ABCMdb

ABCA4 p.Gly1961Glu

ClinVar:	c.5882G>A , p.Gly1961Glu D , Pathogenic, not provided, risk factor
Predicted by SNAP2:	A: D (59%), C: D (71%), D: D (71%), E: D (95%), F: D (85%), H: D (66%), I: D (80%), K: D (66%), L: D (80%), M: D (95%), N: D (53%), P: D (71%), Q: D (63%), R: D (66%), S: N (53%), T: D (53%), V: D (75%), W: D (91%), Y: D (85%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Three different ABCA4 mutations in the same large ... Eur J Hum Genet. 2006 Dec;14(12):1269-73. Epub 2006 Aug 9. Ducroq D, Shalev S, Habib A, Munnich A, Kaplan J, Rozet JM
Three different ABCA4 mutations in the same large family with several consanguineous loops affected with autosomal recessive cone-rod dystrophy.
Eur J Hum Genet. 2006 Dec;14(12):1269-73. Epub 2006 Aug 9., [PMID:16896346]

Abstract [show]
A large multiplex family presumably affected with autosomal recessive cone-rod dystrophy (CRD) was ascertained from Israel. In this family of Christian Arab ancestry with six consanguineous loops, linkage analysis failed to identify homozygosity in all six nuclear families at any of the three arCORD loci hitherto reported. However, homozygosity was found at the CORD3 locus for two nuclear families and the segregation of three distinct haplotypes at this locus in the whole pedigree suggested the alteration of the ABCA4 gene. This hypothesis was confirmed by the identification of three distinct mutations. Subsequently, with regard to the wide spectrum of autosomal recessive retinal dystrophies related to ABCA4 mutations, the natural history of the disease was revisited in all patients. Although the diagnosis of CRD was confirmed in 8/9 patients, the last one, aged of 34, displayed typical signs of Stargardt disease without extension to the peripheral retina. The results of this study emphasize the pitfalls of homozygosity mapping in highly inbred families when the heterozygote carrier frequency is particularly high in the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Three different ABCA4 mutations were identified: (i) c.5460 þ 1G4A (M1), (ii) c.5882G4A (p.G1961E; M2) and (iii) c.3607G4A (p.G1202R; M3). Login to comment
59 The two affected sibs compound heterozygote for the c.5460 þ 1G4A splice-site mutation (M1) and the p.G1961E mutation (M2; patients III1, III2) were as severely affected as patients homozygous for the splice-site mutation. Login to comment
60 Thus, it is likely that the p.G1961E mutation significantly affects the function of the protein. Login to comment
61 This notion is supported by the functional study of this mutation, which showed that the mutant protein exhibited a reduced basal ATPase activity that is inhibited, rather than stimulated, by retinal.17 Additionally, it is worth noting that the p.G1961E mutation has already been found to be associated with arCRD.18,19 Two patients were compound heterozygous for the c.5460 þ 1G4A splice-site mutation (M1) and the p.G1202R substitution (M3, patients IV4 and V1; Figure 1). Login to comment
71 Finally, one patient (IV5) was found to carry the p.G1961E and p.G1202R missense mutations. Login to comment
73 The phenotype of this woman associated with compound heterozygosity for the p.G1961E and p.G1202R mutations is less severe than the association of one of them with the c.5460 þ 1G4A splice-site mutation. Login to comment

[hide] Adenosine triphosphate-binding cassette transporte... Ageing Res Rev. 2003 Jan;2(1):11-24. Efferth T
Adenosine triphosphate-binding cassette transporter genes in ageing and age-related diseases.
Ageing Res Rev. 2003 Jan;2(1):11-24., [PMID:12437993]

Abstract [show]
The family of adenosine triphosphate (ATP)-binding cassette (ABC) transporters is the largest gene family known. While some ABC transporters translocate single substances across membranes with high specificity, others transport a wide variety of different lipophilic compounds. They are responsible for many physiological processes and are also implicated in a number of diseases. The present review focuses on ABC transporter genes which are involved in ageing and age-related diseases. Expression of ABCB1 (MDR1, P-glycoprotein) increases with age in CD4(+) and CD8(+) T-lymphocytes indicating that P-glycoprotein may be involved in the secretion of cytokines, growth factors, and cytotoxic molecules. As T cells in aged individuals are hyporesponsive leading to a reduced immunodefence capability, a role of ABCB1 in age-related immunological processes is presumed. The ABCA1 (ABC1) gene product translocates intracellular cholesterol and phospholipids out of macrophages. Genetic aberrations in ABCA1 cause perturbations in lipoprotein metabolism and contribute to atherosclerosis. ABCA4 (ABCR) represents a retina-specific ABC transporter expressed in rod photoreceptor cells. The ABCA4 gene product translocates retinyl-derivatives. Mutations in the ABCA4 gene contribute to age-related macular degeneration. Polymorphisms in the sulfonylurea receptor gene (ABCC8, SUR1) are associated with non-insulin-dependent diabetes mellitus (NIDDM). Sulfonylureas inhibit potassium conductance and are used to treat NIDDM by stimulation of insulin secretion across ATP-sensitive potassium channels in pancreatic beta-cell membranes. Possible diagnostic and therapeutic implications of ABC transporters for age-related diseases are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
160 The analysis of the two most frequent AMD-associated ABCA4 variants showed an approximately three-fold elevated risk of AMD for the D2177N variant carriers and an approximately five-fold elevated risk for the G1961E variant carriers. Login to comment

[hide] The ABCR gene: a major disease gene in macular and... Mol Genet Metab. 1999 Oct;68(2):310-5. Rozet JM, Gerber S, Souied E, Ducroq D, Perrault I, Ghazi I, Soubrane G, Coscas G, Dufier JL, Munnich A, Kaplan J
The ABCR gene: a major disease gene in macular and peripheral retinal degenerations with onset from early childhood to the elderly.
Mol Genet Metab. 1999 Oct;68(2):310-5., [PMID:10527682]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 However, the G1961E, A1038V, G2588C alleles represent the most common mutant alleles in Europe and America (18.5, 18.5, and 6%, respectively) (8-11). Login to comment
57 Two of the mutations identified (D2177N and G1961E) showed significantly different incidence between AMD and controls (14). Login to comment

[hide] ABC A-subfamily transporters: structure, function ... Biochim Biophys Acta. 2006 May;1762(5):510-24. Epub 2006 Feb 28. Kaminski WE, Piehler A, Wenzel JJ
ABC A-subfamily transporters: structure, function and disease.
Biochim Biophys Acta. 2006 May;1762(5):510-24. Epub 2006 Feb 28., [PMID:16540294]

Abstract [show]
ABC transporters constitute a family of evolutionarily highly conserved multispan proteins that mediate the translocation of defined substrates across membrane barriers. Evidence has accumulated during the past years to suggest that a subgroup of 12 structurally related "full-size" transporters, referred to as ABC A-subfamily transporters, mediates the transport of a variety of physiologic lipid compounds. The emerging importance of ABC A-transporters in human disease is reflected by the fact that as yet four members of this protein family (ABCA1, ABCA3, ABCR/ABCA4, ABCA12) have been causatively linked to completely unrelated groups of monogenetic disorders including familial high-density lipoprotein (HDL) deficiency, neonatal surfactant deficiency, degenerative retinopathies and congenital keratinization disorders. Although the biological function of the remaining 8 ABC A-transporters currently awaits clarification, they represent promising candidate genes for a presumably equally heterogenous group of Mendelian diseases associated with perturbed cellular lipid transport. This review summarizes our current knowledge on the role of ABC A-subfamily transporters in physiology and disease and explores clinical entities which may be potentially associated with dysfunctional members of this gene subfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
178 Interestingly, some mutant alleles such as G863A, A1038V, and G1961E, respectively, appear to be more common and may have altered frequencies in different populations, presumably as a result of a founder effect [76,80]. Login to comment
188 This was supported by the observation that the frequency of two common ABCA4 variants, G1961E and D2177N, in 1200 patients with AMD is significantly higher (3.4%) than that of controls (0.95%) [88]. Login to comment

[hide] Abnormality in the external limiting membrane in e... Ophthalmic Genet. 2012 Aug 7. Burke TR, Yzer S, Zernant J, Smith RT, Tsang SH, Allikmets R
Abnormality in the external limiting membrane in early Stargardt Disease.
Ophthalmic Genet. 2012 Aug 7., [PMID:22871184]

Abstract [show]
Stargardt disease (STGD1) is caused by mutations in the ABCA4 gene. It has previously been reported that abnormalities in STGD1 may be detectable in the photoreceptors using spectral domain-optical coherence tomography (SD-OCT) prior to the detection of retinal pigment epithelium abnormalities. We present a 5-year-old asymptomatic girl with normal appearing fundi who possessed pathogenic ABCA4 variants on both chromosomes and where thickening of the external limiting membrane was the only abnormality detected on SD-OCT.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 The proband was, as expected, heterozygous for this variant and had also inherited the G1961E variant from her father (Figure 1) as determined by direct sequencing of the entire coding region of the ABCA4 gene. Login to comment
36 The detection of BEM was not surprising as this patient carried the common G1961E mutation, which is known to yield a BEM phenotype in STGD1.7 The significance of thickening of the ELM remains, as yet, unclear. Login to comment
31 The proband was, as expected, heterozygous for this variant and had also inherited the G1961E variant from her father (Figure 1) as determined by direct sequencing of the entire coding region of the ABCA4 gene. Login to comment
35 The detection of BEM was not surprising as this patient carried the common G1961E mutation, which is known to yield a BEM phenotype in STGD1.7 The significance of thickening of the ELM remains, as yet, unclear. Login to comment

[hide] Molecular diagnosis of putative Stargardt disease ... BMC Med Genet. 2012 Aug 3;13:67. Strom SP, Gao YQ, Martinez A, Ortube C, Chen Z, Nelson SF, Nusinowitz S, Farber DB, Gorin MB
Molecular diagnosis of putative Stargardt disease probands by exome sequencing.
BMC Med Genet. 2012 Aug 3;13:67., [PMID:22863181]

Abstract [show]
ABSTRACT: BACKGROUND: The commonest genetic form of juvenile or early adult onset macular degeneration is Stargardt Disease (STGD) caused by recessive mutations in the gene ABCA4. However, high phenotypic and allelic heterogeneity and a small but non-trivial amount of locus heterogeneity currently impede conclusive molecular diagnosis in a significant proportion of cases. METHODS: We performed whole exome sequencing (WES) of nine putative Stargardt Disease probands and searched for potentially disease-causing genetic variants in previously identified retinal or macular dystrophy genes. Follow-up dideoxy sequencing was performed for confirmation and to screen for mutations in an additional set of affected individuals lacking a definitive molecular diagnosis. RESULTS: Whole exome sequencing revealed seven likely disease-causing variants across four genes, providing a confident genetic diagnosis in six previously uncharacterized participants. We identified four previously missed mutations in ABCA4 across three individuals. Likely disease-causing mutations in RDS/PRPH2, ELOVL, and CRB1 were also identified. CONCLUSIONS: Our findings highlight the enormous potential of whole exome sequencing in Stargardt Disease molecular diagnosis and research. WES adequately assayed all coding sequences and canonical splice sites of ABCA4 in this study. Additionally, WES enables the identification of disease-related alleles in other genes. This work highlights the importance of collecting parental genetic material for WES testing as the current knowledge of human genome variation limits the determination of causality between identified variants and disease. While larger sample sizes are required to establish the precision and accuracy of this type of testing, this study supports WES for inherited early onset macular degeneration disorders as an alternative to standard mutation screening techniques.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 The p.G1961E missense variant is a known STGD mutation [19]. Login to comment
104 The p.G1961E missense variant is a known STGD mutation [19]. Login to comment

[hide] Retinal phenotypes in patients homozygous for the ... Invest Ophthalmol Vis Sci. 2012 Jul 3;53(8):4458-67. doi: 10.1167/iovs.11-9166. Print 2012 Jul. Burke TR, Fishman GA, Zernant J, Schubert C, Tsang SH, Smith RT, Ayyagari R, Koenekoop RK, Umfress A, Ciccarelli ML, Baldi A, Iannaccone A, Cremers FP, Klaver CC, Allikmets R
Retinal phenotypes in patients homozygous for the G1961E mutation in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2012 Jul 3;53(8):4458-67. doi: 10.1167/iovs.11-9166. Print 2012 Jul., [PMID:22661473]

Abstract [show]
PURPOSE: We evaluated the pathogenicity of the G1961E mutation in the ABCA4 gene, and present the range of retinal phenotypes associated with this mutation in homozygosity in a patient cohort with ABCA4-associated phenotypes. METHODS: Patients were enrolled from the ABCA4 disease database at Columbia University or by inquiry from collaborating physicians. Only patients homozygous for the G1961E mutation were enrolled. The entire ABCA4 gene open reading frame, including all exons and flanking intronic sequences, was sequenced in all patients. Phenotype data were obtained from clinical history and examination, fundus photography, infrared imaging, fundus autofluorescence, fluorescein angiography, and spectral domain-optical coherence tomography. Additional functional data were obtained using the full-field electroretinogram, and static or kinetic perimetry. RESULTS: We evaluated 12 patients homozygous for the G1961E mutation. All patients had evidence of retinal pathology consistent with the range of phenotypes observed in ABCA4 disease. The latest age of onset was recorded at 64 years, in a patient diagnosed initially with age-related macular degeneration (AMD). Of 6 patients in whom severe structural (with/without functional) fundus changes were detected, 5 had additional, heterozygous or homozygous, variants detected in the ABCA4 gene. CONCLUSIONS: Homozygous G1961E mutation in ABCA4 results in a range of retinal pathology. The phenotype usually is at the milder end of the disease spectrum, with severe phenotypes linked to the presence of additional ABCA4 variants. Our report also highlights that milder, late-onset Stargardt disease may be confused with AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Genetics Retinal Phenotypes in Patients Homozygous for the G1961E Mutation in the ABCA4 Gene Tomas R. Burke,1, * Gerald A. Fishman,2 Jana Zernant,1 Carl Schubert,1 Stephen H. Tsang,1,3 R. Theodore Smith,1,4 Radha Ayyagari,5 Robert K. Koenekoop,6 Allison Umfress,7,† Maria Laura Ciccarelli,8 Alfonso Baldi,9 Alessandro Iannaccone,7 Frans P. M. Cremers,10 Caroline C. W. Klaver,11,12 and Rando Allikmets1,3 PURPOSE. Login to comment
1 We evaluated the pathogenicity of the G1961E mutation in the ABCA4 gene, and present the range of retinal phenotypes associated with this mutation in homozygosity in a patient cohort with ABCA4-associated phenotypes. Login to comment
4 Only patients homozygous for the G1961E mutation were enrolled. Login to comment
9 We evaluated 12 patients homozygous for the G1961E mutation. Login to comment
14 Homozygous G1961E mutation in ABCA4 results in a range of retinal pathology. Login to comment
29 The missense mutation G1961E occurs in exon 42 of the ABCA4 gene. Login to comment
30 While this has been characterized as the most common ABCA4 mutation, its frequency in the general population varies widely across ethnic groups, from approximately 0.2% in populations of European origin,18,19 to approximately 10% in East African (e.g., Somali) populations.20 It is considered a pathologic mutation for three main reasons: (1) it always co-segregates with the disease in families,21 (2) other mutations are found rarely in cis (i.e., on the same chromosome), and (3) it affects protein function as determined by indirect functional tests (ATP-ase activity and ATP binding).22 The heterozygous G1961E mutation, in combination with a different ABCA4 allele on the other chromosome, has been associated with a localized disease process that is confined to the posterior pole, normal full-field electroretinogram (ffERG), absence of the ''dark choroid`` sign on fluorescein angiography (FA), and BEM on fundus autofluorescence (FAF).19,23-25 Despite all these data, there still is debate as to whether this mutation causes retinal pathology in homozygosity. Login to comment
31 We studied patients homozygous for the G1961E allele to demonstrate the pathogenicity of the mutation in homozygosity and to describe further the variation in retinal phenotypes associated with it. Login to comment
32 MATERIALS AND METHODS Patients Only patients who demonstrated phenotypes consistent with ABCA4 disease (i.e., BEM, STGD1, CRD, or RP) and who were homozygous for the G1961E mutation in the ABCA4 gene were included. Login to comment
47 In our study, however, we examined the full range of retinal phenotypes in a cohort of patients homozygous for the G1961E mutation to demonstrate the pathogenicity of this mutation in homozygous state. Login to comment
83 All patients were homozygous for the G1961E mutation in the ABCA4 gene. Login to comment
84 Patient 9 was double homozygous for the N96K mutation together with G1961E. Login to comment
87 Two other siblings (patients 7-1 and 7-2), who belonged to a consanguineous Jordanian family, also had the H1838D mutation detected in homozygosity, in addition to being homozygous for the G1961E mutation. Login to comment
91 Summary of Demographic, Clinical, and Functional Data in Patients Homozygous for the G1961E Mutation Patient #, Sex Additional ABCA4 Mutations Onset Age (years) Age at Exam (years) Duration (years) VA Clinical Phenotype ERG Group Silent Choroid Type of Perimetry Scotoma Location OD OS Milder Phenotypes 1, M 19 34 15 20/150 20/100 I I ND MP-1 Central 2, F 20 21 1 20/25 20/40 I I Absent ND ND 3, M T1253M 32 46 14 20/25 20/40 I I Absent GVF Perifoveal 4, F 43 67 24 20/40 20/150 II I ND MP-1 Central 5, F 48 65 17 20/150 20/200 I I ND MP-1 Central 6, F 64 86 22 20/200 20/200 II I Absent GVF Central Severe Phenotypes 7-1, M H1838D (Hom) 4 12 8 20/250 20/250 III III ND GVF Central 7-2, F H1838D (Hom) 7 13 6 20/200 20/200 IV III Peripapillary Ring GVF Central 8-1, F N96K 7 46 39 20/2000 20/2000 III III Peripapillary Ring GVF Central 8-2, M N96K 10 49 39 20/400 20/400 IV ND ND GVF Central 9, F N96K (Hom) 12 59 47 10/400 10/400 IV III ND ND ND 10, M 20 51 31 20/25 20/25 III RP ND GVF Perifoveal Each number identifies distinct families. Login to comment
96 The phase and true homozygosity of the G1961E mutation were determined by segregation analyses. Login to comment
106 Only one patient in this group (patient 3) had a heterozygous T1253M variant detected in the ABCA4 gene, in addition to the homozygous G1961E mutation. Login to comment
133 Interestingly, 5 of 6 patients in this group, with the exception of patient 10, harbored heterozygous or homozygous ABCA4 variants in addition to G1961E. Login to comment
134 DISCUSSION We illustrated the phenotypic expression of retinal disease associated with homozygous G1961E mutation in the ABCA4 gene. Login to comment
135 It was suggested previously that G1961E was not pathogenic, at least in homozygosity, for two reasons. Login to comment
136 First, the mutation is detected at approximately 10% frequency in the general population from Somalia, predicting that 1/100 Somalis are homozygous for G1961E.20 Since, as stated in that FIGURE 2. Login to comment
147 study, ''Stargardt disease is not known to be 100 times more prevalent in Somalia than in the United States, it suggests that G1961E does not frequently cause disease in the homozygous state.`` Secondly, The same group presented an asymptomatic 25-year-old Somali man homozygous for G1961E (Shankar SP. IOVS 2006;47:ARVO E-Abstract 1699). Login to comment
149 It is true that the G1961E mutation is frequent in East Africa. Login to comment
152 One possibility is that the G1961E mutation is pathogenic in Europeans and not in East Africa, that is the change happened twice or multiple times. Login to comment
154 In addition, in our study 50% (3 of 6) of patients with homozygous G1961E and no additional ABCA4 variants had a late disease onset, over 25 years of age. Login to comment
157 Large studies in elderly subjects of East African descent could reveal the correlation between the homozygous G1961E mutation and eye disease in those populations. Login to comment
158 In other populations, for example those of European descent, a normal visual function and a normal clinical examination do not exclude ABCA4 disease, especially when caused by the G1961E mutation in homozygosity. Login to comment
159 A likely scenario has the G1961E mutation arising once, in East Africa, and then lost (eliminated by selective pressure) in other regions due to its pathogenicity and earlier onset in heterozygosity with other, more severe, ABCA4 alleles. Login to comment
160 It is possible that these alleles are rare in East Africa and the mild G1961E mutation itself does not result in the disease during reproductive age, and, therefore, is not under selective pressure. Login to comment
161 Another proof of pathogenicity for the homozygous G1961E comes from allele frequency calculations. Login to comment
166 We have detected 6 G1961E homozygotes after screening approximately 600 random STGD1 patients, which is the exact predicted frequency of homozygosity. Login to comment
167 Six patients had other ABCA4 variants on the same chromosome with G1961E. Login to comment
168 One patient harbored a heterozygous T1253M variant, which previously has been reported sometimes to form a complex allele with G1961E.41 It is predicted to give rise to an amino acid change that lies outside the functional domain of the ABCA4 protein, it never occurs without G1961E, and, therefore, its pathogenicity has not been confirmed. Login to comment
184 These genetic findings in our patients of Italian origin are in keeping with recent reports of this mutation in Italian populations with STGD1.43 The H1838D mutation has been reported previously in patient 7-1.31 This variant clearly has a profoundly deleterious effect on ABCA4 protein function, at least when present in conjunction with the G1961E in homozygosity, giving rise to a severe, early-onset and complex phenotype in both siblings from a consanguineous family of Jordanian descent. Login to comment
185 In general, patients homozygous for the G1961E mutation demonstrated a later onset of visual symptoms than typically would be seen in STGD1.27,44,45 However, despite the better prognosis for overall retinal function in these G1961E homozygous patients (as determined by normal ffERGs) the final visual acuity can still reach 20/200. Login to comment
186 Previous reports have focused mainly on the phenotypes of patients with G1961E in simple or compound heterozygosity. Login to comment
187 The majority of those patients revealed a milder retinal disease phenotype confined to the central macula, with absence of the dark choroid sign on FA, and with normal ffERG.24,25,46 This milder phenotype correlates with the observation that although there is a reduction in ATPase activity with the G1961E mutation, there is comparable yield to the levels seen in the wild-type.46 However, its basal ATPase activity appears inhibited rather than stimulated by retinal.22 While all other patients had a clinical diagnosis of STGD1 before genetic confirmation, patient 6 initially was diagnosed with dry AMD with GA, due to the late onset of disease and the absence of flecks on clinical examination. Login to comment
188 During investigation of the genetic causes of AMD the patient was screened for mutations in the ABCA4 gene and the homozygous G1961E mutation was detected, highlighting an important issue in crossover between AMD and ABCA4-associated disease phenotypes. Login to comment
191 In summary, our findings demonstrate the pathogenicity of the G1961E mutation by the phenotypic manifestation of STGD1 patients where only the G1961E mutation was detected in homozygosity. Login to comment
192 As observed previously in patients compound heterozygous for the G1961E mutation, phenotypic expression was somewhat atypical for classical STGD1, with the traditional findings of retinal flecks and a dark choroid effect on FA largely absent in association with the G1961E mutation in homozygosity. Login to comment
194 Lastly, a normal visual acuity and a normal clinical examination should not exclude a diagnosis of ABCA4 disease, especially when the G1961E mutation is the putative genetic cause. Login to comment
2 We evaluated the pathogenicity of the G1961E mutation in the ABCA4 gene, and present the range of retinal phenotypes associated with this mutation in homozygosity in a patient cohort with ABCA4-associated phenotypes. Login to comment
5 Only patients homozygous for the G1961E mutation were enrolled. Login to comment
10 We evaluated 12 patients homozygous for the G1961E mutation. Login to comment
15 Homozygous G1961E mutation in ABCA4 results in a range of retinal pathology. Login to comment
28 The missense mutation G1961E occurs in exon 42 of the ABCA4 gene. Login to comment
46 In our study, however, we examined the full range of retinal phenotypes in a cohort of patients homozygous for the G1961E mutation to demonstrate the pathogenicity of this mutation in homozygous state. Login to comment
82 All patients were homozygous for the G1961E mutation in the ABCA4 gene. Login to comment
86 Two other siblings (patients 7-1 and 7-2), who belonged to a consanguineous Jordanian family, also had the H1838D mutation detected in homozygosity, in addition to being homozygous for the G1961E mutation. Login to comment
90 Summary of Demographic, Clinical, and Functional Data in Patients Homozygous for the G1961E Mutation Patient #, Sex Additional ABCA4 Mutations Onset Age (years) Age at Exam (years) Duration (years) VA Clinical Phenotype ERG Group Silent Choroid Type of Perimetry Scotoma Location OD OS Milder Phenotypes 1, M 19 34 15 20/150 20/100 I I ND MP-1 Central 2, F 20 21 1 20/25 20/40 I I Absent ND ND 3, M T1253M 32 46 14 20/25 20/40 I I Absent GVF Perifoveal 4, F 43 67 24 20/40 20/150 II I ND MP-1 Central 5, F 48 65 17 20/150 20/200 I I ND MP-1 Central 6, F 64 86 22 20/200 20/200 II I Absent GVF Central Severe Phenotypes 7-1, M H1838D (Hom) 4 12 8 20/250 20/250 III III ND GVF Central 7-2, F H1838D (Hom) 7 13 6 20/200 20/200 IV III Peripapillary Ring GVF Central 8-1, F N96K 7 46 39 20/2000 20/2000 III III Peripapillary Ring GVF Central 8-2, M N96K 10 49 39 20/400 20/400 IV ND ND GVF Central 9, F N96K (Hom) 12 59 47 10/400 10/400 IV III ND ND ND 10, M 20 51 31 20/25 20/25 III RP ND GVF Perifoveal Each number identifies distinct families. Login to comment
95 The phase and true homozygosity of the G1961E mutation were determined by segregation analyses. Login to comment
105 Only one patient in this group (patient 3) had a heterozygous T1253M variant detected in the ABCA4 gene, in addition to the homozygous G1961E mutation. Login to comment
132 Interestingly, 5 of 6 patients in this group, with the exception of patient 10, harbored heterozygous or homozygous ABCA4 variants in addition to G1961E. Login to comment
146 study, ''Stargardt disease is not known to be 100 times more prevalent in Somalia than in the United States, it suggests that G1961E does not frequently cause disease in the homozygous state.`` Secondly, The same group presented an asymptomatic 25-year-old Somali man homozygous for G1961E (Shankar SP. IOVS 2006;47:ARVO E-Abstract 1699). Login to comment
148 It is true that the G1961E mutation is frequent in East Africa. Login to comment
151 One possibility is that the G1961E mutation is pathogenic in Europeans and not in East Africa, that is the change happened twice or multiple times. Login to comment
153 In addition, in our study 50% (3 of 6) of patients with homozygous G1961E and no additional ABCA4 variants had a late disease onset, over 25 years of age. Login to comment
156 Large studies in elderly subjects of East African descent could reveal the correlation between the homozygous G1961E mutation and eye disease in those populations. Login to comment
165 We have detected 6 G1961E homozygotes after screening approximately 600 random STGD1 patients, which is the exact predicted frequency of homozygosity. Login to comment
183 These genetic findings in our patients of Italian origin are in keeping with recent reports of this mutation in Italian populations with STGD1.43 The H1838D mutation has been reported previously in patient 7-1.31 This variant clearly has a profoundly deleterious effect on ABCA4 protein function, at least when present in conjunction with the G1961E in homozygosity, giving rise to a severe, early-onset and complex phenotype in both siblings from a consanguineous family of Jordanian descent. Login to comment
190 In summary, our findings demonstrate the pathogenicity of the G1961E mutation by the phenotypic manifestation of STGD1 patients where only the G1961E mutation was detected in homozygosity. Login to comment
193 Lastly, a normal visual acuity and a normal clinical examination should not exclude a diagnosis of ABCA4 disease, especially when the G1961E mutation is the putative genetic cause. Login to comment

[hide] Correlation between photoreceptor layer integrity ... Invest Ophthalmol Vis Sci. 2012 Jul 3;53(8):4409-15. doi: 10.1167/iovs.11-8201. Print 2012 Jul. Testa F, Rossi S, Sodi A, Passerini I, Di Iorio V, Della Corte M, Banfi S, Surace EM, Menchini U, Auricchio A, Simonelli F
Correlation between photoreceptor layer integrity and visual function in patients with Stargardt disease: implications for gene therapy.
Invest Ophthalmol Vis Sci. 2012 Jul 3;53(8):4409-15. doi: 10.1167/iovs.11-8201. Print 2012 Jul., [PMID:22661472]

Abstract [show]
PURPOSE: To perform a clinical characterization of Stargardt patients with ABCA4 gene mutation, and to investigate the correlation between the inner and outer segment (IS/OS) junction morphology and visual acuity, fundus lesions, electroretinogram abnormalities, and macular sensitivity. METHODS: Sixty-one patients with Stargardt disease (STGD) were given a comprehensive ophthalmic examination. Inner-outer photoreceptor junction morphology evaluated by spectral-domain optical coherence tomography was correlated with visual acuity, fundus lesions, fundus autofluorescence, full-field and multifocal electroretinography responses, and microperimetric macular sensitivities. We classified STGD patients into three groups: (1) IS/OS junction disorganization in the fovea, (2) IS/OS junction loss in the fovea, and (3) extensive loss of IS/OS junction. Mutation analysis of the ABCA4 gene was carried out by sequencing the complete coding region. RESULTS: A significant difference in visual acuity was observed between IS/OS groups 1 and 2 and between IS/OS groups 2 and 3 (P < 0.0001). A significant difference in microperimetry sensitivity was observed between IS/OS groups 2 and 3, and between IS/OS groups 1 and 3 (P < 0.0001). There was also a statistically significant correlation between IS/OS abnormalities and the extent of fundus lesions (Spearman P </= 0.01), as well as with the type of ERG and multifocal ERG results (Spearman P </= 0.01). Finally, the degree of IS/OS junction preservation showed a statistically significant correlation with the extension of foveal abnormalities assessed by fundus autofluorescence imaging (Spearman P </= 0.01). The G1961E mutation was more frequent in the patients without extensive loss of IS/OS junction (P = 0.01) confirming its association with a milder STGD phenotype. CONCLUSIONS: The results of this study suggest that a comprehensive approach in the examination of Stargardt patients has the potential to improve the understanding of vision loss and may provide a sensitive measure to evaluate the efficacy of future experimental therapies in patients with STGD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
12 The G1961E mutation was more frequent in the patients without extensive loss of IS/OS junction (P ¼ 0.01) confirming its association with a milder STGD phenotype. Login to comment
66 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundus† FAF‡ ERG§ mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35þ2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35þ2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35þ2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45þ1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40þ5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35þ2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40þ5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35þ2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35þ2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40þ5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40þ5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35þ2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40þ5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45þ1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45þ1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35þ2t > c IVS40þ5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45þ1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram. Login to comment
75 Three different Fisher exact tests were used to evaluate the significance of association (contingency) between the Group I/II classification and the presence/absence of missense mutation, premature truncation, and/or G1961E. Login to comment
109 However, we confirmed that the G1961E mutation is associated with a milder STGD phenotype, being more frequent in the stage-I group compared with the stage-II group of patients (17 of 60 [28.3%] in group I vs. 5 of 52 [9.6%] in group II; P ¼ 0.01). Login to comment
121 In the present study, it has been demonstrated that the G1961E mutation is associated with a better preserved IS/OS junction; this result also agrees with Cella et al.26 who reported that the anatomic and functional features associated with both homozygous and heterozygous G1961E mutations are limited to changes in the parafoveal region rather than generalized retinal dysfunction. Login to comment
67 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundusߤ FAFߥ ERG&#a7; mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35&#fe;2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35&#fe;2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35&#fe;2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45&#fe;1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40&#fe;5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35&#fe;2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40&#fe;5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35&#fe;2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35&#fe;2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40&#fe;5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40&#fe;5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35&#fe;2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40&#fe;5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45&#fe;1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45&#fe;1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35&#fe;2t > c IVS40&#fe;5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45&#fe;1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram. Statistics Our set of data is described by continuous (BCVA, OCT foveal thickness, and macular sensitivities) and categorical (fundus, FAF, IS/ OS, ERG, and mfERG groups) variables. Login to comment

[hide] Foveal cavitation as an optical coherence tomograp... Retina. 2012 Jul;32(7):1411-9. Leng T, Marmor MF, Kellner U, Thompson DA, Renner AB, Moore W, Sowden JC
Foveal cavitation as an optical coherence tomography finding in central cone dysfunction.
Retina. 2012 Jul;32(7):1411-9., [PMID:22466470]

Abstract [show]
PURPOSE: To describe a distinctive foveal cavitation as seen by spectral-domain optical coherence tomography in certain cone dysfunction syndromes. METHODS: Observational case series. Patients were evaluated by dilated fundus examination, fundus photography, fundus autofluorescence, full-field electroretinogram, multifocal electroretinogram, spectral-domain optical coherence tomography, color vision testing, fluorescein angiography, Goldmann visual field testing, and molecular genetic analysis. RESULTS: We present eight patients with foveal cavitation in association with presumed cone dysfunction. This was characterized on spectral-domain optical coherence tomography by a gap in the subfoveal outer segment layer without more diffuse retinal thinning. There were 5 patients of age 10 years to 27 years and 3 patients of age 49 years to 52 years, with a 1.5- to 38-year history of bilateral visual loss. A small foveal oval-shaped area of reduced foveal fundus autofluorescence, surrounded by increased fundus autofluorescence, was seen in the younger patients, and a broad circle of increased fundus autofluorescence in the older patients. The multifocal electroretinogram always showed central amplitude reduction, but there were varying degrees of cone dysfunction on full-field electroretinogram. There were mild abnormalities on desaturated color vision testing. The family history was noncontributory in all cases. None of the cases were congenital. ABCA4 gene mutations were identified in three of five patients tested; CNGB3 testing was negative in these patients. CONCLUSION: Cone dysfunction syndromes typically show retinal thinning on optical coherence tomography imaging, although several case reports have noted focal outer retinal loss. Our case series shows that a distinctive optical coherence tomography finding, foveal cavitation, may be a clue to cone dysfunction syndromes, but is not specific to any one hereditary disorder or age group.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Nine months later: rod and cone amplitudes smaller, but still normal and implicit times increased, but still normal Reduced amplitude centrally Two alleles: c.1584C.A (p.Tyr528X) c.5882G.A (p.Gly1961Glu). Login to comment
47 No mutations (also negative for ELOVL4) 5 M 15 20/40 20/40 4 Small oval of reduced FAF surrounded by increased FAF Mild Rods: normal Cones: reduced amplitudes Not done One allele: c.5882G.A (p.Gly1961Glu) (heterozygous) No mutations 6 M 52 20/80 20/60 2 Foveal stippling surrounded by increased FAF Mild Rods: normal Cones: reduced amplitudes and increased implicit times Reduced amplitude centrally Not done Not done 7 M 50 CF (amblyopic) 20/32 38 Foveal stippling surrounded by increased FAF Not done Rods: reduced amplitudesCones: reduced amplitudes and slightly increased implicit times; OD worse than OS Reduced amplitude across posterior pole No mutations No mutations 8 M 49 20/200 20/200 31 Small parafoveal ring of increased FAF Not done Not done Not done Not done Not done *Testing with Farnsworth D-15 Test: all cases were normal with the standard test, but made irregular errors with the desaturated test. Login to comment
88 Previous reports by Cella et al10 and by Gomes et al11 describe cases of ABCA4 mutations involving L541P/ A1038V and G1961E. Login to comment
90 Cella et al10 proposed that the G1961E allele in either homozygosity or heterozygosity is associated with anatomical and functional pathologies limited to the parafoveal region; however, this mutation was present as a heterozygous mutation in only 2 of 5 cases tested (Cases 4 and 5) and L541P/A1038V was not present. Login to comment

[hide] Macular function in macular degenerations: repeata... Invest Ophthalmol Vis Sci. 2012 Feb 21;53(2):841-52. Print 2012 Feb. Cideciyan AV, Swider M, Aleman TS, Feuer WJ, Schwartz SB, Russell RC, Steinberg JD, Stone EM, Jacobson SG
Macular function in macular degenerations: repeatability of microperimetry as a potential outcome measure for ABCA4-associated retinopathy trials.
Invest Ophthalmol Vis Sci. 2012 Feb 21;53(2):841-52. Print 2012 Feb., [PMID:22247458]

Abstract [show]
PURPOSE: To measure macular visual function in patients with unstable fixation, to define the photoreceptor source of this function, and to estimate its test-retest repeatability as a prerequisite to clinical trials. METHODS: Patients (n = 38) with ABCA4-associated retinal degeneration (RD) or with retinitis pigmentosa (RP) were studied with retina-tracking microperimetry along the foveo-papillary profile between the fovea and the optic nerve head, and point-by-point test-retest repeatability was estimated. A subset with foveal fixation was also studied with dark-adapted projection perimetry using monochromatic blue and red stimuli along the horizontal meridian. RESULTS: Macular function in ABCA4-RD patients transitioned from lower sensitivity at the parafovea to higher sensitivity in the perifovea. RP patients had the inverse pattern. Red-on-red microperimetric sensitivities successfully avoided ceiling effects and were highly correlated with absolute sensitivities. Point-by-point test-retest limits (95% confidence intervals) were +/-4.2 dB; repeatability was not related to mean sensitivity, eccentricity from the fovea, age, fixation location, or instability. Repeatability was also not related to the local slope of sensitivity and was unchanged in the parapapillary retina. CONCLUSIONS: Microperimetry allows reliable testing of macular function in RD patients without foveal fixation in longitudinal studies evaluating natural disease progression or efficacy of therapeutic trials. A single estimate of test-retest repeatability can be used to determine significant changes in visual function at individual retinal loci within diseased regions that are homogeneous and those that are heterogeneous and also in transition zones at high risk for disease progression.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Clinical and Molecular Characteristics of the ABCA4 Patients Patient Age (y)/Sex ABCA4 Mutation Clinical Diagnosis Visual Acuity* Kinetic Visual Field Extent (V-4e)†Allele 1 Allele 2 Foveal Fixation P1‡ 12/M N965S W821R STGD 20/20 97 P2‡ 17/F V989A IVS28ϩ5 GϾT STGD 20/100 90 P3 18/M G1961E R1129L§ STGD 20/100 105 P4 21/F R212C P68R STGD 20/125 101 P5 24/M P1511 del1ccgC R1705Q STGD 20/25 114 P6 31/M G863A R1108C STGD 20/25 105 P7 32/F IVS40ϩ5 GϾA V935A STGD 20/32 103 P8 34/M G1961E - CRD 20/32 98 P9 37/F R681X P309R STGD 20/20 109 P10 39/M G1961E C54Y§ STGD 20/40 101 P11‡ 42/F G1961E V256V STGD 20/32 105 P12‡ 46/F G1961E V256V STGD 20/32 106 P13 52/F G1961E P1380L STGD 20/40 105 P14 58/M D600E R18W§ STGD 20/40 84 Extrafoveal Fixation P15 11/M V256V T1526M CRD 20/200 102 P16 15/M C54Y IVS35ϩ2 TϾC STGD 20/200 96 P17‡ 16/F V989A IVS28ϩ5 GϾT STGD 20/100 100 P18‡ 16/M N965S W821R STGD 20/125 100 P19 19/F A1038V/L541P N965S STGD 20/400 90 P20 21/M G863A IVS35ϩ2 TϾC STGD 20/200 99 P21 22/F G1961E R152X STGD 20/50 104 P22 27/M G863A P1660S§ STGD 20/100 98 P23 27/F G1961E A1038V/L541P STGD 20/100 109 P24 29/M G1961E T1019M STGD 20/100 104 P25 33/M P1486L deletion of exon 7 STGD 20/400 98 P26 36/F G863A C1490Y STGD 20/100 93 P27 41/M A1038V/L541P - STGD 20/125 108 P28 49/F T1526M R2030Q STGD 20/125 98 P29 55/F W855X - STGD 20/160 87 P30 56/F G1961E IVS37ϩ1 GϾA§ STGD 20/125 89 P31 60/F G1961E M669 del2ccAT STGD 20/125 104 STGD, Stargardt disease; CRD, cone-rod dystrophy. Login to comment

[hide] Phenotypic and genetic spectrum of Danish patients... Ophthalmic Genet. 2012 Dec;33(4):225-31. doi: 10.3109/13816810.2011.643441. Epub 2012 Jan 9. Duno M, Schwartz M, Larsen PL, Rosenberg T
Phenotypic and genetic spectrum of Danish patients with ABCA4-related retinopathy.
Ophthalmic Genet. 2012 Dec;33(4):225-31. doi: 10.3109/13816810.2011.643441. Epub 2012 Jan 9., [PMID:22229821]

Abstract [show]
Background: Pathogenic variations in the ABCA4 gene were originally recognized as genetic background for the autosomal recessive disorders Stargardt disease and fundus flavimaculatus, but have expanded to embrace a diversity of retinal diseases, giving rise to the new diagnostic term, ABCA4-related retinopathy. Diagnostic genotyping of ABCA4 is complicated by the large size of the gene and the existence of approximately 600 known pathogenic variations, along with numerous rare polymorphisms. A commercial diagnostic array-based assay has been developed targeting known mutations, however a conclusive genetic diagnosis must rely on a comprehensive genetic screening as the mutation spectrum of ABCA4-related retinopathies continues to expand. Material and methods: Among 161 patients with a Stargardt-related phenotype previously assessed with the commercial ABCA4 mutation microarray, we analyzed the ABCA4 gene with High-resolution melting (HRM) in patients in whom the array analysis identified either a heterozygous mutation (n = 50) or no mutation (n = 30). Results: The HRM method detected each of the already known mutations and polymorphisms. We identified the second ABCA4 mutation in 31 of 50 heterozygous patients (62%). Several novel mutations were identified of which four were identified multiple times. The recurrent novel mutations were subsequently assessed among the 30 patients with possible ABCA4-related diseases, previously found to be negative for known ABCA4 mutations by array analysis. In total, 30 different mutations were identified of which 21 have not been described before. Conclusion: Scandinavian patients with ABCA4-related retinopathy appear to have a distinct mutation spectrum, which can be identified in patients of diverse clinical phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.5584 + 1G>A na IVS39 New D188 c.5461-10T>C na IVS38 c.5693G>A p.R1898H 40 Known D433 c.5882G>A p.G1961E 42 c.6005 + 1G>A na IVS43 Known D134 c.4667 + 2G>T na IVS32 c.6098 T>G p.L2033R 44 New D186 c.3322C>T p.R1108C 22 c.6386 + 1G>A na IVS46 New D182 c.6089G>A p.R2030Q 44 c.6386 + 1G>A na IVS46 New D189 c.2894A>G p.N965S 19 c.6478 A>G p.K2160E 47 New *p.L541P and p.A1038V might be located on the same allele. Login to comment
97 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773 + 5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005 + 1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773 + 3A>G* D110 p.[L541P+A1038V] c.5584 + 1G>A* D182 p.R2030Q c.6386 + 1G>A* D186 p.R1108C c.6386 + 1G>AA* D133 p.L510R IVS46 + 1G>A* Cone-rod dystrophy D134 c.4667 + 2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame. Login to comment
60 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.5584ߙ+ߙ1G>A na IVS39 New D188 c.5461-10T>C na IVS38 c.5693G>A p.R1898H 40 Known D433 c.5882G>A p.G1961E 42 c.6005ߙ+ߙ1G>A na IVS43 Known D134 c.4667ߙ+ߙ2G>T na IVS32 c.6098 T>G p.L2033R 44 New D186 c.3322C>T p.R1108C 22 c.6386ߙ+ߙ1G>A na IVS46 New D182 c.6089G>A p.R2030Q 44 c.6386ߙ+ߙ1G>A na IVS46 New D189 c.2894A>G p.N965S 19 c.6478 A>G p.K2160E 47 New *p.L541P and p.A1038V might be located on the same allele. Login to comment
100 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773ߙ+ߙ5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005ߙ+ߙ1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773ߙ+ߙ3A>G* D110 p.[L541P+A1038V] c.5584ߙ+ߙ1G>A* D182 p.R2030Q c.6386ߙ+ߙ1G>A* D186 p.R1108C c.6386ߙ+ߙ1G>AA* D133 p.L510R IVS46ߙ+ߙ1G>A* Cone-rod dystrophy D134 c.4667ߙ+ߙ2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame. Login to comment

[hide] Stargardt macular dystrophy: common ABCA4 mutation... Mol Vis. 2012;18:280-9. Epub 2012 Feb 1. Roberts LJ, Nossek CA, Greenberg LJ, Ramesar RS
Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients.
Mol Vis. 2012;18:280-9. Epub 2012 Feb 1., [PMID:22328824]

Abstract [show]
PURPOSE: Based on the previous indications of founder ATP-binding cassette sub-family A member 4 gene (ABCA4) mutations in a South African subpopulation, the purpose was to devise a mechanism for identifying common disease-causing mutations in subjects with ABCA4-associated retinopathies (AARs). Facilitating patient access to this data and determining the frequencies of the mutations in the South African population would enhance the current molecular diagnostic service offered. METHODS: The majority of subjects in this study were of Caucasian ancestry and affected with Stargardt macular dystrophy. The initial cohort consisted of DNA samples from 181 patients, and was screened using the ABCR400 chip. An assay was then designed to screen a secondary cohort of 72 patients for seven of the most commonly occurring ABCA4 mutations in this population. A total of 269 control individuals were also screened for the seven ABCA4 mutations. RESULTS: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. The newly designed genetic assay identified two of the seven disease-associated mutations in 28/72 patients in a secondary patient cohort. In the control cohort, 12/269 individuals were found to be heterozygotes, resulting in an estimated background frequency of these mutations in this particular population of 4.46 per 100 individuals. CONCLUSIONS: The relatively high detection rate of seven ABCA4 mutations in the primary patient cohort led to the design and subsequent utility of a multiplex assay. This assay can be used as a viable screening tool and to reduce costs and laboratory time. The estimated background frequency of the seven ABCA4 mutations, together with the improved diagnostic service, could be used by counselors to facilitate clinical and genetic management of South African families with AARs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment

[hide] Familial discordance in Stargardt disease. Mol Vis. 2012;18:227-33. Epub 2012 Jan 28. Burke TR, Tsang SH, Zernant J, Smith RT, Allikmets R
Familial discordance in Stargardt disease.
Mol Vis. 2012;18:227-33. Epub 2012 Jan 28., [PMID:22312191]

Abstract [show]
PURPOSE: To report genetic and phenotypic discordance across two generations of a family with autosomal recessive Stargardt disease (STGD1) and to compare pathogenicities of the G1961E and A1038V alleles of the ATP-binding cassette transporter, subfamily A, member 4 (ABCA4) gene. METHODS: Five members of a family with STGD1 (patients 1-4, affected; patient 5, carrier) were included. Clinical assessment was performed together with fundus autofluorescence and spectral domain-optical coherence tomography. Patients were stratified based on the results of electroretinogram testing. Genotyping of the ABCA4 gene was performed with the ABCR500 microarray. RESULTS: STGD1 was diagnosed in the male proband and his female sibling (patients 1 and 2, respectively). Two children of patient 2 (patients 3 and 4) were also affected. Genotyping revealed the W663X stop mutation in all affected patients. Patients 3 and 4, who were compound heterozygous for the G1961E mutation, had earlier ages of onset than patients 1 and 2, who were compound heterozygous for the A1038V mutation. Patient 1 had an age of onset 28 years younger than patient 2, whose delayed onset can be explained by relative foveal sparing, while patient 4 had an age of onset 44 years younger than patient 2. CONCLUSIONS: The G1961E mutation, which has been considered "mild," yields a more severe phenotype in this family than the A1038V mutation, which has been considered "severe." Marked intrasibship discordance in clinical course is described, suggesting an additional role for modifying factors in ABCA4 pleiotropism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Familial discordance in Stargardt disease Tomas R. Burke,1,4 Stephen H. Tsang,1,2 Jana Zernant,1 R. Theodore Smith,1,3 Rando Allikmets1,2 1Department of Ophthalmology, Edward S. Harkness Eye Institute, Columbia University, New York, NY; 2Department of Pathology and Cell Biology, Edward S. Harkness Eye Institute, Columbia University, New York, NY; 3Department of Biomedical Engineering, Columbia University, New York, NY; 4The Oxford Deanery, Prince Charles Eye Unit, King Edward VII Hospital, Windsor, United Kingdom Purpose: To report genetic and phenotypic discordance across two generations of a family with autosomal recessive Stargardt disease (STGD1) and to compare pathogenicities of the G1961E and A1038V alleles of the ATP-binding cassette transporter, subfamily A, member 4 (ABCA4) gene. Methods: Five members of a family with STGD1 (patients 1-4, affected; patient 5, carrier) were included. Clinical assessment was performed together with fundus autofluorescence and spectral domain-optical coherence tomography. Patients were stratified based on the results of electroretinogram testing. Login to comment
4 Patients 3 and 4, who were compound heterozygous for the G1961E mutation, had earlier ages of onset than patients 1 and 2, who were compound heterozygous for the A1038V mutation. Login to comment
5 Patient 1 had an age of onset 28 years younger than patient 2, whose delayed onset can be explained by relative foveal sparing, while patient 4 had an age of onset 44 years younger than patient 2. Conclusions: The G1961E mutation, which has been considered "mild," yields a more severe phenotype in this family than the A1038V mutation, which has been considered "severe." Login to comment
22 Patients 3 and 4 inherited the W663X mutation maternally and the G1961E mutation paternally. Login to comment
32 The G1961E missense mutation, which has a deleterious effect on ABCA4`s ATPase activity, is the most common mutation detected in the ABCA4 gene and has been reported to confer a milder phenotype [11,16,17]. Login to comment
33 All affected patients in this family carried the W663X mutation, and although G1961E is considered a "mild" mutation, both patients with the G1961E mutation had earlier ages of onset than those with A1038V, which is considered "severe." Login to comment
34 A report by Cideciyan et al. describing age of disease onset in terms of "age of retina-wide disease initiation" (ADI) suggested that the G1961E mutation results in a much later ADI than the complex allele L541P/A1038V [18]. Login to comment
36 In this study the retinae of patients 3 and 4 (with the G1961E mutation), at ages of examination Figure 1. Login to comment
58 Qualitatively normal thickness RPE was also observed in regions with loss of IS/OS (F, white arrow).Corresponding size bars for A and B, C and D, and E and F are included in A, C and E, respectively Familial discordance in Stargardt disease Tomas R. Burke,1,4 Stephen H. Tsang,1,2 Jana Zernant,1 R. Theodore Smith,1,3 Rando Allikmets1,2 1Department of Ophthalmology, Edward S. Harkness Eye Institute, Columbia University, New York, NY; 2Department of Pathology and Cell Biology, Edward S. Harkness Eye Institute, Columbia University, New York, NY; 3Department of Biomedical Engineering, Columbia University, New York, NY; 4The Oxford Deanery, Prince Charles Eye Unit, King Edward VII Hospital, Windsor, United Kingdom Purpose: To report genetic and phenotypic discordance across two generations of a family with autosomal recessive Stargardt disease (STGD1) and to compare pathogenicities of the G1961E and A1038V alleles of the ATP-binding cassette transporter, subfamily A, member 4 (ABCA4) gene. Methods: Five members of a family with STGD1 (patients 1-4, affected; patient 5, carrier) were included. Clinical assessment was performed together with fundus autofluorescence and spectral domain-optical coherence tomography. Patients were stratified based on the results of electroretinogram testing. Login to comment
62 Patients 3 and 4, who were compound heterozygous for the G1961E mutation, had earlier ages of onset than patients 1 and 2, who were compound heterozygous for the A1038V mutation. Login to comment
63 Patient 1 had an age of onset 28 years younger than patient 2, whose delayed onset can be explained by relative foveal sparing, while patient 4 had an age of onset 44 years younger than patient 2. Conclusions: The G1961E mutation, which has been considered "mild," yields a more severe phenotype in this family than the A1038V mutation, which has been considered "severe." Login to comment
21 Patients 3 and 4 inherited the W663X mutation maternally and the G1961E mutation paternally. Login to comment
31 The G1961E missense mutation, which has a deleterious effect on ABCA4`s ATPase activity, is the most common mutation detected in the ABCA4 gene and has been reported to confer a milder phenotype [11,16,17]. Login to comment
35 In this study the retinae of patients 3 and 4 (with the G1961E mutation), at ages of examination Figure 1. Login to comment
41 OD OS Patient #, sex Age at onset (years) Age at exam (years) Duration (years) ERG group VA GA area (mm 2 ) % change from baseline VA GA area (mm 2 ) % change from baseline Allele 1 Allele 2 1, M 29 63 34 I 20/125 7.5 20/150 7 W663X A1038V 64 35 20/150 8.1 0.067 20/150 7.3 0.047 65 36 20/150 9 0.186 20/200 7.9 0.139 2, F 57 68 11 I 20/25 0.4 20/40 1.5 W663X A1038V 69 12 20/30 0.5 0.309 20/30 1.7 0.167 3, M 21 41 20 I 20/150 10.8 20/150 5.8 W663X G1961E 4, F 13 39 26 I 20/150 2.2 20/150 6 W663X G1961E 40 27 20/150 2.9 0.183 20/150 7 0.109 5, M - 68 - - 20/20 - 20/20 - WT G1961E Figure 2. Login to comment

[hide] Transition zones between healthy and diseased reti... Invest Ophthalmol Vis Sci. 2011 Dec 20;52(13):9581-90. Print 2011. Lazow MA, Hood DC, Ramachandran R, Burke TR, Wang YZ, Greenstein VC, Birch DG
Transition zones between healthy and diseased retina in choroideremia (CHM) and Stargardt disease (STGD) as compared to retinitis pigmentosa (RP).
Invest Ophthalmol Vis Sci. 2011 Dec 20;52(13):9581-90. Print 2011., [PMID:22076985]

Abstract [show]
PURPOSE: To describe the structural changes across the transition zone (TZ) in choroideremia (CHM) and Stargardt disease (STGD) and to compare these to the TZ in retinitis pigmentosa (RP). METHODS: Frequency-domain (Fd)OCT line scans were obtained from seven patients with CHM, 20 with STGD, and 12 with RP and compared with those of 30 previously studied controls. A computer-aided manual segmentation procedure was used to determine the thicknesses of the outer segment (OS) layer, the outer nuclear layer plus outer plexiform layer (ONL+), the retinal pigment epithelium plus Bruch's membrane (RPE+BM), and the outer retina (OR). RESULTS: The TZ, while consistent within patient groups, showed differences across disease groups. In particular, (1) OS loss occurred before ONL+ loss in CHM and RP, whereas ONL+ loss occurred before OS loss in STGD; (2) ONL+ was preserved over a wider region of the retina in CHM than in RP; (3) RPE+BM remained normal across the RP TZ, but was typically thinned in CHM. In some CHM patients, it was abnormally thin in regions with normal OS and ONL+ thickness. In STGD, RPE+BM was thinned by the end of the TZ; and (4) the disappearances of the IS/OS and OLM were more abrupt in CHM and STGD than in RP. CONCLUSIONS: On fdOCT scans, patients with RP, CHM, and STGD all have a TZ between relatively healthy and severely affected retina. The patterns of changes in the receptor layers are similar within a disease category, but different across categories. The findings suggest that the pattern of progression of each disease is distinct and may offer clues for strategies in the development of future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20ϩ5 GϾA, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing. Login to comment
31 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20af9;5 Gb0e;A, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing. Login to comment

