suitable candidates for inclusion in clinical trials, as well as guide the genetic counselling of affected individuals and families.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 This study considers a South African cohort of 118 individuals who express biallelic combinations of seven founder mutations in ABCA4 (c.454C4T (p.Arg152*), c.768G4T (p.Val256Val), c.1804C4T (p.Arg602Trp), c.2588G4C (p.Gly863Ala), c.4469G4A (p.Cys1490Tyr), c.5461-10T4C, c.6079C4T (p.Leu2027Phe)), which collectively account for 36% of STGD cases studied to date in South Africa.19,20 These data, together with clinical information for each patient, were used to test the genotype-phenotype model. Login to comment
30 To illustrate the utility of this model, consider the population of individuals expressing the mutation pair c.4469G4A (p.Cys1490Tyr) and c.1804C4T (p.Arg602Trp). Login to comment
31 The average AOO for this group of individuals is predicted as (0.0460 &#fe; 0.0528&#fe; 0.04680.0295)1 &#bc; 8.61 years, where 0.0460 is the intercept term, 0.0528 is the regression coefficient for c.4469G4A (p.Cys1490Tyr), 0.0468 is the regression coefficient for c.1804C4T (p.Arg602Trp) and 0.0295 is the regression coefficient for c.4469G4A (p.Cys1490Tyr): c.1804C4T (p.Arg602Trp). Login to comment
33 Table 1 A summary of the 23 mutation combinations observed in 118 patients with STGD, showing the number of patients per combination and the average and median AOO (in years) per combination Mutation 1 Mutation 2 Number of patients Average AOO (years) Median AOO (years) c.5461-10T4C c.768G4T (p.Val256Val) 1 6 6 c.5461-10T4C c.5461-10T4C 2 6.5 6.5 c.1804C4T (p.Arg602Trp) c.768G4T (p.Val256Val) 3 6.7 6 c.5461-10T4C c.454C4T (p.Arg152*) 3 7 8 c.4469G4A (p.Cys1490Tyr) c.454C4T (p.Arg152*) 6 7.8 8 c.768G4T (p.Val256Val) c.454C4T (p.Arg152*) 4 8 9 c.768G4T (p.Val256Val) c.768G4T (p.Val256Val) 1 8 8 c.4469G4A (p.Cys1490Tyr) c.4469G4A (p.Cys1490Tyr) 9 8.1 8 c.6079C4T (p.Leu2027Phe) c.454 C4T (p.Arg152*) 7 8.2 7 c.4469G4A (p.Cys1490Tyr) c.1804C4T (p.Arg602Trp) 13 8.6 8 c.4469G4A (p.Cys1490Tyr) c.5461-10T4C 13 8.8 9 c.4469G4A (p.Cys1490Tyr) c.768G4T (p.Val256Val) 10 10.3 9 c.4469G4A (p.Cys1490Tyr) c.6079C4T (p.Leu2027Phe) 12 10.3 9.5 c.6079C4T (p.Leu2027Phe) c.5461-10T4C 3 11 10 c.1804C4T (p.Arg602Trp) c.5461-10T4C 1 11 11 (c.1804C4T (p.Arg602Trp) c.6079C4T (p.Leu2027Phe) 8 12 11 c.6079C4T (p.Leu2027Phe) c.768G4T (p.Val256Val) 6 12.5 13 c.768G4T (p.Val256Val) c.2588G4C (p.Gly863Ala) 3 16.7 18 c.1804C4T (p.Arg602Trp) c.2588G4C (p.Gly863Ala) 2 17.5 17.5 c.4469G4A (p.Cys1490Tyr) c.2588G4C (p.Gly863Ala) 4 18.5 19 c.5461-10T4C c.2588G4C (p.Gly863Ala) 1 20 20 c.6079C4T (p.Leu2027Phe) c.6079C4T (p.Leu2027Phe) 2 28 28 c.2588G4C (p.Gly863Ala) c.454C4T (p.Arg152*) 4 28 30 In some cases, the average AOO of a given mutation differed significantly depending on the mutational context in which it occurred. Login to comment
45 Table 2 Covariates included in the generalised linear model (with inverse link function) with their respective coefficients, standard errors and P-values Covariate Coefficient Standard error P-value (Intercept) 0.0460 0.0106 3.53e 05 c.4469G4A (p.Cys1490Tyr) 0.0528 0.0076 2.71e 10 c.1804C4T (p.Arg602Trp) 0.0468 0.0085 2.33e 07 c.6079C4T (p.Leu2027Phe) 0.0090 0.0089 0.3117 c.5461-10T4C 0.0562 0.0106 6.59e 07 c.768G4T (p.Val256Val) 0.0507 0.0083 2.06e 08 c.2588G4C (p.Gly863Ala) 0.0413 0.0081 1.58e 06 c.454C4T (p.Arg152*) 0.0311 0.0080 0.0002 c.4469G4A (p.Cys1490Tyr) (homozygous) 0.0336 0.0144 0.0214 c.4469G4A (p.Cys1490Tyr): c.5461-10T4C 0.0419 0.0146 0.0049 c.4469G4A (p.Cys1490Tyr): c.1804C4T (p.Arg602Trp) 0.0295 0.0145 0.0442 c.4469G4A (p.Cys1490Tyr): c.768G4T (p.Val256Val) 0.0520 0.0134 0.0002 c.6079C4T (p.Leu2027Phe): c.454C4T (p.Arg152*) 0.0519 0.0158 0.0013 Figure 1 Graph depicting the actual and predicted average AOO with 95% confidence bands for each mutation combination observed in five or more patients. Login to comment
50 For example, consider again the population of individuals expressing the mutation combination c.4469G4A (p.Cys1490Tyr) and c.1804C4T (p.Arg602Trp). Login to comment
52 However, if the regression coefficient for c.4469G4A (p.Cys1490Tyr):c.1804C4T (p.Arg602Trp) ( 0.0295) was not included, ie, (0.0460 &#fe; 0.0528 &#fe; 0.0468)1 &#bc; 6.868, the predicted average AOO would be an underestimation of the true value. Login to comment
53 The mutation combinations not detected in the cohort were c.454C4T (p.Arg152*) (homozygous), c.1804C4T (p.Arg602Trp) (homozygous), c.2588G4C (p.Gly863Ala) (homozygous), c.454C4T (p.Arg152*):c.1804C4T (p.Arg602Trp) and c.2588G4C (p.Gly863Ala): c.6079C4T (p.Leu2027Phe). Login to comment

