ABCMdb

ABCA4 p.Gly863Ala

ClinVar:	c.2588G>C , p.Gly863Ala D , Pathogenic
Predicted by SNAP2:	A: D (85%), C: D (66%), D: D (59%), E: D (59%), F: D (80%), H: D (63%), I: D (95%), K: D (66%), L: D (80%), M: D (75%), N: N (57%), P: D (71%), Q: D (59%), R: D (66%), S: N (57%), T: N (53%), V: D (75%), W: D (91%), Y: D (75%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Alternative splicing at a NAGNAG acceptor site as ... PLoS Genet. 2010 Oct 7;6(10). pii: e1001153. Hinzpeter A, Aissat A, Sondo E, Costa C, Arous N, Gameiro C, Martin N, Tarze A, Weiss L, de Becdelievre A, Costes B, Goossens M, Galietta LJ, Girodon E, Fanen P
Alternative splicing at a NAGNAG acceptor site as a novel phenotype modifier.
PLoS Genet. 2010 Oct 7;6(10). pii: e1001153., [PMID:20949073]

Abstract [show]
Approximately 30% of alleles causing genetic disorders generate premature termination codons (PTCs), which are usually associated with severe phenotypes. However, bypassing the deleterious stop codon can lead to a mild disease outcome. Splicing at NAGNAG tandem splice sites has been reported to result in insertion or deletion (indel) of three nucleotides. We identified such a mechanism as the origin of the mild to asymptomatic phenotype observed in cystic fibrosis patients homozygous for the E831X mutation (2623G>T) in the CFTR gene. Analyses performed on nasal epithelial cell mRNA detected three distinct isoforms, a considerably more complex situation than expected for a single nucleotide substitution. Structure-function studies and in silico analyses provided the first experimental evidence of an indel of a stop codon by alternative splicing at a NAGNAG acceptor site. In addition to contributing to proteome plasticity, alternative splicing at a NAGNAG tandem site can thus remove a disease-causing UAG stop codon. This molecular study reveals a naturally occurring mechanism where the effect of either modifier genes or epigenetic factors could be suspected. This finding is of importance for genetic counseling as well as for deciding appropriate therapeutic strategies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
145 This mutation (2588G.C) was shown to produce two isoforms leading to either an indel of Gly863 or to a missense defect, Gly863Ala, by shifting the NAGNAG motif from an implausible sequence (TAGGAG) into a plausible sequence (TAGCAG). Login to comment

[hide] The ABCR gene: a major disease gene in macular and... Mol Genet Metab. 1999 Oct;68(2):310-5. Rozet JM, Gerber S, Souied E, Ducroq D, Perrault I, Ghazi I, Soubrane G, Coscas G, Dufier JL, Munnich A, Kaplan J
The ABCR gene: a major disease gene in macular and peripheral retinal degenerations with onset from early childhood to the elderly.
Mol Genet Metab. 1999 Oct;68(2):310-5., [PMID:10527682]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Yet, the guanine at position 2588 is part of the 3Ј splice site of exon 17 and lymphoblastoid cell mRNA analysis of STGD patients carrying the G2588C substitution showed that the resulting mutant ABCR proteins either lacked G863 or contained the G863A missense mutation. Login to comment

[hide] ABC A-subfamily transporters: structure, function ... Biochim Biophys Acta. 2006 May;1762(5):510-24. Epub 2006 Feb 28. Kaminski WE, Piehler A, Wenzel JJ
ABC A-subfamily transporters: structure, function and disease.
Biochim Biophys Acta. 2006 May;1762(5):510-24. Epub 2006 Feb 28., [PMID:16540294]

Abstract [show]
ABC transporters constitute a family of evolutionarily highly conserved multispan proteins that mediate the translocation of defined substrates across membrane barriers. Evidence has accumulated during the past years to suggest that a subgroup of 12 structurally related "full-size" transporters, referred to as ABC A-subfamily transporters, mediates the transport of a variety of physiologic lipid compounds. The emerging importance of ABC A-transporters in human disease is reflected by the fact that as yet four members of this protein family (ABCA1, ABCA3, ABCR/ABCA4, ABCA12) have been causatively linked to completely unrelated groups of monogenetic disorders including familial high-density lipoprotein (HDL) deficiency, neonatal surfactant deficiency, degenerative retinopathies and congenital keratinization disorders. Although the biological function of the remaining 8 ABC A-transporters currently awaits clarification, they represent promising candidate genes for a presumably equally heterogenous group of Mendelian diseases associated with perturbed cellular lipid transport. This review summarizes our current knowledge on the role of ABC A-subfamily transporters in physiology and disease and explores clinical entities which may be potentially associated with dysfunctional members of this gene subfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
178 Interestingly, some mutant alleles such as G863A, A1038V, and G1961E, respectively, appear to be more common and may have altered frequencies in different populations, presumably as a result of a founder effect [76,80]. Login to comment

[hide] Organization of the ABCR gene: analysis of promote... Gene. 1998 Jul 17;215(1):111-22. Allikmets R, Wasserman WW, Hutchinson A, Smallwood P, Nathans J, Rogan PK, Schneider TD, Dean M
Organization of the ABCR gene: analysis of promoter and splice junction sequences.
Gene. 1998 Jul 17;215(1):111-22., [PMID:9666097]

Abstract [show]
Mutations in the human ABCR gene have been associated with the autosomal recessive Stargardt disease (STGD), retinitis pigmentosa (RP19), and cone-rod dystrophy (CRD) and have also been found in a fraction of age-related macular degeneration (AMD) patients. The ABCR gene is a member of the ATP-binding cassette (ABC) transporter superfamily and encodes a rod photoreceptor-specific membrane protein. The cytogenetic location of the ABCR gene was refined to 1p22.3-1p22.2. The intron/exon structure was determined for the ABCR gene from overlapping genomic clones. ABCR spans over 100kb and comprises 50 exons. Intron/exon splice site sequences are presented for all exons and analyzed for information content (Ri). Nine splice site sequence variants found in STGD and AMD patients are evaluated as potential mutations. The localization of splice sites reveals a high degree of conservation between other members of the ABC1 subfamily, e.g. the mouse Abc1 gene. Analysis of the 870-bp 5' upstream of the transcription start sequence reveals multiple putative photoreceptor-specific regulatory elements including a novel retina-specific transcription factor binding site. These results will be useful in further mutational screening of the ABCR gene in various retinopathies and for determining the substrate and/or function of this photoreceptor-specific ABC transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
122 acceptors (G863A, 5585+1G/A, V2050L), and six in The mean of the distribution of individual information donors (4253+5G/T, 5196+1G/A, 5196+2T/C, contents (R i values, R sequence ) for splice acceptor and 5714+5G/A, 5898+1G/T, 6005+1G/T). Login to comment
132 In general, splice sites contained well-known exon 17 splice acceptor site, G863A, had a dual effectconserved AG and GT sequences in acceptors and (Fig. 1b). Login to comment
135 The individual information R i acceptor at position 365 by two bits and created an Table 2 Analysis of ABCR splice site variants Exon Mutation Disease Number of patients wt R i mt R i Predicted effect on the ABCR protein 17A G863A STGD/AMD 11/1 11.6 9.7 Change of aa or deletion of one aaa 28D 4253+5G/T STGD 1 8.2 4.3 Partially functioning splice site 36D 5196+1G/A AMD 1 6.8 -6.0 Non-functional protein 36D 5196+2T/C STGD 1 6.8 -0.7 Non-functional protein 40A 55851G/A STGD 1 5.9 -1.6 Non-functional protein 40D 5714+5G/A STGD 8 7.2 3.7 Partially functioning splice site 42D 5898+1G/T STGD 3 8.6 0.8 Non-functional protein 43D 6005+1G/T STGD 1 11.2 3.4 Partially functioning splice site 45A V2050L STGD 2 12.5 10.6 Change of aa, no effect on splicing 'A` or 'D` after the exon number indicates splice acceptor or donor sequences, respectively. Login to comment
150 A G C (G863A) mutation in the first nucleotide of exon 17. Login to comment
126 acceptors (G863A, 5585+1G/A, V2050L), and six in The mean of the distribution of individual information donors (4253+5G/T, 5196+1G/A, 5196+2T/C, contents (R i values, R sequence ) for splice acceptor and 5714+5G/A, 5898+1G/T, 6005+1G/T). Login to comment
138 In general, splice sites contained well-known exon 17 splice acceptor site, G863A, had a dual effect conserved AG and GT sequences in acceptors and (Fig. 1b). Login to comment
141 The individual information R i acceptor at position 365 by two bits and created an Table 2 Analysis of ABCR splice site variants Exon Mutation Disease Number of patients wt R i mt R i Predicted effect on the ABCR protein 17A G863A STGD/AMD 11/1 11.6 9.7 Change of aa or deletion of one aaa 28D 4253+5G/T STGD 1 8.2 4.3 Partially functioning splice site 36D 5196+1G/A AMD 1 6.8 -6.0 Non-functional protein 36D 5196+2T/C STGD 1 6.8 -0.7 Non-functional protein 40A 55851G/A STGD 1 5.9 -1.6 Non-functional protein 40D 5714+5G/A STGD 8 7.2 3.7 Partially functioning splice site 42D 5898+1G/T STGD 3 8.6 0.8 Non-functional protein 43D 6005+1G/T STGD 1 11.2 3.4 Partially functioning splice site 45A V2050L STGD 2 12.5 10.6 Change of aa, no effect on splicing 'A` or 'D` after the exon number indicates splice acceptor or donor sequences, respectively. Login to comment
156 A GQC (G863A) mutation in the first nucleotide of exon 17. Login to comment

[hide] The dark atrophy with indocyanine green angiograph... Invest Ophthalmol Vis Sci. 2012 Jun 26;53(7):3999-4004. Print 2012 Jun. Giani A, Pellegrini M, Carini E, Peroglio Deiro A, Bottoni F, Staurenghi G
The dark atrophy with indocyanine green angiography in Stargardt disease.
Invest Ophthalmol Vis Sci. 2012 Jun 26;53(7):3999-4004. Print 2012 Jun., [PMID:22589445]

Abstract [show]
PURPOSE: To evaluate differences in fluorescein angiography (FA) and indocyanine green angiography (ICGA), findings between subjects affected by Stargardt disease (STGD) and atrophic AMD. METHODS: This was a consecutive, cross-sectional case series. A total of 24 eyes of 12 patients with STGD and 23 eyes of 14 patients with atrophic AMD were enrolled in the study. Patients underwent dynamic simultaneous FA and ICGA using a dual beam confocal scanning system. Images were recorded from the initial filling of choroidal and retinal vessels throughout all the phases of the angiogram. Spectral-domain optical coherence tomography (SD-OCT) and fundus autofluorescence were also executed. FA and ICGA findings in the two groups were evaluated. RESULTS: In 92% (22/24) of eyes affected by STGD, ICGA showed hypocyanescence from the areas of atrophy, more evident in the late phases. This finding, defined as ICGA-imaged "dark atrophy," was present in only 13% (3/23) of the eyes affected by atrophic AMD. The remaining eyes in both groups showed iso- or mild hypercyanescence from the areas of atrophy. Eyes with ICGA-imaged dark atrophy, both in STGD and in atrophic AMD groups, did not show early obscuration of the choroidal vessels by FA. SD-OCT revealed morphologically intact choroid in STGD patients with ICGA-imaged dark atrophy. In atrophic AMD eyes with ICGA-imaged dark atrophy, SD-OCT revealed a severely thinned choroid. CONCLUSIONS: Hypocyanescence by ICGA from the areas of atrophy was more frequent in STGD compared with atrophic AMD. This finding, along with SD-OCT evidence of intact choroid, suggests a possible selective damage of the choriocapillaris in STGD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
140 The diagnosis of STGD was confirmed after genetic analysis of the ABCA4 gene, which revealed the following mutations: c.2099G > A (p.Trp700Term) (het); c.2588G > C (p.Gly863Ala) (het). Login to comment
139 The diagnosis of STGD was confirmed after genetic analysis of the ABCA4 gene, which revealed the following mutations: c.2099G > A (p.Trp700Term) (het); c.2588G > C (p.Gly863Ala) (het). Login to comment

[hide] ABCA4 is an N-retinylidene-phosphatidylethanolamin... Nat Commun. 2012 Jun 26;3:925. doi: 10.1038/ncomms1927. Quazi F, Lenevich S, Molday RS
ABCA4 is an N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine importer.
Nat Commun. 2012 Jun 26;3:925. doi: 10.1038/ncomms1927., [PMID:22735453]

Abstract [show]
ATP-binding cassette (ABC) transporters comprise a superfamily of proteins, which actively transport a variety of compounds across cell membranes. Mammalian and most eukaryotic ABC transporters function as exporters, flipping or extruding substrates from the cytoplasmic to the extracellular or lumen side of cell membranes. Prokaryotic ABC transporters function either as exporters or importers. Here we show that ABCA4, an ABC transporter found in retinal photoreceptor cells and associated with Stargardt macular degeneration, is a novel importer that actively flips N-retinylidene-phosphatidylethanolamine from the lumen to the cytoplasmic leaflet of disc membranes, thereby facilitating the removal of potentially toxic retinoid compounds from photoreceptors. ABCA4 also actively transports phosphatidylethanolamine in the same direction. Mutations known to cause Stargardt disease decrease N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine transport activity of ABCA4. These studies provide the first direct evidence for a mammalian ABC transporter that functions as an importer and provide insight into mechanisms underlying substrate transport and the molecular basis of Stargardt disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
145 To gain further insight into the molecular mechanisms underlying ABCA4-mediated transport activity and Stargardt disease, we examined the functional properties of ABCA4-containing G863A and N965S mutations associated with Stargardt disease and Walker A mutations, K969M in NBD1, K1978M in NBD2 and the double mutant K969M/1978M. Login to comment
146 The K1978M mutant expressed at the same level as WT ABCA4, whereas the G863A, N965S, K969M and K969M/ K1978M mutants expressed within 50% that of WT ABCA4. Login to comment
168 Percent-relative NBD-PE flipping plotted as a mean with error bars representing ± s.d. for n = 3. mutants showing essentially undetectable activity and the G863A and N965S Stargardt mutants displaying ~18 and 37% of WT activity (Fig. 6b). Login to comment
172 Addition of ATP resulted in release of the substrate from the G863A, N965S and K1978M mutants, but impaired release from the K969M mutant and no significant release from the K969M/K1978M double mutant. Login to comment
189 However, retinal readily reacts with PE, I a E ABCA4 W i l d - t y p e G 8 6 3 A N 9 6 5 S K 9 6 9 M K 9 6 9 M / K 1 9 7 8 M K 1 9 7 8 M ABCA4 kDa 250 250 I E I E I E I E I E 150 100 75 50 37 25 e % N-retinylidene PE binding 120 - ATP + ATP 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T b G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M 120 % Retinal transfer * * 100 80 60 40 20 0 W T c G863A N965S Retinal (µM) 250 % Basal ATPase activity 200 150 100 WT 50 0 0 10 20 30 40 50 60 d MM Retinal (µM) K969M K1978M % Basal ATPase activity 250 WT 200 150 100 50 0 0 10 20 30 40 50 60 f % NBD-PE flippase activity * * 120 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T Figure 6 | Effect of Walker A and Stargardt mutations on ATR transfer activity. Login to comment
219 The binding of N-retinyli- dene-PE and its release by ATP is not affected by the G863A and N965S mutations (Fig. 6e), but the basal- and retinal-stimulated ATPase activity and ATP-dependent retinal transfer activity are significantly reduced. Login to comment

[hide] A subgroup of age-related macular degeneration is ... Invest Ophthalmol Vis Sci. 2012 Apr 30;53(4):2112-8. doi: 10.1167/iovs.11-8785. Print 2012 Apr. Fritsche LG, Fleckenstein M, Fiebig BS, Schmitz-Valckenberg S, Bindewald-Wittich A, Keilhauer CN, Renner AB, Mackensen F, Mossner A, Pauleikhoff D, Adrion C, Mansmann U, Scholl HP, Holz FG, Weber BH
A subgroup of age-related macular degeneration is associated with mono-allelic sequence variants in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2012 Apr 30;53(4):2112-8. doi: 10.1167/iovs.11-8785. Print 2012 Apr., [PMID:22427542]

Abstract [show]
Purpose. Age-related macular degeneration (AMD) is a heterogeneous condition of high prevalence and complex etiology involving genetic as well as environmental factors. By fundus autofluorescence (FAF) imaging, AMD can be classified into several distinct phenotypes, with one subgroup characterized by fine granular pattern with peripheral punctate spots (GPS[+]). Some features of GPS[+] overlap with Stargardt disease (STGD1), a recessive macular dystrophy caused by biallelic sequence variants in the ATP-binding cassette transporter 4 (ABCA4) gene. The aim of this study was to investigate the role of ABCA4 in GPS[+]. Methods. The ABCA4 gene was sequenced in 25 patients with the GPS[+] phenotype and 29 with geographic atrophy (GA)-AMD but no signs of GPS (GPS[-]). In addition, frequencies of risk-increasing alleles at three known AMD susceptibility loci, including complement factor H (CFH), age-related maculopathy susceptibility 2 (ARMS2), and complement component 3 (C3), were evaluated. Results. We demonstrate that GPS[+] is associated significantly with monoallelic ABCA4 sequence variants. Moreover, frequencies of AMD risk-increasing alleles at CFH, ARMS2, and C3 are similar in GPS[+] and STGD1 patients, with risk allele frequencies in both subcategories comparable to population-based control individuals estimated from 3,510 individuals from the NHLBI Exome Sequencing Project. Conclusions. Our data suggest that the GPS[+] phenotype is accounted for by monoallelic variants in ABCA4 and unlikely by the well-established AMD risk-increasing alleles at CFH, ARMS2, and C3. These findings provide support for a complex role of ABCA4 in the etiology of a minor proportion of patients with AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 Upper row: Right and left eye of a female patient (age of onset 46 years) with autosomal recessive STGD1 genetically confirmed by two ABCA4 variants (c.2588G>C, p.G863A/p.G863del and c.4234C>T, p.E1412X). Login to comment
82 Upper row: Right and left eye of a female patient (age of onset 46 years) with autosomal recessive STGD1 genetically confirmed by two ABCA4 variants (c.2588G>C, p.G863A/p.G863del and c.4234C>T, p.E1412X). Login to comment

[hide] Macular function in macular degenerations: repeata... Invest Ophthalmol Vis Sci. 2012 Feb 21;53(2):841-52. Print 2012 Feb. Cideciyan AV, Swider M, Aleman TS, Feuer WJ, Schwartz SB, Russell RC, Steinberg JD, Stone EM, Jacobson SG
Macular function in macular degenerations: repeatability of microperimetry as a potential outcome measure for ABCA4-associated retinopathy trials.
Invest Ophthalmol Vis Sci. 2012 Feb 21;53(2):841-52. Print 2012 Feb., [PMID:22247458]

Abstract [show]
PURPOSE: To measure macular visual function in patients with unstable fixation, to define the photoreceptor source of this function, and to estimate its test-retest repeatability as a prerequisite to clinical trials. METHODS: Patients (n = 38) with ABCA4-associated retinal degeneration (RD) or with retinitis pigmentosa (RP) were studied with retina-tracking microperimetry along the foveo-papillary profile between the fovea and the optic nerve head, and point-by-point test-retest repeatability was estimated. A subset with foveal fixation was also studied with dark-adapted projection perimetry using monochromatic blue and red stimuli along the horizontal meridian. RESULTS: Macular function in ABCA4-RD patients transitioned from lower sensitivity at the parafovea to higher sensitivity in the perifovea. RP patients had the inverse pattern. Red-on-red microperimetric sensitivities successfully avoided ceiling effects and were highly correlated with absolute sensitivities. Point-by-point test-retest limits (95% confidence intervals) were +/-4.2 dB; repeatability was not related to mean sensitivity, eccentricity from the fovea, age, fixation location, or instability. Repeatability was also not related to the local slope of sensitivity and was unchanged in the parapapillary retina. CONCLUSIONS: Microperimetry allows reliable testing of macular function in RD patients without foveal fixation in longitudinal studies evaluating natural disease progression or efficacy of therapeutic trials. A single estimate of test-retest repeatability can be used to determine significant changes in visual function at individual retinal loci within diseased regions that are homogeneous and those that are heterogeneous and also in transition zones at high risk for disease progression.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Clinical and Molecular Characteristics of the ABCA4 Patients Patient Age (y)/Sex ABCA4 Mutation Clinical Diagnosis Visual Acuity* Kinetic Visual Field Extent (V-4e)†Allele 1 Allele 2 Foveal Fixation P1‡ 12/M N965S W821R STGD 20/20 97 P2‡ 17/F V989A IVS28ϩ5 GϾT STGD 20/100 90 P3 18/M G1961E R1129L§ STGD 20/100 105 P4 21/F R212C P68R STGD 20/125 101 P5 24/M P1511 del1ccgC R1705Q STGD 20/25 114 P6 31/M G863A R1108C STGD 20/25 105 P7 32/F IVS40ϩ5 GϾA V935A STGD 20/32 103 P8 34/M G1961E - CRD 20/32 98 P9 37/F R681X P309R STGD 20/20 109 P10 39/M G1961E C54Y§ STGD 20/40 101 P11‡ 42/F G1961E V256V STGD 20/32 105 P12‡ 46/F G1961E V256V STGD 20/32 106 P13 52/F G1961E P1380L STGD 20/40 105 P14 58/M D600E R18W§ STGD 20/40 84 Extrafoveal Fixation P15 11/M V256V T1526M CRD 20/200 102 P16 15/M C54Y IVS35ϩ2 TϾC STGD 20/200 96 P17‡ 16/F V989A IVS28ϩ5 GϾT STGD 20/100 100 P18‡ 16/M N965S W821R STGD 20/125 100 P19 19/F A1038V/L541P N965S STGD 20/400 90 P20 21/M G863A IVS35ϩ2 TϾC STGD 20/200 99 P21 22/F G1961E R152X STGD 20/50 104 P22 27/M G863A P1660S§ STGD 20/100 98 P23 27/F G1961E A1038V/L541P STGD 20/100 109 P24 29/M G1961E T1019M STGD 20/100 104 P25 33/M P1486L deletion of exon 7 STGD 20/400 98 P26 36/F G863A C1490Y STGD 20/100 93 P27 41/M A1038V/L541P - STGD 20/125 108 P28 49/F T1526M R2030Q STGD 20/125 98 P29 55/F W855X - STGD 20/160 87 P30 56/F G1961E IVS37ϩ1 GϾA§ STGD 20/125 89 P31 60/F G1961E M669 del2ccAT STGD 20/125 104 STGD, Stargardt disease; CRD, cone-rod dystrophy. Login to comment

[hide] Phenotypic and genetic spectrum of Danish patients... Ophthalmic Genet. 2012 Dec;33(4):225-31. doi: 10.3109/13816810.2011.643441. Epub 2012 Jan 9. Duno M, Schwartz M, Larsen PL, Rosenberg T
Phenotypic and genetic spectrum of Danish patients with ABCA4-related retinopathy.
Ophthalmic Genet. 2012 Dec;33(4):225-31. doi: 10.3109/13816810.2011.643441. Epub 2012 Jan 9., [PMID:22229821]

Abstract [show]
Background: Pathogenic variations in the ABCA4 gene were originally recognized as genetic background for the autosomal recessive disorders Stargardt disease and fundus flavimaculatus, but have expanded to embrace a diversity of retinal diseases, giving rise to the new diagnostic term, ABCA4-related retinopathy. Diagnostic genotyping of ABCA4 is complicated by the large size of the gene and the existence of approximately 600 known pathogenic variations, along with numerous rare polymorphisms. A commercial diagnostic array-based assay has been developed targeting known mutations, however a conclusive genetic diagnosis must rely on a comprehensive genetic screening as the mutation spectrum of ABCA4-related retinopathies continues to expand. Material and methods: Among 161 patients with a Stargardt-related phenotype previously assessed with the commercial ABCA4 mutation microarray, we analyzed the ABCA4 gene with High-resolution melting (HRM) in patients in whom the array analysis identified either a heterozygous mutation (n = 50) or no mutation (n = 30). Results: The HRM method detected each of the already known mutations and polymorphisms. We identified the second ABCA4 mutation in 31 of 50 heterozygous patients (62%). Several novel mutations were identified of which four were identified multiple times. The recurrent novel mutations were subsequently assessed among the 30 patients with possible ABCA4-related diseases, previously found to be negative for known ABCA4 mutations by array analysis. In total, 30 different mutations were identified of which 21 have not been described before. Conclusion: Scandinavian patients with ABCA4-related retinopathy appear to have a distinct mutation spectrum, which can be identified in patients of diverse clinical phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Table 1 Mutations identified by HRM in the initial 50 heterozygous patients Patient Mutation 1 (Asper) Mutation 2 (HRM) RefDNA Protein Exon/intron DNA Protein Exon/intron D043 c.2588G>C p.G863A 17 c.184 C>T p.P62S 3 New D069 c.3113C>T p.A1038V 21 c.1529 T>G p.L510R 11 New D050 c.2588G>C p.G863A 17 c.1529 T>G p.L510R 11 New D112 c.2894A>G p.N965S 19 c.1529 T>G p.L510R 11 New D099 c.6089G>A p.R2030Q 44 c.1529 T>G p.L510R 11 New D165 c.1822T>C p.F608L 13 c.2243 G>A p.C748Y 15 New D166 c.2588G>C p.G863A 17 c.2300 T>A p.V767D 15 Known D117 c.3191-2A>G na IVS21 c.2408delG na 16 New D135 c.2894A>G p.N965S 19 c.2408delG na 16 New D147 c.2894A>G p.N965S 19 c.2408delG na 16 New D173 c.4469G>A p.C1490Y 30 c.2915C>A p.T972N 19 Known D013* c.1622C>T p.L541P 12 c.1313C>T p.A1038V 21 Known D181 c.6089G>A p.R2030Q 44 c.3380 G>A p.G1127E 23 New D018 c.6449G>A p.C2150Y 47 c.3736 C>G p.L1246V 25 New D191 c.2588G>C p.G863A 17 c.4069 G>A p.A1357T 27 New D167 c.5461-10T>C na IVS38 c.4102 C>T p.R1368C 27 New D022 c.4462T>C p.C1488R 30 c.4102 C>T p.R1368C 27 New D108 c.1648G>A p.G550R 12 c.4102 C>T p.R1368C 27 New D414 c.2588G>C p.G863A 17 c.4653 G>A p.W1551X 32 New D027 c.2588G>C p.G863A 17 c.4668-2A>G na IVS32 New D136 c. Login to comment
57 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.4739T>C p.L1580S 33 Known D444 c.2701A>G p.T901A 18 c.4773 + 3A>G na IVS33 New D034 c.2588G>C p.G863A 17 c.4773 + 5G>A na IVS33 New D178 c.3113C>T p.A1038V 21 c.5523_5528del p.1843_1844delRG 39 New D110 c. Login to comment
58 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.5584 + 1G>A na IVS39 New D188 c.5461-10T>C na IVS38 c.5693G>A p.R1898H 40 Known D433 c.5882G>A p.G1961E 42 c.6005 + 1G>A na IVS43 Known D134 c.4667 09;+ 2G>T na IVS32 c.6098 T>G p.L2033R 44 New D186 c.3322C>T p.R1108C 22 c.6386 + 1G>A na IVS46 New D182 c.6089G>A p.R2030Q 44 c.6386 + 1G>A na IVS46 New D189 c.2894A>G p.N965S 19 c.6478 A>G p.K2160E 47 New *p.L541P and p.A1038V might be located on the same allele. Login to comment
76 Among the novel mutations detected, the four p.L510R-carrying alleles are found in the Stargardt-flavimaculatus group in combination with p.G863A, p.2030Q, and the Danish founder mutation p.N965S (Table 4). Login to comment
78 The stop mutation p.W1551X is combined with the mild mutation p.G863A though resulting in a serious phenotype. Login to comment
97 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773 + 5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005 + 1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773 + 3A>G* D110 p.[L541P+A1038V] c.5584 + 1G>A* D182 p.R2030Q c.6386 + 1G>A* D186 p.R1108C c.6386 + 1G>AA* D133 p.L510R IVS46 + 1G>A* Cone-rod dystrophy D134 c.4667 + 2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame. Login to comment
59 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.4739T>C p.L1580S 33 Known D444 c.2701A>G p.T901A 18 c.4773ߙ+ߙ3A>G na IVS33 New D034 c.2588G>C p.G863A 17 c.4773ߙ+ߙ5G>A na IVS33 New D178 c.3113C>T p.A1038V 21 c.5523_5528del p.1843_1844delRG 39 New D110 c. Login to comment
80 The stop mutation p.W1551X is combined with the mild mutation p.G863A though resulting in a serious phenotype. Login to comment
100 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773ߙ+ߙ5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005ߙ+ߙ1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773ߙ+ߙ3A>G* D110 p.[L541P+A1038V] c.5584ߙ+ߙ1G>A* D182 p.R2030Q c.6386ߙ+ߙ1G>A* D186 p.R1108C c.6386ߙ+ߙ1G>AA* D133 p.L510R IVS46ߙ+ߙ1G>A* Cone-rod dystrophy D134 c.4667ߙ+ߙ2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame. Login to comment

[hide] Stargardt macular dystrophy: common ABCA4 mutation... Mol Vis. 2012;18:280-9. Epub 2012 Feb 1. Roberts LJ, Nossek CA, Greenberg LJ, Ramesar RS
Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients.
Mol Vis. 2012;18:280-9. Epub 2012 Feb 1., [PMID:22328824]

Abstract [show]
PURPOSE: Based on the previous indications of founder ATP-binding cassette sub-family A member 4 gene (ABCA4) mutations in a South African subpopulation, the purpose was to devise a mechanism for identifying common disease-causing mutations in subjects with ABCA4-associated retinopathies (AARs). Facilitating patient access to this data and determining the frequencies of the mutations in the South African population would enhance the current molecular diagnostic service offered. METHODS: The majority of subjects in this study were of Caucasian ancestry and affected with Stargardt macular dystrophy. The initial cohort consisted of DNA samples from 181 patients, and was screened using the ABCR400 chip. An assay was then designed to screen a secondary cohort of 72 patients for seven of the most commonly occurring ABCA4 mutations in this population. A total of 269 control individuals were also screened for the seven ABCA4 mutations. RESULTS: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. The newly designed genetic assay identified two of the seven disease-associated mutations in 28/72 patients in a secondary patient cohort. In the control cohort, 12/269 individuals were found to be heterozygotes, resulting in an estimated background frequency of these mutations in this particular population of 4.46 per 100 individuals. CONCLUSIONS: The relatively high detection rate of seven ABCA4 mutations in the primary patient cohort led to the design and subsequent utility of a multiplex assay. This assay can be used as a viable screening tool and to reduce costs and laboratory time. The estimated background frequency of the seven ABCA4 mutations, together with the improved diagnostic service, could be used by counselors to facilitate clinical and genetic management of South African families with AARs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Results: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. Login to comment
54 AS-PCR was used to screen for the p.Gly863Ala mutation (Table 3), and the PCR products were separated using non-denaturing dHPLC conditions on the WAVE® System (Figure 6). Login to comment
61 Exon (mutation) Primer 5'-3' Annealing temperature Mutation detection technique Exon 5 (p.Arg152*) F: gacccatttccccttcaac 60 °C dHPLC, Cycle sequencing using the reverse primer R: aggctgggtgcttccctc Exon 6 (c.768G>T) F: ggtgtctttcctaccacag 57.9 °C dHPLC, Cycle sequencing using the forward primer R: aggaatcaccttgcaattgg Exon 13 (p.Arg602Trp) F: agctatccaagcccgttcc 63 °C SNaPshot PCR R: ccattagcgtgtcatggag Exon 17 (p.Gly863Ala) F: ctgcggtaaggtaggataggg 60 °C Allele-specific PCR R: cacaccgtttacatagagggc Exon 30 (p.Cys1490Tyr) F: gtcagcaactttgaggctg 63 °C SNaPshot PCR R: tccctctgtggcaggcag Intron38/Exon39 (c.5461-10T>C) F: gccccacctgctgaagag 63 °C SNaPshot PCR R: tcccagctttggacccag Exon 44 (p.Leu2027Phe) F: gaagcttctccagccctagc 63 °C SNaPshot PCR R: tgcactctcatgaaacaggc TABLE 2. Login to comment
73 However, seven mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a significantly higher frequency, compared to the other variants in the cohort (Table 4). Login to comment
90 The same study showed that the p.Gly863Ala mutation, which occurs in the first nucleotide and hence the splice acceptor site of exon 17, Figure 2. Login to comment
127 INFORMATION PERTAINING TO THE PRIMERS DESIGNED FOR AS-PCR FOR GLY863ALA MUTATION DETECTION. Login to comment
128 Exon (mutation) Primer name (bp) Primer length Primer sequence* (5'-3') 17 Gly863Ala-Rc 26 tttttgaagtggggttccatagtcag Gly863Ala-Rg 36 gcgtgcttggggtatgaagtggggttccatagtcac Gly863Ala-Rc: The AS-PCR primer designed specifically to bind to the nucleotide, cytosine (C), when exon 17 does not contain the p.Gly863Ala mutation, and is therefore known as the wild type primer. Login to comment
129 Gly863Ala-Rg: The AS-PCR primer designed specifically to bind to the nucleotide, guanine (G), when exon 17 contains the p.Gly863Ala mutation, and is therefore known as the mutation-specific primer. Login to comment
132 A chromatogram, generated using denaturing high-performance liquid chromatography following allele-specific PCR, shows the wild type profile and the profile obtained when a heterozygous p.Gly863Ala mutation is present. Login to comment
133 Of the seven ABCA4 mutations, p.Arg152* and p.Gly863Ala occurred least frequently; each was detected in seven (9.72%) patient samples. Login to comment
139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment
142 The results obtained from the control cohort screening indicate that the carrier frequency of the p.Cys1490Tyr, p.Arg602Trp, and p.Gly863Ala mutations is slightly higher compared to the other mutations (p.Leu2027Phe, c.768G>T, and p.Arg152*), with the c.5461-10T>C mutation not detected at all. Login to comment
166 Mutant alleles Cohort p.Cys1490Tyr p.Arg602Trp p.Leu2027Phe c.5461-10T>C c.768G>T p.Gly863Ala p.Arg152* Patient (n=72; 144 alleles) 16 (11.11%) 10 (6.94%) 12 (8.33%) 13 (9.03%) 13 (9.03%) 7 (4.86%) 7 (4.86%) Control (total; n=269; 538 alleles) 2 (0. Login to comment

[hide] Transition zones between healthy and diseased reti... Invest Ophthalmol Vis Sci. 2011 Dec 20;52(13):9581-90. Print 2011. Lazow MA, Hood DC, Ramachandran R, Burke TR, Wang YZ, Greenstein VC, Birch DG
Transition zones between healthy and diseased retina in choroideremia (CHM) and Stargardt disease (STGD) as compared to retinitis pigmentosa (RP).
Invest Ophthalmol Vis Sci. 2011 Dec 20;52(13):9581-90. Print 2011., [PMID:22076985]

Abstract [show]
PURPOSE: To describe the structural changes across the transition zone (TZ) in choroideremia (CHM) and Stargardt disease (STGD) and to compare these to the TZ in retinitis pigmentosa (RP). METHODS: Frequency-domain (Fd)OCT line scans were obtained from seven patients with CHM, 20 with STGD, and 12 with RP and compared with those of 30 previously studied controls. A computer-aided manual segmentation procedure was used to determine the thicknesses of the outer segment (OS) layer, the outer nuclear layer plus outer plexiform layer (ONL+), the retinal pigment epithelium plus Bruch's membrane (RPE+BM), and the outer retina (OR). RESULTS: The TZ, while consistent within patient groups, showed differences across disease groups. In particular, (1) OS loss occurred before ONL+ loss in CHM and RP, whereas ONL+ loss occurred before OS loss in STGD; (2) ONL+ was preserved over a wider region of the retina in CHM than in RP; (3) RPE+BM remained normal across the RP TZ, but was typically thinned in CHM. In some CHM patients, it was abnormally thin in regions with normal OS and ONL+ thickness. In STGD, RPE+BM was thinned by the end of the TZ; and (4) the disappearances of the IS/OS and OLM were more abrupt in CHM and STGD than in RP. CONCLUSIONS: On fdOCT scans, patients with RP, CHM, and STGD all have a TZ between relatively healthy and severely affected retina. The patterns of changes in the receptor layers are similar within a disease category, but different across categories. The findings suggest that the pattern of progression of each disease is distinct and may offer clues for strategies in the development of future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20ϩ5 GϾA, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing. Login to comment
31 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20af9;5 Gb0e;A, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing. Login to comment

[hide] Quantification of peripapillary sparing and macula... Invest Ophthalmol Vis Sci. 2011 Oct 10;52(11):8006-15. Print 2011. Burke TR, Rhee DW, Smith RT, Tsang SH, Allikmets R, Chang S, Lazow MA, Hood DC, Greenstein VC
Quantification of peripapillary sparing and macular involvement in Stargardt disease (STGD1).
Invest Ophthalmol Vis Sci. 2011 Oct 10;52(11):8006-15. Print 2011., [PMID:21873672]

Abstract [show]
PURPOSE: To quantify and compare structure and function across the macula and peripapillary area in Stargardt disease (STGD1). METHODS: Twenty-seven patients (27 eyes) and 12 age-similar controls (12 eyes) were studied. Patients were classified on the basis of full-field electroretinogram (ERG) results: Fundus autofluorescence (FAF) and spectral domain-optical coherence tomography (SD-OCT) horizontal line scans were obtained through the fovea and peripapillary area. The thicknesses of the outer nuclear layer plus outer plexiform layer (ONL+), outer segment (OS), and retinal pigment epithelium (RPE) were measured through the fovea, and peripapillary areas from 1 degrees to 4 degrees temporal to the optic disc edge using a computer-aided, manual segmentation technique. Visual sensitivities in the central 10 degrees were assessed using microperimetry and related to retinal layer thicknesses. RESULTS: Compared to the central macula, the differences between controls and patients in ONL+, OS, and RPE layer thicknesses were less in the nasal and temporal macula. Relative sparing of the ONL+ and/or OS layers was detected in the nasal (i.e., peripapillary) macula in 8 of 13 patients with extramacular disease on FAF; relative functional sparing was also detected in this subgroup. All 14 patients with disease confined to the central macula, as detected on FAF, showed ONL+ and OS layer thinning in regions of normal RPE thickness. CONCLUSIONS: Relative peripapillary sparing was detected in STGD1 patients with extramacular disease on FAF. Photoreceptor thinning may precede RPE degeneration in STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 Summary of Clinical, Demographic, and Genetic Data Patient Sex Age at Exam (y) Eye VA BCEA 1 SD (deg 2 ) Eccentricity of PRL (deg) ERG Group FAF Abnormalities Allele 1 Allele 2 Allele 3 Distribution Peripapillary Area 1 F 43 OS 20/20 0.73 0 II M - A1799D ND ND 2 M 30 OS 20/150 3.21 6 I M - T1253M G1961E ND 3 F 55 OD 20/30 1.82 0 I EM - G863A IVS28af9;5 Gb0e;T ND 4 M 44 OD 20/25 0.65 0 I M - E161K ND ND 5.1 F 24 OD 20/200 1.57 1 I M - L541P/A1038V G1961E ND 5.2 F 22 OD 20/30 2.74 1 I M - L541P/A1038V G1961E ND 6.1 F 21 OD 20/150 2.01 1 I M - L541P/A1038V G1961E ND 6.2 F 18 OS 20/100 3.09 4 I M - L541P/A1038V G1961E ND 7 F 27 OS 20/400 2.97 9* II EM Peripapillary atrophy L2027F G851D ND 8 M 34 OS 20/100 2.16 4 I M - G1961E G1961E ND 9 M 20 OS 20/150 2.77 4 I M - IVS20af9;5 Gb0e;A G1961E ND 10 F 23 OS 20/150 9.05 5 I M - L541P/A1038V I1846T ND 11 M 59 OS 20/100 6.52 10 II EM - P1380L S1696N ND 12 M 49 OD 20/150 9.97 1 I EM Nasalaf9;temporal flecks R1108H P1380L ND 13 M 47 OS 20/80 5.62 7 I EM - G863A Y106X ND 14 F 42 OD 20/200 9.53 9 I EM Temporal flecks N965S ND ND 15 M 14 OD 20/200 23.84 1 II EM Nasal flecks IVS38-10 Tb0e;C IVS40af9;5 Gb0e;A ND 16 M 52 OS 20/20 1.3 0 I M - IVS38-10 Tb0e;C ND ND 17 M 34 OS 20/30 2.8 1 I M - L541P/A1038V G1961E ND 18 F 33 OD 20/100 6 6 I M - G1961E R2077W ND 19 F 22 OS 20/60 11 4 I M - A854T A1038V C2150Y 20 F 34 OS 20/200 14.2 14 I EM - G1961E ND ND 21 F 19 OD 20/200 3.7 12 I EM - R602W M18821 ND 22 F 27 OD 20/400 9.6 9 II EM Peripapillary atrophy P1380L P1380L ND 23 F 18 OS 20/50 4.9 5 I EM - R1640W V1693I ND 24 M 22 OS 20/150 10.5 2 I EM - C54Y ND ND 25 M 44 OS 20/150 9.1 5 I EM - R1640W ND ND VA, visual acuity; Rel. Login to comment

[hide] Further associations between mutations and polymor... Invest Ophthalmol Vis Sci. 2011 Aug 5;52(9):6206-12. Print 2011 Aug. Aguirre-Lamban J, Gonzalez-Aguilera JJ, Riveiro-Alvarez R, Cantalapiedra D, Avila-Fernandez A, Villaverde-Montero C, Corton M, Blanco-Kelly F, Garcia-Sandoval B, Ayuso C
Further associations between mutations and polymorphisms in the ABCA4 gene: clinical implication of allelic variants and their role as protector/risk factors.
Invest Ophthalmol Vis Sci. 2011 Aug 5;52(9):6206-12. Print 2011 Aug., [PMID:21330655]

Abstract [show]
PURPOSE: Mutations in ABCA4 have been associated with autosomal recessive Stargardt disease, autosomal recessive cone-rod dystrophy, and autosomal recessive retinitis pigmentosa. The purpose of this study was to determine (1) associations among mutations and polymorphisms and (2) the role of the polymorphisms as protector/risk factors. METHODS: A case-control study was designed in which 128 Spanish patients and 84 control individuals were analyzed. Patient samples presented one or two mutated alleles previously identified using ABCR400 microarray and sequencing. RESULTS: A total of 18 previously described polymorphisms were studied in patients and control individuals. All except one presented a polymorphisms frequency higher than 5% in patients, and five mutations were found to have a frequency >5%. The use of statistical methods showed that the frequency of the majority of polymorphisms was similar in patients and controls, except for the IVS10+5delG, p.Asn1868Ile, IVS48+21C>T, and p.Arg943Gln polymorphisms. In addition, IVS48+21C>T and p.Arg943Gln were found to be in linkage disequilibrium with the p.Gly1961Glu and p.Arg602Trp mutations, respectively. CONCLUSIONS: Although the high allelic heterogeneity in ABCA4 and the wide spectrum of many common and rare polymorphisms complicate the interpretation of clinical relevance, polymorphisms were identified that may act as risk factors (p.Asn1868Ile) and others that may act as protection factors (p.His423Arg and IVS10+5 delG).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
130 However, in other European studies the p.Arg943Gln variant was detected in linkage disequilibrium with the p.Gly863Ala mutation,18,19,20 and 21 but this mutation has a low frequency in our series of patients, and no association analysis was performed. Login to comment
150 However, in other European studies the p.Arg943Gln variant was detected in linkage disequilibrium with the p.Gly863Ala mutation,18,19,20 and 21 but this mutation has a low frequency in our series of patients, and no association analysis was performed. Login to comment

[hide] Cone photoreceptor abnormalities correlate with vi... Invest Ophthalmol Vis Sci. 2011 May 17;52(6):3281-92. doi: 10.1167/iovs.10-6538. Print 2011 May. Chen Y, Ratnam K, Sundquist SM, Lujan B, Ayyagari R, Gudiseva VH, Roorda A, Duncan JL
Cone photoreceptor abnormalities correlate with vision loss in patients with Stargardt disease.
Invest Ophthalmol Vis Sci. 2011 May 17;52(6):3281-92. doi: 10.1167/iovs.10-6538. Print 2011 May., [PMID:21296825]