[hide] Quantification of peripapillary sparing and macula... Invest Ophthalmol Vis Sci. 2011 Oct 10;52(11):8006-15. Print 2011. Burke TR, Rhee DW, Smith RT, Tsang SH, Allikmets R, Chang S, Lazow MA, Hood DC, Greenstein VC
Quantification of peripapillary sparing and macular involvement in Stargardt disease (STGD1).
Invest Ophthalmol Vis Sci. 2011 Oct 10;52(11):8006-15. Print 2011., [PMID:21873672]

Abstract [show]
PURPOSE: To quantify and compare structure and function across the macula and peripapillary area in Stargardt disease (STGD1). METHODS: Twenty-seven patients (27 eyes) and 12 age-similar controls (12 eyes) were studied. Patients were classified on the basis of full-field electroretinogram (ERG) results: Fundus autofluorescence (FAF) and spectral domain-optical coherence tomography (SD-OCT) horizontal line scans were obtained through the fovea and peripapillary area. The thicknesses of the outer nuclear layer plus outer plexiform layer (ONL+), outer segment (OS), and retinal pigment epithelium (RPE) were measured through the fovea, and peripapillary areas from 1 degrees to 4 degrees temporal to the optic disc edge using a computer-aided, manual segmentation technique. Visual sensitivities in the central 10 degrees were assessed using microperimetry and related to retinal layer thicknesses. RESULTS: Compared to the central macula, the differences between controls and patients in ONL+, OS, and RPE layer thicknesses were less in the nasal and temporal macula. Relative sparing of the ONL+ and/or OS layers was detected in the nasal (i.e., peripapillary) macula in 8 of 13 patients with extramacular disease on FAF; relative functional sparing was also detected in this subgroup. All 14 patients with disease confined to the central macula, as detected on FAF, showed ONL+ and OS layer thinning in regions of normal RPE thickness. CONCLUSIONS: Relative peripapillary sparing was detected in STGD1 patients with extramacular disease on FAF. Photoreceptor thinning may precede RPE degeneration in STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 Summary of Clinical, Demographic, and Genetic Data Patient Sex Age at Exam (y) Eye VA BCEA 1 SD (deg 2 ) Eccentricity of PRL (deg) ERG Group FAF Abnormalities Allele 1 Allele 2 Allele 3 Distribution Peripapillary Area 1 F 43 OS 20/20 0.73 0 II M - A1799D ND ND 2 M 30 OS 20/150 3.21 6 I M - T1253M G1961E ND 3 F 55 OD 20/30 1.82 0 I EM - G863A IVS28af9;5 Gb0e;T ND 4 M 44 OD 20/25 0.65 0 I M - E161K ND ND 5.1 F 24 OD 20/200 1.57 1 I M - L541P/A1038V G1961E ND 5.2 F 22 OD 20/30 2.74 1 I M - L541P/A1038V G1961E ND 6.1 F 21 OD 20/150 2.01 1 I M - L541P/A1038V G1961E ND 6.2 F 18 OS 20/100 3.09 4 I M - L541P/A1038V G1961E ND 7 F 27 OS 20/400 2.97 9* II EM Peripapillary atrophy L2027F G851D ND 8 M 34 OS 20/100 2.16 4 I M - G1961E G1961E ND 9 M 20 OS 20/150 2.77 4 I M - IVS20af9;5 Gb0e;A G1961E ND 10 F 23 OS 20/150 9.05 5 I M - L541P/A1038V I1846T ND 11 M 59 OS 20/100 6.52 10 II EM - P1380L S1696N ND 12 M 49 OD 20/150 9.97 1 I EM Nasalaf9;temporal flecks R1108H P1380L ND 13 M 47 OS 20/80 5.62 7 I EM - G863A Y106X ND 14 F 42 OD 20/200 9.53 9 I EM Temporal flecks N965S ND ND 15 M 14 OD 20/200 23.84 1 II EM Nasal flecks IVS38-10 Tb0e;C IVS40af9;5 Gb0e;A ND 16 M 52 OS 20/20 1.3 0 I M - IVS38-10 Tb0e;C ND ND 17 M 34 OS 20/30 2.8 1 I M - L541P/A1038V G1961E ND 18 F 33 OD 20/100 6 6 I M - G1961E R2077W ND 19 F 22 OS 20/60 11 4 I M - A854T A1038V C2150Y 20 F 34 OS 20/200 14.2 14 I EM - G1961E ND ND 21 F 19 OD 20/200 3.7 12 I EM - R602W M18821 ND 22 F 27 OD 20/400 9.6 9 II EM Peripapillary atrophy P1380L P1380L ND 23 F 18 OS 20/50 4.9 5 I EM - R1640W V1693I ND 24 M 22 OS 20/150 10.5 2 I EM - C54Y ND ND 25 M 44 OS 20/150 9.1 5 I EM - R1640W ND ND VA, visual acuity; Rel. Login to comment

[hide] Further associations between mutations and polymor... Invest Ophthalmol Vis Sci. 2011 Aug 5;52(9):6206-12. Print 2011 Aug. Aguirre-Lamban J, Gonzalez-Aguilera JJ, Riveiro-Alvarez R, Cantalapiedra D, Avila-Fernandez A, Villaverde-Montero C, Corton M, Blanco-Kelly F, Garcia-Sandoval B, Ayuso C
Further associations between mutations and polymorphisms in the ABCA4 gene: clinical implication of allelic variants and their role as protector/risk factors.
Invest Ophthalmol Vis Sci. 2011 Aug 5;52(9):6206-12. Print 2011 Aug., [PMID:21330655]

Abstract [show]
PURPOSE: Mutations in ABCA4 have been associated with autosomal recessive Stargardt disease, autosomal recessive cone-rod dystrophy, and autosomal recessive retinitis pigmentosa. The purpose of this study was to determine (1) associations among mutations and polymorphisms and (2) the role of the polymorphisms as protector/risk factors. METHODS: A case-control study was designed in which 128 Spanish patients and 84 control individuals were analyzed. Patient samples presented one or two mutated alleles previously identified using ABCR400 microarray and sequencing. RESULTS: A total of 18 previously described polymorphisms were studied in patients and control individuals. All except one presented a polymorphisms frequency higher than 5% in patients, and five mutations were found to have a frequency >5%. The use of statistical methods showed that the frequency of the majority of polymorphisms was similar in patients and controls, except for the IVS10+5delG, p.Asn1868Ile, IVS48+21C>T, and p.Arg943Gln polymorphisms. In addition, IVS48+21C>T and p.Arg943Gln were found to be in linkage disequilibrium with the p.Gly1961Glu and p.Arg602Trp mutations, respectively. CONCLUSIONS: Although the high allelic heterogeneity in ABCA4 and the wide spectrum of many common and rare polymorphisms complicate the interpretation of clinical relevance, polymorphisms were identified that may act as risk factors (p.Asn1868Ile) and others that may act as protection factors (p.His423Arg and IVS10+5 delG).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 In addition, IVS48ϩ21CϾT and p.Arg943Gln were found to be in linkage disequilibrium with the p.Gly1961Glu and p.Arg602Trp mutations, respectively. Login to comment
68 Interestingly, only the p.Gly1961Glu substitution was identified in both patient and control groups. Login to comment
72 Mutations and Polymorphisms in the Patient Cohort ABCA4 mutation screening demonstrated that the most frequent (Ͼ5%) disease-associated alleles were the following: p.Arg1129Leu, p.Gly1961Glu, p.Arg602Trp, c.3211insGT, and p.Leu2060Arg (Table 1; Fig. 1). Login to comment
78 p.Gly1961Glu The p.Gly1961Glu mutation was the second most frequent missense variant, with a frequency of 14.1% (Table 1). Login to comment
79 p.Gly1961Glu was found in association with the following polymorphisms: p.Leu1894Leu in 100% of the patients (P Ͻ 0.001), p.Pro1948Pro in 94.4% (P Ͻ 0.001), p.Leu1938Leu in 89.9% (P Ͻ 0.001), p.Asp2095Asp in 83.3% (P Ͻ 0.001, and IVS10ϩ5delG in 55.6% of the cases (P ϭ 0.005). Login to comment
80 Similarly, IVS48ϩ21CϾT was found to exist in association with p.Gly1961Glu in 72.2% of 18 individuals (P Ͻ 0.001) and was not found in the remaining patients (Table 3). Login to comment
82 However, two polymorphic variants were found to be less frequently associated with the p.Gly1961Glu mutation in TABLE 1. Login to comment
83 Most Frequent ABCA4 Disease-Associated Alleles Identified in the Patient Cohort Exon Nucleotide Change Aminoacid Change Patients n (%) Allele Frequency n (%) Controls n (%) Allele Frequency n (%) P 23 c.3386GϾT p.Arg1129Leu 34 (26.6) 38 (14.8) 0 (0.0) 0 (0.0) 0.000 42 c.5882GϾA p.Gly1961Glu 18 (14.1) 18 (7.0) 1 (1.2) 1 (0.6) 0.001 13 c.1804CϾT p.Arg602Trp 8 (6.3) 9 (3.5) 0 (0.0) 0 (0.0) 0.020 22 c.3211insGT Frameshift 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 45 c.6179TϾG p.Leu2060Arg 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 Note that only the p.Gly1961Glu substitution was identified in both patients and control groups. Login to comment
87 The p.Asn1868Ile variant was found in higher proportion in patients than in control individuals (P ϭ 0.049) (Table 2) and was not present in the 82% of the carrier patients of the p.Gly1961Glu mutation (P ϭ 0.013) (Table 3). Login to comment
88 p.Arg602Trp The p.Arg602Trp mutation was found to be the third most prevalent missense variant, with a frequency of 6.3% (Table 1). Login to comment
109 Association between the Most Frequent ABCA4 Polymorphisms and Mutations Patients Variants Frequency P Status Predicted Effect Mutation, n (%) p.Arg1129Leu 34 (26.6) Present polymorphisms p.His423Arg 94.1% 0.000 Associated Risk IVS33؉48C>T 100% 0.011 Associated Risk IVS10ϩ5delG 20.6% 0.049 Associated Protector p.Leu1938Leu 17.6% 0.033 Associated Protector p.Ser2255Ile 2.9% 0.054 Associated Protector Mutation, n (%) p.Gly1961Glu 18 (14.1) Present polymorphisms p.Pro1948Pro 94.7% 0.000 Associated Risk p.Leu1938Leu 89.5% 0.000 Associated Risk p.Asp2095Asp 78.9% 0.000 Associated Risk IVS48؉21C>T 70.0% 0.000 Associated Risk IVS10؉5delG 57.9% 0.008 Associated Risk p.His423Arg 31.6% 0.016 Associated Protector p.Asn1868Ile 18.7% 0.039 Associated Protector Mutation, n (%) p.Arg602Trp 8 (6.3%) Present polymorphisms p.Arg943Gln 62.5% 0.000 Associated Risk p.Pro1401Pro 25% 0.044 Associated Protector p.Leu1938Leu 0% 0.041 Associated Protector Mutation, n (%) c.3211insGT 7 (5.5%) Present polymorphisms p.His423Arg 100% 0.021 Associated Risk p.Asn1868Ile 100% 0.000 Associated Risk IVS10ϩ5delG 0% 0.047 Associated Protector Mutation, n (%) p.Leu2060Arg 7 (5.5%) Present polymorphisms p.Leu1938Leu 100% 0.000 Associated Risk p.Pro1948Leu 100% 0.000 Associated Risk p.His423Arg 14.3% 0.019 Associated Protector TABLE 4. Login to comment
114 This is the case of the p.His423Arg polymorphism and the p.Gly1961Glu and p.Leu2060Arg mutations (P ϭ 0.023; Table 3); in other cases, however, the same polymorphism was found in association with the pArg1129Leu and c.3211insGT mutations. Login to comment
115 Similarly, the p.Asn1868Ile polymorphism is negatively associated with both p.Gly1961Glu and pArg1129Leu mutations and in positive association with the c.3211insGT mutation (Table 3). Login to comment
116 As expected, no mutations were present in control samples, with the exception of p.Gly1961Glu (1.19%). Login to comment
117 It also was found in other control populations, although less frequently.15,17 The p.Gly1961Glu variant is the second most frequent mutation in our group of patients, although it has been described as the most frequent variant in European populations.14,15 We observe that the p.Gly1961Glu and IVS48ϩ21CϾT variants are in linkage disequilibrium, and the high frequency of the p.Gly1961Glu mutation in Europe may be the result of a founder effect. Login to comment
118 The p.Gly1961Glu variant was found in 18 (out of 128) STGD patients and was considered a moderate allele.9 However, there is no linkage disequilibrium, since five out of 18 STGD patients did not carry the IVS48ϩ21CϾT polymorphism. Login to comment
119 One control individual was seen to carry the p.Gly1961Glu mutation but not the IVS48ϩ21CϾT polymorphism. Login to comment
120 In a Danish population, both ABCA4 gene variants were found, though no possible association was analyzed.18 However, in a German population, 18 individuals were found to have the IVS48ϩ21CϾT polymorphism, of whom 17 had the p.Gly1961Glu mutation.15 As a contrast, p.Asn1868Ile and p.His423Arg are negatively associated with the p.Gly1961Glu mutation. Login to comment
122 We found this polymorphism, IVS10ϩ5delG, to be associated with the p.Gly1961Glu mutation (P ϭ 0.005). Login to comment
129 The p.Arg943Gln polymorphism is in linkage disequilibrium with the p.Arg602Trp mutation in Spanish STGD (P Ͻ 0.001, Table 3). Login to comment
136 We found an association between p.Arg602Trp and p.Arg943Gln that has not been observed in other populations. Login to comment
137 On the other hand, we found the p.Arg1129Leu mutation in 26.6% (34 out of 128) of patients, and these results are in accordance with those of previous studies describing this mutation as the most frequent among Spanish people.23 These findings are in contrast with those obtained from other populations in which the frequency is low. Login to comment
139 Except for the IVS10ϩ5delG, p.Asn1868Ile and IVS48ϩ21CϾT polymorphisms, the remaining polymorphic variants showed no significant differences between patients and control individuals. Login to comment
69 Interestingly, only the p.Gly1961Glu substitution was identified in both patient and control groups. Login to comment
73 Mutations and Polymorphisms in the Patient Cohort ABCA4 mutation screening demonstrated that the most frequent (b0e;5%) disease-associated alleles were the following: p.Arg1129Leu, p.Gly1961Glu, p.Arg602Trp, c.3211insGT, and p.Leu2060Arg (Table 1; Fig. 1). Login to comment
81 Similarly, IVS48af9;21Cb0e;T was found to exist in association with p.Gly1961Glu in 72.2% of 18 individuals (P b0d; 0.001) and was not found in the remaining patients (Table 3). Login to comment
84 Most Frequent ABCA4 Disease-Associated Alleles Identified in the Patient Cohort Exon Nucleotide Change Aminoacid Change Patients n (%) Allele Frequency n (%) Controls n (%) Allele Frequency n (%) P 23 c.3386Gb0e;T p.Arg1129Leu 34 (26.6) 38 (14.8) 0 (0.0) 0 (0.0) 0.000 42 c.5882Gb0e;A p.Gly1961Glu 18 (14.1) 18 (7.0) 1 (1.2) 1 (0.6) 0.001 13 c.1804Cb0e;T p.Arg602Trp 8 (6.3) 9 (3.5) 0 (0.0) 0 (0.0) 0.020 22 c.3211insGT Frameshift 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 45 c.6179Tb0e;G p.Leu2060Arg 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 Note that only the p.Gly1961Glu substitution was identified in both patients and control groups. Login to comment
134 This is the case of the p.His423Arg polymorphism and the p.Gly1961Glu and p.Leu2060Arg mutations (P afd; 0.023; Table 3); in other cases, however, the same polymorphism was found in association with the pArg1129Leu and c.3211insGT mutations. Login to comment
135 Similarly, the p.Asn1868Ile polymorphism is negatively associated with both p.Gly1961Glu and pArg1129Leu mutations and in positive association with the c.3211insGT mutation (Table 3). Login to comment
138 The p.Gly1961Glu variant was found in 18 (out of 128) STGD patients and was considered a moderate allele.9 However, there is no linkage disequilibrium, since five out of 18 STGD patients did not carry the IVS48af9;21Cb0e;T polymorphism. Login to comment
140 In a Danish population, both ABCA4 gene variants were found, though no possible association was analyzed.18 However, in a German population, 18 individuals were found to have the IVS48af9;21Cb0e;T polymorphism, of whom 17 had the p.Gly1961Glu mutation.15 As a contrast, p.Asn1868Ile and p.His423Arg are negatively associated with the p.Gly1961Glu mutation. Login to comment
142 We found this polymorphism, IVS10af9;5delG, to be associated with the p.Gly1961Glu mutation (P afd; 0.005). Login to comment

[hide] Cone photoreceptor abnormalities correlate with vi... Invest Ophthalmol Vis Sci. 2011 May 17;52(6):3281-92. doi: 10.1167/iovs.10-6538. Print 2011 May. Chen Y, Ratnam K, Sundquist SM, Lujan B, Ayyagari R, Gudiseva VH, Roorda A, Duncan JL
Cone photoreceptor abnormalities correlate with vision loss in patients with Stargardt disease.
Invest Ophthalmol Vis Sci. 2011 May 17;52(6):3281-92. doi: 10.1167/iovs.10-6538. Print 2011 May., [PMID:21296825]

Abstract [show]
PURPOSE. To study the relationship between macular cone structure, fundus autofluorescence (AF), and visual function in patients with Stargardt disease (STGD). METHODS. High-resolution images of the macula were obtained with adaptive optics scanning laser ophthalmoscopy (AOSLO) and spectral domain optical coherence tomography in 12 patients with STGD and 27 age-matched healthy subjects. Measures of retinal structure and AF were correlated with visual function, including best-corrected visual acuity, color vision, kinetic and static perimetry, fundus-guided microperimetry, and full-field electroretinography. Mutation analysis of the ABCA4 gene was completed in all patients. RESULTS. Patients were 15 to 55 years old, and visual acuity ranged from 20/25-20/320. Central scotomas were present in all patients, although the fovea was spared in three patients. The earliest cone spacing abnormalities were observed in regions of homogeneous AF, normal visual function, and normal outer retinal structure. Outer retinal structure and AF were most normal near the optic disc. Longitudinal studies showed progressive increases in AF followed by reduced AF associated with losses of visual sensitivity, outer retinal layers, and cones. At least one disease-causing mutation in the ABCA4 gene was identified in 11 of 12 patients studied; 1 of 12 patients showed no disease-causing ABCA4 mutations. CONCLUSIONS. AOSLO imaging demonstrated abnormal cone spacing in regions of abnormal fundus AF and reduced visual function. These findings provide support for a model of disease progression in which lipofuscin accumulation results in homogeneously increased AF with cone spacing abnormalities, followed by heterogeneously increased AF with cone loss, then reduced AF with cone and RPE cell death.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 TABLE1.ClinicalCharacteristicsofthePatientswithStargardtDisease Patient/EyeAge(y)/SexABCA4MutationsBCVA ETDRS ScoreColorVision* GoldmannVisual Field† HumphreyVisualField 10-2 Foveal Threshold (dB)Fixation F1P1OS16/MPro1486Leu/6bp insϩ32bpdel atbase672 20/4075None,0,1.34V4e:full;14e:1°ctl scotoma 8°ctlscotomawithϽ1 logunitsensitivityloss 30Foveal F1P2OS15/MPro1486Leu/6bp insϩ32bpdel atbase672 20/16040NS,2,1.99V4e:full;14e:1°ctl scotoma Densescotomabeginning 4°superiortofixation 27Superior F2P1OS25/FGlu1412Stop20/6361None,0,1.00V4e,14e:full,12e: 5°ctlscotoma 6°ctlscotoma31Foveal F3P1OD24/MGly863Ala20/10050NS,6,2.72V4e:full;14e:3-4° ctlscotoma 3°-4°scotomasuperior tofixation 32Superior F4P1OS16/FNodisease-causing mutations identified 20/20035NS,5,2.25V4e:full;14e:35° ctlscotoma 15°ctlscotomawith eccentricfixation superonasally 8Nasal,slightlybelow horizontal meridian F5P1OS42/M5461-10TϾCintron 39/Gly1961Glu 20/32023NS,5,2.27V4e:full;14e:10° ctlscotoma 12°densectlscotoma27Superonasal F6P1OS19/FLys223Gln/C2291 15bp/5amino aciddeletion (CSGVI) 20/20035NS,6,1.99V4e:full;14e:35° ctlscotoma 10°ctlscotoma20Superonasal F7P1OS55/FArg212Cys/ Gly863Ala/ Thr959Ile 20/16040NS,3,2.01V4e:10°ctl scotoma;14e:20° ctlscotoma Dense15°ctlscotoma6Superonasal F8P1OS36/MSer336Cys/ Arg1068/Ser‡ 20/20034NS,8,3.62V4e:20°ctl scotoma;14e:25° ctlscotoma Densescotomabeginning 6°superiortofixation 12Superior F9P1OS28/MArg1108His/ Val1433lle 20/32025NS,11,3.30V4e:full;14e:15° scotomafrom5- 25°superiorto fixation Densescotomabeginning 5°superiortofixation 23Superior F10P1OS55/FIVS20ϩ5GϾA splice/Gly1961Glu 20/32025NS,6,2.55V4e:30°ctl scotoma;14e:35° ctlscotoma Densescotomaextending fromfixationto10° inferonasally 19Inferonasal F11P1OS50/MArg2030Gln20/2580Tritan,7,2.61V4e:full;14e:25°; ctlscotomafrom 10-25°with fovealsparing Densescotomaextending fromfixationto10° withfovealsparing 27Foveal ctl,central;F,family;F,female;M,male;NS,nonspecificorientation;OD,righteye;OS,lefteye;P,proband. Login to comment

[hide] Loss of peripapillary sparing in non-group I Starg... Exp Eye Res. 2010 Nov;91(5):592-600. Epub 2010 Aug 7. Burke TR, Allikmets R, Smith RT, Gouras P, Tsang SH
Loss of peripapillary sparing in non-group I Stargardt disease.
Exp Eye Res. 2010 Nov;91(5):592-600. Epub 2010 Aug 7., [PMID:20696155]

Abstract [show]
The aim of this study was to assess peripapillary sparing in patients with non-group I Stargardt disease. We suggest this as a useful clinical sign for formulating disease severity. Patients with a diagnosis of Stargardt disease were grouped by electroretinogram (ERG). Fundus autofluorescence was used to assess the peripapillary area for involvement in the Stargardt disease process. From a cohort of 32 patients (64 eyes), 17 patients (33 eyes) demonstrated loss of peripapillary sparing. One of 15 patients in Group I, six of 7 patients in group II and 9 of 10 patients in group III demonstrated peripapillary atrophy. One patient in group II had peripapillary flecks. All patients had at least one mutation detected in the ABCA4 gene. Both mutations were detected in 21 patients. Patients in groups II and III had the earliest ages of onset and the poorest visual acuities. Two novel disease causing mutation in the ABCA4 gene were detected. Our data supports the observation that peripapillary sparing is not universal finding for Stargardt disease and peripapillary atrophy is a useful clinical sign for identifying patients with Stargardt disease who fall into the more severe ERG groups, i.e. groups II and III. The presence of atrophy suggests a continuum of disease between groups II and III. Loss of peripapillary sparing is likely associated with the more deleterious mutations of the ABCA4 gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 In patient 2 the common missense mutation G1961E co-occurs with the splice site mutation IVS 43þ1 G>T which has not been reported before. Login to comment
184 Also, the type of involvement of the peripapillary area Table 1 Summary of clinical and genetic information for patients with ERG Group I Stargardt Disease. Case Mutation Mutation OA Duration Age at AF Visual Acuity Flecks Atrophy GA (mm2 ) PPA # Sex Allele 1 Allele 2 PPA (years) (years) (years) OD OS OD OS OD OS OD OS Pattern RON 1 Male G1961E G1961E e 19 13 32 20/70 20/70 M M M M 1.6 0.2 None 2 Female G1961E *IVS43 þ 1 G > T e 8 21 27 20/200 20/200 M M M M na na None 3.1 Male L541P/A1038V G1961E e 28 3 31 20/50 20/30 M M M M na na None 3.2 Male L541P/A1038V G1961E e 28 5 33 20/60 20/50 M M M M na na None 4.1 Female L541P/A1038V G1961E e 14 3 17 20/30 20/25 None None None None na na None 4.2 Female L541P/A1038V G1961E e 14 10 24 20/150 20/200 M M M M na na None 5 Female G1961E R2077W e 25 5 30 20/60 20/50 None None M M na na None 6.1 Female G1961E L541P/A1038V e 18 3 21 20/150 20/150 None None M M na na None 6.2 Female G1961E L541P/A1038V e 15 3 18 20/150 20/150 None None M M na na None 7 Female R602Q R602Q e 31 5 36 20/20 20/60 M,EM M,EM M M 0.7 0.3 None 8 Male L541P/A1038V ND e 22 24 46 20/200 20/200 M M M M 13.2 4.1 None 9 Femlae A1038V ND e 27 10 37 20/100 20/60 M,EM M,EM M M na na None 10 Female G1961E ND e 27 6 33 20/150 20/150 M M M M na na None 11 Female G1961E ND e 43 24 67 20/40 20/200 M M M M 4.8 na None 12 Male R212C ND OU 5 23 28 20/200 20/200 M,EM M,EM M M 1.6 4.2 Patchy N,T Abbreviations: ERG, electroretinogram; PPA, peripapillary atrophy; OD, right eye; OS, left eye; OU, both eyes; OA, onset age; AF, autofluoresence; M, macula; EM, extramacular retina; GA, geographic atrophy; na, not available; RON, relation to optic nerve; N, nasal; T, temporal; ND, mutation was not detected by the ABCR array e suggesting the presence of a currently unknown mutant allele; and *newly described mutation. Login to comment
119 In patient 2 the common missense mutation G1961E co-occurs with the splice site mutation IVS 43&#fe;1 G>T which has not been reported before. Login to comment
183 Also, the type of involvement of the peripapillary area Table 1 Summary of clinical and genetic information for patients with ERG Group I Stargardt Disease. Case Mutation Mutation OA Duration Age at AF Visual Acuity Flecks Atrophy GA (mm2 ) PPA # Sex Allele 1 Allele 2 PPA (years) (years) (years) OD OS OD OS OD OS OD OS Pattern RON 1 Male G1961E G1961E e 19 13 32 20/70 20/70 M M M M 1.6 0.2 None 2 Female G1961E *IVS43 &#fe; 1 G > T e 8 21 27 20/200 20/200 M M M M na na None 3.1 Male L541P/A1038V G1961E e 28 3 31 20/50 20/30 M M M M na na None 3.2 Male L541P/A1038V G1961E e 28 5 33 20/60 20/50 M M M M na na None 4.1 Female L541P/A1038V G1961E e 14 3 17 20/30 20/25 None None None None na na None 4.2 Female L541P/A1038V G1961E e 14 10 24 20/150 20/200 M M M M na na None 5 Female G1961E R2077W e 25 5 30 20/60 20/50 None None M M na na None 6.1 Female G1961E L541P/A1038V e 18 3 21 20/150 20/150 None None M M na na None 6.2 Female G1961E L541P/A1038V e 15 3 18 20/150 20/150 None None M M na na None 7 Female R602Q R602Q e 31 5 36 20/20 20/60 M,EM M,EM M M 0.7 0.3 None 8 Male L541P/A1038V ND e 22 24 46 20/200 20/200 M M M M 13.2 4.1 None 9 Femlae A1038V ND e 27 10 37 20/100 20/60 M,EM M,EM M M na na None 10 Female G1961E ND e 27 6 33 20/150 20/150 M M M M na na None 11 Female G1961E ND e 43 24 67 20/40 20/200 M M M M 4.8 na None 12 Male R212C ND OU 5 23 28 20/200 20/200 M,EM M,EM M M 1.6 4.2 Patchy N,T Abbreviations: ERG, electroretinogram; PPA, peripapillary atrophy; OD, right eye; OS, left eye; OU, both eyes; OA, onset age; AF, autofluoresence; M, macula; EM, extramacular retina; GA, geographic atrophy; na, not available; RON, relation to optic nerve; N, nasal; T, temporal; ND, mutation was not detected by the ABCR array e suggesting the presence of a currently unknown mutant allele; and *newly described mutation. Login to comment

[hide] Deducing the pathogenic contribution of recessive ... Hum Mol Genet. 2010 Oct 1;19(19):3693-701. Epub 2010 Jul 20. Schindler EI, Nylen EL, Ko AC, Affatigato LM, Heggen AC, Wang K, Sheffield VC, Stone EM
Deducing the pathogenic contribution of recessive ABCA4 alleles in an outbred population.
Hum Mol Genet. 2010 Oct 1;19(19):3693-701. Epub 2010 Jul 20., [PMID:20647261]

Abstract [show]
Accurate prediction of the pathogenic effects of specific genotypes is important for the design and execution of clinical trials as well as for meaningful counseling of individual patients. However, for many autosomal recessive diseases, it can be difficult to deduce the relative pathogenic contribution of individual alleles because relatively few affected individuals share the same two disease-causing variations. In this study, we used multiple regression analysis to estimate the pathogenicity of specific alleles of ABCA4 in patients with retinal phenotypes ranging from Stargardt disease to retinitis pigmentosa. This analysis revealed quantitative allelic effects on two aspects of the visual phenotype, visual acuity (P < 10(-3)) and visual field (P < 10(-7)). Discordance between visual acuity and visual field in individual patients suggests the existence of at least two non-ABCA4 modifying factors. The findings of this study will facilitate the discovery of factors that modify ABCA4 disease and will also aid in the optimal selection of subjects for clinical trials of new therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment
157 In addition, Stargardt patients who had one of the three most common alleles (Gly863Ala, Gly1961Glu or IVS38-10) were also sequenced through the entire coding region of the ABCA4 gene. Login to comment
57 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment
161 In addition, Stargardt patients who had one of the three most common alleles (Gly863Ala, Gly1961Glu or IVS38-10) were also sequenced through the entire coding region of the ABCA4 gene. Login to comment

[hide] Analysis of autofluorescent retinal images and mea... Exp Eye Res. 2010 Aug;91(2):143-52. Epub 2010 Apr 14. Chen B, Tosha C, Gorin MB, Nusinowitz S
Analysis of autofluorescent retinal images and measurement of atrophic lesion growth in Stargardt disease.
Exp Eye Res. 2010 Aug;91(2):143-52. Epub 2010 Apr 14., [PMID:20398653]

Abstract [show]
Current retinal imaging techniques using scanning laser ophthalmoscopy (SLO) provide a powerful mechanism for characterizing the topographical distribution of lipofuscin fluorophores and atrophic lesions (ALs) in retinal disease. In this paper we describe a novel Edge-Flow-Driven Variational Image Segmentation analysis to measure and evaluate progressive change in the area of ALs as well as regions of hyperfluorescence (HF). The algorithm is embedded in a series of almost completely automated image processing steps that allow rapid comparison of serial images. The sensitivity of the methodology to detect change was evaluated by measuring progression of AF lesion size in a cohort of Stargardt Macular Dystrophy (STGD) patients. Fifty-two STGD subjects (mean age = 41.0 +/- 16.6 years, range 9-78 yrs) at varying stages of disease participated in this prospective study. Twenty-four of the 52 subjects presented with atrophic lesions in one or both eyes on first evaluation. For this subgroup of subjects, the mean (+/-1 sd) follow-up time was 2.92 (+0.26) years (range 0.57-3.26 years) and the mean (+/-1 sd) rate of change was found to be approximately 0.94 (+/-0.87) mm(2)/year (range 0.2-2.13 mm(2)/yr). With this methodology, progressive enlargement of AL area was detectable in as little as one year, while regions of HF generally decreased, although there was considerable variability in the appearnce of HF, presumably reflecting the combined effects of the creation or expansion of lipofuscin deposits and resorption and loss associated with retinal cell death. Our findings suggest that this methodology is sufficiently sensitive to detect change and provides a clinically relevant tool to monitor progression not only with regards to natural history, but also to evaluate the efficacy of potential therapeutic interventions in STGD. Finally, we evaluated the association between AL area and measures of rod- and cone-mediated retinal function, as assessed with electroretinography (ERG). In general, the larger the AL, the poorer the ERG response, with a greater impact of lesion size on cone- rather than rod-mediated retinal function, a finding that was expected on the basis of the location and size of the AL and the distribution of rod- and cone-photoreceptors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,þ1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, þ5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 þ 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND ¼ not done. Login to comment
81 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,&#fe;1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, &#fe;5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 &#fe; 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND &#bc; not done. Login to comment

[hide] Preimplantation genetic diagnosis for stargardt di... Am J Ophthalmol. 2010 Apr;149(4):651-655.e2. Epub 2010 Feb 10. Sohrab MA, Allikmets R, Guarnaccia MM, Smith RT
Preimplantation genetic diagnosis for stargardt disease.
Am J Ophthalmol. 2010 Apr;149(4):651-655.e2. Epub 2010 Feb 10., [PMID:20149343]

Abstract [show]
PURPOSE: To report the first use of in vitro fertilization (IVF) and preimplantation genetic diagnosis to achieve an unaffected pregnancy in an autosomal-recessive retinal dystrophy. DESIGN: Case report. METHODS: An affected male with Stargardt disease and his carrier wife underwent IVF. Embryos obtained by intracytoplasmic sperm injection underwent single-cell DNA testing via polymerase chain reaction and restriction enzyme analysis to detect the presence of ABCA4 mutant alleles. Embryos were diagnosed as being either affected by or carriers for Stargardt disease. A single carrier embryo was implanted. RESULTS: Chorionic villus sampling performed during the first trimester verified that the fetus possessed only 1 mutant paternal allele and 1 normal maternal allele, thus making her an unaffected carrier of the disease. A healthy, live-born female was delivered. CONCLUSION: IVF and preimplantation genetic diagnosis can assist couples with an affected spouse and a carrier spouse with recessive retinal dystrophies to have an unaffected child.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 The c5018ϩ2CϾT variant is a relatively rare splice site mutation that has been associated with Stargardt disease in at least 2 studies.12,13 The c5882GϾA substitution, resulting in the G1961E amino acid change, is an extensively characterized and one of the most frequent STGD mutations. Login to comment
43 The same testing on the affected husband found 2 Stargardt disease-associated mutations, the splice site-affecting c5018ϩ2CϾT mutation and the c5882GϾA (G1961E) mutation, thereby confirming the clinical diagnosis of STGD. Login to comment
27 The c5018af9;2Cb0e;T variant is a relatively rare splice site mutation that has been associated with Stargardt disease in at least 2 studies.12,13 The c5882Gb0e;A substitution, resulting in the G1961E amino acid change, is an extensively characterized and one of the most frequent STGD mutations. Login to comment
44 The same testing on the affected husband found 2 Stargardt disease-associated mutations, the splice site-affecting c5018af9;2Cb0e;T mutation and the c5882Gb0e;A (G1961E) mutation, thereby confirming the clinical diagnosis of STGD. Login to comment

[hide] Novel mutations in of the ABCR gene in Italian pat... Eye (Lond). 2010 Jan;24(1):158-64. Epub 2009 Mar 6. Passerini I, Sodi A, Giambene B, Mariottini A, Menchini U, Torricelli F
Novel mutations in of the ABCR gene in Italian patients with Stargardt disease.
Eye (Lond). 2010 Jan;24(1):158-64. Epub 2009 Mar 6., [PMID:19265867]

Abstract [show]
PURPOSE: Stargardt disease (STGD) is the most prevalent juvenile macular dystrophy, and it has been associated with mutations in the ABCR gene, encoding a photoreceptor-specific transport protein. In this study, we determined the mutation spectrum in the ABCR gene in a group of Italian STGD patients. METHODS: The DNA samples of 71 Italian patients (from 62 independent pedigrees), affected with autosomal recessive STGD, were analysed for mutations in all 50 exons of the ABCR gene by the DHPLC approach (with optimization of the DHPLC conditions for mutation analysis) and direct sequencing techniques. RESULTS: In our group of STGD patients, 71 mutations were identified in 68 patients with a detection rate of 95.7%. Forty-three mutations had been already reported in the literature, whereas 28 mutations had not been previously described and were not detected in 150 unaffected control individuals of Italian origin. Missense mutations represented the most frequent finding (59.2%); G1961E was the most common mutation and it was associated with phenotypes in various degrees of severity. CONCLUSIONS: Some novel mutations in the ABCR gene were reported in a group of Italian STGD patients confirming the extensive allelic heterogeneity of this gene-probably related to the vast number of exons that favours rearrangements in the DNA sequence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Missense mutations represented the most frequent finding (59.2%); G1961E was the most common mutation and it was associated with phenotypes in various degrees of severity. Login to comment
57 Table 2 Summary of the mutations identified in the ABCR gene in our series of STGD Italian patients Patient Allele 1 mutation Allele 2 mutation S 1 R212C T1019M S 8 V1433I V1433I S 21 A1598D A1598D S 33 N96K G978D S 56 A1598D G1961E S 70 R212C T1019M S 71 W700X WT S 74 6750delA V767D S 77 G1961E WT S 82 Q21X G1961E S 106 C1177X G1961E S 107 C1177X G1961E S 114 T970P-F1015E - S 115 T970P-F1015E - S 120 N415K G1961E S 162 324-327insT 324-327insT S 181 W1408X G1961E S 190 C1177X A1598D S 201 G1961E WT S 202 Q21X T970P-F1015E S 213 M840R G1961E S 231 WT WT S 236 C1177X G1961E S 237 WT WT S 241 V256 splice WT S 246 IVS6-1g4t R1108C S 260 L2221P 5109delG-I156V S 321 IVS9 þ 1G4C S1099X S 328 IVS42 þ 4delG IVS35 þ 2t4c S 346 E2096K WT S 347 IVS28 þ 5g4a WT S 353 P1484S-G1961E P68L S 354 P1484S-G1961E P68L S 355 P1484S-G1961E P68L S 360 G1961E 5961delGGAC S 364 IVS35 þ 2t4c G1961E S 365 L541P/A1038V G1961E S 377 IVS42 þ 4delG IVS35 þ 2t4c S 380 R653C WT S 413 R212C T1019M S 414 A1598D G1961E S 417 G1078E G1961E S 438 R1055W WT S 440 4021ins24bp T1526M-G1961E S 449 W1479X L2140Q S 450 W1479X L2140Q S 474 W1461X G 1977S S 486 WT WT S 492 R1098C/L1970F 6548insTGAA S 528 T977P IVS40 þ 5g4a S 531 G690V Q1332X S 532 R572X L1473M-4733delGTTT S 535 IVS40 þ 5g4a 5917delG S 550 IVS40 þ 5g4a 6750delA S 555 250insCAAA WT S 556 250insCAAA WT S 575 N96H G1961E S 590 W821R IVS40 þ 5g4a S 592 V931M R1108C S 593 V767D R2030X Table 2 (Continued ) Patient Allele 1 mutation Allele 2 mutation S 594 G172S G1961E S 602 P1380L G1961E S 607 E616K L1580S-K2172R S 640 250insCAAA S1696N S 694 IVS35 þ 2t4c G1961E S 725 IVS13 þ 1g4a Q1376 splice S 731 L541P-A1038V G1961E S 755 N965S IVS40 þ 5g4a S 789 E1087K G1977S S 968 T1019M G1961E S 992 R212C G1961E Bold values indicate novel mutations. Login to comment
62 G1961E was the most common mutated allele among our STGD patients of Italian origin. Login to comment
83 In our series, mainly consisting of patients coming from central Italy, G1961E was the most common mutant allele, in congruence with other studies performed in distinct dissimilar European populations.9,20 Nevertheless, the frequency of G1961E mutation (20.4% of our STGD alleles) was higher than in the other Italian Table 3 Summary of the polymorphic variants identified in the ABCR gene in our series of STGD Italian patients Location Polymorphic variants Number of alleles Exon 3 IVS3 þ 26a4g 14 Exon 5 D159 1 Exon 6 R212H 6 Exon 7 IVS7-32t4c 9 Exon 10 H423R 12 Exon 13 D644 1 Exon 14 IVS14 þ 50t4c 1 Exon 15 IVS15-13t4c 2 Exon 16 IVS16-13c4t 1 Exon 19 R943Q 3 Exon 20 L1988 1 Exon 23 Q1169 4 Exon 23 IVS23 þ 25g4a 2 Exon 24 T1176 6 Exon 24 K1182 3 Exon 28 P1401 1 Exon 33 IVS33-39t4c 2 Exon 34 IVS34 þ 16insgtt 4 Exon 38 D1817Q 7 Exon 40 N1868I 3 Exon 40 L1894 16 Exon 41 L1938 15 Exon 42 P1948 23 Exon 44 I2023 5 Exon 44 IVS44-16g4a 5 Exon 44 IVS44 þ 77g4a 1 Exon 45 I2083 5 Exon 46 D2095 19 Exon 48 IVS48 þ 21c4t 3 Exon 49 S2255I 5 studies where this mutation was detected in 11.110 and 9.7% 11 of the screened alleles. Login to comment
84 In earlier reports, G1961E was considered a mutation with a low pathogenetic influence,10,13 but in our series, it may be associated with STGD phenotypes of a varying severity. Login to comment

[hide] ABC transporters in ophthalmic disease. Methods Mol Biol. 2010;637:221-30. Westerfeld C
ABC transporters in ophthalmic disease.
Methods Mol Biol. 2010;637:221-30., [PMID:20419437]

Abstract [show]
ABC transporters have been implicated in a variety of human diseases. The ABCR gene and its protein have been linked to Stargardt's disease, fundus flavimaculatus, cone-rod dystrophy, retinitis pigmentosa, and age-related macular degeneration. The genetic and molecular pathways involved in the pathogenesis of ABCR-related ophthalmic conditions will be explored. Future diagnostic and therapeutic objectives for these diseases will also be discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Certain mutant alleles such as G863A, A1038V, and G1961E cause Stargardt`s disease and appear to be more common and may have altered frequencies in different populations, presumably because of founder effect (23, 24). Login to comment
95 A 15-center meta-analysis of the published data on the two most common ABCA4 variants, the D2177N and G1961E alleles, found the two variants to be present in 3.4% of patients with AMD in comparison to 0.95% of controls (39). Login to comment

[hide] Outcome of ABCA4 microarray screening in routine c... Mol Vis. 2009 Dec 20;15:2841-7. Ernest PJ, Boon CJ, Klevering BJ, Hoefsloot LH, Hoyng CB
Outcome of ABCA4 microarray screening in routine clinical practice.
Mol Vis. 2009 Dec 20;15:2841-7., [PMID:20029649]

Abstract [show]
PURPOSE: To retrospectively analyze the clinical characteristics of patients who were screened for mutations with the ATP-binding cassette transporter gene ABCA4 (ABCA4) microarray in a routine clinical DNA diagnostics setting. METHODS: We performed a retrospective analysis of the medical charts of 65 patients who underwent an ABCA4 microarray screening between the years 2002 and 2006. An additional denaturing gradient gel electrophoresis (DGGE) was performed in these patients if less than two mutations were found with the microarray. We included all patients who were suspected of autosomal recessive Stargardt disease (STGD1), autosomal recessive cone-rod dystrophy (arCRD), or autosomal recessive retinitis pigmentosa at the time of microarray request. After a retrospective analysis of the clinical characteristics, the patients who were suspected of STGD1 were categorized as having either a typical or atypical form of STGD1, according to the age at onset, fundus appearance, fluorescein angiography, and electroretinography. The occurrence of typical clinical features for STGD1 was compared between patients with different numbers of discovered mutations. RESULTS: Of the 44 patients who were suspected of STGD1, 26 patients (59%) had sufficient data available for a classification in either typical (six patients; 23%) or atypical (20 patients; 77%) STGD1. In the suspected STGD1 group, 59% of all expected pathogenic alleles were found with the ABCA4 microarray. DGGE led to the finding of 12 more mutations, resulting in an overall detection rate of 73%. Thirty-one percent of patients with two or three discovered ABCA4 mutations met all typical STGD1 criteria. An age at onset younger than 25 years and a dark choroid on fluorescein angiography were the most predictive clinical features to find ABCA4 mutations in patients suspected of STGD1. In 18 patients suspected of arCRD, microarray screening detected 22% of the possible pathogenic alleles. CONCLUSIONS: In addition to confirmation of the diagnosis in typical STGD1, ABCA4 microarray screening is usually requested in daily clinical practice to strengthen the diagnosis when the disease is atypical. This study supports the view that the efficiency and accuracy of ABCA4 microarray screening are directly dependent upon the clinical features of the patients who are screened.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
143 DISCOVERED MUTATIONS IN THE ABCA4 GENE IN THE PATIENTS INCLUDED IN THIS STUDY Nucleotide change Effect Alleles References Mutations already included in the ABCA4 microarray c.286A>G p.Asn96Asp 2 [25] c.656G>C p.Arg219Thr 1 [10] c.740A>T p.Asn247Ile 1 This study* c.768G>T splice site 7 [13] c.899C>A p.Thr300Asn 1 [14] c.1805G>A p.Arg602Gln 1 [9] c.1822T>A p.Phe608Ile 2 [13] c.1853G>A p.Gly618Glu 1 [19] c.1938-1G>A splice site 1 [26] c.2588G>C p.DelGly863/Gly863Ala 8 [13] c.2919del exons20-22 deletion/frameshift 2 [13] c.3335C>A p.Thr1112Asn 1 [13] c.3874C>T p.Gln1292X 1 This study* c.3899G>A p.Arg1300Gln 1 [27] c.4297G>A p.Val1433Ile 1 [17] c.4462T>C p.Cys1488Arg 1 [17] c.4506C>A p.Cys1502X 1 This study* c.4539+1G>T splice site 1 [28] c.4774+1G>A splice site 1 [1] c.5161-5162delAC p.Thr1721fs 1 [27] c.5337C>A p.Tyr1779X 1 This study* c.5461-10T>C unknown 9 [9] c.5537T>C p.Ile1846Thr 1 [13] c.5693G>A p.Arg1898His 1 [1] c.5715+5G>A splice site 2 [28] c.5882G>A p.Gly1961Glu 10 [1] c.6088C>T p.Arg2030X 1 [14] c.6089G>A p.Arg2030Gln 1 [9] c.6238-6239delTC p.Ser2080fs 1 [29] c.6529G>A p.Asp2177Asn 1 [1] New mutations found with DGGE analysis c.303+4A>C splice site 1 c.872C>T p.Pro291Leu 1 c.2906A>G p.Lys969Arg 1 c.2947A>G p.Thr983Ala 1 c.3233G>A p.Gly1078Glu 1 c.3305A>T p.Asp1102Val 1 c.4353+1G>A splice site 1 c.5113C>T p.Arg1705Trp 1 c.5762_5763dup p.Ala1922fs 1 c.6411T>A p.Cys2137X 1 Total 74 Mutations are designated by their nucleotide change, followed by their effect on the protein and the number of alleles that were found with the mutation. Login to comment

[hide] The natural history of stargardt disease with spec... Invest Ophthalmol Vis Sci. 2009 Dec;50(12):5867-71. Epub 2009 Jul 2. Genead MA, Fishman GA, Stone EM, Allikmets R
The natural history of stargardt disease with specific sequence mutation in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2009 Dec;50(12):5867-71. Epub 2009 Jul 2., [PMID:19578016]

Abstract [show]
PURPOSE: To determine longitudinal changes in fundus appearance and visual function in patients with Stargardt with at least one allelic mutation (Gly1961Glu) in the ABCA4 gene. METHODS: Sixteen patients with a diagnosis of Stargardt disease and a Gly1961Glu mutation were enrolled. All patients underwent a complete ocular examination including best corrected visual acuity, Goldmann visual field (GVF), and full-field ERG examinations. The percentage of patients who showed at least a doubling in the log of the minimum angle of visual resolution (logMAR) between their initial and most recent visits was determined, as was the percentage of patients who showed a doubling in the size of the central scotoma over this duration. RESULTS: Nine patients had at least a doubling of the logMAR visual acuity in their right eyes and 10 patients in their left eyes, over a mean follow-up (FU) period of 18.6 years. Of 15 patients, 46.7% had equal to or more than a doubling of the central scotoma area in response to a II2e test stimulus in the right eye and 60.0% in the left eyes. Among 10 patients whose ERGs were initially normal for rod and cone responses, 8 remained normal at their most recent FU visit. CONCLUSIONS: In these patients with Stargardt disease and a Gly1961Glu mutation, most showed a clinical phenotype characterized by fundus changes localized to the foveal and parafoveal regions, normal ERG amplitudes, absence of a silent or masked choroid, and a mean age at initial presentation in the third decade.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 To determine longitudinal changes in fundus appearance and visual function in patients with Stargardt with at least one allelic mutation (Gly1961Glu) in the ABCA4 gene. Login to comment
3 Sixteen patients with a diagnosis of Stargardt disease and a Gly1961Glu mutation were enrolled. Login to comment
11 In these patients with Stargardt disease and a Gly1961Glu mutation, most showed a clinical phenotype characterized by fundus changes localized to the foveal and parafoveal regions, normal ERG amplitudes, absence of a silent or masked choroid, and a mean age at initial presentation in the third decade. Login to comment
18 In a previous study by Fishman and et al.,12 an association was observed between a certain ABCA4 genotype, in which the amino acid glutamic acid is substituted for glycine (Gly1961Glu), and a Stargardt disease phenotype. Login to comment
21 In stage IV, there is extensive atrophy of the RPE and choroid.12 Eleven of the patients with Gly1961Glu mutations cited in Fishman et al.12 were also included in the current natural history study. Login to comment
22 The purpose of the present study was to determine longitudinal changes in visual acuity, fundus morphologic features, central scotoma size, and ERG amplitudes in patients with Stargardt with at least one allelic mutation (Gly1961Glu) in the ABCA4 gene. Login to comment
23 MATERIALS AND METHODS Patient Ascertainment One of the authors (GAF) referred 16 patients with a diagnosis of Stargardt macular dystrophy and a specific ABCA4 sequence mutation (Gly1961Glu) on at least one allele for the present study. Login to comment
52 RESULTS Of the 16 patients with Gly1961Glu mutations, 6 (37.5%) had the Gly1961Glu mutation on one allele (heterozygous), whereas 1 (6.2%) was homozygous for the mutation and 9 (56.2%) had a compound heterozygous mutation (Table 1). Login to comment
66 Genetic Mutations in the ABCA4 Gene in the Patients Patient No. Genetic Mutation Allele 1 Genetic Mutation Allele 2 Comments 1 gly1961glu exon 42 Heterozygous 2 gly1961glu exon 42 ala1038val exon 21 and leu541pro exon 12 Compound heterozygous 3 gly1961glu exon 42 Heterozygous 4 gly1961glu exon 42 arg2077trp exon 45 Compound heterozygous 5 gly1961glu exon 42 gly65glu exon 3 Compound heterozygous 6 gly1961glu exon 42 leu1201arg exon 24 Compound heterozygous 7 gly1961glu exon 42 Heterozygous 8 gly1961glu exon 42 Heterozygous 9 gly1961glu exon 42 del Co 1620-1622 exon 35 Compound heterozygous 10 gly1961glu exon 42 Heterozygous 11 gly1961glu exon 42 1bp del(T) Co 36 which creates stop at Co 38 Compound heterozygous 12 gly1961glu exon 42 IVS38-10 TϾC Compound heterozygous 13 gly1961glu exon 42 Heterozygous 14 gly1961glu exon 42 pro1380leu Compound heterozygous 15 gly1961glu exon 42 pro1380leu Compound heterozygous 16 gly1961glu exon 42 gly1961glu exon 42 Homozygous initial visit in the right eye was 0.87 (range, 0.10-1.40), whereas the median logMAR VA at the most recent FU visit was 1.00 (range, 0.18-2.80; P ϭ 0.325). Login to comment
82 Follow-up Period in Stargardt Macular Dystrophy with Gly1961Glu Mutations Follow-up Period (y) Patients, n (%) 6-10 3 (18.8) 11-15 4 (25.0) Ͼ15 9 (56.2) Total 16 (100) a III4e stimulus over a mean of 15.5 years (median, 15.5; range, 6 to 25 years; Table 7). Login to comment
88 DISCUSSION The present study, to our knowledge, is the first to demonstrate the natural history of structural and functional changes observed in the course of disease in patients with Stargardt disease and a Gly1961Glu sequence mutation in the ABCA4 gene. Login to comment
91 In a previous report, Guymer et al.21 described that there was a significant difference in the frequency of the G1y1961Glu allele between visually normal individuals of Somali ancestry (11.3%) and visually normal individuals from a United States population (0.4%).This finding implies a potential for a higher prevalence of individuals who are homozygous for the Gly1961Glu mutation in the Somali population. Login to comment
92 In our group of patients with Stargardt disease and at least one Gly1961Glu mutation, visual acuity was eventually reduced to a level of 20/200 to 20/400. Login to comment
101 This finding is also consistent with observations of Fishman et al.,12 who showed that 90.0% (9/10) of patients with Stargardt with a Gly1961Glu mutation showed normal rod and cone ERG responses. Login to comment
102 In our patients with Stargardt disease and a Gly1961Glu mutation, a high percentage initially presented and then maintained stage I disease; did not manifest a dark choroid; and as a group, maintained normal ERG cone and rod amplitudes. Login to comment
81 Follow-up Period in Stargardt Macular Dystrophy with Gly1961Glu Mutations Follow-up Period (y) Patients, n (%) 6-10 3 (18.8) 11-15 4 (25.0) b0e;15 9 (56.2) Total 16 (100) a III4e stimulus over a mean of 15.5 years (median, 15.5; range, 6 to 25 years; Table 7). Login to comment
87 DISCUSSION The present study, to our knowledge, is the first to demonstrate the natural history of structural and functional changes observed in the course of disease in patients with Stargardt disease and a Gly1961Glu sequence mutation in the ABCA4 gene. Login to comment
90 In a previous report, Guymer et al.21 described that there was a significant difference in the frequency of the G1y1961Glu allele between visually normal individuals of Somali ancestry (11.3%) and visually normal individuals from a United States population (0.4%).This finding implies a potential for a higher prevalence of individuals who are homozygous for the Gly1961Glu mutation in the Somali population. Login to comment
100 This finding is also consistent with observations of Fishman et al.,12 who showed that 90.0% (9/10) of patients with Stargardt with a Gly1961Glu mutation showed normal rod and cone ERG responses. Login to comment

[hide] Frequency of ABCA4 mutations in 278 Spanish contro... Br J Ophthalmol. 2009 Oct;93(10):1359-64. Epub 2008 Oct 31. Riveiro-Alvarez R, Aguirre-Lamban J, Lopez-Martinez MA, Trujillo-Tiebas MJ, Cantalapiedra D, Vallespin E, Avila-Fernandez A, Ramos C, Ayuso C
Frequency of ABCA4 mutations in 278 Spanish controls: an insight into the prevalence of autosomal recessive Stargardt disease.
Br J Ophthalmol. 2009 Oct;93(10):1359-64. Epub 2008 Oct 31., [PMID:18977788]