[hide] Outcome of ABCA4 disease-associated alleles in aut... Ophthalmology. 2013 Nov;120(11):2332-7. doi: 10.1016/j.ophtha.2013.04.002. Epub 2013 Jun 4. Riveiro-Alvarez R, Lopez-Martinez MA, Zernant J, Aguirre-Lamban J, Cantalapiedra D, Avila-Fernandez A, Gimenez A, Lopez-Molina MI, Garcia-Sandoval B, Blanco-Kelly F, Corton M, Tatu S, Fernandez-San Jose P, Trujillo-Tiebas MJ, Ramos C, Allikmets R, Ayuso C
Outcome of ABCA4 disease-associated alleles in autosomal recessive retinal dystrophies: retrospective analysis in 420 Spanish families.
Ophthalmology. 2013 Nov;120(11):2332-7. doi: 10.1016/j.ophtha.2013.04.002. Epub 2013 Jun 4., [PMID:23755871]

Abstract [show]
OBJECTIVE: To provide a comprehensive overview of all detected mutations in the ABCA4 gene in Spanish families with autosomal recessive retinal disorders, including Stargardt's disease (arSTGD), cone-rod dystrophy (arCRD), and retinitis pigmentosa (arRP), and to assess genotype-phenotype correlation and disease progression in 10 years by considering the type of variants and age at onset. DESIGN: Case series. PARTICIPANTS: A total of 420 unrelated Spanish families: 259 arSTGD, 86 arCRD, and 75 arRP. METHODS: Spanish families were analyzed through a combination of ABCR400 genotyping microarray, denaturing high-performance liquid chromatography, and high-resolution melting scanning. Direct sequencing was used as a confirmation technique for the identified variants. Screening by multiple ligation probe analysis was used to detect possible large deletions or insertions in the ABCA4 gene. Selected families were analyzed further by next generation sequencing. MAIN OUTCOME MEASURES: DNA sequence variants, mutation detection rates, haplotypes, age at onset, central or peripheral vision loss, and night blindness. RESULTS: Overall, we detected 70.5% and 36.6% of all expected ABCA4 mutations in arSTGD and arCRD patient cohorts, respectively. In the fraction of the cohort where the ABCA4 gene was sequenced completely, the detection rates reached 73.6% for arSTGD and 66.7% for arCRD. However, the frequency of possibly pathogenic ABCA4 alleles in arRP families was only slightly higher than that in the general population. Moreover, in some families, mutations in other known arRP genes segregated with the disease phenotype. CONCLUSIONS: An increasing understanding of causal ABCA4 alleles in arSTGD and arCRD facilitates disease diagnosis and prognosis and also is paramount in selecting patients for emerging clinical trials of therapeutic interventions. Because ABCA4-associated diseases are evolving retinal dystrophies, assessment of age at onset, accurate clinical diagnosis, and genetic testing are crucial. We suggest that ABCA4 mutations may be associated with a retinitis pigmentosa-like phenotype often as a consequence of severe (null) mutations, in cases of long-term, advanced disease, or both. Patients with classical arRP phenotypes, especially from the onset of the disease, should be screened first for mutations in known arRP genes and not ABCA4.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 Based on our data, the likely severe ABCA4 missense mutations, resulting in an early disease onset and severe disease, include, among others: p.Leu541Pro, p.Arg602Trp, p.Thr1019Met, p.Leu1940Pro, and p.His1838Asp. Login to comment
90 These results are supported by previous findings that the p.Leu541Pro and p.Arg602Trp variants result in mislocalized protein,22 the p.Leu1940Pro and IVS38e10T/C variants confer much earlier onset of the disease,23 and the p.His1838Asp variant, in a complex allele with the p.Gly1961Glu mutation, results in an early-onset, severe disease.24 Although the above estimates are simplified because they do not take into account environmental factors and genetic variation at other loci in these patients, they serve as a good basis for association with disease onset and disease severity. Login to comment

[hide] Clinical and molecular analysis of Stargardt disea... Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003. Fujinami K, Sergouniotis PI, Davidson AE, Wright G, Chana RK, Tsunoda K, Tsubota K, Egan CA, Robson AG, Moore AT, Holder GE, Michaelides M, Webster AR
Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function.
Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003., [PMID:23953153]