Abstract [show]
PURPOSE. To study the relationship between macular cone structure, fundus autofluorescence (AF), and visual function in patients with Stargardt disease (STGD). METHODS. High-resolution images of the macula were obtained with adaptive optics scanning laser ophthalmoscopy (AOSLO) and spectral domain optical coherence tomography in 12 patients with STGD and 27 age-matched healthy subjects. Measures of retinal structure and AF were correlated with visual function, including best-corrected visual acuity, color vision, kinetic and static perimetry, fundus-guided microperimetry, and full-field electroretinography. Mutation analysis of the ABCA4 gene was completed in all patients. RESULTS. Patients were 15 to 55 years old, and visual acuity ranged from 20/25-20/320. Central scotomas were present in all patients, although the fovea was spared in three patients. The earliest cone spacing abnormalities were observed in regions of homogeneous AF, normal visual function, and normal outer retinal structure. Outer retinal structure and AF were most normal near the optic disc. Longitudinal studies showed progressive increases in AF followed by reduced AF associated with losses of visual sensitivity, outer retinal layers, and cones. At least one disease-causing mutation in the ABCA4 gene was identified in 11 of 12 patients studied; 1 of 12 patients showed no disease-causing ABCA4 mutations. CONCLUSIONS. AOSLO imaging demonstrated abnormal cone spacing in regions of abnormal fundus AF and reduced visual function. These findings provide support for a model of disease progression in which lipofuscin accumulation results in homogeneously increased AF with cone spacing abnormalities, followed by heterogeneously increased AF with cone loss, then reduced AF with cone and RPE cell death.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 TABLE1.ClinicalCharacteristicsofthePatientswithStargardtDisease Patient/EyeAge(y)/SexABCA4MutationsBCVA ETDRS ScoreColorVision* GoldmannVisual Field† HumphreyVisualField 10-2 Foveal Threshold (dB)Fixation F1P1OS16/MPro1486Leu/6bp insϩ32bpdel atbase672 20/4075None,0,1.34V4e:full;14e:1°ctl scotoma 8°ctlscotomawithϽ1 logunitsensitivityloss 30Foveal F1P2OS15/MPro1486Leu/6bp insϩ32bpdel atbase672 20/16040NS,2,1.99V4e:full;14e:1°ctl scotoma Densescotomabeginning 4°superiortofixation 27Superior F2P1OS25/FGlu1412Stop20/6361None,0,1.00V4e,14e:full,12e: 5°ctlscotoma 6°ctlscotoma31Foveal F3P1OD24/MGly863Ala20/10050NS,6,2.72V4e:full;14e:3-4° ctlscotoma 3°-4°scotomasuperior tofixation 32Superior F4P1OS16/FNodisease-causing mutations identified 20/20035NS,5,2.25V4e:full;14e:35° ctlscotoma 15°ctlscotomawith eccentricfixation superonasally 8Nasal,slightlybelow horizontal meridian F5P1OS42/M5461-10TϾCintron 39/Gly1961Glu 20/32023NS,5,2.27V4e:full;14e:10° ctlscotoma 12°densectlscotoma27Superonasal F6P1OS19/FLys223Gln/C2291 15bp/5amino aciddeletion (CSGVI) 20/20035NS,6,1.99V4e:full;14e:35° ctlscotoma 10°ctlscotoma20Superonasal F7P1OS55/FArg212Cys/ Gly863Ala/ Thr959Ile 20/16040NS,3,2.01V4e:10°ctl scotoma;14e:20° ctlscotoma Dense15°ctlscotoma6Superonasal F8P1OS36/MSer336Cys/ Arg1068/Ser‡ 20/20034NS,8,3.62V4e:20°ctl scotoma;14e:25° ctlscotoma Densescotomabeginning 6°superiortofixation 12Superior F9P1OS28/MArg1108His/ Val1433lle 20/32025NS,11,3.30V4e:full;14e:15° scotomafrom5- 25°superiorto fixation Densescotomabeginning 5°superiortofixation 23Superior F10P1OS55/FIVS20ϩ5GϾA splice/Gly1961Glu 20/32025NS,6,2.55V4e:30°ctl scotoma;14e:35° ctlscotoma Densescotomaextending fromfixationto10° inferonasally 19Inferonasal F11P1OS50/MArg2030Gln20/2580Tritan,7,2.61V4e:full;14e:25° ctlscotomafrom 10-25°with fovealsparing Densescotomaextending fromfixationto10° withfovealsparing 27Foveal ctl,central;F,family;F,female;M,male;NS,nonspecificorientation;OD,righteye;OS,lefteye;P,proband. Login to comment

[hide] Deducing the pathogenic contribution of recessive ... Hum Mol Genet. 2010 Oct 1;19(19):3693-701. Epub 2010 Jul 20. Schindler EI, Nylen EL, Ko AC, Affatigato LM, Heggen AC, Wang K, Sheffield VC, Stone EM
Deducing the pathogenic contribution of recessive ABCA4 alleles in an outbred population.
Hum Mol Genet. 2010 Oct 1;19(19):3693-701. Epub 2010 Jul 20., [PMID:20647261]

Abstract [show]
Accurate prediction of the pathogenic effects of specific genotypes is important for the design and execution of clinical trials as well as for meaningful counseling of individual patients. However, for many autosomal recessive diseases, it can be difficult to deduce the relative pathogenic contribution of individual alleles because relatively few affected individuals share the same two disease-causing variations. In this study, we used multiple regression analysis to estimate the pathogenicity of specific alleles of ABCA4 in patients with retinal phenotypes ranging from Stargardt disease to retinitis pigmentosa. This analysis revealed quantitative allelic effects on two aspects of the visual phenotype, visual acuity (P < 10(-3)) and visual field (P < 10(-7)). Discordance between visual acuity and visual field in individual patients suggests the existence of at least two non-ABCA4 modifying factors. The findings of this study will facilitate the discovery of factors that modify ABCA4 disease and will also aid in the optimal selection of subjects for clinical trials of new therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment
157 In addition, Stargardt patients who had one of the three most common alleles (Gly863Ala, Gly1961Glu or IVS38-10) were also sequenced through the entire coding region of the ABCA4 gene. Login to comment
57 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment
161 In addition, Stargardt patients who had one of the three most common alleles (Gly863Ala, Gly1961Glu or IVS38-10) were also sequenced through the entire coding region of the ABCA4 gene. Login to comment

[hide] Analysis of autofluorescent retinal images and mea... Exp Eye Res. 2010 Aug;91(2):143-52. Epub 2010 Apr 14. Chen B, Tosha C, Gorin MB, Nusinowitz S
Analysis of autofluorescent retinal images and measurement of atrophic lesion growth in Stargardt disease.
Exp Eye Res. 2010 Aug;91(2):143-52. Epub 2010 Apr 14., [PMID:20398653]

Abstract [show]
Current retinal imaging techniques using scanning laser ophthalmoscopy (SLO) provide a powerful mechanism for characterizing the topographical distribution of lipofuscin fluorophores and atrophic lesions (ALs) in retinal disease. In this paper we describe a novel Edge-Flow-Driven Variational Image Segmentation analysis to measure and evaluate progressive change in the area of ALs as well as regions of hyperfluorescence (HF). The algorithm is embedded in a series of almost completely automated image processing steps that allow rapid comparison of serial images. The sensitivity of the methodology to detect change was evaluated by measuring progression of AF lesion size in a cohort of Stargardt Macular Dystrophy (STGD) patients. Fifty-two STGD subjects (mean age = 41.0 +/- 16.6 years, range 9-78 yrs) at varying stages of disease participated in this prospective study. Twenty-four of the 52 subjects presented with atrophic lesions in one or both eyes on first evaluation. For this subgroup of subjects, the mean (+/-1 sd) follow-up time was 2.92 (+0.26) years (range 0.57-3.26 years) and the mean (+/-1 sd) rate of change was found to be approximately 0.94 (+/-0.87) mm(2)/year (range 0.2-2.13 mm(2)/yr). With this methodology, progressive enlargement of AL area was detectable in as little as one year, while regions of HF generally decreased, although there was considerable variability in the appearnce of HF, presumably reflecting the combined effects of the creation or expansion of lipofuscin deposits and resorption and loss associated with retinal cell death. Our findings suggest that this methodology is sufficiently sensitive to detect change and provides a clinically relevant tool to monitor progression not only with regards to natural history, but also to evaluate the efficacy of potential therapeutic interventions in STGD. Finally, we evaluated the association between AL area and measures of rod- and cone-mediated retinal function, as assessed with electroretinography (ERG). In general, the larger the AL, the poorer the ERG response, with a greater impact of lesion size on cone- rather than rod-mediated retinal function, a finding that was expected on the basis of the location and size of the AL and the distribution of rod- and cone-photoreceptors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,þ1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, þ5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 þ 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND ¼ not done. Login to comment
81 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,&#fe;1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, &#fe;5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 &#fe; 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND &#bc; not done. Login to comment

[hide] Interaction of extracellular domain 2 of the human... J Biol Chem. 2010 Jun 18;285(25):19372-83. Epub 2010 Apr 19. Biswas-Fiss EE, Kurpad DS, Joshi K, Biswas SB
Interaction of extracellular domain 2 of the human retina-specific ATP-binding cassette transporter (ABCA4) with all-trans-retinal.
J Biol Chem. 2010 Jun 18;285(25):19372-83. Epub 2010 Apr 19., [PMID:20404325]

Abstract [show]
The retina-specific ATP-binding cassette (ABC) transporter, ABCA4, is essential for transport of all-trans-retinal from the rod outer segment discs in the retina and is associated with a broad range of inherited retinal diseases, including Stargardt disease, autosomal recessive cone rod dystrophy, and fundus flavimaculatus. A unique feature of the ABCA subfamily of ABC transporters is the presence of highly conserved, long extracellular loops or domains (ECDs) with unknown function. The high degree of sequence conservation and mapped disease-associated mutations in these domains suggests an important physiological significance. Conformational analysis using CD spectroscopy of purified, recombinant ECD2 protein demonstrated that it has an ordered and stable structure composed of 27 +/- 3% alpha-helix, 20 +/- 3% beta-pleated sheet, and 53 +/- 3% coil. Significant conformational changes were observed in disease-associated mutant proteins. Using intrinsic tryptophan fluorescence emission spectrum of ECD2 polypeptide and fluorescence anisotropy, we have demonstrated that this domain specifically interacts with all-trans-retinal. Furthermore, the retinal interaction appeared preferential for the all-trans-isomer and was directly measurable through fluorescence anisotropy analysis. Our results demonstrate that the three macular degeneration-associated mutations lead to significant changes in the secondary structure of the ECD2 domain of ABCA4, as well as in its interaction with all-trans-retinal.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
163 C1488R Mutation-The C1488R mutation has been identified as a Stargardt disease-linked mutation in individuals of Northern and Central European ancestry (13, 23, 47). Login to comment
164 This mutation has been reported to occur in the ABCA4 gene as an individual heterozygous mutation as well as in trans with G863A mutation. This mutation represents a chemically significant substitution of a basic residue for a strictly conserved cysteine residue. Login to comment

[hide] ABC transporters in ophthalmic disease. Methods Mol Biol. 2010;637:221-30. Westerfeld C
ABC transporters in ophthalmic disease.
Methods Mol Biol. 2010;637:221-30., [PMID:20419437]

Abstract [show]
ABC transporters have been implicated in a variety of human diseases. The ABCR gene and its protein have been linked to Stargardt's disease, fundus flavimaculatus, cone-rod dystrophy, retinitis pigmentosa, and age-related macular degeneration. The genetic and molecular pathways involved in the pathogenesis of ABCR-related ophthalmic conditions will be explored. Future diagnostic and therapeutic objectives for these diseases will also be discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Certain mutant alleles such as G863A, A1038V, and G1961E cause Stargardt`s disease and appear to be more common and may have altered frequencies in different populations, presumably because of founder effect (23, 24). Login to comment

[hide] Outcome of ABCA4 microarray screening in routine c... Mol Vis. 2009 Dec 20;15:2841-7. Ernest PJ, Boon CJ, Klevering BJ, Hoefsloot LH, Hoyng CB
Outcome of ABCA4 microarray screening in routine clinical practice.
Mol Vis. 2009 Dec 20;15:2841-7., [PMID:20029649]

Abstract [show]
PURPOSE: To retrospectively analyze the clinical characteristics of patients who were screened for mutations with the ATP-binding cassette transporter gene ABCA4 (ABCA4) microarray in a routine clinical DNA diagnostics setting. METHODS: We performed a retrospective analysis of the medical charts of 65 patients who underwent an ABCA4 microarray screening between the years 2002 and 2006. An additional denaturing gradient gel electrophoresis (DGGE) was performed in these patients if less than two mutations were found with the microarray. We included all patients who were suspected of autosomal recessive Stargardt disease (STGD1), autosomal recessive cone-rod dystrophy (arCRD), or autosomal recessive retinitis pigmentosa at the time of microarray request. After a retrospective analysis of the clinical characteristics, the patients who were suspected of STGD1 were categorized as having either a typical or atypical form of STGD1, according to the age at onset, fundus appearance, fluorescein angiography, and electroretinography. The occurrence of typical clinical features for STGD1 was compared between patients with different numbers of discovered mutations. RESULTS: Of the 44 patients who were suspected of STGD1, 26 patients (59%) had sufficient data available for a classification in either typical (six patients; 23%) or atypical (20 patients; 77%) STGD1. In the suspected STGD1 group, 59% of all expected pathogenic alleles were found with the ABCA4 microarray. DGGE led to the finding of 12 more mutations, resulting in an overall detection rate of 73%. Thirty-one percent of patients with two or three discovered ABCA4 mutations met all typical STGD1 criteria. An age at onset younger than 25 years and a dark choroid on fluorescein angiography were the most predictive clinical features to find ABCA4 mutations in patients suspected of STGD1. In 18 patients suspected of arCRD, microarray screening detected 22% of the possible pathogenic alleles. CONCLUSIONS: In addition to confirmation of the diagnosis in typical STGD1, ABCA4 microarray screening is usually requested in daily clinical practice to strengthen the diagnosis when the disease is atypical. This study supports the view that the efficiency and accuracy of ABCA4 microarray screening are directly dependent upon the clinical features of the patients who are screened.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
143 DISCOVERED MUTATIONS IN THE ABCA4 GENE IN THE PATIENTS INCLUDED IN THIS STUDY Nucleotide change Effect Alleles References Mutations already included in the ABCA4 microarray c.286A>G p.Asn96Asp 2 [25] c.656G>C p.Arg219Thr 1 [10] c.740A>T p.Asn247Ile 1 This study* c.768G>T splice site 7 [13] c.899C>A p.Thr300Asn 1 [14] c.1805G>A p.Arg602Gln 1 [9] c.1822T>A p.Phe608Ile 2 [13] c.1853G>A p.Gly618Glu 1 [19] c.1938-1G>A splice site 1 [26] c.2588G>C p.DelGly863/Gly863Ala 8 [13] c.2919del exons20-22 deletion/frameshift 2 [13] c.3335C>A p.Thr1112Asn 1 [13] c.3874C>T p.Gln1292X 1 This study* c.3899G>A p.Arg1300Gln 1 [27] c.4297G>A p.Val1433Ile 1 [17] c.4462T>C p.Cys1488Arg 1 [17] c.4506C>A p.Cys1502X 1 This study* c.4539+1G>T splice site 1 [28] c.4774+1G>A splice site 1 [1] c.5161-5162delAC p.Thr1721fs 1 [27] c.5337C>A p.Tyr1779X 1 This study* c.5461-10T>C unknown 9 [9] c.5537T>C p.Ile1846Thr 1 [13] c.5693G>A p.Arg1898His 1 [1] c.5715+5G>A splice site 2 [28] c.5882G>A p.Gly1961Glu 10 [1] c.6088C>T p.Arg2030X 1 [14] c.6089G>A p.Arg2030Gln 1 [9] c.6238-6239delTC p.Ser2080fs 1 [29] c.6529G>A p.Asp2177Asn 1 [1] New mutations found with DGGE analysis c.303+4A>C splice site 1 c.872C>T p.Pro291Leu 1 c.2906A>G p.Lys969Arg 1 c.2947A>G p.Thr983Ala 1 c.3233G>A p.Gly1078Glu 1 c.3305A>T p.Asp1102Val 1 c.4353+1G>A splice site 1 c.5113C>T p.Arg1705Trp 1 c.5762_5763dup p.Ala1922fs 1 c.6411T>A p.Cys2137X 1 Total 74 Mutations are designated by their nucleotide change, followed by their effect on the protein and the number of alleles that were found with the mutation. Login to comment

[hide] Frequency of ABCA4 mutations in 278 Spanish contro... Br J Ophthalmol. 2009 Oct;93(10):1359-64. Epub 2008 Oct 31. Riveiro-Alvarez R, Aguirre-Lamban J, Lopez-Martinez MA, Trujillo-Tiebas MJ, Cantalapiedra D, Vallespin E, Avila-Fernandez A, Ramos C, Ayuso C
Frequency of ABCA4 mutations in 278 Spanish controls: an insight into the prevalence of autosomal recessive Stargardt disease.
Br J Ophthalmol. 2009 Oct;93(10):1359-64. Epub 2008 Oct 31., [PMID:18977788]

Abstract [show]
AIM: To determine the carrier frequency of ABCA4 mutations in order to achieve an insight into the prevalence of autosomal recessive Stargardt disease (arSTGD) in the Spanish population. METHODS: arSTGD patients (n = 133) were analysed using ABCR400 microarray and sequencing. Control subjects were analysed by two different strategies: 200 individuals were screened for the p.Arg1129Leu mutation by denaturing-HPLC and sequencing; 78 individuals were tested for variants with the microarray and sequencing. RESULTS: For the first strategy in control subjects, the p.Arg1129Leu variant was found in two heterozygous individuals, which would mean a carrier frequency for any variant of approximately 6.0% and a calculated arSTGD prevalence of 1:1000. For the second strategy, carrier frequency was 6.4% and therefore an estimated prevalence of the disease of 1:870. CONCLUSION: Calculated prevalence of arSTGD based on the ABCA4 carrier frequency could be considerably higher than previous estimation. This discrepancy between observed (genotypic) and estimated (phenotypic) prevalence could be due to the existence of non-pathological or low penetrance alleles, which may result in late-onset arSTGD or may be implicated in age-related macular degeneration. This situation should be regarded with special care when genetic counselling is given and further follow-up of these patients should be recommended.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
96 These Table 1 ABCA4 sequence variants identified in Spanish control population Mutant alleles Nucleotide change Amino acid change Number of cases Number of alleles Frequency (%) Homozygous individuals Mutations* c.661G.A p.Gly221Arg 1 1 0.64 None c.1140T.A p.Asn380Lys 1 1 0.64 None c.2588G.C p.Gly863Ala 1 1 0.64 None c.3113C.T p.Ala1038Val 1 1 0.64 None c.3899G.A p.Arg1300Gln 1 1 0.64 None c.5882G.A p.Gly1961Glu 1 1 0.64 None c.5908C.T p.Leu1970Phe 1 1 0.64 None c.6148G.C p.Val2050Leu 1 1 0.64 None c.6529G.A p.Asp2177Asn 2 2 1.28 None Total 10 Polymorphisms{ c.466A.G p.Ile156Val 5 5 3.2 None c.635G.A p.Arg212His 5 6 3.84 1 c.1268A.G p.His423Arg 43 48 30.7 5 c.1269C.T p.His423His 2 2 1.28 None IVS10+5delG 34 36 23 2 c.2828G.A p.Arg943Gln 1 1 0.64 None c.4203C.A p.Pro1401Pro 3 3 1.9 None IVS33+48C.T 59 75 48 16 c.5603A.T p.Asn1868Ile 4 4 2.5 None c.5682G.C p.Leu1894Leu 29 35 22.4 6 c.5814A.G p.Leu1938Leu 27 33 21.1 6 c.5843 C.T p.Pro1948Leu 9 10 6.4 1 c.5844A.G p.Pro1948Pro 27 32 20.5 5 c.6069C.T p.Ile2023Ile 11 12 7.7 1 c.6249C.T p.Ile2083Ile 12 14 8.9 2 c.6285T.C p.Asp2095Asp 24 26 16.6 2 c.6764G.T p.Ser2255Ile 12 13 8.3 1 *A total of 15 mutant alleles were detected. Login to comment
97 These Table 1 ABCA4 sequence variants identified in Spanish control population Mutant alleles Nucleotide change Amino acid change Number of cases Number of alleles Frequency (%) Homozygous individuals Mutations* c.661G.A p.Gly221Arg 1 1 0.64 None c.1140T.A p.Asn380Lys 1 1 0.64 None c.2588G.C p.Gly863Ala 1 1 0.64 None c.3113C.T p.Ala1038Val 1 1 0.64 None c.3899G.A p.Arg1300Gln 1 1 0.64 None c.5882G.A p.Gly1961Glu 1 1 0.64 None c.5908C.T p.Leu1970Phe 1 1 0.64 None c.6148G.C p.Val2050Leu 1 1 0.64 None c.6529G.A p.Asp2177Asn 2 2 1.28 None Total 10 Polymorphisms{ c.466A.G p.Ile156Val 5 5 3.2 None c.635G.A p.Arg212His 5 6 3.84 1 c.1268A.G p.His423Arg 43 48 30.7 5 c.1269C.T p.His423His 2 2 1.28 None IVS10+5delG 34 36 23 2 c.2828G.A p.Arg943Gln 1 1 0.64 None c.4203C.A p.Pro1401Pro 3 3 1.9 None IVS33+48C.T 59 75 48 16 c.5603A.T p.Asn1868Ile 4 4 2.5 None c.5682G.C p.Leu1894Leu 29 35 22.4 6 c.5814A.G p.Leu1938Leu 27 33 21.1 6 c.5843 C.T p.Pro1948Leu 9 10 6.4 1 c.5844A.G p.Pro1948Pro 27 32 20.5 5 c.6069C.T p.Ile2023Ile 11 12 7.7 1 c.6249C.T p.Ile2083Ile 12 14 8.9 2 c.6285T.C p.Asp2095Asp 24 26 16.6 2 c.6764G.T p.Ser2255Ile 12 13 8.3 1 *A total of 15 mutant alleles were detected. Login to comment

[hide] Lipofuscin- and melanin-related fundus autofluores... Am J Ophthalmol. 2009 May;147(5):895-902, 902.e1. Epub 2009 Feb 25. Kellner S, Kellner U, Weber BH, Fiebig B, Weinitz S, Ruether K
Lipofuscin- and melanin-related fundus autofluorescence in patients with ABCA4-associated retinal dystrophies.
Am J Ophthalmol. 2009 May;147(5):895-902, 902.e1. Epub 2009 Feb 25., [PMID:19243736]

Abstract [show]
PURPOSE: To compare melanin-related near-infrared fundus autofluorescence (NIA; excitation 787 nm, emission > 800 nm) to lipofuscin-related fundus autofluorescence (FAF; excitation 488 nm, emission > 500 nm) in patients with retinal dystrophies associated with ABCA4 gene mutations (ABCA4-RD). DESIGN: Observational case series. METHODS: Sixteen consecutive patients with ABCA4-RD diagnosed in one institution were included. FAF and NIA imaging were performed with a confocal scanning laser ophthalmoscope (Heidelberg Retina Angiograph 2; Heidelberg Engineering, Heidelberg, Germany). The pattern and size of retinal pigment epithelial (RPE) alterations detected with FAF and NIA were evaluated. RESULTS: FAF and NIA alterations were detected in all patients. In 7 of 16 patients, the alterations progressed beyond the vascular arcades, and in 9 of 16, they were confined to the macula. Spots of increased NIA (4/16) were less frequent compared with spots of increased FAF (15/16). Confluent patches of reduced NIA were frequent (12/16), and severely reduced NIA was observed in 3 cases. Areas with reduced NIA corresponded to either increased or reduced FAF. Preservation of subfoveal FAF or NIA corresponded to visual acuity > or = 0.4. Abnormalities detected with NIA were more extensive or more severe compared to FAF in 15 of 16 patients. CONCLUSION: Patterns of FAF and NIA indicate different involvement of lipofuscin and melanin and their derivates in the pathophysiologic process of ABCA4-RD. NIA imaging provides a noninvasive in vivo visualization of RPE abnormalities that may precede FAF alterations during the degenerative process. Combined FAF and NIA imaging will provide further insight in the development of ABCA4-RD and could help to monitor future therapeutic interventions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Age Gender ABCA4 Mutation VA RE/LE Full-field ERG Multifocal ERG Group 1a CRD 2808 34 F c.5413AϾG (p.Asn1805Asp) c.4880_4903dup24 (p.Leu1627_Ala1634dup) 0.05 0.05 DA and LA markedly reduced No recordable potentials CRD 2830 53 F c.2690CϾT (p.Thr897Ile), c.6176GϾC (p.Gly2059Ala) 0.5 0.7 DA and LA moderately reduced Pericentral amplitude reduction CRD 2797 54 M c.4297GϾA (p.Val1433Ile) 2. mutation not foundc 0.1 0.16 DA and LA moderately reduced Not done SD 2872 44 F c.4462TϾC (p.Cys1488Arg) 2. mutation not done 0.6 0.7 DA and LA borderline Central amplitude reduction CRD 2861 72 F c.122GϾA (p.Trp41Ter) 2. mutation not done 0.4 0.5 DA: mildly and LA: moderately reduced Central amplitude reduction CRD 2644 67 F c.634CϾT (p.Arg212Cys), c.656GϾC (p.Arg219Thr), c.2588GϾC (p.Gly863Ala/ delGly863) 0.6 0.04 DA and LA moderately reduced Central amplitude reduction CRD 2936 44 F c.1622T?e;C (p.Leu541Pro)/ c.3113CϾT (p.Ala1038Val), 2. mutation not done 1.0 1.0 DA: mildly and LA: moderately reduced Pericentral amplitude reduction Group 2b SD 2837 42 M c.1622TϾC (p.Leu541Pro)/ c.3113CϾT (p.Ala1038Val), c.5882GϾA (p.Gly1961Glu) 0.16 0.16 Normal Central amplitude reduction SD 2780 37 M c.768GϾT (splice mutation) c.5882GϾA (p.Gly1961Glu) 0.1 0.1 Normal Central amplitude reduction SD 2942 47 F c.1622TϾC (p.Leu541Pro) c.6320 GϾA (p.Arg2107His) 0.1 0.16 Not done Central amplitude reduction SD 2930 40 F c.6089GϾA (p.Arg2030Gln) c.6543del36bp, (p.Leu2182_Phe2193del) 0.1 0.1 DA and LA mildly reduced Central amplitude reduction SD 2933 43 F c.1609CϾT (p.Arg537Cys) c.5882GϾA (p.Gly1961Glu) c.1654GϾA (p.Val552Ile) 0.05 0.1 Normal Not done SD 2669 13 F c.768GϾT (splice mutation) c.6449GϾA (p.Cys2150Tyr) 0.1 0.16 DA and LA borderline Central amplitude reduction SD 2700 22 F c.1609CϾT (p.Arg537Cys) c.2588GϾC (p.Gly863Ala) 0.1 0.1 Normal Central amplitude reduction SD 2833 29 M c.1928TϾG (p.Val643Gly) 2. mutation not foundc 0.1 0.1 Normal Not done SD 2799 13 M c.3113CϾT (p.Ala1038Val) c.5461-10TϾC 0.4 0.4 Not done Central amplitude reduction CRD ϭ cone-rod dystrophy; DA ϭ dark adaptation; ERG ϭ electroretinography; F ϭ female; LA ϭ light adaptation; LE ϭ left eye; M ϭ male; RE ϭ right eye; SD ϭ Stargardt disease; VA ϭ visual acuity. Login to comment

[hide] Clinical utility of the ABCR400 microarray: basing... Arch Ophthalmol. 2009 Apr;127(4):549-54. Roberts LJ, Ramesar RS, Greenberg J
Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip.
Arch Ophthalmol. 2009 Apr;127(4):549-54., [PMID:19365039]

Abstract [show]
OBJECTIVES: To assess the clinical utility of ABCR400 microarray testing in patients with ABCA4-associated retinopathies and to report on possible issues that could arise should genetic results be delivered without validation. METHODS: One hundred thirty-two probands were genotyped with the microarray. Diagnostic assays were designed to verify all mutations identified in individuals in whom at least 2 causative mutations were found. Mutations were verified in the probands, and wherever possible cosegregation analysis was performed in additional family members. RESULTS: Eighty-five of the 132 probands (64.4%) genotyped with the microarray had 2 or more disease-associated mutations identified. Verification of the genotyping, however, resulted in only 80 families being able to benefit from genetic result delivery. The remaining families could not receive results owing to the confounding effect of multiple ABCA4 mutations or the incorrect identification of mutations. CONCLUSIONS: The ABCR400 microarray is useful for mutation screening; however, raw data cannot be delivered directly to patients. All mutations should be verified and, whenever possible, investigated in other family members. CLINICAL RELEVANCE: Validated ABCR400 results provide an unequivocal molecular diagnosis, allowing family members to be offered diagnostic, predictive, carrier, and prenatal testing. Use of the microarray can inform decision-making and identify candidates for future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 308;; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 308;; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction. Login to comment
79 Due Het IVS45+7G>A+ Het F1440S (No G863A) Het IVS45+7G>A+ Het F1440S (No G863A) Het IVS45+7G>A+ Het F1440S Het G863A Het IVS45+7G>A+ Het F1440S Het G863A (No IVS45+7G>A+ No F1440S) Het G863A Figure 3. Pedigree of family RPS141 in which cosegregation analysis revealed that IVS45ϩ7GϾA and F1440S are transmitted on the paternal chromosome, while G863A is transmitted on the maternal chromosome. Login to comment
81 Due Het IVS45+7G>A+ Het F1440S (No G863A) Het IVS45+7G>A+ Het F1440S (No G863A) Het IVS45+7G>A+ Het F1440S Het G863A Het IVS45+7G>A+ Het F1440S Het G863A (No IVS45+7G>A+ No F1440S) Het G863A Figure 3. Pedigree of family RPS141 in which cosegregation analysis revealed that IVS45af9;7Gb0e;A and F1440S are transmitted on the paternal chromosome, while G863A is transmitted on the maternal chromosome. Login to comment

[hide] ABCA4 disease progression and a proposed strategy ... Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12. Cideciyan AV, Swider M, Aleman TS, Tsybovsky Y, Schwartz SB, Windsor EA, Roman AJ, Sumaroka A, Steinberg JD, Jacobson SG, Stone EM, Palczewski K
ABCA4 disease progression and a proposed strategy for gene therapy.
Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12., [PMID:19074458]

Abstract [show]
Autosomal recessive retinal diseases caused by mutations in the ABCA4 gene are being considered for gene replacement therapy. All individuals with ABCA4-disease show macular degeneration, but only some are thought to progress to retina-wide blindness. It is currently not predictable if or when specific ABCA4 genotypes will show extramacular disease, and how fast it will progress thereafter. Early clinical trials of focal subretinal gene therapy will aim to arrest disease progression in the extramacular retina. In 66 individuals with known disease-causing ABCA4 alleles, we defined retina-wide disease expression by measuring rod- and cone-photoreceptor-mediated vision. Serial measurements over a mean period of 8.7 years were consistent with a model wherein a normal plateau phase of variable length was followed by initiation of retina-wide disease that progressed exponentially. Once initiated, the mean rate of disease progression was 1.1 log/decade for rods and 0.45 log/decade for cones. Spatio-temporal progression of disease could be described as the sum of two components, one with a central-to-peripheral gradient and the other with a uniform retina-wide pattern. Estimates of the age of disease initiation were used as a severity metric and contributions made by each ABCA4 allele were predicted. One-third of the non-truncating alleles were found to cause more severe disease than premature truncations supporting the existence of a pathogenic component beyond simple loss of function. Genotype-based inclusion/exclusion criteria and prediction of the age of retina-wide disease initiation will be invaluable for selecting appropriate candidates for clinical trials in ABCA4 disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Intermediate stages of macular disease showing different extents of macular atrophy surrounded by flecks or speckled regions are exemplified by individuals such as P31 carrying G863A and N1799D alleles (Fig. 1B) and P4 with C54Y and G863A alleles (Fig. 1C). Login to comment

[hide] ABCA4 gene analysis in patients with autosomal rec... Eur J Hum Genet. 2008 Jul;16(7):812-9. Epub 2008 Feb 20. Kitiratschky VB, Grau T, Bernd A, Zrenner E, Jagle H, Renner AB, Kellner U, Rudolph G, Jacobson SG, Cideciyan AV, Schaich S, Kohl S, Wissinger B
ABCA4 gene analysis in patients with autosomal recessive cone and cone rod dystrophies.
Eur J Hum Genet. 2008 Jul;16(7):812-9. Epub 2008 Feb 20., [PMID:18285826]

Abstract [show]
The ATP-binding cassette (ABC) transporters constitute a family of large membrane proteins, which transport a variety of substrates across membranes. The ABCA4 protein is expressed in photoreceptors and possibly functions as a transporter for N-retinylidene-phosphatidylethanolamine (N-retinylidene-PE), the Schiff base adduct of all-trans-retinal with PE. Mutations in the ABCA4 gene have been initially associated with autosomal recessive Stargardt disease. Subsequent studies have shown that mutations in ABCA4 can also cause a variety of other retinal dystrophies including cone rod dystrophy and retinitis pigmentosa. To determine the prevalence and mutation spectrum of ABCA4 gene mutations in non-Stargardt phenotypes, we have screened 64 unrelated patients with autosomal recessive cone (arCD) and cone rod dystrophy (arCRD) applying the Asper Ophthalmics ABCR400 microarray followed by DNA sequencing of all coding exons of the ABCA4 gene in subjects with single heterozygous mutations. Disease-associated ABCA4 alleles were identified in 20 of 64 patients with arCD or arCRD. In four of 64 patients (6%) only one mutant ABCA4 allele was detected and in 16 patients (25%), mutations on both ABCA4 alleles were identified. Based on these data we estimate a prevalence of 31% for ABCA4 mutations in arCD and arCRD, supporting the concept that the ABCA4 gene is a major locus for various types of degenerative retinal diseases with abnormalities in cone or both cone and rod function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 of alleles Reference Missense: 6 c.731T4Ca p.L244P 2 23 12 c.1622T4Cb p.L541P 1 5 13 c.1928T4G p.V643G 1 9 17 c.2588G4C p.G863A and p.G863del 2 4 21 c.3113C4Tb p.A1038V 1 4 25 c.3608G4A p.G1203E 1 24 28 c.4139C4T p.P1380L 2 25 30 c.4457C4T p.P1486L 1 25 30 c.4462T4C p.C1488R 1 25 37 c.5285C4A p.A1762D 1 24 41 c.5819T4C p.L1940P 1 26 42 c.5882G4A p.G1961E 1 9 45 c.6148G4C p.V2050L 1 25 45 c.6229C4T p.R2077W 1 25 Nonsense: 6 c.700C4T p.Q234X 1 This study 6 c.735T4G p.Y245X 2 24 28 c.4234C4T p.Q1412X 1 10 Deletion: 24 c.3539_3554del p.S1181PfsX8 1 This study 43 c.5917delG p.V1973X 3 27 Splice site/intronic: 26 c.5196+1G4A Splicing 1 9 34 c.4848+2T4C Splicing 1 This study 36 c.5196+1_5196+4del Splicing 1 15 39 c.5461À10T4C Unknown 8 14 40 c.5714+5G4A Splicing? Login to comment

[hide] Stargardt's disease and the ABCR gene. Semin Ophthalmol. 2008 Jan-Feb;23(1):59-65. Westerfeld C, Mukai S
Stargardt's disease and the ABCR gene.
Semin Ophthalmol. 2008 Jan-Feb;23(1):59-65., [PMID:18214793]

Abstract [show]
Stargardt's disease is an autosomal recessive form of juvenile macular degeneration. The clinical presentation, relevant ancillary tests, and classic histologic features will be reviewed. The role of genetic mutations in the pathophysiology of Stargardt's disease will also be explored. Stargardt's disease is caused by mutations in the ABCR (ABCA4) gene on chromosome 1. Mutations in this gene have also been attributed to some cases of cone-rod dystrophy, retinitis pigmentosa, and age-related macular degeneration. The genetic and molecular pathways that produce Stargardt's disease will be discussed. Future diagnostic and therapeutic objectives for this visually disabling condition will also be presented.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
94 Certain mutant alleles causing Stargardt`s such as G863A, A1038V, and G1961E appear to be more common and may have altered frequencies in different populations, presumably because of founder effect (Maugeri et al., 1999; Simonelli et al., 2000). Login to comment

[hide] Homozygosity for a novel ABCA4 founder splicing mu... Invest Ophthalmol Vis Sci. 2007 Sep;48(9):4308-14. Beit-Ya'acov A, Mizrahi-Meissonnier L, Obolensky A, Landau C, Blumenfeld A, Rosenmann A, Banin E, Sharon D
Homozygosity for a novel ABCA4 founder splicing mutation is associated with progressive and severe Stargardt-like disease.
Invest Ophthalmol Vis Sci. 2007 Sep;48(9):4308-14., [PMID:17724221]

Abstract [show]
PURPOSE: To clinically characterize and genetically analyze members of six families who reside in the same village and manifest a rare form of retinal degeneration. METHODS: Ophthalmic evaluation included a full clinical examination, perimetry, color vision testing, and electroretinography. Genomic DNA was screened for ABCA4 mutations with the use of microarray analysis and direct sequencing. RNA analysis was performed with RT-PCR and sequencing. RESULTS: The authors recruited 15 patients with a unique retinal disease who are members of six highly consanguineous Arab-Muslim families from a single village. During early stages of disease, funduscopic and angiographic findings as well as retinal function resemble those of Stargardt disease. However, later in life, severe, widespread cone-rod degeneration ensues. Marked progressive involvement of the retinal periphery distinguishes this phenotype from classic Stargardt disease. Genetic analysis of ABCA4 revealed two novel deletions, p.Cys1150del and c.4254-15del23. One patient, who was a compound heterozygote, manifested typical Stargardt disease. The remaining 14 patients were homozygote for the c.4254- 15del23 intronic deletion and had the progressive form of disease. We identified an identical ABCA4 haplotype in all alleles carrying this mutation, indicating a founder mutation. Detailed RT-PCR analysis in normal retina and lymphoblastoid cells revealed expression of the full-length ABCA4 transcript and three novel transcripts produced by alternative splicing. The full-length ABCA4 transcript, however, could not be detected in lymphoblastoid cells of affected homozygote patients. CONCLUSIONS: These results expand the genotype-phenotype correlation of ABCA4, showing that homozygosity for the novel c.4254-15del23 splicing mutation is associated with a severe progressive form of disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
172 Analysis of such mutations is challenging because of technical difficulties in amplifying ABCA4 mRNA from readily available tissues, such as peripheral blood and lymphoblastoid cells.4 In only one study thus far15 has reliable splicing data been obtained through this system, leading to an unexpected result: a frequent base substitution (c.2588GϾC) in the first base of exon 17, initially interpreted as a missense mutation (Gly863Ala), created a splicing defect, resulting in a deletion of one amino acid (Gly863). Login to comment

[hide] Quantifying fixation in patients with Stargardt di... Vision Res. 2007 Jul;47(15):2076-85. Epub 2007 Jun 11. Reinhard J, Messias A, Dietz K, Mackeben M, Lakmann R, Scholl HP, Apfelstedt-Sylla E, Weber BH, Seeliger MW, Zrenner E, Trauzettel-Klosinski S
Quantifying fixation in patients with Stargardt disease.
Vision Res. 2007 Jul;47(15):2076-85. Epub 2007 Jun 11., [PMID:17562343]