Abstract [show]
AIM: To determine the carrier frequency of ABCA4 mutations in order to achieve an insight into the prevalence of autosomal recessive Stargardt disease (arSTGD) in the Spanish population. METHODS: arSTGD patients (n = 133) were analysed using ABCR400 microarray and sequencing. Control subjects were analysed by two different strategies: 200 individuals were screened for the p.Arg1129Leu mutation by denaturing-HPLC and sequencing; 78 individuals were tested for variants with the microarray and sequencing. RESULTS: For the first strategy in control subjects, the p.Arg1129Leu variant was found in two heterozygous individuals, which would mean a carrier frequency for any variant of approximately 6.0% and a calculated arSTGD prevalence of 1:1000. For the second strategy, carrier frequency was 6.4% and therefore an estimated prevalence of the disease of 1:870. CONCLUSION: Calculated prevalence of arSTGD based on the ABCA4 carrier frequency could be considerably higher than previous estimation. This discrepancy between observed (genotypic) and estimated (phenotypic) prevalence could be due to the existence of non-pathological or low penetrance alleles, which may result in late-onset arSTGD or may be implicated in age-related macular degeneration. This situation should be regarded with special care when genetic counselling is given and further follow-up of these patients should be recommended.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
96 These Table 1 ABCA4 sequence variants identified in Spanish control population Mutant alleles Nucleotide change Amino acid change Number of cases Number of alleles Frequency (%) Homozygous individuals Mutations* c.661G.A p.Gly221Arg 1 1 0.64 None c.1140T.A p.Asn380Lys 1 1 0.64 None c.2588G.C p.Gly863Ala 1 1 0.64 None c.3113C.T p.Ala1038Val 1 1 0.64 None c.3899G.A p.Arg1300Gln 1 1 0.64 None c.5882G.A p.Gly1961Glu 1 1 0.64 None c.5908C.T p.Leu1970Phe 1 1 0.64 None c.6148G.C p.Val2050Leu 1 1 0.64 None c.6529G.A p.Asp2177Asn 2 2 1.28 None Total 10 Polymorphisms{ c.466A.G p.Ile156Val 5 5 3.2 None c.635G.A p.Arg212His 5 6 3.84 1 c.1268A.G p.His423Arg 43 48 30.7 5 c.1269C.T p.His423His 2 2 1.28 None IVS10+5delG 34 36 23 2 c.2828G.A p.Arg943Gln 1 1 0.64 None c.4203C.A p.Pro1401Pro 3 3 1.9 None IVS33+48C.T 59 75 48 16 c.5603A.T p.Asn1868Ile 4 4 2.5 None c.5682G.C p.Leu1894Leu 29 35 22.4 6 c.5814A.G p.Leu1938Leu 27 33 21.1 6 c.5843 C.T p.Pro1948Leu 9 10 6.4 1 c.5844A.G p.Pro1948Pro 27 32 20.5 5 c.6069C.T p.Ile2023Ile 11 12 7.7 1 c.6249C.T p.Ile2083Ile 12 14 8.9 2 c.6285T.C p.Asp2095Asp 24 26 16.6 2 c.6764G.T p.Ser2255Ile 12 13 8.3 1 *A total of 15 mutant alleles were detected. Login to comment
97 These Table 1 ABCA4 sequence variants identified in Spanish control population Mutant alleles Nucleotide change Amino acid change Number of cases Number of alleles Frequency (%) Homozygous individuals Mutations* c.661G.A p.Gly221Arg 1 1 0.64 None c.1140T.A p.Asn380Lys 1 1 0.64 None c.2588G.C p.Gly863Ala 1 1 0.64 None c.3113C.T p.Ala1038Val 1 1 0.64 None c.3899G.A p.Arg1300Gln 1 1 0.64 None c.5882G.A p.Gly1961Glu 1 1 0.64 None c.5908C.T p.Leu1970Phe 1 1 0.64 None c.6148G.C p.Val2050Leu 1 1 0.64 None c.6529G.A p.Asp2177Asn 2 2 1.28 None Total 10 Polymorphisms{ c.466A.G p.Ile156Val 5 5 3.2 None c.635G.A p.Arg212His 5 6 3.84 1 c.1268A.G p.His423Arg 43 48 30.7 5 c.1269C.T p.His423His 2 2 1.28 None IVS10+5delG 34 36 23 2 c.2828G.A p.Arg943Gln 1 1 0.64 None c.4203C.A p.Pro1401Pro 3 3 1.9 None IVS33+48C.T 59 75 48 16 c.5603A.T p.Asn1868Ile 4 4 2.5 None c.5682G.C p.Leu1894Leu 29 35 22.4 6 c.5814A.G p.Leu1938Leu 27 33 21.1 6 c.5843 C.T p.Pro1948Leu 9 10 6.4 1 c.5844A.G p.Pro1948Pro 27 32 20.5 5 c.6069C.T p.Ile2023Ile 11 12 7.7 1 c.6249C.T p.Ile2083Ile 12 14 8.9 2 c.6285T.C p.Asp2095Asp 24 26 16.6 2 c.6764G.T p.Ser2255Ile 12 13 8.3 1 *A total of 15 mutant alleles were detected. Login to comment

[hide] A comparison of fundus autofluorescence and retina... Invest Ophthalmol Vis Sci. 2009 Aug;50(8):3953-9. Epub 2009 Mar 25. Gomes NL, Greenstein VC, Carlson JN, Tsang SH, Smith RT, Carr RE, Hood DC, Chang S
A comparison of fundus autofluorescence and retinal structure in patients with Stargardt disease.
Invest Ophthalmol Vis Sci. 2009 Aug;50(8):3953-9. Epub 2009 Mar 25., [PMID:19324865]

Abstract [show]
PURPOSE: To improve the understanding of Stargardt disease by comparing structural changes seen on spectral domain optical coherence tomography (SD-OCT) to those visible on fundus autofluorescence (FAF). METHODS: FAF and SD-OCT were performed on 22 eyes of 11 patients with Stargardt disease. SD-OCT images were obtained at the fovea and at the eccentric preferred retinal locus (PRL). The diameters of absent (hypoautofluorescence) and abnormal FAF areas were measured. The extent of the transverse defect of the junction between the inner and outer segments of the photoreceptors (IS-OS) was measured in the foveal area. The PRL was evaluated with fundus photography and microperimetry. RESULTS: Twenty-one of 22 eyes showed defective FAF. In 17 eyes, FAF was absent in the fovea and in four eyes, FAF was abnormal. All eyes showed disorganization and/or loss of the IS-OS junction in the foveal area on SD-OCT. The diameter of the absent FAF area was smaller than the measurement of the IS-OS junction loss; the latter was closer to the diameter of the abnormal FAF area. Seventeen eyes had an eccentric PRL associated with a retinal area with no defects on FAF. CONCLUSIONS: In the majority of eyes, changes shown by SD-OCT correlated well with changes in FAF. However, in three patients, photoreceptor abnormalities were seen in the fovea on SD-OCT without an equivalent abnormality on FAF. This result suggests that in these patients, the structural integrity of the photoreceptors may be affected earlier than changes in the RPE at least as detected by FAF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Summary of Genetic and Selected Clinical Findings Patient Age Sex Allele 1 Allele 2 Visual Acuity (LogMAR) PRL (Degrees) PRL Location OD OS OD OS OD OS 1 12 M K346T ND 0.7 0.7 5.8 5.9 S S 2 42 M ND ND 1.0 1.0 1.9 2.0 S S 3 31 M G1961E G1961E 0.5 0.5 2.8 1.9 S S 4 56 M P1380L S1696N 0.7 0.7 8.4 8.0 S S 5 23 F L541P/A1038V G1961E 1.0 1.0 0.0 0.0 F F 6 62 F D1532N G1961E 1.3 0.4 3.0 0.0 T F 7 65 F G1961E ND 0.3 1.3 4.0 2.0 S S 8 30 F G1961E ND 0.4 0.4 2.9 3.0 S S 9 24 F P1380L P1380L 0.3 0.3 8.6 8.5 S S 10 15 F L541P/A1038V G1961E 0.0 0.0 0.0 0.0 F F 11 20 F L541P/A1038V ND 0.3 0.4 1.8 2.0 S S ND, not determined; S, superior; F, foveal; T, temporal. Login to comment

[hide] The role of the photoreceptor ABC transporter ABCA... Biochim Biophys Acta. 2009 Jul;1791(7):573-83. Epub 2009 Feb 20. Molday RS, Zhong M, Quazi F
The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration.
Biochim Biophys Acta. 2009 Jul;1791(7):573-83. Epub 2009 Feb 20., [PMID:19230850]

Abstract [show]
ABCA4 is a member of the ABCA subfamily of ATP binding cassette (ABC) transporters that is expressed in rod and cone photoreceptors of the vertebrate retina. ABCA4, also known as the Rim protein and ABCR, is a large 2,273 amino acid glycoprotein organized as two tandem halves, each containing a single membrane spanning segment followed sequentially by a large exocytoplasmic domain, a multispanning membrane domain and a nucleotide binding domain. Over 500 mutations in the gene encoding ABCA4 are associated with a spectrum of related autosomal recessive retinal degenerative diseases including Stargardt macular degeneration, cone-rod dystrophy and a subset of retinitis pigmentosa. Biochemical studies on the purified ABCA4 together with analysis of abca4 knockout mice and patients with Stargardt disease have implicated ABCA4 as a retinylidene-phosphatidylethanolamine transporter that facilitates the removal of potentially reactive retinal derivatives from photoreceptors following photoexcitation. Knowledge of the genetic and molecular basis for ABCA4 related retinal degenerative diseases is being used to develop rationale therapeutic treatments for this set of disorders.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
134 Disease mutations, which are substituted in Stargardt disease, are shown in red italics - NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C); NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment
225 A subset of missense mutations reside in NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C, R1129L) and NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment

[hide] G1961E mutant allele in the Stargardt disease gene... Exp Eye Res. 2009 Jun 15;89(1):16-24. Epub 2009 Feb 13. Cella W, Greenstein VC, Zernant-Rajang J, Smith TR, Barile G, Allikmets R, Tsang SH
G1961E mutant allele in the Stargardt disease gene ABCA4 causes bull's eye maculopathy.
Exp Eye Res. 2009 Jun 15;89(1):16-24. Epub 2009 Feb 13., [PMID:19217903]

Abstract [show]
The aim of this study was to characterize the pathological and functional consequences of the G1961E mutant allele in the Stargardt disease gene ABCA4. Data from 15 patients were retrospectively reviewed and all the patients had at least one G1961E mutation. Comprehensive ophthalmic examination, full-field and pattern electroretinograms, and fundus autofluorescence (FAF) imaging were performed on all patients. Microperimetry, spectral-domain optical coherence tomography (OCT), and fluorescein angiography were performed in selected cases. Genetic screening was performed using the ABCR400 micro-array that currently detects 496 distinct ABCA4 variants. All patients had normal full-field scotopic and photopic electroretinograms (ERGs) and abnormal pattern electroretinograms (PERGs) performed on both eyes, and all the fundi had bull's eye maculopathy without retinal flecks on FAF. On OCT, 1 patient had disorganization of photoreceptor outer segment, 2 had outer nuclear layer (ONL) thinning likely due to photoreceptor atrophy proximal to the foveal center, and 3 had additional retinal pigment epithelium (RPE) atrophy. On microperimetry, 6 patients had eccentric superior fixation and amongst this group, 5 had an absolute scotoma in the foveal area. DNA analysis revealed that 3 patients were homozygous G1961E/G1961E and the rest were compound heterozygotes for G1961E and other ABCA4 mutations. The G1961E allele in either homozygosity or heterozygosity is associated with anatomical and functional pathologies limited to the parafoveal region and a trend to delayed onset of symptoms, relative to other manifestations of ABCA4 mutations. Our observations support the hypothesis that the G1961E allele contributes to localized macular changes rather than generalized retinal dysfunction, and is a cause of bull's eye maculopathy in either the homozygosity or heterozygosity state. In addition, genetic testing provides precise diagnosis of the underlying maculopathy, and current non-invasive imaging techniques could be used to detect photoreceptor damage at the earliest clinical onset of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 G1961E mutant allele in the Stargardt disease gene ABCA4 causes bull`s eye maculopathy Wener Cella a , Vivienne C. Greenstein a,c , Jana Zernant-Rajang a , Theodore R. Smith a , Gaetano Barile a , Rando Allikmets a,b,**, Stephen H. Tsang a,b,* a Department of Ophthalmology, Bernard and Shirlee Brown Glaucoma Laboratory, Edward S. Harkness Eye Institute, Columbia University, 160 Fort Washington Avenue, New York, NY 10032, USA b Department of Pathology and Cell Biology, Bernard and Shirlee Brown Glaucoma Laboratory, Edward S. Harkness Eye Institute, Columbia University, 160 Fort Washington Avenue, New York, NY 10032, USA c Department of Ophthalmology, School of Medicine, New York University, NYU Langone Medical Center, 550 First Avenue, New York, NY 10016, USA a r t i c l e i n f o Article history: Received 15 October 2008 Accepted in revised form 4 February 2009 Available online 13 February 2009 Keywords: stargardt mutation maculopathy retinal degeneration dystrophy a b s t r a c t The aim of this study was to characterize the pathological and functional consequences of the G1961E mutant allele in the Stargardt disease gene ABCA4. Login to comment
1 Data from 15 patients were retrospectively reviewed and all the patients had at least one G1961E mutation. Login to comment
8 DNA analysis revealed that 3 patients were homozygous G1961E/G1961E and the rest were compound heterozygotes for G1961E and other ABCA4 mutations. Login to comment
9 The G1961E allele in either homozygosity or heterozygosity is associated with anatomical and functional pathologies limited to the parafoveal region and a trend to delayed onset of symptoms, relative to other manifestations of ABCA4 mutations. Login to comment
10 Our observations support the hypothesis that the G1961E allele contributes to localized macular changes rather than generalized retinal dysfunction, and is a cause of bull`s eye maculopathy in either the homozygosity or heterozygosity state. Login to comment
31 Our aim in this study is to characterize the pathological and functional consequences of the G1961E allele in the ABCA4 gene, and we report an association between group 1 STGD1 patients with bull`s eye maculopathy and homozygous or heterozygous G1961E mutations. Login to comment
32 We also describe in detail (for the first time in the literature to our knowledge) the phenotype of homozygous G1961E mutation as observed in 3 patients. Login to comment
33 We found that the G1961E mutation is associated with early foveal disorganization of photoreceptor outer segment that appear before clinically evident RPE damage. Login to comment
36 Subjects Clinical records of 15 patients (from 11 unrelated families) with the G1961E allele and bull`s eye maculopathy based on fundus autofluorescence (FAF) were examined. Login to comment
74 Screening for G1961E mutations The screening for mutations in the ABCA4 gene was performed using the ABCR400 micro-array (Jaakson et al., 2003) that detects all currently described disease-associated variants in the ABCA4 gene (496), and confirmed by direct sequencing. Login to comment
82 Patients were classified as either G1961E/G1961E homozygous, or compound heterozygous (G1961E and another mutant allele). Login to comment
88 Three patients were homozygous for the G1961E allele and 12 were compound heterozygotes. Login to comment
106 Genetic analysis For further analysis, we grouped patients according to G1961E segregation. Login to comment
109 Homozygous G1961E/G1961E mutation Phenotypic consequences for homozygous G1961E/G1961E have yet to be reported, despite the fact that has been considered one of the most frequent variants in AMD and the Stargardt (Lewis et al., 1999). Login to comment
110 G1961E/G1961E causes bull`s eye maculopathy in these unrelated patients with varying disease onset age and duration. Type B bull`s eye maculopathy was found in 2 patients and type A in one (Fig. 4). Login to comment
121 Compound heterozygous G1961E mutation Twelve patients were ABCA4 compound heterozygous with the G1961E allele. Login to comment
122 Five patients from 2 unrelated families carried the complex mutation L541P/A1038V in addition to the G1961E allele. Login to comment
128 Two patients from family 6 had the G1961E allele paired with cryptic splice site mutation IVS20 þ 5G / A, resulting in early-onset, rapid progression, and moderately-to-severely impaired visual acuity. Login to comment
131 In 5 patients (patients 7-11), missense mutations Q636H, R2077W, T1253M, C54Y and D1532N were found in addition to the G1961E allele, respectively. Login to comment
134 Discussion G1961E is one of the most frequently observed mutant ABCA4 alleles (Allikmets et al., 1997; Gerth et al., 2002; Simonelli et al., 2005). Login to comment
137 Our study demonstrates that the G1961E allele in either the homozygous or heterozygous state is associated with bull`s eye maculopathy and early central photoreceptor disorganization, resulting in reduced pattern electroretinogram (PERG) P50 responses. Login to comment
138 As our G1961E patients have normal full-field ERGs and abnormal PERG, we hypothesize that this mutant allele is associated with retinal dysfunction restricted to the macula, and it is not associated with generalized retinal dysfunction. Login to comment
141 In normal subjects, Table 1 Summary of clinical and genetic data of patients with both homozygous and heterozygous G1961E mutation. Login to comment
142 Case #, sex Age of onset Duration (years) Visual acuity (OD, OS) Allele 2 Bull`s eye type (FAF) SD-OCT MP-1 1, f 20 1 20/25, 20/40 G1961E (homozygous) B Not tested Not tested 2, f 49 13 20/200, 20/150 G1961E (homozygous) B Photoreceptor loss, thinner ONL and RPE atrophy Absolute scotoma in the central 4 degrees OD and in the central 6 degrees OS, eccentric PRL (superior retina) 3, m 19 13 20/70, 20/70 G1961E (homozygous) A Not tested Absolute scotoma in the central 6 degrees in both eyes, eccentric PRL (superior retina) 4.1, f 17 30 20/200, 20/200 L541P/A1038V B Not tested Not tested 4.2, m 28 2 20/25, 20/30 L541P/A1038V B Not tested Decreased sensitivity by 6 dB in the central 2 degrees in both eyes, foveal fixation 4.3, m 28 2 20/30, 20/40 L541P/A1038V B Not tested Decreased sensitivity by 9 dB OD and 11 dB OS in the central 2 degrees, foveal fixation 5.1, f 14 5 20/200, 20/400 L541P/A1038V C Photoreceptor loss (foveal optical gap), thinner ONL and normal RPE Decreased sensitivity by 8 dB in the central 2 degrees in both eyes, eccentric PRL (superior retina) 5.2, f 14 1 20/20, 20/25 L541P/A1038V A Photoreceptor disorganization, normal ONL and normal RPE Decreased sensitivity by 6 dB in the central 2 degrees in both eyes, foveal fixation 6.1, f 17 5 20/100, 20/100 IVS20 þ 5G / A C Photoreceptor loss, thinner ONL and RPE atrophy Absolute scotoma in the central 2 degrees in both eyes, eccentric PRL (superior retina) 6.2, m 14 3 20/40, 20/25 IVS20 þ 5G / A A Photoreceptor loss (foveal optical gap), thinner ONL and normal RPE Absolute scotoma in the central 2 degrees OD and decreased sensitivity by 18 dB in the central 2 degrees OS, eccentric PRL (superior retina) 7, m 28 12 20/200, 20/150 Q636H B Photoreceptor loss, thinner ONL and RPE atrophy Not tested 8, f 25 9 20/80, 20/25 R2077W B Not tested Not tested 9, m 67 2 20/800, 20/60 T1253M B Not tested Not tested 10, f 26 10 20/80, 20/80 C54Y B Not tested Not tested 11, f 44 20 20/400, 20/60 D1532N C Not tested Absolute scotoma in the central 8-10 degrees OD and absolute scotoma in the central 8 degrees OS, eccentric PRL (superior retina) Abbreviations: m, male; f, female; OD, right eye; OS, left eye; FAF, fundus autofluorescence; bull`s eye type A, presence of a ring of increase autofluorescence surrounding decreased autofluorescence; bull`s eye type B, decreased fovea autofluorescence without a surrounding ring of increase autofluorescence; bull`s eye type C, speckled macular appearance with slightly increased surround autofluorescence; SD-OCT, spectral-domain optical coherence tomography; ONL, outer nuclear layer; MP-1, microperimetry; and PRL, preferred retinal location. Login to comment
149 Lipofuscin accumulation leads to photoreceptor damage (Sparrow and Boulton, 2005) and our findings suggest that damage to the photoreceptor outer segment architecture is among the earliest signs of pathology in patients carrying the G1961E mutation. Login to comment
154 Upon subgroup analysis based on ABCA4 allelic combinations, we found that the 3 homozygous G1961E/G1961E patients had retinal changes limited to the central macula. Login to comment
155 Manifestation of bull`s eye maculopathy in these patients suggests that G1961E is a disease-causing mutation rather than a neutral polymorphism (Guymer et al., 2001). Login to comment
157 G1961E decreases ATP-binding and ATPase activity (Sun and Nathans, 1997) and is considered a pathologic mutation that cosegregates with STGD1 (Lewis et al., 1999). Login to comment
158 G1961E is associated with milder phenotypes in homozygous (Fishman et al., 1999) or compound heterozygous states (Simonelli et al., 2005). Login to comment
159 In other words, patients who are homozygous or compound heterozygous for the G1961E allele Fig. 1. Login to comment
160 Bull`s eye maculopathy in patient 1 with homozygous G1961E/G1961E mutation. Login to comment
164 In the compound heterozygous group, 5 patients had the complex mutation allele L541P/A1038V, in addition to G1961E. Login to comment
169 Similarly, although G1961E is considered a ''mild- to-moderate`` allele, it has been reported in bull`s eye maculopathy with more severe phenotype such as extensive atrophic RPE changes (Gerth et al., 2002; Simonelli et al., 2005). Login to comment
172 Bull`s eye maculopathy phenotypes associated with G1961E mutations. Login to comment
175 SD-OCT of patients carrying the G1961E mutation. Login to comment
184 Finally, patient 8 had the missense mutation R2077W in addition to the G1961E allele and a mild-to-moderate phenotype, with asymmetrical visual acuity and discrete autofluorescence changes. Login to comment
186 Our study confirms that the G1961E allele in either homozygosity or compound heterozygosity causes bull`s eye maculopathy featuring photoreceptor outer segment disruption as the earliest detectable finding. Login to comment
192 In conclusion, the G1961E mutant allele in either homozygosity or heterozygosity is associated with localized macular changes rather than generalized retinal dysfunction (Fishman et al., 1999; Lewis et al., 1999; Lois et al., 2004). Login to comment
196 Bull`s eye maculopathy associated with homozygous G1961E/G1961E mutation. Login to comment
135 Discussion G1961E is one of the most frequently observed mutant ABCA4 alleles (Allikmets et al., 1997; Gerth et al., 2002; Simonelli et al., 2005). Login to comment
139 As our G1961E patients have normal full-field ERGs and abnormal PERG, we hypothesize that this mutant allele is associated with retinal dysfunction restricted to the macula, and it is not associated with generalized retinal dysfunction. Login to comment
143 Case #, sex Age of onset Duration (years) Visual acuity (OD, OS) Allele 2 Bull`s eye type (FAF) SD-OCT MP-1 1, f 20 1 20/25, 20/40 G1961E (homozygous) B Not tested Not tested 2, f 49 13 20/200, 20/150 G1961E (homozygous) B Photoreceptor loss, thinner ONL and RPE atrophy Absolute scotoma in the central 4 degrees OD and in the central 6 degrees OS, eccentric PRL (superior retina) 3, m 19 13 20/70, 20/70 G1961E (homozygous) A Not tested Absolute scotoma in the central 6 degrees in both eyes, eccentric PRL (superior retina) 4.1, f 17 30 20/200, 20/200 L541P/A1038V B Not tested Not tested 4.2, m 28 2 20/25, 20/30 L541P/A1038V B Not tested Decreased sensitivity by 6 dB in the central 2 degrees in both eyes, foveal fixation 4.3, m 28 2 20/30, 20/40 L541P/A1038V B Not tested Decreased sensitivity by 9 dB OD and 11 dB OS in the central 2 degrees, foveal fixation 5.1, f 14 5 20/200, 20/400 L541P/A1038V C Photoreceptor loss (foveal optical gap), thinner ONL and normal RPE Decreased sensitivity by 8 dB in the central 2 degrees in both eyes, eccentric PRL (superior retina) 5.2, f 14 1 20/20, 20/25 L541P/A1038V A Photoreceptor disorganization, normal ONL and normal RPE Decreased sensitivity by 6 dB in the central 2 degrees in both eyes, foveal fixation 6.1, f 17 5 20/100, 20/100 IVS20 &#fe; 5G / A C Photoreceptor loss, thinner ONL and RPE atrophy Absolute scotoma in the central 2 degrees in both eyes, eccentric PRL (superior retina) 6.2, m 14 3 20/40, 20/25 IVS20 &#fe; 5G / A A Photoreceptor loss (foveal optical gap), thinner ONL and normal RPE Absolute scotoma in the central 2 degrees OD and decreased sensitivity by 18 dB in the central 2 degrees OS, eccentric PRL (superior retina) 7, m 28 12 20/200, 20/150 Q636H B Photoreceptor loss, thinner ONL and RPE atrophy Not tested 8, f 25 9 20/80, 20/25 R2077W B Not tested Not tested 9, m 67 2 20/800, 20/60 T1253M B Not tested Not tested 10, f 26 10 20/80, 20/80 C54Y B Not tested Not tested 11, f 44 20 20/400, 20/60 D1532N C Not tested Absolute scotoma in the central 8-10 degrees OD and absolute scotoma in the central 8 degrees OS, eccentric PRL (superior retina) Abbreviations: m, male; f, female; OD, right eye; OS, left eye; FAF, fundus autofluorescence; bull`s eye type A, presence of a ring of increase autofluorescence surrounding decreased autofluorescence; bull`s eye type B, decreased fovea autofluorescence without a surrounding ring of increase autofluorescence; bull`s eye type C, speckled macular appearance with slightly increased surround autofluorescence; SD-OCT, spectral-domain optical coherence tomography; ONL, outer nuclear layer; MP-1, microperimetry; and PRL, preferred retinal location. Login to comment
150 Lipofuscin accumulation leads to photoreceptor damage (Sparrow and Boulton, 2005) and our findings suggest that damage to the photoreceptor outer segment architecture is among the earliest signs of pathology in patients carrying the G1961E mutation. Login to comment
156 Manifestation of bull`s eye maculopathy in these patients suggests that G1961E is a disease-causing mutation rather than a neutral polymorphism (Guymer et al., 2001). Login to comment
161 Bull`s eye maculopathy in patient 1 with homozygous G1961E/G1961E mutation. Login to comment
165 In the compound heterozygous group, 5 patients had the complex mutation allele L541P/A1038V, in addition to G1961E. Login to comment
170 Similarly, although G1961E is considered a ''mild- to-moderate`` allele, it has been reported in bull`s eye maculopathy with more severe phenotype such as extensive atrophic RPE changes (Gerth et al., 2002; Simonelli et al., 2005). Login to comment
173 Bull`s eye maculopathy phenotypes associated with G1961E mutations. Login to comment
176 SD-OCT of patients carrying the G1961E mutation. Login to comment
188 Our study confirms that the G1961E allele in either homozygosity or compound heterozygosity causes bull`s eye maculopathy featuring photoreceptor outer segment disruption as the earliest detectable finding. Login to comment
194 In conclusion, the G1961E mutant allele in either homozygosity or heterozygosity is associated with localized macular changes rather than generalized retinal dysfunction (Fishman et al., 1999; Lewis et al., 1999; Lois et al., 2004). Login to comment
198 Bull`s eye maculopathy associated with homozygous G1961E/G1961E mutation. Login to comment

[hide] Lipofuscin- and melanin-related fundus autofluores... Am J Ophthalmol. 2009 May;147(5):895-902, 902.e1. Epub 2009 Feb 25. Kellner S, Kellner U, Weber BH, Fiebig B, Weinitz S, Ruether K
Lipofuscin- and melanin-related fundus autofluorescence in patients with ABCA4-associated retinal dystrophies.
Am J Ophthalmol. 2009 May;147(5):895-902, 902.e1. Epub 2009 Feb 25., [PMID:19243736]

Abstract [show]
PURPOSE: To compare melanin-related near-infrared fundus autofluorescence (NIA; excitation 787 nm, emission > 800 nm) to lipofuscin-related fundus autofluorescence (FAF; excitation 488 nm, emission > 500 nm) in patients with retinal dystrophies associated with ABCA4 gene mutations (ABCA4-RD). DESIGN: Observational case series. METHODS: Sixteen consecutive patients with ABCA4-RD diagnosed in one institution were included. FAF and NIA imaging were performed with a confocal scanning laser ophthalmoscope (Heidelberg Retina Angiograph 2; Heidelberg Engineering, Heidelberg, Germany). The pattern and size of retinal pigment epithelial (RPE) alterations detected with FAF and NIA were evaluated. RESULTS: FAF and NIA alterations were detected in all patients. In 7 of 16 patients, the alterations progressed beyond the vascular arcades, and in 9 of 16, they were confined to the macula. Spots of increased NIA (4/16) were less frequent compared with spots of increased FAF (15/16). Confluent patches of reduced NIA were frequent (12/16), and severely reduced NIA was observed in 3 cases. Areas with reduced NIA corresponded to either increased or reduced FAF. Preservation of subfoveal FAF or NIA corresponded to visual acuity > or = 0.4. Abnormalities detected with NIA were more extensive or more severe compared to FAF in 15 of 16 patients. CONCLUSION: Patterns of FAF and NIA indicate different involvement of lipofuscin and melanin and their derivates in the pathophysiologic process of ABCA4-RD. NIA imaging provides a noninvasive in vivo visualization of RPE abnormalities that may precede FAF alterations during the degenerative process. Combined FAF and NIA imaging will provide further insight in the development of ABCA4-RD and could help to monitor future therapeutic interventions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Age Gender ABCA4 Mutation VA RE/LE Full-field ERG Multifocal ERG Group 1a CRD 2808 34 F c.5413AϾG (p.Asn1805Asp) c.4880_4903dup24 (p.Leu1627_Ala1634dup) 0.05 0.05 DA and LA markedly reduced No recordable potentials CRD 2830 53 F c.2690CϾT (p.Thr897Ile), c.6176GϾC (p.Gly2059Ala) 0.5 0.7 DA and LA moderately reduced Pericentral amplitude reduction CRD 2797 54 M c.4297GϾA (p.Val1433Ile) 2. mutation not foundc 0.1 0.16 DA and LA moderately reduced Not done SD 2872 44 F c.4462TϾC (p.Cys1488Arg) 2. mutation not done 0.6 0.7 DA and LA borderline Central amplitude reduction CRD 2861 72 F c.122GϾA (p.Trp41Ter) 2. mutation not done 0.4 0.5 DA: mildly and LA: moderately reduced Central amplitude reduction CRD 2644 67 F c.634CϾT (p.Arg212Cys), c.656GϾC (p.Arg219Thr), c.2588GϾC (p.Gly863Ala/ delGly863) 0.6 0.04 DA and LA moderately reduced Central amplitude reduction CRD 2936 44 F c.1622TϾC (p.Leu541Pro)/ c.3113CϾT (p.Ala1038Val), 2. mutation not done 1.0 1.0 DA: mildly and LA: moderately reduced Pericentral amplitude reduction Group 2b SD 2837 42 M c.1622TϾC (p.Leu541Pro)/ c.3113CϾT (p.Ala1038Val), c.5882GϾA (p.Gly1961Glu) 0.16 0.16 Normal Central amplitude reduction SD 2780 37 M c.768GϾT (splice mutation) c.5882Gfe;A (p.Gly1961Glu) 0.1 0.1 Normal Central amplitude reduction SD 2942 47 F c.1622TϾC (p.Leu541Pro) c.6320 GϾA (p.Arg2107His) 0.1 0.16 Not done Central amplitude reduction SD 2930 40 F c.6089GϾA (p.Arg2030Gln) c.6543del36bp, (p.Leu2182_Phe2193del) 0.1 0.1 DA and LA mildly reduced Central amplitude reduction SD 2933 43 F c.1609CϾT (p.Arg537Cys) c.5882GϾA (p.Gly1961Glu) c.1654GϾA (p.Val552Ile) 0.05 0.1 Normal Not done SD 2669 13 F c.768GϾT (splice mutation) c.6449Gfe;A (p.Cys2150Tyr) 0.1 0.16 DA and LA borderline Central amplitude reduction SD 2700 22 F c.1609CϾT (p.Arg537Cys) c.2588GϾC (p.Gly863Ala) 0.1 0.1 Normal Central amplitude reduction SD 2833 29 M c.1928TϾG (p.Val643Gly) 2. mutation not foundc 0.1 0.1 Normal Not done SD 2799 13 M c.3113CϾT (p.Ala1038Val) c.5461-10TϾC 0.4 0.4 Not done Central amplitude reduction CRD ϭ cone-rod dystrophy; DA ϭ dark adaptation; ERG ϭ electroretinography; F ϭ female; LA ϭ light adaptation; LE ϭ left eye; M ϭ male; RE ϭ right eye; SD ϭ Stargardt disease; VA ϭ visual acuity. Login to comment

[hide] Molecular analysis of the ABCA4 gene for reliable ... Br J Ophthalmol. 2009 May;93(5):614-21. Epub 2008 Nov 21. Aguirre-Lamban J, Riveiro-Alvarez R, Maia-Lopes S, Cantalapiedra D, Vallespin E, Avila-Fernandez A, Villaverde-Montero C, Trujillo-Tiebas MJ, Ramos C, Ayuso C
Molecular analysis of the ABCA4 gene for reliable detection of allelic variations in Spanish patients: identification of 21 novel variants.
Br J Ophthalmol. 2009 May;93(5):614-21. Epub 2008 Nov 21., [PMID:19028736]

Abstract [show]
BACKGROUND/AIMS: Mutations in ABCA4 have been associated with autosomal recessive Stargardt disease (STGD), a few cases with autosomal recessive cone-rod dystrophy (arCRD) and autosomal recessive retinitis pigmentosa (arRP). The purpose of the study was threefold: to molecularly characterise families with no mutations or partially characterised families; to determine the specificity and sensitivity of the genotyping microarray; and to evaluate the efficiency of different methodologies. METHODS: 23 STGD, five arCRD and three arRP Spanish patients who were previously analysed with the ABCR400 microarray were re-evaluated. Results were confirmed by direct sequencing. In patients with either none or only one mutant allele, ABCA4 was further analysed by denaturing high-performance liquid chromatography (dHPLC) and multiplex ligation-dependent probe amplification (MLPA). Haplotype analysis was also performed. RESULTS: In the first analysis performed with the microarray, 27 ABCA4 variants (27/62; 43.5%) were found. By dHPLC scanning, 12 novel mutations were additionally identified. In addition, two previously described mutations, one false negative (1/62; 1.6%) and one false positive (1.6%), were detected. MLPA analysis did not reveal additional substitutions. The new strategy yielded an increment of 21% compared with the approach used in the first round. CONCLUSION: ABCA4 should be analysed by optimal combination of high-throughput screening techniques such as microarray, dHPLC and direct sequencing. To the best of our knowledge, this strategy yielded significant mutational spectrum identification in Spanish patients with ABCA4-associated phenotypes. Follow-up of patients, presenting an early onset of the disease and severe mutations, seems essential to perform accurate genotype-phenotype correlations and further characterisation of pathological ABCA4 alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 Moreover, both patients presented the p.Gly1961Glu mutation, which is considered an allele of moderate effect.7 Figure 1 Chromatograms showing differences between the wild-type (down) and mutated profile (up). Login to comment
80 Clinical science Br J Ophthalmol 2009;93:614-621. doi:10.1136/bjo.2008.145193 Table 1 Clinical findings of the Spanish patients with Stargardt disease (STGD), autosomal recessive cone-rod dystrophy and autosomal recessive retinitis pigmentosa Pedigree Age (years) Age (years) of onset Visual acuity Diagnosis Allele 1 Allele 2 Segregation OD OS Nucleotide changes (exons) Amino acid change Nucleotide changes (exons) Amino acid change ARDM-135 42 24 0.4 0.6 STGD c.5882G.A(42) p.Gly1961Glu c.1029_1030insT(8) p.Asn344fsX NP ARDM-240 15 13 0.2 0.16 STGD c.5882G.A(42) p.Gly1961Glu c.2285C.A(15) p.Ala762Glu Yes ARDM-225 32 25 0.25 0.50 STGD c.5882G.A(42) p.Gly1961Glu c.6559C.T(48) p.Gln2187X Yes ARDM-164 21 11 NA STGD c.3386G.T(23) p.Arg1129Leu c.700C.T(6) p.Gln234X Yes ARDM-162 50 16 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND Yes ARDM-198 27 19 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND NP ARDM-125 31 9 0.3 0.4 STGD c.3211insGT(22) FS p.KNLFA1876dup Yes ARDM-158 24 9 0.2 0.2 STGD c.3211insGT(22) FS c.4537delC(30) p.Gln1513fsX1525 NP ARDM-165 40 30 NA STGD c.3211insGT(22) FS ND ND NP ARDM-167 49 23 0.05 0.05 STGD c.3211insGT(22) FS ND ND NP ARDM-146 32 13 0.06 0.1 STGD c.3056C.T(21) p.Thr1019Met c.6140T.A(44) p.Ile2047Asn Yes ARDM-40 46 9 0.1 0.1 STGD c.3056C.T(21) p.Thr1019Met c.3943C.T(27) p.Gln1315X Yes ARDM-90 26 8 Hand moving STGD c.5929G.A (43) p.Gly1977Ser IVS21-2A.T Yes ARDM-181 57 16 0.1 0.09 STGD c.3323G.A (22) p.Arg1108His IVS38+5G.A Yes ARDM-197 35 15 0.1 0.1 STGD c.4793C.A(34) (false +) p.Ala1598Asp (false +) c.5172G.T(36) p.Trp1724Cys Yes ARDM-183 63 55 0.150 0.175 STGD c.6079C.T(44) p.Leu2027Phe c.5929G.A(43) (false -) p.Gly1977Ser (false -) NP ARDM-38 35 6 0.01 0.02 STGD c.1804C.T(13) p.Arg602Trp c.4739delT(33) p.Leu1580fs Yes ARDM-163 48 32 0.01 0.32 STGD c.4457C.T(30) p.Pro1486Leu ND ND Yes ARDM-166 42 39 NA STGD c.6320G.A(46) p.Arg2107His ND ND Yes ARDM-222 26 23 NA STGD c.2791G.A(19) p.Val931Met ND ND NP ARDM-160 30 5 0.25 0.1 STGD ND ND ND ND Yes ARDM-173 49 7 NA STGD ND ND ND ND Yes ARDM-205 NA NA NA STGD c.4919G.A(35) p.Arg1640Gln ND ND NP ARDM-247 30 12 0.05 0.1 CRD c.3386G.T(23) p.Arg1129Leu c.6410G.A(47) p.Cys2137Tyr Yes ARDM-99 59 46 0.05 0.05 CRD c.4297G.A(29) p.Val1433Ile ND ND NP ARDM-131 27 15 0.9 0.7 CRD c.2701A.G(18) p.Thr901Ala ND ND Yes ARDM-100 28 4 0.2 0.16 CRD ND ND ND ND Yes ARDM-142 30 25 0.8 0.5 CRD ND ND ND ND Yes RP-773 38 20 0.05 0.05 RP c.33N86G.T(23) p.Arg1129Leu ND ND NP RP-959 53 10 0.1 0.1 RP c.466A.G(5) p.Ile156Val ND ND Yes RP-1058 37 6 0.2 0.6 RP c.4297G.A(29) p.Val1433Ile ND ND NP Twenty-seven out of 31 subjects were found to be compound heterozygous for mutations in the ABCA4 gene detected by microarray. Login to comment
104 The second most prevalent missense disease-associated allele was p.Gly1961Glu (3/62; 4.8%), presenting a lower frequency than other European populations.10 This mutation was found in three STGD patients, two of them presenting at least one putative null mutation (c.1030insT and p.Gln2187X), who presented symptoms at the age of 24-25 years. Login to comment
105 Thus, we could suspect a moderate effect for the p.Gly1961Glu allele, as previously reported.7 In relation to null alleles, the most frequent mutation was c.3211insGT, identified in four independent STGD families out of 31 (6.4%). Login to comment

[hide] Clinical utility of the ABCR400 microarray: basing... Arch Ophthalmol. 2009 Apr;127(4):549-54. Roberts LJ, Ramesar RS, Greenberg J
Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip.
Arch Ophthalmol. 2009 Apr;127(4):549-54., [PMID:19365039]

Abstract [show]
OBJECTIVES: To assess the clinical utility of ABCR400 microarray testing in patients with ABCA4-associated retinopathies and to report on possible issues that could arise should genetic results be delivered without validation. METHODS: One hundred thirty-two probands were genotyped with the microarray. Diagnostic assays were designed to verify all mutations identified in individuals in whom at least 2 causative mutations were found. Mutations were verified in the probands, and wherever possible cosegregation analysis was performed in additional family members. RESULTS: Eighty-five of the 132 probands (64.4%) genotyped with the microarray had 2 or more disease-associated mutations identified. Verification of the genotyping, however, resulted in only 80 families being able to benefit from genetic result delivery. The remaining families could not receive results owing to the confounding effect of multiple ABCA4 mutations or the incorrect identification of mutations. CONCLUSIONS: The ABCR400 microarray is useful for mutation screening; however, raw data cannot be delivered directly to patients. All mutations should be verified and, whenever possible, investigated in other family members. CLINICAL RELEVANCE: Validated ABCR400 results provide an unequivocal molecular diagnosis, allowing family members to be offered diagnostic, predictive, carrier, and prenatal testing. Use of the microarray can inform decision-making and identify candidates for future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 3Ј; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 3Ј; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction. Login to comment

[hide] ABCA4 disease progression and a proposed strategy ... Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12. Cideciyan AV, Swider M, Aleman TS, Tsybovsky Y, Schwartz SB, Windsor EA, Roman AJ, Sumaroka A, Steinberg JD, Jacobson SG, Stone EM, Palczewski K
ABCA4 disease progression and a proposed strategy for gene therapy.
Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12., [PMID:19074458]

Abstract [show]
Autosomal recessive retinal diseases caused by mutations in the ABCA4 gene are being considered for gene replacement therapy. All individuals with ABCA4-disease show macular degeneration, but only some are thought to progress to retina-wide blindness. It is currently not predictable if or when specific ABCA4 genotypes will show extramacular disease, and how fast it will progress thereafter. Early clinical trials of focal subretinal gene therapy will aim to arrest disease progression in the extramacular retina. In 66 individuals with known disease-causing ABCA4 alleles, we defined retina-wide disease expression by measuring rod- and cone-photoreceptor-mediated vision. Serial measurements over a mean period of 8.7 years were consistent with a model wherein a normal plateau phase of variable length was followed by initiation of retina-wide disease that progressed exponentially. Once initiated, the mean rate of disease progression was 1.1 log/decade for rods and 0.45 log/decade for cones. Spatio-temporal progression of disease could be described as the sum of two components, one with a central-to-peripheral gradient and the other with a uniform retina-wide pattern. Estimates of the age of disease initiation were used as a severity metric and contributions made by each ABCA4 allele were predicted. One-third of the non-truncating alleles were found to cause more severe disease than premature truncations supporting the existence of a pathogenic component beyond simple loss of function. Genotype-based inclusion/exclusion criteria and prediction of the age of retina-wide disease initiation will be invaluable for selecting appropriate candidates for clinical trials in ABCA4 disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Similarly, P47 (P1380L/ G1961E) had a sensitivity loss (2.3 dB) that was within normal limits at age 45, and this increased, but not significantly, to 3.6 dB over an 8-year period. Login to comment
125 IVS38-10T.C, G1961R, G1961E and C2150Y) occurring in trans to the truncation and frame shift mutations by subtracting the standard ADI from the ADI of each individual; if there were several individuals with the same genotype, their ADIs were averaged. Login to comment
134 Unrelated individuals P11 and P12 had the same pair of mutant alleles, R152X and G1961E. Login to comment
136 P7 with C54Y and G1961E alleles had normal extramacular vision at age 40 consistent with a predicted ADI of 46.4 years (¼10.6 - 2.1 þ 37.9 years, Table 1). Login to comment
151 Estimated severity of ABCA4 alleles and their properties ABCA4 allele Delay of retina-wide disease initiation (years)a In vitro or in vivo studiesb Molecular structural localizationc C2150Y 225.8 NBD-2 A1038V;L541P 214.0 35, 38 ECD-1/NBD-1 IVS38-10 T.C 211.1 L244P 25.7 ECD-1 E1122K 23.5 NBD-1 C54Y 22.1 35 ECD-1 IVS35þ2 T.C 22.1 R602W 21.8 38 ECD-1 V1896D 21.8 TM12 L1940P 21.4 NBD-2 Truncation mutationsd 0.0 E1087D 2.8 NBD-1 R220C 3.9 ECD-1 A1598D 3.9 ECD-2 R1640Q 3.9 ECD-2 R1098C 4.9 NBD-1 P1380L 7.4 35 TM7 N965S 7.6 35 NBD-1 V1433I 8.6 ECD-2 R1108C 10.4 35 NBD-1 T1526M 14.5 35 ECD-2 R2030Q 14.5 NBD-2 L2027F 15.1 35,37 NBD-2 G818E 17.3 35 TM5/TM6 S100P 18.2 ECD-1 L1201R 18.2 NBD-1 R18W 18.5 Nt D600E 18.5 ECD-1 L11P 21.7 Nt D654N 25.3 36 ECD-1 K2172R 27.9 NBD-2 IVS40þ5 G.A 28.1 G1961E 37.9 35 NBD-2 G1961R 44.0 NBD-2 a Delay of retina-wide disease initiation relative to the standard of age 10.6 years. Login to comment

[hide] ABCA4 mutations in Portuguese Stargardt patients: ... Mol Vis. 2009;15:584-91. Epub 2009 Mar 25. Maia-Lopes S, Aguirre-Lamban J, Castelo-Branco M, Riveiro-Alvarez R, Ayuso C, Silva ED
ABCA4 mutations in Portuguese Stargardt patients: identification of new mutations and their phenotypic analysis.
Mol Vis. 2009;15:584-91. Epub 2009 Mar 25., [PMID:19365591]

Abstract [show]
PURPOSE: To resolve the spectrum of causative retina-specific ATP-binding cassette transporter gene (ABCA4) gene mutations in Portuguese Stargardt (STGD) patients and compare allele frequencies obtained in this cohort with those of previous population surveys. METHODS: Using a microarray technique (ABCR400 gene chip), we screened all previously reported ABCA4 gene mutations in the genomic DNA of 27 patients from 21 unrelated Stargardt families whose phenotypes had been clinically evaluated using psychophysics and electrophysiological measurements. Furthermore, we performed denaturing high performance liquid chromatography whenever one or both mutant alleles failed to be detected using the ABCR gene chip. RESULTS: A total of 36 mutant alleles (out of the 54 tested) were identified in STGD patients, resulting in a detection rate of 67%. Two mutant alleles were present in 12 out of 21 STGD families (57%), whereas in four out of 21 (19%) of the families, only one mutant allele was found. We report the presence of 22 putative pathogenic alterations, including two sequence changes not found in other populations, c.2T>C (p.Met1Thr) and c.4036_4037delAC (p.Thr1346fs), and two novel disease-associated variants, c.400C>T (p.Gln134X) and c.4720G>T (p.Glu1574X). The great majority of the mutations were missense (72.7%). Seven frameshift variants (19.4%), three nonsense mutations (8.3%), and one splicing sequence change (2.7%) were also found in STGD chromosomes. The most prevalent pathologic variant was the missense mutation p.Leu11Pro. Present in 19% of the families, this mutation represents a quite high prevalence in comparison to other European populations. In addition, 23 polymorphisms were also identified, including four novel intronic sequence variants. CONCLUSIONS: To our knowledge, this study represents the first report of ABCA4 mutations in Portuguese STGD patients and provides further evidence of different mutation frequency across populations. Phenotypic characterization of novel putative mutations was addressed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 [Met1Val]+ [Arg2030Gln], found in 4.8% of the families (for details, see Table 1). Login to comment
64 Most of the mutations detected have been reported as STGD-associated variants: p.Met1Val, p.Asn96Asp, p.Arg290Trp, p.Val931Met, p.Gly1961Glu, p.Leu2027Phe, p.Arg2030Gln, p.Asp1048fs, and IVS40+5G>A. Login to comment
65 Although most of the mutations were found in one family, five disease-associated alleles were detected in unrelated STGD families (p.Leu11Pro, p.Asp1048fs; p.Gly1961Glu; p.Ser1642Arg; p.Val1681_Cys1685del; p.Val931Met). Login to comment
69 4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 2 4458 Mi 5 8/10 / 6/10 ND / ND ND/ND 4455 S 8 1/10 / 8/10 ND / ND ND/ND 3 4431 Mo 6 1,6/10 / 1,6/10 c.1804C>T(13) / c.IVS+5G>A(40) p.Arg602Trp [30]/SPLICE [11] 4 4626 S 6 FC / FC c.3211_3212insGT(22) / c.3211_3212insGT(22) p.Asp1048fs [5]/p.Asp1048fs [5] 5 4514 S 12 1/10 / 1/10 c.32T>C(1) / c. Login to comment
70 [1A>G(1)]+[6089G>A(44)] p.Leu11Pro [12]/p.(Met1Val [6])+(Arg2030Gln [9]) 6 4525 Mo 14 1/10 / 1/10 ND / c.868C>T(8) ND/p.Arg290Trp [6] 7 4585 Mo 11 0.5/10 / 0.5/10 c.6079C>T(44) / ND p.Leu2027Phe [5]/ND 8 4678 Mo 9 0.5/10 / 1/10 c.3113C>T(21) / c.3602T>G(24) p.Ala1038Val [5]/p.Leu1201Arg [9] 9 4675 Mo 7 0.5/10 / 1/10 c.2T<C(1) / c.2T<C(1) p.Met1Thr/p.Met1Thr 10 4737 Mo 24 1.2/10 / 1.2/10 c.5882G>A(42) / c.3211_3212insGT(22) p.Gly1961Glu [4]/p.Asp1048fs 11 4613 S 9 FC / FC c. Login to comment
72 (Ser1642Arg [10])+(Val1681_Cys1685del [10])/ p.Leu11Pro 12 4796 Mo 43 1/10 / 3/10 c.4720G>T(33) / c.2791G>A(19) p.Glu1574X/p.Val931Met [5] 13 4859 Mo 30 0.5/10 / 0.5/10 c.5882G>A(42) / ND p.Gly1961Glu/ND 5472 Mo 30 6/10 / 8/10 c.5882G>A(42) / ND p.Gly1961Glu/ND 14 4974 S 7 1/10 / 1/10 c.4036_4037delAC(27) / c.400C>T(4) p.Thr1346fs/p.Gln134X 4975 S 7 1/10 / 1/10 c. Login to comment
83 The p.Gly1961Glu mutation, associated with AMD, was found in 9.5% of our patients. Login to comment
71 (Ser1642Arg [10])+(Val1681_Cys1685del [10])/ p.Leu11Pro 12 4796 Mo 43 1/10 / 3/10 c.4720G>T(33) / c.2791G>A(19) p.Glu1574X/p.Val931Met [5] 13 4859 Mo 30 0.5/10 / 0.5/10 c.5882G>A(42) / ND p.Gly1961Glu/ND 5472 Mo 30 6/10 / 8/10 c.5882G>A(42) / ND p.Gly1961Glu/ND 14 4974 S 7 1/10 / 1/10 c.4036_4037delAC(27) / c.400C>T(4) p.Thr1346fs/p.Gln134X 4975 S 7 1/10 / 1/10 c. Login to comment
82 The p.Gly1961Glu mutation, associated with AMD, was found in 9.5% of our patients. Login to comment

[hide] ABCA4 gene analysis in patients with autosomal rec... Eur J Hum Genet. 2008 Jul;16(7):812-9. Epub 2008 Feb 20. Kitiratschky VB, Grau T, Bernd A, Zrenner E, Jagle H, Renner AB, Kellner U, Rudolph G, Jacobson SG, Cideciyan AV, Schaich S, Kohl S, Wissinger B
ABCA4 gene analysis in patients with autosomal recessive cone and cone rod dystrophies.
Eur J Hum Genet. 2008 Jul;16(7):812-9. Epub 2008 Feb 20., [PMID:18285826]

Abstract [show]
The ATP-binding cassette (ABC) transporters constitute a family of large membrane proteins, which transport a variety of substrates across membranes. The ABCA4 protein is expressed in photoreceptors and possibly functions as a transporter for N-retinylidene-phosphatidylethanolamine (N-retinylidene-PE), the Schiff base adduct of all-trans-retinal with PE. Mutations in the ABCA4 gene have been initially associated with autosomal recessive Stargardt disease. Subsequent studies have shown that mutations in ABCA4 can also cause a variety of other retinal dystrophies including cone rod dystrophy and retinitis pigmentosa. To determine the prevalence and mutation spectrum of ABCA4 gene mutations in non-Stargardt phenotypes, we have screened 64 unrelated patients with autosomal recessive cone (arCD) and cone rod dystrophy (arCRD) applying the Asper Ophthalmics ABCR400 microarray followed by DNA sequencing of all coding exons of the ABCA4 gene in subjects with single heterozygous mutations. Disease-associated ABCA4 alleles were identified in 20 of 64 patients with arCD or arCRD. In four of 64 patients (6%) only one mutant ABCA4 allele was detected and in 16 patients (25%), mutations on both ABCA4 alleles were identified. Based on these data we estimate a prevalence of 31% for ABCA4 mutations in arCD and arCRD, supporting the concept that the ABCA4 gene is a major locus for various types of degenerative retinal diseases with abnormalities in cone or both cone and rod function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 of alleles Reference Missense: 6 c.731T4Ca p.L244P 2 23 12 c.1622T4Cb p.L541P 1 5 13 c.1928T4G p.V643G 1 9 17 c.2588G4C p.G863A and p.G863del 2 4 21 c.3113C4Tb p.A1038V 1 4 25 c.3608G4A p.G1203E 1 24 28 c.4139C4T p.P1380L 2 25 30 c.4457C4T p.P1486L 1 25 30 c.4462T4C p.C1488R 1 25 37 c.5285C4A p.A1762D 1 24 41 c.5819T4C p.L1940P 1 26 42 c.5882G4A p.G1961E 1 9 45 c.6148G4C p.V2050L 1 25 45 c.6229C4T p.R2077W 1 25 Nonsense: 6 c.700C4T p.Q234X 1 This study 6 c.735T4G p.Y245X 2 24 28 c.4234C4T p.Q1412X 1 10 Deletion: 24 c.3539_3554del p.S1181PfsX8 1 This study 43 c.5917delG p.V1973X 3 27 Splice site/intronic: 26 c.5196+1G4A Splicing 1 9 34 c.4848+2T4C Splicing 1 This study 36 c.5196+1_5196+4del Splicing 1 15 39 c.5461À10T4C Unknown 8 14 40 c.5714+5G4A Splicing? Login to comment

[hide] Evidence of widespread retinal dysfunction in pati... Invest Ophthalmol Vis Sci. 2008 Mar;49(3):1191-9. Maia-Lopes S, Silva ED, Silva MF, Reis A, Faria P, Castelo-Branco M
Evidence of widespread retinal dysfunction in patients with stargardt disease and morphologically unaffected carrier relatives.
Invest Ophthalmol Vis Sci. 2008 Mar;49(3):1191-9., [PMID:18326749]