Abstract [show]
PURPOSE: To describe a cohort of patients with Stargardt disease who show a foveal-sparing phenotype. DESIGN: Retrospective case series. METHODS: The foveal-sparing phenotype was defined as foveal preservation on autofluorescence imaging, despite a retinopathy otherwise consistent with Stargardt disease. Forty such individuals were ascertained and a full ophthalmic examination was undertaken. Following mutation screening of ABCA4, the molecular findings were compared with those of patients with Stargardt disease but no foveal sparing. RESULTS: The median age of onset and age at examination of 40 patients with the foveal-sparing phenotype were 43.5 and 46.5 years. The median logMAR visual acuity was 0.18. Twenty-two patients (22/40, 55%) had patchy parafoveal atrophy and flecks; 8 (20%) had numerous flecks at the posterior pole without atrophy; 7 (17.5%) had mottled retinal pigment epithelial changes; 2 (5%) had multiple atrophic lesions, extending beyond the arcades; and 1 (2.5%) had a bull's-eye appearance. The median central foveal thickness assessed with spectral-domain optical coherence tomographic images was 183.0 mum (n = 33), with outer retinal tubulation observed in 15 (45%). Twenty-two of 33 subjects (67%) had electrophysiological evidence of macular dysfunction without generalized retinal dysfunction. Disease-causing variants were found in 31 patients (31/40, 78%). There was a higher prevalence of the variant p.Arg2030Gln in the cohort with foveal sparing compared to the group with foveal atrophy (6.45% vs 1.07%). CONCLUSIONS: The distinct clinical and molecular characteristics of patients with the foveal-sparing phenotype are described. The presence of 2 distinct phenotypes of Stargardt disease (foveal sparing and foveal atrophy) suggests that there may be more than 1 disease mechanism in ABCA4 retinopathy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
141 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency 2 c.71G>A, p.Arg24His 1 0.36% 2 c.161G>A, p.Cys54Tyr 3 1.07% 3 c.223T>G, p.Cys75Gly 1 0.36% 5 c.455G>A, p.Arg152Gln 1 0.36% 5 c.454C>T, p.Arg152* 1 0.36% 5 c.466 A>G, p.Ile156Val 2 0.71% 6 c.634C>T, p. Arg212Cys 3 1.07% 6 c.656G>C, p.Arg219Thr 1 0.36% 6 c.666_678delAAAGACGGTGCGC, p.Lys223_Arg226delfs 2 0.71% 6 c.768G>T, Splicing site 4 1.42% 8 c.1037A>C, p.Lys346Thr 1 0.36% 10 c.1222C>T, p.Arg408* 3 1.07% 12 c.1622T>C, p.Leu541Pro 2 0.71% 12 c.1648 G>T, p.Gly550* 1 0.36% 13 c.1804C>T, p.Arg602Trp 1 0.36% 13 c.1817G>A, p.Gly606Asp 1 0.36% 13 c.1922G>C, p.Cys641Ser 1 0.36% Int 13 c.1937&#fe;1G>A, Splicing site 2 0.71% 14 c.1957C>T, p.Arg653Cys 2 0.71% 17 c.2588G>C, p.Gly863Ala 19 6.79% 18 c.2701A>G, p.Thr901Ala 1 0.36% 19 c.2791G>A, p.Val931Met 2 0.71% 19 c.2894A>G, p.Asn965Ser 1 0.36% 20 c.2966T>C, p.Vla989Ala 3 1.07% 20 c.2971G>C, p.Gly991Arg 2 0.71% 21 c.3056C>T, p.Thr1019Met 1 0.36% 21 c.3113C>T, p.Ala1038Val 3 1.07% 21 c.3064G>A, p.Glu1022Lys 2 0.71% 22 c.3211_3212insGT, p.Ser1071Cysfs 6 2.14% 22 c.3259G>A, p.Glu1087Lys 4 1.43% 22 c.3292C>T, p.Arg1098Cys 1 0.36% 22 c.3322C>T, p.Arg1108Cys 5 1.79% 22 c.3323G>A, p.Arg1108His 1 0.36% 23 c.3364G>A, p.Glu1122Lys 1 0.36% 23 c.3386G>A, p.Arg1129His 1 0.36% 24 c.3602T>G, p.Leu1201Arg 3 1.07% 27 c.3898C>T, p.Arg1300* 2 0.71% 28 c.4139C>T, p.Pro1380Leu 14 5.00% 28 c.4222T>C, p.Trp1408Arg 1 0.36% 28 c.4234C>T, p.Gly1412* 1 0.36% 28 c.4253&#fe;5G>T, Splice site 1 0.36% 28 c.4253&#fe;4C>T, Splice site 1 0.36% 29 c.4283C>T, p.Thr1428Met 1 0.36% 29 c.4319T>C, p.Phe1440Ser 1 0.36% 29 c.4462T>C, p.Cys1488Arg 1 0.36% 30 c.4469G>A, p.Cys1490Tyr 5 1.79% 30 c.4537_4538insC, p.Gly1513Profs 1 0.36% 31 c.4577C>T, p.Thr1526Met 2 0.71% 33 c.4715C>T, p.Thr1572Met 1 0.36% Continued on next page TABLE 3. Login to comment

[hide] ABCA4 gene screening by next-generation sequencing... Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570. Fujinami K, Zernant J, Chana RK, Wright GA, Tsunoda K, Ozawa Y, Tsubota K, Webster AR, Moore AT, Allikmets R, Michaelides M
ABCA4 gene screening by next-generation sequencing in a British cohort.
Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570., [PMID:23982839]