Abstract [show]
Fixational eye movements in 60 eyes of 30 patients with ABCA4-associated Stargardt disease were recorded by a Scanning Laser Ophthalmoscope (SLO). The results were quantified by two new fixation quality measures expressing the eccentricity of the preferred retinal locus (PRL) non-parametrically, and fixation stability by a dynamic index. 46 eyes (77%) fixated eccentrically; in 32 eyes (70% of the eccentrically fixating eyes) the PRL was located above the central retinal lesion. PRL eccentricity correlated positively with logMAR visual acuity (r=.72; p<.0001) and negatively with fixation stability (r=-.58; p<.0001). Multiple PRL were found only in three eyes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
186 of PRL ABCA4 allel1 exon mut 1 ABCA4 allel2 exon mut 2 1 m 32 OD 2 0.4 0.0 90.0 211.0 1 48 L2241V n.f. OS 2 0.6 0.0 90.0 181.6 1 2 f 55 OD 29 0.1 9.7 60.3 9874.6 1 - - - - OS 29 0.1 6.8 67.5 68260.1 2 3 f 38 OD 16 0.05 6.4 73.7 4962.8 1 14 W663X 42 G1961E OS 7 0.4 0.0 90.9 143.5 1 4 m 23 OD 7 0.1 5.7 81.8 664.3 1 40 R1898H 43 G1975R OS 6 0.1 7.0 80.6 594.2 1 5 m 16 OD 7 0.05 7.4 81.0 1052.0 1 12+21 L541P+ 40 IVS40+5 OS 7 0.05 5.0 73.3 11500.0 1 A1038V G->A 6 m 34 OD 34 0.1 0.0 76.2 924.2 1 n.f. n.f. OS 34 0.1 0.0 74.3 1106.2 1 7 m 17 OD 11 0.1 3.1 79.1 3517.6 1 - - - - OS 11 0.1 3.6 70.0 2226.1 1 8 m 46 OD 14 0.5 3.6 80.6 3986.2 1 11 E471K 42 G1961E OS 14 0.2 3.7 58.3 40731.5 1 9 f 26 OD 15 0.1 6.0 70.5 3215.2 1 17 G863A n.f. OS 15 0.1 8.5 56.5 14734.9 1 10 f 19 OD 2 0.1 7.9 65.7 3260.0 1 3 P68L 36 S1689P OS 2 0.1 7.0 63.9 2964.8 1 11 f 34 OD 30 0.4 0.0 88.2 234.1 1 28 E1399K 42 G1961E OS 30 0.4 0.0 87.9 350.0 1 12 m 59 OD 5 0.1 5.2 79.2 1715.5 1 42 G1961E n.f. OS 5 0.1 4.4 75.0 3839.5 1 13 m 35 OD 20 0.05 9.7 72.9 8164.8 1 17 G863A 37 Q1750X OS 20 0.05 10.3 64.9 9820.4 1 14 m 43 OD 29 HM 16.0 58.5 18228.0 1 17 G863A 37 Q1750X OS 29 HM 15.6 42.1 14173.5 1 15 f 32 OD 10 0.05 6.5 61.3 10195.5 1 21 A1038V n.f. OS 10 0.05 5.0 56.7 7560.7 1 16 m 46 OD 4 0.05 8.5 51.1 8641.6 1 12+21 L541P+ 17 G863A OS 4 0.3 5.0 51.1 19827.1 1 A1038V 17 m 43 OD 3 0.5 0.0 90.7 190.9 1 - - - - OS 3 0.7 0.0 81.9 402.2 1 18 f 31 OD 27 1/15 9.8 69.3 2268.5 1 22 R1108C n.f. OS 27 0.1 17.2 60.9 4237.0 1 19 f 23 OD 5 0.05 6.0 72.9 3751.2 1 28 E1399K 43 G1977S OS 5 0.05 6.2 74.8 3578.9 1 20 f 16 OD 5 0.1 6.0 75.8 708.0 1 22 R1108C n.f. OS 5 0.1 5.4 82.4 449.6 1 21 m 38 OD 23 0.1 8.2 53.7 53733.8 2 - - - - OS 12 0.1 6.2 60.3 80873.8 2 22 m 40 OD 6 0.05 16.6 60.8 11677.8 1 14 R681X n.f. OS 6 0.1 10.0 60.6 5134.5 1 23 f 24 OD 3 0.1 6.7 90.5 577.8 1 6 G768T/ n.f. OS 3 0.1 7.1 83.6 3015.2 1 splice 24 m 13 OD 3 0.05 6.9 65.2 1882.7 1 - - - - OS 3 0.05 7.3 53.7 3844.3 1 25 f 39 OD 34 HM 7.0 54.3 24440.2 1 n.f. n.f. OS 34 1/60 10.6 77.6 1245.6 1 26 f 27 OD 2 0.2 0.0 91.8 127.4 1 17 G863A 28 Q1412X OS 2 0.6 0.0 94.9 69.2 1 27 m 25 OD 1 0.3 0.0 70.7 5670.4 1 n.f. n.f. OS 1 0.4 0.0 75.6 764.9 1 28 m 17 OD 3 0.2 0.8 67.3 4244.1 1 - - - - OS 3 0.3 0.0 80.6 2429.2 1 29 m 28 OD 2,5 0.1 5.4 80.8 795.0 1 - - - - OS 2,5 0.1 4.2 64.3 2101.1 1 30 f 27 OD 20 0.1 6.7 88.2 183.6 1 G1961E G1961E OS 20 0.1 10.9 81.0 448.2 1 Dis. dur., disease duration (years); HM, recognition of hand movements; VA, visual acuity in European decimals. Login to comment
183 of PRL ABCA4 allel1 exon mut 1 ABCA4 allel2 exon mut 2 1 m 32 OD 2 0.4 0.0 90.0 211.0 1 48 L2241V n.f. OS 2 0.6 0.0 90.0 181.6 1 2 f 55 OD 29 0.1 9.7 60.3 9874.6 1 - - - - OS 29 0.1 6.8 67.5 68260.1 2 3 f 38 OD 16 0.05 6.4 73.7 4962.8 1 14 W663X 42 G1961E OS 7 0.4 0.0 90.9 143.5 1 4 m 23 OD 7 0.1 5.7 81.8 664.3 1 40 R1898H 43 G1975R OS 6 0.1 7.0 80.6 594.2 1 5 m 16 OD 7 0.05 7.4 81.0 1052.0 1 12+21 L541P+ 40 IVS40+5 OS 7 0.05 5.0 73.3 11500.0 1 A1038V G->A 6 m 34 OD 34 0.1 0.0 76.2 924.2 1 n.f. n.f. OS 34 0.1 0.0 74.3 1106.2 1 7 m 17 OD 11 0.1 3.1 79.1 3517.6 1 - - - - OS 11 0.1 3.6 70.0 2226.1 1 8 m 46 OD 14 0.5 3.6 80.6 3986.2 1 11 E471K 42 G1961E OS 14 0.2 3.7 58.3 40731.5 1 9 f 26 OD 15 0.1 6.0 70.5 3215.2 1 17 G863A n.f. OS 15 0.1 8.5 56.5 14734.9 1 10 f 19 OD 2 0.1 7.9 65.7 3260.0 1 3 P68L 36 S1689P OS 2 0.1 7.0 63.9 2964.8 1 11 f 34 OD 30 0.4 0.0 88.2 234.1 1 28 E1399K 42 G1961E OS 30 0.4 0.0 87.9 350.0 1 12 m 59 OD 5 0.1 5.2 79.2 1715.5 1 42 G1961E n.f. OS 5 0.1 4.4 75.0 3839.5 1 13 m 35 OD 20 0.05 9.7 72.9 8164.8 1 17 G863A 37 Q1750X OS 20 0.05 10.3 64.9 9820.4 1 14 m 43 OD 29 HM 16.0 58.5 18228.0 1 17 G863A 37 Q1750X OS 29 HM 15.6 42.1 14173.5 1 15 f 32 OD 10 0.05 6.5 61.3 10195.5 1 21 A1038V n.f. OS 10 0.05 5.0 56.7 7560.7 1 16 m 46 OD 4 0.05 8.5 51.1 8641.6 1 12+21 L541P+ 17 G863A OS 4 0.3 5.0 51.1 19827.1 1 A1038V 17 m 43 OD 3 0.5 0.0 90.7 190.9 1 - - - - OS 3 0.7 0.0 81.9 402.2 1 18 f 31 OD 27 1/15 9.8 69.3 2268.5 1 22 R1108C n.f. OS 27 0.1 17.2 60.9 4237.0 1 19 f 23 OD 5 0.05 6.0 72.9 3751.2 1 28 E1399K 43 G1977S OS 5 0.05 6.2 74.8 3578.9 1 20 f 16 OD 5 0.1 6.0 75.8 708.0 1 22 R1108C n.f. OS 5 0.1 5.4 82.4 449.6 1 21 m 38 OD 23 0.1 8.2 53.7 53733.8 2 - - - - OS 12 0.1 6.2 60.3 80873.8 2 22 m 40 OD 6 0.05 16.6 60.8 11677.8 1 14 R681X n.f. OS 6 0.1 10.0 60.6 5134.5 1 23 f 24 OD 3 0.1 6.7 90.5 577.8 1 6 G768T/ n.f. OS 3 0.1 7.1 83.6 3015.2 1 splice 24 m 13 OD 3 0.05 6.9 65.2 1882.7 1 - - - - OS 3 0.05 7.3 53.7 3844.3 1 25 f 39 OD 34 HM 7.0 54.3 24440.2 1 n.f. n.f. OS 34 1/60 10.6 77.6 1245.6 1 26 f 27 OD 2 0.2 0.0 91.8 127.4 1 17 G863A 28 Q1412X OS 2 0.6 0.0 94.9 69.2 1 27 m 25 OD 1 0.3 0.0 70.7 5670.4 1 n.f. n.f. OS 1 0.4 0.0 75.6 764.9 1 28 m 17 OD 3 0.2 0.8 67.3 4244.1 1 - - - - OS 3 0.3 0.0 80.6 2429.2 1 29 m 28 OD 2,5 0.1 5.4 80.8 795.0 1 - - - - OS 2,5 0.1 4.2 64.3 2101.1 1 30 f 27 OD 20 0.1 6.7 88.2 183.6 1 G1961E G1961E OS 20 0.1 10.9 81.0 448.2 1 Dis. dur., disease duration (years); HM, recognition of hand movements; VA, visual acuity in European decimals. Login to comment

[hide] Macular pigment and lutein supplementation in ABCA... Invest Ophthalmol Vis Sci. 2007 Mar;48(3):1319-29. Aleman TS, Cideciyan AV, Windsor EA, Schwartz SB, Swider M, Chico JD, Sumaroka A, Pantelyat AY, Duncan KG, Gardner LM, Emmons JM, Steinberg JD, Stone EM, Jacobson SG
Macular pigment and lutein supplementation in ABCA4-associated retinal degenerations.
Invest Ophthalmol Vis Sci. 2007 Mar;48(3):1319-29., [PMID:17325179]

Abstract [show]
PURPOSE: To determine macular pigment (MP) optical density (OD) in patients with ABCA4-associated retinal degenerations (ABCA4-RD) and the response of MP and vision to supplementation with lutein. METHODS: Patients with Stargardt disease or cone-rod dystrophy and known or suspected disease-causing mutations in the ABCA4 gene were included. All patients had foveal fixation. MPOD profiles were measured with heterochromatic flicker photometry. Serum carotenoids, visual acuity, foveal sensitivity, and retinal thickness were quantified. Changes in MPOD and central vision were determined in a subset of patients receiving oral supplementation with lutein for 6 months. RESULTS: MPOD in patients ranged from normal to markedly abnormal. As a group, patients with ABCA4-RD had reduced foveal MPOD, and there was a strong correlation with retinal thickness. Average foveal tissue concentration of MP, estimated by dividing MPOD by retinal thickness, was normal in patients, whereas serum concentration of lutein and zeaxanthin was significantly lower than normal. After oral lutein supplementation for 6 months, 91% of the patients showed significant increases in serum lutein, and 63% of the patients' eyes showed a significant augmentation in MPOD. The retinal responders tended to be female and to have lower serum lutein and zeaxanthin, lower MPOD, and greater retinal thickness at baseline. Responding eyes had significantly lower baseline MP concentration than did nonresponding eyes. Central vision was unchanged after the period of supplementation. CONCLUSIONS: MP is strongly affected by the stage of ABCA4 disease leading to abnormal foveal architecture. MP could be augmented by supplemental lutein in some patients. There was no change in central vision after 6 months of lutein supplementation. Long-term influences of this supplement on the natural history of these macular degenerations require further study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Clinical and Molecular Characteristics of the Patients Patient Age (y)/Gender ABCA4 Mutation Visual Acuity* Refraction† Kinetic Visual Field Extent (V-4e)‡ Lutein Trial Participant?RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 -0.50 -0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 -1.00 -1.25 103 104 N 3 18/M ࿣ 20/20 20/125 -1.00 -1.00 126 105 N 4§ 19/F R1129L/L1940P 20/40 20/50 ϩ0.25 ϩ0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 -0.75 -0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 -1.25 -1.50 112 105 Y 7§ 26/M ࿣ 20/40 20/32 ϩ1.00 ϩ0.75 86 88 Y 8 30/F ࿣ 20/50 20/40 ϩ2.25 ϩ1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 -2.25 -3.50 99 93 Y 10 32/F V935A/IVS40ϩ5G3A 20/32 20/40 -0.75 -1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 -1.50 -1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 -3.00 -2.00 99 105 Y 13¶ 38/F V256V/G1961E 20/25 20/25 -1.00 -1.25 106 101 Y 14¶ 42/F V256V/G1961E 20/25 20/32 -0.50 -0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 ϩ0.75 ϩ0.25 108 103 N 16§ 49/M ࿣ 20/32 20/32 -4.50 -4.50 84 79 Y 17 56/M G1977S 20/25 20/25 -5.50 -5.50 99 109 N * Best corrected visual acuity. Login to comment
62 RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 afa;0.50 afa;0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 afa;1.00 afa;1.25 103 104 N 3 18/M $f3; 20/20 20/125 afa;1.00 afa;1.00 126 105 N 4&#a7; 19/F R1129L/L1940P 20/40 20/50 af9;0.25 af9;0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 afa;0.75 afa;0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 afa;1.25 afa;1.50 112 105 Y 7&#a7; 26/M $f3; 20/40 20/32 af9;1.00 af9;0.75 86 88 Y 8 30/F $f3; 20/50 20/40 af9;2.25 af9;1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 afa;2.25 afa;3.50 99 93 Y 10 32/F V935A/IVS40af9;5G3A 20/32 20/40 afa;0.75 afa;1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 afa;1.50 afa;1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 afa;3.00 afa;2.00 99 105 Y 13&#b6; 38/F V256V/G1961E 20/25 20/25 afa;1.00 afa;1.25 106 101 Y 14&#b6; 42/F V256V/G1961E 20/25 20/32 afa;0.50 afa;0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 af9;0.75 af9;0.25 108 103 N 16&#a7; 49/M $f3; 20/32 20/32 afa;4.50 afa;4.50 84 79 Y 17 56/M G1977S 20/25 20/25 afa;5.50 afa;5.50 99 109 N * Best corrected visual acuity. Login to comment

[hide] Spectrum of the ABCA4 gene mutations implicated in... Invest Ophthalmol Vis Sci. 2007 Mar;48(3):985-90. Valverde D, Riveiro-Alvarez R, Aguirre-Lamban J, Baiget M, Carballo M, Antinolo G, Millan JM, Garcia Sandoval B, Ayuso C
Spectrum of the ABCA4 gene mutations implicated in severe retinopathies in Spanish patients.
Invest Ophthalmol Vis Sci. 2007 Mar;48(3):985-90., [PMID:17325136]

Abstract [show]
PURPOSE: The purpose of this study is to describe the spectrum of mutations in the ABCA4 gene found in Spanish patients affected with several retinal dystrophies. METHODS: Sixty Spanish families with different retinal dystrophies were studied. Samples were analyzed for variants in all 50 exons of the ABCA4 gene by screening with the ABCR400 microarray, and results were confirmed by direct sequencing. Haplotype analyses were also performed. For those families with only one mutation detected by the microarray, denaturing (d)HPLC was performed to complete the mutational screening of the ABCA4 gene. RESULTS: The sequence analysis of the ABCA4 gene led to the identification of 33 (27.5%) potential disease-associated alleles among the 60 patients. These comprised 16 distinct sequence variants in 25 of the 60 subjects investigated. For autosomal recessive cone-rod dystrophy (arCRD), we found that 50% of the CRD families with the mutation had two recurrent changes (2888delG and R943Q). For retinitis pigmentosa (RP) and autosomal dominant macular dystrophy (adMD), one putative disease-associated allele was identified in 9 of the 27 and 3 of the 7 families, respectively. CONCLUSIONS: In the population studied, ABCA4 plays an important role in the pathogenesis of arCRD. However, mutations in this gene are less frequently identified in other retinal dystrophies, like RP or adMD, and therefore it is still not clear whether ABCA4 is involved as a modifying factor or the relationship is a fortuitous association.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
96 Other studies have shown this variant to be associated with G863A, leading to a severer pathogenic state in humans. Login to comment
94 Other studies have shown this variant to be associated with G863A, leading to a severer pathogenic state in humans. Login to comment

[hide] Correlation of clinical and genetic findings in Hu... Invest Ophthalmol Vis Sci. 2005 Dec;46(12):4402-8. Hargitai J, Zernant J, Somfai GM, Vamos R, Farkas A, Salacz G, Allikmets R
Correlation of clinical and genetic findings in Hungarian patients with Stargardt disease.
Invest Ophthalmol Vis Sci. 2005 Dec;46(12):4402-8., [PMID:16303926]

Abstract [show]
PURPOSE: Autosomal recessive Stargardt disease (arSTGD) presents with substantial clinical and genetic heterogeneity. This study was conducted to correlate foveolar thickness (FT) and total macular volume (TMV), measured by optical coherence tomography (OCT), with other clinical characteristics and with specific genetic variation in Hungarian patients with arSTGD. METHODS: After a standard ophthalmic workup, both eyes of 35 patients with STGD from Hungary and of 25 age-matched healthy control subjects were tested with OCT. FT and TMV were measured automatically with the OCT mapping software in the nine Early Treatment Diabetic Retinopathy Study areas of 3500 microm in diameter. All patients were screened for mutations by a combination of the ABCR400 microarray and direct sequencing. RESULTS: The patients with STGD presented with markedly thinned retina in the foveola and decreased macular volume, 72 microm and 1.69 mm3, respectively, compared with 169 microm and 2.48 mm3 in the normal subjects, respectively. Statistically significant correlation was observed between visual acuity (VA) and TMV and between VA and FT. Disease-associated mutations were detected in 23 (65.7%) of 35 patients, including 48.5% with both alleles and 17.2% with one allele. The most frequent ABCA4 alleles in Hungarian patients with STGD were L541P/A1038V (in 28% of all patients), G1961E (20%) and IVS40+5G-->A (17%). Specific genotypes correlated with some phenotypic features and allowed for predictions of the disease progression. CONCLUSIONS: Hungarian patients with STGD presented with extensive foveolar thinning and macular volume loss. Genetic analysis detected several ABCA4 alleles at high frequency in the cohort of patients, suggesting founder effect(s). Unusually homogeneous distribution of disease-associated mutations aided genotype-phenotype correlation analyses in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Summarized Clinical and Genetic Data of Patients with STGD Patient Allele 1 Allele 2 Fishman OU Gender Age Duration VA OD VA OS FT OD (␮m) FT OS (␮m) MV OD (mm3 ) MV OS (mm3 ) 1 ND ND I M 18 10 0.42 0.50 90.00 76.00 1.70 1.67 2 L541P/A1038V ND III F 27 15 0.06 0.08 43.00 58.00 1.27 1.28 3 5917delG 5917delG II F 29 8 0.17 0.17 54.00 20.00 1.38 1.35 4 ND ND III F 42 14 0.10 0.10 91.00 71.00 1.60 1.59 5 V2050L ND II F 22 5 0.20 0.33 28.00 77.00 1.64 1.68 6 ND ND II F 17 2 1.00 0.71 156.00 141.00 2.55 2.6 7 IVS40ϩ5GϾA ND III M 28 13 0.10 0.06 71.00 92.00 1.61 1.61 8 L541P/A1038V G1961E II M 37 15 0.10 0.10 87.00 97.00 1.95 1.95 9 106delT G1961E II M 32 7 0.08 0.08 51.00 32.00 1.59 1.66 10 ND ND I F 55 17 0.25 0.56 160.00 170.00 1.72 1.82 11 L541P/A1038V G863A II F 15 3 0.25 0.33 67.00 68.00 1.78 1.76 12 IVS40ϩ5GϾA 5917delG III M 15 6 0.20 0.20 107.00 117.00 1.93 1.92 13 ND ND I M 27 2 0.38 0.33 56.00 86.00 2.01 1.97 14 G1886E G1961E II F 37 9 0.12 0.16 92.00 46.00 1.55 1.59 15 G1961E ND III F 20 5 0.30 0.20 49.00 34.00 1.43 1.53 16 ND ND II M 28 14 0.32 0.08 52.00 60.00 1.46 1.52 17 IVS40ϩ5GϾA 5917delG III M 27 5 0.10 0.10 97.00 92.00 1.76 1.71 18 L541P/A1038V D1532N III M 28 12 0.25 0.10 49.00 46.00 1.83 1.86 19 ND ND II F 31 11 0.10 0.13 67.00 72.00 1.55 1.49 20 L541P L541P/A1038V II F 15 5 0.10 0.10 28.00 34.00 1.63 1.65 21 L541P/A1038V G863A II F 25 2 0.20 0.62 94.00 81.00 1.92 1.94 22 L541P/A1038V ND II M 18 9 0.08 0.10 63.00 72.00 1.40 1.43 23 G1961E ND III F 34 9 0.16 0.16 16.00 23.00 1.31 1.56 24 ND ND II F 52 14 0.16 0.16 122.00 113.00 1.90 1.99 25 P68L L541P/A1038V III M 37 22 0.10 0.12 40.00 40.00 1.41 1.42 26 ND ND II F 18 11 0.20 0.25 59.00 72.00 1.42 1.47 27 L541P/A1038V G1961E II F 24 7 0.18 0.18 83.00 100.00 1.72 1.77 28 IVS40ϩ5GϾA 5917delG III M 15 7 0.10 0.16 38.00 46.00 1.30 1.41 29 R1108C R1108C II M 31 14 0.10 0.10 41.00 44.00 1.95 1.96 30 G1961E ND II M 28 6 0.33 0.56 91.00 129.00 1.98 2.04 31 ND ND II F 28 11 0.08 0.10 55.00 63.00 1.52 1.59 32 L541P/A1038V G863A II M 32 15 0.20 0.20 92.00 86.00 1.80 1.75 33 ND ND II F 27 4 0.25 0.20 66.00 75.00 1.72 1.76 34 ND ND II F 36 8 0.12 0.10 58.00 69.00 1.59 1.56 35 IVS40ϩ5GϾA IVS40ϩ5GϾA III F 19 6 0.10 0.10 62.00 53.00 1.67 1.65 Fishman OU, classification of patients by fundus photos in three categories according to Fishman et al.25 ND, not determined. Login to comment
97 In patients compound heterozygous for the L541P/ A1038V and G863A alleles (patients 11, 21, 32), a decrease in vision with the duration of the disease was observed. Login to comment
132 Therefore, patients with STGD with the G1961E variant have, in general, a better than average disease prognosis. Login to comment
134 In in vitro studies, the L541P/ A1038V variant demonstrated a reduced, but not completely abolished, ATPase activity.20 The subgroup of patients, compound heterozygous for the L541P/A1038V and G863A alleles, show a better prognosis (i.e., a slower progression of the disease). Login to comment
87 Summarized Clinical and Genetic Data of Patients with STGD Patient Allele 1 Allele 2 Fishman OU Gender Age Duration VA OD VA OS FT OD (òe;m) FT OS (òe;m) MV OD (mm3 ) MV OS (mm3 ) 1 ND ND I M 18 10 0.42 0.50 90.00 76.00 1.70 1.67 2 L541P/A1038V ND III F 27 15 0.06 0.08 43.00 58.00 1.27 1.28 3 5917delG 5917delG II F 29 8 0.17 0.17 54.00 20.00 1.38 1.35 4 ND ND III F 42 14 0.10 0.10 91.00 71.00 1.60 1.59 5 V2050L ND II F 22 5 0.20 0.33 28.00 77.00 1.64 1.68 6 ND ND II F 17 2 1.00 0.71 156.00 141.00 2.55 2.6 7 IVS40af9;5Gb0e;A ND III M 28 13 0.10 0.06 71.00 92.00 1.61 1.61 8 L541P/A1038V G1961E II M 37 15 0.10 0.10 87.00 97.00 1.95 1.95 9 106delT G1961E II M 32 7 0.08 0.08 51.00 32.00 1.59 1.66 10 ND ND I F 55 17 0.25 0.56 160.00 170.00 1.72 1.82 11 L541P/A1038V G863A II F 15 3 0.25 0.33 67.00 68.00 1.78 1.76 12 IVS40af9;5Gb0e;A 5917delG III M 15 6 0.20 0.20 107.00 117.00 1.93 1.92 13 ND ND I M 27 2 0.38 0.33 56.00 86.00 2.01 1.97 14 G1886E G1961E II F 37 9 0.12 0.16 92.00 46.00 1.55 1.59 15 G1961E ND III F 20 5 0.30 0.20 49.00 34.00 1.43 1.53 16 ND ND II M 28 14 0.32 0.08 52.00 60.00 1.46 1.52 17 IVS40af9;5Gb0e;A 5917delG III M 27 5 0.10 0.10 97.00 92.00 1.76 1.71 18 L541P/A1038V D1532N III M 28 12 0.25 0.10 49.00 46.00 1.83 1.86 19 ND ND II F 31 11 0.10 0.13 67.00 72.00 1.55 1.49 20 L541P L541P/A1038V II F 15 5 0.10 0.10 28.00 34.00 1.63 1.65 21 L541P/A1038V G863A II F 25 2 0.20 0.62 94.00 81.00 1.92 1.94 22 L541P/A1038V ND II M 18 9 0.08 0.10 63.00 72.00 1.40 1.43 23 G1961E ND III F 34 9 0.16 0.16 16.00 23.00 1.31 1.56 24 ND ND II F 52 14 0.16 0.16 122.00 113.00 1.90 1.99 25 P68L L541P/A1038V III M 37 22 0.10 0.12 40.00 40.00 1.41 1.42 26 ND ND II F 18 11 0.20 0.25 59.00 72.00 1.42 1.47 27 L541P/A1038V G1961E II F 24 7 0.18 0.18 83.00 100.00 1.72 1.77 28 IVS40af9;5Gb0e;A 5917delG III M 15 7 0.10 0.16 38.00 46.00 1.30 1.41 29 R1108C R1108C II M 31 14 0.10 0.10 41.00 44.00 1.95 1.96 30 G1961E ND II M 28 6 0.33 0.56 91.00 129.00 1.98 2.04 31 ND ND II F 28 11 0.08 0.10 55.00 63.00 1.52 1.59 32 L541P/A1038V G863A II M 32 15 0.20 0.20 92.00 86.00 1.80 1.75 33 ND ND II F 27 4 0.25 0.20 66.00 75.00 1.72 1.76 34 ND ND II F 36 8 0.12 0.10 58.00 69.00 1.59 1.56 35 IVS40af9;5Gb0e;A IVS40af9;5Gb0e;A III F 19 6 0.10 0.10 62.00 53.00 1.67 1.65 Fishman OU, classification of patients by fundus photos in three categories according to Fishman et al.25 ND, not determined. Login to comment
95 In patients compound heterozygous for the L541P/ A1038V and G863A alleles (patients 11, 21, 32), a decrease in vision with the duration of the disease was observed. Login to comment

[hide] Evolution of ABCA4 proteins in vertebrates. J Mol Evol. 2005 Jan;60(1):72-80. Yatsenko AN, Wiszniewski W, Zaremba CM, Jamrich M, Lupski JR
Evolution of ABCA4 proteins in vertebrates.
J Mol Evol. 2005 Jan;60(1):72-80., [PMID:15696369]

Abstract [show]
The ABCA4 (ABCR) gene encodes a retinal-specific ATP-binding cassette transporter. Mutations in ABCA4 are responsible for several recessive macular dystrophies and susceptibility to age related macular degeneration (AMD). The protein appears to function as a flippase of all-trans-retinaldehyde and/or its derivatives across the membrane of outer segment disks and is a potentially important element in recycling visual cycle metabolites. However, the understanding of ABCA4's role in the visual cycle is limited due to the lack of a direct functional assay. An evolutionary analysis of ABCA4 may aid in the identification of conserved elements, the preservation of which implies functional importance. To date, only human, murine, and bovine ABCA4 genes are described. We have identified ABCA4 genes from African (Xenopus laevis) and Western (Silurana tropicalis) clawed frogs. A comparative analysis describing the evolutionary relationships between the frog ABCA4s, annotated T. rubripes ABCA4, and mammalian ABCA4 proteins was carried out. Several segments are conserved in both intradiscal loop (IL) domains, in addition to the transmembrane and ATP-binding domains. Nonconserved segments were found in the IL and cytoplasmic linker domains. Maximum likelihood analyses of the aligned sequences strongly suggest that ABCA4 was subject to purifying selection. Collectively, these data corroborate the current evolutionary model where two distinct ABCA half-transporter progenitors were combined to form a full ABCA4 progenitor in ancestral chordates. We speculate that evolutionary alterations may increase the retinoid metabolite recycling capacity of ABCA4 and may improve dark adaptation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
130 As anticipated, the most frequently occurring STGD- associated missense ABCA4 alterations (R212C, L541P, D645N, G863A, A1038V, R1108C, R1380L, W1408R, T1526M, R1640W, G1961E, L2027F, and L2030Q) map to highly conserved regions. Login to comment

[hide] Microarray-based mutation analysis of the ABCA4 (A... Eur J Hum Genet. 2004 Dec;12(12):1024-32. Klevering BJ, Yzer S, Rohrschneider K, Zonneveld M, Allikmets R, van den Born LI, Maugeri A, Hoyng CB, Cremers FP
Microarray-based mutation analysis of the ABCA4 (ABCR) gene in autosomal recessive cone-rod dystrophy and retinitis pigmentosa.
Eur J Hum Genet. 2004 Dec;12(12):1024-32., [PMID:15494742]

Abstract [show]
Mutations in the ABCA4 gene have been associated with autosomal recessive Stargardt disease (STGD1), cone-rod dystrophy (CRD), and retinitis pigmentosa (RP). We employed a recently developed genotyping microarray, the ABCR400-chip, to search for known ABCA4 mutations in patients with isolated or autosomal recessive CRD (54 cases) or RP (90 cases). We performed detailed ophthalmologic examinations and identified at least one ABCA4 mutation in 18 patients (33%) with CRD and in five patients (5.6%) with RP. Single-strand conformation polymorphism (SSCP) analysis and subsequent DNA sequencing revealed four novel missense mutations (R24C, E161K, P597S, G618E) and a novel 1-bp deletion (5888delG). Ophthalmoscopic abnormalities in CRD patients ranged from minor granular pigmentary changes in the posterior pole to widespread atrophy. In 12 patients with recordable electroretinogram (ERG) tracings, a cone-rod pattern was detected. Three patients demonstrated progression from a retinal dystrophy resembling STGD1 to a more widespread degeneration, and were subsequently diagnosed as CRD. In addition to a variable degree of atrophy, all RP patients displayed ophthalmologic characteristics of classic RP. When detectable, ERG recordings in these patients demonstrated rod-cone patterns of photoreceptor degeneration. In conclusion, in this study, we show that the ABCA4 mutation chip is an efficient first screening tool for arCRD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 15680 Isolated 5882G4A G1961E Not identified NA 15730 Isolated 2588G4C; 2828G4A DG863/G863A; R943Q 2588G4C; 2828G4A DG863/G863A; R943Q ? Login to comment
65 16697 Isolated 2588G4C; 2828G4Ab DG863/G863A; R943Q 1853G4A; 4297G4A G618E; V1433I Yes 16755 Isolated 2588G4C; 2828G4A DG863/G863A; R943Q Not identified NA 16887 Isolated 768G4T Splicing IVS38-10T4C Unknowna Yes 17906 Aut. rec. 768G4T Splicing Not identified NA a Mutation which is presumed to be in linkage disequilibrium with unknown pathologic ABCA4 mutation. Login to comment
101 Likewise, the known Table 2 ABCA4 sequence variants in RP patients RP patient number Inheritance Allele 1 Allele 2 Nucleotide change Effect Nucleotide change Effect 9304 Aut. Rec. 2588G4C; 2828G4Aa DG863/G863A; R943Q 5888delG R1963fs 9444 Aut. Rec. 6529G4A D2177N Not identified 9545 Isolated 6529G4A D2177N Not identified 14753 Isolated 1622T4C; 3113C4T L541P; A1038V Not identified 17597 Isolated 6148G4C V2050L Not identified a Polymorphic variants 4203A, 5603 T, and 5682C also present. Login to comment
143 Given this clinical presentation and the fact that homozygous null mutations were not found Table 5 Functional assessment of missense (A) and splice site (B) mutations (A) Missense mutation Nature of amino-acid change Effect on ABCR functionRef R18W Nonconservative Unknown R24C Nonconservative Unknown; adjacent to first transmembrane domain G65E Nonconservative Unknown E161K Nonconservative Unknown L541P Conservative Decreased ATP binding and ATPase activity50 P597S Nonconservative Unknown G618E Nonconservative Unknown V767D Nonconservative Decreased ABCR expression10 G863A Nonconservative Decreased ATPase activity50, 51 R943Q Nonconservative Decreased ATPase activity51 A1038V Conservative Decreased ATP binding and ATPase activity50 E1087K Nonconservative Decreased ATP binding50 V1433I Conservative Unknown R1640W Nonconservative Unknown A1794D Nonconservative Introduction charged aa in 10th transmembrane domain G1961E Nonconservative Decreased ATP binding and ATPase activity 50 V2050L Conservative Unknown D2177N Nonconservative Increased ATPase activity50 (B) Splice site mutation Effect on mRNARef Predicted effect on ABCR protein 768G4T Nonsense-mediated decay33 No protein IVS36+2T4C Unknown Truncation of exon 36 resulting in V1673fs? Login to comment

[hide] Denaturing HPLC profiling of the ABCA4 gene for re... Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10. Stenirri S, Fermo I, Battistella S, Galbiati S, Soriani N, Paroni R, Manitto MP, Martina E, Brancato R, Allikmets R, Ferrari M, Cremonesi L
Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations.
Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10., [PMID:15192030]

Abstract [show]
BACKGROUND: Mutations in the retina-specific ABC transporter (ABCA4) gene have been associated with several forms of macular degenerations. Because the high complexity of the molecular genotype makes scanning of the ABCA4 gene cumbersome, we describe here the first use of denaturing HPLC (DHPLC) to screen for ABCA4 mutations. METHODS: Temperature conditions were designed for all 50 exons based on effective separation of 83 samples carrying 86 sequence variations and 19 mutagenized controls. For validation, samples from 23 previously characterized Stargardt patients were subjected to DHPLC profiling. Subsequently, samples from a cohort of 30 patients affected by various forms of macular degeneration were subjected to DHPLC scanning under the same conditions. RESULTS: DHPLC profiling not only identified all 132 sequence alterations previously detected by double-gradient denaturing gradient gel electrophoresis but also identified 5 sequence alterations that this approach had missed. Moreover, DHPLC scanning of an additional panel of 30 previously untested patients led to the identification of 26 different mutations and 29 polymorphisms, accounting for 203 sequence variations on 29 of the 30 patients screened. In total, the DHPLC approach allowed us to identify 16 mutations that had never been reported before. CONCLUSIONS: These results provide strong support for the use of DHPLC for molecular characterization of the ABCA4 gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment
34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment

[hide] Mutation spectrum and founder chromosomes for the ... Invest Ophthalmol Vis Sci. 2004 Jun;45(6):1705-11. September AV, Vorster AA, Ramesar RS, Greenberg LJ
Mutation spectrum and founder chromosomes for the ABCA4 gene in South African patients with Stargardt disease.
Invest Ophthalmol Vis Sci. 2004 Jun;45(6):1705-11., [PMID:15161829]

Abstract [show]
PURPOSE: To assess the mutation spectrum of ABCA4 underlying Stargardt disease (STGD) in South Africa (SA) and to determine whether there is a single or a few founder chromosomes in SA STGD families. METHODS: Sixty-four probands exhibiting the STGD phenotype were screened for mutations in the 50 exons of ABCA4 by single-strand conformational polymorphism-heteroduplex analysis sequencing and restriction fragment length polymorphism analysis. Microsatellite marker haplotyping was used to determine the ancestry in 10 families. RESULTS: Fifty-seven ABCA4 disease-associated alleles were identified that comprised 16 different sequence variants, of which two were novel, in 40 individuals of the cohort of 64 subjects. The most common variants identified included the C1490Y, L2027F, R602W, V256splice, R152X, and 2588G-->C mutations. The C1490Y variant was the most common disease-associated variant identified (19/64 subjects) and was absent in 392 control chromosomes. At least 10 ABCA4 disease-associated haplotypes were identified. Two of these haplotypes, which carried the C1490Y mutation, were identified in three unrelated families. CONCLUSIONS: Results suggest that ABCA4 is the major gene underlying STGD in the cohort investigated. Five of the six common sequence variants identified were at a higher frequency in the SA cohort than reported in published data on individuals of similar ancestry. The mutation and haplotype data suggests that there are several ancestral haplotypes underlying STGD in SA. There seems to be at least two different origins for the common C1490Y mutation, as well as two for the R602W mutation, thereby suggesting several founder effects for STGD in SA.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 List of 16 Different Potential Disease-Associated Sequence Variants Identified in 64 SA Subjects with arSTGD Nucleotide Change Amino Acid Change Families (N ‫؍‬ 64) Exon Reference C454T R152X 4 5 3,33 G455A R152Q 1 5 35 C634T R212C 1 6 16,27 G768T (Splice donor) V256splice 5 6 15 C1885T R602W 6 13 9 2588G3C G863A 4 17 8 T3047C V989A 1 20 11 T4319C F1440S 1 29 9 G4328A* R1443H 1 29 This study G4469A C1490Y 19 30 15,9 G5077A V16931 1 36 36 C6079T L2027F 8 44 8 C6088A R2030X 1 44 9,37 C6112T R2038W 2 44 5 IVS45ϩ7G3A Splice donor 1 45 26 6352⌬A* Frameshift 1 46 This study No individuals positive for the R1443H variant were identified in 47 control individuals of Indian ancestry. Login to comment

[hide] Genotyping microarray (gene chip) for the ABCR (AB... Hum Mutat. 2003 Nov;22(5):395-403. Jaakson K, Zernant J, Kulm M, Hutchinson A, Tonisson N, Glavac D, Ravnik-Glavac M, Hawlina M, Meltzer MR, Caruso RC, Testa F, Maugeri A, Hoyng CB, Gouras P, Simonelli F, Lewis RA, Lupski JR, Cremers FP, Allikmets R
Genotyping microarray (gene chip) for the ABCR (ABCA4) gene.
Hum Mutat. 2003 Nov;22(5):395-403., [PMID:14517951]

Abstract [show]
Genetic variation in the ABCR (ABCA4) gene has been associated with five distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), and age-related macular degeneration (AMD). Comparative genetic analyses of ABCR variation and diagnostics have been complicated by substantial allelic heterogeneity and by differences in screening methods. To overcome these limitations, we designed a genotyping microarray (gene chip) for ABCR that includes all approximately 400 disease-associated and other variants currently described, enabling simultaneous detection of all known ABCR variants. The ABCR genotyping microarray (the ABCR400 chip) was constructed by the arrayed primer extension (APEX) technology. Each sequence change in ABCR was included on the chip by synthesis and application of sequence-specific oligonucleotides. We validated the chip by screening 136 confirmed STGD patients and 96 healthy controls, each of whom we had analyzed previously by single strand conformation polymorphism (SSCP) technology and/or heteroduplex analysis. The microarray was >98% effective in determining the existing genetic variation and was comparable to direct sequencing in that it yielded many sequence changes undetected by SSCP. In STGD patient cohorts, the efficiency of the array to detect disease-associated alleles was between 54% and 78%, depending on the ethnic composition and degree of clinical and molecular characterization of a cohort. In addition, chip analysis suggested a high carrier frequency (up to 1:10) of ABCR variants in the general population. The ABCR genotyping microarray is a robust, cost-effective, and comprehensive screening tool for variation in one gene in which mutations are responsible for a substantial fraction of retinal disease. The ABCR chip is a prototype for the next generation of screening and diagnostic tools in ophthalmic genetics, bridging clinical and scientific research.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 What makes ABCR a more difficult diagnostic target than CFTR is that the most frequent disease-associated ABCR alleles, e.g., 5882G>A (G1961E), 2588G>C (G863A/ delG863), and 3113C>T (A1038V), have each been described in only B10% of STGD patients in a distinct population, whereas the delF508 allele of CFTR accounts for close to 70% of all cystic fibrosis alleles [Zielenski and Tsui, 1995]. Login to comment
101 TABLE 1.Validation of theABCR400 Array^Comparison of the SSCP and Chip Data STGD patients Controls SSCP ABCR400 array ABCR400 array Chromosomes analyzed 272 272 192 Di¡erent disease-associated variants 72 96 8 Disease-associated alleles 155 215 9 Disease chromosomes (%) 149 (54.8%) 189 (69.5%) 9 (4.7%) Complex alleles 17 40 2 Complex alleles include 2588G4C;2828G4A (G863A;R943Q). Login to comment
115 Mutations Detected in theTwoTest Populations by the ABCR400 Array,That Had Not Been Found by SSCP Number Nucleotide change Protein e¡ect Number of cases 1 161G4A C54Y 3 2 194G4A G65E 1 3 428C4T P143L 1 4 455G4A R152Q 1 5 514G4A G172S 1 6 635G4A R212H 1 7 656G4C R219T 1 8 768G4Ta Splice/V256V 3 9 1007C4G S336C 2 10 1268A4G H423R 4 11 1411G4A E471K 2 12 1622T4Ca L541P 8 13 1933G4A D645N 1 14 2041C4T R681X 5 15 2090G4A W697X 1 16 2471T4C I824T 1 17 2588G4Ca Splice/G863A 5 18 2828G4A R943Q 1 19 2966T4C V989A 1 20 2971G4C G991R 1 21 4139C4T P1380L 8 22 4195G4A E1399K 1 23 4328G4A R1443H 1 24 4457C4T P1486L 1 25 4462T4Ca C1488R 1 26 4469G4Aa C1490Y 1 27 4918C4Ta R1640W 2 28 IVS40+5G4A Splice 2 29 5537T4C I1846T 2 30 5882G4A G1961E 5 31 6089G4A R2030Q 1 32 6104T4C L2035P 1 33 6449G4A C2150Y 1 Mutation numbering is based on the cDNA sequence (GenBank NM_000350). Login to comment
129 Of the other frequent variants, the 2588G>C (G863A/delG863) allele was frequent in the U.S. and Dutch cohorts, while completely absent in populations from South Europe, Italy, and Slovenia. Login to comment
155 These calculations also assume that all ''major`` alleles have been found in European populations, for example 2588G>C (G863A/delG863) in the Dutch and 1622T>C; 3113C>T (L541P;A1038V) in Germans. Login to comment

[hide] Macular pigment and visual acuity in Stargardt mac... Graefes Arch Clin Exp Ophthalmol. 2002 Oct;240(10):802-9. Epub 2002 Sep 14. Zhang X, Hargitai J, Tammur J, Hutchinson A, Allikmets R, Chang S, Gouras P
Macular pigment and visual acuity in Stargardt macular dystrophy.
Graefes Arch Clin Exp Ophthalmol. 2002 Oct;240(10):802-9. Epub 2002 Sep 14., [PMID:12397427]

Abstract [show]
PURPOSE: To test the hypothesis that macular pigment reflects foveal cone function and possibly the presence of foveal cones in recessive Stargardt macular dystrophy. METHODS: Sixteen patients (32 eyes) diagnosed to have Stargardt macular dystrophy by clinical criteria were studied with a scanning laser ophthalmoscope (SLO) comparing argon laser blue (488 nm), green (514), helium-neon laser red (633 nm) and infrared diode laser (780 nm) images for the presence or absence of macular pigment in the fovea. Fifteen of the patients were screened for mutations in the ABCR gene. Eyes were graded into three categories: those without foveal macular pigment, those with partial pigment and those with normal amounts of macular pigment. These categories were compared with visual acuity determined by the Snellen chart. RESULTS: All patients with a visual acuity of 20/200 or worse had no macular pigment in the fovea. All patients with visual acuity of 20/40 or better had a normal amount of macular pigment in the fovea. Patients with partial macular pigment had intermediary acuity values except for two eyes, one with 20/20 and another with 20/200 acuity. Infrared light revealed more retinal abnormalities than blue light at early stages of the disease. CONCLUSION: Foveal macular pigment is related to foveal cone acuity in Stargardt macular dystrophy and may be a marker for the presence of foveal cones. Infrared light is a sensitive monitor of early Stargardt macular dystrophy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Blue light images (A, C); infrared images (B, D) Table 1 Visual acuity, macular pigment and ABCR mutations in patients with Stargardt dystrophy Patient Age/Sex Visual Acuity Macular Pigment Exon Allele 1 Exon Allele 2 OD OS OD OS 1 33F 0.67 0.38 + + ND ND 2 36F 1 0.5 + + ND ND 3 54F 0.48 0.6 + + 42 G1961E 42 G1061E 4 11M 0.8 1 + + NS NS 5 33F 0.67 0.4 +- + 20 V989A ND 6 12F 0.5 0.2 +- +- 30 C1490Y 40 GIVS+5A 7 47M 0.5 0.4 +- +- 17 G863A/R943Q 45 R2077W 8 53M 0.1 1 +- +- 14 W663X ND 9 29F 0.1 0.1 +- +- 26 3819insT ND 10 43M 0.005 0.005 - - 17 G863A/R943Q ND 11 32F 0.1 0.1 - - 19 N965S ND 12 29F 0.005 0.005 - - 23 R1129H ND 13 30F 0.1 0.1 - - 5 R152Q ND 14 63F 0.1 0.1 - - 42 G1961E ND 15 36M 0.07 0.1 - +- 13 Q636H 42 G1961E 16 41F 0.005 0.005 - - 12 L514P/A1038V ND NS: Not screened; ND: Not detected + Normal macular pigment; +- Partial macular pigment; - Absent macular pigment absorption of infrared light in the center of the macula where maximum absorption of blue light occurs, implying that the macula pigments in this subject`s foveas are normal. Login to comment

[hide] Phenotypes of 16 Stargardt macular dystrophy/fundu... Graefes Arch Clin Exp Ophthalmol. 2002 Aug;240(8):628-38. Epub 2002 Jul 4. Gerth C, Andrassi-Darida M, Bock M, Preising MN, Weber BH, Lorenz B
Phenotypes of 16 Stargardt macular dystrophy/fundus flavimaculatus patients with known ABCA4 mutations and evaluation of genotype-phenotype correlation.
Graefes Arch Clin Exp Ophthalmol. 2002 Aug;240(8):628-38. Epub 2002 Jul 4., [PMID:12192456]

Abstract [show]
PURPOSE: To determine the phenotypic variability in patients with compound heterozygous or homozygous ABCA4 mutations, and to correlate the phenotypes with the functional properties of the altered protein. METHODS: Sixteen patients from 13 families with signs of Stargardt macular dystrophy/fundus flavimaculatus and known mutations on both alleles of the ABCA4 gene (15 compound heterozygous, one homozygous) were characterized by clinical examination, fundus autofluorescence, psychophysics (color vision, kinetic and two-color dark- and light-adapted static threshold perimetry), and electrophysiology (Ganzfeld, multifocal ERG, EOG). RESULTS: The homozygous 5917delG mutation resulted in the earliest disease manifestation (at 5 years) and a general cone-rod dysfunction, whereas the compound heterozygous mother (5917delG, G1961E) exhibited a very mild phenotype. Compound heterozygotes for the IVS40+5G-->A and the C1488Y or Y362X mutation showed also an early age of onset but only a central dysfunction. The effect of the 2588G-->C mutation, the G1961E mutation, and the complex mutation L541P-A1038V depended on the mutation in the second allele. Genotype-phenotype correlation appeared possible in most instances. Psychophysics revealed a simultaneous yet not necessarily congruent cone and rod dysfunction. CONCLUSIONS: The type and combination of ABCA4 mutations in compound heterozygous patients determined were compatible with the severity of the phenotype as to age of onset and the functional consequences in the majority of patients. Unexplained phenotypic differences indicate the influence of other factors. ABCA4 mutations result in cone and rod dysfunction. Different disease durations limit the power of presently available genotype-phenotype correlations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 Patients with the complex mutation L541P-A1038V Two patients were compound heterozygous for this complex mutation and a nonsense mutation (W855X, patient 4) as well as a mutation with bipartite outcome [2588G→C (G863A/G863del), patient 5]. Login to comment