Abstract [show]
PURPOSE: To characterize contrast sensitivity (CS) across the visual field for two achromatic spatial-temporal frequencies in 21 families with Stargardt disease (STGD) and to correlate psychophysical impairment with patterns of change in multifocal electroretinography (mfERG). METHODS: Twenty-seven eyes from patients with STGD, 16 eyes from asymptomatic relatives, and 44 age-matched control eyes were included. Chromatic CS function was assessed by comparing protan, deutan, and tritan (Cambridge Color Test; Cambridge Research Systems Ltd., Rochester, UK) and anomaloscope measures (IF-2; Roland Consult, Wiesbaden, Germany). Achromatic CS measures were obtained with custom-made software in nine locations by using randomly interleaved staircases. The first task-low spatial frequency (LSF)-matched the known frequency-doubling method that is believed to activate the magnocellular pathway preferentially. The second included an intermediate spatial frequency (ISF, 3.5 cyc/deg). mfERGs (RETIscan; Roland Consult) were also obtained. Relatives were screened for ABCA4 mutations by ABCR400 microarray and direct sequencing. RESULTS: Central impairment of achromatic and chromatic CS (along the three isolation axes) was observed in STGD. LSF and ISF tasks revealed significant and widespread dysfunction in patients and their morphologically unaffected relatives, 80% of whom were found to be ABCA4 mutation carriers. Significant reduction of P1 amplitudes was also observed in both groups. CONCLUSIONS: CS function is impaired in patients with STGD at distinct spatial-temporal frequencies, which, in addition to the color vision deficits, suggests dual impairment of the magno- parvocellular pathways. STGD morphologically unaffected carriers may show patterns of psychophysical dysfunction that are mirrored by abnormal mfERG responses.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
149 The most frequent mutation found was the missense variant G1961E (6.7%) that, even in the heterozygous state, has been significantly associated with age-related macular degeneration (AMD).16 One missense mutation involving an uncharged amino acid (L11P) in a conserved domain that has been found in FFM patients was detected. Login to comment
191 Given the similarity between STGD and AMD and that some high-prevalence mutations-namely, the variant G1961E-even in the heterozygous state, have been significantly associated with AMD, STGD carriers may well have some predisposition to the development of AMD, although this statement must at this point remain speculative. Login to comment
133 The most frequent mutation found was the missense variant G1961E (6.7%) that, even in the heterozygous state, has been significantly associated with age-related macular degeneration (AMD).16 One missense mutation involving an uncharged amino acid (L11P) in a conserved domain that has been found in FFM patients was detected. Login to comment
169 Given the similarity between STGD and AMD and that some high-prevalence mutations-namely, the variant G1961E-even in the heterozygous state, have been significantly associated with AMD, STGD carriers may well have some predisposition to the development of AMD, although this statement must at this point remain speculative. Login to comment

[hide] Stargardt's disease and the ABCR gene. Semin Ophthalmol. 2008 Jan-Feb;23(1):59-65. Westerfeld C, Mukai S
Stargardt's disease and the ABCR gene.
Semin Ophthalmol. 2008 Jan-Feb;23(1):59-65., [PMID:18214793]

Abstract [show]
Stargardt's disease is an autosomal recessive form of juvenile macular degeneration. The clinical presentation, relevant ancillary tests, and classic histologic features will be reviewed. The role of genetic mutations in the pathophysiology of Stargardt's disease will also be explored. Stargardt's disease is caused by mutations in the ABCR (ABCA4) gene on chromosome 1. Mutations in this gene have also been attributed to some cases of cone-rod dystrophy, retinitis pigmentosa, and age-related macular degeneration. The genetic and molecular pathways that produce Stargardt's disease will be discussed. Future diagnostic and therapeutic objectives for this visually disabling condition will also be presented.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
94 Certain mutant alleles causing Stargardt`s such as G863A, A1038V, and G1961E appear to be more common and may have altered frequencies in different populations, presumably because of founder effect (Maugeri et al., 1999; Simonelli et al., 2000). Login to comment
107 In an international 15-center meta-analysis of the published data on the two most common ABCA4 variants, the D2177N and G1961E alleles, there was a statistically significant but small correlation with AMD. Login to comment

[hide] Pseudo-vitelliform macular detachment and cuticula... Ophthalmic Genet. 2007 Dec;28(4):192-7. Barbazetto IA, Yannuzzi NA, Klais CM, Merriam JE, Zernant J, Peiretti E, Yannuzzi LA, Allikmets R
Pseudo-vitelliform macular detachment and cuticular drusen: exclusion of 6 candidate genes.
Ophthalmic Genet. 2007 Dec;28(4):192-7., [PMID:18161617]

Abstract [show]
PURPOSE: The etiology and genetic cause of pseudo-vitelliform macular detachment with cuticular drusen (PVMD/CD) are unknown; nor is it clear if this phenotype represents a separate disease entity, or is a sub-phenotype of disorders with overlapping clinical presentation. To answer this question, we screened a cohort of patients affected with PVMD/CD for variation in six plausible candidate genes (ABCA4, VMD2, TIMP-3, peripherin/RDS, fibulin 5 (FIBL5) and complement factor H (CFH)) associated with diseases of overlapping phenotypes. METHODS: Twenty-eight patients, diagnosed with pseudo-vitelliform macular detachment and cuticular drusen, were evaluated by clinical examination, fundus photography, fluorescein angiography and autofluorescence imaging. DNA from all study subjects were screened for variants in the ABCA4, VMD2, TIMP-3, peripherin/RDS, FIBL5 and CFH genes by a combination of DHPLC, array screening and direct sequencing. RESULTS: All patients presented with cuticular drusen; pseudo-vitelliform detachment was seen in 21 cases, while atrophic changes following regression of the detachment were seen in the remaining 7 subjects. Visual acuity ranged from 20/20 to CF. The screening revealed an I32V mutation in peripherin/RDS in one patient and 2ABCA4 variants, T897I and G1961E, in 2 more patients. No amino acid-altering variants were detected in VMD2, TIMP-3, and FIBL5 genes. The frequency of the CFH Y402H variant in this cohort corresponded to that detected in the general population. CONCLUSIONS: Screening of 6 candidate genes detected possibly disease-associated mutations in only 3/28 (10.7%) of patients presenting with PVMD/CD, eliminating these genes as causal for this phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 The screening revealed an I32V mutation in peripherin/RDS in one patient and 2 ABCA4 variants, T897I and G1961E, in 2 more patients. Login to comment
42 Thecompletescreeningofthe5candidategenesin28patients revealed the I32V mutation in peripherin /RDS in one patient and 2 ABCA4 variants, T897I and G1961E, in 2 more patients. Login to comment
47 The right eye (A) shows a partially resolved pseudo-vitelliform detachment with cuticular and soft drusen, while drusen-like deposits are seen in the left eye (B); patient #5 (C, D) with the ABCA4 G1961E mutation. Login to comment
52 Sex Age CHF genotype Other mutations VA OD VA OS Drusen type Hyper Hypo CNV GA Pseudo 1 F 81 CT 20/25 20/40 C, SI y y y 2 M 76 CT 20/80 20/20 C, SI y n y 3 F 49 CT 20/25 20/30 C n n n 4 F 72 CT RDS I32V 20/50 20/20 C n n y 5 M 54 TT ABCA4 G1961E 20/80 20/50 C, SI y n n 6 M 52 TT 20/150 20/20 C y y y 7 M 76 TT 20/80 20/100 C, R y y y 8 M 76 CT 10/400 20/100 C, SI y y n 9 F 60 CT 20/20 20/50 C, SI y y y 10 F 83 CC ABCA4 T897I 20/30 20/60 C, SI n n y 11 F 60 TT 20/30 20/30 C n n y 12 F 78 TT 20/30 20/80 C, SI y y y 13 F 40 CT 20/40 20/20 C, SI y y y 14 F 65 CT 20/30 20/80 C y y y 15 M 73 TT 20/30 20/40 C, SI y y y 16 F 49 CC 20/50 20/50 C, SI y y y 17 M 91 CC 20/200 20/30 C, SI y y y 18 F 79 CC 20/30 20/30 C n n y 19 M 41 CT 20/25 20/25 C n y n 20 F 64 CT CF 20/25 C, SI y y CNV y 21 F 58 TT 20/40 20/30 C n n n 22 F 61 CT 20/50 20/70 C, SI y y GA y 23 F 80 CT 20/20 20/40 C, SI y y n 24 F 79 CT 20/60 20/30 C, SI n y y 25 F 77 CT 20/80 20/40 C, SI y y y 26 F 46 CT 20/30 20/40 C, SI y y n 27 F 74 TT 20/40 20/80 C, SI n y y 28 M 73 CT 20/60 20/400 C n y y VA-visual acuity. Login to comment

[hide] Quantifying fixation in patients with Stargardt di... Vision Res. 2007 Jul;47(15):2076-85. Epub 2007 Jun 11. Reinhard J, Messias A, Dietz K, Mackeben M, Lakmann R, Scholl HP, Apfelstedt-Sylla E, Weber BH, Seeliger MW, Zrenner E, Trauzettel-Klosinski S
Quantifying fixation in patients with Stargardt disease.
Vision Res. 2007 Jul;47(15):2076-85. Epub 2007 Jun 11., [PMID:17562343]

Abstract [show]
Fixational eye movements in 60 eyes of 30 patients with ABCA4-associated Stargardt disease were recorded by a Scanning Laser Ophthalmoscope (SLO). The results were quantified by two new fixation quality measures expressing the eccentricity of the preferred retinal locus (PRL) non-parametrically, and fixation stability by a dynamic index. 46 eyes (77%) fixated eccentrically; in 32 eyes (70% of the eccentrically fixating eyes) the PRL was located above the central retinal lesion. PRL eccentricity correlated positively with logMAR visual acuity (r=.72; p<.0001) and negatively with fixation stability (r=-.58; p<.0001). Multiple PRL were found only in three eyes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
186 of PRL ABCA4 allel1 exon mut 1 ABCA4 allel2 exon mut 2 1 m 32 OD 2 0.4 0.0 90.0 211.0 1 48 L2241V n.f. OS 2 0.6 0.0 90.0 181.6 1 2 f 55 OD 29 0.1 9.7 60.3 9874.6 1 - - - - OS 29 0.1 6.8 67.5 68260.1 2 3 f 38 OD 16 0.05 6.4 73.7 4962.8 1 14 W663X 42 G1961E OS 7 0.4 0.0 90.9 143.5 1 4 m 23 OD 7 0.1 5.7 81.8 664.3 1 40 R1898H 43 G1975R OS 6 0.1 7.0 80.6 594.2 1 5 m 16 OD 7 0.05 7.4 81.0 1052.0 1 12+21 L541P+ 40 IVS40+5 OS 7 0.05 5.0 73.3 11500.0 1 A1038V G->A 6 m 34 OD 34 0.1 0.0 76.2 924.2 1 n.f. n.f. OS 34 0.1 0.0 74.3 1106.2 1 7 m 17 OD 11 0.1 3.1 79.1 3517.6 1 - - - - OS 11 0.1 3.6 70.0 2226.1 1 8 m 46 OD 14 0.5 3.6 80.6 3986.2 1 11 E471K 42 G1961E OS 14 0.2 3.7 58.3 40731.5 1 9 f 26 OD 15 0.1 6.0 70.5 3215.2 1 17 G863A n.f. OS 15 0.1 8.5 56.5 14734.9 1 10 f 19 OD 2 0.1 7.9 65.7 3260.0 1 3 P68L 36 S1689P OS 2 0.1 7.0 63.9 2964.8 1 11 f 34 OD 30 0.4 0.0 88.2 234.1 1 28 E1399K 42 G1961E OS 30 0.4 0.0 87.9 350.0 1 12 m 59 OD 5 0.1 5.2 79.2 1715.5 1 42 G1961E n.f. OS 5 0.1 4.4 75.0 3839.5 1 13 m 35 OD 20 0.05 9.7 72.9 8164.8 1 17 G863A 37 Q1750X OS 20 0.05 10.3 64.9 9820.4 1 14 m 43 OD 29 HM 16.0 58.5 18228.0 1 17 G863A 37 Q1750X OS 29 HM 15.6 42.1 14173.5 1 15 f 32 OD 10 0.05 6.5 61.3 10195.5 1 21 A1038V n.f. OS 10 0.05 5.0 56.7 7560.7 1 16 m 46 OD 4 0.05 8.5 51.1 8641.6 1 12+21 L541P+ 17 G863A OS 4 0.3 5.0 51.1 19827.1 1 A1038V 17 m 43 OD 3 0.5 0.0 90.7 190.9 1 - - - - OS 3 0.7 0.0 81.9 402.2 1 18 f 31 OD 27 1/15 9.8 69.3 2268.5 1 22 R1108C n.f. OS 27 0.1 17.2 60.9 4237.0 1 19 f 23 OD 5 0.05 6.0 72.9 3751.2 1 28 E1399K 43 G1977S OS 5 0.05 6.2 74.8 3578.9 1 20 f 16 OD 5 0.1 6.0 75.8 708.0 1 22 R1108C n.f. OS 5 0.1 5.4 82.4 449.6 1 21 m 38 OD 23 0.1 8.2 53.7 53733.8 2 - - - - OS 12 0.1 6.2 60.3 80873.8 2 22 m 40 OD 6 0.05 16.6 60.8 11677.8 1 14 R681X n.f. OS 6 0.1 10.0 60.6 5134.5 1 23 f 24 OD 3 0.1 6.7 90.5 577.8 1 6 G768T/ n.f. OS 3 0.1 7.1 83.6 3015.2 1 splice 24 m 13 OD 3 0.05 6.9 65.2 1882.7 1 - - - - OS 3 0.05 7.3 53.7 3844.3 1 25 f 39 OD 34 HM 7.0 54.3 24440.2 1 n.f. n.f. OS 34 1/60 10.6 77.6 1245.6 1 26 f 27 OD 2 0.2 0.0 91.8 127.4 1 17 G863A 28 Q1412X OS 2 0.6 0.0 94.9 69.2 1 27 m 25 OD 1 0.3 0.0 70.7 5670.4 1 n.f. n.f. OS 1 0.4 0.0 75.6 764.9 1 28 m 17 OD 3 0.2 0.8 67.3 4244.1 1 - - - - OS 3 0.3 0.0 80.6 2429.2 1 29 m 28 OD 2,5 0.1 5.4 80.8 795.0 1 - - - - OS 2,5 0.1 4.2 64.3 2101.1 1 30 f 27 OD 20 0.1 6.7 88.2 183.6 1 G1961E G1961E OS 20 0.1 10.9 81.0 448.2 1 Dis. dur., disease duration (years); HM, recognition of hand movements; VA, visual acuity in European decimals. Login to comment
183 of PRL ABCA4 allel1 exon mut 1 ABCA4 allel2 exon mut 2 1 m 32 OD 2 0.4 0.0 90.0 211.0 1 48 L2241V n.f. OS 2 0.6 0.0 90.0 181.6 1 2 f 55 OD 29 0.1 9.7 60.3 9874.6 1 - - - - OS 29 0.1 6.8 67.5 68260.1 2 3 f 38 OD 16 0.05 6.4 73.7 4962.8 1 14 W663X 42 G1961E OS 7 0.4 0.0 90.9 143.5 1 4 m 23 OD 7 0.1 5.7 81.8 664.3 1 40 R1898H 43 G1975R OS 6 0.1 7.0 80.6 594.2 1 5 m 16 OD 7 0.05 7.4 81.0 1052.0 1 12+21 L541P+ 40 IVS40+5 OS 7 0.05 5.0 73.3 11500.0 1 A1038V G->A 6 m 34 OD 34 0.1 0.0 76.2 924.2 1 n.f. n.f. OS 34 0.1 0.0 74.3 1106.2 1 7 m 17 OD 11 0.1 3.1 79.1 3517.6 1 - - - - OS 11 0.1 3.6 70.0 2226.1 1 8 m 46 OD 14 0.5 3.6 80.6 3986.2 1 11 E471K 42 G1961E OS 14 0.2 3.7 58.3 40731.5 1 9 f 26 OD 15 0.1 6.0 70.5 3215.2 1 17 G863A n.f. OS 15 0.1 8.5 56.5 14734.9 1 10 f 19 OD 2 0.1 7.9 65.7 3260.0 1 3 P68L 36 S1689P OS 2 0.1 7.0 63.9 2964.8 1 11 f 34 OD 30 0.4 0.0 88.2 234.1 1 28 E1399K 42 G1961E OS 30 0.4 0.0 87.9 350.0 1 12 m 59 OD 5 0.1 5.2 79.2 1715.5 1 42 G1961E n.f. OS 5 0.1 4.4 75.0 3839.5 1 13 m 35 OD 20 0.05 9.7 72.9 8164.8 1 17 G863A 37 Q1750X OS 20 0.05 10.3 64.9 9820.4 1 14 m 43 OD 29 HM 16.0 58.5 18228.0 1 17 G863A 37 Q1750X OS 29 HM 15.6 42.1 14173.5 1 15 f 32 OD 10 0.05 6.5 61.3 10195.5 1 21 A1038V n.f. OS 10 0.05 5.0 56.7 7560.7 1 16 m 46 OD 4 0.05 8.5 51.1 8641.6 1 12+21 L541P+ 17 G863A OS 4 0.3 5.0 51.1 19827.1 1 A1038V 17 m 43 OD 3 0.5 0.0 90.7 190.9 1 - - - - OS 3 0.7 0.0 81.9 402.2 1 18 f 31 OD 27 1/15 9.8 69.3 2268.5 1 22 R1108C n.f. OS 27 0.1 17.2 60.9 4237.0 1 19 f 23 OD 5 0.05 6.0 72.9 3751.2 1 28 E1399K 43 G1977S OS 5 0.05 6.2 74.8 3578.9 1 20 f 16 OD 5 0.1 6.0 75.8 708.0 1 22 R1108C n.f. OS 5 0.1 5.4 82.4 449.6 1 21 m 38 OD 23 0.1 8.2 53.7 53733.8 2 - - - - OS 12 0.1 6.2 60.3 80873.8 2 22 m 40 OD 6 0.05 16.6 60.8 11677.8 1 14 R681X n.f. OS 6 0.1 10.0 60.6 5134.5 1 23 f 24 OD 3 0.1 6.7 90.5 577.8 1 6 G768T/ n.f. OS 3 0.1 7.1 83.6 3015.2 1 splice 24 m 13 OD 3 0.05 6.9 65.2 1882.7 1 - - - - OS 3 0.05 7.3 53.7 3844.3 1 25 f 39 OD 34 HM 7.0 54.3 24440.2 1 n.f. n.f. OS 34 1/60 10.6 77.6 1245.6 1 26 f 27 OD 2 0.2 0.0 91.8 127.4 1 17 G863A 28 Q1412X OS 2 0.6 0.0 94.9 69.2 1 27 m 25 OD 1 0.3 0.0 70.7 5670.4 1 n.f. n.f. OS 1 0.4 0.0 75.6 764.9 1 28 m 17 OD 3 0.2 0.8 67.3 4244.1 1 - - - - OS 3 0.3 0.0 80.6 2429.2 1 29 m 28 OD 2,5 0.1 5.4 80.8 795.0 1 - - - - OS 2,5 0.1 4.2 64.3 2101.1 1 30 f 27 OD 20 0.1 6.7 88.2 183.6 1 G1961E G1961E OS 20 0.1 10.9 81.0 448.2 1 Dis. dur., disease duration (years); HM, recognition of hand movements; VA, visual acuity in European decimals. Login to comment

[hide] Macular pigment and lutein supplementation in ABCA... Invest Ophthalmol Vis Sci. 2007 Mar;48(3):1319-29. Aleman TS, Cideciyan AV, Windsor EA, Schwartz SB, Swider M, Chico JD, Sumaroka A, Pantelyat AY, Duncan KG, Gardner LM, Emmons JM, Steinberg JD, Stone EM, Jacobson SG
Macular pigment and lutein supplementation in ABCA4-associated retinal degenerations.
Invest Ophthalmol Vis Sci. 2007 Mar;48(3):1319-29., [PMID:17325179]

Abstract [show]
PURPOSE: To determine macular pigment (MP) optical density (OD) in patients with ABCA4-associated retinal degenerations (ABCA4-RD) and the response of MP and vision to supplementation with lutein. METHODS: Patients with Stargardt disease or cone-rod dystrophy and known or suspected disease-causing mutations in the ABCA4 gene were included. All patients had foveal fixation. MPOD profiles were measured with heterochromatic flicker photometry. Serum carotenoids, visual acuity, foveal sensitivity, and retinal thickness were quantified. Changes in MPOD and central vision were determined in a subset of patients receiving oral supplementation with lutein for 6 months. RESULTS: MPOD in patients ranged from normal to markedly abnormal. As a group, patients with ABCA4-RD had reduced foveal MPOD, and there was a strong correlation with retinal thickness. Average foveal tissue concentration of MP, estimated by dividing MPOD by retinal thickness, was normal in patients, whereas serum concentration of lutein and zeaxanthin was significantly lower than normal. After oral lutein supplementation for 6 months, 91% of the patients showed significant increases in serum lutein, and 63% of the patients' eyes showed a significant augmentation in MPOD. The retinal responders tended to be female and to have lower serum lutein and zeaxanthin, lower MPOD, and greater retinal thickness at baseline. Responding eyes had significantly lower baseline MP concentration than did nonresponding eyes. Central vision was unchanged after the period of supplementation. CONCLUSIONS: MP is strongly affected by the stage of ABCA4 disease leading to abnormal foveal architecture. MP could be augmented by supplemental lutein in some patients. There was no change in central vision after 6 months of lutein supplementation. Long-term influences of this supplement on the natural history of these macular degenerations require further study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Clinical and Molecular Characteristics of the Patients Patient Age (y)/Gender ABCA4 Mutation Visual Acuity* Refraction† Kinetic Visual Field Extent (V-4e)‡ Lutein Trial Participant?RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 -0.50 -0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 -1.00 -1.25 103 104 N 3 18/M ࿣ 20/20 20/125 -1.00 -1.00 126 105 N 4§ 19/F R1129L/L1940P 20/40 20/50 ϩ0.25 ϩ0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 -0.75 -0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 -1.25 -1.50 112 105 Y 7§ 26/M ࿣ 20/40 20/32 ϩ1.00 ϩ0.75 86 88 Y 8 30/F ࿣ 20/50 20/40 ϩ2.25 ϩ1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 -2.25 -3.50 99 93 Y 10 32/F V935A/IVS40ϩ5G3A 20/32 20/40 -0.75 -1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 -1.50 -1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 -3.00 -2.00 99 105 Y 13¶ 38/F V256V/G1961E 20/25 20/25 -1.00 -1.25 106 101 Y 14¶ 42/F V256V/G1961E 20/25 20/32 -0.50 -0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 ϩ0.75 ϩ0.25 108 103 N 16§ 49/M ࿣ 20/32 20/32 -4.50 -4.50 84 79 Y 17 56/M G1977S 20/25 20/25 -5.50 -5.50 99 109 N * Best corrected visual acuity. Login to comment
62 RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 afa;0.50 afa;0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 afa;1.00 afa;1.25 103 104 N 3 18/M $f3; 20/20 20/125 afa;1.00 afa;1.00 126 105 N 4&#a7; 19/F R1129L/L1940P 20/40 20/50 af9;0.25 af9;0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 afa;0.75 afa;0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 afa;1.25 afa;1.50 112 105 Y 7&#a7; 26/M $f3; 20/40 20/32 af9;1.00 af9;0.75 86 88 Y 8 30/F $f3; 20/50 20/40 af9;2.25 af9;1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 afa;2.25 afa;3.50 99 93 Y 10 32/F V935A/IVS40af9;5G3A 20/32 20/40 afa;0.75 afa;1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 afa;1.50 afa;1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 afa;3.00 afa;2.00 99 105 Y 13&#b6; 38/F V256V/G1961E 20/25 20/25 afa;1.00 afa;1.25 106 101 Y 14&#b6; 42/F V256V/G1961E 20/25 20/32 afa;0.50 afa;0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 af9;0.75 af9;0.25 108 103 N 16&#a7; 49/M $f3; 20/32 20/32 afa;4.50 afa;4.50 84 79 Y 17 56/M G1977S 20/25 20/25 afa;5.50 afa;5.50 99 109 N * Best corrected visual acuity. Login to comment

[hide] Spectrum of the ABCA4 gene mutations implicated in... Invest Ophthalmol Vis Sci. 2007 Mar;48(3):985-90. Valverde D, Riveiro-Alvarez R, Aguirre-Lamban J, Baiget M, Carballo M, Antinolo G, Millan JM, Garcia Sandoval B, Ayuso C
Spectrum of the ABCA4 gene mutations implicated in severe retinopathies in Spanish patients.
Invest Ophthalmol Vis Sci. 2007 Mar;48(3):985-90., [PMID:17325136]

Abstract [show]
PURPOSE: The purpose of this study is to describe the spectrum of mutations in the ABCA4 gene found in Spanish patients affected with several retinal dystrophies. METHODS: Sixty Spanish families with different retinal dystrophies were studied. Samples were analyzed for variants in all 50 exons of the ABCA4 gene by screening with the ABCR400 microarray, and results were confirmed by direct sequencing. Haplotype analyses were also performed. For those families with only one mutation detected by the microarray, denaturing (d)HPLC was performed to complete the mutational screening of the ABCA4 gene. RESULTS: The sequence analysis of the ABCA4 gene led to the identification of 33 (27.5%) potential disease-associated alleles among the 60 patients. These comprised 16 distinct sequence variants in 25 of the 60 subjects investigated. For autosomal recessive cone-rod dystrophy (arCRD), we found that 50% of the CRD families with the mutation had two recurrent changes (2888delG and R943Q). For retinitis pigmentosa (RP) and autosomal dominant macular dystrophy (adMD), one putative disease-associated allele was identified in 9 of the 27 and 3 of the 7 families, respectively. CONCLUSIONS: In the population studied, ABCA4 plays an important role in the pathogenesis of arCRD. However, mutations in this gene are less frequently identified in other retinal dystrophies, like RP or adMD, and therefore it is still not clear whether ABCA4 is involved as a modifying factor or the relationship is a fortuitous association.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 TABLE 1. Genetic Analyses of ABCA4 Mutations in Three Families with Autosomal Dominant Macular Dystrophy Family Allele 1 Allele 2 Haplotype AnalysisNucleotide Change Amino Acid Change Nucleotide Change Amino Acid Change ADDM-59 [5582G3A; 6764G3T] [G1961E; S22551] Excluded ADDM-92 466A3G I156V Not done ADDM-105 2828G3A R943Q Not done No change has been detected as allele 2. Login to comment
66 In family ADDM-59, a complex allele [G1961E; S2255I] was detected in the index patient, but not in her affected daughter, suggesting no cosegregation of the disease within the family. Login to comment
87 TABLE 3. Genetic Analyses of ABCA4 Changes in Nine Families with Autosomal Recessive RP Family Allele 1 Allele 2 Nucleotide Change Amino Acid Change Nucleotide Change Amino Acid Change SRP-716 6764G3T S2255I (likely nonpathogenic) c.858 ؉8T3G SRP-766 2300T3A V767D c.858 ؉8T3G SRP-775 466A3G I156V c.858 ؉8T3G SRP-818 6764G3T S2255I (likely nonpathogenic) SRP-834 c.5547ϩ5G3A Splice acceptor SRP-854 6764G3T S2255I B57 466A3G I156V B173 2828G3A R943Q G5466A L1821L B278 2701A3G T901A [G1961E; S2255I] did not support the pathologic role of this mutation in the family. Login to comment
55 TABLE 1. Genetic Analyses of ABCA4 Mutations in Three Families with Autosomal Dominant Macular Dystrophy Family Allele 1 Allele 2 Haplotype Analysis Nucleotide Change Amino Acid Change Nucleotide Change Amino Acid Change ADDM-59 [5582G3A; 6764G3T] [G1961E; S22551] Excluded ADDM-92 466A3G I156V Not done ADDM-105 2828G3A R943Q Not done No change has been detected as allele 2. Login to comment
65 In family ADDM-59, a complex allele [G1961E; S2255I] was detected in the index patient, but not in her affected daughter, suggesting no cosegregation of the disease within the family. Login to comment
85 TABLE 3. Genetic Analyses of ABCA4 Changes in Nine Families with Autosomal Recessive RP Family Allele 1 Allele 2 Nucleotide Change Amino Acid Change Nucleotide Change Amino Acid Change SRP-716 6764G3T S2255I (likely nonpathogenic) c.858 d19;8T3G SRP-766 2300T3A V767D c.858 d19;8T3G SRP-775 466A3G I156V c.858 d19;8T3G SRP-818 6764G3T S2255I (likely nonpathogenic) SRP-834 c.5547af9;5G3A Splice acceptor SRP-854 6764G3T S2255I B57 466A3G I156V B173 2828G3A R943Q G5466A L1821L B278 2701A3G T901A [G1961E; S2255I] did not support the pathologic role of this mutation in the family. Login to comment

[hide] Progressive cone and cone-rod dystrophies: phenoty... Surv Ophthalmol. 2006 May-Jun;51(3):232-58. Michaelides M, Hardcastle AJ, Hunt DM, Moore AT
Progressive cone and cone-rod dystrophies: phenotypes and underlying molecular genetic basis.
Surv Ophthalmol. 2006 May-Jun;51(3):232-58., [PMID:16644365]

Abstract [show]
The cone and cone-rod dystrophies form part of a heterogeneous group of retinal disorders that are an important cause of visual impairment in children and adults. There have been considerable advances made in recent years in our understanding of the pathogenesis of these retinal dystrophies, with many of the chromosomal loci and causative genes having now been identified. Mutations in 12 genes, including GUCA1A, peripherin/RDS, ABCA4 and RPGR, have been described to date; and in many cases detailed functional assessment of the effects of the encoded mutant proteins has been undertaken. This improved knowledge of disease mechanisms has raised the possibility of future treatments for these disorders, for which there are no specific therapies available at the present time.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
236 Of the four patients exhibiting minimal fundus pigmentary changes, two harbored a Leu1201Arg variant.45 The most common ABCA4 STGD variant, Gly1961Glu, was not observed in this cohort. Login to comment
245 It is currently believed that homozygous null mutations cause the most severe phenotype of autosomal recessive retinitis pigmentosa (RP), combinations of a null mutation with a moderate missense mutation result in autosomal recessive CORD, and combinations of null/mild missense or two moderate missense mutations cause STGD/FFM (Fundus Flavimaculatus).197 Assessment of functional activity of mutant ABCA4 transporter has been performed by Sun et al.190 For example, the missense mutations, Leu541Pro and Gly1961Glu, are associated with severely reduced but not abolished ATPase activity, whereas nonsense mutations would be predicted to have a more severe effect on protein function. Login to comment

[hide] ABCA4-associated retinal degenerations spare struc... Invest Ophthalmol Vis Sci. 2005 Dec;46(12):4739-46. Cideciyan AV, Swider M, Aleman TS, Sumaroka A, Schwartz SB, Roman MI, Milam AH, Bennett J, Stone EM, Jacobson SG
ABCA4-associated retinal degenerations spare structure and function of the human parapapillary retina.
Invest Ophthalmol Vis Sci. 2005 Dec;46(12):4739-46., [PMID:16303974]

Abstract [show]
PURPOSE: To study the parapapillary retinal region in patients with ABCA4-associated retinal degenerations. METHODS: Patients with Stargardt disease or cone-rod dystrophy and disease-causing variants in the ABCA4 gene were included. Fixation location was determined under fundus visualization, and central cone-mediated vision was measured. Intensity and texture abnormalities of autofluorescence (AF) images were quantified. Parapapillary retina of an eye donor with ungenotyped Stargardt disease was examined microscopically. RESULTS: AF images ranged from normal, to spatially homogenous abnormal increase of intensity, to a spatially heterogenous speckled pattern, to variably sized patches of low intensity. A parapapillary ring of normal-appearing AF was visible at all disease stages. Quantitative analysis of the intensity and texture properties of AF images showed the preserved region to be an annulus, at least 0.6 mm wide, surrounding the optic nerve head. A similar region of relatively preserved photoreceptor nuclei was apparent in the donor retina. In patients with foveal fixation, there was better cone sensitivity at a parapapillary locus in the nasal retina than at the same eccentricity in the temporal retina. In patients with eccentric fixation, approximately 30% had a preferred retinal locus in the parapapillary retina. CONCLUSIONS: Human retinal degenerations caused by ABCA4 mutations spare the structure of retina and RPE in a circular parapapillary region that commonly serves as the preferred fixation locus when central vision is lost. The retina between fovea and optic nerve head could serve as a convenient, accessible, and informative region for structural and functional studies to determine natural history or outcome of therapy in ABCA4-associated disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 16), a 23-year-old man with clinically diagnosed11 STGD phenotype I and a molecularly diagnosed G1961E mutation in the ABCA4 gene. He had best corrected visual acuities of 20/40 and 20/ 100 in the right and left eyes, respectively. Login to comment
60 16), a 23-year-old man with clinically diagnosed11 STGD phenotype I and a molecularly diagnosed G1961E mutation in the ABCA4 gene. Login to comment

[hide] Correlation of clinical and genetic findings in Hu... Invest Ophthalmol Vis Sci. 2005 Dec;46(12):4402-8. Hargitai J, Zernant J, Somfai GM, Vamos R, Farkas A, Salacz G, Allikmets R
Correlation of clinical and genetic findings in Hungarian patients with Stargardt disease.
Invest Ophthalmol Vis Sci. 2005 Dec;46(12):4402-8., [PMID:16303926]

Abstract [show]
PURPOSE: Autosomal recessive Stargardt disease (arSTGD) presents with substantial clinical and genetic heterogeneity. This study was conducted to correlate foveolar thickness (FT) and total macular volume (TMV), measured by optical coherence tomography (OCT), with other clinical characteristics and with specific genetic variation in Hungarian patients with arSTGD. METHODS: After a standard ophthalmic workup, both eyes of 35 patients with STGD from Hungary and of 25 age-matched healthy control subjects were tested with OCT. FT and TMV were measured automatically with the OCT mapping software in the nine Early Treatment Diabetic Retinopathy Study areas of 3500 microm in diameter. All patients were screened for mutations by a combination of the ABCR400 microarray and direct sequencing. RESULTS: The patients with STGD presented with markedly thinned retina in the foveola and decreased macular volume, 72 microm and 1.69 mm3, respectively, compared with 169 microm and 2.48 mm3 in the normal subjects, respectively. Statistically significant correlation was observed between visual acuity (VA) and TMV and between VA and FT. Disease-associated mutations were detected in 23 (65.7%) of 35 patients, including 48.5% with both alleles and 17.2% with one allele. The most frequent ABCA4 alleles in Hungarian patients with STGD were L541P/A1038V (in 28% of all patients), G1961E (20%) and IVS40+5G-->A (17%). Specific genotypes correlated with some phenotypic features and allowed for predictions of the disease progression. CONCLUSIONS: Hungarian patients with STGD presented with extensive foveolar thinning and macular volume loss. Genetic analysis detected several ABCA4 alleles at high frequency in the cohort of patients, suggesting founder effect(s). Unusually homogeneous distribution of disease-associated mutations aided genotype-phenotype correlation analyses in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 The most frequent ABCA4 alleles in Hungarian patients with STGD were L541P/A1038V (in 28% of all patients), G1961E (20%) and IVS40ϩ5G3A (17%). Login to comment
83 Other frequent alleles included the G1961E mutation (10%), the IVS40ϩ5G3A splice site variant (8.6%) and the 5917delG nonsense allele at 7%. Login to comment
89 Summarized Clinical and Genetic Data of Patients with STGD Patient Allele 1 Allele 2 Fishman OU Gender Age Duration VA OD VA OS FT OD (␮m) FT OS (␮m) MV OD (mm3 ) MV OS (mm3 ) 1 ND ND I M 18 10 0.42 0.50 90.00 76.00 1.70 1.67 2 L541P/A1038V ND III F 27 15 0.06 0.08 43.00 58.00 1.27 1.28 3 5917delG 5917delG II F 29 8 0.17 0.17 54.00 20.00 1.38 1.35 4 ND ND III F 42 14 0.10 0.10 91.00 71.00 1.60 1.59 5 V2050L ND II F 22 5 0.20 0.33 28.00 77.00 1.64 1.68 6 ND ND II F 17 2 1.00 0.71 156.00 141.00 2.55 2.6 7 IVS40ϩ5GϾA ND III M 28 13 0.10 0.06 71.00 92.00 1.61 1.61 8 L541P/A1038V G1961E II M 37 15 0.10 0.10 87.00 97.00 1.95 1.95 9 106delT G1961E II M 32 7 0.08 0.08 51.00 32.00 1.59 1.66 10 ND ND I F 55 17 0.25 0.56 160.00 170.00 1.72 1.82 11 L541P/A1038V G863A II F 15 3 0.25 0.33 67.00 68.00 1.78 1.76 12 IVS40ϩ5GϾA 5917delG III M 15 6 0.20 0.20 107.00 117.00 1.93 1.92 13 ND ND I M 27 2 0.38 0.33 56.00 86.00 2.01 1.97 14 G1886E G1961E II F 37 9 0.12 0.16 92.00 46.00 1.55 1.59 15 G1961E ND III F 20 5 0.30 0.20 49.00 34.00 1.43 1.53 16 ND ND II M 28 14 0.32 0.08 52.00 60.00 1.46 1.52 17 IVS40ϩ5GϾA 5917delG III M 27 5 0.10 0.10 97.00 92.00 1.76 1.71 18 L541P/A1038V D1532N III M 28 12 0.25 0.10 49.00 46.00 1.83 1.86 19 ND ND II F 31 11 0.10 0.13 67.00 72.00 1.55 1.49 20 L541P L541P/A1038V II F 15 5 0.10 0.10 28.00 34.00 1.63 1.65 21 L541P/A1038V G863A II F 25 2 0.20 0.62 94.00 81.00 1.92 1.94 22 L541P/A1038V ND II M 18 9 0.08 0.10 63.00 72.00 1.40 1.43 23 G1961E ND III F 34 9 0.16 0.16 16.00 23.00 1.31 1.56 24 ND ND II F 52 14 0.16 0.16 122.00 113.00 1.90 1.99 25 P68L L541P/A1038V III M 37 22 0.10 0.12 40.00 40.00 1.41 1.42 26 ND ND II F 18 11 0.20 0.25 59.00 72.00 1.42 1.47 27 L541P/A1038V G1961E II F 24 7 0.18 0.18 83.00 100.00 1.72 1.77 28 IVS40ϩ5GϾA 5917delG III M 15 7 0.10 0.16 38.00 46.00 1.30 1.41 29 R1108C R1108C II M 31 14 0.10 0.10 41.00 44.00 1.95 1.96 30 G1961E ND II M 28 6 0.33 0.56 91.00 129.00 1.98 2.04 31 ND ND II F 28 11 0.08 0.10 55.00 63.00 1.52 1.59 32 L541P/A1038V G863A II M 32 15 0.20 0.20 92.00 86.00 1.80 1.75 33 ND ND II F 27 4 0.25 0.20 66.00 75.00 1.72 1.76 34 ND ND II F 36 8 0.12 0.10 58.00 69.00 1.59 1.56 35 IVS40ϩ5GϾA IVS40ϩ5GϾA III F 19 6 0.10 0.10 62.00 53.00 1.67 1.65 Fishman OU, classification of patients by fundus photos in three categories according to Fishman et al.25 ND, not determined. Login to comment
97 In patients compound heterozygous for the L541P/ A1038V and G863A alleles (patients 11, 21, 32), a decrease in vision with the duration of the disease was observed. Login to comment
98 Subjects compound heterozygous for the G1961E mutation (n ϭ 7) were classified into phenotype groups II and III based on their fundus appearance. Login to comment
99 This result does not agree with previous studies20,25 in which patients with the G1961E allele mainly presented with the Fishman I fundi. Login to comment
131 First, patients with the G1961E mutation, although classified in phenotype groups II and III, show the slowest progression of the TMV loss. Login to comment
132 Therefore, patients with STGD with the G1961E variant have, in general, a better than average disease prognosis. Login to comment
133 This observation is supported by two earlier re- ports20,25 and could be explained by the fact that although the G1961E variant had a drastic effect on ATPase activity, it was comparable to the wild-type protein in yield.8 Second, patients with the L541P/A1038V complex allele have, near the average in all patients with STGD, a moderate rate of disease progression. Login to comment
81 Other frequent alleles included the G1961E mutation (10%), the IVS40af9;5G3A splice site variant (8.6%) and the 5917delG nonsense allele at 7%. Login to comment
87 Summarized Clinical and Genetic Data of Patients with STGD Patient Allele 1 Allele 2 Fishman OU Gender Age Duration VA OD VA OS FT OD (òe;m) FT OS (òe;m) MV OD (mm3 ) MV OS (mm3 ) 1 ND ND I M 18 10 0.42 0.50 90.00 76.00 1.70 1.67 2 L541P/A1038V ND III F 27 15 0.06 0.08 43.00 58.00 1.27 1.28 3 5917delG 5917delG II F 29 8 0.17 0.17 54.00 20.00 1.38 1.35 4 ND ND III F 42 14 0.10 0.10 91.00 71.00 1.60 1.59 5 V2050L ND II F 22 5 0.20 0.33 28.00 77.00 1.64 1.68 6 ND ND II F 17 2 1.00 0.71 156.00 141.00 2.55 2.6 7 IVS40af9;5Gb0e;A ND III M 28 13 0.10 0.06 71.00 92.00 1.61 1.61 8 L541P/A1038V G1961E II M 37 15 0.10 0.10 87.00 97.00 1.95 1.95 9 106delT G1961E II M 32 7 0.08 0.08 51.00 32.00 1.59 1.66 10 ND ND I F 55 17 0.25 0.56 160.00 170.00 1.72 1.82 11 L541P/A1038V G863A II F 15 3 0.25 0.33 67.00 68.00 1.78 1.76 12 IVS40af9;5Gb0e;A 5917delG III M 15 6 0.20 0.20 107.00 117.00 1.93 1.92 13 ND ND I M 27 2 0.38 0.33 56.00 86.00 2.01 1.97 14 G1886E G1961E II F 37 9 0.12 0.16 92.00 46.00 1.55 1.59 15 G1961E ND III F 20 5 0.30 0.20 49.00 34.00 1.43 1.53 16 ND ND II M 28 14 0.32 0.08 52.00 60.00 1.46 1.52 17 IVS40af9;5Gb0e;A 5917delG III M 27 5 0.10 0.10 97.00 92.00 1.76 1.71 18 L541P/A1038V D1532N III M 28 12 0.25 0.10 49.00 46.00 1.83 1.86 19 ND ND II F 31 11 0.10 0.13 67.00 72.00 1.55 1.49 20 L541P L541P/A1038V II F 15 5 0.10 0.10 28.00 34.00 1.63 1.65 21 L541P/A1038V G863A II F 25 2 0.20 0.62 94.00 81.00 1.92 1.94 22 L541P/A1038V ND II M 18 9 0.08 0.10 63.00 72.00 1.40 1.43 23 G1961E ND III F 34 9 0.16 0.16 16.00 23.00 1.31 1.56 24 ND ND II F 52 14 0.16 0.16 122.00 113.00 1.90 1.99 25 P68L L541P/A1038V III M 37 22 0.10 0.12 40.00 40.00 1.41 1.42 26 ND ND II F 18 11 0.20 0.25 59.00 72.00 1.42 1.47 27 L541P/A1038V G1961E II F 24 7 0.18 0.18 83.00 100.00 1.72 1.77 28 IVS40af9;5Gb0e;A 5917delG III M 15 7 0.10 0.16 38.00 46.00 1.30 1.41 29 R1108C R1108C II M 31 14 0.10 0.10 41.00 44.00 1.95 1.96 30 G1961E ND II M 28 6 0.33 0.56 91.00 129.00 1.98 2.04 31 ND ND II F 28 11 0.08 0.10 55.00 63.00 1.52 1.59 32 L541P/A1038V G863A II M 32 15 0.20 0.20 92.00 86.00 1.80 1.75 33 ND ND II F 27 4 0.25 0.20 66.00 75.00 1.72 1.76 34 ND ND II F 36 8 0.12 0.10 58.00 69.00 1.59 1.56 35 IVS40af9;5Gb0e;A IVS40af9;5Gb0e;A III F 19 6 0.10 0.10 62.00 53.00 1.67 1.65 Fishman OU, classification of patients by fundus photos in three categories according to Fishman et al.25 ND, not determined. Login to comment
96 Subjects compound heterozygous for the G1961E mutation (n afd; 7) were classified into phenotype groups II and III based on their fundus appearance. Login to comment
129 First, patients with the G1961E mutation, although classified in phenotype groups II and III, show the slowest progression of the TMV loss. Login to comment
130 Therefore, patients with STGD with the G1961E variant have, in general, a better than average disease prognosis. Login to comment

[hide] ABCA4 mutations causing mislocalization are found ... Hum Mol Genet. 2005 Oct 1;14(19):2769-78. Epub 2005 Aug 15. Wiszniewski W, Zaremba CM, Yatsenko AN, Jamrich M, Wensel TG, Lewis RA, Lupski JR
ABCA4 mutations causing mislocalization are found frequently in patients with severe retinal dystrophies.
Hum Mol Genet. 2005 Oct 1;14(19):2769-78. Epub 2005 Aug 15., [PMID:16103129]

Abstract [show]
ABCA4, also called ABCR, is a retinal-specific member of the ATP-binding cassette (ABC) family that functions in photoreceptor outer segments as a flipase of all-trans retinal. Homozygous and compound heterozygous ABCA4 mutations are associated with various autosomal recessive retinal dystrophies, whereas heterozygous ABCA4 mutations have been associated with dominant susceptibility to age-related macular degeneration in both humans and mice. We analyzed a cohort of 29 arRP families for the mutations in ABCA4 with a commercial microarray, ABCR-400 in addition to direct sequencing and segregation analysis, and identified both mutant alleles in two families (7%): compound heterozygosity for missense (R602W) and nonsense (R408X) alleles and homozygosity for a complex [L541P; A1038V] allele. The missense mutations were analyzed functionally in the photoreceptors of Xenopus laevis tadpoles, which revealed mislocalization of ABCA4 protein. These mutations cause retention of ABCA4 in the photoreceptor inner segment, likely by impairing correct folding, resulting in the total absence of physiologic protein function. Patients with different retinal dystrophies harboring two misfolding alleles exhibit early age-of-onset (AO) (5-12 years) of retinal disease. Our data suggest that a class of ABCA4 mutants may be an important determinant of the AO of disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 arRP patients from five families (AR168, AR192, AR194, AR554 and AR591) were heterozygous for various missense ABCA4 mutations that by conceptual translation would lead to either an amino acid change (G1961E, V2050L and D2177 N) or splicing alteration (36IVSþ1G . Login to comment
44 A WT 168-05 24 20/25 OD; 20/30 OS;VF , 308 OU RP N/A N/A 168-06 26 N/A RP N/A N/A AR192 192-03 9 20/20 OD; 20/25 OS;VF , 58 OU RP D2177N WT 192-04 19 20/30 OD; 20/40 OS;VF , 58 OU RP WT WT 192-05 19 20/30 OD; 20/40 OS;VF , 58 OU RP WT WT AR194 194-03 30 N/A RP D2177N WT 194-05 Childhood 20/25 OD; 20/40 OS RP N/A N/A 194-06 5 N/A RP D2177N WT 194-07 4 or 5 20/80 OU RP N/A N/A AR197 197-05 7 CF 3 feet OD; CF 2 feet OS RP [L541P; A1038V] [L541P; A1038V] 197-06 9 CF 5 feet OD; HM OS RP [L541P; A1038V] [L541P; A1038V] AR554 554-03 2 10/12 20/60 OU RP V2050L WT 554-04 1 9/12 N/A RP N/A N/A AR591 591-03 20 20/25 OU RP N/A N/A 591-04 8 20/20 OD; 20/25 OS;VF , 108 OU RP G1961E WT AR689 689-03 7 N/A RP R408X R602W 689-08 7 N/A RP N/A N/A OD, right eye; OS, left eye; OU, both eyes; VF, visual field; RP, retinitis pigementosa, WT, wild type; N/A, not available; CF, counting fingers; HM, hand motions. Login to comment
131 In subjects from five RP families (9% of disease alleles), we found heterozygous missense ABCA4 mutations (G1961E, V2050L, D2177 N and 36IVSþ1) that are suggested to have functional consequences for ABCA4 activity (29,36). Login to comment
146 Genotype-phenotype correlations among patients bearing one and two mislocalization-mutations Two mislocalization-alleles One mislocalization-allele RP STGD Allele 1 Allele 2 AO Allele 1 Allele 2 AO [L541P; A1038V] [L541P; A1038V] 7 [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 9 [L541P; A1038V] R1108H 13 [L541P; A1038V] G1961E 16 CRD [L541P; A1038V] G1961E 28 Allele 1 Allele 2 AO [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 10 [L541P; A1038V] L2027F 12 [L541P; A1038V] C1490Y 12 [L541P; A1038V] P1380L 5 R602W R602W 7 [L541P; A1038V] T1019M 6 [L541P; A1038V] G1961E 7 STGD [L541P; A1038V] T1019M 6 Allele 1 Allele 2 AO R602W L2027F 9 [L541P; A1038V] [L541P; A1038V] 12 C1490Y G1961E 28 C1490Y C1490Y 7 C1490Y G1961E 13 C1490Y R602W 9 C1490Y L2027F 10 C1490Y R602W 10 C1490Y L2027F 18 C1490 L2027F 18 AO-age of onset (in years). Login to comment

[hide] The spectrum of retinal phenotypes caused by mutat... Graefes Arch Clin Exp Ophthalmol. 2005 Feb;243(2):90-100. Epub 2004 Dec 22. Klevering BJ, Deutman AF, Maugeri A, Cremers FP, Hoyng CB
The spectrum of retinal phenotypes caused by mutations in the ABCA4 gene.
Graefes Arch Clin Exp Ophthalmol. 2005 Feb;243(2):90-100. Epub 2004 Dec 22., [PMID:15614537]

Abstract [show]
BACKGROUND: The majority of studies on the retina-specific ATP-binding cassette transporter (ABCA4) gene have focussed on molecular genetic analysis; comparatively few studies have described the clinical aspects of ABCA4-associated retinal disorders. In this study, we demonstrate the spectrum of retinal dystrophies associated with ABCA4 gene mutations. METHODS: Nine well-documented patients representing distinct phenotypes in the continuum of ABCA4-related disorders were selected. All patients received an extensive ophthalmologic evaluation, including kinetic perimetry, fluorescein angiography, and electroretinography (ERG). Mutation analysis had been performed previously with the genotyping microarray (ABCR400 chip) and/or single-strand conformation polymorphism analysis in combination with direct DNA sequencing. RESULTS: In all patients, at least one pathologic ABCA4 mutation was identified. Patient 10034 represented the mild end of the phenotypic spectrum, demonstrating exudative age-related macular degeneration (AMD). Patient 24481 received the diagnosis of late-onset fundus flavimaculatus (FFM), patient 15168 demonstrated the typical FFM phenotype, and patient 19504 had autosomal recessive Stargardt disease (STGD1). Patients 11302 and 7608 exhibited progression from FFM/STGD1 to cone-rod dystrophy (CRD). A more typical CRD phenotype was found in patients 15680 and 12608. Finally, the most severe ABCA4-associated phenotype was retinitis pigmentosa (RP) in patient 11366. This phenotype was characterised by extensive atrophy with almost complete loss of peripheral and central retinal functions. CONCLUSION: We describe nine patients during different stages of disease progression; together, these patients form a continuum of ABCA4-associated phenotypes. Besides characteristic disorders such as FFM/STGD1, CRD and RP, intermediate phenotypes may be encountered. Moreover, as the disease progresses, marked differences may be observed between initially comparable phenotypes. In contrast, distinctly different phenotypes may converge to a similar final stage, characterised by extensive chorioretinal atrophy and very low visual functions. The identified ABCA4 mutations in most, but not all, patients were compatible with the resulting phenotypes, as predicted by the genotype-phenotype model for ABCA4-associated disorders. With the advent of therapeutic options, recognition by the general ophthalmologist of the various retinal phenotypes associated with ABCA4 mutations is becoming increasingly important.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Ophthalmoscopy revealed widespread pisciform yellow flecks Table 2 Results of the ABCA4 mutation analysis Case Patient ID ABCA4 mutations Allele 1 Allele 2 1 10034 G1961E 2 24481 768G→T 3 15168 G683A/ΔG863;R943Q 768G→T 4 19504 G683A/ΔG863;R943Q IVS40+5G→A 5 11302 768G→T 6 7608 G683A/ΔG863;R943Q 768G→T 7 15680 G1961E 8 12608 IVS38-10T→C IVS38-10T→C 9 11366 768G→T 768G→T characteristic for fundus flavimaculatus. Login to comment
121 The first visual field in Table 3 Functional implications of missense and splice site mutations Mutation Type of mutation Predicted effect on ABCR function 768G→T Splice site No protein [34] G683A/ΔG863 Missense Decreased ATPase activity [54, 57] R943Q Missense Decreased ATPase activity [54] IVS38-10T→C Splice site Variant in linkage disequilibrium with unknown mutation [39] IVS40+5G→A Splice site Some residual ABCR function [39] G1961E Missense Decreased ATP binding and ATPase activity [57] Fig. 1 Fundus photographs of the patients in this study. Login to comment
155 Case 1 (patient 10034), displaying the combination of AMD and a heterozygous G1961E mutation, is an exception in the sense that a causal relation may be disputed. Login to comment
156 The assumption that certain heterozygous ABCA4 mutations are associated with AMD is primarily founded on the observation that a three- to fivefold elevated risk of AMD exists for carriers of the D2177N and G1961E variants [2-4]. Login to comment
210 Patient 10034 (case 1), with AMD, carries the G1961E variant; the heterozygous presence of this ABCA4 sequence variation has previously been associated with AMD [2]. Login to comment
79 Ophthalmoscopy revealed widespread pisciform yellow flecks Table 2 Results of the ABCA4 mutation analysis Case Patient ID ABCA4 mutations Allele 1 Allele 2 1 10034 G1961E 2 24481 768G࢐T 3 15168 G683A/ƊG863;R943Q 768G࢐T 4 19504 G683A/ƊG863;R943Q IVS40+5G࢐A 5 11302 768G࢐T 6 7608 G683A/ƊG863;R943Q 768G࢐T 7 15680 G1961E 8 12608 IVS38-10T࢐C IVS38-10T࢐C 9 11366 768G࢐T 768G࢐T characteristic for fundus flavimaculatus. Login to comment
122 The first visual field in Table 3 Functional implications of missense and splice site mutations Mutation Type of mutation Predicted effect on ABCR function 768G࢐T Splice site No protein [34] G683A/ƊG863 Missense Decreased ATPase activity [54, 57] R943Q Missense Decreased ATPase activity [54] IVS38-10T࢐C Splice site Variant in linkage disequilibrium with unknown mutation [39] IVS40+5G࢐A Splice site Some residual ABCR function [39] G1961E Missense Decreased ATP binding and ATPase activity [57] Fig. 1 Fundus photographs of the patients in this study. Login to comment
157 The assumption that certain heterozygous ABCA4 mutations are associated with AMD is primarily founded on the observation that a threeto fivefold elevated risk of AMD exists for carriers of the D2177N and G1961E variants [2-4]. Login to comment
211 Patient 10034 (case 1), with AMD, carries the G1961E variant; the heterozygous presence of this ABCA4 sequence variation has previously been associated with AMD [2]. Login to comment