Abstract [show]
PURPOSE: We applied a recently reported next-generation sequencing (NGS) strategy for screening the ABCA4 gene in a British cohort with ABCA4-associated disease and report novel mutations. METHODS: We identified 79 patients with a clinical diagnosis of ABCA4-associated disease who had a single variant identified by the ABCA4 microarray. Comprehensive phenotypic data were obtained, and the NGS strategy was applied to identify the second allele by means of sequencing the entire coding region and adjacent intronic sequences of the ABCA4 gene. Identified variants were confirmed by Sanger sequencing and assessed for pathogenicity by in silico analysis. RESULTS: Of the 42 variants detected by prescreening with the microarray, in silico analysis suggested that 34, found in 66 subjects, were disease-causing and 8, found in 13 subjects, were benign variants. We detected 42 variants by NGS, of which 39 were classified as disease-causing. Of these 39 variants, 31 were novel, including 16 missense, 7 splice-site-altering, 4 nonsense, 1 in-frame deletion, and 3 frameshift variants. Two or more disease-causing variants were confirmed in 37 (47%) of 79 patients, one disease-causing variant in 36 (46%) subjects, and no disease-causing variant in 6 (7%) individuals. CONCLUSIONS: Application of the NGS platform for ABCA4 screening enabled detection of the second disease-associated allele in approximately half of the patients in a British cohort where one mutation had been detected with the arrayed primer extension (APEX) array. The time- and cost-efficient NGS strategy is useful in screening large cohorts, which will be increasingly valuable with the advent of ABCA4-directed therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 1 c.161G>A p.C54Y DC c.2297G>T p.G766V DC 2 2 c.223T>G p.C75G DC c.5088C>G p.S1696R DC 2 3 c.740A>C p.N247T DC c.1433T>C p.I478T B c.2345G>A p.W782* DC 2 4 c.768G>T Splice site DC 1 5 c.1222C>T p.R408* DC c.2568C>A p.Y856* DC 2 6 c.1804C>T p.R602W DC c.859-9T>C Splice site PDC 2 7 c.1805G>A p.R602Q DC c.5113C>T p.R1705W DC 2 8 c.1922G>C p.C641S DC 1 9 c.1957C>T p.R653C DC 1 10 c.1957C>T p.R653C DC 1 11 c.2588G>C p.G863A DC c.655A>T p.R219* DC 2 Allele 2 (p.R219*) was APEX-false-negative 12 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 13 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 14 c.2588G>C p.G863A DC 1 15 c.2588G>C p.G863A DC 1 16 c.2894A>G p.N965S DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 17 c.3064G>A p.E1022K DC c.6729&#fe;4_&#fe;18delAGTTGGCCCTGGGGC Splice site DC 2 18 c.3064G>A p.E1022K DC 1 19 c.3208_3209insGT p.S1071fs DC c.2942C>T p.P981L DC c.6529G>A p.D2177N B 2 20 c.3208_3209insGT p.S1071fs DC c.1519G>T p.D507Y DC 2 21 c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 2 22 c.3208_3209insGT p.S1071fs DC 1 23 c.3292C>T p.R1098C DC c.3299T>A p.I1100N DC 2 24 c.3322C>T p.R1108C DC c.4978delC p.L1661* DC 2 25 c.3386G>A p.R1129H DC c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 3 Allele 2 (p.S1071fs) was APEX false-negative and allele 1 (p.R1129H) was NGS false-negative 26 c.4139C>T p.P1380L DC c.3191-1G>T Splice site DC 2 27 c.4139C>T p.P1380L DC c.3398T>C p.I1133T PDC 2 28 c.4139C>T p.P1380L DC c.4070C>A p.A1357E DC 2 29 c.4139C>T p.P1380L DC c.4773G>C Splice site DC 2 30 c.4139C>T p.P1380L DC 1 31 c.4139C>T p.P1380L DC 1 32 c.4139C>T p.P1380L DC 1 33 c.4234C>T p.Q1412* DC 1 34 c.4319T>C p.F1440S DC 1 35 c.4328G>A p.R1443H DC c.180delG p.M61fs DC 2 36 c.4469G>A p.C1490Y DC c.1726G>C p.D576H DC 2 37 c.4469G>A p.C1490Y DC 1 38 c.4537_4538insC p.Q1513fs DC c.5578C>T p.R1860W DC 2 Allele 1 (p.Q1513fs) was NGS-false-negative 39 c.4577C>T p.T1526M DC 1 T ABLE 2. Continued Pt Allele 1 Detected by APEX Allele 2 Detected by NGS Allele 3 Detected by NGS Total N of DC Variants Comments DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. Login to comment
62 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 3 c.161G>A p.C54Y 1 1 [ [ Lewis RA, et al. 11 Tol. 0.11 PRD 0.994 No change 1/13006 db SNP (rs150774447) 3 c.223T>G p.C75G 1 2 [ [ Lewis RA, et al. 11 Del. NA POD 0.603 No change ND 5 c.466A>G p.I156V 2 77, 78 [ [ Papaioannou M, et al. 16 Tol. 0.46 B 0.003 No change 16/13006 db SNP (rs112467008) Benign 6 c.655A>T p.R219* 1 11 [ Xi Q, et al. 27 ND 6 c.740A>C p.N247T 1 3 [ [ APEX Del. NA B 0.135 No change ND 6 c.768G>T Splice site 1 4 [ [ Klevering BJ, et al. 22 Tol. 0.56 NA Don. 70.4 58 Site broken (17.51) ND 9 c.1222C>T p.R408* 1 5 [ [ Webster AR, et al. 7 ND 12 c.1726G>C p.D576H 1 36 [ Downs K, et al. 25 POD 0.688 Acc. 68.1 39.1 Site broken (42.54) 1/13006 13 c.1804C>T p.R602W 1 6 [ [ Lewis RA, et al. 11 Del. 0.00 B 0.129 No change ND db SNP (rs 6179409) 13 c.1805G>A p.R602Q 1 7 [ [ Webster AR, et al. 7 Del. 0.04 PRD 0.513 Acc. 48.9 77.9 New site (&#fe;59.14) 2/13006 db SNP (rs61749410) 13 c.1906C>T p.Q636* 3 12, 13, 60 [ Zernant J, et al. 5 No change 1/13006 db SNP (rs145961131) 13 c.1922G>C p.C641S 1 8 [ [ Stenirri S, et al. 24 Del. 0.00 No change ND db SNP (rs61749416) 14 c.1957C>T p.R653C 2 9, 10 [ [ Rivera A, et al. 17 Del. 0.00 PRD 0.999 No change ND db SNP (rs61749420) 17 c.2588G>C p.G863A/ p.DelG863 5 11, 12, 13, 14, 15 [ [ Lewis RA, et al. 11 / Maugeri A, et al. 29 Del. 0.00 PRD 0.996 No change 68/13006 db SNP (rs76157638) 18 c.2701A>G p.T901A 1 74 [ [ APEX Tol. 0.82 B 0.008 23/13006 db SNP (rs139655975) Benign 19 c.2894A>G p.N965S 1 16 [ [ Lewis RA, et al. 11 Del. 0.03 PRD 0.981 Acc. 53.4 82.3 New site (&#fe;54.26) ND db SNP (rs201471607) 20 c.2971G>C p.G991R 1 67 [ [ Yatsenko AN, et al. 13 Del. 0.02 PRD 0.999 No change 28/13006 db SNP (rs147484266) Benign 22 c.3064G>A p.E1022K 2 17, 18 [ [ Webster AR, et al. 7 Del. 0.00 PRD 1.000 No change ND db SNP (rs61749459) 22 c.3208_3209insGT p.S1071fs 5 19, 20, 21, 22, 25 [ [ APEX ND False-negative in APEX in patient 25 22 c.3292C>T p.R1098C 1 23 [ [ Rivera A, et al. 17 Del. NA PRD 0.999 No change ND 22 c.3322C>T p.R1108C 3 16, 24, 61 [ [ Rozet JM, et al. 10 Del. 0.00 PRD 0.986 No change 1/13006 db SNP (rs61750120) False-negative in APEX in patients 16 and 61 23 c.3386G>A p.R1129H 1 25 [ Zernant J, et al. 5 PRD 0.989 No change ND False-negative in NGS in patient 25 24 c.3602T>G p.L1201R 4 72, 73, 74, 79 [ [ Lewis RA, et al. 11 Tol. 0.37 B 0.052 Don. 61.3 73.7 New site (20.08) 416/13006 db SNP (rs61750126) Benign 28 c.4139C>T p.P1380L 7 30, 31, 32, 33, 34, 35, 36 [ [ Lewis RA, et al. 11 Del. 0.01 B 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4234C>T p.Q1412* 1 33 [ [ Rivera A, et al. 17 ND db SNP (rs61750137) 29 c.4283C>T p.T1428M 1 76 [ [ APEX Tol. 0.15 B 0.010 No change 2/13006 db SNP (rs1800549) Benign 29 c.4319T>C p.F1440S 1 34 [ [ Lewis RA, et al. 11 Del. 0.00 POD 0.744 No change ND dbSNP (rs61750141) 29 c.4326C>A p.N1442K 1 64 [ Zernant J, et al. 5 Tol. NA POD 0.374 No change ND 29 c.4328G>A p.R1443H 1 35 [ [ Rivera A, et al. 17 Del. 0.02 PRD 0.999 No change 1/13006 dbSNP (rs61750142) IVS29 c.4352&#fe;1G>A Splice site 1 73 [ Zernant J, et al. 5 Don. 82.3 55.4 WT site broken (32.62) ND 30 c.4469G>A p.C1490Y 2 36, 37 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.994 No change ND dbSNP (rs61751402) 30 c.4538A>G p.Q1513R 1 67 [ Webster AR, et al. 7 Tol. NA Benign 0.043 Acc. 91.7 62.8 Site broken (31.55) ND T ABLE 3. Continued Exon/ IVS Nucleotide Substitution Protein Change/ Effect N of Alleles Identified Pt Method Previous Report SIFT Polyphen 2 HSF Matrix Allele Freq. by EVS Reference Comment APEX NGS Pred. Tol. Index (0-1) Pred. Login to comment