[hide] Biochemical defects in retina-specific human ATP b... J Biol Chem. 2002 Jun 14;277(24):21759-67. Epub 2002 Mar 27. Suarez T, Biswas SB, Biswas EE
Biochemical defects in retina-specific human ATP binding cassette transporter nucleotide binding domain 1 mutants associated with macular degeneration.
J Biol Chem. 2002 Jun 14;277(24):21759-67. Epub 2002 Mar 27., [PMID:11919200]

Abstract [show]
The retina-specific human ABC transporter (ABCR) functions in the retinal transport system and has been implicated in several inherited visual diseases, including Stargardt disease, fundus flavimaculatus, cone-rod dystrophy, and age-related macular degeneration. We have previously described a general ribonucleotidase activity of the first nucleotide binding domain (NBD1) of human ABCR (Biswas, E. E. (2001) Biochemistry 40, 8181-8187). In this communication, we present a quantitative study analyzing the effects of certain disease-associated mutations, Gly-863 --> Ala, Pro-940 --> Arg, and Arg-943 --> Gln on the nucleotide binding, and general ribonucleotidase activities of this domain. NBD1 proteins, harboring these mutations, were created through in vitro site-specific mutagenesis and expressed in Escherichia coli. Results of the enzyme-kinetic studies indicated that these mutations altered the ATPase and CTPase activities of NBD1. The G863A and P940R mutations were found to have significant attenuation of the rates of nucleotide hydrolysis and binding affinities. On the other hand, the R943Q mutation had small, but detectable reduction in its nucleotidase activity and nucleotide binding affinity. We have measured the nucleotide binding affinities of NBD1 protein and its mutants quantitatively by fluorescence anisotropy changes during protein binding to ethenoadenosine ATP (epsilonATP), a fluorescent ATP analogue. We have correlated the dissociation constant (K(D)) and the rates of nucleotide hydrolysis (V(max)) of NBD1 and its mutants with the available genetic data for these mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 The G863A and P940R mutations were found to have significant attenuation of the rates of nucleotide hydrolysis and binding affinities. Login to comment
139 Equal amounts of cells before and after induction were analyzed by 5-18% SDS-PAGE followed by Coomassie Blue R-250 staining: lanes 1 and 2, BL21(DE3)/pET29aNBD1 wild-type cells before and after induction, respectively; lane 3, BL21(DE3)/pET29aNBD1/ G863A cells before induction, and after induction in lane 4; lanes 5 and 6, BL21(DE3)/pET29aNBD1/P940R cells before induction and after induction, respectively; lane 7, BL21(DE3)/pET29aNBD1/R943Q cells before induction and lane 8 after induction. Login to comment
141 Lane 1, wild-type NBD1 protein; lane 2, NBD1/G863A mutant protein; lane 3, NBD1/P940R mutant protein; and lane 4, NBD1/R943Q mutant protein. Login to comment
145 ATPase and CTPase activities of NBD1 wild-type and NBD1/G863A mutant proteins. Login to comment
146 A, comparison of ATP hydrolysis by NBD1wt and NBD1/G863A polypeptides. Login to comment
147 Protein titration of purified NBD1 wild-type and NBD1/G863A proteins in a standard ATPase assay was carried out as described under "Materials and Methods" at 37 °C for 60 min using the indicate amounts of protein and ATP concentration of 500 ␮M. B, CTP hydrolysis by wtNBD1 and NBD1/G863A. Login to comment
148 Protein titration of purified NBD1 wild-type and NBD1/G863A proteins in a standard CTPase assay was carried out as described under "Materials and Methods" at 37 °C for 60 min using the indicate amounts of protein and CTP concentration of 500 ␮M. C, time-course analysis of ATP hydrolysis. Standard ATP assays were carried out as described under "Materials and Methods" at 37 °C for the times indicated using [␣-32 P]ATP and 2.5 ␮g of purified NBD1 wild-type and NBD1/G863A proteins. Login to comment
149 NBD1 wild-type (Ⅺ) and G863A mutant (E). Login to comment
153 Consequences of the Gly-863 3 Ala Mutation on the ATPase/ CTPase Activity of NBD1 Protein-The ABCR mutation G863A is a commonly encountered mutation and has been reported in patients suffering from Stargardt disease (2, 9-11), age-related macular dystrophy (11), fundus flavimaculatus (5), and retinitis pigmentosa (10). Login to comment
155 The results presented in Fig. 3A indicated that the ATPase function of G863A mutant protein was reduced ϳ3-fold as compared with NBD1wt, indicating ϳ70% of inhibition of the ATPase activity. Login to comment
156 The Vmax (ATPase) for G863A mutant was 128 pmol/min/mg and that of the wild-type NBD1 was 584 pmol/min/mg (Table II). Login to comment
159 However, in the mutant G863A protein the CTPase activity was reduced (Fig. 3B). Login to comment
160 In this case, the CTP hydrolysis of G863A was reduced to ϳ30% of the activity of NDB1wt. Login to comment
161 The Vmax for G863A mutant was 104 pmol/min/mg and that of the wild-type NBD1 was 376 pmol/min/mg (Table II). Login to comment
180 The CTPase activity in the P940R mutant protein was reduced to 84 pmol/min/mg whereas the ATPase activity was diminished to 129 pmol/min/mg (Table II). Login to comment
183 The P940R mutation severely affected the NBD1 function, although unlike G863A, the degree of inhibition was different for ATP and CTP. Login to comment
196 In general, the G863A and P940R point mutations increased the Km values as follows: 80, 66 ␮M, respectively. Login to comment
197 The rate of ATP hydrolysis was also altered and the Vmax values were 392 (R943Q), 129 (G863A), and 128 (P940R) pmol/min/mg. Login to comment
198 This represented a 78% decrease in Vmax for the G863A and P940R mutants, whereas the Vmax for R943Q mutant was diminished by only 33%. Login to comment
211 The plots, shown in Fig. 7, were generated by TABLE II Thermodynamic and kinetic parameters of ATP binding and hydrolysis for wild-type and mutant NBD1 proteins Parameter Wild-type R943Q P940R G863A Enzyme kinetics Vmax (pmol/min/mg) ATP 584 392 129 128 CTP 376 172 84 104 ATP binding ⌬G ° (kcal/mol) -8.2 -8.6 -8.1 -7.6 KD (M) 9.9 ϫ 10-7 5 ϫ 10-7 1.2 ϫ10-6 2.7 ϫ 10-6 Inhibition (%) ATP 0 33 78 78 CTP 0 54 78 72 Disease severity - ϩ/- ϩϩ ϩϩ FIG. 6. Login to comment
219 NBD1 wild-type (Ⅺ), mutant G863A (E), mutant P940R (‚), and mutant R943Q (●). Login to comment
222 This nonlinear regression analysis gave dissociation constants (KD) for each of these proteins as follows: 9.9 ϫ 10-7 , 2.7 ϫ 10-6 , 1.2 ϫ 10-6 , and 5 ϫ 10-7 M, and ⌬G ϭ -8.2, -7.6, -8.1, and -8.6 kcal/mol for wild-type protein, G863A, P940R, and R943Q, respectively. Login to comment
223 Thus, the ATP binding affinity was impaired in the G863A mutant and to a lesser extent in the P940R mutant. Login to comment
231 We have generated a model for the NBD1 domain of ABCR (Fig. 9) using the Swiss-PDB and SYBYL6.7 homology-based protein structure modeling software to delineate the G863A, P940R, and R943Q mutations and analyze the possible structural implications on the wild-type NBD1 structure. Login to comment
243 Using refolded and highly purified and homogeneous preparations of wild-type, G863A, P940R, and R943Q NBD1 proteins (Fig. 2), we were able to examine the biochemical consequences of these mutations on the nucleotide binding and hydrolysis activity of FIG. 7. Login to comment
246 B, NBD1/G863A mutant (E). Login to comment
253 The data were fitted with BIOEQS using a simple binding model (monomer) for ⑀ATP binding to wild-type, G863A, P940R, and R943Q NBD1 proteins. Login to comment
263 The G863A mutation is a frequently occurring mutation and associated with a number of retinal diseases (Table I). Login to comment
265 The G863A mutation in the NBD1 polypeptide resulted in a ϳ70% decrease of the ATPase and CTPase activities of NBD1wt (Fig. 3). Login to comment
266 The rate of ATP hydrolysis was considerably decreased; the observed Vmax of ATPase activity for the G863A mutant was 128 pmol/min/mg. Login to comment
271 Protein titration analyses also showed that, although NBD1wt has ϳ3-fold higher CTPase than ATPase activity, the G863A appeared to affect the hydrolysis of both nucleotides to a similar extent. Login to comment
272 Consequently, the G863A mutation appeared to lead to a general defect in nucleotide hydrolysis. Login to comment
273 The P940R mutation in ABCR has been linked with exudative age-related macular degeneration (14), which is a severe form of AMD. Login to comment
274 We have carried out a detailed kinetic analysis of P940R mutant of NBD1. Login to comment
277 In general, both the G863A and P940R mutations were comparable in attenuating the nucleotidase activities. Login to comment
278 Perhaps the prevalence of the G863A mutation in the human population is much higher than the P940R, because exudative AMD is not a frequently encountered form of this disease, and as a result, the G863A mutation has been found to be associated with more common retinal diseases (44). Login to comment
279 The ATPase activity of the R943Q mutant protein was diminished, although the extent of diminution was not as great as that observed with G863A or P940R (Figs. 3-5, Table II). Login to comment
281 Overall, the enzymatic activity of mutants G863A and P940R was reduced more than that of the R943Q mutant, and the results on the nucleotide binding and hydrolysis correlate well with frequency and disease severity. Login to comment
282 Effects of G863A, P940R, and R943Q Mutations on the ⑀ATP Binding to NBD1 Protein-The biochemical effects in ATPase could be due to defects in nucleotide binding or hydrolysis or both. Login to comment
289 On the other hand, the dissociation constants for P940R and G863A pathogenic mutations were 1.2 ϫ 10-6 M and 2.7 ϫ 10-6 M, respectively. Login to comment
290 The overall order of nucleotide binding affinity was: R943Q Ͼ wild-type Ͼ P940R Ͼ G863A. Login to comment
291 The values for the free energy change involved in nucleotide binding (⌬G°) were as follows: -8.2 (wild-type), -8.6 (R943Q), -8.1 (P940R), and -7.6 (G863A) kcal/mole, respectively. Login to comment
300 Biochemical Defects in Mutants Appear to Be Related to the Disease Severity-According to our enzyme kinetic and fluorescence anisotropy results, the mutations that most severely affected both the ATPase activity and ⑀ATP binding of NBD1 were G863A and P940R. Login to comment
301 The G863A mutation has been reported as one of the most frequently observed mutations in STGD patients in North America (2) and Netherlands (12). Login to comment
303 The P940R appeared to have a significant defect in nucleotide hydrolysis similar to that observed with G863A mutation. Login to comment
310 The R943Q mutation has also been shown to occur in conjunction with G863A leading to a more severe pathogenic state in humans (45). Login to comment
136 Equal amounts of cells before and after induction were analyzed by 5-18% SDS-PAGE followed by Coomassie Blue R-250 staining: lanes 1 and 2, BL21(DE3)/pET29aNBD1 wild-type cells before and after induction, respectively; lane 3, BL21(DE3)/pET29aNBD1/ G863A cells before induction, and after induction in lane 4; lanes 5 and 6, BL21(DE3)/pET29aNBD1/P940R cells before induction and after induction, respectively; lane 7, BL21(DE3)/pET29aNBD1/R943Q cells before induction and lane 8 after induction. Login to comment
138 Lane 1, wild-type NBD1 protein; lane 2, NBD1/G863A mutant protein; lane 3, NBD1/P940R mutant protein; and lane 4, NBD1/R943Q mutant protein. Login to comment
142 ATPase and CTPase activities of NBD1 wild-type and NBD1/G863A mutant proteins. Login to comment
143 A, comparison of ATP hydrolysis by NBD1wt and NBD1/G863A polypeptides. Login to comment
144 Protein titration of purified NBD1 wild-type and NBD1/G863A proteins in a standard ATPase assay was carried out as described under "Materials and Methods" at 37 &#b0;C for 60 min using the indicate amounts of protein and ATP concentration of 500 òe;M. B, CTP hydrolysis by wtNBD1 and NBD1/G863A. Login to comment
150 Consequences of the Gly-863 3 Ala Mutation on the ATPase/ CTPase Activity of NBD1 Protein-The ABCR mutation G863A is a commonly encountered mutation and has been reported in patients suffering from Stargardt disease (2, 9-11), age-related macular dystrophy (11), fundus flavimaculatus (5), and retinitis pigmentosa (10). Login to comment
152 The results presented in Fig. 3A indicated that the ATPase function of G863A mutant protein was reduced b03;3-fold as compared with NBD1wt, indicating b03;70% of inhibition of the ATPase activity. Login to comment
157 In this case, the CTP hydrolysis of G863A was reduced to b03;30% of the activity of NDB1wt. Login to comment
158 The Vmax for G863A mutant was 104 pmol/min/mg and that of the wild-type NBD1 was 376 pmol/min/mg (Table II). Login to comment
193 In general, the G863A and P940R point mutations increased the Km values as follows: 80, 66 òe;M, respectively. Login to comment
194 The rate of ATP hydrolysis was also altered and the Vmax values were 392 (R943Q), 129 (G863A), and 128 (P940R) pmol/min/mg. This represented a 78% decrease in Vmax for the G863A and P940R mutants, whereas the Vmax for R943Q mutant was diminished by only 33%. Login to comment
207 The plots, shown in Fig. 7, were generated by TABLE II Thermodynamic and kinetic parameters of ATP binding and hydrolysis for wild-type and mutant NBD1 proteins Parameter Wild-type R943Q P940R G863A Enzyme kinetics Vmax (pmol/min/mg) ATP 584 392 129 128 CTP 376 172 84 104 ATP binding èc;G &#b0; (kcal/mol) afa;8.2 afa;8.6 afa;8.1 afa;7.6 KD (M) 9.9 afb; 10afa;7 5 afb; 10afa;7 1.2 afb;10afa;6 2.7 afb; 10afa;6 Inhibition (%) ATP 0 33 78 78 CTP 0 54 78 72 Disease severity afa; af9;/afa; af9;af9; af9;af9; FIG. 6. Login to comment
215 NBD1 wild-type (ǧa;), mutant G863A (E), mutant P940R (Éa;), and mutant R943Q (cf;). Login to comment
218 This nonlinear regression analysis gave dissociation constants (KD) for each of these proteins as follows: 9.9 afb; 10afa;7 , 2.7 afb; 10afa;6 , 1.2 afb; 10afa;6 , and 5 afb; 10afa;7 M, and èc;G afd; afa;8.2, afa;7.6, afa;8.1, and afa;8.6 kcal/mol for wild-type protein, G863A, P940R, and R943Q, respectively. Login to comment
227 We have generated a model for the NBD1 domain of ABCR (Fig. 9) using the Swiss-PDB and SYBYL6.7 homology-based protein structure modeling software to delineate the G863A, P940R, and R943Q mutations and analyze the possible structural implications on the wild-type NBD1 structure. Login to comment
239 Using refolded and highly purified and homogeneous preparations of wild-type, G863A, P940R, and R943Q NBD1 proteins (Fig. 2), we were able to examine the biochemical consequences of these mutations on the nucleotide binding and hydrolysis activity of FIG. 7. Login to comment
242 B, NBD1/G863A mutant (E). Login to comment
249 The data were fitted with BIOEQS using a simple binding model (monomer) for ঈATP binding to wild-type, G863A, P940R, and R943Q NBD1 proteins. Login to comment
259 The G863A mutation is a frequently occurring mutation and associated with a number of retinal diseases (Table I). Login to comment
261 The G863A mutation in the NBD1 polypeptide resulted in a b03;70% decrease of the ATPase and CTPase activities of NBD1wt (Fig. 3). Login to comment
262 The rate of ATP hydrolysis was considerably decreased; the observed Vmax of ATPase activity for the G863A mutant was 128 pmol/min/mg. Login to comment
267 Consequently, the G863A mutation appeared to lead to a general defect in nucleotide hydrolysis. Login to comment
276 Overall, the enzymatic activity of mutants G863A and P940R was reduced more than that of the R943Q mutant, and the results on the nucleotide binding and hydrolysis correlate well with frequency and disease severity. Login to comment
284 On the other hand, the dissociation constants for P940R and G863A pathogenic mutations were 1.2 afb; 10afa;6 M and 2.7 afb; 10afa;6 M, respectively. Login to comment
285 The overall order of nucleotide binding affinity was: R943Q b0e; wild-type b0e; P940R b0e; G863A. Login to comment
286 The values for the free energy change involved in nucleotide binding (èc;G&#b0;) were as follows: afa;8.2 (wild-type), afa;8.6 (R943Q), afa;8.1 (P940R), and afa;7.6 (G863A) kcal/mole, respectively. Login to comment
295 Defects in ABCR NBD1 Mutants Associated with Macular Degeneration Biochemical Defects in Mutants Appear to Be Related to the Disease Severity-According to our enzyme kinetic and fluorescence anisotropy results, the mutations that most severely affected both the ATPase activity and ঈATP binding of NBD1 were G863A and P940R. Login to comment
296 The G863A mutation has been reported as one of the most frequently observed mutations in STGD patients in North America (2) and Netherlands (12). Login to comment
298 The P940R appeared to have a significant defect in nucleotide hydrolysis similar to that observed with G863A mutation. Login to comment
305 The R943Q mutation has also been shown to occur in conjunction with G863A leading to a more severe pathogenic state in humans (45). Login to comment

[hide] Alterations of slow and fast rod ERG signals in pa... Invest Ophthalmol Vis Sci. 2002 Apr;43(4):1248-56. Scholl HP, Besch D, Vonthein R, Weber BH, Apfelstedt-Sylla E
Alterations of slow and fast rod ERG signals in patients with molecularly confirmed Stargardt disease type 1.
Invest Ophthalmol Vis Sci. 2002 Apr;43(4):1248-56., [PMID:11923272]

Abstract [show]
PURPOSE: To investigate the slow and fast rod signals of the scotopic 15-Hz flicker ERG in patients with molecularly confirmed Stargardt disease type I (STGD1). There is evidence that these slow and the fast rod ERG signals can be attributed to the rod bipolar-AII cell pathway and the rod-cone coupling pathway, respectively. METHODS: Twenty-seven patients with STGD1 with mutations in both alleles of the ABCA4 gene were included. Scotopic ERG response amplitudes and phases to flicker intensities ranging from -3.37 to -0.57 log scotopic troland x sec (log scot td x sec) were measured at a flicker frequency of 15 Hz. In addition, scotopic standard ERGs were obtained. Twenty-two normal subjects served as controls. RESULTS: The amplitudes of both the slow and fast rod ERG signals were significantly reduced in the STGD1 group. The phases of the slow rod signals lagged significantly, whereas those of the fast rod signals did not. The standard scotopic ERG did not reveal significant alterations. CONCLUSIONS: The results provide evidence that a defective ABCA4 transporter can functionally affect both the rod bipolar-AII cell pathway and the rod-cone coupling pathway. In STGD1, the scotopic 15-Hz flicker ERG may reveal subtle abnormalities at different sites within the rod system that remain undetected by standard ERG techniques.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
200 A recent functional study has supported this view and shown that the two products of the 2588G3C mutation, G863A and delG863, produce a substantially impaired and a mildly impaired protein, respectively.61 Genetically, our STGD1 study group therefore appears to be relatively uniform, in the sense that in none of the patients there were two protein-truncating disease alleles. Login to comment

[hide] The ABCA4 2588G>C Stargardt mutation: single origi... Eur J Hum Genet. 2002 Mar;10(3):197-203. Maugeri A, Flothmann K, Hemmrich N, Ingvast S, Jorge P, Paloma E, Patel R, Rozet JM, Tammur J, Testa F, Balcells S, Bird AC, Brunner HG, Hoyng CB, Metspalu A, Simonelli F, Allikmets R, Bhattacharya SS, D'Urso M, Gonzalez-Duarte R, Kaplan J, te Meerman GJ, Santos R, Schwartz M, Van Camp G, Wadelius C, Weber BH, Cremers FP
The ABCA4 2588G>C Stargardt mutation: single origin and increasing frequency from South-West to North-East Europe.
Eur J Hum Genet. 2002 Mar;10(3):197-203., [PMID:11973624]

Abstract [show]
Inherited retinal dystrophies represent the most important cause of vision impairment in adolescence, affecting approximately 1 out of 3000 individuals. Mutations of the photoreceptor-specific gene ABCA4 (ABCR) are a common cause of retinal dystrophy. A number of mutations have been repeatedly reported for this gene, notably the 2588G>C mutation which is frequent in both patients and controls. Here we ascertained the frequency of the 2588G>C mutation in a total of 2343 unrelated random control individuals from 11 European countries and 241 control individuals from the US, as well as in 614 patients with STGD both from Europe and the US. We found an overall carrier frequency of 1 out of 54 in Europe, compared with 1 out of 121 in the US, confirming that the 2588G>C ABCA4 mutation is one of the most frequent autosomal recessive mutations in the European population. Carrier frequencies show an increasing gradient in Europe from South-West to North-East. The lowest carrier frequency, 0 out of 199 (0%), was found in Portugal; the highest, 11 out of 197 (5.5%), was found in Sweden. Haplotype analysis in 16 families segregating the 2588G>C mutation showed four intragenic polymorphisms invariably present in all 16 disease chromosomes and sharing of the same allele for several markers flanking the ABCA4 locus in most of the disease chromosomes. These results indicate a single origin of the 2588G>C mutation which, to our best estimate, occurred between 2400 and 3000 years ago.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
17 Recently, functional studies23 clearly demonstrated that both the DG863 and G863A variant impair ABCR protein function. Login to comment
80 As mentioned before, functional studies have shown unequivocally a biochemical defect for both the G863A and the DG863 variants of the ABCR protein. Login to comment
79 As mentioned before, functional studies have shown unequivocally a biochemical defect for both the G863A and the DG863 variants of the ABCR protein. Login to comment

[hide] Differential occurrence of mutations causative of ... Hum Mutat. 2002 Mar;19(3):189-208. Pang CP, Lam DS
Differential occurrence of mutations causative of eye diseases in the Chinese population.
Hum Mutat. 2002 Mar;19(3):189-208., [PMID:11857735]

Abstract [show]
Ethnic differences and geographic variations affect the frequencies and nature of human mutations. In the literature, descriptions of causative mutations of eye diseases in the Chinese population are few. In this paper we attempt to reveal molecular information on genetic eye diseases involving Chinese patients from published and unpublished works by us and other groups. Our studies on candidate genes of eye diseases in the Chinese population in Hong Kong include MYOC and TISR for primary open angle glaucoma, RHO and RP1 for retinitis pigmentosa, ABCA4 and APOE for age-related macular degeneration, RB1 for retinoblastoma, APC for familial adenomatous polyposis with congenital hypertrophy of retinal pigment epithelium, BIGH3/TGFBI for corneal dystrophies, PAX6 for aniridia and Reiger syndrome, CRYAA and CRYBB2 for cataracts, and mtDNA for Leber hereditary optic neuropathy. We have revealed novel mutations in most of these genes, and in RHO, RP1, RB1, BIGH3, and PAX6 we have reported mutations that contribute to better understanding of the functions and properties of the respective gene products. We showed absence of MYOC does not necessarily cause glaucoma. No disease causative mutations have been identified in MYOC or ABCA4. There are similarities in the patterns of sequence alterations and phenotype-genotype associations in comparison with other ethnic groups, while the MYOC, RB1, APC, and PAX6 genes have more Chinese-specific sequence alterations. Establishment of a mutation database specific for the Chinese is essential for identification of genetic markers with diagnostic, prognostic, or pharmacological values.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
162 G1961E, G863A/delG863, and A1038V together account for about 10% of ABCA4 mutations in Caucasians. Login to comment
163 G863A/delG863 is likely to harbor founder effects [Maugeri et al., 1999]. Login to comment

[hide] Cosegregation and functional analysis of mutant AB... Hum Mol Genet. 2001 Nov 1;10(23):2671-8. Shroyer NF, Lewis RA, Yatsenko AN, Wensel TG, Lupski JR
Cosegregation and functional analysis of mutant ABCR (ABCA4) alleles in families that manifest both Stargardt disease and age-related macular degeneration.
Hum Mol Genet. 2001 Nov 1;10(23):2671-8., [PMID:11726554]

Abstract [show]
Mutations in ABCR (ABCA4) have been reported to cause a spectrum of autosomal recessively inherited retinopathies, including Stargardt disease (STGD), cone-rod dystrophy and retinitis pigmentosa. Individuals heterozygous for ABCR mutations may be predisposed to develop the multifactorial disorder age-related macular degeneration (AMD). We hypothesized that some carriers of STGD alleles have an increased risk to develop AMD. We tested this hypothesis in a cohort of families that manifest both STGD and AMD. With a direct-sequencing mutation detection strategy, we found that AMD-affected relatives of STGD patients are more likely to be carriers of pathogenic STGD alleles than predicted based on chance alone. We further investigated the role of AMD-associated ABCR mutations by testing for expression and ATP-binding defects in an in vitro biochemical assay. We found that mutations associated with AMD have a range of assayable defects ranging from no detectable defect to apparent null alleles. Of the 21 missense ABCR mutations reported in patients with AMD, 16 (76%) show abnormalities in protein expression, ATP-binding or ATPase activity. We infer that carrier relatives of STGD patients are predisposed to develop AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
114 Sun et al. (28) reported substantial defects in protein expression or ATP binding of eight AMD-associated mutations (R212C, G863A, A1038V, R1108C, R1129L, P1380L, G1961E and L2027F) and an abnormal increase in the ATPase activity of the D2177N mutation, and they reported mild defects or wild-type activity within the sensitivity of the assay in four other AMD-associated variants (E471K, C1488R, T1526M and R1898H). Login to comment

[hide] Null missense ABCR (ABCA4) mutations in a family w... Invest Ophthalmol Vis Sci. 2001 Nov;42(12):2757-61. Shroyer NF, Lewis RA, Yatsenko AN, Lupski JR
Null missense ABCR (ABCA4) mutations in a family with stargardt disease and retinitis pigmentosa.
Invest Ophthalmol Vis Sci. 2001 Nov;42(12):2757-61., [PMID:11687513]

Abstract [show]
PURPOSE: To determine the type of ABCR mutations that segregate in a family that manifests both Stargardt disease (STGD) and retinitis pigmentosa (RP), and the functional consequences of the underlying mutations. METHODS: Direct sequencing of all 50 exons and flanking intronic regions of ABCR was performed for the STGD- and RP-affected relatives. RNA hybridization, Western blot analysis, and azido-adenosine triphosphate (ATP) labeling was used to determine the effect of disease-associated ABCR mutations in an in vitro assay system. RESULTS: Compound heterozygous missense mutations were identified in patients with STGD and RP. STGD-affected individual AR682-03 was compound heterozygous for the mutation 2588G-->C and a complex allele, [W1408R; R1640W]. RP-affected individuals AR682-04 and-05 were compound heterozygous for the complex allele [W1408R; R1640W] and the missense mutation V767D. Functional analysis of the mutation V767D by Western blot and ATP binding revealed a severe reduction in protein expression. In vitro analysis of ABCR protein with the mutations W1408R and R1640W showed a moderate effect of these individual mutations on expression and ATP-binding; the complex allele [W1408R; R1640W] caused a severe reduction in protein expression. CONCLUSIONS: These data reveal that missense ABCR mutations may be associated with RP. Functional analysis reveals that the RP-associated missense ABCR mutations are likely to be functionally null. These studies of the complex allele W1408R; R1640W suggest a synergistic effect of the individual mutations. These data are congruent with a model in which RP is associated with homozygous null mutations and with the notion that severity of retinal disease is inversely related to residual ABCR activity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 Sequencing of STGD1-affected proband AR682-03 revealed three ABCR mutations: the transition 4222T3C that encodes the missense substitution W1408R, the transition 4918C3T that results in the missense substitution R1640W, and the transversion 2588G3C that gives rise to equal amounts of proteins with either a deletion of glycine at residue 863 or the missense substitution G863A (Fig. 2, Table 1).10,15,16 Sequencing of her RP-affected paternal grandmother, AR682-04, also revealed three ABCR mutations: the missense substitutions W1408R and R1640W and a transversion 2300T3A that encodes the missense substitution V767D (Fig. 2, Table 1).17 Direct DNA sequencing of all members of pedigree AR682 for the exons corresponding to these mutations revealed segregation of the mutation 2588G3C from the maternal lineage and the complex allele [W1408R; R1640W] from the paternal lineage; the mutation V767D was identified only in the two RP-affected individuals (Fig. 2). Login to comment
100 For brevity, the mutation 2588G3C was denoted G863A. Login to comment
102 ABCR Alterations in Patients with Stargardt Disease and Retinitis Pigmentosa Exon Nucleotide Amino Acid AR682-03 AR682-04 3 302ϩ26 A/A A/G 10 1268G 3 A H423R A/A A/G 1356ϩ11delG 6G/6G 6G/7G 15 2300T 3 A V767D T/T T/A 17 2588G 3 C G863A G/C G/G 19 2828G 3 A R943Q G/A G/G 24 3523-30 A/T A/T 28 4203C 3 A P1401P C/A C/C 4222T 3 C W1408R C/T C/T 33 4667ϩ48 C/T T/T 35 4918C 3 T R1640W C/T C/T 40 5585-70 C/T T/T 5603A 3 T N1868I A/T A/A 5682G 3 C L1894L G/C G/G Mutations are indicated in bold. Login to comment
115 The 2588G3C alteration in STGD1 patient AR682-03 has been observed previously in 26 unrelated patients with STGD1 and has been classified as a mild mutant allele based on its association with later onset disease and its pairing with presumed severe alleles in patients with STGD1.10,15,19 In addition, we observed the polymorphism 2828G3A in cis to the 2588G3C alteration, consistent with linkage disequilibrium between these two alterations, as reported previously.15,19 The effects of the mutation 2588G3C have been studied by Sun et al.,12 who report a moderate reduction in expression of the G863A mutant protein and a modest reduction in ATP-binding for the G863del variant of the 2588G3C mutation. Login to comment
75 Sequencing of STGD1-affected proband AR682-03 revealed three ABCR mutations: the transition 4222T3C that encodes the missense substitution W1408R, the transition 4918C3T that results in the missense substitution R1640W, and the transversion 2588G3C that gives rise to equal amounts of proteins with either a deletion of glycine at residue 863 or the missense substitution G863A (Fig. 2, Table 1).10,15,16 Sequencing of her RP-affected paternal grandmother, AR682-04, also revealed three ABCR mutations: the missense substitutions W1408R and R1640W and a transversion 2300T3A that encodes the missense substitution V767D (Fig. 2, Table 1).17 Direct DNA sequencing of all members of pedigree AR682 for the exons corresponding to these mutations revealed segregation of the mutation 2588G3C from the maternal lineage and the complex allele [W1408R; R1640W] from the paternal lineage; the mutation V767D was identified only in the two RP-affected individuals (Fig. 2). Login to comment
99 For brevity, the mutation 2588G3C was denoted G863A. Login to comment
101 ABCR Alterations in Patients with Stargardt Disease and Retinitis Pigmentosa Exon Nucleotide Amino Acid AR682-03 AR682-04 3 302af9;26 A/A A/G 10 1268G 3 A H423R A/A A/G 1356af9;11delG 6G/6G 6G/7G 15 2300T 3 A V767D T/T T/A 17 2588G 3 C G863A G/C G/G 19 2828G 3 A R943Q G/A G/G 24 3523-30 A/T A/T 28 4203C 3 A P1401P C/A C/C 4222T 3 C W1408R C/T C/T 33 4667af9;48 C/T T/T 35 4918C 3 T R1640W C/T C/T 40 5585-70 C/T T/T 5603A 3 T N1868I A/T A/A 5682G 3 C L1894L G/C G/G Mutations are indicated in bold. Login to comment
114 The 2588G3C alteration in STGD1 patient AR682-03 has been observed previously in 26 unrelated patients with STGD1 and has been classified as a mild mutant allele based on its association with later onset disease and its pairing with presumed severe alleles in patients with STGD1.10,15,19 In addition, we observed the polymorphism 2828G3A in cis to the 2588G3C alteration, consistent with linkage disequilibrium between these two alterations, as reported previously.15,19 The effects of the mutation 2588G3C have been studied by Sun et al.,12 who report a moderate reduction in expression of the G863A mutant protein and a modest reduction in ATP-binding for the G863del variant of the 2588G3C mutation. Login to comment

[hide] Mutational scanning of the ABCR gene with double-g... Hum Genet. 2001 Sep;109(3):326-38. Fumagalli A, Ferrari M, Soriani N, Gessi A, Foglieni B, Martina E, Manitto MP, Brancato R, Dean M, Allikmets R, Cremonesi L
Mutational scanning of the ABCR gene with double-gradient denaturing-gradient gel electrophoresis (DG-DGGE) in Italian Stargardt disease patients.
Hum Genet. 2001 Sep;109(3):326-38., [PMID:11702214]

Abstract [show]
Mutations in the retina-specific ABC transporter (ABCR) gene are responsible for autosomal recessive Stargardt disease (arSTGD). Mutation detection efficiency in ABCR in arSTGD patients ranges between 30% and 66% in previously published studies, because of high allelic heterogeneity and technical limitations of the employed methods. Conditions were developed to screen the ABCR gene by double-gradient denaturing-gradient gel electrophoresis. The efficacy of this method was evaluated by analysis of DNA samples with previously characterized ABCR mutations. This approach was applied to mutation detection in 44 Italian arSTGD patients corresponding to 36 independent genomes, in order to assess the nature and frequency of the ABCR mutations in this ethnic group. In 34 of 36 (94.4%) STGD patients, 37 sequence changes were identified, including 26 missense, six frameshift, three splicing, and two nonsense variations. Among these, 20 had not been previously described. Several polymorphisms were detected in affected individuals and in matched controls. Our findings extend the spectrum of mutations identified in STGD patients and suggest the existence of a subset of molecular defects specific to the Italian population. The identification of at least two disease-associated mutations in four healthy control individuals indicates a higher than expected carrier frequency of variant ABCR alleles in the general population. Genotype-phenotype analysis in our series showed a possible correlation between the nature and location of some mutations and specific ophthalmoscopic features of STGD disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 DNA samples (n=22) carrying previously identified mutations in the ABCR gene were employed as controls for evaluating the efficacy of the DG-DGGE approach in detecting sequence variations R572Q (Lewis et al. 1999), Y639X (Lewis et al. 1999), G863A (Lewis et al. 1999; Maugeri et al. 1999), A1038V (Rozet et al. 1998), T1019M (Rozet et al. 1998), 3211insGT (Lewis et al. 1999), P1380L (Lewis et al. 1999), H1406Y (Lewis et al. 1999), 4947delC (Lewis et al. 1999), H1838Y (Lewis et al. 1999), 5714+5G→A (Cremers et al. 1998), N1868I (De La Paz et al. 1999), L1938L (Rivera et al. 2000), G1961E (Allikmets et al. 1997a, 1997b), L1970F (Lewis et al. 1999), L2027F (Nasonkin et al. 1998), V2050L (Lewis et al. 1999), E2131K (Lewis et al. 1999), R2139W (Lewis et al. 1999), 6709insG (Lewis et al. 1999), D2177N (Allikmets et al. 1997a, 1997b), 2181del12 (Lewis et al. 1999). Login to comment

[hide] Mutations in ABCR (ABCA4) in patients with Stargar... Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36. Briggs CE, Rucinski D, Rosenfeld PJ, Hirose T, Berson EL, Dryja TP
Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.
Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36., [PMID:11527935]

Abstract [show]
PURPOSE: To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). METHODS: One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. RESULTS: The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. CONCLUSIONS: This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Specifically, Leu541Pro, Pro1380Leu, Gly1961Glu, and Leu2027Phe were not identified in any of the control individuals (P Ͻ 0.04). Login to comment
64 Gly863Ala was detected in 9 of 252 patient alleles and 2 of 380 normal control alleles tested (P ϭ 0.009), and it was also considered pathogenic. Login to comment
89 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 ϩ 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 ϩ 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 ϩ 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 ϩ 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 ϩ 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 ϩ 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. Login to comment
91 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 071-002 Leu2035Pro CTT 3 CCT Het None 032-064 Val2050Leu5 GTT 3 CTT Het None 032-061 Arg2107His18 CGC 3 CAC Het None 032-018 Arg2107Cys CGC 3 TGC Het Arg152Ter 032-084 Arg2139Trp CGG 3 TGG Het Thr1525Met 007-009* Gly2146Asp GGC 3 GAC Het None 032-045 Cys2150Tyr16 TGT 3 TGC Hom None 034-036 Cys2150Arg TGT 3 CGT Het Gly863Ala 034-026 Deletion Lys13-Trp15 38del9 [AGAACTGGA] Het None 034-037 Deletion Lys13-Trp15 38del9 [AGAACTGGA] Het None Polymorphisms and Rare Variants Sequence Change Alleles Among 126 Patients (n) Alleles Among Controls (n) P† 6 Nonpathogenic Missense Changes Arg212His23 CGC 3 CAC 8 10/(188) 0.3 His423Arg23 CAC 3 CGC 34 14/(178) 0.09 Arg943Gln27 CGG 3 CAG 15 9/(190) 0.7 Ala1637Thr GCC 3 ACC 1 - Not determined Asn1868Ile21 AAT 3 ATT 41 50/(170) 0.002 Pro1948Leu21 CCA 3 CTA 10 4/(190) 0.4 35 Intron and Isocoding Changes Pro47Pro CCG 3 CCA - IVS3 - 71delA - IVS3 ϩ 20C 3 T - IVS3 ϩ 26A 3 G - IVS3 ϩ 92A 3 G - IVS6 - 32T 3 C23 Thr311Thr ACC 3 ACT - IVS9 - 14C 3 T - IVS10 ϩ 6insC - IVS10 ϩ 11delG Ala626Ala GCG 3 GCA Leu988Leu CTC 3 CTT - IVS22 - 34A 3 G Pro1401Pro21 CCC 3 CCA - IVS32 - 38C 3 T23 - IVS32 - 15C 3 T - IVS33 - 16delGT23 - IVS35 - 32G 3 A - IVS38 - 50delA - IVS38 - 10T 3 C - IVS39 ϩ 6del12 [TGGTAGCCGAGG]: ins11 [CGGTCGAGGGC] - IVS40 - 25A 3 C Leu1894Leu21 CTG 3 CTC - IVS41 - 10A 3 G Leu1938Leu23 TTA 3 TTG Pro1948Pro21 CCA 3 CCG Ile2023Ile ATC 3 ATT Ile2083Ile27 ATC 3 ATT - IVS45 ϩ 7G 3 A32 Asp2095Asp21 GAT 3 GAC - IVS48 ϩ 21 C 3 T - IVS48 - 3 T 3 C - IVS49 - 85 C 3 T - IVS49 ϩ 28 G 3 C Val2244Val GTG 3 GTA References for previously reported changes are indicated in superscript in the first column (for exon sequence changes) or the second column (for intron sequence changes). Login to comment
116 Nucleotide 2588G 3C (Gly863Ala) and Nucleotide 2828G3A (Arg943Gln) One likely pathogenic missense change, Gly863Ala, was frequently associated with a presumed nonpathogenic missense change, Arg943Gln. Login to comment
117 In fact, all 9 patients who were heterozygous carriers of Gly863Ala also carried Arg943Gln. Login to comment
118 Maugeri et al.21 also found an association between the Gly863Ala and Arg943Gln changes, but they were unable to determine whether Gly863Ala by itself was pathogenic. Login to comment
119 In our study, the Arg943Gln change was present in five other patients without Gly863Ala, and it was present without Gly863Ala in 9 of 190 control alleles. Login to comment
120 In addition, a recently reported evaluation of the Gly863Ala mutant protein has shown that it has abnormal function in vitro.26 Taken together, these results indicate that Gly863Ala by itself is likely to be pathogenic and Arg943Gln by itself is not. Login to comment
121 Seven of the nine patients with Stargardt disease who were carrying Gly863Ala heterozygously also carried another missense change. Login to comment
123 Two patients who were heterozygous for the Gly863Ala allele had no other detectable changes likely to be pathogenic. Login to comment
145 Of the eight patients carrying Gly863Ala reported by Maugeri et al.,21 five were compound heterozygotes with a null mutation affecting the other allele. Login to comment
146 This led to speculation that the Gly863Ala sequence change is only pathogenic when present in TABLE 2. Login to comment
88 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 af9; 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 af9; 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 af9; 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 af9; 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 af9; 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 af9; 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None IOVS, September 2001, Vol. 42, No. 10 ABCR in Stargardt Macular Degeneration Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. 10 TABLE 1 (continued). Login to comment
113 Nucleotide 2588G 3C (Gly863Ala) and Nucleotide 2828G3A (Arg943Gln) One likely pathogenic missense change, Gly863Ala, was frequently associated with a presumed nonpathogenic missense change, Arg943Gln. Login to comment
114 In fact, all 9 patients who were heterozygous carriers of Gly863Ala also carried Arg943Gln. Login to comment
115 Maugeri et al.21 also found an association between the Gly863Ala and Arg943Gln changes, but they were unable to determine whether Gly863Ala by itself was pathogenic. Login to comment
142 Of the eight patients carrying Gly863Ala reported by Maugeri et al.,21 five were compound heterozygotes with a null mutation affecting the other allele. Login to comment
143 This led to speculation that the Gly863Ala sequence change is only pathogenic when present in TABLE 2. Login to comment

[hide] L- and M-cone-driven electroretinograms in Stargar... Invest Ophthalmol Vis Sci. 2001 May;42(6):1380-9. Scholl HP, Kremers J, Vonthein R, White K, Weber BH
L- and M-cone-driven electroretinograms in Stargardt's macular dystrophy-fundus flavimaculatus.
Invest Ophthalmol Vis Sci. 2001 May;42(6):1380-9., [PMID:11328755]