[hide] Evolution of ABCA4 proteins in vertebrates. J Mol Evol. 2005 Jan;60(1):72-80. Yatsenko AN, Wiszniewski W, Zaremba CM, Jamrich M, Lupski JR
Evolution of ABCA4 proteins in vertebrates.
J Mol Evol. 2005 Jan;60(1):72-80., [PMID:15696369]

Abstract [show]
The ABCA4 (ABCR) gene encodes a retinal-specific ATP-binding cassette transporter. Mutations in ABCA4 are responsible for several recessive macular dystrophies and susceptibility to age related macular degeneration (AMD). The protein appears to function as a flippase of all-trans-retinaldehyde and/or its derivatives across the membrane of outer segment disks and is a potentially important element in recycling visual cycle metabolites. However, the understanding of ABCA4's role in the visual cycle is limited due to the lack of a direct functional assay. An evolutionary analysis of ABCA4 may aid in the identification of conserved elements, the preservation of which implies functional importance. To date, only human, murine, and bovine ABCA4 genes are described. We have identified ABCA4 genes from African (Xenopus laevis) and Western (Silurana tropicalis) clawed frogs. A comparative analysis describing the evolutionary relationships between the frog ABCA4s, annotated T. rubripes ABCA4, and mammalian ABCA4 proteins was carried out. Several segments are conserved in both intradiscal loop (IL) domains, in addition to the transmembrane and ATP-binding domains. Nonconserved segments were found in the IL and cytoplasmic linker domains. Maximum likelihood analyses of the aligned sequences strongly suggest that ABCA4 was subject to purifying selection. Collectively, these data corroborate the current evolutionary model where two distinct ABCA half-transporter progenitors were combined to form a full ABCA4 progenitor in ancestral chordates. We speculate that evolutionary alterations may increase the retinoid metabolite recycling capacity of ABCA4 and may improve dark adaptation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
130 As anticipated, the most frequently occurring STGD- associated missense ABCA4 alterations (R212C, L541P, D645N, G863A, A1038V, R1108C, R1380L, W1408R, T1526M, R1640W, G1961E, L2027F, and L2030Q) map to highly conserved regions. Login to comment

[hide] Microarray-based mutation analysis of the ABCA4 (A... Eur J Hum Genet. 2004 Dec;12(12):1024-32. Klevering BJ, Yzer S, Rohrschneider K, Zonneveld M, Allikmets R, van den Born LI, Maugeri A, Hoyng CB, Cremers FP
Microarray-based mutation analysis of the ABCA4 (ABCR) gene in autosomal recessive cone-rod dystrophy and retinitis pigmentosa.
Eur J Hum Genet. 2004 Dec;12(12):1024-32., [PMID:15494742]

Abstract [show]
Mutations in the ABCA4 gene have been associated with autosomal recessive Stargardt disease (STGD1), cone-rod dystrophy (CRD), and retinitis pigmentosa (RP). We employed a recently developed genotyping microarray, the ABCR400-chip, to search for known ABCA4 mutations in patients with isolated or autosomal recessive CRD (54 cases) or RP (90 cases). We performed detailed ophthalmologic examinations and identified at least one ABCA4 mutation in 18 patients (33%) with CRD and in five patients (5.6%) with RP. Single-strand conformation polymorphism (SSCP) analysis and subsequent DNA sequencing revealed four novel missense mutations (R24C, E161K, P597S, G618E) and a novel 1-bp deletion (5888delG). Ophthalmoscopic abnormalities in CRD patients ranged from minor granular pigmentary changes in the posterior pole to widespread atrophy. In 12 patients with recordable electroretinogram (ERG) tracings, a cone-rod pattern was detected. Three patients demonstrated progression from a retinal dystrophy resembling STGD1 to a more widespread degeneration, and were subsequently diagnosed as CRD. In addition to a variable degree of atrophy, all RP patients displayed ophthalmologic characteristics of classic RP. When detectable, ERG recordings in these patients demonstrated rod-cone patterns of photoreceptor degeneration. In conclusion, in this study, we show that the ABCA4 mutation chip is an efficient first screening tool for arCRD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 15680 Isolated 5882G4A G1961E Not identified NA 15730 Isolated 2588G4C; 2828G4A DG863/G863A; R943Q 2588G4C; 2828G4A DG863/G863A; R943Q ? Login to comment
143 Given this clinical presentation and the fact that homozygous null mutations were not found Table 5 Functional assessment of missense (A) and splice site (B) mutations (A) Missense mutation Nature of amino-acid change Effect on ABCR functionRef R18W Nonconservative Unknown R24C Nonconservative Unknown; adjacent to first transmembrane domain G65E Nonconservative Unknown E161K Nonconservative Unknown L541P Conservative Decreased ATP binding and ATPase activity50 P597S Nonconservative Unknown G618E Nonconservative Unknown V767D Nonconservative Decreased ABCR expression10 G863A Nonconservative Decreased ATPase activity50, 51 R943Q Nonconservative Decreased ATPase activity51 A1038V Conservative Decreased ATP binding and ATPase activity50 E1087K Nonconservative Decreased ATP binding50 V1433I Conservative Unknown R1640W Nonconservative Unknown A1794D Nonconservative Introduction charged aa in 10th transmembrane domain G1961E Nonconservative Decreased ATP binding and ATPase activity 50 V2050L Conservative Unknown D2177N Nonconservative Increased ATPase activity50 (B) Splice site mutation Effect on mRNARef Predicted effect on ABCR protein 768G4T Nonsense-mediated decay33 No protein IVS36+2T4C Unknown Truncation of exon 36 resulting in V1673fs? Login to comment

[hide] Electroretinographic findings in patients with Sta... Retina. 2004 Dec;24(6):920-8. Oh KT, Weleber RG, Stone EM, Oh DM, Rosenow J, Billingslea AM
Electroretinographic findings in patients with Stargardt disease and fundus flavimaculatus.
Retina. 2004 Dec;24(6):920-8., [PMID:15579991]

Abstract [show]
PURPOSE: To characterize the clinical and electroretinogram (ERG) features of our cohort of patients with Stargardt disease (STGD) exhibiting coding sequence variations in the ABCA4 gene. METHODS: Review of 76 patients with the clinical diagnosis of Stargardt disease/fundus flavimaculatus (STGD/FF) from the University of Iowa Department of Ophthalmology and Visual Sciences (41 patients) and the Casey Eye Institute (35 patients). Clinical examination, Goldmann perimetry, and electroretinography were performed on all 76 patients. Patients were divided into three groups on the basis of their funduscopic and electroretinographic features: (1) a normal ERG by the standards of the laboratory; (2) minimal rod or cone abnormalities; (3) severe ERG dysfunction. The latter category was further subdivided on the basis of a cone-dominated loss of function (C > R or "cone-rod dystrophy") or diffuse depression of rods and cones (C = R). Mutational analysis of the coding sequence of the ABCA4 gene was performed by single strand conformation polymorphism analysis followed by automated DNA sequencing. Each electroretinographic group was analyzed for the presence of disease causing changes using exact tests of binomial proportions corrected for multiple comparisons by Bonferroni method. Quantitative polymerase chain reaction (QPCR) was performed on patients who were homozygous for disease causing changes in the ABCA4 gene to rule out the possibility of deletions. RESULTS: Overall, 56 of 76 patients (and 77 of 152 alleles) exhibited coding sequence variations that were compatible with high-penetrance disease-causing mutations. The most common of these were His423Arg (9), frameshift mutations (7), Ala1038Val (7), and Pro1380Leu (6). Although no patients with His423Arg presented with normal ERGs, no significant correlation was observed between specific sequence variations and the electroretinographic characteristics or fundus appearance. However, a significantly greater fraction of patients with normal ERG studies failed to exhibit detectable disease-causing coding sequence variations in the ABCA4 gene identified on either allele (P = 0.0006). CONCLUSION: STGD/FF patients in our cohort exhibit a wide range of electroretinographic abnormalities, some of which are more prevalent than previously suspected. No direct correlation between clinical appearance, electrophysiologic characteristics and specific ABCA4 alleles could be identified, although a significantly lower number of our cohort with a normal ERG exhibited detectable coding sequence variations in the ABCA4 gene. However, four patients with ERG dysfunction were homozygous for a His423Arg change proven by QPCR not to be an artifact of a deletion. The presence of electrophysiologic dysfunction is not uncommon in our cohort of patients with STGD. Thus, the ERG provides clinically important information of retinal function for STGD/FF and, as such, is still indicated as part of the evaluation of these patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
170 The common Gly1961Glu sequence variation was notably absent from patients with severe ERG findings but was present in two patients with normal ERGs and one patient with mild ERG derangements, suggesting that this is either a marker polymorphism for a heretofore unidentified mutation or itself a mild disease-causing allele.34 However, His423Arg was only seen in patients with electrophysiologic derangements, suggesting that it may have a marked effect on gene function or lead to greater loss of photoreceptor function. Login to comment

[hide] Denaturing HPLC profiling of the ABCA4 gene for re... Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10. Stenirri S, Fermo I, Battistella S, Galbiati S, Soriani N, Paroni R, Manitto MP, Martina E, Brancato R, Allikmets R, Ferrari M, Cremonesi L
Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations.
Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10., [PMID:15192030]

Abstract [show]
BACKGROUND: Mutations in the retina-specific ABC transporter (ABCA4) gene have been associated with several forms of macular degenerations. Because the high complexity of the molecular genotype makes scanning of the ABCA4 gene cumbersome, we describe here the first use of denaturing HPLC (DHPLC) to screen for ABCA4 mutations. METHODS: Temperature conditions were designed for all 50 exons based on effective separation of 83 samples carrying 86 sequence variations and 19 mutagenized controls. For validation, samples from 23 previously characterized Stargardt patients were subjected to DHPLC profiling. Subsequently, samples from a cohort of 30 patients affected by various forms of macular degeneration were subjected to DHPLC scanning under the same conditions. RESULTS: DHPLC profiling not only identified all 132 sequence alterations previously detected by double-gradient denaturing gradient gel electrophoresis but also identified 5 sequence alterations that this approach had missed. Moreover, DHPLC scanning of an additional panel of 30 previously untested patients led to the identification of 26 different mutations and 29 polymorphisms, accounting for 203 sequence variations on 29 of the 30 patients screened. In total, the DHPLC approach allowed us to identify 16 mutations that had never been reported before. CONCLUSIONS: These results provide strong support for the use of DHPLC for molecular characterization of the ABCA4 gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment
34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment

[hide] Dark adaptation of rod photoreceptors in normal su... Invest Ophthalmol Vis Sci. 2004 Jul;45(7):2447-56. Kang Derwent JJ, Derlacki DJ, Hetling JR, Fishman GA, Birch DG, Grover S, Stone EM, Pepperberg DR
Dark adaptation of rod photoreceptors in normal subjects, and in patients with Stargardt disease and an ABCA4 mutation.
Invest Ophthalmol Vis Sci. 2004 Jul;45(7):2447-56., [PMID:15223829]

Abstract [show]
PURPOSE: Psychophysical and electroretinographic (ERG) studies indicate that patients with Stargardt disease exhibit abnormally slow rod dark adaptation after illumination that bleaches a substantial fraction of rhodopsin. However, relatively little information is available concerning rod recovery in this disease after weaker adapting (i.e., conditioning) light. With the use of a paired-flash ERG method, properties of the derived rod response to a low-bleach (<1%) but rod-saturating conditioning flash were investigated in seven normal subjects and in five Stargardt patients with identified sequence variations in the ABCA4 gene. METHODS: In the first of two experiments, the interval between a fixed conditioning flash (67 or 670 scotopic cd s m(-2)) and a bright probe flash of fixed strength was varied to determine the falling-phase kinetics of the derived rod response to the conditioning flash. In the second, the instantaneous amplitude-intensity function for the rod response at an intermediate stage of recovery from the conditioning flash was determined by presenting a test flash of various strengths at a fixed time after the conditioning flash, and a probe flash at 200 ms after the test flash. RESULTS: The maximum peak amplitude of the dark-adapted, rod-mediated a-wave determined in Stargardt patients (211 +/- 87 microV) was on average lower than that determined in normal subjects (325 +/- 91 microV; P = 0.06). The derived rod response to the 670 scotopic cd s m(-2) conditioning flash determined in normal subjects and Stargardt patients exhibited a biphasic recovery, and the kinetics of the early stage of this recovery were similar in the two subject groups. For both normal subjects and patients, normalized amplitude-intensity functions describing the dark-adapted derived rod response exhibited half-saturation at approximately 1.5 log scotopic troland second. In both groups, the normalized amplitude-intensity function determined at approximately 2 seconds after the 67 scotopic cd s m(-2) conditioning flash and at approximately 9 seconds after the 670 scotopic cd s m(-2) conditioning flash exhibited an average desensitization (i.e., an increase of test flash strength at half-saturation) of approximately 0.5 to 0.6 log unit relative to that determined under dark-adapted conditions. CONCLUSIONS: The results indicate that, despite a reduction in the average dark-adapted maximum a-wave amplitude in the Stargardt/ABCA4 patients, the early-stage recovery kinetics of the derived rod response to a low-bleaching conditioning flash as well as the lingering rod desensitization produced by such a flash are similar to those determined in normal subjects.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Description of Subjects Subject Number Age* Sex ABCA4 Variation Dark-Adapted Maximum Peak a-Wave Amplitude (␮V)† Normal subjects 101 55 M - -243 102 37 F - -410 103 26 M - -188 104 23 F - -397 105 56 F - -268 111 29 F - -362 112 23 M - -410 -325 Ϯ 91 Stargardt patients 106 50 F val849ala, arg2107his -201 107 41 M gly1961glu, arg2077trp -306 108 22 M ala60val, 1 bp ins codon 1513 -82 109 34 M leu541pro/ala1038val,‡ gly1961glu -277 110 51 M gly1961glu -191 -211 Ϯ 87 * Age on the date of determination of the a-wave result shown in the right-hand column. Login to comment
78 All of the allelic variations in the ABCA4 gene found in these patients are significantly more prevalent in patients with Stargardt disease than in the normal population.24 The ala1038val and gly1961glu alleles are relatively common in Stargardt disease and may have altered frequencies in different populations as a result of founder effects.31 FIGURE 2. Login to comment

[hide] Mutations in ABCA4 result in accumulation of lipof... Hum Mol Genet. 2004 Mar 1;13(5):525-34. Epub 2004 Jan 6. Cideciyan AV, Aleman TS, Swider M, Schwartz SB, Steinberg JD, Brucker AJ, Maguire AM, Bennett J, Stone EM, Jacobson SG
Mutations in ABCA4 result in accumulation of lipofuscin before slowing of the retinoid cycle: a reappraisal of the human disease sequence.
Hum Mol Genet. 2004 Mar 1;13(5):525-34. Epub 2004 Jan 6., [PMID:14709597]

Abstract [show]
Mutations in ABCA4, which encodes a photoreceptor specific ATP-binding cassette transporter (ABCR), cause autosomal recessive forms of human blindness due to retinal degeneration (RD) including Stargardt disease. The exact disease sequence leading to photoreceptor and vision loss in ABCA4-RD is not known. Extrapolation from murine and in vitro studies predicts that two of the earliest pathophysiological features resulting from disturbed ABCR function in man would be slowed kinetics of the retinoid cycle and accelerated deposition of lipofuscin in the retinal pigment epithelium (RPE). To determine the human pathogenetic sequence, we studied surrogate measures of retinoid cycle kinetics, lipofuscin accumulation, and rod and cone photoreceptor and RPE loss in ABCA4-RD patients with a wide spectrum of disease severities. There were different extents of photoreceptor/RPE loss and lipofuscin accumulation in different regions of the retina. Slowing of retinoid cycle kinetics was not present in all patients; when present, it was not homogeneous across the retina; and the extent of slowing correlated well with the degree of degeneration. The orderly relationship between these phenotypic features permitted the development of a model of disease sequence in ABCA4-RD. The model predicted lipofuscin accumulation as a key and early component of the disease expression in man, as in mice. In man, however, abnormal slowing of the rod and cone retinoid cycle occurs at later stages of the disease sequence. Knowledge of the human ABCA4 disease sequence will be critical for defining rates of progression, selecting appropriate patients and retinal locations for future therapy, and choosing appropriate treatment outcomes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 Of interest were four compound heterozygotes with G1961E change in one allele (P6, P11, P12, P15): those with frameshift mutations in the second allele (2005delAT or 4531insC) showed less degeneration at older ages (55 and 29, respectively) than those with point mutations (R2149L or E1122K) at younger ages (48 and 19, respectively). Login to comment
47 Alleles demonstrated to have major abnormalities in vitro (7) could result in mild disease (P10: E1087K/G1961E) or severe disease (P5: G818E/ L541Pþ A1038V; or P9: N965S/N965S). Login to comment

[hide] Three families displaying the combination of Starg... Ophthalmology. 2004 Mar;111(3):546-53. Klevering BJ, Maugeri A, Wagner A, Go SL, Vink C, Cremers FP, Hoyng CB
Three families displaying the combination of Stargardt's disease with cone-rod dystrophy or retinitis pigmentosa.
Ophthalmology. 2004 Mar;111(3):546-53., [PMID:15019334]

Abstract [show]
OBJECTIVE: To investigate the clinical spectrum and molecular causes of retinal dystrophies in 3 families. DESIGN: Family molecular genetics study. PARTICIPANTS: Sixteen patients and 15 relatives in 3 families. METHODS: Members of 3 families with multiple ABCA4-associated retinal disorders were clinically evaluated. Deoxyribonucleic acid samples of all affected individuals and their family members were analyzed for variants in all 50 exons of the ABCA4 gene. MAIN OUTCOME MEASURES: ABCA4-associated retinal phenotypes and mutations in the ABCA4 gene. RESULTS: In family A, 2 sisters were diagnosed with Stargardt's disease (STGD); the eldest sister was compound heterozygous for the mild 2588G-->C and the severe 768G-->T mutation. Another patient in this family with a severe type of retinitis pigmentosa (RP) carried the 768G-->T mutation homozygously. In family B, 2 siblings presented with an RP of severity similar to that encountered in family A. Both were homozygous for the severe IVS33+1G-->A mutation. Two other family members with STGD were compound heterozygous for the 2588G-->C and IVS33+1G-->A mutations. In family C, all 5 siblings of generation II demonstrated age-related macular degeneration (AMD). In generations III and IV, 2 STGD patients and 1 cone-rod dystrophy (CRD) patient were present. In 1 STGD patient we identified a heterozygous 768G-->T mutation. Sequence analysis of the entire ABCA4 gene did not reveal the remaining 2 mutations. Nevertheless, the 2 patients with STGD, the patient with CRD, and 2 of the AMD patients shared a common haplotype spanning the ABCA4 gene. CONCLUSIONS: Different mutations in the ABCA4 gene are the cause of STGD and RP or CRD in at least 2 and, possibly, 3 families. Patients with RP caused by ABCA4 mutations are characterized by an early onset and rapid progression of their retinal dystrophy, with extensive chorioretinal atrophy resulting in a very low visual acuity. Various combinations of relatively rare retinal disorders such as STGD, CRD, and RP in one family may not be as uncommon as once believed, in view of the relatively high carrier frequency of ABCA4 mutations (about 5%) in the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 546 (c) 2004 by the American Academy of Ophthalmology ISSN 0161-6420/04/$-see front matter Published by Elsevier Inc. doi:10.1016/j.ophtha.2003.06.010 study (D2177N and G1961E) were evaluated in a larger investigation including 1218 unrelated AMD patients and 1258 comparison individuals. Login to comment
32 The 2 sequence changes were found in 3.4% of the AMD patients and in approximately 0.95% of the control subjects, and it was concluded that the risk of AMD is elevated approximately 3-fold in D2177N carriers and approximately 5-fold in G1961E carriers.14 Other groups, however, could not find a significant difference in the prevalence of heterozygous ABCA4 mutations in exudative and dry AMD patients and control groups, although the numbers of individuals analyzed in these studies were smaller.15-20 In the proposed genotype-phenotype model for ABCA4 there is an inverse relationship between the presumed residual ABCA4 function and the severity of the retinal dystrophy.2,6,21 Because different combinations of ABCA4 mutations lead to different phenotypes, this model implicitly predicts the occurrence of families harboring different types of ABCA4-associated retinal disorders.2,3,6,7 In this study, we present the clinical and genetic findings in 3 families with multiple ABCA4-associated retinal disorders. Login to comment

[hide] Genotyping microarray (gene chip) for the ABCR (AB... Hum Mutat. 2003 Nov;22(5):395-403. Jaakson K, Zernant J, Kulm M, Hutchinson A, Tonisson N, Glavac D, Ravnik-Glavac M, Hawlina M, Meltzer MR, Caruso RC, Testa F, Maugeri A, Hoyng CB, Gouras P, Simonelli F, Lewis RA, Lupski JR, Cremers FP, Allikmets R
Genotyping microarray (gene chip) for the ABCR (ABCA4) gene.
Hum Mutat. 2003 Nov;22(5):395-403., [PMID:14517951]

Abstract [show]
Genetic variation in the ABCR (ABCA4) gene has been associated with five distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), and age-related macular degeneration (AMD). Comparative genetic analyses of ABCR variation and diagnostics have been complicated by substantial allelic heterogeneity and by differences in screening methods. To overcome these limitations, we designed a genotyping microarray (gene chip) for ABCR that includes all approximately 400 disease-associated and other variants currently described, enabling simultaneous detection of all known ABCR variants. The ABCR genotyping microarray (the ABCR400 chip) was constructed by the arrayed primer extension (APEX) technology. Each sequence change in ABCR was included on the chip by synthesis and application of sequence-specific oligonucleotides. We validated the chip by screening 136 confirmed STGD patients and 96 healthy controls, each of whom we had analyzed previously by single strand conformation polymorphism (SSCP) technology and/or heteroduplex analysis. The microarray was >98% effective in determining the existing genetic variation and was comparable to direct sequencing in that it yielded many sequence changes undetected by SSCP. In STGD patient cohorts, the efficiency of the array to detect disease-associated alleles was between 54% and 78%, depending on the ethnic composition and degree of clinical and molecular characterization of a cohort. In addition, chip analysis suggested a high carrier frequency (up to 1:10) of ABCR variants in the general population. The ABCR genotyping microarray is a robust, cost-effective, and comprehensive screening tool for variation in one gene in which mutations are responsible for a substantial fraction of retinal disease. The ABCR chip is a prototype for the next generation of screening and diagnostic tools in ophthalmic genetics, bridging clinical and scientific research.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 What makes ABCR a more difficult diagnostic target than CFTR is that the most frequent disease-associated ABCR alleles, e.g., 5882G>A (G1961E), 2588G>C (G863A/ delG863), and 3113C>T (A1038V), have each been described in only B10% of STGD patients in a distinct population, whereas the delF508 allele of CFTR accounts for close to 70% of all cystic fibrosis alleles [Zielenski and Tsui, 1995]. Login to comment
115 Mutations Detected in theTwoTest Populations by the ABCR400 Array,That Had Not Been Found by SSCP Number Nucleotide change Protein e¡ect Number of cases 1 161G4A C54Y 3 2 194G4A G65E 1 3 428C4T P143L 1 4 455G4A R152Q 1 5 514G4A G172S 1 6 635G4A R212H 1 7 656G4C R219T 1 8 768G4Ta Splice/V256V 3 9 1007C4G S336C 2 10 1268A4G H423R 4 11 1411G4A E471K 2 12 1622T4Ca L541P 8 13 1933G4A D645N 1 14 2041C4T R681X 5 15 2090G4A W697X 1 16 2471T4C I824T 1 17 2588G4Ca Splice/G863A 5 18 2828G4A R943Q 1 19 2966T4C V989A 1 20 2971G4C G991R 1 21 4139C4T P1380L 8 22 4195G4A E1399K 1 23 4328G4A R1443H 1 24 4457C4T P1486L 1 25 4462T4Ca C1488R 1 26 4469G4Aa C1490Y 1 27 4918C4Ta R1640W 2 28 IVS40+5G4A Splice 2 29 5537T4C I1846T 2 30 5882G4A G1961E 5 31 6089G4A R2030Q 1 32 6104T4C L2035P 1 33 6449G4A C2150Y 1 Mutation numbering is based on the cDNA sequence (GenBank NM_000350). Login to comment
127 The most frequent individual allele in all cohorts was, with one exception, the 5882G>A (G1961E) mutation, ranging from 7% in the NEI/NIH cohort to >21% in the Slovenian sample (Table 3). Login to comment

[hide] The genetics of inherited macular dystrophies. J Med Genet. 2003 Sep;40(9):641-50. Michaelides M, Hunt DM, Moore AT
The genetics of inherited macular dystrophies.
J Med Genet. 2003 Sep;40(9):641-50., [PMID:12960208]

Abstract [show]
The inherited macular dystrophies comprise a heterogeneous group of disorders characterised by central visual loss and atrophy of the macula and underlying retinal pigment epithelium (RPE). The different forms of macular degeneration encompass a wide range of clinical, psychophysical and histological findings. The complexity of the molecular basis of monogenic macular disease is now beginning to be elucidated with the identification of many of the disease-causing genes. Age related macular degeneration (ARMD), the leading cause of blind registration in the developed world, may also have a significant genetic component to its aetiology. Genes implicated in monogenic macular dystrophies are good candidate susceptibility genes for ARMD, although to date, with the possible exception of ABCA4, none of these genes have been shown to confer increased risk of ARMD. The aim of this paper is to review current knowledge relating to the monogenic macular dystrophies, with discussion of currently mapped genes, chromosomal loci and genotype-phenotype relationships. Inherited systemic disorders with a macular dystrophy component will not be discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
335 It is currently believed that: (1) homozygous null mutations cause the most severe phenotype of autosomal recessive RP; (2) combinations of a null mutation with a moderate missense mutation result in autosomal recessive CORD, and (3) combinations of null/mild missense or two moderate missense mutations cause STGD/FFM.28 Assessment of functional activity of mutant ABCA4 transporter has been performed by Sun et al.27 For example the missense mutations, L541P and G1961E, are associated with severely reduced but not abolished ATPase activity, whereas nonsense mutations would be predicted to have a more severe effect on protein function. Login to comment

[hide] Detailed analysis of allelic variation in the ABCA... Invest Ophthalmol Vis Sci. 2003 Jul;44(7):2868-75. Schmidt S, Postel EA, Agarwal A, Allen IC Jr, Walters SN, De la Paz MA, Scott WK, Haines JL, Pericak-Vance MA, Gilbert JR
Detailed analysis of allelic variation in the ABCA4 gene in age-related maculopathy.
Invest Ophthalmol Vis Sci. 2003 Jul;44(7):2868-75., [PMID:12824224]

Abstract [show]
PURPOSE: Age-related maculopathy (ARM) is one of the most common causes of blindness in older adults worldwide. Sequence variants in a gene coding for a retina-specific ATP-binding cassette (ABCA4) transporter protein, which is responsible for a phenotypically similar Mendelian form of retinal disease, were proposed to increase the risk of ARM. To examine the potential relationship of ABCA4 sequence variation and ARM risk in an independent data set, a clinically well-characterized population of 165 multiplex patients with ARM from 70 families, 33 unaffected relatives, and 59 unrelated control subjects with confirmed absence of ARM was screened for variants in any of the 50 exons and exon-intron boundaries of this gene. METHODS: A combination of denaturing high-performance liquid chromatography (DHPLC) and bidirectional sequencing was used to detect ABCA4 sequence variants. The data set was analyzed with both case-control and family-based association analysis methods. RESULTS: No evidence was found of significantly different allele frequencies of ABCA4 sequence variants in patients compared with control subjects, and no evidence for association or cosegregation with disease in family-based analyses. CONCLUSIONS: This study confirmed the very high degree of ABCA4 sequence polymorphism in the general population, which makes the detection of potential disease-associated alleles particularly challenging. While this study does not definitively exclude ABCA4 from contributing to a small or moderate fraction of ARM, it adds to the body of evidence suggesting that ABCA4 is not a major susceptibility gene for this disorder.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 We did not detect the variants G1961E (5882G3A, exon 42) and D2177N (6529G3A, exon 48) reported as disease-associated16 in any of the 257 samples screened in this study. Login to comment
102 In agreement with the DHPLC results, we did not detect G1961E and D2177N in this patient population. Login to comment
158 However, the fact that we did not detect a single copy of the only variants that have so far been reported as potentially disease associated, G1961E (5882G3A) and D2177N (6529G3A), in any of our 165 patients with ARM, suggests that their contribution to this phenotype is small at best. Login to comment
170 The frequency of potentially disease-associated variants has been consistently estimated to be no higher than 1% in a nonpatient population.11,12,16,20 Because of uncertainty about the true effect size, we have assumed three plausible relative risk values for an ABCA4 variant: 5, estimated for G1961E;16 3, estimated for D2177N;16 and 1.5, the lower confidence limit for G1961E.16 Power calculations using commercial software (nQuery-Advisor; Statistical Solutions, Saugus, MA) and DSTPLAN (http://odin. Login to comment
183 However, it is not clear that the two sequence variants proposed to be disease-associated in humans (G1961E, D2177N) are equivalent to a null mutation, even though they were shown to have some effect on the function of the ABCA4 protein.46 An animal model can be an invaluable tool for assessing the potential significance of sequence variation in a candidate gene; however, caution is necessary in inferring functional consequences in the context of complex human disease from data generated on mice. Login to comment
188 That said, several recent empiric studies have suggested that the impact of population stratification in reasonably well-designed genetic-epidemiologic studies may not be as large as initially suspected.47,48 Nevertheless, the report of a much higher prevalence of the G1961E allele in healthy individuals of Somali ancestry20 was illuminating, and, in the absence of high prevalences of either ARM or STGD in Somalia, certainly raised doubts about the potential disease association of this allele. Login to comment

[hide] ABCA4 gene sequence variations in patients with au... Arch Ophthalmol. 2003 Jun;121(6):851-5. Fishman GA, Stone EM, Eliason DA, Taylor CM, Lindeman M, Derlacki DJ
ABCA4 gene sequence variations in patients with autosomal recessive cone-rod dystrophy.
Arch Ophthalmol. 2003 Jun;121(6):851-5., [PMID:12796258]

Abstract [show]
OBJECTIVE: To identify sequence variations in the ABCA4 gene in a cohort of patients with autosomal recessive cone-rod dystrophy. METHODS: The coding sequences of the ABCA4 gene were analyzed in 30 unrelated probands. In those patients with plausible disease-causing variations, correlations were made between genotype and fundus phenotype as well as with electrophysiological and visual field findings. RESULTS: Sixteen (53%) of 30 probands were found to harbor plausible disease-causing variations in the ABCA4 gene. Two distinctly different fundus phenotypes were observed in our cohort of patients. Twelve patients showed diffuse pigmentary degenerative changes, whereas 4 showed either no pigmentary changes or only a mild degree of peripheral pigment degeneration. An associa-tion between certain sequence variations and each of these 2 different phenotypes was observed. CONCLUSIONS: Our findings confirm that a substantial percentage of patients with autosomal recessive cone-rod dystrophy are likely to harbor a mutation in the ABCA4 gene as the cause of their disease. The fundus phenotype observed in such patients is quite variable, and certain fundus phenotypes may be more associated with certain genotypes. Clinical Relevance Identification of the molecular genetic basis for various inherited human retinal dystrophies, such as cone-rod dystrophy, facilitates a potentially better understanding of the mechanisms by which photoreceptor cells degenerate. This in turn provides guidance as to how to better proceed in identifying the most optimal future therapeutic strategies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 The most common ABCA4 change seen in Stargardt patients, Gly1961Glu, was not observed at all in this cohort of patients with cone-rod dystrophy. Login to comment

[hide] ABCA4 sequence variants in Chinese patients with a... Ophthalmologica. 2003 Mar-Apr;217(2):111-4. Baum L, Chan WM, Li WY, Lam DS, Wang PB, Pang CP
ABCA4 sequence variants in Chinese patients with age-related macular degeneration or Stargardt's disease.
Ophthalmologica. 2003 Mar-Apr;217(2):111-4., [PMID:12592048]

Abstract [show]
ABCA4 gene sequence alterations cause Stargardt's disease (STGD) and may cause some age-related macular degeneration (AMD). We sought to shed light on these associations among Hong Kong Chinese by genotyping 140 AMD, 18 STGD and 95 normal control subjects for 15 ABCA4 exons which were reported to often contain AMD- or STGD-associated mutations. Sequence alterations R212H, T1428M, V1433I, T1572M, I2166M, IVS6-5T>G and IVS33+1G>T were found in AMD patients. T1428M and R2040X occurred in STGD patients. Control subjects displayed all the above missense alterations but no splicing or nonsense changes. Therefore, ABCA4 splicing mutations may be associated with a small proportion of AMD cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 However, one very large study revealed a significant association of D2177N and G1961E with AMD [20]. Login to comment
45 D2177N and G1961E have been associated with AMD, but we found these mutations in neither AMD, STGD nor control subjects [20]. Login to comment

[hide] Macular pigment and visual acuity in Stargardt mac... Graefes Arch Clin Exp Ophthalmol. 2002 Oct;240(10):802-9. Epub 2002 Sep 14. Zhang X, Hargitai J, Tammur J, Hutchinson A, Allikmets R, Chang S, Gouras P
Macular pigment and visual acuity in Stargardt macular dystrophy.
Graefes Arch Clin Exp Ophthalmol. 2002 Oct;240(10):802-9. Epub 2002 Sep 14., [PMID:12397427]

Abstract [show]
PURPOSE: To test the hypothesis that macular pigment reflects foveal cone function and possibly the presence of foveal cones in recessive Stargardt macular dystrophy. METHODS: Sixteen patients (32 eyes) diagnosed to have Stargardt macular dystrophy by clinical criteria were studied with a scanning laser ophthalmoscope (SLO) comparing argon laser blue (488 nm), green (514), helium-neon laser red (633 nm) and infrared diode laser (780 nm) images for the presence or absence of macular pigment in the fovea. Fifteen of the patients were screened for mutations in the ABCR gene. Eyes were graded into three categories: those without foveal macular pigment, those with partial pigment and those with normal amounts of macular pigment. These categories were compared with visual acuity determined by the Snellen chart. RESULTS: All patients with a visual acuity of 20/200 or worse had no macular pigment in the fovea. All patients with visual acuity of 20/40 or better had a normal amount of macular pigment in the fovea. Patients with partial macular pigment had intermediary acuity values except for two eyes, one with 20/20 and another with 20/200 acuity. Infrared light revealed more retinal abnormalities than blue light at early stages of the disease. CONCLUSION: Foveal macular pigment is related to foveal cone acuity in Stargardt macular dystrophy and may be a marker for the presence of foveal cones. Infrared light is a sensitive monitor of early Stargardt macular dystrophy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Blue light images (A, C); infrared images (B, D) Table 1 Visual acuity, macular pigment and ABCR mutations in patients with Stargardt dystrophy Patient Age/Sex Visual Acuity Macular Pigment Exon Allele 1 Exon Allele 2 OD OS OD OS 1 33F 0.67 0.38 + + ND ND 2 36F 1 0.5 + + ND ND 3 54F 0.48 0.6 + + 42 G1961E 42 G1061E 4 11M 0.8 1 + + NS NS 5 33F 0.67 0.4 +- + 20 V989A ND 6 12F 0.5 0.2 +- +- 30 C1490Y 40 GIVS+5A 7 47M 0.5 0.4 +- +- 17 G863A/R943Q 45 R2077W 8 53M 0.1 1 +- +- 14 W663X ND 9 29F 0.1 0.1 +- +- 26 3819insT ND 10 43M 0.005 0.005 - - 17 G863A/R943Q ND 11 32F 0.1 0.1 - - 19 N965S ND 12 29F 0.005 0.005 - - 23 R1129H ND 13 30F 0.1 0.1 - - 5 R152Q ND 14 63F 0.1 0.1 - - 42 G1961E ND 15 36M 0.07 0.1 - +- 13 Q636H 42 G1961E 16 41F 0.005 0.005 - - 12 L514P/A1038V ND NS: Not screened; ND: Not detected + Normal macular pigment; +- Partial macular pigment; - Absent macular pigment absorption of infrared light in the center of the macula where maximum absorption of blue light occurs, implying that the macula pigments in this subject`s foveas are normal. Login to comment

[hide] Phenotypes of 16 Stargardt macular dystrophy/fundu... Graefes Arch Clin Exp Ophthalmol. 2002 Aug;240(8):628-38. Epub 2002 Jul 4. Gerth C, Andrassi-Darida M, Bock M, Preising MN, Weber BH, Lorenz B
Phenotypes of 16 Stargardt macular dystrophy/fundus flavimaculatus patients with known ABCA4 mutations and evaluation of genotype-phenotype correlation.
Graefes Arch Clin Exp Ophthalmol. 2002 Aug;240(8):628-38. Epub 2002 Jul 4., [PMID:12192456]

Abstract [show]
PURPOSE: To determine the phenotypic variability in patients with compound heterozygous or homozygous ABCA4 mutations, and to correlate the phenotypes with the functional properties of the altered protein. METHODS: Sixteen patients from 13 families with signs of Stargardt macular dystrophy/fundus flavimaculatus and known mutations on both alleles of the ABCA4 gene (15 compound heterozygous, one homozygous) were characterized by clinical examination, fundus autofluorescence, psychophysics (color vision, kinetic and two-color dark- and light-adapted static threshold perimetry), and electrophysiology (Ganzfeld, multifocal ERG, EOG). RESULTS: The homozygous 5917delG mutation resulted in the earliest disease manifestation (at 5 years) and a general cone-rod dysfunction, whereas the compound heterozygous mother (5917delG, G1961E) exhibited a very mild phenotype. Compound heterozygotes for the IVS40+5G-->A and the C1488Y or Y362X mutation showed also an early age of onset but only a central dysfunction. The effect of the 2588G-->C mutation, the G1961E mutation, and the complex mutation L541P-A1038V depended on the mutation in the second allele. Genotype-phenotype correlation appeared possible in most instances. Psychophysics revealed a simultaneous yet not necessarily congruent cone and rod dysfunction. CONCLUSIONS: The type and combination of ABCA4 mutations in compound heterozygous patients determined were compatible with the severity of the phenotype as to age of onset and the functional consequences in the majority of patients. Unexplained phenotypic differences indicate the influence of other factors. ABCA4 mutations result in cone and rod dysfunction. Different disease durations limit the power of presently available genotype-phenotype correlations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Results: The homozygous 5917delG mutation resulted in the earliest disease manifestation (at 5 years) and a general cone-rod dysfunction, whereas the compound heterozygous mother (5917delG, G1961E) exhibited a very mild phenotype. Login to comment
4 The effect of the 2588G→C mutation, the G1961E mutation, and the complex mutation L541P-A1038V depended on the mutation in the second allele. Login to comment
29 [17] identified three different phenotypes among 49 STGD patients associated with single heterozygous (16 patients) or compound heterozygous (13 patients) ABCA4 mutations and suggested that there is an association between the heterozygous ABCA4 mutation (Gly1961Glu change, exon 42) in one allele and a certain phenotype (fundus: small macular lesion; visual acuity: well preserved; angiography: no dark choroid; Ganzfeld ERG: normal). Login to comment
81 Patient 2 had a Table 2 Identified mutations in the ABCR alleles in the 16 patients (ND not tested) Patient ABCA4 allele 1 ABCA4 allele 2 no./sex (1*) Nucleotide changes Effects Nucleotide changes Effects 1a/F (139) 5917delG Frameshift 5917delG Frameshift 1b/F(139b) 5917delG Frameshift 5882G→A G1961E 2/M (167) IVS 40+5G→A Splice 4463G→A C1488Y 3/F (108) IVS 40+5G→A Splice 1086T→A Y362X 4/M (109) 1622T→C- L541P-A1038V 2564G→A W855X 3113C→T 5/F (113) 1622T→C- L541P-A1038V 2588G→C Splice 3113C→T 6/M (50) 2588G→C Splice 3113C→T A1038V 7b/M (138) 2588G→C Splice IVS13+1G→A Splice 7a/F Not tested Splice Not tested Splice 8/F (111) 5882G→A G1961E 2292delT-2295T→G Frameshift-S765R 9/F (147) 5882G→A G1961E IVS36+1G→A Splice 10/F (41) 5882G→A G1961E 2041C→T R681X 11a/F (114) 5882G→A G1961E 6609C→A Y2203X 11b/M ND ND 12/F (148) 3292C→T R1097C 6609C→A Y2203X 13/M (107) 3528insTGCA Frameshift 2291G→A C764Y* Refers to the patients` ID in [42] Table3Demographicdataandclinicalfeaturesofthe16patients(NDtestnotdone,Aabnormal,Nnormal,RreducedArdenratio,NRnotreliable,NAmfERGnotanalyz- able,+present,-absent,DCdarkchoroid,DDdiscdiameter) Pat.aAgeDiseaseVisualacuityColorFun-GanzfeldERGEOGmfERGStatictwo-colorKineticperimetryAngio-FundusAF atdurationvisiondusbthresholdperimetrygraphy onset/(years)ODOSRodMaximalConePeakResponseCentralCon-CentralCircularPeri- examresponseresponseresponsetimesdensitiesMeanRSLMeanCSLscotomacentricAFAFmacular/ b-wavecb-wavec30Hzab-abnormalc(dB)e(dB)efortargetcon-AF flickerdnormaldstriction <=13°>13°<=13°>13° 1a5/10520/250*20/250NDIfNDNANAND-ND-NRNRND+-- 1b32/32020/30*20/30NDINDNNNDN5-10°ND-ND-NDNDND+-- 27/15820/10020/200*AIINNNND5-15°5-25°2120--ND+-+ 39/13420/250*20/250AIINNNN5-15°5-25°0030I-2e-ND+++ 47/12520/25020/250*AIIINNNN5-25°5-25°ND-ND-I-4e-ND>1DD-- 520/4525<20/400<20/400*AIIINNNNNANA194143II-3e+ND>1DD-+ 614/19520/200*20/200AIINDNNNR5-10°5-25°1080I-4e-ND+-+ 7b16/23720/25020/250*AIINDNNR20°5-25°101113I-3e-ND+-+ 7a6/272120/20020/200NDIINDNDNDNDND-ND-ND-NDNDNDND 815/18320/100*20/100AINNND5-10°5-25°2010I-2e-N++- 921/23220/40*20/200AINDNNN10-15°5°0060NDNDN+++ 1024/31720/400*20/400AIINNNN5°5-15°3270I-2e-ND+-+ 11a16/331720/200*20/200AIINDNNNN5-15°81140I-2e-NDND 11b26/28220/20020/200*AINNNN5-10°,5-10°0010I-2e-ND+++ 20-25° 1238/571920/22*20/250NDIII(OD)ND5-25°5-25°35/3835/39ND-III/4e-NDND 1314/16220/100*20/100AIINDNNNN5-25°1120ND-DC+-+ aOnenumberindicatesonefamily bReferredtoTable1 cResults<5thpercentile dResults>95thpercentile eRSL(rodsensitivityloss;500nm,darkadapted)andCSL(conesensitivityloss; 600nm,lightadapted)comparedtothe10thpercentileofnormals;mfERGrespons- eswereanalyzedforallbutthecentral(1°inradius)responseduetohighnoise fRetinalvesselattenuation *EyetestedformfERG/staticperimetry CSL within 13° and a more widespread RSL over the 30° test field. Login to comment
94 AF Fig. 1 Fundus photographs, AF images, and mfERG trace arrays (from top to bottom) of patient 1a (homozygote for 5917delG) and her mother, patient 1b (compound heterozygote for 5917delG and G1961E) showed central hypofluorescence with surrounding perimacular hyper- and hypofluorescent spots in patients 6 and 7b. Login to comment
98 Patients with the missense mutation G1961E Four patients were compound heterozygous for this missense mutation and an alteration in the donor splice site of exon 36 (IVS36+1G→A, patient 9), a nonsense mutation (R681X, patient 10; Y2203X, patient 11a) or frameshift mutation [5917delG, patient 1b (results described above)] (Figs. 2, 3). Login to comment
99 In patient 8 two alterations in the Fig. 2 Fundus photograph, AF images, rod and cone sensitivity in the static two-color threshold perimetry in the dark-adapted (500 nm; RSL) and the light-adapted (600 nm; CSL) state, and mfERG trace arrays (from top to bottom) of three patients with the G1961E mutation in one and the 2292delT-S765R mutation (patient 8), the IVS36+1G→A mutation (patient 9), or the R681X mutation (patient 10) in the second ABCA4 allele. Scale for mfERG shown in Fig. 1. Login to comment
100 Static perimetry results are shown as gray scales of sensitivity loss (normal sensitivity indicated by white, no stimulus detection by black, blind spot by two blank test squares) second ABCA4 allele (frameshift 2292delT and missense S765R mutation) were identified in addition to the missense G1961E mutation. Login to comment
108 Patients with the nonsense mutation Y2203X Three patients were identified as compound heterozygous for this nonsense mutation and the missense mutations G1961E [siblings 11a and 11b (results described above)] or R1097C (patient 12) (Figs. 3, 4). Login to comment
109 Age at onset Fig. 3 Fundus photograph, RSL, CSL, and mfERG trace arrays (from top to bottom) of two siblings (patients 11a and 11b) with the Y2203X mutation in one and the G1961E mutation in the second ABCA4 allele. Scale for mfERG/perimetry shown in Fig. 1 Fig. 4 Fundus photograph, RSL, and mfERG trace arrays (from top to bottom) of patient 12 with the Y2203X mutation in one and the R1097C mutation in the second ABCA4 allele. Scale for mfERG/perimetry shown in Fig. 1 varied (Table 3). Login to comment
153 The milder phenotype in her mother (patient 1b), who was shown to be compound heterozygous for the 5917delG and G1961E mutation, is not unexpected since the G1961E mutation in her second allele is thought to result in partial activity of the ABCA4 transporter [49]. Login to comment
167 636 The missense mutation G1961E (with a clearly reduced ATPase activity but wild-type-like yield [49]) associated with the splice donor mutation IVS36+1G→A (patient 9), the complex mutation 2292delT-S765R (patient 8), the nonsense R681X mutation (patient 10) or the Y2203X mutation (patient 11a) in the second allele resulted in different degrees of photoreceptor dysfunction. Login to comment
172 Since ABCA4 is not prenylated, the loss of these amino acids may cause a less impaired protein function than the 2292delT-S765R and R681X mutations, which predict a loss of about three quarters of the gene product due to the location in the first TMD. Login to comment
173 By correlating the functional prediction to the clinical phenotype it is obvious that the patient with the G1961E- Y2203X mutation showed a more advanced rod dysfunction than the other patients with the G1961E mutation in one allele. Login to comment
175 The Y2203X mutation associated with the missense mutation R1097C (NBD-1) in patient 12 resulted in a less severe phenotype than seen in patient 11a (G1961E). Login to comment
30 [17] identified three different phenotypes among 49 STGD patients associated with single heterozygous (16 patients) or compound heterozygous (13 patients) ABCA4 mutations and suggested that there is an association between the heterozygous ABCA4 mutation (Gly1961Glu change, exon 42) in one allele and a certain phenotype (fundus: small macular lesion; visual acuity: well preserved; angiography: no dark choroid; Ganzfeld ERG: normal). Login to comment
152 The milder phenotype in her mother (patient 1b), who was shown to be compound heterozygous for the 5917delG and G1961E mutation, is not unexpected since the G1961E mutation in her second allele is thought to result in partial activity of the ABCA4 transporter [49]. Login to comment
166 636 The missense mutation G1961E (with a clearly reduced ATPase activity but wild-type-like yield [49]) associated with the splice donor mutation IVS36+1G࢐A (patient 9), the complex mutation 2292delT-S765R (patient 8), the nonsense R681X mutation (patient 10) or the Y2203X mutation (patient 11a) in the second allele resulted in different degrees of photoreceptor dysfunction. Login to comment
174 The Y2203X mutation associated with the missense mutation R1097C (NBD-1) in patient 12 resulted in a less severe phenotype than seen in patient 11a (G1961E). Login to comment

[hide] Alterations of slow and fast rod ERG signals in pa... Invest Ophthalmol Vis Sci. 2002 Apr;43(4):1248-56. Scholl HP, Besch D, Vonthein R, Weber BH, Apfelstedt-Sylla E
Alterations of slow and fast rod ERG signals in patients with molecularly confirmed Stargardt disease type 1.
Invest Ophthalmol Vis Sci. 2002 Apr;43(4):1248-56., [PMID:11923272]

Abstract [show]
PURPOSE: To investigate the slow and fast rod signals of the scotopic 15-Hz flicker ERG in patients with molecularly confirmed Stargardt disease type I (STGD1). There is evidence that these slow and the fast rod ERG signals can be attributed to the rod bipolar-AII cell pathway and the rod-cone coupling pathway, respectively. METHODS: Twenty-seven patients with STGD1 with mutations in both alleles of the ABCA4 gene were included. Scotopic ERG response amplitudes and phases to flicker intensities ranging from -3.37 to -0.57 log scotopic troland x sec (log scot td x sec) were measured at a flicker frequency of 15 Hz. In addition, scotopic standard ERGs were obtained. Twenty-two normal subjects served as controls. RESULTS: The amplitudes of both the slow and fast rod ERG signals were significantly reduced in the STGD1 group. The phases of the slow rod signals lagged significantly, whereas those of the fast rod signals did not. The standard scotopic ERG did not reveal significant alterations. CONCLUSIONS: The results provide evidence that a defective ABCA4 transporter can functionally affect both the rod bipolar-AII cell pathway and the rod-cone coupling pathway. In STGD1, the scotopic 15-Hz flicker ERG may reveal subtle abnormalities at different sites within the rod system that remain undetected by standard ERG techniques.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Characteristics of the 27 patients with STGD1 Patient Sex Age Onset VA (OD) VA (OS) CFC DF Mut(1) Mut(2) Slow Rod ERG Fast Rod ERG 1 M 32 9 1/50 20/400 Severe ϩϩ Q1412X R2077W 19.2 12.1 2 M 49 17 20/200 20/200 Severe ϩ 768G3T G1961E 56.1 23.8 3 M 46 30 20/40 20/200 Mild ϩ E471K G1961E 31.7 29.0 4* M 27 19 20/32 20/100 Moderate ϩ 2588G3C E1885K 35.0 45.1 5* M 31 18 20/400 20/400 Severe ϩϩ 2588G3C E1885K 36.1 39.1 6* F 29 12 20/200 20/200 Moderate ϩϩ 2588G3C E1885K 23.4 8.1 7 F 23 18 20/400 20/400 Mild ϩϩ E1399K G1977S 103.5 39.3 8 M 28 17 20/200 20/200 Mild ϩϩ R1898H G1975R 44.4 19.5 9 M 39 29 20/100 20/200 Moderate ϩ G607R G1961E 45.8 20.7 10 F 23 17 20/200 20/200 Mild - P68L S1689P 80.2 25.9 11 F 33 30 20/50 20/50 Mild - E1399K G1961E 49.8 62.0 12 M 50 42 20/400 20/64 Severe ϩϩ 2588G3C L541P/A1038V 53.8 30.2 13 M 36 25 20/40 20/32 Moderate ϩϩ 296insA A1038V 88.2 40.0 14 F 55 16 HM HM Severe ϩϩ Q635K IVS40ϩ5G3A 11.7 11.2 15 F 27 25 20/100 20/50 Moderate ϩ 2588G3C Q1412X 65.8 71.5 16 F 45 14 1/50 1/35 Severe ϩϩ L541P/A1038V S1063P 16.4 16.6 17 M 40 23 20/100 20/200 Moderate ϩ 296insA G1961E 46.1 58.3 18** M 35 15 20/400 20/400 Moderate ϩ 2588G3C Q1750X 14.1 12.9 19** M 43 14 HM HM Severe ϩϩ 2588G3C Q1750X 17.4 8.6 20 F 32 8 20/200 20/200 Severe ϩ G1961E G1961E 66.2 79.0 21 F 23 12 20/400 20/400 Mild - R212C T9591 24.6 25.3 22 F 29 9 20/200 20/200 Moderate ϩ L541P/A1038V G1961E 72.3 31.8 23 M 20 9 20/400 20/400 Moderate ϩϩ L541P/A1038V IVS40ϩ5G3A 64.7 42.2 24 F 39 23 20/400 20/50 Moderate - W663X G1961E 92.6 68.8 25 F 41 36 20/200 20/64 Severe ϩ F1440V G1748R 97.2 52.7 26*** M 13 10 20/100 20/200 Moderate - R572Q/2588G3C IVS35ϩ2T3A 59.2 33.5 27*** M 16 15 20/200 20/200 Moderate ϩ R572Q/2588G3C IVS35ϩ2T3A 31.1 22.9 Age at examination (y), gender, age of onset (y), visual acuity (VA), central fundus changes (CFC), and existence and distribution of the typical white-yellow flecks (DF) are shown. Login to comment
104 For instance, patient 20, who was homozygous for the G1961E mutation, exhibited the earliest onset (8 years of age) but relatively mild reductions of both the slow and fast rod ERG signals. Login to comment
107 Patient 13, carrying the mutations 296insA and G1961E, exhibited the latest onset (42 years). Login to comment

[hide] Differential occurrence of mutations causative of ... Hum Mutat. 2002 Mar;19(3):189-208. Pang CP, Lam DS
Differential occurrence of mutations causative of eye diseases in the Chinese population.
Hum Mutat. 2002 Mar;19(3):189-208., [PMID:11857735]

Abstract [show]
Ethnic differences and geographic variations affect the frequencies and nature of human mutations. In the literature, descriptions of causative mutations of eye diseases in the Chinese population are few. In this paper we attempt to reveal molecular information on genetic eye diseases involving Chinese patients from published and unpublished works by us and other groups. Our studies on candidate genes of eye diseases in the Chinese population in Hong Kong include MYOC and TISR for primary open angle glaucoma, RHO and RP1 for retinitis pigmentosa, ABCA4 and APOE for age-related macular degeneration, RB1 for retinoblastoma, APC for familial adenomatous polyposis with congenital hypertrophy of retinal pigment epithelium, BIGH3/TGFBI for corneal dystrophies, PAX6 for aniridia and Reiger syndrome, CRYAA and CRYBB2 for cataracts, and mtDNA for Leber hereditary optic neuropathy. We have revealed novel mutations in most of these genes, and in RHO, RP1, RB1, BIGH3, and PAX6 we have reported mutations that contribute to better understanding of the functions and properties of the respective gene products. We showed absence of MYOC does not necessarily cause glaucoma. No disease causative mutations have been identified in MYOC or ABCA4. There are similarities in the patterns of sequence alterations and phenotype-genotype associations in comparison with other ethnic groups, while the MYOC, RB1, APC, and PAX6 genes have more Chinese-specific sequence alterations. Establishment of a mutation database specific for the Chinese is essential for identification of genetic markers with diagnostic, prognostic, or pharmacological values.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
162 G1961E, G863A/delG863, and A1038V together account for about 10% of ABCA4 mutations in Caucasians. Login to comment
165 About 20% of them have G1961E and 10% G2588C, while the L541P-A1038V complex allele appears to be a founder mutation [Rivera et al., 2000]. Login to comment
168 Several studies found no significant association [Stone et al., 1998; Rivera et al., 2000; Webster et al., 2001], but the largest study to date showed a significant association of two mutations with AMD: D2177N in 1.8% of AMD cases and 0.6% of controls (p = 0.005), and G1961E in 1.6% of AMD and 0.3% of controls (p = 0.0008) [Allikmets, 2000]. Login to comment