[hide] Identification of three ABCA4 sequence variations ... Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4. Utz VM, Chappelow AV, Marino MJ, Beight CD, Sturgill-Short GM, Pauer GJ, Crowe S, Hagstrom SA, Traboulsi EI
Identification of three ABCA4 sequence variations exclusive to African American patients in a cohort of patients with Stargardt disease.
Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4., [PMID:24011517]

Abstract [show]
PURPOSE: To describe the clinical and molecular findings in ten unrelated African American patients with Stargardt disease. DESIGN: Retrospective, observational case series. METHODS: We reviewed the clinical histories, examinations, and genotypes of 85 patients with molecular diagnoses of Stargardt disease. Three ABCA4 sequence variations identified exclusively in African Americans were evaluated in 300 African American controls and by in silico analysis. RESULTS: ABCA4 sequence changes were identified in 85 patients from 80 families, of which 11 patients identified themselves as African American. Of these 11 patients, 10 unrelated patients shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). The minor allele frequencies in the African American control population for each variation were 7.5%, 6.3%, and 2%, respectively. This is comparable to the allele frequency in African Americans in the Exome Variant Server. In contrast, the allele frequency of all three of these variations was less than or equal to 0.05% in European Americans. Although both c.3602T>G and c.3899G>A have been reported as likely disease-causing variations, one of our control patients was homozygous for each variant, suggesting that these are nonpathogenic. In contrast, the absence of c.6320G>A in the control population in the homozygous state, combined with the results of bioinformatics analysis, support its pathogenicity. CONCLUSIONS: Three ABCA4 sequence variations were identified exclusively in 10 unrelated African American patients: p.L1201R and p.R1300Q likely represent nonpathogenic sequence variants, whereas the p.R2107H substitution appears to be pathogenic. Characterization of population-specific disease alleles may have important implications for the development of genetic screening algorithms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 Population-Specific ABCA4 Alleles in Patients with Stargardt Disease References Population Allele Protein Rivera et al.28 Hargitai et al.12 Hungaro-German c.1622T>C/c.3113C>T p.L541P/p.A1038V September et al.47 Afrikaner c.4469G>A p.C1490Y September et al.47 Afrikaner c.1804C>T p.R602W Rosenberg et al.48 Danish c.2894A>G p.N965S Maugeri et al.27 Western European c.2588G>C p.G863A Maia-Lopes et al.49 Portuguese c.32T>C p.L11P Valverde et al.29 Spanish c.5882G>A p.R1129L Fumagalli et al.50 Italian c.2099G>A p.W700X VOL. 156, NO. 6 ALL AUTHORS HAVE COMPLETED AND SUBMITTED THE ICMJE FORM FOR DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST, and the following were reported. Login to comment

[hide] Whole exome sequencing detects homozygosity for AB... BMC Med Genet. 2014 Jan 20;15:11. doi: 10.1186/1471-2350-15-11. Ortube MC, Strom SP, Nelson SF, Nusinowitz S, Martinez A, Gorin MB
Whole exome sequencing detects homozygosity for ABCA4 p.Arg602Trp missense mutation in a pediatric patient with rapidly progressive retinal dystrophy.
BMC Med Genet. 2014 Jan 20;15:11. doi: 10.1186/1471-2350-15-11., [PMID:24444108]