Abstract [show]
PURPOSE: To study the dynamics of the long (L)- and middle (M)-wavelength-sensitive cone-driven pathways and their interactions in patients with Stargardt's macular dystrophy-fundus flavimaculatus (SMD-FF) and to correlate them with other clinical parameters and individual genotypes. METHODS: Forty-seven patients with SMD-FF participated in the study. In addition to standard 30-Hz flicker electroretinograms (30-Hz fERG), ERG responses were measured to stimuli that modulated exclusively the L or the M cones (L/M cones) or the two simultaneously. Blood samples were screened for mutations in the 50 exons of the ABCA4 gene. RESULTS: Patients with SMD-FF did not show a decrease in the mean L/M-cone-driven ERG sensitivity, but there was a significant increase in the interindividual variability. The mean L-/M-cone weighting ratio was normal. However, the L-cone-driven ERG was significantly phase delayed, whereas the M-cone-driven ERG was significantly phase advanced. These phase changes were significantly correlated with disease duration. The amplitude and implicit time of the standard 30-Hz fERG both correlated significantly with the L/M-cone-driven ERG sensitivity and with the phase difference between the L/M-cone-driven ERGs, indicating the complex origin of the standard 30-Hz fERG. Probable disease-associated mutations in the ABCA4 gene were found in 40 of 45 patients, suggesting that they form a genetically fairly uniform SMD-FF study group. There was no correlation between the genotype and the L/M-cone-driven ERGS: CONCLUSIONS: The changes in L/M-cone-driven ERG sensitivity and phase possibly represent two independent disease processes. The phase changes are similar to those found in patients with retinitis pigmentosa and possibly are a general feature of retinal dystrophies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Characteristics of the Patients with SMD-FF Patient Sex Age (y) Age at Onset (y) VA CFC DF CV Exon (1) Mut (1) Exon (2) Mut (2) 1 M 32 29 0.6 Moderate ϩ Normal 48 L2241V NF 2 F 39 23 0.4 Moderate - Chaotic 14 W663X 42 G1961E 3 M 34 16 0.1 Moderate ϩ - 42 G1961E NF 4 M 49 17 0.1 Severe ϩ NP 6 G768T/splice 42 G1961E 5 F 36 35 0.6 Moderate ϩ VS (T) 6 C230S 42 G1961E 6 M 28 17 0.1 Mild ϩϩ INS 40 R1898H 43 G1975R 7 M 20 9 0.05 Moderate ϩϩ VS (P/D) 12 ϩ 21 L541P ϩ A1038V 40 IVS40 ϩ 5G 3 A 8 M 33 6 0.1 Mild - Chaotic NF NF 9 M 39 29 0.2 Moderate ϩ VS (P/D) 13 G607R 42 G1961E 10 M 38 22 0.1 Severe ϩ Chaotic NF NF 11 F 28 20 0.7 Mild ϩϩ INS 3 A60T 40 R1898H 12 M 46 30 0.5 Mild ϩ Chaotic 11 E471K 42 G1961E 13 F 25 11 0.1 Moderate ϩϩ S 17 G863A NF 14 F 51 41 0.8 Moderate ϩϩ NP 40 R1898H NF 15 F 23 17 0.1 Mild - Chaotic 3 P68L 36 S1689P 16 F 33 30 0.4 Mild - Chaotic 28 E1399K 42 G1961E 17 F 41 36 0.1 Severe ϩ VS (T) 29 F1440V 37 G1748R 18 M 59 54 0.1 Severe ϩ VS (P/D) 42 G1961E NF 19* M 35 15 0.05 Moderate ϩ Chaotic 17 G863A 37 Q1750X 20* M 43 14 HM Severe ϩϩ NP 17 G863A 37 Q1750X 21 F 46 16 0.1 Moderate ϩ NP NF NF 22 F 32 22 0.05 Moderate ϩ INS 21 A1038V NF 23 M 50 42 0.3 Severe ϩϩ VS (P/D) 12 ϩ 21 L541P ϩ A1038V 17 G863A 24 F 30 14 0.1 Moderate ϩϩ INS 17 G863A 40 IVS40 ϩ 5G 3 A 25 M 36 25 0.5 Moderate ϩϩ - 3 296INSA 21 A1038V 26 M 40 23 0.2 Moderate ϩ S 3 296INSA 42 G1961E 27 F 35 9 0.1 Severe ϩϩ VS (P/D) 22 R1108C NF 28 F 23 18 0.05 Mild ϩϩ S 28 E1399K 43 G1977S 29 F 25 18 0.2 Mild ϩ Chaotic 37 L1763P NF 30 F 16 11 0.1 Moderate ϩ Chaotic 22 R1108C NF 31 M 40 35 0.1 Moderate ϩϩ VS (P/D) 14 R681X NF 32 F 28 27 0.1 Moderate ϩ S 12 ϩ 21 L541P ϩ A1038V 21 A1038V 33 M 32 9 0.05 Severe ϩϩ Chaotic 28 Q1412X 45 R2077W 34 F 23 21 0.2 Moderate ϩ INS 6 G768T/splice NF 35 F 38 33 FC Moderate - Chaotic 17 G863A NF 36 F 39 10 HM Severe ϩϩ NP NF NF 37 F 13 8 0.1 Moderate ϩϩ S - - 38 F 27 25 0.2 Moderate ϩ Chaotic 17 G863A 28 Q1412X 39 M 16 15 0.1 Moderate ϩ VS (P/D) 12 ϩ 17 R572Q ϩ G863A 35 IVS35 ϩ 2T 3 A 40 M 27 26 0.6 Moderate - S 17 G863A NF 41 M 18 16 0.2 Moderate ϩ - - - 42 M 25 24 0.1 Mild - - NF NF 43 F 29 9 0.1 Moderate ϩ Chaotic 12 ϩ 21 L541P ϩ A1038V 42 G1961E 44 M 39 28 0.1 Mild - NP 6 N247S NF 45 F 23 12 0.05 Mild - NP 6 R212C 19 T959I 46 M 43 36 0.2 Moderate ϩ VS (P/D) 21 A1038V NF 47 M 21 18 0.4 Mild ϩϩ INS 28 Q1412X NF Shown are age at examination, age of onset, visual acuity, central fundus changes, and existence and distribution of the typical white-yellow flecks. Login to comment
44 Characteristics of the Patients with SMD-FF Patient Sex Age (y) Age at Onset (y) VA CFC DF CV Exon (1) Mut (1) Exon (2) Mut (2) 1 M 32 29 0.6 Moderate af9; Normal 48 L2241V NF 2 F 39 23 0.4 Moderate afa; Chaotic 14 W663X 42 G1961E 3 M 34 16 0.1 Moderate af9; - 42 G1961E NF 4 M 49 17 0.1 Severe af9; NP 6 G768T/splice 42 G1961E 5 F 36 35 0.6 Moderate af9; VS (T) 6 C230S 42 G1961E 6 M 28 17 0.1 Mild af9;af9; INS 40 R1898H 43 G1975R 7 M 20 9 0.05 Moderate af9;af9; VS (P/D) 12 af9; 21 L541P af9; A1038V 40 IVS40 af9; 5G 3 A 8 M 33 6 0.1 Mild afa; Chaotic NF NF 9 M 39 29 0.2 Moderate af9; VS (P/D) 13 G607R 42 G1961E 10 M 38 22 0.1 Severe af9; Chaotic NF NF 11 F 28 20 0.7 Mild af9;af9; INS 3 A60T 40 R1898H 12 M 46 30 0.5 Mild af9; Chaotic 11 E471K 42 G1961E 13 F 25 11 0.1 Moderate af9;af9; S 17 G863A NF 14 F 51 41 0.8 Moderate af9;af9; NP 40 R1898H NF 15 F 23 17 0.1 Mild afa; Chaotic 3 P68L 36 S1689P 16 F 33 30 0.4 Mild afa; Chaotic 28 E1399K 42 G1961E 17 F 41 36 0.1 Severe af9; VS (T) 29 F1440V 37 G1748R 18 M 59 54 0.1 Severe af9; VS (P/D) 42 G1961E NF 19* M 35 15 0.05 Moderate af9; Chaotic 17 G863A 37 Q1750X 20* M 43 14 HM Severe af9;af9; NP 17 G863A 37 Q1750X 21 F 46 16 0.1 Moderate af9; NP NF NF 22 F 32 22 0.05 Moderate af9; INS 21 A1038V NF 23 M 50 42 0.3 Severe af9;af9; VS (P/D) 12 af9; 21 L541P af9; A1038V 17 G863A 24 F 30 14 0.1 Moderate af9;af9; INS 17 G863A 40 IVS40 af9; 5G 3 A 25 M 36 25 0.5 Moderate af9;af9; - 3 296INSA 21 A1038V 26 M 40 23 0.2 Moderate af9; S 3 296INSA 42 G1961E 27 F 35 9 0.1 Severe af9;af9; VS (P/D) 22 R1108C NF 28 F 23 18 0.05 Mild af9;af9; S 28 E1399K 43 G1977S 29 F 25 18 0.2 Mild af9; Chaotic 37 L1763P NF 30 F 16 11 0.1 Moderate af9; Chaotic 22 R1108C NF 31 M 40 35 0.1 Moderate af9;af9; VS (P/D) 14 R681X NF 32 F 28 27 0.1 Moderate af9; S 12 af9; 21 L541P af9; A1038V 21 A1038V 33 M 32 9 0.05 Severe af9;af9; Chaotic 28 Q1412X 45 R2077W 34 F 23 21 0.2 Moderate af9; INS 6 G768T/splice NF 35 F 38 33 FC Moderate afa; Chaotic 17 G863A NF 36 F 39 10 HM Severe af9;af9; NP NF NF 37 F 13 8 0.1 Moderate af9;af9; S - - 38 F 27 25 0.2 Moderate af9; Chaotic 17 G863A 28 Q1412X 39 M 16 15 0.1 Moderate af9; VS (P/D) 12 af9; 17 R572Q af9; G863A 35 IVS35 af9; 2T 3 A 40 M 27 26 0.6 Moderate afa; S 17 G863A NF 41 M 18 16 0.2 Moderate af9; - - - 42 M 25 24 0.1 Mild afa; - NF NF 43 F 29 9 0.1 Moderate af9; Chaotic 12 af9; 21 L541P af9; A1038V 42 G1961E 44 M 39 28 0.1 Mild afa; NP 6 N247S NF 45 F 23 12 0.05 Mild afa; NP 6 R212C 19 T959I 46 M 43 36 0.2 Moderate af9; VS (P/D) 21 A1038V NF 47 M 21 18 0.4 Mild af9;af9; INS 28 Q1412X NF Shown are age at examination, age of onset, visual acuity, central fundus changes, and existence and distribution of the typical white-yellow flecks. Login to comment

[hide] An analysis of allelic variation in the ABCA4 gene... Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89. Webster AR, Heon E, Lotery AJ, Vandenburgh K, Casavant TL, Oh KT, Beck G, Fishman GA, Lam BL, Levin A, Heckenlively JR, Jacobson SG, Weleber RG, Sheffield VC, Stone EM
An analysis of allelic variation in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89., [PMID:11328725]

Abstract [show]
PURPOSE: To assess the allelic variation of the ATP-binding transporter protein (ABCA4). METHODS: A combination of single-strand conformation polymorphism (SSCP) and automated DNA sequencing was used to systematically screen this gene for sequence variations in 374 unrelated probands with a clinical diagnosis of Stargardt disease, 182 patients with age-related macular degeneration (AMD), and 96 normal subjects. RESULTS: There was no significant difference in the proportion of any single variant or class of variant between the control and AMD groups. In contrast, truncating variants, amino acid substitutions, synonymous codon changes, and intronic variants were significantly enriched in patients with Stargardt disease when compared with their presence in subjects without Stargardt disease (Kruskal-Wallis P < 0.0001 for each variant group). Overall, there were 2480 instances of 213 different variants in the ABCA4 gene, including 589 instances of 97 amino acid substitutions, and 45 instances of 33 truncating variants. CONCLUSIONS: Of the 97 amino acid substitutions, 11 occurred at a frequency that made them unlikely to be high-penetrance recessive disease-causing variants (HPRDCV). After accounting for variants in cis, one or more changes that were compatible with HPRDCV were found on 35% of all Stargardt-associated alleles overall. The nucleotide diversity of the ABCA4 coding region, a collective measure of the number and prevalence of polymorphic sites in a region of DNA, was found to be 1.28, a value that is 9 to 400 times greater than that of two other macular disease genes that were examined in a similar fashion (VMD2 and EFEMP1).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
155 Three missense variants, Gly863Ala, Asn1868Ile, and Ser2255Ile, were significantly enriched among patients with Stargardt disease but not to the extent that would be expected if they were fully penetrant Stargardt alleles. Login to comment
158 The variant Gly863Ala occurred on 28 Stargardt alleles in 28 patients with Stargardt disease. Login to comment
173 Furthermore, the missense changes Gly863Ala and Arg943Gln were commonly found together. Login to comment
175 However, linkage disequilibrium was not complete, because the rarer Gly863Ala change occurred by itself in three patients with Stargardt disease. Login to comment
177 Similarly, Leu541Pro occurred in 10 patients with Stargardt disease who harbored the variant Ala1038Val, and, when phase could be determined, these variations were found in cis. Login to comment
243 The missense change Gly863Ala is of particular interest, because it was found in 4% of Stargardt alleles and in 0.7% of non-Stargardt alleles. Login to comment
103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
156 Three missense variants, Gly863Ala, Asn1868Ile, and Ser2255Ile, were significantly enriched among patients with Stargardt disease but not to the extent that would be expected if they were fully penetrant Stargardt alleles. Login to comment
160 The variant Gly863Ala occurred on 28 Stargardt alleles in 28 patients with Stargardt disease. Login to comment
245 The missense change Gly863Ala is of particular interest, because it was found in 4% of Stargardt alleles and in 0.7% of non-Stargardt alleles. Login to comment

[hide] Late-onset Stargardt disease is associated with mi... Hum Genet. 2001 Apr;108(4):346-55. Yatsenko AN, Shroyer NF, Lewis RA, Lupski JR
Late-onset Stargardt disease is associated with missense mutations that map outside known functional regions of ABCR (ABCA4).
Hum Genet. 2001 Apr;108(4):346-55., [PMID:11379881]

Abstract [show]
Based on recent studies of the photoreceptor-specific ABC transporter gene ABCR (ABCA4) in Stargardt disease (STGD1) and other retinal dystrophies, we and others have developed a model in which the severity of retinal disease correlates inversely with residual ABCR activity. This model predicts that patients with late-onset STGDI may retain partial ABCR activity attributable to mild missense alleles. To test this hypothesis, we used late-onset STGDI patients (onset: > or =35 years) to provide an in vivo functional analysis of various combinations of mutant alleles. We sequenced directly the entire coding region of ABCR and detected mutations in 33/50 (66%) disease chromosomes, but surprisingly, 11/33 (33%) were truncating alleles. Importantly, all 22 missense mutations were located outside the known functional domains of ABCR (ATP-binding or transmembrane), whereas in our general cohort of STGDI subjects, alterations occurred with equal frequency across the entire protein. We suggest that these missense mutations in regions of unknown function are milder alleles and more susceptible to modifier effects. Thus, we have corroborated a prediction from the model of ABCR pathogenicity that (1) one mutant ABCR allele is always missense in late-onset STGD1 patients, and (2) the age-of-onset is correlated with the amount of ABCR activity of this allele. In addition, we report three new pseudodominant families that now comprise eight of 178 outbred STGD1 families and suggest a carrier frequency of STGD1-associated ABCR mutations of about 4.5% (approximately 1/22).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Allele 1 nucleotide Amino acid Allele 2 Amino acid Age of change nucleotide change onset (years) AR129-08 37 AR140-01 6079C→T L2027F 3322C→T R1108C 36 AR204-04 35 AR280-03 6316C→T R2106C 6710insA T2237fs 35 AR311-04 4462T→C C1488R 35 AR336-03 2588G→C G863A 5898+1G→A E1966splice 39 AR343-06 2588G→C G863A 3322C→T R1108C 43 AR387-03 4919G→A R1640Q 2971G→C G991R 40 AR410-04 768G→T V256splice 3113C→T A1038V 38 AR440-03 6238-6239del2 bp S2080fs 44 AR448-01a 454C→T R152X 6089G→A R2030Q 52 AR452-04 2005-2006del2 bp M669fs 6089G→A R2030Q 40 AR455-05 [1622T→C;3113C→T] [L541P;A1038V] 43 AR474-02 36 AR516-01a 5196+1G→A I1732splice 3113C→T A1038V 47 AR518-03 3322C→T R1108C 35 AR540-01a 4685T→C I1562T 51 AR594-02a 5196+1G→A I1732splice 36 AR606-04 3322C→T R1108C 2588G→C G863A 39 AR608-02 1025-1038del14 bp D342fs 40 AR617-03 2827C→T R943W 39 AR632-02a 3386G→T R1129L 50 AR649-03 3303G→A W1101X 3113C→T A1038V 36 AR662-02a 1015T→G W339G 50 AR723-01a 3602T→G L1201R 65 Fig.1 Pedigrees of late-onset Stargardt disease families (filled symbols STGD1-affected individuals). Login to comment
134 Conversely, missense mutations located in other regions (e.g., missense mutations in late-onset STGD1) might retain some ABCR activity. This hypothesis is supported by the observations of Sun et al. (2000) that ABCR missense mutations located outside the known functional domains (L541P, G863A, A1038V, R1108C, R1129L, C1488R, R2106C) have a milder functional effect on expression and ATP-binding activity (1/3-2/3 activity of wild-type). Login to comment

[hide] Clinical electrophysiology of two rod pathways: no... Graefes Arch Clin Exp Ophthalmol. 2001 Feb;239(2):71-80. Scholl HP, Langrova H, Weber BH, Zrenner E, Apfelstedt-Sylla E
Clinical electrophysiology of two rod pathways: normative values and clinical application.
Graefes Arch Clin Exp Ophthalmol. 2001 Feb;239(2):71-80., [PMID:11372548]

Abstract [show]
BACKGROUND: The scotopic 15-Hz flicker electroretinogram (ERG) has two limbs (slow and fast ERG rod signals), and these have been attributed to two retinal rod pathways (the ON rod bipolar and AII amacrine pathway and the rodcone gap-junction pathway). The aim of this study was to provide normative values of the scotopic 15-Hz flicker ERG, to estimate the inter-individual variability, and to apply this method to a clinical setting. METHODS: Twenty-two normal subjects, one patient with retinitis pigmentosa (RP), and two patients with Stargardt's mascular dystrophy (SMD) participated in the study. The SMD patients were screened for mutations in the 50 exons of the ABCA4 (formerly ABCR) gene. We measured ERG response amplitudes and phases to flicker intensities ranging from -3.37 to -0.57 log scotopic trolands s at a flicker frequency of 15 Hz. RESULTS: The normal scotopic 15-Hz flicker ERG showed a biphasic amplitude pattern with a minimum at about-1.57 log scotopic trolands s, where there was an abrupt phase shift of about 180 deg. The inter-individual variability in ERG amplitude ranged from 47% to 67% for the slow and from 41% to 64% for the fast rod signal. Both the RP patient and the SMD patients (who were compound heterozygotes for mutations in the ABCA4 gene) showed reduced amplitudes for the two rod ERG pathways. CONCLUSION: The inter-individual variability might be explained by anatomical differences between individual retinae. In the RP patient, the amplitude reductions corresponded well with the standard rod ERG. In the SMD patients, however, the scotopic 15-Hz flicker ERG revealed rod dysfunction, whereas the standard rod ERG was within normal limits. The scotopic 15-Hz flicker method may be more sensitive than the standard rod ERG.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
145 The first, a G to C alteration at nucleotide position 2588 in exon 17, results in an amino acid substitution at codon 863 (G863A) and the second, a C to T transition at nucleotide position 4234 in exon 28, causes a premature stop codon at codon 1412 (Q1412X). Login to comment
164 Molecular genetic analysis of the 50 exons of ABCA4 gene revealed two missense mutations, a G to C transversion at nucleotide 2588 resulting in an amino acid substitution at codon 863 (G863A) and, in exon 40, a G to A alteration at nucleotide 5653 resulting in an amino acid substitution at codon 1885 (E1885 K). Login to comment

[hide] Simple and complex ABCR: genetic predisposition to... Am J Hum Genet. 2000 Oct;67(4):793-9. Epub 2000 Sep 1. Allikmets R
Simple and complex ABCR: genetic predisposition to retinal disease.
Am J Hum Genet. 2000 Oct;67(4):793-9. Epub 2000 Sep 1., [PMID:10970771]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 What makes ABCR an even more difficult diagnostic target than CFTR is that, across all populations studied, the most-frequent disease-associated ABCR alleles-for example, G1961E, G863A/ delG863, and A1038V-have been described in ~10% of patients with STGD, whereas the delF508 allele of CFTR accounts for close to 70% of all cystic fibrosis alleles (Zielenski and Tsui 1995). Login to comment
43 The earlier study by Maugeri et al. had defined the 2588GrC variant resulting in a dual effect, G863A/ delG863, as a founder mutation in northern-European patients with STGD (Maugeri et al. 1999). Login to comment
120 Another issue that has been clarified is that of the functional significance of the G863A/delG863 variant. Login to comment

[hide] A comprehensive survey of sequence variation in th... Am J Hum Genet. 2000 Oct;67(4):800-13. Epub 2000 Aug 24. Rivera A, White K, Stohr H, Steiner K, Hemmrich N, Grimm T, Jurklies B, Lorenz B, Scholl HP, Apfelstedt-Sylla E, Weber BH
A comprehensive survey of sequence variation in the ABCA4 (ABCR) gene in Stargardt disease and age-related macular degeneration.
Am J Hum Genet. 2000 Oct;67(4):800-13. Epub 2000 Aug 24., [PMID:10958763]

Abstract [show]
Stargardt disease (STGD) is a common autosomal recessive maculopathy of early and young-adult onset and is caused by alterations in the gene encoding the photoreceptor-specific ATP-binding cassette (ABC) transporter (ABCA4). We have studied 144 patients with STGD and 220 unaffected individuals ascertained from the German population, to complete a comprehensive, population-specific survey of the sequence variation in the ABCA4 gene. In addition, we have assessed the proposed role for ABCA4 in age-related macular degeneration (AMD), a common cause of late-onset blindness, by studying 200 affected individuals with late-stage disease. Using a screening strategy based primarily on denaturing gradient gel electrophoresis, we have identified in the three study groups a total of 127 unique alterations, of which 90 have not been previously reported, and have classified 72 as probable pathogenic mutations. Of the 288 STGD chromosomes studied, mutations were identified in 166, resulting in a detection rate of approximately 58%. Eight different alleles account for 61% of the identified disease alleles, and at least one of these, the L541P-A1038V complex allele, appears to be a founder mutation in the German population. When the group with AMD and the control group were analyzed with the same methodology, 18 patients with AMD and 12 controls were found to harbor possible disease-associated alterations. This represents no significant difference between the two groups; however, for detection of modest effects of rare alleles in complex diseases, the analysis of larger cohorts of patients may be required.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 Certain mutant alleles-for example, G863A, A1038V, and G1961E-appear to be more common and may have altered frequencies in different populations, as a result of founder effect (Maugeri et al. 1999; Simonelli et al. 2000). Login to comment
81 b Effect is missense mutation (G863A) and in-frame deletion (delG863), according to Maugeri et al. (1999). Login to comment

[hide] Molecular genetic analysis of ABCR gene in Japanes... Jpn J Ophthalmol. 2000 May-Jun;44(3):245-9. Fuse N, Suzuki T, Wada Y, Yoshida M, Shimura M, Abe T, Nakazawa M, Tamai M
Molecular genetic analysis of ABCR gene in Japanese dry form age-related macular degeneration.
Jpn J Ophthalmol. 2000 May-Jun;44(3):245-9., [PMID:10913642]

Abstract [show]
PURPOSE: To explore whether the mutation in the retina-specific ATP-binding cassette transporter (ABCR) gene, the Stargardt's disease gene, contributes to the prevalence of the dry form of age-related macular degeneration (dry AMD) in Japanese unrelated patients. METHODS: Twenty-five Japanese unrelated patients with dry AMD who were diagnosed by fluorescein angiography and indocyanine green angiography were chosen as the dry AMD group. None of these cases had apparent choroidal neovascularization. To detect the mutations in the ABCR gene, genomic DNA was extracted from leukocytes of peripheral blood, and 26 exons of the ABCR gene were amplified by polymerase chain reaction (PCR). All the PCR products were then directly sequenced. When a mutation was detected, the occurrence of a mutation was compared between these AMD patients and the control group. RESULTS: After direct sequencing, a point mutation in exon 29 was found in one of the 25 dry AMD patients. In addition, a polymorphism in exon 45 was found in two other patients, and three sequence variations in exon 23 were detected in all patients. The incidence in AMD patients in whom a mutation in exon 29 (4%) was detected was less than that in controls (5%). Screening of the intron-exon boundaries also led to the identification of intronic mutation in intron 33. CONCLUSION: In this study we found no relationship between allelic variation in the ABCR gene and the prevalence of dry AMD in Japanese unrelated patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Mutations Found in ABCR* Gene in 26 Exons Examined in This Study Exon AMD† Stargardt`s Disease Exon AMD Stargardt`s Disease 11 E471K 29 T1428M 15 31 R1517S 16 G818E, G863A (D847H) 33 I1562T G1578R 17 34 N1614FS 18 35 19 V931M, 2884delC N965M, (R943Q) 36 5196ϩ1G→A 5041deL15 5196ϩ2T→C 20 40 R1898H R1898H 21 A1028V 42 G1961E G1961E 22 3211insGT, V1072A E1087K 43 L1970F 6006ϩ1G→T 23 R1129L 44 L2027F, R2038W (I2023I) 24 45 V2050L, R2077W (I2083I) 25 46 R2106C (V2094V) 27 48 6519⌬11bp D2177N 6568⌬C 6519⌬11bp 6709insG *ABCR: ATP-binding cassette transporter. Login to comment
72 It was reported that four mutations found in AMD patients (R1898H, G1961E, 6519del11, and G863A) were also found in patients with Stargardt`s disease.14 In our study, only one polymorphism (I2083I) was found. Login to comment

[hide] An analysis of ABCR mutations in British patients ... Invest Ophthalmol Vis Sci. 2000 Jan;41(1):16-9. Papaioannou M, Ocaka L, Bessant D, Lois N, Bird A, Payne A, Bhattacharya S
An analysis of ABCR mutations in British patients with recessive retinal dystrophies.
Invest Ophthalmol Vis Sci. 2000 Jan;41(1):16-9., [PMID:10634594]

Abstract [show]
PURPOSE: Several reports have shown that mutations in the ABCR gene can lead to Stargardt disease (STGD)/fundus flavimaculatus (FFM), autosomal recessive retinitis pigmentosa (arRP), and autosomal recessive cone-rod dystrophy (arCRD). To assess the involvement of ABCR in these retinal dystrophies, the gene was screened in a panel of 70 patients of British origin. METHODS: Fifty-six patients exhibiting the STGD/FFM phenotype, 6 with arRP, and 8 with arCRD, were screened for mutations in the 50 exons of the ABCR gene by heteroduplex analysis and direct sequencing. Microsatellite marker haplotyping was used to determine ancestry. RESULTS: In the 70 patients analyzed, 31 sequence changes were identified, of which 20 were considered to be novel mutations, in a variety of phenotypes. An identical haplotype was associated with the same pair of in-cis alterations in 5 seemingly unrelated patients and their affected siblings with STGD/FFM. Four of the aforementioned patients were found to carry three alterations in the coding sequence of the ABCR gene, with two of them being in-cis. CONCLUSIONS: These results suggest that ABCR is a relatively polymorphic gene. Because putative mutations have been identified thus far only in 25 of 70 patients, of whom only 8 are compound heterozygotes, a large number of mutations have yet to be ascertained. The disease haplotype seen in the 5 patients carrying the same "complex" allele is consistent with the presence of a common ancestor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 In the family of a STGD/FFM patient, three sequence alterations Cys-54-Tyr, Gly-863-Ala, and Arg-943-Gln in ABCR exons 3, 17, and 19, respectively, were found to be present. Login to comment
44 Both the Gly-863-Ala and Arg-943-Gln substitutions were present in the unaffected mother who had no clinical evidence of the disease at the age of 58 years. Login to comment
45 Neither of these putative TABLE 1. List of Mutations Found in 70 Patients of British Origin Nucleotide Change Amino Acid Change No. of Patients (/70) Phenotype No. of Controls (/96) G161A Cys-54-Tyr 1 STG/FFM NF A286G Asn-96-Asp 1 STG/FFM NF A286C Asn-96-His 1 STG/FFM NF A466G Ile-156-Val 1 STG/FFM NF C1220T Ala-407-Val 6 STG/FFM, arCRD NF T1271C Val-424-Ala 2 STG/FFM, arRP NF C1335G Ser-445-Arg 1 STG/FFM NF C1804T Arg-602-Trp 1 STG/FFM NF C2337A Cys-779-Ter 1 STG/FFM NF *G2588C Gly-863-Ala 5 STG/FFM 2/176 3392delC 1147 Ter 1 STG/FFM NF T4286C Val-1429-Ala 1 STG/FFM NF 4774-2A3C Splice acceptor 2 STG/FFM NF †C4918T Arg-1640-Trp 1 STG/FFM NF C5107G Gln-1703-Lys 1 STG/FFM NF 5161delAC Frameshift 1 STG/FFM NF C5337G Tyr-1779-Ter 1 STG/FFM NF C6088T Arg-2030-Ter 1 arCRD NF 6282ϩ7G3A Splice donor 1 STG/FFM NF G6449A Cys-2150-Tyr 2 arCRD NF A6479G Lys-2160-Arg 1 STG/FFM NF * Independently reported by Allikmets et al.6 † Independently reported by Rozet et al.8 NF, not found in 96 ethnically matched control individuals. Login to comment
49 We therefore assumed that the two sequence changes Gly-863-Ala and Arg-943-Gln were in-cis on the maternally inherited chromosome, comprising a "complex" allele. Login to comment
51 When screening additional patients, we discovered that four more individuals affected with STGD/FFM carried the same two changes in-cis (Gly-863-Ala and Arg-943-Gln). Login to comment
62 The allele in question is the "complex" one carrying two sequence changes, Gly-863-Ala and Arg-943-Gln, in-cis. Login to comment
65 Of the two amino acid alterations in-cis, Gly-863-Ala besides being a putative missense mutation could also affect proper RNA splicing as it occurs at the acceptor splice site of exon 17.13 The second alteration, Arg-943-Gln, has been classified as a "polymorphism. Login to comment
69 Ancestral Haplotype Shared by the 5 Families Carrying the Two Amino Acid Alterations Gly-863-Ala and Arg-943-Gln in-cis Marker Distance Family 1 Family 2 Family 3 Family 4 Family 5 1a 1b 1c 1d 2a 2b 5a 5b D1S198 2 2 2 2 2 2 2 2 2 2 6.2 D1S216 2 2 2 2 2 2 2 2 2 2 10.4 D1S207 3 3 3 3 3 3 - 3 3 3 11.9 D1S2813 1 1 1 1 1 1 1 1 1 1 ABCR gene 2.9 D1S236 1 1 1 1 1 1 1 1 1 1 10.9 D1S248 4 4 4 4 5 5 5 5 2 2 11.8 D1S252 1 1 1 1 1 1 - 1 2 2 9.0 D1S305 1 1 1 1 1 1 2 - 2 2 Column 1 denotes the markers used for haplotyping analysis, and column 2 shows the genetic distance between the respective markers (in cM). Login to comment

[hide] A novel mutation in the ABCR gene in four patients... Am J Ophthalmol. 1999 Dec;128(6):720-4. Zhang K, Garibaldi DC, Kniazeva M, Albini T, Chiang MF, Kerrigan M, Sunness JS, Han M, Allikmets R
A novel mutation in the ABCR gene in four patients with autosomal recessive Stargardt disease.
Am J Ophthalmol. 1999 Dec;128(6):720-4., [PMID:10612508]

Abstract [show]
PURPOSE: To identify additional mutations in the ABCR gene and describe the clinical features of four affected siblings with autosomal recessive Stargardt disease. METHODS: A cohort of eight siblings was identified for study. Four of these individuals were diagnosed with Stargardt disease based on clinical evaluation and fluorescein angiography. Blood samples were obtained from seven of eight siblings, including all those affected. All 50 exons of the ABCR gene were analyzed by single-stranded confirmation polymorphism analysis, followed by direct sequencing of observed variants, to identify mutations in the ABCR gene. RESULTS: We identified a previously unreported kindred of eight siblings, four of whom had mutations in both of their ABCR alleles. A previously described G-to-C transversion of nucleotide 2588, predicting a Gly863Ala amino acid substitution, and a novel G-to-A transition of nucleotide 161, resulting in a Cys54Tyr substitution, were identified. These mutations co-segregated with the affected members of this family. Three of the siblings demonstrated clinical features characteristic of classic Stargardt disease, with bilateral regions of macular atrophy associated with yellow-white "flavimaculatus" flecks in the posterior pole at the level of the retinal pigment epithelium. The fourth affected sibling showed features of early Stargardt disease, with a beaten-bronze appearance to both maculas, as well as perimacular flecks. In all four affected patients, fluorescein angiography showed a characteristic peripheral dark choroid. CONCLUSIONS: We have identified both a previously described and a novel mutation in the ABCR gene in four patients with autosomal recessive Stargardt disease. In-depth knowledge of the ABCR mutation spectrum in patients with Stargardt disease will provide for more efficient screening and may provide potential therapies for Stargardt disease and other retinal diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 A previously described G-to-C transversion of nucleotide 2588, predicting a Gly863Ala amino acid substitution, and a novel G-to-A transition of nucleotide 161, resulting in a Cys54Tyr substitution, were identified. Login to comment
70 A G-to-C transversion of nucleotide 2588, resulting in a Gly863Ala amino acid substitution, and a G-to-A transition of nucleotide 161, which caused a Cys54Tyr substitution (Figure 4), were identified. Login to comment
82 The Gly863Ala amino acid substitution in exon 18 of the ABCR gene represents a frequent mutation in families of Caucasian origin with Stargardt disease.3 The second mutation, a Cys54Tyr substitution, represents a novel mutation in the ABCR gene. Login to comment

[hide] Analysis of the Stargardt disease gene (ABCR) in a... Ophthalmology. 1999 Aug;106(8):1531-6. De La Paz MA, Guy VK, Abou-Donia S, Heinis R, Bracken B, Vance JM, Gilbert JR, Gass JD, Haines JL, Pericak-Vance MA
Analysis of the Stargardt disease gene (ABCR) in age-related macular degeneration.
Ophthalmology. 1999 Aug;106(8):1531-6., [PMID:10442900]

Abstract [show]
PURPOSE: Age-related macular degeneration (AMD) is a complex genetic disorder and the leading cause of severe vision loss in the elderly. The Stargardt disease gene (ABCR) has been proposed as a major genetic risk factor in AMD. The purpose of this study was to evaluate the authors' AMD population for the specific ABCR variants proposed previously as genetic risk factors for AMD. METHODS: The authors screened their AMD population (159 familial cases from 112 multiplex families and 53 sporadic cases) and 56 racially matched individuals with no known history of AMD from the same clinic population for evidence of the ABCR variants. Grading of disease severity was performed according to a standard protocol. Patients with extensive intermediate drusen or large soft drusen, drusenoid retinal pigment epithelial (RPE) detachments, geographic atrophy of the RPE, or evidence of exudative maculopathy were considered affected. Analysis for variants was performed by polymerase chain reaction amplification of individual exons of the ABCR gene with flanking primers and a combination of single-strand conformation polymorphism, heteroduplex analysis, and high-performance liquid chromatography. All abnormal conformers detected using these techniques were characterized by direct sequencing. RESULTS: The authors identified only two of the previously reported variants in their study population. Both variants occurred in sporadic cases, and none was found in familial cases or the randomly selected population. In addition, the authors identified several newly described polymorphisms and variants in both the AMD and control populations. CONCLUSIONS: Based on these initial findings, the authors suggest that ABCR is not a major genetic risk factor for AMD in their study population. Additional genetic studies are needed to more fully evaluate the role of ABCR in AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 In addition to screening for the previously reported variants, we screened our population for the five most common ABCR polymorphisms reported by Allikmets et al31 (U843G, D8464H, G863A, R934Z, S2255I) and failed to identify any of these particular polymorphisms in our study. Login to comment

[hide] Genotype/Phenotype analysis of a photoreceptor-spe... Am J Hum Genet. 1999 Feb;64(2):422-34. Lewis RA, Shroyer NF, Singh N, Allikmets R, Hutchinson A, Li Y, Lupski JR, Leppert M, Dean M
Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease.
Am J Hum Genet. 1999 Feb;64(2):422-34., [PMID:9973280]

Abstract [show]
Mutation scanning and direct DNA sequencing of all 50 exons of ABCR were completed for 150 families segregating recessive Stargardt disease (STGD1). ABCR variations were identified in 173 (57%) disease chromosomes, the majority of which represent missense amino acid substitutions. These ABCR variants were not found in 220 unaffected control individuals (440 chromosomes) but do cosegregate with the disease in these families with STGD1, and many occur in conserved functional domains. Missense amino acid substitutions located in the amino terminal one-third of the protein appear to be associated with earlier onset of the disease and may represent misfolding alleles. The two most common mutant alleles, G1961E and A1038V, each identified in 16 of 173 disease chromosomes, composed 18.5% of mutations identified. G1961E has been associated previously, at a statistically significant level in the heterozygous state, with age-related macular degeneration (AMD). Clinical evaluation of these 150 families with STGD1 revealed a high frequency of AMD in first- and second-degree relatives. These findings support the hypothesis that compound heterozygous ABCR mutations are responsible for STGD1 and that some heterozygous ABCR mutations may enhance susceptibility to AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift. Login to comment
101 For the double-mutant chromosomes in the compound heterozygous families (AR31: Y340D and R572Q; AR106: E471K and E2131K; AR128: R572Q and G863A; and AR189: L541P and A1038V) and in those families in which the second disease chromosome was not identified (AR215: H1406Y and V2050L; AR264: D1204N and L2027F; AR254: D249G and R1898H; AR265: G863A and R1898H; AR285: 2714ϩ5GrA and 2884delC; and AR305: G863A and R1898H), in three cases (AR128, AR265, and AR305) each mutation on the double-mutant chromosome had been identified independently as disease causing in other, unrelated families with STGD1 (table 1). Login to comment
110 Seven mutant alleles, including six missense amino acid substitutions and one splice-site mutation (G863A, A1038V, R1108C, T1526M, G1961E, L2027F, and 5714ϩ5GrA) accounted for 41% of the disease-causing mutations identified in this cohort. Login to comment
111 In three instances, identical codons were affected by different base-pair substitutions, yielding different predicted missense amino acid substitutions (R572Q and R572P; R1129C and R1129L) or a missense substitution and a stop codon (R2030Q and R2030X). Login to comment
178 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET ‫ע‬ SD (YEARS)Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 ‫ע‬ 12.7 51961GrA AR307 10 A1038V AR290 16 5714ϩ5GrA AR314 25 5898ϩ1GrT AR336 39 A1038V R572P AR321 6 12.5 ‫ע‬ 6.9 S1071L AR358 6 L1970F AR428 6 5196ϩ2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 ‫ע‬ 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 ‫ע‬ 4.5 C75G AR427 12 C1490Y AR370 13 2160ϩ1GrC AR218 14 4253ϩ5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 ‫ע‬ 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment
77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift. Login to comment
102 For the double-mutant chromosomes in the compound heterozygous families (AR31: Y340D and R572Q; AR106: E471K and E2131K; AR128: R572Q and G863A; and AR189: L541P and A1038V) and in those families in which the second disease chromosome was not identified (AR215: H1406Y and V2050L; AR264: D1204N and L2027F; AR254: D249G and R1898H; AR265: G863A and R1898H; AR285: 2714af9;5GrA and 2884delC; and AR305: G863A and R1898H), in three cases (AR128, AR265, and AR305) each mutation on the double-mutant chromosome had been identified independently as disease causing in other, unrelated families with STGD1 (table 1). Login to comment
179 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET cf2; SD (YEARS) Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 cf2; 12.7 51961GrA AR307 10 A1038V AR290 16 5714af9;5GrA AR314 25 5898af9;1GrT AR336 39 A1038V R572P AR321 6 12.5 cf2; 6.9 S1071L AR358 6 L1970F AR428 6 5196af9;2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 cf2; 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 cf2; 4.5 C75G AR427 12 C1490Y AR370 13 2160af9;1GrC AR218 14 4253af9;5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 cf2; 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment

[hide] Autosomal recessive retinitis pigmentosa and cone-... Hum Mol Genet. 1998 Mar;7(3):355-62. Cremers FP, van de Pol DJ, van Driel M, den Hollander AI, van Haren FJ, Knoers NV, Tijmes N, Bergen AA, Rohrschneider K, Blankenagel A, Pinckers AJ, Deutman AF, Hoyng CB
Autosomal recessive retinitis pigmentosa and cone-rod dystrophy caused by splice site mutations in the Stargardt's disease gene ABCR.
Hum Mol Genet. 1998 Mar;7(3):355-62., [PMID:9466990]

Abstract [show]
Ophthalmological and molecular genetic studies were performed in a consanguineous family with individuals showing either retinitis pigmentosa (RP) or cone-rod dystrophy (CRD). Assuming pseudodominant (recessive) inheritance of allelic defects, linkage analysis positioned the causal gene at 1p21-p13 (lod score 4.22), a genomic segment known to harbor the ABCR gene involved in Stargardt's disease (STGD) and age-related macular degeneration (AMD). We completed the exon-intron structure of the ABCR gene and detected a severe homozygous 5[prime] splice site mutation, IVS30+1G->T, in the four RP patients. The five CRD patients in this family are compound heterozygotes for the IVS30+1G->T mutation and a 5[prime] splice site mutation in intron 40 (IVS40+5G->A). Both splice site mutations were found heterozygously in two unrelated STGD patients, but not in 100 control individuals. In these patients the second mutation was either a missense mutation or unknown. Since thus far no STGD patients have been reported to carry two ABCR null alleles and taking into account that the RP phenotype is more severe than the STGD phenotype, we hypothesize that the intron 30 splice site mutation represents a true null allele. Since the intron 30 mutation is found heterozygously in the CRD patients, the IVS40+5G->A mutation probably renders the exon 40 5[prime] splice site partially functional. These results show that mutations in the ABCR gene not only result in STGD and AMD, but can also cause autosomal recessive RP and CRD. Since the heterozygote frequency for ABCR mutations is estimated at 0.02, mutations in ABCR might be an important cause of autosomal recessive and sporadic forms of RP and CRD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 The Gly863Ala mutation was found in another 20 of a total of 58 STGD patients, but not in 100 control individuals. Login to comment
103 The Gly863Ala mutation thereby is one of the most frequently observed mutations in our STGD patient cohort. Login to comment
126 18, amino acid position 1475) of the predicted ABCR protein (Fig. 5, splice variantB).TheIVS30+1G→Tmutationwasalsoobservedintwo STGD patients, one of which carried a Gly863Ala mutation in the second allele. Login to comment
128 Genotype-phenotype comparison for the RP, CRD, STGD/FFM and AMD patients and a hypothetical correlation between ABCR activity and the observed phenotypes Patient Phenotype ABCR allele 1 ABCR allele 2 ABCR activity 7023 (V-3) RP IVS30+1G→T IVS30+1G→T - 7028 (IV-7) CRD IVS30+1G→T IVS40+5G→A +/- 7560 STGD IVS30+1G→T Gly863Ala + 7727 STGD IVS30+1G→T Unknown + 8439 STGD IVS40+5G→A Ala1038Val + 8272 STGD/FFM IVS40+5G→A Unknown + AMD Missense or null mutation (19) ++ Normal ++++ 3360 Figure . Login to comment
139 Given the more severe clinical picture in RP patients compared with CRD and STGD patients, it can be deduced that homozygosity for the IVS30+1G→T mutation, associated with an RP phenotype, is more detrimental to ABCR activity than compound heterozygosity for the IVS30+1G→T and IVS40+5G→A mutations, which results in a CRD phenotype, or compound heterozygosity for the IVS30+1G→T and Gly863Ala mutations, which results in an STGD phenotype. Login to comment
100 The Gly863Ala mutation was found in another 20 of a total of 58 STGD patients, but not in 100 control individuals. Login to comment
101 The Gly863Ala mutation thereby is one of the most frequently observed mutations in our STGD patient cohort. Login to comment
123 If the cryptic 5' splice site is used there will be a 10 amino acid insertion after amino acid position 1513 (in ref. 18, amino acid position 1475) of the predicted ABCR protein (Fig. 5, splice variantB).TheIVS30+1G࢐Tmutationwasalsoobservedintwo STGD patients, one of which carried a Gly863Ala mutation in the second allele. Login to comment
125 Genotype-phenotype comparison for the RP, CRD, STGD/FFM and AMD patients and a hypothetical correlation between ABCR activity and the observed phenotypes Patient Phenotype ABCR allele 1 ABCR allele 2 ABCR activity 7023 (V-3) RP IVS30+1G࢐T IVS30+1G࢐T - 7028 (IV-7) CRD IVS30+1G࢐T IVS40+5G࢐A +/- 7560 STGD IVS30+1G࢐T Gly863Ala + 7727 STGD IVS30+1G࢐T Unknown + 8439 STGD IVS40+5G࢐A Ala1038Val + 8272 STGD/FFM IVS40+5G࢐A Unknown + AMD Missense or null mutation (19) ++ Normal ++++ Figure 5. Login to comment
136 Given the more severe clinical picture in RP patients compared with CRD and STGD patients, it can be deduced that homozygosity for the IVS30+1G࢐T mutation, associated with an RP phenotype, is more detrimental to ABCR activity than compound heterozygosity for the IVS30+1G࢐T and IVS40+5G࢐A mutations, which results in a CRD phenotype, or compound heterozygosity for the IVS30+1G࢐T and Gly863Ala mutations, which results in an STGD phenotype. Login to comment