[hide] Genotype-phenotype analysis of ABCR variants in ma... Invest Ophthalmol Vis Sci. 2002 Feb;43(2):466-73. Bernstein PS, Leppert M, Singh N, Dean M, Lewis RA, Lupski JR, Allikmets R, Seddon JM
Genotype-phenotype analysis of ABCR variants in macular degeneration probands and siblings.
Invest Ophthalmol Vis Sci. 2002 Feb;43(2):466-73., [PMID:11818392]

Abstract [show]
PURPOSE: Single-copy variants of the autosomal recessive Stargardt disease (STGD1) gene ABCR (ABCA4) have been shown to confer enhanced susceptibility to age-related macular degeneration (AMD). To investigate the role of ABCR alleles in AMD further, genotype-phenotype analysis was performed on siblings of patients with AMD who had known ABCR variants. This genetically related population provides a cohort of subjects with similar age and ethnic background for genotype-phenotype comparison to the original probands. METHODS: All available siblings of 26 probands carrying probable disease-associated ABCR variants were examined clinically. Blood samples were collected from these siblings for genotype analysis to search for the ABCR variant alleles corresponding to the isofamilial proband. RESULTS: Nineteen of 33 siblings from 15 families carried the respective proband's variant ABCR allele. Some families exhibited concordance of ABCR alleles with macular degeneration phenotype, but others did not. Exudative AMD was uncommon among both probands and siblings. CONCLUSIONS: Although population studies have indicated that some ABCR variant alleles may enhance susceptibility to AMD, investigation of the extent of ABCR involvement by kindred analysis is complicated by a plethora of environmental and other hereditary factors not investigated in the current study that may also play important roles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
14 We reported that 16% of an initial cadre of patients with AMD (26/167) had heterozygous ABCR variants that resulted in non-conservative amino acid substitutions, frameshifts, or splice-site changes that were found in less than 1% of a general population control cohort.14 Two variants, G1961E and D2177N, accounted for half of the reported disease-associated variants, whereas the others were rare variants found in one or two affected individuals.14 Two groups subsequently reported much lower rates of potential disease-associated ABCR variants in their cohorts of patients with AMD,15-17 but their selected populations, clinical criteria, and mutation detection rates differed substantially from the initial study.18 More recently, however, a large multicenter international consortium confirmed that G1961E and D2177N variants of ABCR are indeed found in patients with AMD at a significantly higher frequency relative to control subjects.19 The two variants were found in 3.4% of patients with AMD (40/1189) versus 0.95% of control subjects (12/ 1258; P Ͻ 0.0001).19 We postulate that relatives of patients with Stargardt disease and of patients with AMD who are heterozygous carriers of the same variant ABCR alleles as the family proband may have an increased risk of development of AMD under some circumstances. Login to comment
52 AMD Grade of Probands Carrying Heterozygous ABCR Variants ABCR Variant Grade 1 Grade 2 Grade 3 Grade 4 Grade 5 E471K 0 0 1 1 0 P940R* 0 0 0 1 0 T1428M 0 0 1 0 0 R1517S 0 0 0 1 0 I1562T 0 0 1 1 0 G1578R 0 0 1 0 0 5196ϩ1G3A 0 0 1 0 0 R1898H 0 0 0 1 0 G1961E 0 0 2 4 0 L1970F 0 0 1 0 0 6519⌬11bp 0 0 0 1 0 D2177N 0 1 3 3 0 6568⌬C 0 0 0 0 1 Data are number of probands at each grade. Login to comment
66 Statistical analysis becomes even more challenging if individual ABCR variants are examined, because the number of subjects becomes quite small, but two variants, G1961E and D2177N, deserve special attention. Login to comment
67 Not only are they more common than other AMD-associated variants,14 but their association with risk of AMD has been confirmed in a large consortium study,19 and they alter ABCR adenosine triphosphatase (ATPase) activity in vitro in a manner similar to the majority of Stargardt- and AMD-associated ABCR variants analyzed so far.28 Three of four siblings of G1961E probands who also carried the variant G1961E allele had grade 2 or greater maculopathy, whereas both siblings who did not carry the variant allele had grade 4 disease. Login to comment
115 Our study of the D2177N and G1961E mutations in age-matched ophthalmoscopically examined control subjects confirms that an ABCR variant does not by itself confer an AMD phenotype in all cases, but may increase susceptibility to the complex trait when large populations are examined.19 The fact that many siblings have AMD without the same ABCR variant as the family proband is not unexpected, especially because there are likely to be other inherited and environmental risk factors that have not yet been identified that may act alone or in concert with ABCR alleles to enhance susceptibility to AMD. Login to comment
129 This is a recurring problem facing investigators studying other complex adult-onset multifactorial diseases, such as breast cancer and prostate cancer.46,47 Statistical power analysis indicates that we would need 144 siblings to achieve an 80% power of detecting a statistically significant elevated risk at P ϭ 0.05 if the study population prevalence of AMD is assumed to be 10% and the elevated risk of AMD conferred by any AMD-associated ABCR variant is comparable to the approximately threefold elevation in AMD risk found for the G1961E and D2177N ABCR variants in the International ABCR Consortium Study.19 Although there is mounting evidence that heterozygous variants in ABCR contribute to AMD susceptibility, we should not expect consistent concordance of variant alleles with AMD phenotype, because it is a complex trait influenced by a multitude of other hereditary and environmental risk factors. Login to comment

[hide] Visual function in patients with cone-rod dystroph... Exp Eye Res. 2001 Dec;73(6):877-86. Birch DG, Peters AY, Locke KL, Spencer R, Megarity CF, Travis GH
Visual function in patients with cone-rod dystrophy (CRD) associated with mutations in the ABCA4(ABCR) gene.
Exp Eye Res. 2001 Dec;73(6):877-86., [PMID:11846518]

Abstract [show]
Mutations in the ABCA4(ABCR) gene cause autosomal recessive Stargardt disease (STGD). ABCR mutations were identified in patients with cone-rod dystrophy (CRD) and retinitis pigmentosa (RP) by direct sequencing of all 50 exons in 40 patients. Of 10 patients with RP, one contained two ABCR mutations suggesting a compound heterozygote. This patient had a characteristic fundus appearance with attenuated vessels, pale disks and bone-spicule pigmentation. Rod electroretinograms (ERGs) were non-detectable, cone ERGs were greatly reduced in amplitude and delayed in implicit time, and visual fields were constricted to 10 degrees diameter. Eleven of 30 (37%) patients with CRD had mutations in ABCR. In general, these patients showed reduced but detectable rod ERG responses, reduced and delayed cone responses, and poor visual acuity. Rod photoresponses to high intensity flashes were of reduced maximum amplitude but showed normal values for the gain of phototransduction. Most CRD patients with mutations in ABCR showed delayed recovery of sensitivity (dark adaptation) following exposure to bright light. Pupils were also significantly smaller in these patients compared to controls at 30 min following light exposure, consistent with a persistent 'equivalent light' background due to the accumulation of a tentatively identified 'noisy' photoproduct.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
207 In contrast, the ®t of the T ABLE III ABCR mutations in patients with ARRP and CRD hRmP exon # Base variation site Codon variation site # WT with mutation New mutation WT genotype RP CRD 3195 3424 5402 5398 4317 146 3793 2566 4800 4512 5581 4770 3 3 H Jxn 1 3 H Jxn 0 in 53 Yes G/G G/A 3 G161A C054Y 0 in 53 No G/G A/A G/A 6 C618G S206R 0 in 53 No C/C C/G 6 G574A A192T 0 in 53 No G/G G/A 9 C1222T R408stop 0 in 53 No C/C C/T 18 A2701G T901A 0 in 53 No A/A A/G 19 A2894G N965S 0 in 53 No A/A A/G 28 T4169C L1390P 0 in 53 Yes T/T T/C 33 3 H Jxn 2 3 H Jxn 0 in 53 Yes T/T T/C 35 C4926G S1642R 0 in 53 Yes C/C C/G 36 G5115T R1705L 0 in 53 No G/G G/T 36 deletion deletion 0 in 53 Yes no del deln 37 T5206C S1736P 0 in 53 No T/T T/C 42 G5882A G1961E 0 in 53 No G/G A/G 47 G6449A C2150Y 0 in 53 No G/G G/A phototransduction model to the cone a-waves revealed a reduction in gain of approximately 0.5 log unit. Login to comment

[hide] Mechanistic studies of ABCR, the ABC transporter i... J Bioenerg Biomembr. 2001 Dec;33(6):523-30. Sun H, Nathans J
Mechanistic studies of ABCR, the ABC transporter in photoreceptor outer segments responsible for autosomal recessive Stargardt disease.
J Bioenerg Biomembr. 2001 Dec;33(6):523-30., [PMID:11804194]

Abstract [show]
ABCR is an ABC transporter that is found exclusively in vertebrate photoreceptor outer segments. Mutations in the human ABCR gene are responsible for autosomal recessive Stargardt disease, the most common cause of early onset macular degeneration. In this paper we review our recent work with purified and reconstituted ABCR derived from bovine retina and from cultured cells expressing wild type or site-directed mutants of human ABCR. These experiments implicate all-trans-retinal (or Schiff base adducts between all-trans-retinal and phosphatidylethanolamine) as the transport substrate, and they reveal asymmetric roles for the two nucleotide binding domains in the transport reaction. A model for the retinal transport reaction is presented which accounts for these experimental observations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
96 Figure 4(A) and (B) illustrates the behavior of two of these variants, T971N and G1961E, which reside within NBD-1 and NBD-2, respectively. Login to comment
98 G1961E exhibits reduced basal ATPase activity, and the ATPase activity shows inhibition by retinal rather than stimulation. Login to comment
105 (B) Naturally occurring variant G1961E in NBD-2. Login to comment
109 Among the variants tested in NBD-2, L1971R eliminates both basal and retinal-stimulated ATP hydrolysis, whereas G1977S and E2096K resemble G1961E in showing inhibition rather than stimulation of ATPase by retinal. Login to comment
114 When purified, reconstituted, and tested for ATPase activity, the synthetic mutations show (1) that mutations in NBD-1 (G966D or K969M), either alone or in combination with mutations in NBD-2 (G966D/G1975D or K969M/K1978M), abolish both basal and retinal-stimulated ATP hydrolysis and (2) that mutations in NBD-2 (G1975D or K1978M) do not alter the basal ATPase activity but lead to inhibition rather than stimulation of ATP hydrolysis by retinal (Fig. 4(C) and (D)), a pattern noted above for the naturally occurring NBD-2 mutations G1961E, G1977S, and E2096K. Login to comment

[hide] Cosegregation and functional analysis of mutant AB... Hum Mol Genet. 2001 Nov 1;10(23):2671-8. Shroyer NF, Lewis RA, Yatsenko AN, Wensel TG, Lupski JR
Cosegregation and functional analysis of mutant ABCR (ABCA4) alleles in families that manifest both Stargardt disease and age-related macular degeneration.
Hum Mol Genet. 2001 Nov 1;10(23):2671-8., [PMID:11726554]

Abstract [show]
Mutations in ABCR (ABCA4) have been reported to cause a spectrum of autosomal recessively inherited retinopathies, including Stargardt disease (STGD), cone-rod dystrophy and retinitis pigmentosa. Individuals heterozygous for ABCR mutations may be predisposed to develop the multifactorial disorder age-related macular degeneration (AMD). We hypothesized that some carriers of STGD alleles have an increased risk to develop AMD. We tested this hypothesis in a cohort of families that manifest both STGD and AMD. With a direct-sequencing mutation detection strategy, we found that AMD-affected relatives of STGD patients are more likely to be carriers of pathogenic STGD alleles than predicted based on chance alone. We further investigated the role of AMD-associated ABCR mutations by testing for expression and ATP-binding defects in an in vitro biochemical assay. We found that mutations associated with AMD have a range of assayable defects ranging from no detectable defect to apparent null alleles. Of the 21 missense ABCR mutations reported in patients with AMD, 16 (76%) show abnormalities in protein expression, ATP-binding or ATPase activity. We infer that carrier relatives of STGD patients are predisposed to develop AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 A subsequent multicenter international study confirmed this initial association for two specific disease-associated variants (G1961E and D2177N) and estimated a 3-5-fold increased risk for development of AMD among carriers of these two ABCR mutations (20). Login to comment
43 Of note, AR468-8 was heterozygous for three mutations: the transitions 3758C→T (encoding the missense mutation T1253M), 4139C→T (encoding the missense mutation P1380L) and 5882G→A (encoding the missense mutation G1961E). Login to comment
44 Segregation analysis in this family revealed that two alterations (T1253M and G1961E) were on the same chromosome; thus AR468-8 is compound heterozygous for a novel complex allele [T1253M; G1961E] and the missense mutation P1380L (Fig. 1). Login to comment
47 Two novel mutations were identified in this cohort: the missense mutation T1253M was identified as part of the complex allele [T1253M; G1961E] and the transition 1648G→A (encoding the missense mutation G550R) was identified in STGD-affected AR484-4. Login to comment
97 Pedigree Maternal allele Paternal allele AMD relative A priori Cosegregation AR19 pGM, -6 0.5 - AR33 [W1408R; R1640W] R24H and D1532N mA, -16 0.5 Yes AR59 4232insTATG C1488R pGM, -6 0.5 No AR80 T1526M pGF, -5 0.5 - AR80 T1526M mGF, -7 0.5 Yes AR125 4947delC C1488R pGM, -7 0.5 Yes AR215 [H1406Y; V2050L] pGM, -5 0.5 - AR218 2160+1G→C G1961E mA, -8 0.5 No AR262 W821R pGGF, -7 0.25 No AR271 P68R E1087K mGA, -6 0.25 No AR335 D645N F608I mGM, -9 0.5 Yes AR382 R1108C mGM, -6 0.5 Yes AR389 E2096K 5714+5G→A pGM, -8 0.5 Yes AR397 5196+1G→A 5585-1G→A mA, -5 0.5 No AR410 A1038V 768G→T pC, -5 0.25 Yes AR422 pGM, -6 0.5 - AR423 P1380L D1532N pGF, -4 0.5 No AR468 P1380L P1380L mU, -9 0.5 Yes AR484 L2027F G550R mGU, -5 0.25 Yes AR562 R2107H 3050+5G→A pGU, -5 0.25 No AR643 5196+2T→C L2027F mU, -4 0.5 Yes AR661 P1380L C54Y mGF, -6 0.5 Yes AR669 664del13 pGF, -4 0.5 No AR534 W821R P1380L pGM, -7 0.5 Yes (17) Family 1 R212C I2113M mGM, I-2 0.5 Yes (27) Family 2 R1108C R2107H mGM, I-2 0.5 Yes (27) Family 3 R212C G1977S mGF, I-1 0.5 Yes (27) 10.25 15 unlikely to account for many of the remaining alleles (our unpublished observations). Login to comment
114 Sun et al. (28) reported substantial defects in protein expression or ATP binding of eight AMD-associated mutations (R212C, G863A, A1038V, R1108C, R1129L, P1380L, G1961E and L2027F) and an abnormal increase in the ATPase activity of the D2177N mutation, and they reported mild defects or wild-type activity within the sensitivity of the assay in four other AMD-associated variants (E471K, C1488R, T1526M and R1898H). Login to comment

[hide] Mutational scanning of the ABCR gene with double-g... Hum Genet. 2001 Sep;109(3):326-38. Fumagalli A, Ferrari M, Soriani N, Gessi A, Foglieni B, Martina E, Manitto MP, Brancato R, Dean M, Allikmets R, Cremonesi L
Mutational scanning of the ABCR gene with double-gradient denaturing-gradient gel electrophoresis (DG-DGGE) in Italian Stargardt disease patients.
Hum Genet. 2001 Sep;109(3):326-38., [PMID:11702214]

Abstract [show]
Mutations in the retina-specific ABC transporter (ABCR) gene are responsible for autosomal recessive Stargardt disease (arSTGD). Mutation detection efficiency in ABCR in arSTGD patients ranges between 30% and 66% in previously published studies, because of high allelic heterogeneity and technical limitations of the employed methods. Conditions were developed to screen the ABCR gene by double-gradient denaturing-gradient gel electrophoresis. The efficacy of this method was evaluated by analysis of DNA samples with previously characterized ABCR mutations. This approach was applied to mutation detection in 44 Italian arSTGD patients corresponding to 36 independent genomes, in order to assess the nature and frequency of the ABCR mutations in this ethnic group. In 34 of 36 (94.4%) STGD patients, 37 sequence changes were identified, including 26 missense, six frameshift, three splicing, and two nonsense variations. Among these, 20 had not been previously described. Several polymorphisms were detected in affected individuals and in matched controls. Our findings extend the spectrum of mutations identified in STGD patients and suggest the existence of a subset of molecular defects specific to the Italian population. The identification of at least two disease-associated mutations in four healthy control individuals indicates a higher than expected carrier frequency of variant ABCR alleles in the general population. Genotype-phenotype analysis in our series showed a possible correlation between the nature and location of some mutations and specific ophthalmoscopic features of STGD disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 DNA samples (n=22) carrying previously identified mutations in the ABCR gene were employed as controls for evaluating the efficacy of the DG-DGGE approach in detecting sequence variations R572Q (Lewis et al. 1999), Y639X (Lewis et al. 1999), G863A (Lewis et al. 1999; Maugeri et al. 1999), A1038V (Rozet et al. 1998), T1019M (Rozet et al. 1998), 3211insGT (Lewis et al. 1999), P1380L (Lewis et al. 1999), H1406Y (Lewis et al. 1999), 4947delC (Lewis et al. 1999), H1838Y (Lewis et al. 1999), 5714+5G→A (Cremers et al. 1998), N1868I (De La Paz et al. 1999), L1938L (Rivera et al. 2000), G1961E (Allikmets et al. 1997a, 1997b), L1970F (Lewis et al. 1999), L2027F (Nasonkin et al. 1998), V2050L (Lewis et al. 1999), E2131K (Lewis et al. 1999), R2139W (Lewis et al. 1999), 6709insG (Lewis et al. 1999), D2177N (Allikmets et al. 1997a, 1997b), 2181del12 (Lewis et al. 1999). Login to comment

[hide] Mutations in ABCR (ABCA4) in patients with Stargar... Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36. Briggs CE, Rucinski D, Rosenfeld PJ, Hirose T, Berson EL, Dryja TP
Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.
Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36., [PMID:11527935]

Abstract [show]
PURPOSE: To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). METHODS: One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. RESULTS: The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. CONCLUSIONS: This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Specifically, Leu541Pro, Pro1380Leu, Gly1961Glu, and Leu2027Phe were not identified in any of the control individuals (P Ͻ 0.04). Login to comment
83 One family had an index member (034-045) who was heterozygous for the missense changes Ile824Thr and Gly1961Glu. Login to comment
84 The Gly1961Glu allele27 was found to have been inherited from the patient`s mother, but the Ile824Thr allele was not detected in either parent or in any sibling. Login to comment
87 We did not conduct further studies to determine whether the Ile824Thr and Gly1961Glu changes were allelic in this index patient. Login to comment
89 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 ϩ 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 ϩ 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 ϩ 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 ϩ 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 ϩ 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 ϩ 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. Login to comment
62 Specifically, Leu541Pro, Pro1380Leu, Gly1961Glu, and Leu2027Phe were not identified in any of the control individuals (P b0d; 0.04). Login to comment
82 One family had an index member (034-045) who was heterozygous for the missense changes Ile824Thr and Gly1961Glu. Login to comment
86 We did not conduct further studies to determine whether the Ile824Thr and Gly1961Glu changes were allelic in this index patient. Login to comment
88 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 af9; 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 af9; 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 af9; 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 af9; 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 af9; 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 af9; 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None IOVS, September 2001, Vol. 42, No. 10 ABCR in Stargardt Macular Degeneration Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. 10 TABLE 1 (continued). Login to comment

[hide] Spectrum of ABCA4 (ABCR) gene mutations in Spanish... Hum Mutat. 2001 Jun;17(6):504-10. Paloma E, Martinez-Mir A, Vilageliu L, Gonzalez-Duarte R, Balcells S
Spectrum of ABCA4 (ABCR) gene mutations in Spanish patients with autosomal recessive macular dystrophies.
Hum Mutat. 2001 Jun;17(6):504-10., [PMID:11385708]

Abstract [show]
The ABCA4 gene has been involved in several forms of inherited macular dystrophy. In order to further characterize the complex genotype-phenotype relationships involving this gene, we have performed a mutation analysis of ABCA4 in 14 Spanish patients comprising eight STGD (Stargardt), four FFM (fundus flavimaculatus), and two CRD (Cone-rod dystrophy) patients. SSCP (single-strand conformation polymorphism) analysis and DNA sequencing of the coding and 5' upstream regions of this gene allowed the identification of 16 putatively pathogenic alterations, nine of which are novel. Most of these were missense changes, and no patient was found to carry two null alleles. Overall, the new data agree with a working model relating the different pathogenic phenotypes to the severity of the mutations. When considering the information presented here together with that of previous reports, a picture of the geographic distribution of three particular mutations emerges. The R212C change has been found in French, Italian, Dutch, German, and Spanish but not in British patients. In the Spanish collection, R212C was found in a CRD patient, indicating that it may be a rather severe change. In contrast, c.2588G>C, a very common mild allele in the Dutch population, is rarely found in Southern Europe. Interestingly, the c.2588G>C mutation has been found in a double mutant allele together with the missense R1055W. Finally, the newly described L1940P was found in two unrelated Spanish patients, and may be a moderate to severe allele.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Pathogenic Mutations In the absence of a functional assay, it is difficult to relate the structural alteration with the TABLE 1. Summary of the Pathogenic Variants Found in the Screening of the ABCA4 Gene Family (NAS) Paternal allele (E) Maternal allele (E) Onset (years) Phenotype SB1 c.3211-3212insGT (22) R212C (6) 9 CRD M266 (2) c.4253+5G>A (28) L2060R (46) 7/4 CRD SM3 [R152Q (5); R2107H (46)] [R152Q (5); R2107H (46)] 7 STGD SZ2 L1940P (41) ND 8 STGD SM1 N1799D (38) ND 9 STGD SM2 c.2888delG (19) [R1055W (21); C.2588G>C (17)] 11 STGD SP1 ND ND 12 STGD SZ3 ND ND 12 STGD M280 N1805D (39) N1805D (39) 14 STGD SB2 (2) R1108C (22) L686S (14) 18/11 STGD SZ4 ND ND 20/28 FFM SP2 ND ND 21 FFM SM4 [T1253L (25); G1961E (42)] ND 38 FFM SZ1 L1940P (41) ND 28 FFM Novel putative pathogenic variants are depicted in bold type and their corresponding nucleotide changes are as follows: L686S=c.2057T>C; R1055W=c.3163C>T; T1253L=c.3758C>T; N1799D=c.5396A>G; N1805D=c.5413A>G; L1940P=c.5819T>C; L2060R=c.6179T>G. Login to comment
93 3) Mutation G1961E, which has been reported in most populations as rather infrequent (16/150 USA, 2/40 Dutch, 2/11 Italian, and 1/14 Spanish), has now been reported as very frequent in Germany (33/144). Login to comment

[hide] The ABCA4 gene and age-related macular degeneratio... Arch Ophthalmol. 2001 May;119(5):752-3. Gorin MB
The ABCA4 gene and age-related macular degeneration: innocence or guilt by association.
Arch Ophthalmol. 2001 May;119(5):752-3., [PMID:11346403]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 The family studies conducted with grandparents of patients with Stargardt disease have been criticized for ascertainment bias and/or inadequate statistical power.7,11 However, studies that claim that the presence of a particular ABCA4 variant in a family member who lacks any evidence of ARMD dis- proves a disease association are also limited by a lack of statistical power and an inability to estimate the extent that incomplete penetrance may play a role in ARMD.6 Guymer and coauthors illustrate this issue clearly in their reporting of the G1961E allele in unaffected family members with ARMD, and they accurately present their findings within the correct genetic context that considers incomplete penetrance. Login to comment
16 The high prevalence of the G1961E allele in the healthy individuals of Somali ancestry and the range of G1961E allele frequencies observed between the US and Swiss patients illustrate the need to constantly consider this problem. Login to comment
18 The high prevalence of the G1961E allele in the healthy Somali population tends to minimize the argument that this allele is disease causing because there is no reported high incidence of either ARMD or Stargardt See also page 745 EDITORIAL (REPRINTED) ARCH OPHTHALMOL/VOL 119, MAY 2001 WWW.ARCHOPHTHALMOL.COM (c)2001 American Medical Association. All rights reserved. Login to comment
23 Yet other investigators have found no particular association of the G1961E allele with either exudative or atrophic ARMD.8 In the study by Allikmets, the classification of the patients was based on photographs in accordance with the International Classification System,16 which is designed to grade types and severity of ARMD-related disease but does not distinguish ARMD from other conditions. Login to comment
22 Yet other investigators have found no particular association of the G1961E allele with either exudative or atrophic ARMD.8 In the study by Allikmets, the classification of the patients was based on photographs in accordance with the International Classification System,16 which is designed to grade types and severity of ARMD-related disease but does not distinguish ARMD from other conditions. Login to comment

[hide] Variation of codons 1961 and 2177 of the Stargardt... Arch Ophthalmol. 2001 May;119(5):745-51. Guymer RH, Heon E, Lotery AJ, Munier FL, Schorderet DF, Baird PN, McNeil RJ, Haines H, Sheffield VC, Stone EM
Variation of codons 1961 and 2177 of the Stargardt disease gene is not associated with age-related macular degeneration.
Arch Ophthalmol. 2001 May;119(5):745-51., [PMID:11346402]

Abstract [show]
OBJECTIVES: To investigate the role of 2 specific alleles of the Stargardt disease gene (ABCA4) in the pathogenesis of age-related macular degeneration (AMD). Secondary objectives were to investigate differences in frequency of the G1961E allele in selected ethnic groups as well as to examine the segregation of both G1961E and D2177N alleles in 5 multiplex families with AMD. METHODS: Five hundred forty-four patients with AMD and 689 controls were ascertained from 3 continents. Blood samples from 62 normal individuals of Somalian ancestry were also obtained. Participants were screened for the presence of these ABCA4 alleles with a combination of restriction digestion and single-strand conformation polymorphism analysis of polymerase chain reaction amplification products. Detected alleles were confirmed by DNA sequencing. The number of subjects exhibiting the G1961E or D2177N variants were compared between AMD and control groups using a 2-tailed Fisher exact test. RESULTS: There was no significant difference (P >.1) in the frequency of the G1961E and D2177N alleles in patients with AMD (2.2%) vs controls (1.0%). In contrast, there was a significant difference (P< .001) in the frequency of the G1961E alleles between normal individuals of Somali ancestry (11.3%) and normal individuals from other populations (0.4%). There was no evidence of cosegregation of these alleles and the AMD phenotype in the 5 multiplex families with AMD examined. These two ABCA4 alleles were slightly more frequent in patients with AMD with choroidal neovascularization (2.7%) than those without this complication (2.5%). CONCLUSIONS: Somali ancestry is more than 100 times more strongly associated with presence of the G1961E allele than the AMD phenotype. This study did not find any statistically significant evidence for involvement of the G1961E or D2177N alleles of the ABCA4 gene in AMD. CLINICAL RELEVANCE: The ABCA4 gene is definitively involved in the pathogenesis of Stargardt disease and some cases of photoreceptor degeneration. However, it does not seem to be involved in a statistically significant fraction of AMD cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 Secondary objectives were to investigate differences in frequency of the G1961E allele in selected ethnic groups as well as to examine the segregation of both G1961E and D2177N alleles in 5 multiplex families with AMD. Login to comment
6 The number of subjects exhibiting the G1961E orD2177NvariantswerecomparedbetweenAMDandcon- trol groups using a 2-tailed Fisher exact test. Login to comment
7 Results: There was no significant difference (PϾ.1) in the frequency of the G1961E and D2177N alleles in patients with AMD (2.2%) vs controls (1.0%). Login to comment
8 In contrast, there was a significant difference (PϽ.001) in the frequency of the G1961E alleles between normal individuals of Somali ancestry (11.3%) and normal individuals from other populations (0.4%). Login to comment
11 Conclusions: Somali ancestry is more than 100 times more strongly associated with presence of the G1961E allele than the AMD phenotype. Login to comment
12 This study did not find any statistically significant evidence for involvement of the G1961E or D2177N alleles of the ABCA4 gene in AMD. Login to comment
24 (1) The primary purpose was to try to clarify the role of ABCA4 in AMD by screening a large cohort of patients with AMD and ethnically matched controls for the presence of the 2 sequence variations (G1961E and D2177N) that were most highly associated with AMD in the study by Allikmets et al.7 (2) A secondary purpose was to investigate the variation in allele frequency of G1961E among selected ethnic groups. Login to comment
25 (3) The final purpose was to examine the segregation of the G1961E and D2177N alleles in 5 multiplex families with AMD from Australia. Login to comment
26 RESULTS The distributions of G1961E and D2177N sequence variations in the various AMD and control populations are summarized in Table 1. Login to comment
28 Five instances of the G1961E variation and 7 instances of the D2177N change were observed among the patients with AMD, while 3 instances of G1961E and 4 of D2177N were observed among the controls. Login to comment
30 A Fisher exact test revealed the differences in allele frequency between these groups to be insignificant whether the alleles were considered together or separately (PϾ.10 in all cases) even without correction for multiple measurements.27 Collectively, the G1961E and D2177N sequence changes were found in 2.2% of the 544 patients with AMD in this study, ranging from 0.99% in patients from the United States to 5.1% in patients from Switzerland. Login to comment
42 MOLECULAR ANALYSIS The DNA was extracted from venous blood as previously described.24 Exons 42 and 48 (containing codons 1961 and 2177 respectively) of the ABCA4 gene were amplified using previously reported oligonucleotide primers.7,25 The G1961E variant was detected using a Taq 1 restriction digestion as follows. Login to comment
44 Five microliters of the digested product were electrophoresed on 6% polyacrylamide, 5% glycerol nondenaturing gels, and stained with silver nitrate using a standard protocol.26 The G1961E allele was recognized by the appearance of 2 new fragments 135 base pair (bp) and 77 bp in size and confirmed by automated DNA sequencing using dye-terminator chemistry and an ABI 377 sequencer. Login to comment
45 The D2177N allele was detected by single-strand conformation polymorphism analysis. Login to comment
49 STATISTICAL ANALYSIS The proportion of subjects showing the G1961E or D2177N variant were compared between AMD and control groups using the Fisher exact test (2-tailed). Login to comment
54 Two of these 5 individuals were homozygous for G1961E, and both of them were patients with Somali ancestry. Login to comment
55 The fact that these were the only 2 Stargardt probands in the entire cohort who were known to have Somali ancestry suggested that the G1961E allele frequency might be much higher in individuals from Somalia than those from other ethnic backgrounds. Login to comment
56 To test this hypothesis, 62 unrelated normal individuals with Somali ancestry were screened for the G1961E change, and 7 were found to be heterozygous for this variant (11.2%). Login to comment
57 Table 2 gives the result of sequential comparisons (Fisher exact test) of the frequency of the G1961E change in normal individuals in Somalia and normal individuals from our other study populations. Login to comment
58 The frequency of the G1961E change is significantly greater in normal individuals of Somali ancestry than in normal individuals from other ethnic backgrounds. Login to comment
59 Table 3 gives a similar set of sequential comparisons between the frequency of the G1961E change in normal individuals from Somalia and the frequency of the change in patients with AMD in our study. Login to comment
60 The frequency of the G1961E change is significantly greater in unaffected individuals from Somalia than in the entire cohort of patients with AMD in this study (PϽ.001). Login to comment
61 Five of the 7 AMD probands from Australia who harbored a G1961E or D2177N change had family members who also carried the clinical diagnosis of AMD. Login to comment
64 Of the 15 family members diagnosed with AMD, 8 harbored a G1961E or D2177N change. Login to comment
68 The G1961E or D2177N sequence variations were found in 6 of the patients (2.7%) with CNV and 6 of the patients (2.5%) who were free from this complication. Login to comment
70 G1961E Association With Age-Related Macular Degeneration* Location No. Login to comment
117 G1961E Association With Ethnicity (Somali Controls vs Other Controls)* Location No. Login to comment
122 G1961E Association With Ethnicity (Somali Controls vs Patients With AMD)* Location No. Login to comment
133 Therefore, in this study, we focused on the 2 sequence variations (G1961E and D2177N) that were most plausibly associated with AMD in the study by Allikmets et al.7 In that study, Allikmets and colleagues found evidence that one or the other of those 2 sequence variations were found in approximately 8% of patients with AMD (one-half of the total ABCA4 association they observed). Login to comment
134 Although these 2 sequence variations were statistically associated with AMD when considered by themselves,7 there was no statistical association with AMD if all of the observed missense variations were included in the analysis, or alternatively, if all of the various subgroup analyses were subjected to a statistical correction for multiple measurements.16 In this study, we failed to find any statistically significant association between AMD and the presence of the G1961E and D2177N ABCA4 sequence variations. Login to comment
140 Her visual acuity was 20/200 OD. Although 5 of her 6 siblings harbored the G1961E allele, she did not. Login to comment
142 Although this woman did harbor the G1961E allele, the clinicians who examined her felt that she was unaffected by AMD. Login to comment
146 A plus indicates the presence of a heterozygous ABCA4 sequence variation that was present in the family`s proband (G1961E for family 1, and D2177N for families 2-5). Login to comment
150 The sample size of this study was also large enough to result in a 95% power (␣=.05) to detect such a 3-fold difference if the frequency in the AMD cohort was as large as had been previously suggested (ie, 7.8% vs 2.6%).7 An interesting observation in the study by Allikmets and coauthors7 was that the G1961E and D2177N sequence variations were more commonly found in patients who had not experienced CNV. Login to comment
153 Of the 12 patients with AMD in this study who harbor G1961E or D2177N sequence variations, 6 had CNV. Login to comment
157 For example, in this study, we found that the frequency of the G1961E allele was significantly higher in patients of Somali ancestry than in control populations from the United States, Australia, and Switzerland (Table 2) or AMD populations in the United States and Australia (Table 3). Login to comment
158 Although further work needs to be performed to carefully characterize the phenotype of G1961E heterozygotes with Somali ancestry, the point to be made in the present context is that Somali ancestry is more than 100 times more highly correlated to the presence of the G1961E sequence variation than the presence of AMD. Login to comment
174 In the present study, we examined all of the siblings of 5 families affected with AMD who were also found to harbor a G1961E or D2177N ABCA4 allele. Login to comment
182 The fact that 11% of people of Somali ancestry are heterozygous for the G1961E allele would predict that more than 1% of that population would be homozygous. Login to comment
183 The fact that Stargardt disease is not known to be 100 times more prevalent in this population than in the United States, Switzerland, or Australia suggests that G1961E does not frequently cause disease in the homozygous state. Login to comment
184 It raises the testable hypothesis that G1961E is more likely to cause disease in the compound heterozygous state than in the homozygous state. Login to comment
185 Thus at the present time, it seems that we do not fully understand the pathogenic role of the G1961E allele even in patients with Stargardt disease (with which the allele has been significantly associated in multiple studies). Login to comment
27 RESULTS The distributions of G1961E and D2177N sequence variations in the various AMD and control populations are summarized in Table 1. Login to comment
29 Five instances of the G1961E variation and 7 instances of the D2177N change were observed among the patients with AMD, while 3 instances of G1961E and 4 of D2177N were observed among the controls. Login to comment
31 A Fisher exact test revealed the differences in allele frequency between these groups to be insignificant whether the alleles were considered together or separately (P..10 in all cases) even without correction for multiple measurements.27 Collectively, the G1961E and D2177N sequence changes were found in 2.2% of the 544 patients with AMD in this study, ranging from 0.99% in patients from the United States to 5.1% in patients from Switzerland. Login to comment
43 MOLECULAR ANALYSIS The DNA was extracted from venous blood as previously described.24 Exons 42 and 48 (containing codons 1961 and 2177 respectively) of the ABCA4 gene were amplified using previously reported oligonucleotide primers.7,25 The G1961E variant was detected using a Taq 1 restriction digestion as follows. Login to comment
50 STATISTICAL ANALYSIS The proportion of subjects showing the G1961E or D2177N variant were compared between AMD and control groups using the Fisher exact test (2-tailed). Login to comment
62 Five of the 7 AMD probands from Australia who harbored a G1961E or D2177N change had family members who also carried the clinical diagnosis of AMD. Login to comment
65 Of the 15 family members diagnosed with AMD, 8 harbored a G1961E or D2177N change. Login to comment
69 The G1961E or D2177N sequence variations were found in 6 of the patients (2.7%) with CNV and 6 of the patients (2.5%) who were free from this complication. Login to comment
71 G1961E Association With Age-Related Macular Degeneration* Location No. Login to comment
118 G1961E Association With Ethnicity (Somali Controls vs Other Controls)* Location No. Login to comment
123 G1961E Association With Ethnicity (Somali Controls vs Patients With AMD)* Location No. Login to comment
135 Although these 2 sequence variations were statistically associated with AMD when considered by themselves,7 there was no statistical association with AMD if all of the observed missense variations were included in the analysis, or alternatively, if all of the various subgroup analyses were subjected to a statistical correction for multiple measurements.16 In this study, we failed to find any statistically significant association between AMD and the presence of the G1961E and D2177N ABCA4 sequence variations. Login to comment
141 Her visual acuity was 20/200 OD. Although 5 of her 6 siblings harbored the G1961E allele, she did not. Login to comment
143 Although this woman did harbor the G1961E allele, the clinicians who examined her felt that she was unaffected by AMD. Login to comment
147 A plus indicates the presence of a heterozygous ABCA4 sequence variation that was present in the family`s proband (G1961E for family 1, and D2177N for families 2-5). Login to comment
151 The sample size of this study was also large enough to result in a 95% power (a=.05) to detect such a 3-fold difference if the frequency in the AMD cohort was as large as had been previously suggested (ie, 7.8% vs 2.6%).7 An interesting observation in the study by Allikmets and coauthors7 was that the G1961E and D2177N sequence variations were more commonly found in patients who had not experienced CNV. Login to comment
154 Of the 12 patients with AMD in this study who harbor G1961E or D2177N sequence variations, 6 had CNV. Login to comment
159 Although further work needs to be performed to carefully characterize the phenotype of G1961E heterozygotes with Somali ancestry, the point to be made in the present context is that Somali ancestry is more than 100 times more highly correlated to the presence of the G1961E sequence variation than the presence of AMD. Login to comment
175 In the present study, we examined all of the siblings of 5 families affected with AMD who were also found to harbor a G1961E or D2177N ABCA4 allele. Login to comment
186 Thus at the present time, it seems that we do not fully understand the pathogenic role of the G1961E allele even in patients with Stargardt disease (with which the allele has been significantly associated in multiple studies). Login to comment

[hide] L- and M-cone-driven electroretinograms in Stargar... Invest Ophthalmol Vis Sci. 2001 May;42(6):1380-9. Scholl HP, Kremers J, Vonthein R, White K, Weber BH
L- and M-cone-driven electroretinograms in Stargardt's macular dystrophy-fundus flavimaculatus.
Invest Ophthalmol Vis Sci. 2001 May;42(6):1380-9., [PMID:11328755]

Abstract [show]
PURPOSE: To study the dynamics of the long (L)- and middle (M)-wavelength-sensitive cone-driven pathways and their interactions in patients with Stargardt's macular dystrophy-fundus flavimaculatus (SMD-FF) and to correlate them with other clinical parameters and individual genotypes. METHODS: Forty-seven patients with SMD-FF participated in the study. In addition to standard 30-Hz flicker electroretinograms (30-Hz fERG), ERG responses were measured to stimuli that modulated exclusively the L or the M cones (L/M cones) or the two simultaneously. Blood samples were screened for mutations in the 50 exons of the ABCA4 gene. RESULTS: Patients with SMD-FF did not show a decrease in the mean L/M-cone-driven ERG sensitivity, but there was a significant increase in the interindividual variability. The mean L-/M-cone weighting ratio was normal. However, the L-cone-driven ERG was significantly phase delayed, whereas the M-cone-driven ERG was significantly phase advanced. These phase changes were significantly correlated with disease duration. The amplitude and implicit time of the standard 30-Hz fERG both correlated significantly with the L/M-cone-driven ERG sensitivity and with the phase difference between the L/M-cone-driven ERGs, indicating the complex origin of the standard 30-Hz fERG. Probable disease-associated mutations in the ABCA4 gene were found in 40 of 45 patients, suggesting that they form a genetically fairly uniform SMD-FF study group. There was no correlation between the genotype and the L/M-cone-driven ERGS: CONCLUSIONS: The changes in L/M-cone-driven ERG sensitivity and phase possibly represent two independent disease processes. The phase changes are similar to those found in patients with retinitis pigmentosa and possibly are a general feature of retinal dystrophies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Characteristics of the Patients with SMD-FF Patient Sex Age (y) Age at Onset (y) VA CFC DF CV Exon (1) Mut (1) Exon (2) Mut (2) 1 M 32 29 0.6 Moderate ϩ Normal 48 L2241V NF 2 F 39 23 0.4 Moderate - Chaotic 14 W663X 42 G1961E 3 M 34 16 0.1 Moderate ϩ - 42 G1961E NF 4 M 49 17 0.1 Severe ϩ NP 6 G768T/splice 42 G1961E 5 F 36 35 0.6 Moderate ϩ VS (T) 6 C230S 42 G1961E 6 M 28 17 0.1 Mild ϩϩ INS 40 R1898H 43 G1975R 7 M 20 9 0.05 Moderate ϩϩ VS (P/D) 12 ϩ 21 L541P ϩ A1038V 40 IVS40 ϩ 5G 3 A 8 M 33 6 0.1 Mild - Chaotic NF NF 9 M 39 29 0.2 Moderate ϩ VS (P/D) 13 G607R 42 G1961E 10 M 38 22 0.1 Severe ϩ Chaotic NF NF 11 F 28 20 0.7 Mild ϩϩ INS 3 A60T 40 R1898H 12 M 46 30 0.5 Mild ϩ Chaotic 11 E471K 42 G1961E 13 F 25 11 0.1 Moderate ϩϩ S 17 G863A NF 14 F 51 41 0.8 Moderate ϩϩ NP 40 R1898H NF 15 F 23 17 0.1 Mild - Chaotic 3 P68L 36 S1689P 16 F 33 30 0.4 Mild - Chaotic 28 E1399K 42 G1961E 17 F 41 36 0.1 Severe ϩ VS (T) 29 F1440V 37 G1748R 18 M 59 54 0.1 Severe ϩ VS (P/D) 42 G1961E NF 19* M 35 15 0.05 Moderate ϩ Chaotic 17 G863A 37 Q1750X 20* M 43 14 HM Severe ϩϩ NP 17 G863A 37 Q1750X 21 F 46 16 0.1 Moderate ϩ NP NF NF 22 F 32 22 0.05 Moderate ϩ INS 21 A1038V NF 23 M 50 42 0.3 Severe ϩϩ VS (P/D) 12 ϩ 21 L541P ϩ A1038V 17 G863A 24 F 30 14 0.1 Moderate ϩϩ INS 17 G863A 40 IVS40 ϩ 5G 3 A 25 M 36 25 0.5 Moderate ϩϩ - 3 296INSA 21 A1038V 26 M 40 23 0.2 Moderate ϩ S 3 296INSA 42 G1961E 27 F 35 9 0.1 Severe ϩϩ VS (P/D) 22 R1108C NF 28 F 23 18 0.05 Mild ϩϩ S 28 E1399K 43 G1977S 29 F 25 18 0.2 Mild ϩ Chaotic 37 L1763P NF 30 F 16 11 0.1 Moderate ϩ Chaotic 22 R1108C NF 31 M 40 35 0.1 Moderate ϩϩ VS (P/D) 14 R681X NF 32 F 28 27 0.1 Moderate ϩ S 12 ϩ 21 L541P ϩ A1038V 21 A1038V 33 M 32 9 0.05 Severe ϩϩ Chaotic 28 Q1412X 45 R2077W 34 F 23 21 0.2 Moderate ϩ INS 6 G768T/splice NF 35 F 38 33 FC Moderate - Chaotic 17 G863A NF 36 F 39 10 HM Severe ϩϩ NP NF NF 37 F 13 8 0.1 Moderate ϩϩ S - - 38 F 27 25 0.2 Moderate ϩ Chaotic 17 G863A 28 Q1412X 39 M 16 15 0.1 Moderate ϩ VS (P/D) 12 ϩ 17 R572Q ϩ G863A 35 IVS35 ϩ 2T 3 A 40 M 27 26 0.6 Moderate - S 17 G863A NF 41 M 18 16 0.2 Moderate ϩ - - - 42 M 25 24 0.1 Mild - - NF NF 43 F 29 9 0.1 Moderate ϩ Chaotic 12 ϩ 21 L541P ϩ A1038V 42 G1961E 44 M 39 28 0.1 Mild - NP 6 N247S NF 45 F 23 12 0.05 Mild - NP 6 R212C 19 T959I 46 M 43 36 0.2 Moderate ϩ VS (P/D) 21 A1038V NF 47 M 21 18 0.4 Mild ϩϩ INS 28 Q1412X NF Shown are age at examination, age of onset, visual acuity, central fundus changes, and existence and distribution of the typical white-yellow flecks. Login to comment
204 Correlation with Genotype It has been proposed that residual ABCA4 protein activity determines the clinical phenotype of SMD-FF and other related retinal diseases, whereas the pairing of two null or severe mutations is thought to lead to a more severe phenotype resembling a cone-rod dystrophy or inverse RP.33-35 The mutation profile in our group of patients with SMD-FF (with two identified mutations) is in concordance with this model, because only a combination of a mild and severe mutation (e.g., G1961E and 296insA) or of two moderate mutations (e.g., IVS40ϩ5G3A and A1038V) were encountered, whereas the pairing of two null or severe mutations was not observed in our patient sample. Login to comment
44 Characteristics of the Patients with SMD-FF Patient Sex Age (y) Age at Onset (y) VA CFC DF CV Exon (1) Mut (1) Exon (2) Mut (2) 1 M 32 29 0.6 Moderate af9; Normal 48 L2241V NF 2 F 39 23 0.4 Moderate afa; Chaotic 14 W663X 42 G1961E 3 M 34 16 0.1 Moderate af9; - 42 G1961E NF 4 M 49 17 0.1 Severe af9; NP 6 G768T/splice 42 G1961E 5 F 36 35 0.6 Moderate af9; VS (T) 6 C230S 42 G1961E 6 M 28 17 0.1 Mild af9;af9; INS 40 R1898H 43 G1975R 7 M 20 9 0.05 Moderate af9;af9; VS (P/D) 12 af9; 21 L541P af9; A1038V 40 IVS40 af9; 5G 3 A 8 M 33 6 0.1 Mild afa; Chaotic NF NF 9 M 39 29 0.2 Moderate af9; VS (P/D) 13 G607R 42 G1961E 10 M 38 22 0.1 Severe af9; Chaotic NF NF 11 F 28 20 0.7 Mild af9;af9; INS 3 A60T 40 R1898H 12 M 46 30 0.5 Mild af9; Chaotic 11 E471K 42 G1961E 13 F 25 11 0.1 Moderate af9;af9; S 17 G863A NF 14 F 51 41 0.8 Moderate af9;af9; NP 40 R1898H NF 15 F 23 17 0.1 Mild afa; Chaotic 3 P68L 36 S1689P 16 F 33 30 0.4 Mild afa; Chaotic 28 E1399K 42 G1961E 17 F 41 36 0.1 Severe af9; VS (T) 29 F1440V 37 G1748R 18 M 59 54 0.1 Severe af9; VS (P/D) 42 G1961E NF 19* M 35 15 0.05 Moderate af9; Chaotic 17 G863A 37 Q1750X 20* M 43 14 HM Severe af9;af9; NP 17 G863A 37 Q1750X 21 F 46 16 0.1 Moderate af9; NP NF NF 22 F 32 22 0.05 Moderate af9; INS 21 A1038V NF 23 M 50 42 0.3 Severe af9;af9; VS (P/D) 12 af9; 21 L541P af9; A1038V 17 G863A 24 F 30 14 0.1 Moderate af9;af9; INS 17 G863A 40 IVS40 af9; 5G 3 A 25 M 36 25 0.5 Moderate af9;af9; - 3 296INSA 21 A1038V 26 M 40 23 0.2 Moderate af9; S 3 296INSA 42 G1961E 27 F 35 9 0.1 Severe af9;af9; VS (P/D) 22 R1108C NF 28 F 23 18 0.05 Mild af9;af9; S 28 E1399K 43 G1977S 29 F 25 18 0.2 Mild af9; Chaotic 37 L1763P NF 30 F 16 11 0.1 Moderate af9; Chaotic 22 R1108C NF 31 M 40 35 0.1 Moderate af9;af9; VS (P/D) 14 R681X NF 32 F 28 27 0.1 Moderate af9; S 12 af9; 21 L541P af9; A1038V 21 A1038V 33 M 32 9 0.05 Severe af9;af9; Chaotic 28 Q1412X 45 R2077W 34 F 23 21 0.2 Moderate af9; INS 6 G768T/splice NF 35 F 38 33 FC Moderate afa; Chaotic 17 G863A NF 36 F 39 10 HM Severe af9;af9; NP NF NF 37 F 13 8 0.1 Moderate af9;af9; S - - 38 F 27 25 0.2 Moderate af9; Chaotic 17 G863A 28 Q1412X 39 M 16 15 0.1 Moderate af9; VS (P/D) 12 af9; 17 R572Q af9; G863A 35 IVS35 af9; 2T 3 A 40 M 27 26 0.6 Moderate afa; S 17 G863A NF 41 M 18 16 0.2 Moderate af9; - - - 42 M 25 24 0.1 Mild afa; - NF NF 43 F 29 9 0.1 Moderate af9; Chaotic 12 af9; 21 L541P af9; A1038V 42 G1961E 44 M 39 28 0.1 Mild afa; NP 6 N247S NF 45 F 23 12 0.05 Mild afa; NP 6 R212C 19 T959I 46 M 43 36 0.2 Moderate af9; VS (P/D) 21 A1038V NF 47 M 21 18 0.4 Mild af9;af9; INS 28 Q1412X NF Shown are age at examination, age of onset, visual acuity, central fundus changes, and existence and distribution of the typical white-yellow flecks. Login to comment
205 Correlation with Genotype It has been proposed that residual ABCA4 protein activity determines the clinical phenotype of SMD-FF and other related retinal diseases, whereas the pairing of two null or severe mutations is thought to lead to a more severe phenotype resembling a cone-rod dystrophy or inverse RP.33-35 The mutation profile in our group of patients with SMD-FF (with two identified mutations) is in concordance with this model, because only a combination of a mild and severe mutation (e.g., G1961E and 296insA) or of two moderate mutations (e.g., IVS40af9;5G3A and A1038V) were encountered, whereas the pairing of two null or severe mutations was not observed in our patient sample. Login to comment

[hide] An analysis of allelic variation in the ABCA4 gene... Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89. Webster AR, Heon E, Lotery AJ, Vandenburgh K, Casavant TL, Oh KT, Beck G, Fishman GA, Lam BL, Levin A, Heckenlively JR, Jacobson SG, Weleber RG, Sheffield VC, Stone EM
An analysis of allelic variation in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89., [PMID:11328725]

Abstract [show]
PURPOSE: To assess the allelic variation of the ATP-binding transporter protein (ABCA4). METHODS: A combination of single-strand conformation polymorphism (SSCP) and automated DNA sequencing was used to systematically screen this gene for sequence variations in 374 unrelated probands with a clinical diagnosis of Stargardt disease, 182 patients with age-related macular degeneration (AMD), and 96 normal subjects. RESULTS: There was no significant difference in the proportion of any single variant or class of variant between the control and AMD groups. In contrast, truncating variants, amino acid substitutions, synonymous codon changes, and intronic variants were significantly enriched in patients with Stargardt disease when compared with their presence in subjects without Stargardt disease (Kruskal-Wallis P < 0.0001 for each variant group). Overall, there were 2480 instances of 213 different variants in the ABCA4 gene, including 589 instances of 97 amino acid substitutions, and 45 instances of 33 truncating variants. CONCLUSIONS: Of the 97 amino acid substitutions, 11 occurred at a frequency that made them unlikely to be high-penetrance recessive disease-causing variants (HPRDCV). After accounting for variants in cis, one or more changes that were compatible with HPRDCV were found on 35% of all Stargardt-associated alleles overall. The nucleotide diversity of the ABCA4 coding region, a collective measure of the number and prevalence of polymorphic sites in a region of DNA, was found to be 1.28, a value that is 9 to 400 times greater than that of two other macular disease genes that were examined in a similar fashion (VMD2 and EFEMP1).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
148 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His. Login to comment
172 Similarly, the Gly1961Glu variant was always associated with either of two rare alleles at codon 1948 (CCG, CTG), which in turn were always found on chromosomes bearing the common intron 41 polymorphism. Login to comment
253 One note of caution is that a Stargardt-associated allele in one population, may no longer be in complete linkage disequilibrium with the disease in a different population, as we have recently shown for the most common change in white patients with Stargardt disease, Gly1961Glu, which appears to be quite common in normal individuals from Somalia.39 Further in vitro studies of mutated ABCA4 proteins, such as those reported by Sun et al.1 might help determine the dysfunction of, and thus the potential pathogenicity of, specific ABCA4 alleles. Login to comment
103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
149 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His. Login to comment
174 Similarly, the Gly1961Glu variant was always associated with either of two rare alleles at codon 1948 (CCG, CTG), which in turn were always found on chromosomes bearing the common intron 41 polymorphism. Login to comment
255 One note of caution is that a Stargardt-associated allele in one population, may no longer be in complete linkage disequilibrium with the disease in a different population, as we have recently shown for the most common change in white patients with Stargardt disease, Gly1961Glu, which appears to be quite common in normal individuals from Somalia.39 Further in vitro studies of mutated ABCA4 proteins, such as those reported by Sun et al.1 might help determine the dysfunction of, and thus the potential pathogenicity of, specific ABCA4 alleles. Login to comment

[hide] Simple and complex ABCR: genetic predisposition to... Am J Hum Genet. 2000 Oct;67(4):793-9. Epub 2000 Sep 1. Allikmets R
Simple and complex ABCR: genetic predisposition to retinal disease.
Am J Hum Genet. 2000 Oct;67(4):793-9. Epub 2000 Sep 1., [PMID:10970771]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 What makes ABCR an even more difficult diagnostic target than CFTR is that, across all populations studied, the most-frequent disease-associated ABCR alleles-for example, G1961E, G863A/ delG863, and A1038V-have been described in ~10% of patients with STGD, whereas the delF508 allele of CFTR accounts for close to 70% of all cystic fibrosis alleles (Zielenski and Tsui 1995). Login to comment
69 In that study, the two most common AMD-associated variants, G1961E and D2177N, were genotyped in 1,218 unrelated patients with AMD and in 1,258 reportedly unaffected, matched controls. Login to comment
72 The risk of AMD was estimated to be increased approximately threefold in carriers of D2177N and approximately fivefold in carriers of G1961E. Login to comment
81 Note that the relative risk estimates calculated on the basis of the meta-analysis are also increased compared with those in the consortium study (Allikmets 2000) and are estimated at ~4 for the D2177N mutation and at ~7 for the G1961E variant. Login to comment
115 For example, they demonstrate that both ABCR variants analyzed in the consortium study, G1961E and D2177N, affect the protein function in vitro. Login to comment
116 The mutant G1961E protein, produced after the transfection of human embryonic kidney (293) cells with cloned cDNA, exhibits both several-fold-lower binding of 8-azido-ATP and dramatic inhibition of ATPase activity by retinal, compared with the wild-type ABCR protein. Login to comment
119 These results will also challenge several suggestions (Fishman et al. 1999; Lotery et al. 2000) that G1961E, the mutation most frequently found in patients with STGD and/or AMD, is indeed a benign variant in linkage disequilibrium with another disease-causing mutation. Login to comment