Abstract [show]
BACKGROUND: A pediatric patient presented with rapidly progressive vision loss, nyctalopia and retinal dystrophy. This is the first report of homozygosity for the p.Arg602Trp mutation in the ABCA4 gene. The child became legally blind within a period of 2 years. CASE PRESENTATION: An eight year-old Hispanic female presented with bilateral decreased vision following a febrile gastrointestinal illness with nausea and vomiting. Extensive workup involved pediatric infectious disease and rheumatology consultations.Initial visual acuity was 20/60 at distance and 20/30 at near in both eyes. Rapidly progressive vision loss occurred during a 2-year period resulting in visual acuities of 20/200 at distance in both eyes. Fundus exam disclosed attenuated vessels and multiple subretinal blister-like elevations. Optical coherence tomography showed far more lesions than were clinically evident with different levels of elevation. Autofluorescence imagery showed dramatic and widespread geographic areas of atrophy. The deposits that appeared drusen-like on clinical exam were hyperfluorescent, consistent with lipofuscin deposits containing A2e (N-retinylidene-N-retinylethanolamine) indicative of RPE cell dysfunction. Electroretinography was consistent with cone dystrophy, with relative preservation of rod function. Blood analysis and rheumatology evaluation found no evidence of a diffuse post-infectious/inflammatory process. The unique and rapid progression of her subretinal blister-like lesions was documented by fluorescein angiography, optical coherence tomography, autofluorescence imagery, and fundus photography. Family pedigree history disclosed consanguinity, her parents being first cousins. DNA analysis by whole exomic sequencing revealed homozygosity of p.Arg602Trp in the ABCA4 gene. CONCLUSION: The pediatric patient presented with a striking clinical appearance and dramatic rate of progression that was clinically more characteristic of an infectious or inflammatory process. This case expands the diverse range of phenotypes attributed to ABCA4 mutations and further supports the role of whole exome sequencing as a powerful new tool available to aid clinicians in establishing diagnosis for challenging cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 CASE REPORT Open Access Whole exome sequencing detects homozygosity for ABCA4 p.Arg602Trp missense mutation in a pediatric patient with rapidly progressive retinal dystrophy Maria Carolina Ortube1* , Samuel P Strom2,3 , Stanley F Nelson2,3 , Steven Nusinowitz1 , Ariadna Martinez1 and Michael B Gorin1,3 Abstract Background: A pediatric patient presented with rapidly progressive vision loss, nyctalopia and retinal dystrophy. Login to comment
1 This is the first report of homozygosity for the p.Arg602Trp mutation in the ABCA4 gene. Login to comment
15 DNA analysis by whole exomic sequencing revealed homozygosity of p.Arg602Trp in the ABCA4 gene. Login to comment
24 After 2 years of ophthalmic follow-up we performed exomic sequencing and identified a likely pathogenic homozygous variant in ABCA4 (p.Arg602Trp). Login to comment
26 Here we provide a comprehensive phenotypic characterization of a young patient homozygous for this highly pathogenic p.Arg602Trp variant. Login to comment
96 Whole exome sequencing identified a homozygous ABCA4 missense variant (p.Arg602Trp) that has been identified as a Stargardt Disease mutation [7,8]. Login to comment
102 Whole exomic sequencing (WES) identified a total of 14 homozygous rare coding variants, including p.Arg602Trp in ABCA4 (Additional file 1). Login to comment
112 Compound heterozygous cases that included the p.Arg602Trp mutation of the ABCA4 gene have been described in early onset, autosomal recessive retinitis pigmentosa families [7,8]. Login to comment
165 Grants Foundation Fighting Blindness Harold and Pauline Price Chair Research to Prevent Blindness Shorter version: Homozygous ABCA4 p.Arg602Trp missense mutation. Login to comment
225 Arch Ophthalmol 2012, 130(2):171-179. doi:10.1186/1471-2350-15-11 Cite this article as: Ortube et al.: Whole exome sequencing detects homozygosity for ABCA4 p.Arg602Trp missense mutation in a pediatric patient with rapidly progressive retinal dystrophy. Login to comment

[hide] Quantitative fundus autofluorescence in recessive ... Invest Ophthalmol Vis Sci. 2014 May 1;55(5):2841-52. doi: 10.1167/iovs.13-13624. Burke TR, Duncker T, Woods RL, Greenberg JP, Zernant J, Tsang SH, Smith RT, Allikmets R, Sparrow JR, Delori FC
Quantitative fundus autofluorescence in recessive Stargardt disease.
Invest Ophthalmol Vis Sci. 2014 May 1;55(5):2841-52. doi: 10.1167/iovs.13-13624., [PMID:24677105]

Abstract [show]
PURPOSE: To quantify fundus autofluorescence (qAF) in patients with recessive Stargardt disease (STGD1). METHODS: A total of 42 STGD1 patients (ages: 7-52 years) with at least one confirmed disease-associated ABCA4 mutation were studied. Fundus AF images (488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference to account for variable laser power and detector sensitivity. The gray levels (GLs) of each image were calibrated to the reference, zero GL, magnification, and normative optical media density to yield qAF. Texture factor (TF) was calculated to characterize inhomogeneities in the AF image and patients were assigned to the phenotypes of Fishman I through III. RESULTS: Quantified fundus autofluorescence in 36 of 42 patients and TF in 27 of 42 patients were above normal limits for age. Young patients exhibited the relatively highest qAF, with levels up to 8-fold higher than healthy eyes. Quantified fundus autofluorescence and TF were higher in Fishman II and III than Fishman I, who had higher qAF and TF than healthy eyes. Patients carrying the G1916E mutation had lower qAF and TF than most other patients, even in the presence of a second allele associated with severe disease. CONCLUSIONS: Quantified fundus autofluorescence is an indirect approach to measuring RPE lipofuscin in vivo. We report that ABCA4 mutations cause significantly elevated qAF, consistent with previous reports indicating that increased RPE lipofuscin is a hallmark of STGD1. Even when qualitative differences in fundus AF images are not evident, qAF can elucidate phenotypic variation. Quantified fundus autofluorescence will serve to establish genotype-phenotype correlations and as an outcome measure in clinical trials.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 [A854T; A1038V]; p.C2150Y 512 2.3 26 F 52 1 0.70 0.48 I - p.R212C 722 2.0 27 F 52 13 1.00 1.00 - I p.A1038V; p.A848D 459 4.1 28 M 20 5 0.30 0.40 I - p.L2027F; p.R1108H 507 2.3 29 M 23 7 1.00 1.00 I I p.G1961E; p.R2030Q 334 347 2.4 2.0 30 M 44 26 0.70 0.70 - II p.P1380L; p.R1108H 453 4.7 31 F 30 22 1.00 1.30 - I p.G1961E; c.6005&#fe;1G > T 428 2.3 32 M 12 8 0.40 0.40 I - p.W821R; p.C2150Y 306 2.0 33 F 20 9 0.88 0.88 III III p.R602W; p.M1882I 650 655 2.6 2.5 34 F 47 4 0.40 0.40 I - p.G1961E; p.R1129C 400 2.5 35 F 19 3 0.70 0.48 II II p. Login to comment