[hide] Mutation of the Stargardt disease gene (ABCR) in a... Science. 1997 Sep 19;277(5333):1805-7. Allikmets R, Shroyer NF, Singh N, Seddon JM, Lewis RA, Bernstein PS, Peiffer A, Zabriskie NA, Li Y, Hutchinson A, Dean M, Lupski JR, Leppert M
Mutation of the Stargardt disease gene (ABCR) in age-related macular degeneration.
Science. 1997 Sep 19;277(5333):1805-7., [PMID:9295268]

Abstract [show]
Age-related macular degeneration (AMD) is the leading cause of severe central visual impairment among the elderly and is associated both with environmental factors such as smoking and with genetic factors. Here, 167 unrelated AMD patients were screened for alterations in ABCR, a gene that encodes a retinal rod photoreceptor protein and is defective in Stargardt disease, a common hereditary form of macular dystrophy. Thirteen different AMD-associated alterations, both deletions and amino acid substitutions, were found in one allele of ABCR in 26 patients (16%). Identification of ABCR alterations will permit presymptomatic testing of high-risk individuals and may lead to earlier diagnosis of AMD and to new strategies for prevention and therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
110 Alteration AMD STGD1 General population V643G 1/167 (0.6%) 0/98 (0%) 1/80 (1.25%) D846H 0/167 (0%) 1/98 (1%) 1/50 (2%) G863A 1/167 (0.6%) 13/150 (8.7%) 2/220 (0.9%) R943Q 6/127 (4.7%) 4/47 (9.5%) 13/80 (16.25%) S2255I 24/167 (14.4%) 8/98 (8%) 6/58 (10.3%) SCIENCE ⅐ VOL. Login to comment
107 Alteration AMD STGD1 General population V643G 1/167 (0.6%) 0/98 (0%) 1/80 (1.25%) D846H 0/167 (0%) 1/98 (1%) 1/50 (2%) G863A 1/167 (0.6%) 13/150 (8.7%) 2/220 (0.9%) R943Q 6/127 (4.7%) 4/47 (9.5%) 13/80 (16.25%) S2255I 24/167 (14.4%) 8/98 (8%) 6/58 (10.3%) SCIENCE z VOL. 277 z 19 SEPTEMBER 1997 z www.sciencemag.org which map primarily to the highly conserved ATP-binding regions of the ABCR protein, AMD alterations were found outside these domains (Fig. 1). Login to comment

[hide] Stargardt disease caused by a rare combination of ... Medicina (Kaunas). 2013;49(8):386-91. Serapinas D, Obrikyte V, Sakalauskas R
Stargardt disease caused by a rare combination of double homozygous mutations.
Medicina (Kaunas). 2013;49(8):386-91., [PMID:24509150]

Abstract [show]
Stargardt disease is a juvenile macular degeneration most often inherited in an autosomal recessive pattern, characterized by decreased vision in the first 2 decades of life. This report presents a clinical case of Stargardt disease: a 10-year-old female patient complained of blurry vision, and in a 4-year period, her visual acuity was reduced from OD=0.3 and OS=0.3 to OD=0.08 and OS=0.1, respectively. A genetic analysis revealed a rare combination of 2 homozygous recessive mutations in the ABCA4 gene, which caused Stargardt disease. The presence of different genetic mechanisms leading to a severe disease phenotype can challenge molecular geneticists, ophthalmologists, and genetic counselors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Several studies have identified frequent ethnic group-specific ABCA4 alleles, such as the c.2588G>C variant resulting in a dual effect, p.G863A/delG863 as a founder mutation in Northern European patients with Stargardt disease, and a complex allele p.L541P/A1038V in the patients of the German origin who have both Stargardt disease and cone-rod dystrophy. Login to comment
59 Several studies have identified frequent ethnic group-specific ABCA4 alleles, such as the c.2588G>C variant resulting in a dual effect, p.G863A/delG863 as a founder mutation in Northern European patients with Stargardt disease, and a complex allele p.L541P/A1038V in the patients of the German origin who have both Stargardt disease and cone-rod dystrophy. Login to comment

[hide] Analysis of the ABCA4 gene by next-generation sequ... Invest Ophthalmol Vis Sci. 2011 Oct 31;52(11):8479-87. doi: 10.1167/iovs.11-8182. Zernant J, Schubert C, Im KM, Burke T, Brown CM, Fishman GA, Tsang SH, Gouras P, Dean M, Allikmets R
Analysis of the ABCA4 gene by next-generation sequencing.
Invest Ophthalmol Vis Sci. 2011 Oct 31;52(11):8479-87. doi: 10.1167/iovs.11-8182., [PMID:21911583]

Abstract [show]
PURPOSE: To find all possible disease-associated variants in coding sequences of the ABCA4 gene in a large cohort of patients diagnosed with ABCA4-associated diseases. METHODS: One hundred sixty-eight patients who had been clinically diagnosed with Stargardt disease, cone-rod dystrophy, and other ABCA4-associated phenotypes were prescreened for mutations in ABCA4 with the ABCA4 microarray, resulting in finding 1 of 2 expected mutations in 111 patients and 0 of 2 mutations in 57 patients. The next-generation sequencing (NGS) strategy was applied to these patients to sequence the entire coding region and the splice sites of the ABCA4 gene. Identified new variants were confirmed or rejected by Sanger sequencing and analyzed for possible pathogenicity by in silico programs and, where possible, by segregation analyses. RESULTS: Sequencing was successful in 159 of 168 patients and identified the second disease-associated allele in 49 of 103 (~48%) of patients with one previously identified mutation. Among those with no mutations, both disease-associated alleles were detected in 4 of 56 patients, and one mutation was detected in 10 of 56 patients. The authors detected a total of 57 previously unknown, possibly pathogenic, variants: 29 missense, 4 nonsense, 9 small deletions and 15 splice-site-altering variants. Of these, 55 variants were deemed pathogenic by a combination of predictive methods and segregation analyses. CONCLUSIONS: Many mutations in the coding sequences of the ABCA4 gene are still unknown, and many possibly reside in noncoding regions of the ABCA4 locus. Although the ABCA4 array remains a good first-pass screening option, the NGS platform is a time- and cost-efficient tool for screening large cohorts.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
17 Several studies have identified frequent "ethnic group-specific" ABCA4 alleles, such as the c.2588Gb0e;C variant resulting in a dual effect, p.G863A/delG863, as a founder mutation in Northern European patients with STGD17 and a complex allele (two variants on the same chromosome), p.L541P/A1038V, in both STGD1 and CRD patients of German origin (Fig. 2B).3,8 Complex ABCA4 alleles are not uncommon in STGD1.9 In fact, they are detected in approximately 10% of all STGD patients.10 Allelic heterogeneity has substantially complicated genetic analyses of ABCA4-associated retinal disease. Login to comment

[hide] Clinical and molecular genetic study of 12 Italian... Genet Mol Res. 2012 Dec 17;11(4):4342-50. doi: 10.4238/2012.October.9.3. Oldani M, Marchi S, Giani A, Cecchin S, Rigoni E, Persi A, Podavini D, Guerrini A, Nervegna A, Staurenghi G, Bertelli M
Clinical and molecular genetic study of 12 Italian families with autosomal recessive Stargardt disease.
Genet Mol Res. 2012 Dec 17;11(4):4342-50. doi: 10.4238/2012.October.9.3., [PMID:23096905]

Abstract [show]
Stargardt disease was diagnosed in 12 patients from 12 families using complete ophthalmologic examination, fundus photography, fundus autofluorescence, and spectral-domain optical coherence tomography. DNA was extracted for polymerase chain reaction (PCR) and direct DNA sequencing (ABCA4 gene). Genetic counseling and eye examination were offered to 16 additional family members. Various patterns of presentation were observed in patients with clinical diagnoses of Stargardt disease. The genetic study identified 2 mutations in 75% of families (9/12); a second mutation could not be found in the remaining 25% of families (3/12). The most frequent mutation was G1961E, found in 17% of families (2/12). This finding is similar to that of a previous analysis report of an Italian patient series. Four new mutations were also identified: Tyr1858Asp, Leu1195fsX1196, p.Tyr850Cys, and p.Thr959Ala. Our results suggest that PCR and direct DNA sequencing are the most appropriate techniques for the analysis of the ABCA4 gene. However, this method requires supplementation with specific PCR analysis to diagnose large deletions. The study of the families identified healthy carriers and affected subjects in presymptomatic stages and was also useful for evaluating the risk of transmission to progeny. Combined ophthalmologic and genetic evaluation enabled better clinical management of these families.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 of patients Subject Allele 1 Allele 2 Age of diagnosis (years) Visual acuity Right eye Left eye 1 F1 ID81 Tyr1858Asp Met1Val; Arg2030Gln 22 20/50 20/32 2 F2 ID220 Ile156Val Gly607Arg; Gly1961Glu 30 20/800 20/400 3 F3 ID362 Met1Val Gly1961Glu; Arg2030Gln 60 20/40 20/32 4 F4 ID197 Asp1532Asn Arg2030term 40 20/32 20/32 5 F6 ID363 Tyr362Term Gly863Ala 16 20/200 20/250 6 F7 ID365 Arg1098Cys Cys1488Arg 50 20/32 20/800 7 F8 ID394 Arg18Trp Val767Asp 10 20/800 20/800 8 F9 ID396 IVS40+5G>A IVS13+1G>A 19 20/40 20/50 9 F10 ID366 p.Gln1513Profs*42 - 20 20/200 20/200 10 F12 ID377 Leu1195Argfs*2 - 50 20/32 20/20 11 F13 ID4 Cys2150Tyr - 70 20/400 20/400 12 F17 ID457 p.Tyr850Cys p.Thr959Ala 50 20/20 20/40 F1 = family 1; ID = reference code to a specific patient. Login to comment

[hide] Detection rate of pathogenic mutations in ABCA4 us... Arch Ophthalmol. 2012 Nov;130(11):1486-90. doi: 10.1001/archophthalmol.2012.1697. Downes SM, Packham E, Cranston T, Clouston P, Seller A, Nemeth AH
Detection rate of pathogenic mutations in ABCA4 using direct sequencing: clinical and research implications.
Arch Ophthalmol. 2012 Nov;130(11):1486-90. doi: 10.1001/archophthalmol.2012.1697., [PMID:23143460]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 In 5 of the 11 patients, the identification of 2 pathogenic mutations confirmed the historical diagnosis and all had chorioretinal atro- Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 1 1Ab0e;G M1V 2588Gb0e;C G863A In trans Unaffected parents carriers 30 STGD maf9;/0/0 R2030Q 3 PVs 2 161Gb0e;A C54Y 2588Gb0e;C G863A In trans Affected sibling with same mutations 12 STGD m/0/0 0 2 PVs 3 161Gb0e;A C54Y 5882Gb0e;A G1961E NK NK 18 STGD m/0/0 0 2 PVs 4 634Cb0e;T R212C 4457Cb0e;T P1486L In trans Unaffected parents carriers 17 STGD m/0/0 0 2 PVs 5 2588Gb0e;C G863A 4469Gb0e;A C1490Y NK NK 48 STGD maf9;/0/1 0 2 PVs 6 2971Gb0e;C G991R 4254-2Ab0e;G Splice NK NK 21 STGD m/0/0 0 2 PVs 7 2971Gb0e;C G991R 3602Tb0e;G L1201R NK NK 18 STGD maf9;af9;/NP/NP V643M (likely), G885E (likely), G1441D (unlikely), V2244V (highly likely) b0e;2 PVs 8 3322Cb0e;T R1108C 768Gb0e;T V256V NK NK 13 STGD maf9;af9;/1/1 0 2 PVs 9 3322Cb0e;T R1108C 6079Cb0e;T L2027F NK NK 26 STGD maf9;/0/0 0 2 PVs 10 3386Gb0e;T R1129L 4469Gb0e;A C1490Y In trans Unaffected parents carriers 15 STGD maf9;/0/0 R152Q (unlikely) 2 PVs (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1486 phy on current clinical examination, consistent with progression of the disorder.5 One of the 11 patients with chorioretinal atrophy (subject 40) had a single stop codon, again strongly supporting the original clinical diagnosis. Six of the 11 patients did not have pathogenic mutations in ABCA4. Login to comment
30 In 3 of the 6 patients with a historical diagnosis Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients (continued) Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 11 4139Cb0e;T P1380L 5714 af9; 5Gb0e;A Splice NK NK 19 STGD m/0/0 0 2 PVs 12 4457Cb0e;T P1486L 4457Cb0e;T P1486L In trans Unaffected sibling carries 1 mutation 25 STGD maf9;af9;/1/1 0 2 PVs 13 4537dupC Q1513fs 6391Gb0e;A E2131K In trans Unaffected parents carriers 10 STGD maf9;/0/0 R152Q in cis with Q1513fs, E2131K in cis with E471K 2 PVs 14 6079Cb0e;T L2027F 6079Cb0e;T L2027F In trans Unaffected sibling carrier 28 STGD maf9;af9;/0/0 0 2 PVs 15 5018 af9; 2Tb0e;C NA 6316Cb0e;T R2106C In trans Affected sibling with same mutations 17 STGD m/0/1 0 2 PVs 16 3004Cb0e;T R1002Wb 1957Cb0e;T R653C In trans NK 16 STGD m/0/1 0 2 PVs 17 1253Tb0e;C F418S 2588Gb0e;C G863A NK NK 52 STGD maf9;/0/0 0 2 PVs 18 6709Ab0e;C T2237Pb 3064Gb0e;A E1022K In trans 2 Affected siblings with same mutations 6 STGD maf9;af9;/0/0 0 2 PVs 19 5260Tb0e;G Y1754D 4469Gb0e;A C1490Y In trans NK 12 STGD maf9;af9;/0/0 0 2 PVs 20 551Cb0e;T S184Fb 4793Cb0e;A A1598D NK 2 Affected siblings with same mutations 58 STGD m/NP/NP 0 2 PVs 21 550-551TCb0e;CG S184Rb 5882Gb0e;A G1961E In trans Affected sibling with same mutations 25 STGD maf9;af9;/0/0 0 2 PVs 22 5313-3Cb0e;G Spliceb 5882Gb0e;A G1961E In trans Unaffected parents carriers 47 STGD m/0/1 0 2 PVs 23 2588Gb0e;C G863A 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans NA 26 STGD maf9;af9;/3/1 1 In cis with G863A 2 PVs 24 5537Tb0e;C I1846T 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected son carries I1846T only 17 STGD maf9;af9;/3/3 0 2 PVs 25 6089Gb0e;A R2030Q 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected sibling carries R2030Q 4 STGD m/NP/NP 0 2 PVs 26 6730-1Gb0e;C Spliceb 2588Gb0e;C G863A NK NK 15 STGD NP/NP/NP 0 2 PVs 27 3291Ab0e;T R1097Sb 3056Cb0e;T T1019M In trans NK 9 STGD NP/NP/NP 1 In cis with R1097S 2 PVs 28 498delT L167HisfsX2b Not present NA NA NK 28 STGD m/1/1 0 1 PV 29 2345Gb0e;A W782Xb Not present NA NA Unaffected mother carries mutation 25 STGD m/1/1 0 1 PV 30 2588Gb0e;C G863A 4326Cb0e;A N1442K NK NK 36 STGD maf9;/0/0 0 1 PV af9; N1442K (unlikely) 31 2966Tb0e;C V989A Not present NA NA NK 49 STGD m/1/1 0 1 PV (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1487 (c)2012 American Medical Association. All rights reserved. Downloaded From: http://archopht.jamanetwork.com/ by a Semmelweis University Budapest User on 12/06/2015 lopathy is genetically heterogeneous. A total of 10 novel mutations were identified (Table). Login to comment

[hide] Retinoid binding properties of nucleotide binding ... J Biol Chem. 2012 Dec 28;287(53):44097-107. doi: 10.1074/jbc.M112.409623. Epub 2012 Nov 9. Biswas-Fiss EE, Affet S, Ha M, Biswas SB
Retinoid binding properties of nucleotide binding domain 1 of the Stargardt disease-associated ATP binding cassette (ABC) transporter, ABCA4.
J Biol Chem. 2012 Dec 28;287(53):44097-107. doi: 10.1074/jbc.M112.409623. Epub 2012 Nov 9., [PMID:23144455]

Abstract [show]
The retina-specific ATP binding cassette transporter, ABCA4 protein, is associated with a broad range of inherited macular degenerations, including Stargardt disease, autosomal recessive cone rod dystrophy, and fundus flavimaculatus. In order to understand its role in retinal transport in rod out segment discs, we have investigated the interactions of the soluble domains of ABCA4 with both 11-cis- and all-trans-retinal. Using fluorescence anisotropy-based binding analysis and recombinant polypeptides derived from the amino acid sequences of the four soluble domains of ABCA4, we demonstrated that the nucleotide binding domain 1 (NBD1) specifically bound 11-cis-retinal. Its affinity for all-trans-retinal was markedly reduced. Stargardt disease-associated mutations in this domain resulted in attenuation of 11-cis-retinal binding. Significant differences in 11-cis-retinal binding affinities were observed between NBD1 and other cytoplasmic and lumenal domains of ABCA4. The results suggest a possible role of ABCA4 and, in particular, the NBD1 domain in 11-cis-retinal binding. These results also correlate well with a recent report on the in vivo role of ABCA4 in 11-cis-retinal transport.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Lane 1, WT-NBD1; lane 2, mutant P940R; lane 3, mutant R943Q; lane 4, mutant G863A. Login to comment
171 Error bars, S.D. TABLE 1 Thermodynamic and kinetic parameters of 11-cis-retinal binding and nucleotide hydrolysis for wild-type and mutant NBD1 proteins Parameter Wild type R943Q P940R G863A Enzyme kinetics Vmax (pmol/min/mg) ATP 584 392 129 128 CTP 376 172 84 104 Retinal binding 11-cis-Retinal Kd (M) 8.0 afe; 1.3 afb; 10afa;8 8.0 afe; 2.0 afb; 10afa;6 4.0 afe; 1.4 afb; 10afa;6 c56;1.0 afb; 10afa;5 11-cis-Retinal af9; 1.0 mM AMP-PNP Kd (M) 4.1 afe; 0.6 afb; 10afa;6 NDa ND ND 11-cis-Retinal af9; 1.0 mM ADP Kd (M) 3.6 afe; 0.8 afb; 10afa;7 ND ND ND -Fold inhibition NAb 100 50 NA Disease severity af9;/afa; af9;af9; af9;af9; a ND, not detectable with a ᐵ11-cis-retinalᐶ of c55;1 afb; 10afa;5 M. b NA, not applicable. Login to comment
174 Three ABCA4 mutations associated with Stargardt disease (R943Q, P940R, and G863A) were chosen for analysis in this study. Login to comment
178 We have explored the effects of missense mutations R943Q, P940R, and G863A on 11-cis-retinal interaction with the NBD1. Login to comment
180 The binding of mutant G863A was significantly attenuated as indicated by the drastic right shift of the binding isotherm as well as its inability to achieve saturation in the presence of a high concentration of protein (Fig. 6A). Login to comment
183 The retinal binding of the G863A mutant was severely attenuated, and the Kd was c56;1.0 afb; 10afa;5 M. DISCUSSION The ABCA4 protein is an essential component of the visual transduction cycle of vertebrate retina. Login to comment
196 A, titration of 100 nM 11-cis-retinal with mutant G863A. Login to comment
215 Three missense mutations in NBD1 were examined in this study, R943Q, P940R, and G863A. Login to comment
219 The most significant change was observed with G863A, in which saturation binding was no longer observed. Login to comment

[hide] Novel mutations in CRB1 and ABCA4 genes cause Lebe... Eur J Hum Genet. 2013 Nov;21(11):1266-71. doi: 10.1038/ejhg.2013.23. Epub 2013 Feb 27. Jonsson F, Burstedt MS, Sandgren O, Norberg A, Golovleva I
Novel mutations in CRB1 and ABCA4 genes cause Leber congenital amaurosis and Stargardt disease in a Swedish family.
Eur J Hum Genet. 2013 Nov;21(11):1266-71. doi: 10.1038/ejhg.2013.23. Epub 2013 Feb 27., [PMID:23443024]

Abstract [show]
This study aimed to identify genetic mechanisms underlying severe retinal degeneration in one large family from northern Sweden, members of which presented with early-onset autosomal recessive retinitis pigmentosa and juvenile macular dystrophy. The clinical records of affected family members were analysed retrospectively and ophthalmological and electrophysiological examinations were performed in selected cases. Mutation screening was initially performed with microarrays, interrogating known mutations in the genes associated with recessive retinitis pigmentosa, Leber congenital amaurosis and Stargardt disease. Searching for homozygous regions with putative causative disease genes was done by high-density SNP-array genotyping, followed by segregation analysis of the family members. Two distinct phenotypes of retinal dystrophy, Leber congenital amaurosis and Stargardt disease were present in the family. In the family, four patients with Leber congenital amaurosis were homozygous for a novel c.2557C>T (p.Q853X) mutation in the CRB1 gene, while of two cases with Stargardt disease, one was homozygous for c.5461-10T>C in the ABCA4 gene and another was carrier of the same mutation and a novel ABCA4 mutation c.4773+3A>G. Sequence analysis of the entire ABCA4 gene in patients with Stargardt disease revealed complex alleles with additional sequence variants, which were evaluated by bioinformatics tools. In conclusion, presence of different genetic mechanisms resulting in variable phenotype within the family is not rare and can challenge molecular geneticists, ophthalmologists and genetic counsellors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 None of our healthy controls carried the c.5461-10T4C mutation, in line with previous observations of different population carrier frequencies.35 Interestingly, our STGD1 patients carried the sequence variant ABCA4 p.N1868I that was predicted to be possibly damaging, as well as acting as a risk-increasing factor in AMD.36 In our study, this variant was detected in almost 14% of the healthy controls, which is higher compared with the maximal frequency of 7.5% reported in a Finnish population in the 1000 Genomes project.36 It is worth mentioning that ABCA4 c.2588G4C (p.G863A), the most frequent autosomal recessive mutation in the European population, is disease causative only in combination with a severe ABCA4 mutation,32 and does not result in a STGD1 phenotype when present bi-allelic or in combination with a mild ABCA4 mutation. Login to comment

[hide] A longitudinal study of stargardt disease: clinica... Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15. Fujinami K, Lois N, Davidson AE, Mackay DS, Hogg CR, Stone EM, Tsunoda K, Tsubota K, Bunce C, Robson AG, Moore AT, Webster AR, Holder GE, Michaelides M
A longitudinal study of stargardt disease: clinical and electrophysiologic assessment, progression, and genotype correlations.
Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15., [PMID:23499370]

Abstract [show]
PURPOSE: To investigate the clinical and electrophysiologic natural history of Stargardt disease and correlate with the genotype. DESIGN: Cohort study of 59 patients. METHODS: Clinical history, examination, and electrophysiologic assessment were undertaken in a longitudinal survey. Patients were classified into 3 groups based on electrophysiologic findings, as previously published: Group 1 had dysfunction confined to the macula; Group 2 had macular and generalized cone system dysfunction; and Group 3 had macular and both generalized cone and rod system dysfunction. At baseline, there were 27 patients in Group 1, 17 in Group 2, and 15 in Group 3. Amplitude reduction of >50% in the relevant electroretinogram (ERG) component or a peak time shift of >3 ms for the 30 Hz flicker ERG or bright flash a-wave was considered clinically significant ERG deterioration. Molecular screening of ABCA4 was undertaken. RESULTS: The mean age at baseline was 31.7 years, with the mean follow-up interval being 10.5 years. A total of 22% of patients from Group 1 showed ERG group transition during follow-up, with 11% progressing to Group 2 and 11% to Group 3. Forty-seven percent of patients in Group 2 progressed to Group 3. There was clinically significant ERG deterioration in 54% of all subjects: 22% of Group 1, 65% of Group 2, and 100% of Group 3. At least 1 disease-causing ABCA4 variant was identified in 47 patients. CONCLUSIONS: All patients with initial rod ERG involvement demonstrated clinically significant electrophysiologic deterioration; only 20% of patients with normal full-field ERGs at baseline showed clinically significant progression. Such data assist counseling by providing more accurate prognostic information and are also highly relevant in the design, patient selection, and monitoring of potential therapeutic interventions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Clinical Data and Molecular Genetic Status of 59 Patients With Stargardt Disease Pt Onset (y) Age (y) logMAR VA Variants Identifieda BL FU BL FU 1 16 17 26 0.0/1.0 0.0/0.48 c.768G>T / p.Gly863Ala / p.Arg943Gln 2 15 17 25 0.78/0.78 1.0/1.0 p. Arg1443His 3 11 18 27 0.78/1.0 1.0/1.0 p.Trp439* / p.Gly863Ala / p.Leu1970Phe 4 19 21 32 0.78/0.78 1.0/1.0 p.Leu2027Phe 5 10 22 30 0.48/0.48 1.0/0.78 p.Gly863Ala / p.Arg943Gln / c.5461-10 T>C 6 18 26 37 0.78/1.0 1.0/1.0 p.Pro1380Phe 7 25 28 40 0.78/1.0 1.3/0.78 ND 8 24 29 38 1.0/0.78 1.0/1.0 p.Phe418Ser / p.Leu2027Phe 9 24 31 44 1.0/1.0 1.3/1.0 c.4253&#fe;5 G>T / p.Gly1507Arg 10 26 32 44 0.78/0.78 1.0/1.0 p.Cys1490Tyr / p.Arg2030Gln 11 31 34 46 0.18/0.3 0.6/0.7 ND 12 17 35 47 1.0/1.0 1.0/1.0 p.Asn96His 13 23 35 45 1.0/0.3 1.0/0.48 p.Gly1513Profs*1554 14 33 37 48 0.18/1.48 1.0/1.3 ND 15 38 40 51 0.18/0.78 1.0/1.0 p.Arg2107His 16 42 43 53 0.0/0.0 1.0/1.0 ND 17 22 48 59 1.0/1.0 1.0/1.0 p.Cys54Tyr 18 20 49 59 1.0/0.6 1.0/1.0 p.Pro1380Leu / p.Gly1961Glu 19 35 50 61 1.0/0.3 1.0/1.0 p.Arg1108Cys 20 25 56 67 1.3/0.18 1.0/1.0 p.Trp439* / p.Gly863Ala 21 48 59 71 1.0/0.78 1.0/1.0 p. Ile156 Val / p. Cys1455Arg / p. Phe1839Ser 22 21 22 31 0.3/1.0 1.0/1.0 p.Arg2107His 23 21 23 33 1.0/1.0 1.0/1.0 p.Gly863Ala 24 48 64 73 0.0/1.0 0.18/3.0 p.Tyr1652* 25 17 19 29 0.78/0.3 1.0/1.0 c.5461-10 T>C 26 17 21 33 1.0/0.78 1.0/1.0 ND 27 27 53 66 1.78/1.78 1.3/1.0 p.Ser1071Cysfs*1084 28 5 14 21 0.78/0.78 1.0/1.0 p.Arg408* / p.Val675lle 29 9 15 27 1.08/1.08 1.0/1.0 p.Cys2150Tyr 30 14 24 32 1.0/0.78 1.0/1.0 ND 31 18 28 39 1.0/1.0 1.0/1.0 p.Gly863Ala / p.Arg1108Cys / p.Arg943Gln 32 14 29 37 1.0/1.0 1.0/1.0 p.Arg653Cys / p.Arg2030Gln 33 19 29 40 1.0/1.0 1.0/1.08 ND 34 34 40 49 0.3/0.48 1.0/1.0 p.Gly863Ala / p.Glu1087Lys 35 25 43 54 1.0/1.0 1.0/1.0 p.Cys54Tyr / p.Gly863Ala 36 38 60 69 1.0/1.0 1.3/1.08 p.Val931Met / c.5461-10 T>C 37 10 11 20 1.0/0.78 1.3/1.3 p.Pro1380Leu 38 10 15 23 1.0/1.0 1.3/1.3 p.Ser1071Cysfs*1084 / p.Pro1380Leu 39 24 25 38 1.56/0.3 2.0/2.0 c.5461-10 T>C / c.5714&#fe;5 G>A 40 18 26 36 1.3/1.3 2.0/1.3 ND 41 32 33 45 0.48/0.48 1.0/1.0 ND 42 32 35 46 1.3/0.0 3.0/1.0 p.Cys54Tyr 43 30 35 45 0.48/0.48 2.0/1.3 ND 44 15 41 49 1.3/1.3 2.0/1.3 p.Asn965Ser 45 8 8 20 0.78/0.78 1.0/1.0 p.Thr1019Met 46 10 11 23 1.0/1.0 1.0/1.0 p.Thr1019Met 47 8 12 24 2.0/1.56 1.78/1.48 p.Cys2150Tyr 48 17 18 26 1.0/0.78 1.3/1.0 c.5461-10 T>C / p.Leu2027Phe 49 8 21 33 1.3/1.3 2.0/2.0 p.Asp574Aspfs*582 50 8 27 39 2.0/1.56 1.78/1.48 c.5461-10 T>C 51 24 31 43 1.18/1.18 1.08/1.3 p.Arg1640Trp / p.Leu2027Phe Continued on next page respective electrophysiologic traces appear in Figure 2. Login to comment
179 All 3 unrelated patients (1, 5, and 31) harboring p.Arg943Gln also had p.Gly863Ala, suggesting linkage disequilibrium of these 2 substitutions, with none of these subjects having clinically significant ERG deterioration. Login to comment
209 Co-inheritance of p.Arg943Gln and p.Gly863Ala has been previously reported,44,45 with p.Arg943Gln thought to be a benign polymorphism29,45 and p.Gly863Ala believed to be associated with milder phenotypes,42,45 although there has been a single report of a severe phenotype associated with p.Gly863Ala in the homozygous configuration.44 Only 2 out of 8 patients harboring p.Gly863Ala in the present series had evidence of ERG progression, suggesting this variant is indeed likely to be associated with milder disease. Login to comment

[hide] Stargardt disease: towards developing a model to p... Eur J Hum Genet. 2013 Oct;21(10):1173-6. doi: 10.1038/ejhg.2013.92. Epub 2013 May 22. Heathfield L, Lacerda M, Nossek C, Roberts L, Ramesar RS
Stargardt disease: towards developing a model to predict phenotype.
Eur J Hum Genet. 2013 Oct;21(10):1173-6. doi: 10.1038/ejhg.2013.92. Epub 2013 May 22., [PMID:23695285]

Abstract [show]
Stargardt disease is an ABCA4-associated retinopathy, which generally follows an autosomal recessive inheritance pattern and is a frequent cause of macular degeneration in childhood. ABCA4 displays significant allelic heterogeneity whereby different mutations can cause retinal diseases with varying severity and age of onset. A genotype-phenotype model has been proposed linking ABCA4 mutations, purported ABCA4 functional protein activity and severity of disease, as measured by degree of visual loss and the age of onset. It has, however, been difficult to verify this model statistically in observational studies, as the number of individuals sharing any particular mutation combination is typically low. Seven founder mutations have been identified in a large number of Caucasian Afrikaner patients in South Africa, making it possible to test the genotype-phenotype model. A generalised linear model was developed to predict and assess the relative pathogenic contribution of the seven mutations to the age of onset of Stargardt disease. It is shown that the pathogenicity of an individual mutation can differ significantly depending on the genetic context in which it occurs. The results reported here may be used to identify suitable candidates for inclusion in clinical trials, as well as guide the genetic counselling of affected individuals and families.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 This study considers a South African cohort of 118 individuals who express biallelic combinations of seven founder mutations in ABCA4 (c.454C4T (p.Arg152*), c.768G4T (p.Val256Val), c.1804C4T (p.Arg602Trp), c.2588G4C (p.Gly863Ala), c.4469G4A (p.Cys1490Tyr), c.5461-10T4C, c.6079C4T (p.Leu2027Phe)), which collectively account for 36% of STGD cases studied to date in South Africa.19,20 These data, together with clinical information for each patient, were used to test the genotype-phenotype model. Login to comment
33 Table 1 A summary of the 23 mutation combinations observed in 118 patients with STGD, showing the number of patients per combination and the average and median AOO (in years) per combination Mutation 1 Mutation 2 Number of patients Average AOO (years) Median AOO (years) c.5461-10T4C c.768G4T (p.Val256Val) 1 6 6 c.5461-10T4C c.5461-10T4C 2 6.5 6.5 c.1804C4T (p.Arg602Trp) c.768G4T (p.Val256Val) 3 6.7 6 c.5461-10T4C c.454C4T (p.Arg152*) 3 7 8 c.4469G4A (p.Cys1490Tyr) c.454C4T (p.Arg152*) 6 7.8 8 c.768G4T (p.Val256Val) c.454C4T (p.Arg152*) 4 8 9 c.768G4T (p.Val256Val) c.768G4T (p.Val256Val) 1 8 8 c.4469G4A (p.Cys1490Tyr) c.4469G4A (p.Cys1490Tyr) 9 8.1 8 c.6079C4T (p.Leu2027Phe) c.454 C4T (p.Arg152*) 7 8.2 7 c.4469G4A (p.Cys1490Tyr) c.1804C4T (p.Arg602Trp) 13 8.6 8 c.4469G4A (p.Cys1490Tyr) c.5461-10T4C 13 8.8 9 c.4469G4A (p.Cys1490Tyr) c.768G4T (p.Val256Val) 10 10.3 9 c.4469G4A (p.Cys1490Tyr) c.6079C4T (p.Leu2027Phe) 12 10.3 9.5 c.6079C4T (p.Leu2027Phe) c.5461-10T4C 3 11 10 c.1804C4T (p.Arg602Trp) c.5461-10T4C 1 11 11 (c.1804C4T (p.Arg602Trp) c.6079C4T (p.Leu2027Phe) 8 12 11 c.6079C4T (p.Leu2027Phe) c.768G4T (p.Val256Val) 6 12.5 13 c.768G4T (p.Val256Val) c.2588G4C (p.Gly863Ala) 3 16.7 18 c.1804C4T (p.Arg602Trp) c.2588G4C (p.Gly863Ala) 2 17.5 17.5 c.4469G4A (p.Cys1490Tyr) c.2588G4C (p.Gly863Ala) 4 18.5 19 c.5461-10T4C c.2588G4C (p.Gly863Ala) 1 20 20 c.6079C4T (p.Leu2027Phe) c.6079C4T (p.Leu2027Phe) 2 28 28 c.2588G4C (p.Gly863Ala) c.454C4T (p.Arg152*) 4 28 30 In some cases, the average AOO of a given mutation differed significantly depending on the mutational context in which it occurred. Login to comment
45 Table 2 Covariates included in the generalised linear model (with inverse link function) with their respective coefficients, standard errors and P-values Covariate Coefficient Standard error P-value (Intercept) 0.0460 0.0106 3.53e 05 c.4469G4A (p.Cys1490Tyr) 0.0528 0.0076 2.71e 10 c.1804C4T (p.Arg602Trp) 0.0468 0.0085 2.33e 07 c.6079C4T (p.Leu2027Phe) 0.0090 0.0089 0.3117 c.5461-10T4C 0.0562 0.0106 6.59e 07 c.768G4T (p.Val256Val) 0.0507 0.0083 2.06e 08 c.2588G4C (p.Gly863Ala) 0.0413 0.0081 1.58e 06 c.454C4T (p.Arg152*) 0.0311 0.0080 0.0002 c.4469G4A (p.Cys1490Tyr) (homozygous) 0.0336 0.0144 0.0214 c.4469G4A (p.Cys1490Tyr): c.5461-10T4C 0.0419 0.0146 0.0049 c.4469G4A (p.Cys1490Tyr): c.1804C4T (p.Arg602Trp) 0.0295 0.0145 0.0442 c.4469G4A (p.Cys1490Tyr): c.768G4T (p.Val256Val) 0.0520 0.0134 0.0002 c.6079C4T (p.Leu2027Phe): c.454C4T (p.Arg152*) 0.0519 0.0158 0.0013 Figure 1 Graph depicting the actual and predicted average AOO with 95% confidence bands for each mutation combination observed in five or more patients. Login to comment
53 The mutation combinations not detected in the cohort were c.454C4T (p.Arg152*) (homozygous), c.1804C4T (p.Arg602Trp) (homozygous), c.2588G4C (p.Gly863Ala) (homozygous), c.454C4T (p.Arg152*):c.1804C4T (p.Arg602Trp) and c.2588G4C (p.Gly863Ala): c.6079C4T (p.Leu2027Phe). Login to comment
57 The c.2588G4C (p.Gly863Ala): c.6079C4T (p.Leu2027Phe) combination may be an example of this, as this combination has not yet been reported in the literature, to the best of our knowledge, and c.2588G4C (p.Gly863Ala) was previously proposed as a mild mutation.16 Lastly, and least likely, the mutation combination may be so severe that it leads to panretinal atrophy and therefore would not be identified in this STGD patient cohort. Login to comment

[hide] Characterization of stargardt disease using polari... Invest Ophthalmol Vis Sci. 2013 Sep 27;54(9):6416-25. doi: 10.1167/iovs.12-11550. Ritter M, Zotter S, Schmidt WM, Bittner RE, Deak GG, Pircher M, Sacu S, Hitzenberger CK, Schmidt-Erfurth UM
Characterization of stargardt disease using polarization-sensitive optical coherence tomography and fundus autofluorescence imaging.
Invest Ophthalmol Vis Sci. 2013 Sep 27;54(9):6416-25. doi: 10.1167/iovs.12-11550., [PMID:23882696]

Abstract [show]
PURPOSE: To identify disease-specific changes in Stargardt disease (STGD) based on imaging with polarization-sensitive spectral-domain optical coherence tomography (PS-OCT) and to compare structural changes with those visible on blue light fundus autofluorescence (FAF) imaging. METHODS: Twenty-eight eyes of 14 patients diagnosed with STGD were imaged using a novel high-speed, large-field PS-OCT system and FAF (excitation 488 nm, emission > 500 nm). The ophthalmoscopic phenotype was classified into three groups. ABCA4 mutation testing detected 15 STGD alleles, six of which harbor novel mutations. RESULTS: STGD phenotype 1 (12 eyes) showed sharply delineated areas of absent RPE signal on RPE segmentation B-scans of PS-OCT correlating with areas of hypofluorescence on FAF. Adjacent areas of irregular fluorescence correlated with an irregular RPE segmentation line with absence of overlaying photoreceptor layers. Eyes characterized on OCT by a gap in the subfoveal outer segment layer (foveal cavitation) showed a normal RPE segmentation line on PS-OCT. Hyperfluorescent flecks on FAF in phenotype 2 STGD (8 eyes) were identified as clusters of depolarizing material at the level of the RPE. Distribution of flecks could be depicted on RPE elevation maps. An increased amount of depolarizing material in the choroid was characteristic for STGD Phenotype 3 (8 eyes). CONCLUSIONS: PS-OCT together with FAF identified characteristic patterns of changes in different stages of the disease. PS-OCT is a promising new tool for diagnosis and evaluation of future treatment modalities in STGD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 [2588G>C; 2828G>A] (p.[Gly863Ala; Arg943Gln]) and a, so far unknown, missense mutation in exon 22, c.3266C>T (p.Thr1089Ile), which affects a highly conserved threonine residue within the transmembrane helix and is predicted to be deleterious. Login to comment
197 [2588G>C; 2828G>A] p.[Gly863Ala; Arg943Glu]; II: c.5714&#fe;5G>A; III: c.5882G>A p.Gly1961Glu) or severe (c. Login to comment

[hide] Clinical and molecular analysis of Stargardt disea... Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003. Fujinami K, Sergouniotis PI, Davidson AE, Wright G, Chana RK, Tsunoda K, Tsubota K, Egan CA, Robson AG, Moore AT, Holder GE, Michaelides M, Webster AR
Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function.
Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003., [PMID:23953153]