[hide] A comprehensive survey of sequence variation in th... Am J Hum Genet. 2000 Oct;67(4):800-13. Epub 2000 Aug 24. Rivera A, White K, Stohr H, Steiner K, Hemmrich N, Grimm T, Jurklies B, Lorenz B, Scholl HP, Apfelstedt-Sylla E, Weber BH
A comprehensive survey of sequence variation in the ABCA4 (ABCR) gene in Stargardt disease and age-related macular degeneration.
Am J Hum Genet. 2000 Oct;67(4):800-13. Epub 2000 Aug 24., [PMID:10958763]

Abstract [show]
Stargardt disease (STGD) is a common autosomal recessive maculopathy of early and young-adult onset and is caused by alterations in the gene encoding the photoreceptor-specific ATP-binding cassette (ABC) transporter (ABCA4). We have studied 144 patients with STGD and 220 unaffected individuals ascertained from the German population, to complete a comprehensive, population-specific survey of the sequence variation in the ABCA4 gene. In addition, we have assessed the proposed role for ABCA4 in age-related macular degeneration (AMD), a common cause of late-onset blindness, by studying 200 affected individuals with late-stage disease. Using a screening strategy based primarily on denaturing gradient gel electrophoresis, we have identified in the three study groups a total of 127 unique alterations, of which 90 have not been previously reported, and have classified 72 as probable pathogenic mutations. Of the 288 STGD chromosomes studied, mutations were identified in 166, resulting in a detection rate of approximately 58%. Eight different alleles account for 61% of the identified disease alleles, and at least one of these, the L541P-A1038V complex allele, appears to be a founder mutation in the German population. When the group with AMD and the control group were analyzed with the same methodology, 18 patients with AMD and 12 controls were found to harbor possible disease-associated alterations. This represents no significant difference between the two groups; however, for detection of modest effects of rare alleles in complex diseases, the analysis of larger cohorts of patients may be required.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 Certain mutant alleles-for example, G863A, A1038V, and G1961E-appear to be more common and may have altered frequencies in different populations, as a result of founder effect (Maugeri et al. 1999; Simonelli et al. 2000). Login to comment
80 Nucleotide alterations occurring in sim- Table 2 ABCA4 Mutations Found in Patients with STGD and AMD and in Controls EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 3: 178GrA A60T 1 0 0 This study 179CrT A60E 1 0 0 This study 194GrA G65E 1 0 0 Fishman et al. (1999) 203CrT P68L 1 0 0 This study 214GrA G72R 1 0 0 This study 296insA Frameshift 2 0 0 This study 5: 454CrT R152X 1 0 0 This study 6: 634CrT R212C 1 0 0 Lewis et al. (1999) 688TrA C230S 1 0 0 This study 730delCT Frameshift 1 0 0 This study 740ArG N247S 1 0 0 This study 768GrT Splice 2 0 0 Maugeri et al. (1999) 8: 983ArT E328V 1a 0 0 This study 1086TrA Y362X 1 0 0 This study 10: 1317GrA W438X 1 0 0 This study 11: 1411GrA E471K 1 0 0 Lewis et al. (1999) 12: 1622TrC L541P 21a 1a 0 Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) 1715GrA R572Q 1a 0 0 Lewis et al. (1999) 13: 1819GrA G607R 1 0 0 This study 1903CrA Q635K 2a 0 0 This study 1903CrT Q635X 1 0 0 This study IVS13ϩ1GrA Splice 2 0 0 This study 14: 1957CrT R653C 1 0 0 This study 1988GrA W663X 1 0 0 This study 2041CrT R681X 4 0 0 Maugeri et al. (1999) 15: 2291GrA C764Y 1 0 0 This study 2292delT Frameshift 1a 0 0 This study 2295TrG S765R 1a 0 0 This study 16: 2564GrA W855X 1 0 0 Nasonkin et al. (1998) 17: 2588GrC Spliceb 17a 6 5 Allikmets et al. (1997a), Cremers et al. (1998), Lewis et al. (1999), Maugeri et al. (1999), Papaioannou et al. (2000) 18: 2701ArG T901A 0 2 0 This study 2741ArG H914A 0 0 1 This study 19: 2876CrT T959I 1 0 0 This study 20: IVS20ϩ5GrA Splice 1 0 0 This study 21: 3106GrA E1036K 1a 0 0 Nasonkin et al. (1998) 3113CrT A1038V 26a 4a 1 Allikmets et al. (1997a), Cremers et al. (1998), Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) T3187TrC S1063P 1 0 0 This study (Continued) 805 Table 2 Continued EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 22: 3292CrT R1097C 1 0 0 This study 3322CrT R1108C 4 0 0 Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999) 24: 3528insTGCA Frameshift 1 0 0 This study 25: 3808GrT E1270X 1 0 0 This study 27: 3898CrT R1300X 1 0 0 This study 28: IVS28ϩ5GrA Splice 1 0 0 This study 4139CrT P1380L 1 0 0 Lewis et al. (1999) 4195GrA E1399K 2 0 0 This study 4234CrT Q1412X 4 0 0 Maugeri et al. (1999) 29: 4289TrC L1430P 2 0 0 This study 4318TrG F1440V 1 0 0 This study 4328GrA R1443H 1 0 0 This study 30: 4457CrT P1486L 1 0 0 Lewis et al. (1999) 4463GrA C1488Y 1 0 0 This study 31: 4610CrT T1537M 1 0 0 This study 35: IVS35ϩ2TrA Splice 1 0 0 This study 36: 5065TrC S1689P 1 0 0 This study 5114GrT R1705L 1 0 0 This study IVS36ϩ1GrA Splice 1 0 0 This study 37: 5198TrC M1733T 0 0 1 This study 5242GrA G1748R 1 0 0 This study 5248CrT Q1750X 1 0 0 This study 5288TrC L1763P 1 0 0 This study 38: IVS38ϩ1GrA Splice 1 0 0 This study 40: 5653GrA E1885K 1 0 0 This study 5693GrA R1898H 5 2 1 Allikmets et al. (1997b), Lewis et al. (1999) IVS40ϩ5GrA Splice 8a 0 0 Cremers et al. (1998), Lewis et al. (1999), Maugeri et al. (1999) 42: 5882GrA G1961E 34 4 2 Allikmets et al. (1997b), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) 43: 5917delG Frameshift 3 0 0 This study 5923GrC G1975R 1 0 0 This study 5929GrA G1977S 1 0 0 Rozet et al. (1998), Lewis et al. (1999) 45: 6229CrG R2077G 1 0 0 This study 6229CrT R2077W 1 0 0 Allikmets et al. (1997a), Fishman et al. (1999), Lewis et al. (1999) 48: 6609CrA Y2203X 2 0 0 This study 6647GrT A2216V 0 0 1 This study a Mutation pairs occurring on a single haplotype. Login to comment
82 Table 3 Rare Sequence Variants in the ABCA4 Gene EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 5: 455GrA R152Q 3 1 3 This study 8: IVS8ϩ38ArT Unknown 0 1 0 This study 12: 1654GrA V552I 0 0 2 This study IVS11-6CrG Unknown 0 4 2 This study 13: 1932CrT D644D 2 0 0 This study 17: IVS16-12CrG Unknown 0 0 8 This study 18: IVS17-56CrG Unknown 3 0 0 This study IVS17-36CrT Unknown 0 2 1 This study 22: 3261ArC E1087D 1 0 0 This study 3264CrT P1088P 0 0 1 This study IVS21-20CrT Unknown 1 0 0 This study 23: IVS23ϩ10TrG Unknown 1 0 0 This study IVS23ϩ17GrC Unknown 1 0 0 This study 24: IVS23-28TrC Unknown 2 4 1 This study 25: 3759GrA T1253T 1 0 0 This study 28: 4140GrA P1380P 2 0 0 This study IVS28ϩ43GrA Unknown 4 3 1 This study 29: IVS29ϩ13GrA Unknown 0 1 0 This study IVS29ϩ32ArG Unknown 1 0 0 This study 31: 4578GrA T1526T 0 1 0 This study 32: IVS32ϩ45TrC Unknown 1 0 0 This study 33: IVS32-57TrG Unknown 0 0 1 This study 4685TrC I1562T 0 0 6 Allikmets et al. (1997b) 36: IVS36ϩ20GrA Unknown 1 0 0 This study 39: 5487GrT L1829L 0 0 1 This study IVS38-10TrC Unknown 9 0 0 Maugeri et al. (1999) 41: 5761GrA V1921M 1 1 1 This study 43: 5908CrT L1970F 1 0 1 Allikmets et al. (1997b), Rozet et al. (1998), Lewis et al. (1999) IVS43ϩ7ArC Unknown 1 0 0 This study 44: 6027CrT I2023I 1 0 0 Allikmets et al. (1997a), Nasonkin et al. (1998) 45: 6176GrC G2059A 0 0 1 This study 46: IVS46ϩ27GrA Unknown 0 0 1 This study 47: IVS46-46TrA Unknown 1 0 0 This study 48: IVS48ϩ21CrT Unknown 18a 2a 0 Allikmets et al. (1997b), Nasonkin et al. (1998), Papaioannou et al. (2000) 6529GrA D2177N 2 3 4 Allikmets et al. (1997b) 6721CrG L2241V 1 0 0 This study a Occurs together with G1961E in 17/18 and 2/2 instances. Login to comment
100 because of linkage disequilibrium with the mutation G1961E (data not shown). Login to comment
111 Likewise, for the intron 28 alteration, a spliced product Table 5 Patients with STGD Who Have Two Identified Disease Alleles AGE AT ONSET AND PATIENT MUTATION SEGREGATION IN FAMILY a Allele 1 Allele 2 5-9 years: STGD17 Q1412X R2077W Yes STGD88 G65E G1961E NA STGD93 G1961E G1961E Yes STGD99 L541P-A1038V G1961E Yes STGD100 L541P-A1038V IVS40ϩ5GrA Yes STGD108 Y362X IVS40ϩ5GrA Yes STGD109 L541P-A1038V W855X Yes STGD139b 5917delG 5917delG Yes STGD167 C1488Y IVS40ϩ5GrA Yes 10-14 years: STGD21 R681X R1898H NA STGD37 L541P-A1038V L541P-A1038V Yes STGD47/164 IVS13ϩ1GrA 2588GrC Yes STGD50 2588GrC A1038V NA STGD70 2588GrC IVS40ϩ5GrA NA STGD82 L541P-A1038V S1063P Yes STGD87 2588GrC Q1750X Yes STGD98 R212C T959I Yes STGD102 R572Q-2588GrC IVS35ϩ2TrA Yes STGD107 C764Y 3528ins4 Yes STGD120 L1430P L1430P NA STGD121 R1300X IVS40ϩ5GrA Yes STGD156 R1108C G1961E NA STGD159 R1108C Q1412X Yes STGD171 L541P-A1038V G1961E NA 15-19 years: STGD34 G768T G1961E Yes STGD39 L541P-A1038V R1443H NA STGD40/163 2588GrC E1885K Yes STGD45 E1399K G1977S Yes STGD59 R1898H G1975R NA STGD67 P68L S1689P Yes STGD75 Q635K IVS40ϩ5GrA Yes STGD111 2292delT-S765R G1961E Yes STGD114 Y2203X G1961E Yes STGD138 IVS13ϩ1GA 2588GrC Yes 20-24 years: STGD41 R681X G1961E Yes STGD63 A60T R1898H NA STGD86 296insA G1961E Yes STGD91 L541P-A1038V A1038V NA STGD113 L541P-A1038V 2588GrC Yes STGD118b IVS20ϩ5GrA G1961E Yes STGD119 L541P-A1038V G1961E Yes STGD122 L541P-A1038V G1961E Yes STGD135 W663X G1961E NA STGD147 IVS36ϩ1GrA G1961E Yes STGD168 L541P-A1038V G1961E NA 25-29 years: STGD62 G607R G1961E NA STGD71 296insA A1038V Yes STGD78 2588GrC Q1412X Yes STGD103 2588GrC IVS20ϩ5GrA Yes STGD116 L541P-A1038V G1961E Yes STGD139bb G1961E 5917delG Yes у30 years: STGD38 E471K G1961E Yes STGD68 E1399K G1961E Yes STGD69 L541P-A1038V 2588GrC NA STGD95 F1440V G1748R Yes STGD134 C230S G1961E NA STGD144 2588GrC R1705L NA STGD148 R1097C Y2203X NA STGD170 L541P-A1038V 2588GrC NA a NA p not applicable. Login to comment
149 Although the majority of mutations are rare, found in only one or two families, three disease alleles (2588GrC, L541P-A1038V, and G1961E) are present at high frequencies in the German population. Login to comment
150 The most frequent is G1961E, which represents 34 (20.5%) of 166 identified alleles, a frequency that is significantly higher than the 4%-9% reported in other studies (Allikmets 1997a; Lewis et al. 1999; Maugeri et al. 1999; Simonelli et al. 2000). Login to comment
172 On the contrary, specific mutations are associated with highly variable ages at onset; for example, compound heterozygosity for the complex allele L541P-A1038V and G1961E was found in patients with age at onset of 9-25 years (table 5). Login to comment
182 This stands in contrast to a recentP p .72 study, involving 15 research groups from the United States and Europe, that specifically investigated the frequency of two common ABCA4 variants, G1961E and D2177N, in a large cohort (11,200 individuals each) of patients with AMD and of controls (Allikmets and The International ABCR Screening Consortium 2000). Login to comment

[hide] Mutations in the ABCA4 (ABCR) gene are the major c... Am J Hum Genet. 2000 Oct;67(4):960-6. Epub 2000 Aug 24. Maugeri A, Klevering BJ, Rohrschneider K, Blankenagel A, Brunner HG, Deutman AF, Hoyng CB, Cremers FP
Mutations in the ABCA4 (ABCR) gene are the major cause of autosomal recessive cone-rod dystrophy.
Am J Hum Genet. 2000 Oct;67(4):960-6. Epub 2000 Aug 24., [PMID:10958761]

Abstract [show]
The photoreceptor cell-specific ATP-binding cassette transporter gene (ABCA4; previously denoted "ABCR") is mutated, in most patients, with autosomal recessive (AR) Stargardt disease (STGD1) or fundus flavimaculatus (FFM). In addition, a few cases with AR retinitis pigmentosa (RP) and AR cone-rod dystrophy (CRD) have been found to have ABCA4 mutations. To evaluate the importance of the ABCA4 gene as a cause of AR CRD, we selected 5 patients with AR CRD and 15 patients from Germany and The Netherlands with isolated CRD. Single-strand conformation-polymorphism analysis and sequencing revealed 19 ABCA4 mutations in 13 (65%) of 20 patients. In six patients, mutations were identified in both ABCA4 alleles; in seven patients, mutations were detected in one allele. One complex ABCA4 allele (L541P;A1038V) was found exclusively in German patients with CRD; one patient carried this complex allele homozygously, and five others were compound heterozygous. These findings suggest that mutations in the ABCA4 gene are the major cause of AR CRD. A primary role of the ABCA4 gene in STGD1/FFM and AR CRD, together with the gene's involvement in an as-yet-unknown proportion of cases with AR RP, strengthens the idea that mutations in the ABCA4 gene could be the most frequent cause of inherited retinal dystrophy in humans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Although the significance of this finding is under debate (Stone et al. 1998), at least two ABCA4 mutations (G1961E and D2177N) have been shown, in a large multicenter study, to be statistically more frequent in patients Table 1 ABCA4 Mutations in Patients with CRD PATIENT INHERITANCE ABCA4 ALLELE 1 ABCA4 ALLELE 2 Nucleotide Changes Effects Nucleotide Changes Effects 9250a Isolated 1622TrC;3113CrT L541P;A1038Vb 194GrA G65Eb 9303 AR 1622TrC;3113CrT L541P;A1038Vb 9336 Isolated 6658CrT Q2220X 9369a AR 6601-6602delAG Frameshift 9370 Isolated 1622TrC;3113CrT L541P;A1038Vb 9371 Isolated 1622TrC;3113CrT L541P;A1038Vb 1622TrC;3113CrT L541P;A1038Vb 9378a Isolated 768GrT 5 Splice mutationb 9553 AR 2588GrC DG863/G863Ab IVS35del-2rϩ2del4 3 Splice mutation 9633 Isolated 1622TrC;3113CrT L541P;A1038Vb 4469GrA C1490Yb 9650 Isolated 3364GrA E1122Kb 9887 Isolated 4793CrA A1598D 6329GrA W2110X 11872 Isolated 634CrT R212Cb 13163a AR 1622TrC;3113CrT L541P;A1038Vb IVS36ϩ1GrA 5 Splice mutationb a Patient with atypical CRD. Login to comment

[hide] Further evidence for an association of ABCR allele... Am J Hum Genet. 2000 Aug;67(2):487-91. Epub 2000 Jul 3. Allikmets R
Further evidence for an association of ABCR alleles with age-related macular degeneration. The International ABCR Screening Consortium.
Am J Hum Genet. 2000 Aug;67(2):487-91. Epub 2000 Jul 3., [PMID:10880298]

Abstract [show]
Age-related macular degeneration (AMD) accounts for >50% of the registered visual disability among North American and Western European populations and has been associated both with environmental factors, such as smoking, and with genetic factors. Previously we have reported disease-associated variants in the ABCR (also called ABCA4) gene in a subset of patients affected with this complex disorder. We have now tested our original hypothesis, that ABCR is a dominant susceptibility locus for AMD, by screening 1,218 unrelated AMD patients of North American and Western European origin and 1,258 comparison individuals from 15 centers in North America and Europe for the two most frequent AMD-associated variants found in ABCR. These two sequence changes, G1961E and D2177N, were found in one allele of ABCR in 40 patients ( approximately 3.4%), and in 13 control subjects ( approximately 0.95%). Fisher's two-sided exact test confirmed that these two variants are associated with AMD at a statistically significant level (P<.0001). The risk of AMD is elevated approximately threefold in D2177N carriers and approximately fivefold in G1961E carriers. The identification of a gene that confers risk of AMD is an important step in unraveling this complex disorder.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 These two sequence changes, G1961E and D2177N, were found in one allele of ABCR in 40 patients (~3.4%), and in 13 control subjects (~0.95%). Login to comment
9 .0001 fivefold in G1961E carriers. Login to comment
21 We present new data on 1,218 patients with AMD and 1,258 matched controls studied at 15 centers (7 in the United States and 8 in Europe) to test the associations with AMD of two of the more common AMD-associated ABCR variants, G1961E and D2177N. Login to comment
27 Table 1 Association of G1961E and D2177N Alleles with AMD CENTER POPULATION AMD SAMPLES CONTROLS G1961E D2177N Dry Wet Total GP AM Total AMD (D/W) Control (GP/AM) AMD (D/W) Control (GP/AM) Boston/Salt Lake City/Baltimore Eur. Am. Login to comment
37 Genotyping of the G1961E and D2177N variants was performed by a method of choice at each center. Login to comment
42 G1961E was found in 19/1,218 (1.56%) patients with AMD compared with 4/1,258 (0.32%) control subjects (table 1) (Fisher`s two-sided exact test [Mehta and Patel 1995]; ). Login to comment
45 No statistically significant evidence of heterogeneity of odds ratios exists among analysis units, and the prevalence is higher in the AMD group in six of the eight units with at least one G1961E allele. Login to comment
49 The combination of either G1961E or D2177N was found in 40/1,189 (3.36%) patients with AMD, compared with 12/1,258 (0.95%) control subjects (P ! Login to comment
65 Together, the G1961E and D2177N variants were present in 23/533 patients with nonexudative disease and in 17/685 with exudative lesions. Login to comment
75 For population stratification to explain the above associations at any one study center, ethnic (sub)groups in that center should both associate strongly with AMD prevalence and segregate concordantly with the prevalences of both G1961E and D2177N. Login to comment
80 It also seems unlikely that similar ethnic correlations should occur with G1961E and D2177N, which we have yet to find together in the same subject. Login to comment
85 The mutant G1961E protein, produced after the transfection of human embryonic kidney (293) cells with cloned cDNA, exhibits several-fold lower binding of 8- azido-ATP and inhibition of ATPase activity by retinal, as compared with the wild-type ABCR protein. Login to comment
92 In summary, new data from 15 centers in the United States and Europe independently confirm the association of ABCR alleles G1961E and D2177N with AMD. Login to comment
79 It also seems unlikely that similar ethnic correlations should occur with G1961E and D2177N, which we have yet to find together in the same subject. Login to comment
84 The mutant G1961E protein, produced after the transfection of human embryonic kidney (293) cells with cloned cDNA, exhibits several-fold lower binding of 8-azido-ATP and inhibition of ATPase activity by retinal, as compared with the wild-type ABCR protein. Login to comment
91 In summary, new data from 15 centers in the United States and Europe independently confirm the association of ABCR alleles G1961E and D2177N with AMD. Login to comment

[hide] Molecular genetic analysis of ABCR gene in Japanes... Jpn J Ophthalmol. 2000 May-Jun;44(3):245-9. Fuse N, Suzuki T, Wada Y, Yoshida M, Shimura M, Abe T, Nakazawa M, Tamai M
Molecular genetic analysis of ABCR gene in Japanese dry form age-related macular degeneration.
Jpn J Ophthalmol. 2000 May-Jun;44(3):245-9., [PMID:10913642]

Abstract [show]
PURPOSE: To explore whether the mutation in the retina-specific ATP-binding cassette transporter (ABCR) gene, the Stargardt's disease gene, contributes to the prevalence of the dry form of age-related macular degeneration (dry AMD) in Japanese unrelated patients. METHODS: Twenty-five Japanese unrelated patients with dry AMD who were diagnosed by fluorescein angiography and indocyanine green angiography were chosen as the dry AMD group. None of these cases had apparent choroidal neovascularization. To detect the mutations in the ABCR gene, genomic DNA was extracted from leukocytes of peripheral blood, and 26 exons of the ABCR gene were amplified by polymerase chain reaction (PCR). All the PCR products were then directly sequenced. When a mutation was detected, the occurrence of a mutation was compared between these AMD patients and the control group. RESULTS: After direct sequencing, a point mutation in exon 29 was found in one of the 25 dry AMD patients. In addition, a polymorphism in exon 45 was found in two other patients, and three sequence variations in exon 23 were detected in all patients. The incidence in AMD patients in whom a mutation in exon 29 (4%) was detected was less than that in controls (5%). Screening of the intron-exon boundaries also led to the identification of intronic mutation in intron 33. CONCLUSION: In this study we found no relationship between allelic variation in the ABCR gene and the prevalence of dry AMD in Japanese unrelated patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Mutations Found in ABCR* Gene in 26 Exons Examined in This Study Exon AMD† Stargardt`s Disease Exon AMD Stargardt`s Disease 11 E471K 29 T1428M 15 31 R1517S 16 G818E, G863A (D847H) 33 I1562T G1578R 17 34 N1614FS 18 35 19 V931M, 2884delC N965M, (R943Q) 36 5196ϩ1G→A 5041deL15 5196ϩ2T→C 20 40 R1898H R1898H 21 A1028V 42 G1961E G1961E 22 3211insGT, V1072A E1087K 43 L1970F 6006ϩ1G→T 23 R1129L 44 L2027F, R2038W (I2023I) 24 45 V2050L, R2077W (I2083I) 25 46 R2106C (V2094V) 27 48 6519⌬11bp D2177N 6568⌬C 6519⌬11bp 6709insG *ABCR: ATP-binding cassette transporter. Login to comment
72 It was reported that four mutations found in AMD patients (R1898H, G1961E, 6519del11, and G863A) were also found in patients with Stargardt`s disease.14 In our study, only one polymorphism (I2083I) was found. Login to comment

[hide] New ABCR mutations and clinical phenotype in Itali... Invest Ophthalmol Vis Sci. 2000 Mar;41(3):892-7. Simonelli F, Testa F, de Crecchio G, Rinaldi E, Hutchinson A, Atkinson A, Dean M, D'Urso M, Allikmets R
New ABCR mutations and clinical phenotype in Italian patients with Stargardt disease.
Invest Ophthalmol Vis Sci. 2000 Mar;41(3):892-7., [PMID:10711710]

Abstract [show]
PURPOSE: To assess the mutation spectrum in the ABCR gene and clinical phenotypes in Italian families with autosomal recessive Stargardt disease (STGD1) and fundus flavimaculatus (FFM). METHODS: Eleven families from southern Italy, including 18 patients with diagnoses of STGD1, were clinically examined. Ophthalmologic examination included kinetic perimetry, electrophysiological studies, and fluorescein angiography. DNA samples of the affected individuals and their family members were analyzed for variants in all 50 exons of the ABCR gene by a combination of single-strand conformation polymorphism analysis and direct sequencing techniques. RESULTS: TenABCR variants were identified in 16 (73%) of 22 mutant alleles of patients with STGD1. Five mutations of 10 that were found had not been previously described. The majority of variants represent missense amino acid substitutions, and all mutant alleles cosegregate with the disease in the respective families. These ABCR variants were not detected in 170 unaffected control individuals (340 chromosomes) of Italian origin. Clinical evaluation of these families affected by STGD1 showed an unusually high frequency of early age-related macular degeneration (AMD) in parents of patients with STGD1 (8/22; 36%), consistent with the hypothesis that some heterozygous ABCR mutations enhance susceptibility to AMD. CONCLUSIONS: Patients from southern Italy with Stargardt disease show extensive allelic heterogeneity of the ABCR gene, concordant with previous observations in patients with STGD1 from different ethnic groups. Half the mutations identified in this study had not been previously described in patients with STGD1. Screening of increasingly large numbers of patients would help to determine whether this can be explained by ethnic differences, or is an indicator of extensive allelic heterogeneity of ABCR in STGD1 and other eye diseases. In 6 (55%) of 11 families, the first-degree relatives of patients with STGD1 were diagnosed with early AMD, supporting the previous observation that some STGD1 alleles are also associated with AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 Clinical Characteristics and Segregation of Mutations in 11 Italian STGD/FFM Pedigrees Pedigree Patients Age Age of Onset Visual Acuity Diagnosis Allele 1 Allele 2 431 431 S 18 10 20/200 STGD R212C R212C 433 D 29 8 20/200 STGD R212C R212C 432 F 63 10 LE 20/40RE LP High myopia with macular involvement R212C R212H(p) 858 Gm 87 10 LP High myopia with macular involvement wt R212H(p) 774 M 60 58 20/25 Pigmentary abnormalities and drusen R212C wt 260 D 41 35 20/200 STGD 250ƒCAAA G1961E 759 S 39 38 20/100 STGD 250ƒCAAA G1961E 760 M 60 57 20/40 Pigmentary abnormalities and drusen wt G1961E 761 Gs 20/20 Normal wt G1961E 762 Gs 20/20 Normal 250ƒCAAA wt 631 631 S 18 3 20/200 STGD / FFM 5018 ϩ 2T 3 C 5018 ϩ 2T 3 C 777 F 59 58 20/20 Soft distinct drusen 5018 ϩ 2T 3 C wt 779 M 52 50 20/20 Hard distinct drusen 5018 ϩ 2T 3 C wt 624 624 D 40 18 20/200 STGD R1640Q G1961E 625 S 36 20 20/200 STGD R1640Q G1961E 834 M 74 20/20 Normal R1640Q wt 636 636 S 22 15 20/400 STGD / FFM E1087K G1961E 778 M 43 43 20/20 Hard distinct drusen wt G1961E 632 632 D 24 8 20/200 STGD / FFM 250ƒCAAA V767D 628 628 S 27 18 20/200 STGD T897I N/D 4 F 63 20/20 Normal wt N/D 5 M 62 62 20/20 Pigmentary abnormalities and drusen T897I N/D 633 633 D 12 8 20/400 STGD / FFM A1038V N/D 776 S 15 20/20 Normal A1038V N/D 634 D 20 10 20/400 STGD / FFM A1038V N/D 3 F 60 60 20/20 Pigmentary abnormalities and drusen wt N/D 2 M 49 20/20 Normal A1038V N/D 615 615 S 22 8 20/200 STGD / FFM 5018 ϩ 2T 3 C N/D 616 D 23 10 20/200 STGD / FFM 5018 ϩ 2T 3 C N/D 764 D 25 20/20 Normal 5018 ϩ 2T 3 C N/D 763 F 60 20/20 Normal 5018 ϩ 2T 3 C N/D 765 M 55 55 20/20 Pigmentary abnormalities and drusen wt N/D 629 629 D 23 10 STGD / FFM E1399K N/D 622 627 D 47 12 20/400 STGD N/D N/D 622 D 35 8 20/400 STGD / FFM N/D N/D 623 C 19 10 20/200 STGD / FFM S, son; D, daughter; F, father; M, mother; C, cousin; Gm, grandmother; Gs, grandson; (p), polymorphism; wt, wild type; N/D, not determined. Login to comment
69 Of interest, the second allele in this pedigree was identified as harboring the G1961E mutation. Login to comment
70 Moreover, in the two other families heterozygous for the G1961E variant (pedigrees 624 and 636, Table 1) the age of diagnosis was 15 years or more. Login to comment
93 The previously reported G1961E mutation segregated with the disease in 3 (27%) of 11 families (Fig. 1). Login to comment
96 Although limited numbers and the relatively early age (below or near 60 years) of individuals studied prevents us from making definitive conclusions, this observation supports the association of the G1961E variant with AMD. Login to comment
97 It is of interest that in all three families segregating the G1961E allele patients were found to have Stargardt disease at the age 15 or more (Table 1). Login to comment
116 To date, no patient with STGD1 homozygous for the G1961E mutation has been identified, although this mutation is one of the most frequent in patients with STGD (Ͼ10%), and the number of screened patients with STGD1 exceeds several hundred.4,11,14 Altogether, these data allow classifying the G1961E mutation as a "mild" alteration15 and individuals homozygous for this variant may not manifest the Stargardt disease phenotype. Login to comment
119 The G1961E variant was found to be the most frequent in Italian patients with STGD, in correlation with the previous data from patient collections with different ethnic backgrounds. Login to comment

[hide] Analysis of the Stargardt disease gene (ABCR) in a... Ophthalmology. 1999 Aug;106(8):1531-6. De La Paz MA, Guy VK, Abou-Donia S, Heinis R, Bracken B, Vance JM, Gilbert JR, Gass JD, Haines JL, Pericak-Vance MA
Analysis of the Stargardt disease gene (ABCR) in age-related macular degeneration.
Ophthalmology. 1999 Aug;106(8):1531-6., [PMID:10442900]

Abstract [show]
PURPOSE: Age-related macular degeneration (AMD) is a complex genetic disorder and the leading cause of severe vision loss in the elderly. The Stargardt disease gene (ABCR) has been proposed as a major genetic risk factor in AMD. The purpose of this study was to evaluate the authors' AMD population for the specific ABCR variants proposed previously as genetic risk factors for AMD. METHODS: The authors screened their AMD population (159 familial cases from 112 multiplex families and 53 sporadic cases) and 56 racially matched individuals with no known history of AMD from the same clinic population for evidence of the ABCR variants. Grading of disease severity was performed according to a standard protocol. Patients with extensive intermediate drusen or large soft drusen, drusenoid retinal pigment epithelial (RPE) detachments, geographic atrophy of the RPE, or evidence of exudative maculopathy were considered affected. Analysis for variants was performed by polymerase chain reaction amplification of individual exons of the ABCR gene with flanking primers and a combination of single-strand conformation polymorphism, heteroduplex analysis, and high-performance liquid chromatography. All abnormal conformers detected using these techniques were characterized by direct sequencing. RESULTS: The authors identified only two of the previously reported variants in their study population. Both variants occurred in sporadic cases, and none was found in familial cases or the randomly selected population. In addition, the authors identified several newly described polymorphisms and variants in both the AMD and control populations. CONCLUSIONS: Based on these initial findings, the authors suggest that ABCR is not a major genetic risk factor for AMD in their study population. Additional genetic studies are needed to more fully evaluate the role of ABCR in AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 Number of Age-related Macular Degeneration (AMD) Cases with Variants* Mutation Duke (n ‫؍‬ 169)† D2177N 2 (1.2%) E471K 0 R1129L 0 T1428M 0 R1517S 0 I1562T 0 G1578R 0 5169 ϩ 1G 3 A 0 R1898H 0 G1961E 0 L1970F 0 6519⌬11bp 0 6568⌬C 0 Total 2 (1.2%) * Variants considered to be associated with the genetic etiology of AMD by Allikmets et al.31 † Independent cases are determined by counting 1 familial AMD case from each of the 112 families and adding the 57 sporadic AMD cases, for a total of 169 cases. Login to comment

[hide] The rod photoreceptor ATP-binding cassette transpo... Vision Res. 1999 Jul;39(15):2537-44. Shroyer NF, Lewis RA, Allikmets R, Singh N, Dean M, Leppert M, Lupski JR
The rod photoreceptor ATP-binding cassette transporter gene, ABCR, and retinal disease: from monogenic to multifactorial.
Vision Res. 1999 Jul;39(15):2537-44., [PMID:10396622]

Abstract [show]
The ABCR gene encodes a rod photoreceptor specific ATP-binding cassette transporter. Mutations in ABCR are associated with at least four inherited retinal dystrophies: Stargardt disease, Fundus Flavimaculatus, cone-rod dystrophy, and retinitis pigmentosa. A statistically significant increase in heterozygous ABCR alterations has been identified in patients with age-related macular degeneration (AMD). A pedigree is described which manifests both Stargardt disease and AMD in which an ABCR mutation cosegregates with both disease phenotypes. These data from this case report support the hypothesis that ABCR is a dominant susceptibility locus for AMD. Recent work regarding ABCR is reviewed and a model is presented in which decreased ABCR function correlates with severity of retinal disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 The two most common AMD-associated mutations have similar frequencies in the Utah and Boston cohorts: D2177N was identified in five patients from Utah and two patients from Boston; G1961E was identified in two patients from Utah and four patients from Boston. Login to comment
142 Conclusions We reported elsewhere that seven alterations in ABCR (R1898H, G1961E, 6519del11bp, E471K, R1129L, 5196+1GA, and L1970F) are associated with STGD in compound heterozygous states and with AMD in an apparent heterozygous state (Allikmets et al., 1997a; Lewis et al., 1999). Login to comment
143 In addition, we previously showed that the most common mutant ABCR allele (G1961E) identified in a cohort of 150 families was also one of the most frequently identified disease associated ABCR alterations in a cohort of 167 AMD patients (Allikmets et al., 1997a; Lewis et al., 1999). Login to comment
144 In addition, we previously showed that the most common mutant ABCR allele (G1961E) identified in a cohort of 150 families was also one of the most frequently identified disease associated ABCR alterations in a cohort of 167 AMD patients (Allikmets et al., 1997a; Lewis et al., 1999). Login to comment

[hide] Variation of clinical expression in patients with ... Arch Ophthalmol. 1999 Apr;117(4):504-10. Fishman GA, Stone EM, Grover S, Derlacki DJ, Haines HL, Hockey RR
Variation of clinical expression in patients with Stargardt dystrophy and sequence variations in the ABCR gene.
Arch Ophthalmol. 1999 Apr;117(4):504-10., [PMID:10206579]

Abstract [show]
OBJECTIVE: To report the spectrum of ophthalmic findings in patients with Stargardt dystrophy or fundus flavimaculatus who have a specific sequence variation in the ABCR gene. PATIENTS: Twenty-nine patients with Stargardt dystrophy or fundus flavimaculatus from different pedigrees were identified with possible disease-causing sequence variations in the ABCR gene from a group of 66 patients who were screened for sequence variations in this gene. METHODS: Patients underwent a routine ocular examination, including slitlamp biomicroscopy and a dilated fundus examination. Fluorescein angiography was performed on 22 patients, and electroretinographic measurements were obtained on 24 of 29 patients. Kinetic visual fields were measured with a Goldmann perimeter in 26 patients. Single-strand conformation polymorphism analysis and DNA sequencing were used to identify variations in coding sequences of the ABCR gene. RESULTS: Three clinical phenotypes were observed among these 29 patients. In phenotype I, 9 of 12 patients had a sequence change in exon 42 of the ABCR gene in which the amino acid glutamic acid was substituted for glycine (Gly1961Glu). In only 4 of these 9 patients was a second possible disease-causing mutation found on the other ABCR allele. In addition to an atrophic-appearing macular lesion, phenotype I was characterized by localized perifoveal yellowish white flecks, the absence of a dark choroid, and normal electroretinographic amplitudes. Phenotype II consisted of 10 patients who showed a dark choroid and more diffuse yellowish white flecks in the fundus. None exhibited the Gly1961Glu change. Phenotype III consisted of 7 patients who showed extensive atrophic-appearing changes of the retinal pigment epithelium. Electroretinographic cone and rod amplitudes were reduced. One patient showed the Gly1961Glu change. CONCLUSIONS: A wide variation in clinical phenotype can occur in patients with sequence changes in the ABCR gene. In individual patients, a certain phenotype seems to be associated with the presence of a Gly1961Glu change in exon 42 of the ABCR gene. CLINICAL RELEVANCE: The identification of correlations between specific mutations in the ABCR gene and clinical phenotypes will better facilitate the counseling of patients on their visual prognosis. This information will also likely be important for future therapeutic trials in patients with Stargardt dystrophy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 In phenotype I, 9 of 12 patients had a sequence change in exon 42 of the ABCR gene in which the amino acid glutamic acid was substituted for glycine (Gly1961Glu). Login to comment
10 None exhibited the Gly1961Glu change. Login to comment
13 One patient showed the Gly1961Glu change. Login to comment
15 In individual patients, a certain phenotype seems to be associated with the presence of a Gly1961Glu change in exon 42 of the ABCR gene. Login to comment
31 These patients would have been classified as having stage 1 disease as described by Fishman.14 Of interest, 9 of the 12 patients showed a Gly1961Glu sequence variation on 1 allele of the ABCR gene (Table 1), none of whom showed a dark choroid or abnormal ERG findings. Login to comment
66 Such patients were previously categorized as having stage 3 or stage 4 disease.14 One of the 7 patients in this subgroup showed a compound heterozygous sequence variation in which 1 allele had a Gly1961Glu change. Login to comment
70 Clinical Features of Patients With ABCR Gene Mutations* Patient No./ Sex/Age, y Clinical Phenotype Vision Silent Choroid Central Scotoma MutationOD OS 1/M/19 I 20/200 20/200 ND + Thr300Asn, exon 8 2/M/44 I 20/25 20/15 - + Cys1488Arg, exon 30 3/M/35 I 20/100 20/100 ND + Gly1961Glu, exon 42 Cys2150Tyr, exon 47 4/M/44 I 20/200 20/200 - + Gly1961Glu, exon 42 5/F/28 I 20/80 20/100 - + Gly1961Glu, exon 42 Gly65Glu, exon 3 6/M/36 I 20/25 20/200 - + Gly1961Glu, exon 42 Arg2077Trp, exon 45 7/F/44 I 20/200 20/200 - + Gly1961Glu, exon 42 8/M/41 I 20/200 20/200 - + Gly1961Glu, exon 42 9/F/32 I 20/25 20/30 - + Gly1961Glu, exon 42 10/F/36 I 20/50 20/200 - + Gly1961Glu, exon 42 11/M/31 I 20/200 20/200 - + Gly1961Glu, exon 42 Ala1038Val, exon 21 Leu541Pro, exon 12 12/M/35 I 20/200 20/200 - + Arg2107His, exon 46 Leu1729Pro, exon 36 13/M/22 II 20/200 20/200 + + 1bp del (g), codon 448, exon 10 14/F/9 II 20/200 20/40 ND + 9bp del, codon 1760/1761, exon 37 1bp ins (c), codon 1513, exon 30 15/M/19 II 10/120 10/160 + + 1bp ins (c), codon 1513, exon 30 Ala60Val, exon 3 16/M/25 II 20/200 20/200 + ND Ser974Pro, exon 20 17/F/12 II 20/200 20/200 ND + 2884 del (c), exon 19 18/F/73 II 20/30 20/25 + Paracentral scotoma 5bp del, codon 505, exon 11 19/F/35 II 10/160 10/120 ND + Val849Ala, exon 16 20/F/48 II 20/400 20/400 + +; Mild peripheral restriction Val849Ala, exon 16 Arg2107His, exon 46 21/M/54 II 20/200 20/200 + + Arg2030stop, exon 44 22/M/28 II 20/400 20/400 + + His2128Arg, exon 46 23/F/34 III 10/400 10/225 Diffuse hyperfluorescence ND Arg2038Trp, exon 44 24/F/53 III 10/700 10/600 Diffuse hyperfluorescence and notable choroidal atrophy + Arg1108Cys, exon 22 25/F/54 III 10/350 3/350 Diffuse hyperfluorescence +; Mild concentric restriction Tyr1652Asp, exon 35 Arg2107His, exon 46 26/M/57 III 20/50 20/80 ND ND Splice donor GϾA, exon 24 27/F/65 III 1/225 1/225 Diffuse choroidal atrophy Temporal islands Gly1961Glu, exon 42 frameshift del, codons 1620-1622, exon 35† 28/M/32 III 20/400 20/400 Diffuse hyperfluorescence +; Peripheral restriction Ala1038Val, exon 21 Leu541Pro, exon 12 Donor splice, exon 30 29/M/46 III 10/225 10/225 ND +; Peripheral restriction Trp1408Leu, exon 28 Ser206Arg, exon 6 Arg2107His, exon 46 *M indicates male; F, female; ND, angiography or visual field testing not done; +, present; and -, absent. Login to comment
90 With 1 exception, the Gly1961Glu sequence variation was observed in patients with a phenotype I expression. Login to comment
99 For example, suppose that the Gly1961Glu change is in fact a non-disease-causing polymorphism present in a relatively small portion of the general population. Login to comment
100 If a true disease-causing mutation occurred by chance in the promoter region of such a "1961- marked" allele, then one would expect an enrichment of the Gly1961Glu sequence change among a group of patients with Stargardt dystrophy (compared with the Figure 7. Login to comment
106 However, even if such an event were to occur, clinical associations with the marker polymorphism (such as the association between the Gly1961Glu sequence change and phenotype I in this article) would be meaningful only as long as the frequency of the polymorphism in the general population was relatively low. Login to comment

[hide] Genotype/Phenotype analysis of a photoreceptor-spe... Am J Hum Genet. 1999 Feb;64(2):422-34. Lewis RA, Shroyer NF, Singh N, Allikmets R, Hutchinson A, Li Y, Lupski JR, Leppert M, Dean M
Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease.
Am J Hum Genet. 1999 Feb;64(2):422-34., [PMID:9973280]

Abstract [show]
Mutation scanning and direct DNA sequencing of all 50 exons of ABCR were completed for 150 families segregating recessive Stargardt disease (STGD1). ABCR variations were identified in 173 (57%) disease chromosomes, the majority of which represent missense amino acid substitutions. These ABCR variants were not found in 220 unaffected control individuals (440 chromosomes) but do cosegregate with the disease in these families with STGD1, and many occur in conserved functional domains. Missense amino acid substitutions located in the amino terminal one-third of the protein appear to be associated with earlier onset of the disease and may represent misfolding alleles. The two most common mutant alleles, G1961E and A1038V, each identified in 16 of 173 disease chromosomes, composed 18.5% of mutations identified. G1961E has been associated previously, at a statistically significant level in the heterozygous state, with age-related macular degeneration (AMD). Clinical evaluation of these 150 families with STGD1 revealed a high frequency of AMD in first- and second-degree relatives. These findings support the hypothesis that compound heterozygous ABCR mutations are responsible for STGD1 and that some heterozygous ABCR mutations may enhance susceptibility to AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 The two most common mutant alleles, G1961E and A1038V, each identified in 16 of 173 disease chromosomes, composed 18.5% of mutations identified. Login to comment
3 G1961E has been associated previously, at a statistically significant level in the heterozygous state, with age-related macular degeneration (AMD). Login to comment
76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift. Login to comment
110 Seven mutant alleles, including six missense amino acid substitutions and one splice-site mutation (G863A, A1038V, R1108C, T1526M, G1961E, L2027F, and 5714ϩ5GrA) accounted for 41% of the disease-causing mutations identified in this cohort. Login to comment
111 In three instances, identical codons were affected by different base-pair substitutions, yielding different predicted missense amino acid substitutions (R572Q and R572P; R1129C and R1129L) or a missense substitution and a stop codon (R2030Q and R2030X). Login to comment
146 However, variation in self-reported age at onset, even by 11 decade, was noted for two families with identical ABCR compound heterozygous genotypes (age 8 years for family AR417 and age 20 years for family AR274, each with genotype G1961E/A1038V), suggesting either modifier alleles or environmental factors affecting disease expression or different sensitivity to reported age at onset. Login to comment
178 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET ‫ע‬ SD (YEARS)Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 ‫ע‬ 12.7 51961GrA AR307 10 A1038V AR290 16 5714ϩ5GrA AR314 25 5898ϩ1GrT AR336 39 A1038V R572P AR321 6 12.5 ‫ע‬ 6.9 S1071L AR358 6 L1970F AR428 6 5196ϩ2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 ‫ע‬ 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 ‫ע‬ 4.5 C75G AR427 12 C1490Y AR370 13 2160ϩ1GrC AR218 14 4253ϩ5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 ‫ע‬ 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment
191 We reported previously that three AMD-associated ABCR variants (R1898H, G1961E, and 6519D11bp) (Allikmets et al. 1997a) had been identified in families with STGD1 (Allikmets et al. 1997b). Login to comment
192 Interestingly, four other STGD1-causing ABCR mutations (E471K, R1129L, 5196ϩ1GrA, and L1970F) in these new families were documented previously as AMD-associated ABCR variants (Allikmets et al. 1997a). Login to comment
193 Importantly, the G1961E allele, identified as one of the two most frequent variants in both the Utah and the Boston cohorts of AMD patients (Allikmets et al. 1997a), was also the most frequently identified ABCR mutant allele in our cohort of 150 families with STGD1. Login to comment
194 In 6 of the 16 families with STGD1 who had a G1961E disease chromosome, the other mutant allele also was identified; in all 16 cases, G1961E cosegregated with the disease. Thus, G1961E is a pathologic mutation and not a benign variant. Login to comment
77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift. Login to comment
147 However, variation in self-reported age at onset, even by 11 decade, was noted for two families with identical ABCR compound heterozygous genotypes (age 8 years for family AR417 and age 20 years for family AR274, each with genotype G1961E/A1038V), suggesting either modifier alleles or environmental factors affecting disease expression or different sensitivity to reported age at onset. Login to comment
179 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET cf2; SD (YEARS) Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 cf2; 12.7 51961GrA AR307 10 A1038V AR290 16 5714af9;5GrA AR314 25 5898af9;1GrT AR336 39 A1038V R572P AR321 6 12.5 cf2; 6.9 S1071L AR358 6 L1970F AR428 6 5196af9;2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 cf2; 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 cf2; 4.5 C75G AR427 12 C1490Y AR370 13 2160af9;1GrC AR218 14 4253af9;5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 cf2; 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment
195 In 6 of the 16 families with STGD1 who had a G1961E disease chromosome, the other mutant allele also was identified; in all 16 cases, G1961E cosegregated with the disease. Thus, G1961E is a pathologic mutation and not a benign variant. Login to comment

[hide] Mutation of the Stargardt disease gene (ABCR) in a... Science. 1997 Sep 19;277(5333):1805-7. Allikmets R, Shroyer NF, Singh N, Seddon JM, Lewis RA, Bernstein PS, Peiffer A, Zabriskie NA, Li Y, Hutchinson A, Dean M, Lupski JR, Leppert M
Mutation of the Stargardt disease gene (ABCR) in age-related macular degeneration.
Science. 1997 Sep 19;277(5333):1805-7., [PMID:9295268]

Abstract [show]
Age-related macular degeneration (AMD) is the leading cause of severe central visual impairment among the elderly and is associated both with environmental factors such as smoking and with genetic factors. Here, 167 unrelated AMD patients were screened for alterations in ABCR, a gene that encodes a retinal rod photoreceptor protein and is defective in Stargardt disease, a common hereditary form of macular dystrophy. Thirteen different AMD-associated alterations, both deletions and amino acid substitutions, were found in one allele of ABCR in 26 patients (16%). Identification of ABCR alterations will permit presymptomatic testing of high-risk individuals and may lead to earlier diagnosis of AMD and to new strategies for prevention and therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Six patients had a G1961E (23) alteration. Login to comment
99 Mutation AMD (n ϭ167) STGD (n ϭ 98) General population (n ϭ 220) E471K 2 (1.2%) NA 0 (0%) R1129L 1 (0.6%) 0 (0%)* 0 (0%) T1428M 1 (0.6%) 0 (0%) 0 (0%) R1517S 1 (0.6%) 0 (0%) 0 (0%) I1562T 2 (1.2%) 0 (0%) 0 (0%) G1578R 1 (0.6%) 0 (0%) 0 (0%) 5196ϩ1G 3 A 1 (0.6%) 0 (0%) 0 (0%) R1898H 1 (0.6%) 4 (4%) 0 (0%) G1961E 6 (3.6%) 8 (8%) 0 (0%) L1970F 1 (0.6%) 0 (0%) 0 (0%) 6519⌬11bp 1 (0.6%)† 1 (1%)† 0 (0%) D2177N 7 (4.2%) 0 (0%) 1 (0.45%) 6568⌬C 1 (0.6%) 0 (0%) 0 (0%) Totals 26 (16%) 13 (13%) 1 (0.45%) *A substitution to a different amino acid (R1129C) was detected in one STGD1 patient. Login to comment
86 Six patients had a G1961E (23) alteration. Login to comment
96 Mutation AMD (n 5167) STGD (n 5 98) General population (n 5 220) E471K 2 (1.2%) NA 0 (0%) R1129L 1 (0.6%) 0 (0%)* 0 (0%) T1428M 1 (0.6%) 0 (0%) 0 (0%) R1517S 1 (0.6%) 0 (0%) 0 (0%) I1562T 2 (1.2%) 0 (0%) 0 (0%) G1578R 1 (0.6%) 0 (0%) 0 (0%) 519611G 3 A 1 (0.6%) 0 (0%) 0 (0%) R1898H 1 (0.6%) 4 (4%) 0 (0%) G1961E 6 (3.6%) 8 (8%) 0 (0%) L1970F 1 (0.6%) 0 (0%) 0 (0%) 6519D11bp 1 (0.6%)ߤ 1 (1%)ߤ 0 (0%) D2177N 7 (4.2%) 0 (0%) 1 (0.45%) 6568DC 1 (0.6%) 0 (0%) 0 (0%) Totals 26 (16%) 13 (13%) 1 (0.45%) *A substitution to a different amino acid (R1129C) was detected in one STGD1 patient. Login to comment

[hide] Evaluation of the common variants of the ABCA4 gen... Int J Mol Med. 2008 Jun;21(6):715-20. Shastry BS
Evaluation of the common variants of the ABCA4 gene in families with Stargardt disease and autosomal recessive retinitis pigmentosa.
Int J Mol Med. 2008 Jun;21(6):715-20., [PMID:18506364]

Abstract [show]
Stargardt disease (STGD) is one of the most common autosomal recessive retinal dystrophies with an estimated incidence of one in 10,000. It affects the central retina (macula). Retinitis pigmentosa (RP) comprises a large and exceptionally heterogeneous group of hereditary disorders of the retina. It is caused by the loss of photoreceptors. The condition is a degenerative disorder characterized by retinal pigment deposits and has an estimated incidence of one in 4,000. Although, to date, 45 known loci have been identified, none of them independently account for a substantial portion of RP. Recently, the photoreceptor cell-specific ATP-binding cassette transporter (ABCA4) gene was found to be mutated in patients with STGD as well as autosomal recessive RP. In order to further understand the contribution of this gene to the susceptibility to STGD and RP, we analyzed three unrelated STGD families and one autosomal recessive RP family specifically for the more common variants (A1038V, G1961E, 2588G-->C, R943Q or 2828G-->A) in the ABCA4 gene. Our analyses employing standard techniques such as polymerase chain reaction, restriction fragment length polymorphism, and direct DNA sequencing of amplified products were able to identify one common variant (R943Q) in all three STGD families but not in the RP family. All three affected STGD individuals, however, were heterozygous for this variation, and this alteration did not segregate with the disease and was also present in the normal controls. Similar analysis of other common variants revealed no pathogenic mutations in the STGD and RP families. It is likely that the variant identified in this study represents a rare polymorphism (non-pathogenic). Although, at present we cannot eliminate the possibility of this gene as a candidate gene, future extensive studies on this as well as other candidate genes may uncover the susceptibility gene for these recessive forms of the disorders in these families.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 In order to further understand the contribution of this gene to the susceptibility to STGD and RP, we analyzed three unrelated STGD families and one autosomal recessive RP family specifically for the more common variants (A1038V, G1961E, 2588G&#a1;C, R943Q or 2828G&#a1;A) in the ABCA4 gene. Login to comment
49 To further extend the diagnostic and prognostic value of the molecular genetic study of STGD and to understand the genetic heterogeneity of RP, in this report we analyzed three unrelated STGD families and one AR RP family specifically for the more common variants (A1038V, G1961E, R943Q or 2828G&#a1;A and 2588G&#a1;C) of the ABCA4 gene which when mutated produce a broad spectrum of the retinal phenotypes including RP and age-related macular degeneration (AMD). Login to comment
79 The amplified product was subjected to restriction enzyme digestion with either 10 units of Alu I (2588G&#a1;C mutation in exon 17 of ABCA4 gene creates a site for Alu I), or Bse YI (A1038V mutation in exon 21 destroys a site for Bse YI), or Taq I (G1961E variation in exon 42 in ABCA4 creates a Taq I site), or Msp I (R943Q alteration in exon 19 destroys the Msp I site), or Nla III (Y402H mutation in exon 9 of the CFH gene creates a Nla III site) at 37da;C (Alu I, Bse YI, Msp I, Nla III) and 65da;C (Taq I) for 1 h. Login to comment
83 The finding that the variants A1038V (exon 21), G1961E (exon 42), 2588G&#a1;C (exon 17) and R943Q (exon 19) which is previously known as 2828G&#a1;A (4) are more common INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 21: 715-720, 2008 717 Figure 1. Login to comment
92 The restriction enzyme digestion patterns for R943Q (Msp I) and G1961E (Taq I) changes are shown in Fig. 3A and B respectively. Login to comment
98 Similar experiments with the Taq I enzyme for the G1961E mutation detected no alteration in any patient (Fig. 3B). Login to comment
103 Restriction digestion patterns of PCR-amplified products for R943Q (A) and G1961E (B) variants. Login to comment
105 Similar experiments with Taq I enzyme for the G1961E mutation did not detect any alterations (B). Login to comment
109 Restriction digestion patterns of PCR-amplified products for variants 2588 G&#a1;C (A), A1038V (B), G1961E (C) and Y402H (D). Login to comment
114 Additionally, variants G1961E in the ABCA4 gene and Y402H in exon 9 of the CFH gene are associated with AMD at a statistically significant level. Login to comment