[hide] Molecular diagnosis of putative Stargardt disease ... PLoS One. 2014 Apr 24;9(4):e95528. doi: 10.1371/journal.pone.0095528. eCollection 2014. Zhang X, Ge X, Shi W, Huang P, Min Q, Li M, Yu X, Wu Y, Zhao G, Tong Y, Jin ZB, Qu J, Gu F
Molecular diagnosis of putative Stargardt disease by capture next generation sequencing.
PLoS One. 2014 Apr 24;9(4):e95528. doi: 10.1371/journal.pone.0095528. eCollection 2014., [PMID:24763286]

Abstract [show]
Stargardt Disease (STGD) is the commonest genetic form of juvenile or early adult onset macular degeneration, which is a genetically heterogeneous disease. Molecular diagnosis of STGD remains a challenge in a significant proportion of cases. To address this, seven patients from five putative STGD families were recruited. We performed capture next generation sequencing (CNGS) of the probands and searched for potentially disease-causing genetic variants in previously identified retinal or macular dystrophy genes. Seven disease-causing mutations in ABCA4 and two in PROM1 were identified by CNGS, which provides a confident genetic diagnosis in these five families. We also provided a genetic basis to explain the differences among putative STGD due to various mutations in different genes. Meanwhile, we show for the first time that compound heterozygous mutations in PROM1 gene could cause cone-rod dystrophy. Our findings support the enormous potential of CNGS in putative STGD molecular diagnosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
130 Among these four reported mutations, p.A1773V in ABCA4 was reported as one of the founder mutations (up to17%) in Latin American population [18]; p.R2038W mutation in USA, Estonia and South African population; p.R602W mutation in USA, South African population [2,3,19]; G607R in the German population[20]. Login to comment
131 Taken together, this study confirmed that these four mutations are pathogenic mutations and among these four reported mutations, p.A1773V, p.R2038W and p.R602W may have higher allele frequencies since they were frequently reported in different populations. Login to comment
156 Allele frequency Family Gene Identified Mutations (Exon) Reported or novel SIFT PolyPhen PANTHER 1000G ESP6500 In-house A ABCA4 c.5318C.T;p.A1773V (Exon 38) Reported D $ PD $ T $ 0 0 0 c.4128+1 G.T (Exon 27) Novel N/A N/A N/A 0 0 0 B ABCA4 c.6112C.T; p.R2038W (Exon 44) Reported D $ PD $ De $ 0 0.00008 0 c.1804C.T; p. R602W (Exon 13) Reported D $ Benign De $ 0 0 0 C ABCA4 c.1819G.A;p.G607R(Exon 13, Homo*) Reported D $ PD $ De $ 0 0.000077 0 D ABCA4 c.6095A.G; p.H2032R (Exon 44) Novel D $ PD $ De $ 0 0 0 c.3420C.G;p.C1140W (Exon 23) Novel D $ PD $ De $ 0 0 0 E PROM1 c.730C.T; p.R244X (Exon 6) Novel N/A N/A N/A 0 0 0 c.1983+1 C.T (Exon18) Novel N/A N/A N/A 0 0 0 $ D: Damaging; PD, Possibly damaging; T, Tolerated; DE,Deleterious; N/A, No Answer; *Homo, Homozygous mutation; , SIFT (http://sift.jcvi.org/); PolyPhen (http://genetics.bwh.harvard.edu/pph2/). Login to comment

[hide] Identification of Genetic Defects in 33 Probands w... PLoS One. 2015 Jul 10;10(7):e0132635. doi: 10.1371/journal.pone.0132635. eCollection 2015. Xin W, Xiao X, Li S, Jia X, Guo X, Zhang Q
Identification of Genetic Defects in 33 Probands with Stargardt Disease by WES-Based Bioinformatics Gene Panel Analysis.
PLoS One. 2015 Jul 10;10(7):e0132635. doi: 10.1371/journal.pone.0132635. eCollection 2015., [PMID:26161775]