Abstract [show]
PURPOSE: To describe a cohort of patients with Stargardt disease who show a foveal-sparing phenotype. DESIGN: Retrospective case series. METHODS: The foveal-sparing phenotype was defined as foveal preservation on autofluorescence imaging, despite a retinopathy otherwise consistent with Stargardt disease. Forty such individuals were ascertained and a full ophthalmic examination was undertaken. Following mutation screening of ABCA4, the molecular findings were compared with those of patients with Stargardt disease but no foveal sparing. RESULTS: The median age of onset and age at examination of 40 patients with the foveal-sparing phenotype were 43.5 and 46.5 years. The median logMAR visual acuity was 0.18. Twenty-two patients (22/40, 55%) had patchy parafoveal atrophy and flecks; 8 (20%) had numerous flecks at the posterior pole without atrophy; 7 (17.5%) had mottled retinal pigment epithelial changes; 2 (5%) had multiple atrophic lesions, extending beyond the arcades; and 1 (2.5%) had a bull's-eye appearance. The median central foveal thickness assessed with spectral-domain optical coherence tomographic images was 183.0 mum (n = 33), with outer retinal tubulation observed in 15 (45%). Twenty-two of 33 subjects (67%) had electrophysiological evidence of macular dysfunction without generalized retinal dysfunction. Disease-causing variants were found in 31 patients (31/40, 78%). There was a higher prevalence of the variant p.Arg2030Gln in the cohort with foveal sparing compared to the group with foveal atrophy (6.45% vs 1.07%). CONCLUSIONS: The distinct clinical and molecular characteristics of patients with the foveal-sparing phenotype are described. The presence of 2 distinct phenotypes of Stargardt disease (foveal sparing and foveal atrophy) suggests that there may be more than 1 disease mechanism in ABCA4 retinopathy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 Mutation screening of ABCA4 was performed with the arrayed primer extension (APEX) microarray (ABCR400 chip, Asper Ophthalmics, TABLE 1. Summary of Clinical Findings and Molecular Status of 40 Patients With a Foveal-Sparing Phenotypea of Stargardt Disease Patient Onsetb (y) Age (y) LogMAR Visual Acuity Fundus Patternc OCT ERGe Mutation Status CFTd (mm) ORT Group PERG mfERG OD OS OD OS OD OS OD OS 1 45 45 0 0 3 219 223 NA NA NA NA NA [c.1411 G>A, p.Glu471Lys/c.2588 G>C, p. Gly863Ala/c.4594 G>A, p.Asp1532Asn/c.5693 G>A, p.Arg1898His] 2 33 33 0.18 0.48 1 NA NA 3 ND ND NA NA [c.1622 T>C, p.Leu541Pro/c.3113 C>T, p.Ala1038Val/c.6089 G>A, p.Arg2030Gln] 3 53 66 0.18 0.18 1 NA NA 2 A A NA NA [c.768 G>T, Splice site/c. 6320 G>A, p. Arg2107His ] 4 37 54 1.48 0.18 1 32 39 U 3 ND ND 2 2 [c.1760 &#fe;1 G>T, Splice site/c.4594 G>T, p.Asg1532Tyr ] 5 57 57 0.3 0.18 1 NA NA 1 ND ND NA NA [c. Login to comment
47 6089 G>A, p.Arg2030Gln/c.6118 C>T, p.Arg2040*] 8 39 44 0.1 0.1 4 297 230 U 3 A A NA NA [c.71 G>A, p.Arg24His/c.4577 C>T, p. Thr1526Met] 9 35* 35 0.18 0.18 2 142 154 3 ND ND NA NA [c.658 C>T, p.p.Arg220Cys/c.2588 G>C, p. Gly863Ala] 10 45 54 0.48 0.18 1 102 116 3 ND A NA NA [c.1957 C>T, p.Arg653Cys/c.5693 G>A, p.Arg1898His] 11 43 43 0.1 0 2 170 185 1 A A 2 2 [c.2588 G>C, p. Gly863Ala/c.4139 C>T, p.Ala1038Val] 12 36** 38 0.3 0 1 220 212 U 1 A A 1 1 [c.4139 C>T, p.Ala1038Val/c.4594 G>T, p.Asp1532Asn] 13 62 68 0.1 0.48 1 196 189 U 1 N N 2 2 [c.4222 T>C, p.Trp1408Arg/c.4918 C>T, p.Arg1640Trp] 14 36 44 0.48 0.48 3 79 89 1 A A NA NA [c.4222 T>C, p.Trp1408Arg/c.4918 C>T, p.Arg1640Trp] 15 46* 46 0.1 0.1 3 NA NA 1 A A NA NA [c.4469 G>A, p.Cys1490Tyr/c. Login to comment
48 6089 G>A, p.Arg2030Gln] 16 44* 44 0.18 0 2 NA NA 1 A A NA NA [c.6079 C>T, p.Leu2027Phe/c.6079 C>T, p.Leu2027Phe] 17 48 73 0.18 3 4 135 86 U 2 A ND NA NA [c.4956 T>G, p.Tyr1652*] 18 56 57 0 0 2 254 273 1 ND A NA NA [c.5018&#fe;2 T>C, Splice site] 19 53* 53 0.48 0.18 1 137 133 1 A A NA NA [c.5461-10 T>C, Splice site] 20 49 58 0.18 0 1 256 222 U 1 A N 1 1 [c.5461-10 T>C, Splice site] 21 47** 47 0.3 0.3 1 239 202 U 1 A A 1 1 [c.1805 G>A, p.Arg602Gln] 22 50* 50 0.48 0.18 1 263 261 U 1 N N NA NA [c.1957 C>T, p.Arg653Cys] 23 39* 39 0 0.1 2 225 228 1 N N NA NA [c.2588 G>C, p. Gly863Ala] 24 55 57 0.48 0.48 1 117 74 1 ND ND NA NA [c.3602 T>G, p.Leu1201Arg] 25 50 54 0.48 0.18 1 147 144 U 3 ND ND NA NA [c.3602 T>G, p.Leu1201Arg] 26 43 47 2 0.18 1 70 52 1 ND ND NA NA [c.4319 T>C, p.Phe1440Ser] 27 30 51 0.3 0.3 1 75 79 U 3 A A NA NA [c.4685 T>C, p.Ile1562Thr] 28 29 34 0.18 0.18 3 132 107 1 A A NA NA [c.4926 C>G, p.Ser1642Arg] 29 52* 52 0.18 0.18 3 180 200 1 ND ND 2 2 [c.5882 G>A, p.Gly1961Glu] 30 28 28 0.1 0.1 2 NA NA 1 N ND NA NA [c.6079 C>T, p.Leu2027Phe] 31 40* 40 0.1 0.1 2 222 223 U NA NA NA NA NA [c.6079 C>T, p.Leu2027Phe] 32 45 48 0.18 3 1 237 252 U NA NA NA NA NA NA Continued on next page Tartu, Estonia) in all probands.43 The term ''variants`` used herein includes those sequence changes previously shown to be enriched in patients with Stargardt disease from prior studies. Login to comment
127 2588G>C, p.Gly863Ala 4 Het Allikmets46 Intol. 0.01 PRD 0.996 No change 68/13006 db SNP (rs76157638) 21 c.3113C>T, p.Ala1038Val 1 Het Webster53 Tol. NA Benign 0.014 Donor 43.5 70 New site (&#fe;61.72) 22/13006 db SNP (rs61751374) 24 c.3602T>G, p.Leu1201Arg 2 Het Lewis48 Tol. NA Benign 0.052 Donor 61.3 74 New site (&#fe;20.08) 416/13006 db SNP (rs61750126) 27 c.3898C>T, p.Arg1300* 1 Het Rivera49 NA NA ND 28 c.4139C>T, p.Pro1380Leu 2 Het Lewis48 Intol. 0.01 Benign 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4222 T>C, p.Trp1408Arg 2 Het Lewis48 Tol. NA PRD 0.845 No change ND dbSNP (rs61750135) 29 c.4319T>C, p.Phe1440Ser 1 Het Lewis48 Tol. NA PRD 0.744 No change ND dbSNP (rs61750141) 30 c.4469G>A, p.Cys1490Tyr 1 Het Webster53 Intol. 0.03 PRD 0.994 No change ND dbSNP (rs61751402) 31 c.4577C>T, p.Thr1526Met 1 Het Lewis48 Intol. 0.00 PRD 0.91 No change ND db SNP (rs61750152) 31 c.4594G>T, p.Asp1532Asn 3 Het Lewis48 Tol. NA PRD 0.853 No change ND 33 c.4685T>C, p.Ile1562Thr 1 Het Allikmets46 Tol. NA Benign 0.034 No change 18/13006 db SNP (rs1762111) 35 c.4956T>G, p.Tyr1652* 1 Het Fumagalli52 NA NA Acceptor 43 72 New site (&#fe;67.36) ND 35 c.4918C>T, p.Arg1640Trp 2 Het Rozet47 Intol. 0.00 PRD 1 No change ND dbSNP (rs61751404) 35 c.4926C>G, p.Ser1642Arg 1 Het Birch50 Tol. 0.68 Benign 0.116 No change ND db SNP (rs61753017) Int 35 c.5018&#fe;2T>C, Splice site 1 Het Fumagalli52 NA NA Donor 81.2 54 WT site broken (33.07) ND Int 38 c.5461-10T>C 3 Het Briggs50 NA NA No change 3/13006 db SNP (rs1800728) 40 c.5693G>A, p.Arg1898His 2 Het Allikmets46 NA Benign 0.00 No change 25/13006 db SNP (rs1800552) 42 c.5882G>A, p.Gly1961Glu 1 Het Allikmets46 Tol. 0.18 PRD 1 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T, p.Leu2027Phe 4 Homo Lewis48 Intol. 0.02 PRD 0.999 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A, p.Arg2030Gln 4 Het Lewis48 Tol. NA PRD 0.995 No change 8/13006 db SNP (rs61750641) 44 c.6118C>T, p.Arg2040* 1 Het Rosenberg54 NA NA ND 46 c.6320G>A, p.Arg2107His 1 Het Fishman8 Intol. 0.00 PRD 0.996 No change 91/13006 db SNP (rs62642564) EVS &#bc; Exome Variant Server; HSF &#bc; Human Splicing Finder program; Hum var score &#bc; Human var score; Int &#bc; intron; Intol &#bc; intolerant; Mt CV &#bc; mutant consensus value; NA &#bc; not applicable; ND &#bc; not detected; PRD &#bc; probably damaging; Pred. &#bc; prediction; SIFT &#bc; Sorting Intolerant from Tolerance program; Tol. &#bc; tolerant; Wt CV &#bc; wild-type consensus value. Login to comment
136 The most common variants identified were p.Gly863Ala, c.5461-10T>C, p.Leu2027Phe, and p.Arg2030Gln, occurring, respectively, in 4, 3, 3, and 4 patients with the foveal-sparing phenotype of Stargardt disease. Login to comment
140 The 4 most prevalent variants were p.Gly863Ala, TABLE 3. Login to comment
141 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency 2 c.71G>A, p.Arg24His 1 0.36% 2 c.161G>A, p.Cys54Tyr 3 1.07% 3 c.223T>G, p.Cys75Gly 1 0.36% 5 c.455G>A, p.Arg152Gln 1 0.36% 5 c.454C>T, p.Arg152* 1 0.36% 5 c.466 A>G, p.Ile156Val 2 0.71% 6 c.634C>T, p. Arg212Cys 3 1.07% 6 c.656G>C, p.Arg219Thr 1 0.36% 6 c.666_678delAAAGACGGTGCGC, p.Lys223_Arg226delfs 2 0.71% 6 c.768G>T, Splicing site 4 1.42% 8 c.1037A>C, p.Lys346Thr 1 0.36% 10 c.1222C>T, p.Arg408* 3 1.07% 12 c.1622T>C, p.Leu541Pro 2 0.71% 12 c.1648 G>T, p.Gly550* 1 0.36% 13 c.1804C>T, p.Arg602Trp 1 0.36% 13 c.1817G>A, p.Gly606Asp 1 0.36% 13 c.1922G>C, p.Cys641Ser 1 0.36% Int 13 c.1937&#fe;1G>A, Splicing site 2 0.71% 14 c.1957C>T, p.Arg653Cys 2 0.71% 17 c.2588G>C, p.Gly863Ala 19 6.79% 18 c.2701A>G, p.Thr901Ala 1 0.36% 19 c.2791G>A, p.Val931Met 2 0.71% 19 c.2894A>G, p.Asn965Ser 1 0.36% 20 c.2966T>C, p.Vla989Ala 3 1.07% 20 c.2971G>C, p.Gly991Arg 2 0.71% 21 c.3056C>T, p.Thr1019Met 1 0.36% 21 c.3113C>T, p.Ala1038Val 3 1.07% 21 c.3064G>A, p.Glu1022Lys 2 0.71% 22 c.3211_3212insGT, p.Ser1071Cysfs 6 2.14% 22 c.3259G>A, p.Glu1087Lys 4 1.43% 22 c.3292C>T, p.Arg1098Cys 1 0.36% 22 c.3322C>T, p.Arg1108Cys 5 1.79% 22 c.3323G>A, p.Arg1108His 1 0.36% 23 c.3364G>A, p.Glu1122Lys 1 0.36% 23 c.3386G>A, p.Arg1129His 1 0.36% 24 c.3602T>G, p.Leu1201Arg 3 1.07% 27 c.3898C>T, p.Arg1300* 2 0.71% 28 c.4139C>T, p.Pro1380Leu 14 5.00% 28 c.4222T>C, p.Trp1408Arg 1 0.36% 28 c.4234C>T, p.Gly1412* 1 0.36% 28 c.4253&#fe;5G>T, Splice site 1 0.36% 28 c.4253&#fe;4C>T, Splice site 1 0.36% 29 c.4283C>T, p.Thr1428Met 1 0.36% 29 c.4319T>C, p.Phe1440Ser 1 0.36% 29 c.4462T>C, p.Cys1488Arg 1 0.36% 30 c.4469G>A, p.Cys1490Tyr 5 1.79% 30 c.4537_4538insC, p.Gly1513Profs 1 0.36% 31 c.4577C>T, p.Thr1526Met 2 0.71% 33 c.4715C>T, p.Thr1572Met 1 0.36% Continued on next page TABLE 3. Login to comment
164 Comparison of the Most Prevalent ABCA4 Variants` Frequency Between the Cohort With the Foveal-Sparing Stargardt Disease and the Group With the Typical Stargardt Disease (Without Evidence of Foveal Sparing) Number of Alleles and Those Frequencies Foveal-Sparing Stargardt Disease (n &#bc; 31, Total 30 Variants in 62 Alleles) Typical Stargardt Disease (n &#bc; 140, Total 72 Variants in 280 Alleles) c.2588G>C, p.Gly863Ala 4 (6.45%) 19 (6.79%) c.4139C>T, p.Pro1380Leu 2 (3.23%) 14 (5.00%) c.6079C>T, p.Leu2027Phe 4 (6.45%) 10 (3.57%) c.6089G>A, p.Arg2030Gln 4 (6.45%) 3 (1.07%) c.5461-10T>C 3 (4.84%) 23 (8.21%) c.5882G>A, p.Gly1961Glu 1 (1.61%) 17 (6.07%) in the foveal-sparing phenotype compared to the typical phenotype; there was also clear concordance in sibships with the foveal-sparing phenotype, although a possible influence of genetic/environmental modifiers cannot be excluded. Login to comment

[hide] ABCA4 gene screening by next-generation sequencing... Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570. Fujinami K, Zernant J, Chana RK, Wright GA, Tsunoda K, Ozawa Y, Tsubota K, Webster AR, Moore AT, Allikmets R, Michaelides M
ABCA4 gene screening by next-generation sequencing in a British cohort.
Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570., [PMID:23982839]

Abstract [show]
PURPOSE: We applied a recently reported next-generation sequencing (NGS) strategy for screening the ABCA4 gene in a British cohort with ABCA4-associated disease and report novel mutations. METHODS: We identified 79 patients with a clinical diagnosis of ABCA4-associated disease who had a single variant identified by the ABCA4 microarray. Comprehensive phenotypic data were obtained, and the NGS strategy was applied to identify the second allele by means of sequencing the entire coding region and adjacent intronic sequences of the ABCA4 gene. Identified variants were confirmed by Sanger sequencing and assessed for pathogenicity by in silico analysis. RESULTS: Of the 42 variants detected by prescreening with the microarray, in silico analysis suggested that 34, found in 66 subjects, were disease-causing and 8, found in 13 subjects, were benign variants. We detected 42 variants by NGS, of which 39 were classified as disease-causing. Of these 39 variants, 31 were novel, including 16 missense, 7 splice-site-altering, 4 nonsense, 1 in-frame deletion, and 3 frameshift variants. Two or more disease-causing variants were confirmed in 37 (47%) of 79 patients, one disease-causing variant in 36 (46%) subjects, and no disease-causing variant in 6 (7%) individuals. CONCLUSIONS: Application of the NGS platform for ABCA4 screening enabled detection of the second disease-associated allele in approximately half of the patients in a British cohort where one mutation had been detected with the arrayed primer extension (APEX) array. The time- and cost-efficient NGS strategy is useful in screening large cohorts, which will be increasingly valuable with the advent of ABCA4-directed therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 1 c.161G>A p.C54Y DC c.2297G>T p.G766V DC 2 2 c.223T>G p.C75G DC c.5088C>G p.S1696R DC 2 3 c.740A>C p.N247T DC c.1433T>C p.I478T B c.2345G>A p.W782* DC 2 4 c.768G>T Splice site DC 1 5 c.1222C>T p.R408* DC c.2568C>A p.Y856* DC 2 6 c.1804C>T p.R602W DC c.859-9T>C Splice site PDC 2 7 c.1805G>A p.R602Q DC c.5113C>T p.R1705W DC 2 8 c.1922G>C p.C641S DC 1 9 c.1957C>T p.R653C DC 1 10 c.1957C>T p.R653C DC 1 11 c.2588G>C p.G863A DC c.655A>T p.R219* DC 2 Allele 2 (p.R219*) was APEX-false-negative 12 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 13 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 14 c.2588G>C p.G863A DC 1 15 c.2588G>C p.G863A DC 1 16 c.2894A>G p.N965S DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 17 c.3064G>A p.E1022K DC c.6729&#fe;4_&#fe;18delAGTTGGCCCTGGGGC Splice site DC 2 18 c.3064G>A p.E1022K DC 1 19 c.3208_3209insGT p.S1071fs DC c.2942C>T p.P981L DC c.6529G>A p.D2177N B 2 20 c.3208_3209insGT p.S1071fs DC c.1519G>T p.D507Y DC 2 21 c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 2 22 c.3208_3209insGT p.S1071fs DC 1 23 c.3292C>T p.R1098C DC c.3299T>A p.I1100N DC 2 24 c.3322C>T p.R1108C DC c.4978delC p.L1661* DC 2 25 c.3386G>A p.R1129H DC c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 3 Allele 2 (p.S1071fs) was APEX false-negative and allele 1 (p.R1129H) was NGS false-negative 26 c.4139C>T p.P1380L DC c.3191-1G>T Splice site DC 2 27 c.4139C>T p.P1380L DC c.3398T>C p.I1133T PDC 2 28 c.4139C>T p.P1380L DC c.4070C>A p.A1357E DC 2 29 c.4139C>T p.P1380L DC c.4773G>C Splice site DC 2 30 c.4139C>T p.P1380L DC 1 31 c.4139C>T p.P1380L DC 1 32 c.4139C>T p.P1380L DC 1 33 c.4234C>T p.Q1412* DC 1 34 c.4319T>C p.F1440S DC 1 35 c.4328G>A p.R1443H DC c.180delG p.M61fs DC 2 36 c.4469G>A p.C1490Y DC c.1726G>C p.D576H DC 2 37 c.4469G>A p.C1490Y DC 1 38 c.4537_4538insC p.Q1513fs DC c.5578C>T p.R1860W DC 2 Allele 1 (p.Q1513fs) was NGS-false-negative 39 c.4577C>T p.T1526M DC 1 T ABLE 2. Continued Pt Allele 1 Detected by APEX Allele 2 Detected by NGS Allele 3 Detected by NGS Total N of DC Variants Comments DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. Login to comment
62 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 3 c.161G>A p.C54Y 1 1 [ [ Lewis RA, et al. 11 Tol. 0.11 PRD 0.994 No change 1/13006 db SNP (rs150774447) 3 c.223T>G p.C75G 1 2 [ [ Lewis RA, et al. 11 Del. NA POD 0.603 No change ND 5 c.466A>G p.I156V 2 77, 78 [ [ Papaioannou M, et al. 16 Tol. 0.46 B 0.003 No change 16/13006 db SNP (rs112467008) Benign 6 c.655A>T p.R219* 1 11 [ Xi Q, et al. 27 ND 6 c.740A>C p.N247T 1 3 [ [ APEX Del. NA B 0.135 No change ND 6 c.768G>T Splice site 1 4 [ [ Klevering BJ, et al. 22 Tol. 0.56 NA Don. 70.4 58 Site broken (17.51) ND 9 c.1222C>T p.R408* 1 5 [ [ Webster AR, et al. 7 ND 12 c.1726G>C p.D576H 1 36 [ Downs K, et al. 25 POD 0.688 Acc. 68.1 39.1 Site broken (42.54) 1/13006 13 c.1804C>T p.R602W 1 6 [ [ Lewis RA, et al. 11 Del. 0.00 B 0.129 No change ND db SNP (rs 6179409) 13 c.1805G>A p.R602Q 1 7 [ [ Webster AR, et al. 7 Del. 0.04 PRD 0.513 Acc. 48.9 77.9 New site (&#fe;59.14) 2/13006 db SNP (rs61749410) 13 c.1906C>T p.Q636* 3 12, 13, 60 [ Zernant J, et al. 5 No change 1/13006 db SNP (rs145961131) 13 c.1922G>C p.C641S 1 8 [ [ Stenirri S, et al. 24 Del. 0.00 No change ND db SNP (rs61749416) 14 c.1957C>T p.R653C 2 9, 10 [ [ Rivera A, et al. 17 Del. 0.00 PRD 0.999 No change ND db SNP (rs61749420) 17 c.2588G>C p.G863A/ p.DelG863 5 11, 12, 13, 14, 15 [ [ Lewis RA, et al. 11 / Maugeri A, et al. 29 Del. 0.00 PRD 0.996 No change 68/13006 db SNP (rs76157638) 18 c.2701A>G p.T901A 1 74 [ [ APEX Tol. 0.82 B 0.008 23/13006 db SNP (rs139655975) Benign 19 c.2894A>G p.N965S 1 16 [ [ Lewis RA, et al. 11 Del. 0.03 PRD 0.981 Acc. 53.4 82.3 New site (&#fe;54.26) ND db SNP (rs201471607) 20 c.2971G>C p.G991R 1 67 [ [ Yatsenko AN, et al. 13 Del. 0.02 PRD 0.999 No change 28/13006 db SNP (rs147484266) Benign 22 c.3064G>A p.E1022K 2 17, 18 [ [ Webster AR, et al. 7 Del. 0.00 PRD 1.000 No change ND db SNP (rs61749459) 22 c.3208_3209insGT p.S1071fs 5 19, 20, 21, 22, 25 [ [ APEX ND False-negative in APEX in patient 25 22 c.3292C>T p.R1098C 1 23 [ [ Rivera A, et al. 17 Del. NA PRD 0.999 No change ND 22 c.3322C>T p.R1108C 3 16, 24, 61 [ [ Rozet JM, et al. 10 Del. 0.00 PRD 0.986 No change 1/13006 db SNP (rs61750120) False-negative in APEX in patients 16 and 61 23 c.3386G>A p.R1129H 1 25 [ Zernant J, et al. 5 PRD 0.989 No change ND False-negative in NGS in patient 25 24 c.3602T>G p.L1201R 4 72, 73, 74, 79 [ [ Lewis RA, et al. 11 Tol. 0.37 B 0.052 Don. 61.3 73.7 New site (20.08) 416/13006 db SNP (rs61750126) Benign 28 c.4139C>T p.P1380L 7 30, 31, 32, 33, 34, 35, 36 [ [ Lewis RA, et al. 11 Del. 0.01 B 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4234C>T p.Q1412* 1 33 [ [ Rivera A, et al. 17 ND db SNP (rs61750137) 29 c.4283C>T p.T1428M 1 76 [ [ APEX Tol. 0.15 B 0.010 No change 2/13006 db SNP (rs1800549) Benign 29 c.4319T>C p.F1440S 1 34 [ [ Lewis RA, et al. 11 Del. 0.00 POD 0.744 No change ND dbSNP (rs61750141) 29 c.4326C>A p.N1442K 1 64 [ Zernant J, et al. 5 Tol. NA POD 0.374 No change ND 29 c.4328G>A p.R1443H 1 35 [ [ Rivera A, et al. 17 Del. 0.02 PRD 0.999 No change 1/13006 dbSNP (rs61750142) IVS29 c.4352&#fe;1G>A Splice site 1 73 [ Zernant J, et al. 5 Don. 82.3 55.4 WT site broken (32.62) ND 30 c.4469G>A p.C1490Y 2 36, 37 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.994 No change ND dbSNP (rs61751402) 30 c.4538A>G p.Q1513R 1 67 [ Webster AR, et al. 7 Tol. NA Benign 0.043 Acc. 91.7 62.8 Site broken (31.55) ND T ABLE 3. Continued Exon/ IVS Nucleotide Substitution Protein Change/ Effect N of Alleles Identified Pt Method Previous Report SIFT Polyphen 2 HSF Matrix Allele Freq. by EVS Reference Comment APEX NGS Pred. Tol. Index (0-1) Pred. Login to comment

[hide] Identification of three ABCA4 sequence variations ... Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4. Utz VM, Chappelow AV, Marino MJ, Beight CD, Sturgill-Short GM, Pauer GJ, Crowe S, Hagstrom SA, Traboulsi EI
Identification of three ABCA4 sequence variations exclusive to African American patients in a cohort of patients with Stargardt disease.
Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4., [PMID:24011517]

Abstract [show]
PURPOSE: To describe the clinical and molecular findings in ten unrelated African American patients with Stargardt disease. DESIGN: Retrospective, observational case series. METHODS: We reviewed the clinical histories, examinations, and genotypes of 85 patients with molecular diagnoses of Stargardt disease. Three ABCA4 sequence variations identified exclusively in African Americans were evaluated in 300 African American controls and by in silico analysis. RESULTS: ABCA4 sequence changes were identified in 85 patients from 80 families, of which 11 patients identified themselves as African American. Of these 11 patients, 10 unrelated patients shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). The minor allele frequencies in the African American control population for each variation were 7.5%, 6.3%, and 2%, respectively. This is comparable to the allele frequency in African Americans in the Exome Variant Server. In contrast, the allele frequency of all three of these variations was less than or equal to 0.05% in European Americans. Although both c.3602T>G and c.3899G>A have been reported as likely disease-causing variations, one of our control patients was homozygous for each variant, suggesting that these are nonpathogenic. In contrast, the absence of c.6320G>A in the control population in the homozygous state, combined with the results of bioinformatics analysis, support its pathogenicity. CONCLUSIONS: Three ABCA4 sequence variations were identified exclusively in 10 unrelated African American patients: p.L1201R and p.R1300Q likely represent nonpathogenic sequence variants, whereas the p.R2107H substitution appears to be pathogenic. Characterization of population-specific disease alleles may have important implications for the development of genetic screening algorithms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 Population-Specific ABCA4 Alleles in Patients with Stargardt Disease References Population Allele Protein Rivera et al.28 Hargitai et al.12 Hungaro-German c.1622T>C/c.3113C>T p.L541P/p.A1038V September et al.47 Afrikaner c.4469G>A p.C1490Y September et al.47 Afrikaner c.1804C>T p.R602W Rosenberg et al.48 Danish c.2894A>G p.N965S Maugeri et al.27 Western European c.2588G>C p.G863A Maia-Lopes et al.49 Portuguese c.32T>C p.L11P Valverde et al.29 Spanish c.5882G>A p.R1129L Fumagalli et al.50 Italian c.2099G>A p.W700X VOL. 156, NO. 6 ALL AUTHORS HAVE COMPLETED AND SUBMITTED THE ICMJE FORM FOR DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST, and the following were reported. Login to comment

[hide] Inner and outer retinal changes in retinal degener... Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768. Huang WC, Cideciyan AV, Roman AJ, Sumaroka A, Sheplock R, Schwartz SB, Stone EM, Jacobson SG
Inner and outer retinal changes in retinal degenerations associated with ABCA4 mutations.
Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768., [PMID:24550365]

Abstract [show]
PURPOSE: To investigate in vivo inner and outer retinal microstructure and effects of structural abnormalities on visual function in patients with retinal degeneration caused by ABCA4 mutations (ABCA4-RD). METHODS: Patients with ABCA4-RD (n = 45; age range, 9-71 years) were studied by spectral-domain optical coherence tomography (OCT) scans extending from the fovea to 30 degrees eccentricity along horizontal and vertical meridians. Thicknesses of outer and inner retinal laminae were analyzed. Serial OCT measurements available over a mean period of 4 years (range, 2-8 years) allowed examination of the progression of outer and inner retinal changes. A subset of patients had dark-adapted chromatic static threshold perimetry. RESULTS: There was a spectrum of photoreceptor layer thickness changes from localized central retinal abnormalities to extensive thinning across central and near midperipheral retina. The inner retina also showed changes. There was thickening of the inner nuclear layer (INL) that was mainly associated with regions of photoreceptor loss. Serial data documented only limited change in some patients while others showed an increase in outer nuclear layer (ONL) thinning accompanied by increased INL thickening in some regions imaged. Visual function in regions both with and without INL thickening was describable with a previously defined model based on photoreceptor quantum catch. CONCLUSIONS: Inner retinal laminar abnormalities, as in other human photoreceptor diseases, can be a feature of ABCA4-RD. These changes are likely due to the retinal remodeling that accompanies photoreceptor loss. Rod photoreceptor-mediated visual loss in retinal regionswith inner laminopathy at the stages studied did not exceed the prediction from photoreceptor loss alone.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Characteristics of the ABCA4-Related Retinal Disease Patients Patient Age at Visits, y Sex Allele 1 Allele 2 Previous Report*ߤ P1 9, 12 M E341G F608I P2 9, 15 M R681X C2150Y P28* P3ߥ 12 M N965S W821R P1ߤ P4 13, 16 M V256V T1526M P21*, P15ߤ P5 14, 20 F W1408R IVS40&#fe;5 G>A P49* P6ߥ 16 F V989A IVS28&#fe;5 G>T P17ߤ P7ߥ 16 M N965S W821R P18ߤ P8 18, 20 F Y362X IVS38-10 T>C P9ߥ 18 F V989A IVS28&#fe;5 G>T P10 18, 22 M G1961E R1129L P3ߤ P11 20 M R1640Q c.5174_5175insG P12ߥ 20 M G1961E G1961E/P68L P13 22, 25 M G863A IVS35&#fe;2 T>C P20ߤ P14 22, 24 F G1961E R152X P12*, P21ߤ P15ߥ 23 M G1961E G1961E/P68L P16 25, 27 M G1961E R152X P11* P17 26, 32 F L1940P R1129L P64* P18 27, 34 F R1925G A1038V/L541P P19 27, 29 M c.4530_4531insC R1705Q P52*, P5ߤ P20 28, 30 F G1961E A1038V/L541P P23ߤ P21 31, 35 M T1019M G1961E P34* P22ߥ 32, 37 M P1486L Deletion of exon 7 P25ߤ P23 33, 35 M G863A R1108C P29*, P6ߤ P24 34, 37 F IVS40&#fe;5 G>A V935A P32*, P7ߤ P25 34 M G1961E &#a7; P8ߤ P26 37, 43 F C54Y G863A P4* P27 39, 44 F G863A C1490Y P30*, P26ߤ P28 40 M G1961E C54Y P7*, P10ߤ P29 41 F IVS38-10 T>C E1087D P59* P30ߥ 43, 47 F G1961E V256V P23*, P11ߤ P31ߥ 47, 51 F P1486L Deletion of exon 7 P32 47 M Y245X Y245X P20* P33ߥ 48, 51 F G1961E V256V P22*, P12ߤ P34 48, 50 F c.3208_3209insTG IVS40&#fe;5 G>A P35 50, 54 M V1433I L2027F P50* P36ߥ 52, 55 F T1526M R2030Q P55*, P28ߤ P37 53, 59 F G1961E P1380L P47*, P13ߤ P38ߥ 53, 61 M L1940P IVS40&#fe;5 G>A P61* P39 58 M D600E R18W P2*, P14ߤ P40 59, 62 M E1122K G1961E P44* P41 59, 62 F R1640Q G1961E P58* P42ߥ 62 F T1526M R2030Q P54* P43ߥ 64, 68 M L1940P IVS40&#fe;5 G>A P62* P44 68 F R1108C IVS40&#fe;5 G>A P42* P45 71 F IVS38-10 T>C &#a7; Novel variants are bold and italicized. Login to comment

[hide] Quantitative fundus autofluorescence in recessive ... Invest Ophthalmol Vis Sci. 2014 May 1;55(5):2841-52. doi: 10.1167/iovs.13-13624. Burke TR, Duncker T, Woods RL, Greenberg JP, Zernant J, Tsang SH, Smith RT, Allikmets R, Sparrow JR, Delori FC
Quantitative fundus autofluorescence in recessive Stargardt disease.
Invest Ophthalmol Vis Sci. 2014 May 1;55(5):2841-52. doi: 10.1167/iovs.13-13624., [PMID:24677105]

Abstract [show]
PURPOSE: To quantify fundus autofluorescence (qAF) in patients with recessive Stargardt disease (STGD1). METHODS: A total of 42 STGD1 patients (ages: 7-52 years) with at least one confirmed disease-associated ABCA4 mutation were studied. Fundus AF images (488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference to account for variable laser power and detector sensitivity. The gray levels (GLs) of each image were calibrated to the reference, zero GL, magnification, and normative optical media density to yield qAF. Texture factor (TF) was calculated to characterize inhomogeneities in the AF image and patients were assigned to the phenotypes of Fishman I through III. RESULTS: Quantified fundus autofluorescence in 36 of 42 patients and TF in 27 of 42 patients were above normal limits for age. Young patients exhibited the relatively highest qAF, with levels up to 8-fold higher than healthy eyes. Quantified fundus autofluorescence and TF were higher in Fishman II and III than Fishman I, who had higher qAF and TF than healthy eyes. Patients carrying the G1916E mutation had lower qAF and TF than most other patients, even in the presence of a second allele associated with severe disease. CONCLUSIONS: Quantified fundus autofluorescence is an indirect approach to measuring RPE lipofuscin in vivo. We report that ABCA4 mutations cause significantly elevated qAF, consistent with previous reports indicating that increased RPE lipofuscin is a hallmark of STGD1. Even when qualitative differences in fundus AF images are not evident, qAF can elucidate phenotypic variation. Quantified fundus autofluorescence will serve to establish genotype-phenotype correlations and as an outcome measure in clinical trials.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 [L541P; A1038V] 413 1.9 2 F 25 11 0.80 0.80 II II p.G863A; c.5898&#fe;1G > A 710 675 3.4 3.3 3 M 11 6 0.80 0.70 I - p.G1961E; p.P1380L 267 2.3 4.1 M 35 10 0.30 0.18 I - p.G1961E; p. Login to comment

[hide] Generalized choriocapillaris dystrophy, a distinct... Invest Ophthalmol Vis Sci. 2014 Apr 29;55(4):2766-76. doi: 10.1167/iovs.13-13391. Bertelsen M, Zernant J, Larsen M, Duno M, Allikmets R, Rosenberg T
Generalized choriocapillaris dystrophy, a distinct phenotype in the spectrum of ABCA4-associated retinopathies.
Invest Ophthalmol Vis Sci. 2014 Apr 29;55(4):2766-76. doi: 10.1167/iovs.13-13391., [PMID:24713488]

Abstract [show]
PURPOSE: We describe a particular form of autosomal recessive generalized choriocapillaris dystrophy phenotype associated with ABCA4 mutations. METHODS: A cohort of 30 patients with identified ABCA4 mutations and a distinct phenotype was studied. A retrospective review of history, fundus photographs, electroretinography, visual field testing, dark adaptometry, and optical coherence tomography was performed. Genetic analyses were performed by ABCA4 microarray analysis, high resolution melting, and/or next generation sequencing of all protein-coding sequences of the ABCA4 gene. RESULTS: The earliest recorded manifestation of ABCA4-associated disease was a central bull's eye type of macular dystrophy that progressed to chorioretinal atrophy of the macula with coarse rounded hyperpigmentations and expanding involvement of the periphery. The mean age at first presentation was 10.3 years, the longest follow-up was 61 years. All patients had two ABCA4 mutations identified, confirming the molecular genetic diagnosis of an ABCA4-associated disease. Most patients harbored at least one mutation classified as "severe," the most common of which was the p.N965S variant that had been found previously at a high frequency among patients with ABCA4-associated retinal dystrophies in Denmark. CONCLUSIONS: Generalized choriocapillaris dystrophy is a progressive ABCA4-associated phenotype characterized by early-onset macular dystrophy that disperses and expands to widespread end-stage chorioretinal atrophy with profound visual loss. All cases in this study were confirmed as harboring two ABCA4 mutations. Most of the ABCA4 mutations were classified as "severe" explaining the early onset, panretinal degeneration, and fast progression of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 mutation (21%), p.G863A, c.2408delG, and p.L541P/A1038V. Login to comment
123 Summary of Detected Potential Pathogenic Variants (Known and Novel [in Bold Face]) Found in the ABCA4 Gene of Patients With Generalized Choriocapillaris Dystrophy Patient Method Mutation 1 Mutation 2 Nucleotide Protein Nucleotide Protein D513 NGS c.203C>T p.P68L c.2894A>G p.N965S D514 Microarray, NGS c.2894A>G p.N965S c.5461-10T>C - D516 NGS c.4926C>G p.S1642R c.5041_5055del p.V1681_C1685del D517 NGS c.5169C>G p.Y1723* c.6079C>T p.L2027F D137 Microarray, NGS c.2894A>G p.N965S c.2894A>G p.N965S D801 Microarray, NGS c.6386&#fe;1G>A Aberrant splicing c.4234C>T p.Q1412* D109 Microarray c.2894A>G p.N965S c.4234C>T p.Q1412* D040 Microarray c.6229C>T p.R2077W c.6229C>T p.R2077W D159 Microarray c.3113C>T p.L541P/A1038V c.3113C>T p.L541P/A1038V D129 Microarray c.2894A>G p.N965S c.3322C>T p.R1108C D115 Microarray c.2894A>G p.N965S c.3113C>T p.L541P/A1038V D033 Microarray c.2894A>G p.N965S c.2041C>T p.R681* D023 Microarray c.203C>T p.P68L c.3329-2A>G Aberrant splicing D001 Microarray c.666_678del p.K223_R226delfs c.4667&#fe;2T>C Aberrant splicing D147 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D162 Microarray c.3329-2A>G Aberrant splicing c.6089G>A p.R2030Q D022 Microarray, HRM c.4462T>C p.C1488R c.4102C>T p.R1368C D112 Microarray, HRM c.2894A>G p.N965S c.1529T>G p.L510R D108 Microarray, HRM c.1648G>A p.G550R c.4102C>T p.R1368C D107 Microarray c.666_678del p.K223_R226delfs c.2588G>C p.G863A D070 Microarray c.2588G>C p.G863A c.2588G>C p.G863A D116 Microarray c.2300T>A p.V767D c.5461-10T>C - D135 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D117 Microarray, HRM c.3191-2A>G Aberrant splicing c.2408delG p.G803fs D186 Microarray, HRM c.3322C>T p.R1108C c.6386&#fe;1G>A Aberrant splicing D173 Microarray, HRM c.4469G>A p.C1490Y c.2915C>A p.T972N TABLE 3. Login to comment
124 In Silico Analysis of ABCA4 Variants Detected in This Study Using Alamut 2.2 Software cDNA Variant Protein Variant Effect on Protein Function AGVGD Class SIFT Prediction Effect on Protein PPH2 Prediction Effect on Protein TASTER Prediction Effect on Splicing Missense variants c.203C>T p.P68L C65 Deleterious Probably damaging Disease causing c.1529T>G p.L510R C65 Deleterious Benign Polymorphism c.1622T>C p.L541P Reduced ATP binding mislocali- zation26,27 C65 Deleterious Probably damaging Disease causing c.1648G>A p.G550R C65 Deleterious Possibly damaging Disease causing New acceptor site c.2300T>A p.V767D Reduced protein28 C65 Deleterious Benign Disease causing c.2588G>C p.G863A Reduced protein level, reduced ATP binding, reduced ATPase activity26 C55 Deleterious Possibly damaging Disease causing Predicted change at acceptor site 1 bp upstream: 11.1%, creating a new stronger acceptor 3 bp downstream c.2894A>G p.N965S Reduced ATP binding26 C45 Deleterious Probably damaging Disease causing New acceptor site c.2915C>A p.T972N C55 Deleterious Probably damaging Disease causing c.3113C>T p.A1038V Reduced ATP binding, reduced ATP hydrolysis26 C65 Deleterious Benign Disease causing c.3322C>T p.R1108C Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing c.4102C>T p.R1368C C65 Deleterious Probably damaging Disease causing c.4462T>C p.C1488R C65 Deleterious Possibly damaging Disease causing c.4469G>A p.C1490Y Misfolding, mislocali- zation27 C65 Deleterious Probably damaging Disease causing Cryptic donor strongly activated c.4926C>G p.S1642R C25 Deleterious Benign Disease causing c.6079C>T p.L2027F Reduced ATP binding26,29 C15 Deleterious Probably damaging Disease causing c.6089G>A p.R2030Q C35 Deleterious Probably damaging Disease causing c.6229C>T p.R2077W Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing Deletion/frame-shift/stop variants c.666_678del p.K223_ R226delfs c.2041C>T p.R681* c.2408delG p.G803fs c.4234C>T p.Q1412* c.5041_5055del p.V1681_ C1685del c.5169C>G p.Y1723* Splicing affecting variants c.3191-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.3329-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.4667&#fe;2T>C Predicted change at donor site 2 bps upstream: 100% generalized choriocapillaris dystrophy have the occasional hallmarks of early Stargardt disease, such as vermillion fundus, fundus hyperautofluorescence, and a dark choroid on fluorescein angiograms. Login to comment
129 In addition, most other, missense, mutations are deemed severe either by in silico or indirect functional analyses (Table 3), or from data presented in previous studies even if the exact effect of the variant on the protein is unknown (e.g., the c.5461-10T>C variant).26-29 The p.G863A mutation found in some of our patients is a common mutation in Stargardt disease patients of mainly Dutch descent,30 and it also has been observed in patients with CRD.31 This mutation is considered to be relatively mild and claimed not to be disease-causing in a homozygous state32 ; however, the patient D070 (Table 2) who is homozygous for this mutation, is one of a few examples of two mild mutations leading to generalized choriocapillaris dystrophy. Login to comment

[hide] Molecular diagnosis of putative Stargardt disease ... PLoS One. 2014 Apr 24;9(4):e95528. doi: 10.1371/journal.pone.0095528. eCollection 2014. Zhang X, Ge X, Shi W, Huang P, Min Q, Li M, Yu X, Wu Y, Zhao G, Tong Y, Jin ZB, Qu J, Gu F
Molecular diagnosis of putative Stargardt disease by capture next generation sequencing.
PLoS One. 2014 Apr 24;9(4):e95528. doi: 10.1371/journal.pone.0095528. eCollection 2014., [PMID:24763286]

Abstract [show]
Stargardt Disease (STGD) is the commonest genetic form of juvenile or early adult onset macular degeneration, which is a genetically heterogeneous disease. Molecular diagnosis of STGD remains a challenge in a significant proportion of cases. To address this, seven patients from five putative STGD families were recruited. We performed capture next generation sequencing (CNGS) of the probands and searched for potentially disease-causing genetic variants in previously identified retinal or macular dystrophy genes. Seven disease-causing mutations in ABCA4 and two in PROM1 were identified by CNGS, which provides a confident genetic diagnosis in these five families. We also provided a genetic basis to explain the differences among putative STGD due to various mutations in different genes. Meanwhile, we show for the first time that compound heterozygous mutations in PROM1 gene could cause cone-rod dystrophy. Our findings support the enormous potential of CNGS in putative STGD molecular diagnosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
128 There are reports that ''population-specific`` ABCA4 alleles, such as p.G863A/delG863, are founder mutations in Northern European patients. Login to comment

[hide] Molecular diagnostic testing by eyeGENE: analysis ... Invest Ophthalmol Vis Sci. 2014 Jul 31;55(9):5510-21. doi: 10.1167/iovs.14-14359. Alapati A, Goetz K, Suk J, Navani M, Al-Tarouti A, Jayasundera T, Tumminia SJ, Lee P, Ayyagari R
Molecular diagnostic testing by eyeGENE: analysis of patients with hereditary retinal dystrophy phenotypes involving central vision loss.
Invest Ophthalmol Vis Sci. 2014 Jul 31;55(9):5510-21. doi: 10.1167/iovs.14-14359., [PMID:25082885]