Abstract [show]
Stargardt disease (STGD) is the most common hereditary macular degeneration in juveniles, with loss of central vision occurring in the first or second decade of life. The aim of this study is to identify the genetic defects in 33 probands with Stargardt disease. Clinical data and genomic DNA were collected from 33 probands from unrelated families with STGD. Variants in coding genes were initially screened by whole exome sequencing. Candidate variants were selected from all known genes associated with hereditary retinal dystrophy and then confirmed by Sanger sequencing. Putative pathogenic variants were further validated in available family members and controls. Potential pathogenic mutations were identified in 19 of the 33 probands (57.6%). These mutations were all present in ABCA4, but not in the other four STGD-associated genes or in genes responsible for other retinal dystrophies. Of the 19 probands, ABCA4 mutations were homozygous in one proband and compound heterozygous in 18 probands, involving 28 variants (13 novel and 15 known). Analysis of normal controls and available family members in 12 of the 19 families further support the pathogenicity of these variants. Clinical manifestation of all probands met the diagnostic criteria of STGD. This study provides an overview of a genetic basis for STGD in Chinese patients. Mutations in ABCA4 are the most common cause of STGD in this cohort. Genetic defects in approximately 42.4% of STGD patients await identification in future studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Patient Nucleotide Amino Acid State Computational Prediction Allele Frequency in Reported ID Change Change P/SS Proven SIFT 1000G EVS ExAC NC RC QT058 c.6173T>G p.L2058R Het PrD D D NA NA NA 0/192 0/456 Novel c.4773 +1G>T Splicing defect Het SSA NA NA NA NA NA - 0/456 Pang et al. 2002; Riveiro-Alvarez et al. 2013 QT085 c.6173T>G p.L2058R Het PrD D D NA NA NA 0/192 0/456 Novel c.5932delA p. K1978Qfs*13 Het NA NA NA NA NA NA 0/192 0/456 Novel QT292 c.6389T>A p.M2130K Het PoD D D NA NA NA - 0/456 Yi et al. 2012 c.6118C>T p.R2040* Het NA NA NA NA NA 2/121394 0/192 0/456 Baum et al. 2003 QT302 c.6816 +1G>A Splicing defect Het SSA NA NA NA NA NA - 0/456 Robert et al. 2014 c.4555delA p.T1519Rfs*7 Het NA NA NA NA NA NA 0/192 0/456 Novel QT398 c.4352 +1G>A Splicing defect Het SSA NA NA NA NA 1/121268 - 0/456 Ernest et al. 2009 c.1804C>T p.R602W Het PoD D D NA NA 6/119038 - 2/456 Lewis et al. 1999; Wiszniewski et al. 2005; Heathfield et al. 2013 QT431 c.5646G>A p.M1882I Het PoD D D NA NA 3/121340 - 0/456 Zernant et al. 2011 c.1804C>T p.R602W Het B D D NA NA 6/119038 - 2/456 Lewis et al. 1999; Wiszniewski et al. 2005; Heathfield et al. 2013 QT458 c.4555delA p.T1519Rfs*7 Het NA NA NA NA NA NA 0/192 0/456 Novel c.164A>G p.H55R Het PoD D D NA NA NA - 0/456 Thiadens et al. 2012 QT727 c.161-2A>G Splicing defect Het SSA NA NA NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT833 c.2424C>G p.Y808* Het NA NA NA NA NA NA - 0/456 Zhou et al. 2014 c.1560delG p.V521Sfs*47 Het NA NA NA NA NA NA 0/192 0/456 Novel QT1137 c.6284A>T p.D2095V Het PrD D D NA NA NA 0/192 0/456 Novel c.22C>T p.Q8* Het NA NA NA NA 0.0001 NA 0/192 0/456 Novel QT1160 c.240_241del p.C81Ffs*17 Het NA NA NA NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT1175 c.4195G>T p.E1399* Het NA NA NA NA NA 2/120596 0/192 0/456 Novel c.2894A>G p.N965S Het PrD D D NA 0.0001 21/ 121302 - 0/456 Allikmets et al. 1997; Shanks et al. 2013; Bertelsen et al. 2014 QT1182 c.4773 +1G>T Splicing defect Hom SSA NA NA NA NA NA - 0/456 Pang et al. 2002; Riveiro-Alvarez et al. 2013 QT1198 c.5646G>A p.M1882I Het B D D NA NA 3/121340 - 0/456 Zernant et al. 2011 c.2894A>G p.N965S Het PrD D D NA 0.0001 21/ 121302 - 0/456 Allikmets et al. 1997;Shanks et al. 2013; Bertelsen et al. 2014 QT1200 c.6563T>C p.F2188S Het B D D NA 0.0005 2/121380 - 1/456 Fukui et al. 2002 c.858+2T>A Splicing defect Het SSA NA NA NA NA NA - 0/456 Zhang et al. 2014 QT1230 c.6317G>C p.R2106P Het PrD D D NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT1277 c.6479 +2T>C Splicing defect Het SSA NA NA NA NA NA 0/192 0/456 Novel (Continued) Table 1. Login to comment

[hide] Recessive Stargardt disease phenocopying hydroxych... Graefes Arch Clin Exp Ophthalmol. 2015 Aug 28. Noupuu K, Lee W, Zernant J, Greenstein VC, Tsang S, Allikmets R
Recessive Stargardt disease phenocopying hydroxychloroquine retinopathy.
Graefes Arch Clin Exp Ophthalmol. 2015 Aug 28., [PMID:26311262]

Abstract [show]
PURPOSE: To describe a series of patients with Stargardt disease (STGD1) exhibiting a phenotype usually associated with hydroxychloroquine (HCQ) retinopathy on spectral domain-optical coherence tomography (SD-OCT). METHODS: Observational case series from Columbia University Medical Center involving eight patients with genetically-confirmed STGD1. Patients selected for the study presented no history of HCQ use. Horizontal macular SD-OCT scans and accompanying 488-nm autofluorescence (AF) images, color fundus photographs, and full-field electroretinograms were analyzed. RESULTS: All study patients exhibited an abrupt thinning of the parafoveal region or disruption of the outer retinal layers on SD-OCT resembling the transient HCQ retinopathy phenotype. Funduscopy and AF imaging revealed variations of bull's eye maculopathy (BEM). Five patients exhibited local fleck-like deposits around the lesion. Genetic screening confirmed two disease-causing ABCA4 mutations in five patients and one mutation in three patients. CONCLUSIONS: A transient SD-OCT phenotype ascribed to patients with HCQ retinopathy is associated with an early subtype of STGD1. This finding may also present with HCQ retinopathy-like BEM lesions on AF imaging and funduscopy. A possible phenotypic overlap is unsurprising, given certain shared mechanistic disease processes between the two conditions. A thorough work-up, including screening of genes that are causal in retinal dystrophies associated with foveal sparing, may prevent misdiagnosis of more ambiguous cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 [5461-10T > C] P2 55, F White 20/20 20/20 Mottling + flecks Mottling + flecks p. [A1357V]; [G1961E] P3 57, M African-American 20/20 20/20 BEM + flecks BEM + flecks p. [R2107H] P4 10, F White 20/30 20/25 BEM + flecks BEM + flecks p. [E160*]; [R1108C] P5 26, F African-American 20/30 20/20 Mottling + flecks Mottling + flecks p. [R2107H]; [E526A] P6 19, F Asian-Caucasian 20/25 20/25 BEM BEM p. [R602W] P7 26, M African-Arab 20/20 20/20 BEM BEM p. [R1300*]; [R2106C] P8 25, M White 20/20 20/40 BEM BEM p. [Q1003*]; [G1961E] Abbreviations: M male, F female, BCVA best-corrected visual acuity, OD right eye, OS left eye, BEM bull`s eye maculopathy Fig. 1 Thinning of the parafoveal region with relative foveal sparing presenting as the hydroxychloroquine retinopathy- associated parafoveal outer retina thinning phenotype in patients with recessive Stargardt disease (STGD1). Login to comment