Abstract [show]
PURPOSE: To analyze the genetic test results of probands referred to eyeGENE with a diagnosis of hereditary maculopathy. METHODS: Patients with Best macular dystrophy (BMD), Doyne honeycomb retinal dystrophy (DHRD), Sorsby fundus dystrophy (SFD), or late-onset retinal degeneration (LORD) were screened for mutations in BEST1, EFEMP1, TIMP3, and CTRP5, respectively. Patients with pattern dystrophy (PD) were screened for mutations in PRPH2, BEST1, ELOVL4, CTRP5, and ABCA4; patients with cone-rod dystrophy (CRD) were screened for mutations in CRX, ABCA4, PRPH2, ELOVL4, and the c.2513G>A p.Arg838His variant in GUCY2D. Mutation analysis was performed by dideoxy sequencing. Impact of novel variants was evaluated using the computational tool PolyPhen. RESULTS: Among the 213 unrelated patients, 38 had BMD, 26 DHRD, 74 PD, 8 SFD, 6 LORD, and 54 CRD; six had both PD and BMD, and one had no specific clinical diagnosis. BEST1 variants were identified in 25 BMD patients, five with novel variants of unknown significance (VUS). Among the five patients with VUS, one was diagnosed with both BMD and PD. A novel EFEMP1 variant was identified in one DHRD patient. TIMP3 novel variants were found in two SFD patients, PRPH2 variants in 14 PD patients, ABCA4 variants in four PD patients, and p.Arg838His GUCY2D mutation in six patients diagnosed with dominant CRD; one patient additionally had a CRX VUS. ABCA4 mutations were identified in 15 patients with recessive CRD. CONCLUSIONS: Of the 213 samples, 55 patients (26%) had known causative mutations, and 13 (6%) patients had a VUS that was possibly pathogenic. Overall, selective screening for mutations in BEST1, PRPH2, and ABCA4 would likely yield the highest success rate in identifying the genetic basis for macular dystrophy phenotypes. Because of the overlap in phenotypes between BMD and PD, it would be beneficial to screen genes associated with both diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Mutations and Unknown Variants Detected in Patients With Central Vision Loss Patient Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Molecular Diagnosis Late-onset retinal degeneration NA CTRP5 NA NA NA NA NA NA Sorsby fundus dystrophy Patient 1 TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 Positive Patient 2 TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 Positive Patient 3 TIMP3 5 c.610A>T p.Ser204Cys Het Mut Positive Doyne honeycomb dystrophy Patient 1 EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut Positive Patient 2 EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut Positive Patient 3 EFEMP1 IVS10 c.IVS10-14C>T None Het vAR/us NA NA Unconfirmed Best macular dystrophy Patient 1 BEST1 2 c.28G>A p.Ala10Thr Het Mut Positive Patient 2 BEST1 2 c.47C>T p.Ser16Phe Het Mut Positive Patient 3 BEST1 2 c.72G>T p.Trp24Cys Het Mut Positive Patient 4 BEST1 3 c.240C>A p.Phe80Leu Het Mut Positive Patient 5 BEST1 3 c.240C>A p.Phe80Leu Het Mut Positive Patient 6 BEST1 4 c.248G>C p.Gly83Ala Het vAR/us Probably damaging 1 Positive Patient 7 BEST1 4 c.277T>C p.Trp93Arg Het vAR/us Probably damaging 1 Positive Patient 8 BEST1 4 c.279G>C p.Trp93Cys Het Mut Positive Patient 9 BEST1 6 c.652C>T p.Arg218Cys Het Mut Positive Patient 10 BEST1 6 c.652C>T p.Arg218Cys Het Mut Positive Patient 11 BEST1 6 c.680A>G p.Tyr227Cys Het Mut Positive Patient 12 BEST1 6 c.741G>A p.Arg218His Het Mut Positive Patient 13 BEST1 6 c.741G>A p.Arg218His Het Mut Positive Patient 14 BEST1 7 c.727G>A p.Ala243Thr Het Mut Positive Patient 15 BEST1 7 c.727G>A p.Ala243Thr Het Mut Positive Patient 16 BEST1 7 c.728C>T p.Ala243Val Het Mut Positive Patient 17 BEST1 7 c.728C>T p.Ala243Val Het Mut Positive Patient 18 BEST1 8 c.880C>T p.Leu294Phe Het vAR/us Probably damaging 1 Positive Patient 19 BEST1 8 c.887A>G p.Asn296Ser Het Mut Positive Patient 20 BEST1 8 c.903T>G p.Asp301Glu Het Mut Positive Patient 21 BEST1 8 c.903T>G p.Asp301Glu Het Mut Positive Patient 22 BEST1 8 c.910G>A p.Asp304Asn Het Mut Positive Patient 23 BEST1 8 c.925T>C p.Trp309Arg Het vAR/us Probably damaging 1 Positive Patient 24 BEST1 8 c.929T>C p.Ile310Thr Het Mut Positive Patient 25, case 3 BEST1 4 c.250T>G p.Phe84Val Het vAR/us Probably damaging 1 Positive Pattern dystrophy Patient 1 ABCA4 6 c.634C>T p.Arg212Cys Het Mut Positive ABCA4 30 c.4469G>A p.Cys1490Tyr Het Mut Patient 2 ABCA4 17 c.2588G>C p.Gly863Ala Het Mut Unconfirmed Patient 3 ABCA4 IVS26 c.3862&#fe;3A>G Abnormal splicing Het vAR/us Unconfirmed Patient 4 PRPH2 1 c.271T>A p.Tyr91Asn Het vAR/us Probably damaging 0.909 Positive PRPH2 1 c.310-313del(AT) p.Ile104Val Het Mut Patient 5, case 6 PRPH2 1 c.422A>G p.Tyr141Cys Het Mut Positive Patient 6 PRPH2 1 c.422A>G p.Tyr141Cys Het Mut Positive Patient 7 PRPH2 1 c.515G>A p.Arg172Gln Het Mut Positive Patient 8 PRPH2 2 c.583C>T p.Arg195Stop Het Mut Positive Patient 9 PRPH2 2 c.629C>G p.Pro210Arg Het Mut Positive Patient 10 PRPH2 2 c.635G>C p.Ser212Thr Het Mut Positive Patient 11 PRPH2 2 c.683C>T p.Thr228Ile Het Mut Positive Patient 12 PRPH2 2 c.708C>G p.Tyr236Stop Het Mut Positive Patient 13, case 4 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive TABLE 2. Continued Patient Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Molecular Diagnosis Patient 14 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 15 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 16 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 17, case 2 ABCA4 IVS38 c.5461-10T>C None Het Mut Unconfirmed Patient 18 PRPH2 2 c.584G>A p.Arg195Gln Het vAR/us Probably damaging 1 Positive Cone-rod dystrophy Patient 1, dominant GUCY2D 13 c.2512C>T p.Arg838Cys Het Mut Positive Patient 2, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 3, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 4, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 5, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive CRX 3 c.607T>C p.Ser213Pro Het vAR/us Probably damaging 0.999 Patient 6, recessive ABCA4 2 c.156T>G p.His52Gln Het vAR/us Probably damaging 0.998 Positive ABCA4 3 c.161G>A p.Cys54Tyr Het Mut ABCA4 28 c.4169T>C p.Leu1390Pro Het Mut Patient 7, recessive ABCA4 16 c.2385C>T p.Ser795Arg Het vAR/us Probably damaging 0.99 Positive ABCA4 IVS40 c.5714&#fe;5G>A Splice Het Mut Patient 8, recessive ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut Positive ABCA4 45 c.6221G>T p.Gly2074Val Het vAR/us Probably damaging 1 Patient 9, recessive ABCA4 IVS42 c.5898&#fe;1G<A Splice Het Mut Positive ABCA4 IVS42 c.5899-2delA Splice Het Mut Patient 10, recessive ABCA4 5 c.559C>T p.Arg187Cys Het Mut Positive ABCA4 40 c.5645T>C p.Met1882Thr Het Mut Patient 11, recessive ABCA4 6 c.768G>T p.Val256Val (abnlspl) Het Mut Positive ABCA4 31 c.4577C>T p.Thr1526Met Het Mut Patient 12, recessive ABCA4 12 c.1622T>C p.Leu541Pro Het Mut Positive ABCA4 21 c.3113C>T p.Ala1038Val Het Mut ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut ABCA4 22 c.3322C>T p.Arg1108Cys Het Mut Patient 13, recessive ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut Positive ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut Patient 14, recessive ABCA4 13 c.1927G>A p.Val643Met Het Mut Positive ABCA4 24 c.3602T>G p.Leu1201Arg Het Mut ABCA4 36 c.5186T>C p.Leu1729Pro Het Mut Patient 15, recessive ABCA4 23 c.3364G>A p.Glu1122Lys Het Mut Positive ABCA4 48 c.6529G>A p.Asp2177Asn Het Mut Patient 16, recessive ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut Positive ABCA4 28 c.4222T>C p.Trp1408Arg Het Mut Patient 17, recessive ABCA4 11 c.1532G>A p.Arg511His Het Mut Unconfirmed Patient 18, recessive ABCA4 27 c.3899G>A p.Arg1300Gln Het vAR/us Benign 0.143 Unconfirmed Patient 19, recessive ABCA4 13 c.1933G>A p.Asp645Asn Het Mut Unconfirmed Patient 20, recessive ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut Unconfirmed Patient 21, recessive ABCA4 IVS7 c.859-9T>C Unknown Hom vAR/us NA NA Unconfirmed Molecular Diagnostic Testing by eyeGENE IOVS j September 2014 j Vol. 55 j No. 9 j were screened for the p.Arg838His mutation in GUCY2D, and mutations in the CRX, ELOVL4, PRPH2, and/or ABCA4 genes. Login to comment
116 Mutations or Unknown Variants Detected in Patients With Central Vision Loss Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Frequency* Variant ID Late-onset retinal degeneration CTRP5 NA NA NA NA NA NA NA NA NA Sorsby fundus dystrophy TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 2 TIMP3 5 c.610A>T p.Ser204Cys Het Mut 1 CM941325/ rs137853298 Doyne honeycomb dystrophy EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut 2 CM990504 EFEMP1 IVS10 c.IVS10-14C>T None Het vAR/us NA NA 1 Best macular dystrophy BEST1 2 c.28G>A p.Ala10Thr Het Mut 1 CM982017 BEST1 2 c.47C>T p.Ser16Phe Het Mut 1 CM010520 BEST1 2 c.72G>T p.Trp24Cys Het Mut 1 CM982018 BEST1 3 c.240C>A p.Phe80Leu Het Mut 2 CM004423 BEST1 4 c.248G>C p.Gly83Ala Het vAR/us Probably damaging 1 1 BEST1 4 c.277T>C p.Trp93Arg Het vAR/us Probably damaging 1 1 BEST1 4 c.279G>C p.Trp93Cys Het Mut 1 rs28940273/ CM982021 BEST1 6 c.652C>T p.Arg218Cys Het Mut 2 CM982023 BEST1 6 c.680A>G p.Tyr227Cys Het Mut 1 CM982024 BEST1 6 c.741G>A p.Arg218His Het Mut 2 CM003486 BEST1 7 c.727G>A p.Ala243Thr Het Mut 2 CM004434 BEST1 7 c.728C>T p.Ala243Val Het Mut 2 rs28940570/ CM00841 BEST1 8 c.880C>T p.Leu294Phe Het vAR/us Probably damaging 1 1 BEST1 8 c.887A>G p.Asn296Ser Het Mut 1 CM010524 BEST1 8 c.903T>G p.Asp301Glu Het Mut 2 CM991243 BEST1 8 c.910G>A p.Asp304Asn Het Mut 1 CM024219 BEST1 8 c.925T>C p.Trp309Arg Het vAR/us Probably damaging 1 1 BEST1 8 c.929T>C p.Ile310Thr Het Mut 1 CM000843 BEST1 4 c.250T>G p.Phe84Val Het vAR/us Probably damaging 1 1 Pattern dystrophy ABCA4 6 c.634C>T p.Arg212Cys Het Mut 1 rs61750200 ABCA4 17 c.2588G>C p.Gly863Ala Het Mut 1 CM970003/ rs76157638 ABCA4 IVS26 c.3862&#fe;3A>G Abnormal splicing Het vAR/us 1 NA ABCA4 30 c.4469G>A p.Cys1490Tyr Het Mut 1 CM990056/ rs61751402 ABCA4 IVS38 c.5461-10T>C None Het Mut 1 CS057513 PRPH2 1 c.271T>A p.Tyr91Asn Het vAR/us Probably damaging .909 1 PRPH2 1 c.310-313del(AT) p.Ile104Val Het Mut 1 NA/Deletion PRPH2 1 c.422A>G p.Tyr141Cys Het Mut 2 CM010125/ rs61755781 PRPH2 1 c.515G>A p.Arg172Gln Het Mut 1 CM930637/ rs61755792 PRPH2 2 c.583C>T p.Arg195Stop Het Mut 1 CM032999 PRPH2 2 c.629C>G p.Pro210Arg Het Mut 1 CM941210 PRPH2 2 c.635G>C p.Ser212Thr Het Mut 1 CM971289/ rs61755801 PRPH2 2 c.683C>T p.Thr228Ile Het Mut 1 TMP_ESP_6_ 42672248 PRPH2 2 c.708C>G p.Tyr236Stop Het Mut 1 rs61755813 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut 4 CS010139 PRPH2 2 c.584G>A p.Arg195Gln Het vAR/us Probably damaging 1 1 TABLE 3. Continued Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Frequency* Variant ID Cone-rod dystrophy ABCA4 2 c.156T>G p.His52Gln Het vAR/us Probably damaging 0.998 1 ABCA4 3 c.161G>A p.Cys54Tyr Het Mut 1 CM990012/ rs150774447 ABCA4 28 c.4169T>C p.Leu1390Pro Het Mut 1 CM014810/ rs61752430 ABCA4 16 c.2385C>T p.Ser795Arg Het vAR/us Probably damaging 0.99 1 ABCA4 IVS40 c.5714&#fe;5G>A Splice Het Mut 1 CS982057 ABCA4 27 c.3899G>A p.Arg1300Gln Het vAR/us Benign 0.143 1 ABCA4 32 c.4661A>G p.Glu1554Gly Het vAR/us Benign 0.326 1 ABCA4 30 c.4383G>A p.Trp1461Stop Het Mut 1 Stop/NA ABCA4 IVS38 c.5461-10T>C None Het Mut NA NA 2 CS057513 ABCA4 22 c.3259G>A p.Glu1087Lys Het Mut 1 CM970008/ rs61751398 ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut 2 CM970016/ rs1800553 ABCA4 45 c.6221G>T p.Gly2074Val Het vAR/us Probably damaging 1 1 ABCA4 IVS42 c.5898&#fe;1G<A Splice Het Mut 1 CS011524 ABCA4 IVS42 c.5899-2delA Splice Het Mut 1 rs3112831 CRX 3 c.607T>C p.Ser213Pro Het vAR/us Probably damaging 0.999 1 ABCA4 5 c.559C>T p.Arg187Cys Het Mut 1 COSM913472 ABCA4 40 c.5645T>C p.Met1882Thr Het Mut 1 rs4147830 ABCA4 6 c.768G>T p.Val256Val (abnlspl) Het Mut 1 CM990057/ rs61750152 ABCA4 31 c.4577C>T p.Thr1526Met Het Mut 1 rs62645944 ABCA4 11 c.1532G>A p.Arg511His Het Mut 1 rs140482171 ABCA4 12 c.1622T>C p.Leu541Pro Het Mut 1 CM990022/ rs61751392 ABCA4 21 c.3113C>T p.Ala1038Val Het Mut 1 CM970006/ rs61751374 ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut 2 CM990022/ rs61751392 ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut 2 CM970006/ rs61751374 ABCA4 22 c.3322C>T p.Arg1108Cys Het Mut 1 CM990039/ rs61750120 ABCA4 13 c.1927G>A p.Val643Met Het Mut 1 CM014293/ rs61749417/ rs143548435 ABCA4 24 c.3602T>G p.Leu1201Arg Het Mut 1 CM990042/ rs61750126 ABCA4 36 c.5186T>C p.Leu1729Pro Het Mut 1 CM990062/ rs61750567 ABCA4 13 c.1933G>A p.Asp645Asn Het Mut 1 rs617494181933 ABCA4 23 c.3364G>A p.Glu1122Lys Het Mut 1 CM990041 ABCA4 48 c.6529G>A p.Asp2177Asn Het Mut 1 CM970023/ rs1800555 ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut 2 CM983728/ rs61751404 ABCA4 28 c.4222T>C p.Trp1408Arg Het Mut 1 CM990048/ rs61750135 GUCY2D 13 c.2512C>T p.Arg838Cys Het Mut 1 rs61750172 GUCY2D 13 c.2513G>A p.Arg838His Het Mut 5 CM012606/ rs61750173 ABCA4 IVS7 c.859-9T>C Unknown Hom vAR/us NA NA 1 ABCA4 42 c.5882G>A p.Gly1961Glu Hom Mut 1 CM970016/ rs1800553 ABCA4 43 c.5917delG Deletion Hom Mut 1 RISN_ABCR: c.5917delG Molecular Diagnostic Testing by eyeGENE IOVS j September 2014 j Vol. 55 j No. 9 j Six patients with late-onset retinal pathology and drusen had well-characterized clinical data. Login to comment

[hide] The external limiting membrane in early-onset Star... Invest Ophthalmol Vis Sci. 2014 Aug 19;55(10):6139-49. doi: 10.1167/iovs.14-15126. Lee W, Noupuu K, Oll M, Duncker T, Burke T, Zernant J, Bearelly S, Tsang SH, Sparrow JR, Allikmets R
The external limiting membrane in early-onset Stargardt disease.
Invest Ophthalmol Vis Sci. 2014 Aug 19;55(10):6139-49. doi: 10.1167/iovs.14-15126., [PMID:25139735]

Abstract [show]
PURPOSE: To describe pathologic changes of the external limiting membrane (ELM) in young patients with early-onset Stargardt (STGD1) disease. METHODS: Twenty-six STGD1 patients aged younger than 20 years with confirmed disease-causing adenosine triphosphate-binding cassette, subfamily A, member 4 (ABCA4) alleles and 30 age-matched unaffected individuals were studied. Spectral-domain optical coherence tomography (SD-OCT), fundus autofluorescence (AF), and color fundus photography (CFP) images, as well as full-field electroretinograms were obtained and analyzed for one to four visits in each patient. RESULTS: The ELM in all patients exhibited a distinct thickening that was not observed in unaffected individuals. In addition, accumulations of reflective deposits were noted in the outer nuclear layer in every patient. Four patients exhibited a concave protuberance or bulging of a thickened and hyperreflective ELM band within the fovea containing preserved photoreceptors. Longitudinal SD-OCT data in several patients revealed the persistence of this ELM abnormality over a period of time (1-4 years). Furthermore, the edges of the inner segment ellipsoid band appeared to recede earlier than the ELM band in active lesions. CONCLUSIONS: Structural changes seen in the ELM of this cohort may reflect a gliotic response to cellular stress at the photoreceptor level in early-onset STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 [L541P;A1038V] p.L2027F P19 16 Caucasian 20/150 (0.88) 20/150 (0.88) 1 n/a Early 6 p.G863A p. Login to comment
93 [W1408R;R1640W] P20 18 African American 20/125 (0.80) 20/50 (0.40) 2 2 Mid 5 p.R1640W ND P21 12 Caucasian 20/50 (0.40) 20/50 (0.40) 1 1 6 p.W821R p.C2150Y P22 17 Indian 20/40 (0.30) 20/100 (0.70) 1 n/a Mid 3 p.G1961E c.6729&#fe;4_&#fe;18del P23 10 Indian 20/400 (1.30) 20/400 (1.30) 2 2 Early 3 c.885delC p.R537C P24 19 Caucasian 20/20 (0.00) 20/20 (0.00) 1 n/a ND p.G863A c.5898&#fe;1G>A P25 16 Middle Eastern 20/80 (0.60) 20/100 (0.70) 1 1 4 p.A1773V p.G1961E P26 17 Caucasian 20/150 (0.88) 20/200 (1.00) 1 1 2 p.K1547* p.R2030Q ND, not determined; n/a, not available. Login to comment

[hide] Quantitative fundus autofluorescence distinguishes... Ophthalmology. 2015 Feb;122(2):345-55. doi: 10.1016/j.ophtha.2014.08.017. Epub 2014 Oct 3. Duncker T, Tsang SH, Lee W, Zernant J, Allikmets R, Delori FC, Sparrow JR
Quantitative fundus autofluorescence distinguishes ABCA4-associated and non-ABCA4-associated bull's-eye maculopathy.
Ophthalmology. 2015 Feb;122(2):345-55. doi: 10.1016/j.ophtha.2014.08.017. Epub 2014 Oct 3., [PMID:25283059]

Abstract [show]
PURPOSE: Quantitative fundus autofluorescence (qAF) and spectral-domain optical coherence tomography (SD OCT) were performed in patients with bull's-eye maculopathy (BEM) to identify phenotypic markers that can aid in the differentiation of ABCA4-associated and non-ABCA4-associated disease. DESIGN: Prospective cross-sectional study at an academic referral center. SUBJECTS: Thirty-seven BEM patients (age range, 8-60 years) were studied. All patients exhibited a localized macular lesion exhibiting a smooth contour and qualitatively normal-appearing surrounding retina without flecks. Control values consisted of previously published data from 277 healthy subjects (374 eyes; age range, 5-60 years) without a family history of retinal dystrophy. METHODS: Autofluorescence (AF) images (30 degrees , 488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference to account for variable laser power and detector sensitivity. The grey levels (GLs) from 8 circularly arranged segments positioned at an eccentricity of approximately 7 degrees to 9 degrees in each image were calibrated to the reference (0 GL), magnification, and normative optical media density to yield qAF. In addition, horizontal SD OCT images through the fovea were obtained. All patients were screened for ABCA4 mutations using the ABCR600 microarray, next-generation sequencing, or both. MAIN OUTCOME MEASURES: Quantitative AF, correlations between AF and SD OCT, and genotyping for ABCA4 variants. RESULTS: ABCA4 mutations were identified in 22 patients, who tended to be younger (mean age, 21.9+/-8.3 years) than patients without ABCA4 mutations (mean age, 42.1+/-14.9 years). Whereas phenotypic differences were not obvious on the basis of qualitative fundus AF and SD OCT imaging, with qAF, the 2 groups of patients were clearly distinguishable. In the ABCA4-positive group, 37 of 41 eyes (19 of 22 patients) had qAF8 of more than the 95% confidence interval for age. Conversely, in the ABCA4-negative group, 22 of 26 eyes (13 of 15 patients) had qAF8 within the normal range. CONCLUSIONS: The qAF method can differentiate between ABCA4-associated and non-ABCA4-associated BEM and may guide clinical diagnosis and genetic testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Sex Age (yrs) Race or Ethnicity Best-Corrected Visual Acuity (Logarithm of the Minimum Angle of Resolution Units) Genetic Data Average of Quantitative Fundus Autofluorescence Values of the 8 Segments ABCA4 Mutations Right Eye Left Eye Allele 1 Allele 2 Right Eye Left Eye 1 M 36 White 0.70 0.70 p.G1961E p.G1961E 282 279 2 F 46 White 0.40 0.40y p.G1961E p.R1129C 391 3 M 17 Asian Indian 0.70 0.88 p.G1961E c.6729&#fe;4_&#fe;18del 340 363 4 M 17 White 0.88 0.88 p.G1961E p.A1773V 340 366 5 M 21 White 0.88 0.88 p.G1961E p.W15* 341 325 6 F 22 White 0.70 0.48 p.G1961E p.G863A 361 351 7 F 20 White 0.70z 0.88z p.G1961E p.L541P 317 8 M 12 White 0.80 0.70 p.G1961E p.P1380L 251 242 9 F 21 White 0.88 0.88 p.G1961E p.R212C 407 439 10 F 26 White 0.40z 0.70z p.G1961E c.5196&#fe;1056A/G 379 344 11 F 24 White 0.88z 0.88z p.G1961E p.C2150R 405 396 12 F 24 White 0.30z 0.18z p.G1961E p.N96D 513 549 13 F 20 White 0.30 0.40 p.G1961E p.N96D 397 355 14 M 25 White 0.00y 0.30 p.G1961E p.Q1003* 322 328 15 M 8.2 White 0.88 0.88 p. Login to comment
66 [L541P; A1038V] 438 432 16 M 25 White 0.60 0.60 p.S84fs p.R2107H 294 17 F 24 Black 0.70 0.88 p.G991R p.L1138P 321 326 18 M 26 White 0.00y 0.00y p.R1300* p.R2106C 419 412 19 M 11 White 0.40z 0.40z p.W821R p.C2150Y 304 296 20 F 16 White 0.70 0.40 p.K1547* p.R2030Q 481 513 21 F 13 White 1.30 1.00 pR1108C p.Q1412* 511 528 22 F 18 White 0.00 0.00 p.G863A c.5898&#fe;1G/A 465 431 Mutations in Other Genes 23 F 16 White 0.40 0.48 GUCY2D e p.R838H 152 165 24 M 53 Black 0.88 0.88 CNGA3 e p. Login to comment

[hide] Early-onset stargardt disease: phenotypic and geno... Ophthalmology. 2015 Feb;122(2):335-44. doi: 10.1016/j.ophtha.2014.08.032. Epub 2014 Oct 17. Lambertus S, van Huet RA, Bax NM, Hoefsloot LH, Cremers FP, Boon CJ, Klevering BJ, Hoyng CB
Early-onset stargardt disease: phenotypic and genotypic characteristics.
Ophthalmology. 2015 Feb;122(2):335-44. doi: 10.1016/j.ophtha.2014.08.032. Epub 2014 Oct 17., [PMID:25444351]

Abstract [show]
OBJECTIVE: To describe the phenotype and genotype of patients with early-onset Stargardt disease. DESIGN: Retrospective cohort study. PARTICIPANTS: Fifty-one Stargardt patients with age at onset </=10 years. METHODS: We reviewed patient medical records for age at onset, medical history, initial symptoms, best-corrected visual acuity (BCVA), ophthalmoscopy, fundus photography, fundus autofluorescence (FAF), fluorescein angiography (FA), spectral-domain optical coherence tomography (SD-OCT), and full-field electroretinography (ffERG). The ABCA4 gene was screened for mutations. MAIN OUTCOME MEASURES: Age at onset, BCVA, fundus appearance, FAF, FA, SD-OCT, ffERG, and presence of ABCA4 mutations. RESULTS: The mean age at onset was 7.2 years (range, 1-10). The median times to develop BCVA of 20/32, 20/80, 20/200, and 20/500 were 3, 5, 12, and 23 years, respectively. Initial ophthalmoscopy in 41 patients revealed either no abnormalities or foveal retinal pigment epithelium (RPE) changes in 10 and 9 patients, respectively; the other 22 patients had foveal atrophy, atrophic RPE lesions, and/or irregular yellow-white fundus flecks. On FA, there was a "dark choroid" in 21 out of 29 patients. In 14 out of 50 patients, foveal atrophy occurred before flecks developed. On FAF, there was centrifugal expansion of disseminated atrophic spots, which progressed to the eventual profound chorioretinal atrophy. Spectral-domain OCT revealed early photoreceptor damage followed by atrophy of the outer retina, RPE, and choroid. On ffERG in 26 patients, 15 had normal amplitudes, and 11 had reduced photopic and/or scotopic amplitudes at their first visit. We found no correlation between ffERG abnormalities and the rate of vision loss. Thirteen out of 25 patients had progressive ffERG abnormalities. Finally, genetic screening of 44 patients revealed >/=2 ABCA4 mutations in 37 patients and single heterozygous mutations in 7. CONCLUSIONS: In early-onset Stargardt, initial ophthalmoscopy can reveal no abnormalities or minor retinal abnormalities. Yellow-white flecks can be preceded by foveal atrophy and may be visible only on FAF. Although ffERG is insufficient for predicting the rate of vision loss, abnormalities can develop. Over time, visual acuity declines rapidly in parallel with progressive retinal degeneration, resulting in profound chorioretinal atrophy. Thus, early-onset Stargardt lies at the severe end of the spectrum of ABCA4-associated retinal phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
137 11 13 16, 23, 32, 39 c.818G>A p.Trp273* 1 1 This study c.872C>T p.Pro291Leu 1 1 34 c.1622T>C p.Leu541Pro 2 2 1, 16, 32, 40 c.1822T>A p.Phe608Ile 4 5 1, 23 c.1957C>T p.Arg653Cys 1 1 32, 41 c.2588G>C p.Gly863Ala/p.DelGly863 3 4 16, 18, 23, 32, 42 c.2919-?_3328&#fe;?del p.Ser974_Gly1110delinsCys 2 2 23 c.2947A>G p.Thr983Ala 3 4 34 c.3113C>T p.Ala1038Val 2 2 16, 31, 32, 40, 43 c.3335C>A p.Thr1112Asn 1 1 23 c.3449G>A p.Cys1150Tyr 1 1 This study c.3813G>C p.Glu1271Asp 1 1 This study c.3874C>T p.Gln1292* 1 1 34 c.4224G>T p.Trp1408Cys 1 1 This study c.4462T>C p.Cys1488Arg 1 1 1, 8, 44, 45 c.4506C>A p.Cys1502* 1 1 34 c.4539&#fe;1G>T p.? Login to comment

[hide] Common synonymous variants in ABCA4 are protective... BMC Ophthalmol. 2015 Mar 6;15:18. doi: 10.1186/s12886-015-0008-0. Grassmann F, Bergholz R, Mandl J, Jagle H, Ruether K, Weber BH
Common synonymous variants in ABCA4 are protective for chloroquine induced maculopathy (toxic maculopathy).
BMC Ophthalmol. 2015 Mar 6;15:18. doi: 10.1186/s12886-015-0008-0., [PMID:25884411]

Abstract [show]
BACKGROUND: Chloroquine (CQ) and hydroxychloroquine (HCQ) are used to treat auto-immune related diseases such as rheumatoid arthritis (RA) or systemic lupus erythematosus. Both drugs however can cause retinal toxicity eventually leading to irreversible maculopathy and retinopathy. Established risk factors are duration and dosage of treatment while the involvement of genetic factors contributing to toxic maculopathy is largely unclear. To address the latter issue, this study aimed to expand on earlier efforts by (1) evaluating risk-altering variants known to be associated with age-related macular degeneration (AMD), a frequent maculopathy in individuals over 55 years of age, and (2) determining the contribution of genetic variants in the coding sequence of the ABCA4 gene. METHODS: The ABCA4 gene was analyzed by deep sequencing technology using a personal genome machine (Ion Torrent) with 200 bp read length. Assessment of AMD variants was done by restriction enzyme digestion of PCR products and TaqMan SNP genotyping. Effect sizes, p-values and confidence intervals of common variants were evaluated by logistic regression (Firth's bias corrected). To account for multiple testing, p-values were adjusted according to the false discovery rate. RESULTS: We found no effects of known AMD-associated variants on the risk of toxic maculopathy. In contrast, we report a statistically significant association of common variants in the ABCA4 gene with retinal disease, assessed by a score-based variance-component test (PSKAT = 0.0055). This association remained significant after adjustment for environmental factors like age and duration of medication and was driven by three common variants in ABCA4 (c.5682G > C, c.5814A > G, c.5844A > G), all conferring a reduced risk for toxic maculopathy. CONCLUSIONS: Our findings demonstrate that minor alleles of common genetic variants in ABCA4 significantly reduce susceptibility to develop toxic maculopathy under CQ treatment. A refined risk profile based on genetic and environmental factors may have implications for revised recommendations in CQ as well as HCQ treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 Table 2 Genetic variants identified in ABCA4 sequence analysis in CQ-treated patients with (cases) and without (controls) toxic maculopathy Frequency in Variant (NM_000350.2) Amino acid exchange (NP_000341.2) Cases Controls EURߤ Raw p-value FDR# c.324G > A M114I 0.00 0.04 - - - c.635G > A R212H 0.06 0.08 0.06 - - c.1268A > G* H423R 0.29 0.23 0.30 0.58783 0.58783 c.1269C > T H423H 0.13 0.04 0.07 - - c.1622T > C L541P 0.02 0.00 - - - c.2588G > C G863A 0.00 0.04 0.00 - - c.2828G > A R943Q 0.04 0.12 0.04 - - c.3113C > T A1038V 0.02 0.00 0.00 - - c.4203C > A P1401P 0.00 0.04 - - - c.4297G > A V1433I 0.00 0.04 0.00 - - c.5603A > T N1868I 0.06 0.08 0.07 - - c.5682G > C* L1894L 0.13 0.38 0.26 0.02292 0.030 c.5814A > G* L1938L 0.06 0.31 0.18 0.00722 0.014 c.5843C > T P1948L 0.04 0.08 0.04 - - c.5844A > G* P1948P 0.06 0.31 0.19 0.00722 0.014 c.6069T > C I2023I 0.04 0.08 0.06 - c.6148G > C V2050L 0.02 0.00 0.00 - - c.6249C > T I2083I 0.04 0.08 0.05 - - c.6282 + 7G > A - 0.04 0.08 0.05 - - c.6285T > C D2095D 0.08 0.15 0.10 - - c.6357A > G E2119E 0.02 0.00 - - - c.6730-3T > C - 0.02 0.12 0.02 - - c.6764G > T S2255I 0.02 0.12 0.02 - - *Common variants (combined frequency in cases and controls > 11.6%). Login to comment

[hide] Objective Analysis of Hyperreflective Outer Retina... Invest Ophthalmol Vis Sci. 2015 Jul;56(8):4662-7. doi: 10.1167/iovs.15-16955. Park JC, Collison FT, Fishman GA, Allikmets R, Zernant J, Liu M, McAnany JJ
Objective Analysis of Hyperreflective Outer Retinal Bands Imaged by Optical Coherence Tomography in Patients With Stargardt Disease.
Invest Ophthalmol Vis Sci. 2015 Jul;56(8):4662-7. doi: 10.1167/iovs.15-16955., [PMID:26207301]

Abstract [show]
PURPOSE: To develop and apply an objective algorithm for analyzing outer retinal layers imaged by spectral-domain optical coherence tomography (SD-OCT) in patients with Stargardt disease (STGD1). METHODS: Horizontal macular B-scans were acquired from 20 visually normal controls and 20 genetically confirmed stage 1 STGD1 patients. The number of outer retinal bands was quantified using a semiautomated algorithm that detected bands using the second derivative of longitudinal reflectivity profiles. The present analysis focused on the three outermost bands, currently associated with the ellipsoid zone (EZ), cone outer segment interdigitation zone (IZ), and retinal pigment epithelium (RPE) complex. RESULTS: The RPE complex and EZ bands were detected throughout the B-scan in all controls. The RPE complex was detected throughout the B-scan in all patients, but was atrophic appearing in some locations. The EZ band was detected only outside the central lesion. Interdigitation zone band detection varied as a function of eccentricity for both groups, with detection for controls being highest in the para- and perifovea and lowest in the fovea and near periphery. In patients, the IZ band was generally not present in the fovea or para- or perifovea due to the central lesion. Outside of the lesion, the IZ band was detected in 26% of patients (mean detection across the near periphery), which was approximately half of the detection in controls. CONCLUSIONS: An objective approach for quantifying the number of outer retinal OCT bands found reduced IZ detection in STGD1 patients. This occurred even outside the central lesion, demonstrating an inability to image the IZ, possibly due to enhanced RPE reflectivity or abnormal outer retinal structure.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 14 33 F 20/200 2 p.[(L541P;A1038V(;)I1684N)] 15 41 F 20/25&#fe;1 2 p.[(V989A)];[(V989A)] 16 45 F 20/25 2 p.[(I975M(;)K1978E)] 17 45 M 20/200 2 p.[(R1108C;Q876P)];[(Q876P)] 18 47 F 20/200 2 p.[(R1108C(;)G1961E)] 19 48 M 20/253 2 p.[(G1961E)];[(G1961E)] 20 48 M 20/100 2 p.[(G863A)];[(G863A)] BCVA, best-corrected visual acuity; ''?`` indicates that the second mutation was not identified. Login to comment

[hide] Flecks in Recessive Stargardt Disease: Short-Wavel... Invest Ophthalmol Vis Sci. 2015 Jul;56(8):5029-39. doi: 10.1167/iovs.15-16763. Sparrow JR, Marsiglia M, Allikmets R, Tsang S, Lee W, Duncker T, Zernant J
Flecks in Recessive Stargardt Disease: Short-Wavelength Autofluorescence, Near-Infrared Autofluorescence, and Optical Coherence Tomography.
Invest Ophthalmol Vis Sci. 2015 Jul;56(8):5029-39. doi: 10.1167/iovs.15-16763., [PMID:26230768]

Abstract [show]
PURPOSE: We evaluated the incongruous observation whereby flecks in recessive Stargardt disease (STGD1) can exhibit increased short-wavelength autofluorescence (SW-AF) that originates from retinal pigment epithelium (RPE) lipofuscin, while near-infrared AF (NIR-AF), emitted primarily from RPE melanin, is usually reduced or absent at fleck positions. METHODS: Flecks in SW- and NIR-AF images and spectral-domain optical coherence tomography (SD-OCT) scans were studied in 19 STGD1 patients carrying disease-causing ABCA4 mutations. Fleck spatial distribution and progression were recorded in serial AF images. RESULTS: Flecks observed in SW-AF images typically colocalized with darkened foci in NIR-AF images; the NIR-AF profiles were larger. The decreased NIR-AF signal from flecks preceded apparent changes in SW-AF. Spatiotemporal changes in fleck distribution usually progressed centrifugally, but in one case centripetal expansion was observed. Flecks in SW-AF images corresponded to hyperreflective deposits that progressively traversed photoreceptor-attributable bands in SD-OCT images. Outer nuclear layer (ONL) thickness negatively correlated with expansion of flecks from outer to inner retina. CONCLUSIONS: In the healthy retina, RPE lipofuscin fluorophores form in photoreceptor cells but are transferred to RPE; thus the SW-AF signal from photoreceptor cells is negligible. In STGD1, NIR-AF imaging reveals that flecks are predominantly hypofluorescent and larger and that NIR-AF darkening occurs prior to heightened SW-AF signal. These observations indicate that RPE cells associated with flecks in STGD1 are considerably changed or lost. Spectral-domain OCT findings are indicative of ongoing photoreceptor cell degeneration. The bright SW-AF signal of flecks likely originates from augmented lipofuscin formation in degenerating photoreceptor cells impaired by the failure of RPE.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 [570&#fe;1798A>G] 16* F 24.44 Caucasian 0.2 0 p. [G863A]; c. Login to comment

[hide] Cone and rod loss in Stargardt disease revealed by... JAMA Ophthalmol. 2015 Oct;133(10):1198-203. doi: 10.1001/jamaophthalmol.2015.2443. Song H, Rossi EA, Latchney L, Bessette A, Stone E, Hunter JJ, Williams DR, Chung M
Cone and rod loss in Stargardt disease revealed by adaptive optics scanning light ophthalmoscopy.
JAMA Ophthalmol. 2015 Oct;133(10):1198-203. doi: 10.1001/jamaophthalmol.2015.2443., [PMID:26247787]

Abstract [show]
IMPORTANCE: Stargardt disease (STGD1) is characterized by macular atrophy and flecks in the retinal pigment epithelium. The causative ABCA4 gene encodes a protein localizing to photoreceptor outer segments. The pathologic steps by which ABCA4 mutations lead to clinically detectable retinal pigment epithelium changes remain unclear. We investigated early STGD1 using adaptive optics scanning light ophthalmoscopy. OBSERVATIONS: Adaptive optics scanning light ophthalmoscopy imaging of 2 brothers with early STGD1 and their unaffected parents was compared with conventional imaging. Cone and rod spacing were increased in both patients (P < .001) with a dark cone appearance. No foveal cones were detected in the older brother. In the younger brother, foveal cones were enlarged with low density (peak cone density, 48.3 x 103 cones/mm2). The ratio of cone to rod spacing was increased in both patients, with greater divergence from normal approaching the foveal center, indicating that cone loss predominates centrally and rod loss increases peripherally. Both parents had normal photoreceptor mosaics. Genetic testing revealed 3 disease-causing mutations. CONCLUSIONS AND RELEVANCE: This study provides in vivo images of rods and cones in STGD1. Although the primary clinical features of STGD1 are retinal pigment epithelial lesions, adaptive optics scanning light ophthalmoscopy reveals increased cone and rod spacing in areas that appear normal in conventional images, suggesting that photoreceptor loss precedes clinically detectable retinal pigment epithelial disease in STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 Molecular genetic analysis revealed 3 disease-causing ABCA4 mutations: Gly1961Glu (paternal allele) and Gly863Ala and Arg2030Stop (maternal allele). Login to comment
87 Two of the 3 disease-causing mutations-Gly1961Glu (paternal) and Gly863Ala (maternal)-have been associated with a milder visual acuity and visual field phenotype.9 The additional Arg2030Stop mutation on the maternal allele is uncommon, and its pathogenic contribution has not been well described, but the 2 mutations on the maternal allele were not sufficient to cause disease in the carrier state. Login to comment

[hide] Quantitative Fundus Autofluorescence and Optical C... Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7274-85. doi: 10.1167/iovs.15-17371. Duncker T, Stein GE, Lee W, Tsang SH, Zernant J, Bearelly S, Hood DC, Greenstein VC, Delori FC, Allikmets R, Sparrow JR
Quantitative Fundus Autofluorescence and Optical Coherence Tomography in ABCA4 Carriers.
Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7274-85. doi: 10.1167/iovs.15-17371., [PMID:26551331]

Abstract [show]
PURPOSE: To assess whether carriers of ABCA4 mutations have increased RPE lipofuscin levels based on quantitative fundus autofluorescence (qAF) and whether spectral-domain optical coherence tomography (SD-OCT) reveals structural abnormalities in this cohort. METHODS: Seventy-five individuals who are heterozygous for ABCA4 mutations (mean age, 47.3 years; range, 9-82 years) were recruited as family members of affected patients from 46 unrelated families. For comparison, 57 affected family members with biallelic ABCA4 mutations (mean age, 23.4 years; range, 6-67 years) and two noncarrier siblings were also enrolled. Autofluorescence images (30 degrees , 488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference. The gray levels (GLs) of each image were calibrated to the reference, zero GL, magnification, and normative optical media density to yield qAF. Horizontal SD-OCT scans through the fovea were obtained and the thicknesses of the outer retinal layers were measured. RESULTS: In 60 of 65 carriers of ABCA4 mutations (age range, 9-60), qAF levels were within normal limits (95% confidence level) observed for healthy noncarrier subjects, while qAF levels of affected family members were significantly increased. Perifoveal fleck-like abnormalities were observed in fundus AF images in four carriers, and corresponding changes were detected in the outer retinal layers in SD-OCT scans. Thicknesses of the outer retinal layers were within the normal range. CONCLUSIONS: With few exceptions, individuals heterozygous for ABCA4 mutations and between the ages of 9 and 60 years do not present with elevated qAF. In a small number of carriers, perifoveal fleck-like changes were visible.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 [L541P;A1038V] 0.10 0.10 OS n/a 141 S2.2 F 44.4 Indian Mother c.6729&#fe;5_&#fe;19del 0.10 0.00 OS 257 291 S2.3 M 56.2 Indian Father p.G1961E 0.00 0.00 OD 475 431 S3.4 F 54.1 White Mother p.G863A 0.00 0.00 OS 459 451 S3.5 F 82.0 White Grandmother p.G863A 0.00 0.00 OD n/a n/a S4.2 F 44.6 White Mother p.W855* 0.00 0.00 OD 330 n/a S4.3 M 40.9 White Father p.T1526M 0.00 0.00 OS 283 271 S5.2 F 71.5 White Sister p.C698Y 0.00 0.10 OD n/a n/a S5.3 F 67.5 White Sister c.2160&#fe;1G>C 0.00 0.00 OS n/a n/a S5.4 F 62.9 White Sister p.C698Y 0.00 0.00 OD n/a n/a S6.2 M 54.9 Black Brother p.T1526M 0.10 0.00 OS 477 423 S7.2 F 48.9 White Mother c.5196&#fe;1G>A 0.00 0.00 OS 443 415 S8.2 F 59.6 White Mother p.K346T 0.00 0.00 OD 546 483 S8.3 M 54.6 White Father p.T1117I 0.10 0.10 OD 289 n/a S9.2 F 51.5 White Mother c.5196&#fe;1137G>A 0.00 0.00 n/a 302 n/a S9.3 M 57.8 White Father p.C54Y 0.00 0.00 OS 419 375 S10.2 M 24.1 Indian Brother p.Q2220* 0.00 0.00 OD 227 227 S11.2 F 40.0 Asian Mother c.5923del 0.00 0.18 OD 229 191 S11.3 M 40.1 Asian Father p.R408* 0.00 0.00 OD 195 178 S12.2 F 53.2 White Mother p.L2027F 0.00 0.00 n/a 355 309 S13.2 F 49.8 White Mother p.R1161S 0.00 0.00 OS 367 372 S13.3 M 22.3 White Brother p.R1161S 0.00 0.00 OD 202 206 S14.2 F 67.0 White Mother p.P1380L 0.00 0.00 OD n/a n/a S14.3 F 24.4 White Sister p.P1380L 0.00 0.00 OS n/a 163 S15.3 F 26.8 White Sister c.3050&#fe;5G>A 0.00 0.00 n/a 293 281 S16.2 M 53.7 Black Father c.4253&#fe;5G>T 0.00 0.00 n/a n/a 204 S17.2 F 60.0 Hispanic Mother p.A1038V 0.00 0.00 n/a 247 n/a S18.2 F 41.8 Indian Father c.5917del 0.00 0.00 OD n/a 194 S18.3 M 48.6 Indian Mother c.859-9T>C 0.00 0.00 OD 253 215 S18.4 F 12.9 Indian Sister c.5917del 0.00 0.00 OD 84 93 S19.4 F 58.5 White Mother p.L2027F 0.00 0.00 OD 205 n/a S19.5 M 61.6 White Father p.G851D 0.10 0.10 OD n/a n/a S20.2 F 41.5 White Mother c.5312&#fe;1G>A 0.00 0.00 n/a 335 351 S20.3 M 39.0 White Father p.R2030* 0.00 0.10 n/a 442 n/a S21.3 F 53.1 White Mother p.G1961E 0.00 0.00 OD 490 488 S22.3 M 46.3 White Father p.L2027F 0.00 0.00 OS 386 376 S22.4 F 47.1 White Mother p. Login to comment
67 [L541P;A1038V] c.768&#fe;358C>T 0.30 0.18 n/a 413 P 2.1ߤ M 17.9 Indian p.G1961E c.6729&#fe;5_&#fe;19del 0.70 0.88 340 363 P 3.1&#a7; F 25.1 White p.G863A c.5898&#fe;1G>A 0.80 0.80 710 675 P 3.2ߤ F 18.9 White p.G863A c.5898&#fe;1G>A 0.00 0.00 465 431 P 3.3 F 24.4 White p.G863A c.5898&#fe;1G>A 0.18 0.00 507 467 P 4.1 M 9.0 White p.W855* p.T1526M 1.00 1.00 538 n/a P 5.1 F 67.0 White p.C54Y c.2160&#fe;1G>C CF HM n/a n/a P 6.1 M 46.0 Black p.T1526M 0.30 0.80 n/a n/a P 7.1 F 25.3 White c.5196&#fe;1G>A p.S2235P 1.00 1.30 420 317 P 8.1 M 17.0 White p.K346T p.T1117I 1.30 0.70 871 828 P 9.1 M 21.5 White p.C54Y c.5196&#fe;1137G>A 0.18 0.18 609 608 P 10.1 M 31.0 Indian c. Login to comment