[hide] Allelic and phenotypic heterogeneity in ABCA4 muta... Ophthalmic Genet. 2011 Sep;32(3):165-74. doi: 10.3109/13816810.2011.565397. Epub 2011 Apr 21. Burke TR, Tsang SH
Allelic and phenotypic heterogeneity in ABCA4 mutations.
Ophthalmic Genet. 2011 Sep;32(3):165-74. doi: 10.3109/13816810.2011.565397. Epub 2011 Apr 21., [PMID:21510770]

Abstract [show]
Since the discovery of the ABCA4 gene as the cause of autosomal recessive Stargardt disease/fundus flavimaculatus much has been written of the phenotypic variability in ABCA4 retinopathy. In this review the authors discuss the findings seen on examination and the disease features detected using various clinical tests. Important differential diagnoses are presented and unusual presentations of ABCA4 disease highlighted.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 The G1961E missense mutation, the most commonly detected mutation in the ABCA4 gene,31,33,41 may not be associated with the presence of a dark choroid, as well as having more localized and less severe disease phenotype.42-44 Where extensive disease is present there can be difficulty identifying the presence or absence of a silent choroid on FA in the presence of numerous window defects and staining of the flecks during the course of angiography.45 The presence of a ring of hypofluorescence in the peripapillary region on FA has been reported in 37% of patients in a cohort of patients with STGD.45 It was detected at a higher frequency in patients with more severe disease, and was associated with poorer visual acuity and greater visual field defects. Login to comment

[hide] Analysis of the ABCA4 gene by next-generation sequ... Invest Ophthalmol Vis Sci. 2011 Oct 31;52(11):8479-87. doi: 10.1167/iovs.11-8182. Zernant J, Schubert C, Im KM, Burke T, Brown CM, Fishman GA, Tsang SH, Gouras P, Dean M, Allikmets R
Analysis of the ABCA4 gene by next-generation sequencing.
Invest Ophthalmol Vis Sci. 2011 Oct 31;52(11):8479-87. doi: 10.1167/iovs.11-8182., [PMID:21911583]

Abstract [show]
PURPOSE: To find all possible disease-associated variants in coding sequences of the ABCA4 gene in a large cohort of patients diagnosed with ABCA4-associated diseases. METHODS: One hundred sixty-eight patients who had been clinically diagnosed with Stargardt disease, cone-rod dystrophy, and other ABCA4-associated phenotypes were prescreened for mutations in ABCA4 with the ABCA4 microarray, resulting in finding 1 of 2 expected mutations in 111 patients and 0 of 2 mutations in 57 patients. The next-generation sequencing (NGS) strategy was applied to these patients to sequence the entire coding region and the splice sites of the ABCA4 gene. Identified new variants were confirmed or rejected by Sanger sequencing and analyzed for possible pathogenicity by in silico programs and, where possible, by segregation analyses. RESULTS: Sequencing was successful in 159 of 168 patients and identified the second disease-associated allele in 49 of 103 (~48%) of patients with one previously identified mutation. Among those with no mutations, both disease-associated alleles were detected in 4 of 56 patients, and one mutation was detected in 10 of 56 patients. The authors detected a total of 57 previously unknown, possibly pathogenic, variants: 29 missense, 4 nonsense, 9 small deletions and 15 splice-site-altering variants. Of these, 55 variants were deemed pathogenic by a combination of predictive methods and segregation analyses. CONCLUSIONS: Many mutations in the coding sequences of the ABCA4 gene are still unknown, and many possibly reside in noncoding regions of the ABCA4 locus. Although the ABCA4 array remains a good first-pass screening option, the NGS platform is a time- and cost-efficient tool for screening large cohorts.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 Three ABCA4 mutations in three different samples identified by sequencing-p.P1486L, p.G1961E, and p.R2106C-represented ABCA4 array false negatives. Login to comment
130 From 53 samples in which the combined APEX/NGS analysis had detected two mutations, only two samples carried the same two mutations-p.G1961E and p.R2149*. Login to comment
145 The best known example from this category in ABCA4 is the c.5461-10Tb0e;C variant in intron 38, which is the third most frequent variant (found in 7.1% of STGD1 patients) after the p.G1961E and p.L541P/A1038V mutations in our study. Login to comment

[hide] Disruption in Bruch membrane in patients with Star... Ophthalmic Genet. 2012 Mar;33(1):49-52. doi: 10.3109/13816810.2011.628358. Epub 2011 Nov 7. Park SP, Chang S, Allikmets R, Smith RT, Burke TR, Gregory-Roberts E, Tsang SH
Disruption in Bruch membrane in patients with Stargardt disease.
Ophthalmic Genet. 2012 Mar;33(1):49-52. doi: 10.3109/13816810.2011.628358. Epub 2011 Nov 7., [PMID:22060670]

Abstract [show]
PURPOSE: To describe the spectral domain-optical coherence tomography (SD-OCT) findings of two patients with complete defects in the retinal pigment epithelium (RPE) with disruptions in Bruch membrane in Stargardt disease (STGD1). METHODS: Two patients with STGD1 were referred to our clinic for further evaluation. Fundus autofluorescence (FAF), spectral domain optical coherence tomography (SD-OCT), electroretinography (ERG) and Microperimetry (MP-1) were performed to assess the retinal anatomy and function. Screening for mutations in the ABCA4 gene was carried out and detected mutations were confirmed by direct sequencing. RESULTS: Both patients had bilateral macular geographic atrophy (GA) and yellowish subretinal pisciform flecks and mutations were detected in the ABCA4 gene by chip screening. SD-OCT revealed marked atrophy of the retina in the central macula, with focal defects in the RPE with disruptions in Bruch membrane and herniation of the retina through the defect in three of four eyes. CONCLUSION: This case report highlights the necessity for a detailed ophthalmic examination including SD-OCT of patients with STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Genetic screening revealed that the patient was compound heterozygous for the H1406Y and G1961E mutations in the ABCA4 gene. Login to comment

[hide] Clinical and molecular genetic study of 12 Italian... Genet Mol Res. 2012 Dec 17;11(4):4342-50. doi: 10.4238/2012.October.9.3. Oldani M, Marchi S, Giani A, Cecchin S, Rigoni E, Persi A, Podavini D, Guerrini A, Nervegna A, Staurenghi G, Bertelli M
Clinical and molecular genetic study of 12 Italian families with autosomal recessive Stargardt disease.
Genet Mol Res. 2012 Dec 17;11(4):4342-50. doi: 10.4238/2012.October.9.3., [PMID:23096905]

Abstract [show]
Stargardt disease was diagnosed in 12 patients from 12 families using complete ophthalmologic examination, fundus photography, fundus autofluorescence, and spectral-domain optical coherence tomography. DNA was extracted for polymerase chain reaction (PCR) and direct DNA sequencing (ABCA4 gene). Genetic counseling and eye examination were offered to 16 additional family members. Various patterns of presentation were observed in patients with clinical diagnoses of Stargardt disease. The genetic study identified 2 mutations in 75% of families (9/12); a second mutation could not be found in the remaining 25% of families (3/12). The most frequent mutation was G1961E, found in 17% of families (2/12). This finding is similar to that of a previous analysis report of an Italian patient series. Four new mutations were also identified: Tyr1858Asp, Leu1195fsX1196, p.Tyr850Cys, and p.Thr959Ala. Our results suggest that PCR and direct DNA sequencing are the most appropriate techniques for the analysis of the ABCA4 gene. However, this method requires supplementation with specific PCR analysis to diagnose large deletions. The study of the families identified healthy carriers and affected subjects in presymptomatic stages and was also useful for evaluating the risk of transmission to progeny. Combined ophthalmologic and genetic evaluation enabled better clinical management of these families.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 The most frequent mutation was G1961E, found in 17% of families (2/12). Login to comment
35 The most interesting aspect is that mutation G1961E is the most common in Italy and is associated with a milder phenotype (Simonelli et al., 2005; Passerini et al., 2010; Sodi et al., 2010). Login to comment
69 of patients Subject Allele 1 Allele 2 Age of diagnosis (years) Visual acuity Right eye Left eye 1 F1 ID81 Tyr1858Asp Met1Val; Arg2030Gln 22 20/50 20/32 2 F2 ID220 Ile156Val Gly607Arg; Gly1961Glu 30 20/800 20/400 3 F3 ID362 Met1Val Gly1961Glu; Arg2030Gln 60 20/40 20/32 4 F4 ID197 Asp1532Asn Arg2030term 40 20/32 20/32 5 F6 ID363 Tyr362Term Gly863Ala 16 20/200 20/250 6 F7 ID365 Arg1098Cys Cys1488Arg 50 20/32 20/800 7 F8 ID394 Arg18Trp Val767Asp 10 20/800 20/800 8 F9 ID396 IVS40+5G>A IVS13+1G>A 19 20/40 20/50 9 F10 ID366 p.Gln1513Profs*42 - 20 20/200 20/200 10 F12 ID377 Leu1195Argfs*2 - 50 20/32 20/20 11 F13 ID4 Cys2150Tyr - 70 20/400 20/400 12 F17 ID457 p.Tyr850Cys p.Thr959Ala 50 20/20 20/40 F1 = family 1; ID = reference code to a specific patient. Login to comment
90 In patients with the G1961E mutation, the most frequent ABCA4 alleles in Italian STGD patients, we observed various clinical features: one patient had late onset of the disease (30 years) and showed multiple foci of hypoautofluorescence surrounded by a hyperautofluorescent area in the macular region. Login to comment
95 For example, patients with the G1961E mutation had extremely different ages of onset and fundus findings. Login to comment
107 The most frequent mutation was G1961E, found in 17% of families. Login to comment

[hide] Detection rate of pathogenic mutations in ABCA4 us... Arch Ophthalmol. 2012 Nov;130(11):1486-90. doi: 10.1001/archophthalmol.2012.1697. Downes SM, Packham E, Cranston T, Clouston P, Seller A, Nemeth AH
Detection rate of pathogenic mutations in ABCA4 using direct sequencing: clinical and research implications.
Arch Ophthalmol. 2012 Nov;130(11):1486-90. doi: 10.1001/archophthalmol.2012.1697., [PMID:23143460]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 In 5 of the 11 patients, the identification of 2 pathogenic mutations confirmed the historical diagnosis and all had chorioretinal atro- Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 1 1Ab0e;G M1V 2588Gb0e;C G863A In trans Unaffected parents carriers 30 STGD maf9;/0/0 R2030Q 3 PVs 2 161Gb0e;A C54Y 2588Gb0e;C G863A In trans Affected sibling with same mutations 12 STGD m/0/0 0 2 PVs 3 161Gb0e;A C54Y 5882Gb0e;A G1961E NK NK 18 STGD m/0/0 0 2 PVs 4 634Cb0e;T R212C 4457Cb0e;T P1486L In trans Unaffected parents carriers 17 STGD m/0/0 0 2 PVs 5 2588Gb0e;C G863A 4469Gb0e;A C1490Y NK NK 48 STGD maf9;/0/1 0 2 PVs 6 2971Gb0e;C G991R 4254-2Ab0e;G Splice NK NK 21 STGD m/0/0 0 2 PVs 7 2971Gb0e;C G991R 3602Tb0e;G L1201R NK NK 18 STGD maf9;af9;/NP/NP V643M (likely), G885E (likely), G1441D (unlikely), V2244V (highly likely) b0e;2 PVs 8 3322Cb0e;T R1108C 768Gb0e;T V256V NK NK 13 STGD maf9;af9;/1/1 0 2 PVs 9 3322Cb0e;T R1108C 6079Cb0e;T L2027F NK NK 26 STGD maf9;/0/0 0 2 PVs 10 3386Gb0e;T R1129L 4469Gb0e;A C1490Y In trans Unaffected parents carriers 15 STGD maf9;/0/0 R152Q (unlikely) 2 PVs (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1486 phy on current clinical examination, consistent with progression of the disorder.5 One of the 11 patients with chorioretinal atrophy (subject 40) had a single stop codon, again strongly supporting the original clinical diagnosis. Six of the 11 patients did not have pathogenic mutations in ABCA4. Login to comment
30 In 3 of the 6 patients with a historical diagnosis Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients (continued) Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 11 4139Cb0e;T P1380L 5714 af9; 5Gb0e;A Splice NK NK 19 STGD m/0/0 0 2 PVs 12 4457Cb0e;T P1486L 4457Cb0e;T P1486L In trans Unaffected sibling carries 1 mutation 25 STGD maf9;af9;/1/1 0 2 PVs 13 4537dupC Q1513fs 6391Gb0e;A E2131K In trans Unaffected parents carriers 10 STGD maf9;/0/0 R152Q in cis with Q1513fs, E2131K in cis with E471K 2 PVs 14 6079Cb0e;T L2027F 6079Cb0e;T L2027F In trans Unaffected sibling carrier 28 STGD maf9;af9;/0/0 0 2 PVs 15 5018 af9; 2Tb0e;C NA 6316Cb0e;T R2106C In trans Affected sibling with same mutations 17 STGD m/0/1 0 2 PVs 16 3004Cb0e;T R1002Wb 1957Cb0e;T R653C In trans NK 16 STGD m/0/1 0 2 PVs 17 1253Tb0e;C F418S 2588Gb0e;C G863A NK NK 52 STGD maf9;/0/0 0 2 PVs 18 6709Ab0e;C T2237Pb 3064Gb0e;A E1022K In trans 2 Affected siblings with same mutations 6 STGD maf9;af9;/0/0 0 2 PVs 19 5260Tb0e;G Y1754D 4469Gb0e;A C1490Y In trans NK 12 STGD maf9;af9;/0/0 0 2 PVs 20 551Cb0e;T S184Fb 4793Cb0e;A A1598D NK 2 Affected siblings with same mutations 58 STGD m/NP/NP 0 2 PVs 21 550-551TCb0e;CG S184Rb 5882Gb0e;A G1961E In trans Affected sibling with same mutations 25 STGD maf9;af9;/0/0 0 2 PVs 22 5313-3Cb0e;G Spliceb 5882Gb0e;A G1961E In trans Unaffected parents carriers 47 STGD m/0/1 0 2 PVs 23 2588Gb0e;C G863A 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans NA 26 STGD maf9;af9;/3/1 1 In cis with G863A 2 PVs 24 5537Tb0e;C I1846T 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected son carries I1846T only 17 STGD maf9;af9;/3/3 0 2 PVs 25 6089Gb0e;A R2030Q 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected sibling carries R2030Q 4 STGD m/NP/NP 0 2 PVs 26 6730-1Gb0e;C Spliceb 2588Gb0e;C G863A NK NK 15 STGD NP/NP/NP 0 2 PVs 27 3291Ab0e;T R1097Sb 3056Cb0e;T T1019M In trans NK 9 STGD NP/NP/NP 1 In cis with R1097S 2 PVs 28 498delT L167HisfsX2b Not present NA NA NK 28 STGD m/1/1 0 1 PV 29 2345Gb0e;A W782Xb Not present NA NA Unaffected mother carries mutation 25 STGD m/1/1 0 1 PV 30 2588Gb0e;C G863A 4326Cb0e;A N1442K NK NK 36 STGD maf9;/0/0 0 1 PV af9; N1442K (unlikely) 31 2966Tb0e;C V989A Not present NA NA NK 49 STGD m/1/1 0 1 PV (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1487 (c)2012 American Medical Association. All rights reserved. Downloaded From: http://archopht.jamanetwork.com/ by a Semmelweis University Budapest User on 12/06/2015 lopathy is genetically heterogeneous. A total of 10 novel mutations were identified (Table). Login to comment

[hide] Retinal phenotypes in patients homozygous for the ... Invest Ophthalmol Vis Sci. 2013 Jan 17;54(1):520. doi: 10.1167/iovs.12-11472. Burton DS, Ali M, McKibbin M
Retinal phenotypes in patients homozygous for the G1961E mutation in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2013 Jan 17;54(1):520. doi: 10.1167/iovs.12-11472., [PMID:23329737]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Letters Retinal Phenotypes in Patients Homozygous for the G1961E Mutation in the ABCA4 Gene We read with great interest the article by Burke et al., ''Retinal Phenotypes in Patients Homozygous for the G1961E Mutation in the ABCA4 Gene.``1 The article, which describes a series of 12 patients and the range of ocular phenotypes associated with homozygosity for the G1961E mutation in the ABCA4 gene, concludes that the phenotype is usually at the milder end of the disease spectrum and with a later onset of visual symptoms than would be typically seen in Stargardt disease. Login to comment
7 However, genetic analysis subsequently identified heterozygous mutations in the ABCA4 gene, that is, G1961E and a novel splice site mutation (c.3328&#fe;1G>C). Login to comment
8 An earlier study by Cella et al.2 reported the phenotype of patients who were both heterozygous and homozygous for the G1961E mutation. Login to comment
10 The phenotype for the heterozygous cases is similar to that reported by Simonelli and colleagues.3 Collectively, these reports suggest that there may not be a meaningful difference in the phenotype and specifically the age of onset between homozygous and heterozygous carriers of the G1961E mutation. Login to comment
13 Burke TR, Fishman GA, Zernant J, et al. Retinal phenotypes in patients homozygous for the G1961E mutation in the ABCA4 gene. Login to comment
16 Cella W, Greenstein VC, Zernant-Rajang J, et al. G1961E mutant allele in the Stargardt disease gene ABCA4 causes bull`s eye maculopathy. Login to comment

[hide] Author response: Retinal phenotypes in patients ho... Invest Ophthalmol Vis Sci. 2013 Jan 17;54(1):521. doi: 10.1167/iovs.12-11528. Burke TR, Allikmets R
Author response: Retinal phenotypes in patients homozygous for the G1961E mutation in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2013 Jan 17;54(1):521. doi: 10.1167/iovs.12-11528., [PMID:23329738]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Letters Author Response: Retinal Phenotypes in Patients Homozygous for the G1961E Mutation in the ABCA4 Gene We appreciate the interest and comments of Burton et al.1 relating to our recent publication ''Retinal phenotypes in patients homozygous for the G1961E mutation in the ABCA4 gene.``2 In our report of 12 patients homozygous for the G1961E mutation, six patients had ''milder`` and six had more ''severe`` retinal disease phenotypes (as suggested by the extent of retinal changes present). Login to comment
1 Of the six patients in the latter group, five had additional mutations detected in cis with G1961E on either one or both chromosomes (i.e., complex alleles), clearly exacerbating protein dysfunction and, consequently, disease severity. Login to comment
2 We concluded that the G1961E mutation causes disease in homozygosity and that these patients exhibit a wide range of retinal phenotypes. Login to comment
3 Therefore, our findings were consistent with the authors` statement that ''there may not be a meaningful difference in the phenotype`` between patients homozygous and (compound) heterozygous for the G1961E mutation. Login to comment
4 The publications that they cited, together with other reports (both from our group as well as that from others), have shown that G1961E, in either compound heterozygous or homozygous state, tends to be associated with a localized retinal disease phenotype, including bull`s eye maculopathy, the absence of a ''silent`` choroid on fluorescein angiogram, and a normal full-field electroretinogram.3-5 The cumulative evidence suggests that even in cases of a ''severe`` second mutation (those resulting in a nonfunctional protein, such as nonsense mutations and frameshift-generating variants), G1961E tends to yield a ''milder`` phenotype, although variation in phenotype has also been reported in such patients.6 With regard to age of onset of visual symptoms in ABCA4 disease, the severity of phenotype may also be affected by environmental or genetic (other than ABCA4) modifying factors and their effects on ABCA4 protein function. Login to comment
7 Nonetheless, trends in age of onset emerge from the studies of patient cohorts that carry at least one mutation, which is the same for the entire cohort, and these have suggested that this is generally later for patients with the G1961E mutation. Login to comment
8 In summary, patients homozygous and heterozygous for the G1961E mutation in the ABCA4 gene tend to demonstrate a milder phenotype, including a later age of onset of visual symptoms. Login to comment
13 Retinal phenotypes in patients homozygous for the G1961E mutation in the ABCA4 gene. Invest Ophthalmol Vis Sci. 2013;54:520. Login to comment
14 2. Burke TR, Fishman GA, Zernant J, et al. Retinal phenotypes in patients homozygous for the G1961E mutation in the ABCA4 gene. Invest Ophthalmol Vis Sci. 2012;53:4458-4467. Login to comment
23 Cella W, Greenstein VC, Zernant-Rajang J, et al. G1961E mutant allele in the Stargardt disease gene ABCA4 causes bull`s eye maculopathy. Login to comment

[hide] A longitudinal study of stargardt disease: clinica... Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15. Fujinami K, Lois N, Davidson AE, Mackay DS, Hogg CR, Stone EM, Tsunoda K, Tsubota K, Bunce C, Robson AG, Moore AT, Webster AR, Holder GE, Michaelides M
A longitudinal study of stargardt disease: clinical and electrophysiologic assessment, progression, and genotype correlations.
Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15., [PMID:23499370]

Abstract [show]
PURPOSE: To investigate the clinical and electrophysiologic natural history of Stargardt disease and correlate with the genotype. DESIGN: Cohort study of 59 patients. METHODS: Clinical history, examination, and electrophysiologic assessment were undertaken in a longitudinal survey. Patients were classified into 3 groups based on electrophysiologic findings, as previously published: Group 1 had dysfunction confined to the macula; Group 2 had macular and generalized cone system dysfunction; and Group 3 had macular and both generalized cone and rod system dysfunction. At baseline, there were 27 patients in Group 1, 17 in Group 2, and 15 in Group 3. Amplitude reduction of >50% in the relevant electroretinogram (ERG) component or a peak time shift of >3 ms for the 30 Hz flicker ERG or bright flash a-wave was considered clinically significant ERG deterioration. Molecular screening of ABCA4 was undertaken. RESULTS: The mean age at baseline was 31.7 years, with the mean follow-up interval being 10.5 years. A total of 22% of patients from Group 1 showed ERG group transition during follow-up, with 11% progressing to Group 2 and 11% to Group 3. Forty-seven percent of patients in Group 2 progressed to Group 3. There was clinically significant ERG deterioration in 54% of all subjects: 22% of Group 1, 65% of Group 2, and 100% of Group 3. At least 1 disease-causing ABCA4 variant was identified in 47 patients. CONCLUSIONS: All patients with initial rod ERG involvement demonstrated clinically significant electrophysiologic deterioration; only 20% of patients with normal full-field ERGs at baseline showed clinically significant progression. Such data assist counseling by providing more accurate prognostic information and are also highly relevant in the design, patient selection, and monitoring of potential therapeutic interventions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Clinical Data and Molecular Genetic Status of 59 Patients With Stargardt Disease Pt Onset (y) Age (y) logMAR VA Variants Identifieda BL FU BL FU 1 16 17 26 0.0/1.0 0.0/0.48 c.768G>T / p.Gly863Ala / p.Arg943Gln 2 15 17 25 0.78/0.78 1.0/1.0 p. Arg1443His 3 11 18 27 0.78/1.0 1.0/1.0 p.Trp439* / p.Gly863Ala / p.Leu1970Phe 4 19 21 32 0.78/0.78 1.0/1.0 p.Leu2027Phe 5 10 22 30 0.48/0.48 1.0/0.78 p.Gly863Ala / p.Arg943Gln / c.5461-10 T>C 6 18 26 37 0.78/1.0 1.0/1.0 p.Pro1380Phe 7 25 28 40 0.78/1.0 1.3/0.78 ND 8 24 29 38 1.0/0.78 1.0/1.0 p.Phe418Ser / p.Leu2027Phe 9 24 31 44 1.0/1.0 1.3/1.0 c.4253&#fe;5 G>T / p.Gly1507Arg 10 26 32 44 0.78/0.78 1.0/1.0 p.Cys1490Tyr / p.Arg2030Gln 11 31 34 46 0.18/0.3 0.6/0.7 ND 12 17 35 47 1.0/1.0 1.0/1.0 p.Asn96His 13 23 35 45 1.0/0.3 1.0/0.48 p.Gly1513Profs*1554 14 33 37 48 0.18/1.48 1.0/1.3 ND 15 38 40 51 0.18/0.78 1.0/1.0 p.Arg2107His 16 42 43 53 0.0/0.0 1.0/1.0 ND 17 22 48 59 1.0/1.0 1.0/1.0 p.Cys54Tyr 18 20 49 59 1.0/0.6 1.0/1.0 p.Pro1380Leu / p.Gly1961Glu 19 35 50 61 1.0/0.3 1.0/1.0 p.Arg1108Cys 20 25 56 67 1.3/0.18 1.0/1.0 p.Trp439* / p.Gly863Ala 21 48 59 71 1.0/0.78 1.0/1.0 p. Ile156 Val / p. Cys1455Arg / p. Phe1839Ser 22 21 22 31 0.3/1.0 1.0/1.0 p.Arg2107His 23 21 23 33 1.0/1.0 1.0/1.0 p.Gly863Ala 24 48 64 73 0.0/1.0 0.18/3.0 p.Tyr1652* 25 17 19 29 0.78/0.3 1.0/1.0 c.5461-10 T>C 26 17 21 33 1.0/0.78 1.0/1.0 ND 27 27 53 66 1.78/1.78 1.3/1.0 p.Ser1071Cysfs*1084 28 5 14 21 0.78/0.78 1.0/1.0 p.Arg408* / p.Val675lle 29 9 15 27 1.08/1.08 1.0/1.0 p.Cys2150Tyr 30 14 24 32 1.0/0.78 1.0/1.0 ND 31 18 28 39 1.0/1.0 1.0/1.0 p.Gly863Ala / p.Arg1108Cys / p.Arg943Gln 32 14 29 37 1.0/1.0 1.0/1.0 p.Arg653Cys / p.Arg2030Gln 33 19 29 40 1.0/1.0 1.0/1.08 ND 34 34 40 49 0.3/0.48 1.0/1.0 p.Gly863Ala / p.Glu1087Lys 35 25 43 54 1.0/1.0 1.0/1.0 p.Cys54Tyr / p.Gly863Ala 36 38 60 69 1.0/1.0 1.3/1.08 p.Val931Met / c.5461-10 T>C 37 10 11 20 1.0/0.78 1.3/1.3 p.Pro1380Leu 38 10 15 23 1.0/1.0 1.3/1.3 p.Ser1071Cysfs*1084 / p.Pro1380Leu 39 24 25 38 1.56/0.3 2.0/2.0 c.5461-10 T>C / c.5714&#fe;5 G>A 40 18 26 36 1.3/1.3 2.0/1.3 ND 41 32 33 45 0.48/0.48 1.0/1.0 ND 42 32 35 46 1.3/0.0 3.0/1.0 p.Cys54Tyr 43 30 35 45 0.48/0.48 2.0/1.3 ND 44 15 41 49 1.3/1.3 2.0/1.3 p.Asn965Ser 45 8 8 20 0.78/0.78 1.0/1.0 p.Thr1019Met 46 10 11 23 1.0/1.0 1.0/1.0 p.Thr1019Met 47 8 12 24 2.0/1.56 1.78/1.48 p.Cys2150Tyr 48 17 18 26 1.0/0.78 1.3/1.0 c.5461-10 T>C / p.Leu2027Phe 49 8 21 33 1.3/1.3 2.0/2.0 p.Asp574Aspfs*582 50 8 27 39 2.0/1.56 1.78/1.48 c.5461-10 T>C 51 24 31 43 1.18/1.18 1.08/1.3 p.Arg1640Trp / p.Leu2027Phe Continued on next page respective electrophysiologic traces appear in Figure 2. Login to comment

[hide] Outcome of ABCA4 disease-associated alleles in aut... Ophthalmology. 2013 Nov;120(11):2332-7. doi: 10.1016/j.ophtha.2013.04.002. Epub 2013 Jun 4. Riveiro-Alvarez R, Lopez-Martinez MA, Zernant J, Aguirre-Lamban J, Cantalapiedra D, Avila-Fernandez A, Gimenez A, Lopez-Molina MI, Garcia-Sandoval B, Blanco-Kelly F, Corton M, Tatu S, Fernandez-San Jose P, Trujillo-Tiebas MJ, Ramos C, Allikmets R, Ayuso C
Outcome of ABCA4 disease-associated alleles in autosomal recessive retinal dystrophies: retrospective analysis in 420 Spanish families.
Ophthalmology. 2013 Nov;120(11):2332-7. doi: 10.1016/j.ophtha.2013.04.002. Epub 2013 Jun 4., [PMID:23755871]

Abstract [show]
OBJECTIVE: To provide a comprehensive overview of all detected mutations in the ABCA4 gene in Spanish families with autosomal recessive retinal disorders, including Stargardt's disease (arSTGD), cone-rod dystrophy (arCRD), and retinitis pigmentosa (arRP), and to assess genotype-phenotype correlation and disease progression in 10 years by considering the type of variants and age at onset. DESIGN: Case series. PARTICIPANTS: A total of 420 unrelated Spanish families: 259 arSTGD, 86 arCRD, and 75 arRP. METHODS: Spanish families were analyzed through a combination of ABCR400 genotyping microarray, denaturing high-performance liquid chromatography, and high-resolution melting scanning. Direct sequencing was used as a confirmation technique for the identified variants. Screening by multiple ligation probe analysis was used to detect possible large deletions or insertions in the ABCA4 gene. Selected families were analyzed further by next generation sequencing. MAIN OUTCOME MEASURES: DNA sequence variants, mutation detection rates, haplotypes, age at onset, central or peripheral vision loss, and night blindness. RESULTS: Overall, we detected 70.5% and 36.6% of all expected ABCA4 mutations in arSTGD and arCRD patient cohorts, respectively. In the fraction of the cohort where the ABCA4 gene was sequenced completely, the detection rates reached 73.6% for arSTGD and 66.7% for arCRD. However, the frequency of possibly pathogenic ABCA4 alleles in arRP families was only slightly higher than that in the general population. Moreover, in some families, mutations in other known arRP genes segregated with the disease phenotype. CONCLUSIONS: An increasing understanding of causal ABCA4 alleles in arSTGD and arCRD facilitates disease diagnosis and prognosis and also is paramount in selecting patients for emerging clinical trials of therapeutic interventions. Because ABCA4-associated diseases are evolving retinal dystrophies, assessment of age at onset, accurate clinical diagnosis, and genetic testing are crucial. We suggest that ABCA4 mutations may be associated with a retinitis pigmentosa-like phenotype often as a consequence of severe (null) mutations, in cases of long-term, advanced disease, or both. Patients with classical arRP phenotypes, especially from the onset of the disease, should be screened first for mutations in known arRP genes and not ABCA4.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
90 These results are supported by previous findings that the p.Leu541Pro and p.Arg602Trp variants result in mislocalized protein,22 the p.Leu1940Pro and IVS38e10T/C variants confer much earlier onset of the disease,23 and the p.His1838Asp variant, in a complex allele with the p.Gly1961Glu mutation, results in an early-onset, severe disease.24 Although the above estimates are simplified because they do not take into account environmental factors and genetic variation at other loci in these patients, they serve as a good basis for association with disease onset and disease severity. Login to comment

[hide] The clinical effect of homozygous ABCA4 alleles in... Ophthalmology. 2013 Nov;120(11):2324-31. doi: 10.1016/j.ophtha.2013.04.016. Epub 2013 Jun 12. Fujinami K, Sergouniotis PI, Davidson AE, Mackay DS, Tsunoda K, Tsubota K, Robson AG, Holder GE, Moore AT, Michaelides M, Webster AR
The clinical effect of homozygous ABCA4 alleles in 18 patients.
Ophthalmology. 2013 Nov;120(11):2324-31. doi: 10.1016/j.ophtha.2013.04.016. Epub 2013 Jun 12., [PMID:23769331]

Abstract [show]
PURPOSE: To describe the phenotypic presentation of a cohort of individuals with homozygous disease-associated ABCA4 variants. DESIGN: Retrospective case series. PARTICIPANTS: Eighteen affected individuals from 13 families ascertained from a total cohort of 214 families with ABCA4-related retinal disease presenting to a single center. METHODS: A detailed history was obtained, and color fundus photography, autofluorescence (AF) imaging, optical coherence tomography (OCT), and electrophysiologic assessment were performed. Phenotypes based on ophthalmoscopy, AF, and electrophysiology were assigned using previously reported characteristics. ABCA4 mutation detection was performed using the ABCR400 microarray (Asper Biotech, Tartu, Estonia) and high-throughput DNA sequencing, with direct sequencing used to assess segregation. MAIN OUTCOME MEASURES: Detailed clinical, electrophysiologic, and molecular genetic findings. RESULTS: Eleven disease-associated homozygous ABCA4 alleles were identified, including 1 frame shift, 2 stops, 1 intronic variant causing splice-site alteration, 2 complex missense variants, and 5 missense variants: p.Glu905fsX916, p.Arg1300X, p.Gln2220X, c.4253+4 C>T, p.Leu541Pro and p.Ala1038Val (homozygosity for complex allele), p.Val931Met and p.Arg1705Gln (complex allele), p.Arg212Cys, p.Cys1488Arg, p.Arg1640Trp, p.Gly1961Glu, and p.Leu2027Phe. Eight of these 11 homozygous alleles have not been reported previously. Six of 7 patients with homozygous null alleles had early-onset (<10 years) disease, with all 7 having a severe phenotype. Two patients with homozygous missense variants (p.Leu541Pro and p.Ala1038Val [complex], and p.Arg1640Trp) presented with a severe phenotype. Three patients with homozygous p.Gly1961Glu had adult-onset disease and a mild phenotype. One patient with homozygous p.Leu2027Phe showed a spared fovea and preserved visual acuity. CONCLUSIONS: The phenotypes represented in patients identified as homozygous for presumed disease-associated ABCA4 variants gives insight into the effect of individual alleles. Null alleles have severe functional effects, and certain missense variants are similar to nulls, suggesting complete abrogation of protein function. The common alleles identified, p.Gly1961Glu and p. Leu2027Phe, both have a mild structural and functional effect on the adult retina; the latter is associated with relatively retained photoreceptor architecture and function at the fovea.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Results: Eleven disease-associated homozygous ABCA4 alleles were identified, including 1 frame shift, 2 stops, 1 intronic variant causing splice-site alteration, 2 complex missense variants, and 5 missense variants: p.Glu905fsX916, p.Arg1300X, p.Gln2220X, c.4253&#fe;4 C>T, p.Leu541Pro and p.Ala1038Val (homozygosity for complex allele), p.Val931Met and p.Arg1705Gln (complex allele), p.Arg212Cys, p.Cys1488Arg, p.Arg1640Trp, p.Gly1961Glu, and p.Leu2027Phe. Login to comment
11 Three patients with homozygous p.Gly1961Glu had adult-onset disease and a mild phenotype. Login to comment
13 Conclusions: The phenotypes represented in patients identified as homozygous for presumed disease-associated ABCA4 variants gives insight into the effect of individual alleles. Null alleles have severe functional effects, and certain missense variants are similar to nulls, suggesting complete abrogation of protein function. The common alleles identified, p.Gly1961Glu and p. Leu2027Phe, both have a mild structural and functional effect on the adult retina; the latter is associated with relatively retained photoreceptor architecture and function at the fovea. Login to comment
18 There are a number of reports of families or small case series describing the phenotypic features of homozygous patients,6,10,11,22,25e28 and 1 report features homozygous patients with 1 specific common allele (p.Gly1961Glu).12 However, studies of large cohorts are still lacking because of the rarity of such homozygous cases. Login to comment
60 Sex Ethnicity Consanguinity Age at Onset (yrs) Age (yrs) Duration of Disease (yrs) LogMAR VA Fundus Appearance AF Pattern ERG Group OCT Central Foveal Thickness (mm) Mutation Status RE LE RE LE 1 1 M S Asian Yes (1st cousin) 11 33 22 1.0 1.0 2 2 1 64 69 c.634 C>T, p.Arg212Cys 2 1 F S Asian Yes (1st cousin) 11 36 25 1.0 1.0 2 2 3 31 41 c.634 C>T, p.Arg212Cys 3* 2 M European No 3 8 5 1.2 1.2 2 2 3y 41 36 c.1622 T>C, p.Leu541Pro / c.3113 C>T, p.Ala1038Val 4 3 F S Asian Yes (2nd cousin once removed) 5 8 3 1.0 1.0 2 2 3 NA NA c.2713delG, p.Glu905fsX916 5 4 M S Asian Yes (unknown) 10 25 15 1.0 1.08 2 2 3 64 60 c.2791 G>A, p.Val931Met / c.5114 G>A, p.Arg1705Gln 6 5 M S Asian Yes (1st cousin) 10 30 20 1.0 1.0 2 2 3 NA NA c.4462 T>C, p.Cys1488Arg 7 5 F S Asian Yes (1st cousin) 10 22 12 2.0 1.0 2 2 3 NA NA c.4462 T>C, p.Cys1488Arg 8 6 M ME Asian Yes (1st cousin) 30 36 6 1.08 2.0 3 3 3 103 95 c.4918 C>T, p.Arg1640Trp 9 7 F S Asian Yes (2nd cousin) 19 27 8 1.78 2.0 1 2 1 128 90 c.5882 G>A, p.Gly1961Glu 10 7 M S Asian Yes (2nd cousin) 30 34 4 0.48 0.48 1 2 1 NA NA c.5882 G>A, p.Gly1961Glu 11 8 F S Asian Yes (1st cousin) 17 26 9 0.78 0.78 1 1 1 54 47 c.5882 G>A, p.Gly1961Glu 12 9 F European No 44 44 0 0.18 0.0 2 2 1 NA NA c.6079 C>T, p.Leu2027Phe 13 10 M ME Asian Yes (1st cousin) 5 11 6 1.3 1.0 3 2 3 62 68 c.3898 C>T, p.Arg1300X 14 11 M S Asian Yes (unknown) 8 11 3 1.0 1.0 2 2 3 NA NA c.4253&#fe;4 C>T 15 12 M S Asian Yes (1st cousin) 9 48 39 3.0 3.0 3 NA 3 NA NA c.6658 C>T, p.Gln2220X 16 13 M S Asian Yes (uncle and niece) 4 7 3 1.08 1.08 1 NA 3 NA NA c.6658 C>T, p.Gln2220X 17 13 M S Asian Yes (uncle and niece) 6 8 2 1.08 1.0 1 NA 3 NA NA c.6658 C>T, p.Gln2220X 18 13 M S Asian Yes (1st cousin) 17 25 8 1.78 1.78 3 NA 3 NA NA c.6658 C>T, p.Gln2220X AF &#bc; autofluorescence; ERG &#bc; electroretinography; F &#bc; female; FM No. Login to comment
95 Three patients from 2 families (patients 9, 10, and 11), homozygous for p.Gly1961Glu, showed similar mild findings: adult onset (17e30 years), type 1 fundus appearance, type 1 or 2 AF pattern, and ERG group 1 but variable visual acuity and OCT findings. Login to comment
116 Three patients, homozygous for p.Gly1961Glu, had localized dysfunction confined to the macula with no evidence of generalized retinal dysfunction, consistent with previous reports.12,20 Burke et al12 reported that patients homozygous for p.Gly1961Glu usually have milder disease, with severe phenotypes linked to the presence of additional ABCA4 variants. Login to comment
117 The 2 previously reported variants (p.Asn96Lys and p.His1838Asp) in complex with p.Gly1961Glu that were associated with a very severe phenotype were not detected in our patients.12 We observed a particularly late-onset mild disorder, with numerous flecks and foveal sparing, associated with p.Leu2027Phe, suggesting primary disease of the parafoveal RPE with preservation of foveal structure, a "foveal sparing" phenotype. Login to comment
118 This supports previous reports of p.Leu2027Phe in heterozygous patients.14,23 Of note, p.Gly1961Glu and p.Leu2027Phe are both situated in the nucleotide-binding domain 2 subunit, shown to be the site of adenosine triphosphatase activity (Fig 5, available at http://aaojournal.org).39,40 Subjects homozygous for p.Arg212Cys had phenotypes of moderate severity, and these findings are generally in keeping with previous reports.19 Patient 5, homozygous for p.Val931Met and p.Arg1705Gln in complex, and subjects 6 and 7, homozygous for p.Cys1488Arg, had "typical" Stargardt`s disease fundus and AF findings with macular atrophy surrounded by flecks with electrophysiologic evidence of generalized rod and cone system dysfunction. Login to comment
123 Haplotype analysis in 2 probands homozygous for p.G1961E and 2 homozygous for p.Gln2220X suggested a founder effect for these mutations in these consanguineous families from South Asia, although some of the screened variants were not rare. Login to comment
124 Concordance in phenotypic features between patients with an identical disease-causing variant was observed in individuals homozygous for p.Arg212Cys, p.Cys1488Arg, p.Gly1961Glu, and p.Gln2220X, suggesting that few modifiers exist. Login to comment

[hide] Characterization of stargardt disease using polari... Invest Ophthalmol Vis Sci. 2013 Sep 27;54(9):6416-25. doi: 10.1167/iovs.12-11550. Ritter M, Zotter S, Schmidt WM, Bittner RE, Deak GG, Pircher M, Sacu S, Hitzenberger CK, Schmidt-Erfurth UM
Characterization of stargardt disease using polarization-sensitive optical coherence tomography and fundus autofluorescence imaging.
Invest Ophthalmol Vis Sci. 2013 Sep 27;54(9):6416-25. doi: 10.1167/iovs.12-11550., [PMID:23882696]

Abstract [show]
PURPOSE: To identify disease-specific changes in Stargardt disease (STGD) based on imaging with polarization-sensitive spectral-domain optical coherence tomography (PS-OCT) and to compare structural changes with those visible on blue light fundus autofluorescence (FAF) imaging. METHODS: Twenty-eight eyes of 14 patients diagnosed with STGD were imaged using a novel high-speed, large-field PS-OCT system and FAF (excitation 488 nm, emission > 500 nm). The ophthalmoscopic phenotype was classified into three groups. ABCA4 mutation testing detected 15 STGD alleles, six of which harbor novel mutations. RESULTS: STGD phenotype 1 (12 eyes) showed sharply delineated areas of absent RPE signal on RPE segmentation B-scans of PS-OCT correlating with areas of hypofluorescence on FAF. Adjacent areas of irregular fluorescence correlated with an irregular RPE segmentation line with absence of overlaying photoreceptor layers. Eyes characterized on OCT by a gap in the subfoveal outer segment layer (foveal cavitation) showed a normal RPE segmentation line on PS-OCT. Hyperfluorescent flecks on FAF in phenotype 2 STGD (8 eyes) were identified as clusters of depolarizing material at the level of the RPE. Distribution of flecks could be depicted on RPE elevation maps. An increased amount of depolarizing material in the choroid was characteristic for STGD Phenotype 3 (8 eyes). CONCLUSIONS: PS-OCT together with FAF identified characteristic patterns of changes in different stages of the disease. PS-OCT is a promising new tool for diagnosis and evaluation of future treatment modalities in STGD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Patient Characteristics Patient Number Sex Age Age of Onset Visual Acuity RE/LE Fundus Phenotype ERG Type ABCA4 Mutation Allele 1 ABCA4 Mutation Allele 2 Exon Position cDNA Effect on Protein Exon Position cDNA Effect on Protein 1 M 52 19 1.00/1.30 1 2 33 c.4738_4739delTT p.Leu1580Lysfs*16 46 c.6320G>A p.Arg2107His 2 F 32 9 1.30/1.00 1 1 19 c.2829delG p.Pro944Glnfs*6 42 c.5882G>A p.Gly1961Glu 3 M 29 16 1.30/1.00 1 1 IVS1 c.66&#fe;3A>C / 19 c.2791G>A p.Val931Met 4 F 32 20 1.00/1.00 1 1 17 c.2588G>C* p.Gly863Ala* 22 c.3266C>T p.Thr1089Ile 5 M 28 21 0.52/0.70 1 1 42 c.5882G>A p.Gly1961Glu 42 c.5882G>A p.Gly1961Glu 6 F 25 20 1.00/0.80 1 1 13 c.1865delG p.Ser622Thrfs*27 42 c.5882G>A p.Gly1961Glu 7 F 32 27 0.05/0.10 2 1 25 c.3626T>C p.Met1209Thr 33 c.4739T>C p.Leu1580Ser 8 F 42 17 1.00/1.00 2 1 12 c.1622T>C* p.Leu541Proߤ 42 c.5882G>A p.Gly1961Glu 9 F 23 23 0.00/0.00 2 1 IVS40 c.5714&#fe;5G>A / IVS40 c.5714&#fe;5G>A / 10 F 30 16 1.00/1.00 2 1 12 c.1622T>Cߤ p.Leu541Proߤ 19 c.2864A>G p.Glu955Gly 11 M 45 19 1.30/1.30 3 2 12 c.1622T>Cߤ p.Leu541Proߤ 17 c.2588G>C* p.Gly863Ala* 12 M 37 14 1.00/1.00 3 2 12 c.1622T>Cߤ p.Leu541Proߤ 19 c.2864A>G p.Glu955Gly 13 F 27 20 1.00/1.00 3 2 12 c.1622T>Cߤ p.Leu541Proߤ IVS40 c.5714&#fe;5G>A / 14 M 41 14 2.00/2.00 3 3 IVS13 c.1937&#fe;1G>A / 17 c.2588G>C* p.Gly863Ala* Patient number, sex, age, age of disease onset, visual acuity (logMAR), fundus phenotype (1, STGD phenotype 1; 2, STGD phenotype 2; 3, STGD phenotype 3), ERG type, ABCA4 mutation allele 1 and ABCA4 mutation allele 2; exons and coding DNA (cDNA) positions based on reference sequence NM_000350 (IVS: intervening sequence, intron) are shown. Login to comment
109 The four patients showing a central area of RPE atrophy were compound heterozygous for a known missense mutation and for a novel, previously not described, mutation: patient 1 harbored the known c.6320G>A (p.Arg2107His) mutation and a, so far not described, null mutation in exon 33, c.4738_4739delTT (p.Leu1580Lysfs*16), patient 2 the frequent mild missense mutation c.5882G>A (p.Gly1961Glu) and a novel single-base deletion, c.2829delG (p.Pro944Glnfs*6) in exon 19, and patient 3 the known c.2791G>A (p.Val931Met) mutation and a presumably destructive novel splice site mutation within the first intron (c.66&#fe;3A>C). Login to comment
112 Both patients characterized by a foveal cavitation carried the frequent mild p.Gly1961Glu mutation, which was homozygous in patient 5 and compound heterozygous with a novel single-base deletion in exon 13, c.1865delG (p.Ser622Thrfs*27) in patient 6. Login to comment
197 [2588G>C; 2828G>A] p.[Gly863Ala; Arg943Glu]; II: c.5714&#fe;5G>A; III: c.5882G>A p.Gly1961Glu) or severe (c. Login to comment
201 Both patients with the foveal cavitation phenotype carried the mild Gly1961Glu mutation, either homozygous or in combination with a null mutation. Login to comment

[hide] Clinical and molecular analysis of Stargardt disea... Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003. Fujinami K, Sergouniotis PI, Davidson AE, Wright G, Chana RK, Tsunoda K, Tsubota K, Egan CA, Robson AG, Moore AT, Holder GE, Michaelides M, Webster AR
Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function.
Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003., [PMID:23953153]

Abstract [show]
PURPOSE: To describe a cohort of patients with Stargardt disease who show a foveal-sparing phenotype. DESIGN: Retrospective case series. METHODS: The foveal-sparing phenotype was defined as foveal preservation on autofluorescence imaging, despite a retinopathy otherwise consistent with Stargardt disease. Forty such individuals were ascertained and a full ophthalmic examination was undertaken. Following mutation screening of ABCA4, the molecular findings were compared with those of patients with Stargardt disease but no foveal sparing. RESULTS: The median age of onset and age at examination of 40 patients with the foveal-sparing phenotype were 43.5 and 46.5 years. The median logMAR visual acuity was 0.18. Twenty-two patients (22/40, 55%) had patchy parafoveal atrophy and flecks; 8 (20%) had numerous flecks at the posterior pole without atrophy; 7 (17.5%) had mottled retinal pigment epithelial changes; 2 (5%) had multiple atrophic lesions, extending beyond the arcades; and 1 (2.5%) had a bull's-eye appearance. The median central foveal thickness assessed with spectral-domain optical coherence tomographic images was 183.0 mum (n = 33), with outer retinal tubulation observed in 15 (45%). Twenty-two of 33 subjects (67%) had electrophysiological evidence of macular dysfunction without generalized retinal dysfunction. Disease-causing variants were found in 31 patients (31/40, 78%). There was a higher prevalence of the variant p.Arg2030Gln in the cohort with foveal sparing compared to the group with foveal atrophy (6.45% vs 1.07%). CONCLUSIONS: The distinct clinical and molecular characteristics of patients with the foveal-sparing phenotype are described. The presence of 2 distinct phenotypes of Stargardt disease (foveal sparing and foveal atrophy) suggests that there may be more than 1 disease mechanism in ABCA4 retinopathy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 6089 G>A, p.Arg2030Gln] 16 44* 44 0.18 0 2 NA NA 1 A A NA NA [c.6079 C>T, p.Leu2027Phe/c.6079 C>T, p.Leu2027Phe] 17 48 73 0.18 3 4 135 86 U 2 A ND NA NA [c.4956 T>G, p.Tyr1652*] 18 56 57 0 0 2 254 273 1 ND A NA NA [c.5018&#fe;2 T>C, Splice site] 19 53* 53 0.48 0.18 1 137 133 1 A A NA NA [c.5461-10 T>C, Splice site] 20 49 58 0.18 0 1 256 222 U 1 A N 1 1 [c.5461-10 T>C, Splice site] 21 47** 47 0.3 0.3 1 239 202 U 1 A A 1 1 [c.1805 G>A, p.Arg602Gln] 22 50* 50 0.48 0.18 1 263 261 U 1 N N NA NA [c.1957 C>T, p.Arg653Cys] 23 39* 39 0 0.1 2 225 228 1 N N NA NA [c.2588 G>C, p. Gly863Ala] 24 55 57 0.48 0.48 1 117 74 1 ND ND NA NA [c.3602 T>G, p.Leu1201Arg] 25 50 54 0.48 0.18 1 147 144 U 3 ND ND NA NA [c.3602 T>G, p.Leu1201Arg] 26 43 47 2 0.18 1 70 52 1 ND ND NA NA [c.4319 T>C, p.Phe1440Ser] 27 30 51 0.3 0.3 1 75 79 U 3 A A NA NA [c.4685 T>C, p.Ile1562Thr] 28 29 34 0.18 0.18 3 132 107 1 A A NA NA [c.4926 C>G, p.Ser1642Arg] 29 52* 52 0.18 0.18 3 180 200 1 ND ND 2 2 [c.5882 G>A, p.Gly1961Glu] 30 28 28 0.1 0.1 2 NA NA 1 N ND NA NA [c.6079 C>T, p.Leu2027Phe] 31 40* 40 0.1 0.1 2 222 223 U NA NA NA NA NA [c.6079 C>T, p.Leu2027Phe] 32 45 48 0.18 3 1 237 252 U NA NA NA NA NA NA Continued on next page Tartu, Estonia) in all probands.43 The term ''variants`` used herein includes those sequence changes previously shown to be enriched in patients with Stargardt disease from prior studies. Login to comment
127 2588G>C, p.Gly863Ala 4 Het Allikmets46 Intol. 0.01 PRD 0.996 No change 68/13006 db SNP (rs76157638) 21 c.3113C>T, p.Ala1038Val 1 Het Webster53 Tol. NA Benign 0.014 Donor 43.5 70 New site (&#fe;61.72) 22/13006 db SNP (rs61751374) 24 c.3602T>G, p.Leu1201Arg 2 Het Lewis48 Tol. NA Benign 0.052 Donor 61.3 74 New site (&#fe;20.08) 416/13006 db SNP (rs61750126) 27 c.3898C>T, p.Arg1300* 1 Het Rivera49 NA NA ND 28 c.4139C>T, p.Pro1380Leu 2 Het Lewis48 Intol. 0.01 Benign 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4222 T>C, p.Trp1408Arg 2 Het Lewis48 Tol. NA PRD 0.845 No change ND dbSNP (rs61750135) 29 c.4319T>C, p.Phe1440Ser 1 Het Lewis48 Tol. NA PRD 0.744 No change ND dbSNP (rs61750141) 30 c.4469G>A, p.Cys1490Tyr 1 Het Webster53 Intol. 0.03 PRD 0.994 No change ND dbSNP (rs61751402) 31 c.4577C>T, p.Thr1526Met 1 Het Lewis48 Intol. 0.00 PRD 0.91 No change ND db SNP (rs61750152) 31 c.4594G>T, p.Asp1532Asn 3 Het Lewis48 Tol. NA PRD 0.853 No change ND 33 c.4685T>C, p.Ile1562Thr 1 Het Allikmets46 Tol. NA Benign 0.034 No change 18/13006 db SNP (rs1762111) 35 c.4956T>G, p.Tyr1652* 1 Het Fumagalli52 NA NA Acceptor 43 72 New site (&#fe;67.36) ND 35 c.4918C>T, p.Arg1640Trp 2 Het Rozet47 Intol. 0.00 PRD 1 No change ND dbSNP (rs61751404) 35 c.4926C>G, p.Ser1642Arg 1 Het Birch50 Tol. 0.68 Benign 0.116 No change ND db SNP (rs61753017) Int 35 c.5018&#fe;2T>C, Splice site 1 Het Fumagalli52 NA NA Donor 81.2 54 WT site broken (33.07) ND Int 38 c.5461-10T>C 3 Het Briggs50 NA NA No change 3/13006 db SNP (rs1800728) 40 c.5693G>A, p.Arg1898His 2 Het Allikmets46 NA Benign 0.00 No change 25/13006 db SNP (rs1800552) 42 c.5882G>A, p.Gly1961Glu 1 Het Allikmets46 Tol. 0.18 PRD 1 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T, p.Leu2027Phe 4 Homo Lewis48 Intol. 0.02 PRD 0.999 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A, p.Arg2030Gln 4 Het Lewis48 Tol. NA PRD 0.995 No change 8/13006 db SNP (rs61750641) 44 c.6118C>T, p.Arg2040* 1 Het Rosenberg54 NA NA ND 46 c.6320G>A, p.Arg2107His 1 Het Fishman8 Intol. 0.00 PRD 0.996 No change 91/13006 db SNP (rs62642564) EVS &#bc; Exome Variant Server; HSF &#bc; Human Splicing Finder program; Hum var score &#bc; Human var score; Int &#bc; intron; Intol &#bc; intolerant; Mt CV &#bc; mutant consensus value; NA &#bc; not applicable; ND &#bc; not detected; PRD &#bc; probably damaging; Pred. &#bc; prediction; SIFT &#bc; Sorting Intolerant from Tolerance program; Tol. &#bc; tolerant; Wt CV &#bc; wild-type consensus value. Login to comment
142 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) (Continued) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency Int 33 c.4773&#fe;48C>T 1 0.36% 34 c.4793C>A, p.Ala1598Asp 1 0.36% 35 c.c.4918C>T, p.Arg1640Trp 1 0.36% Int 35 c.5018&#fe;2T>C, Splice site 2 0.71% 36 c.5114G>A, p.Arg1705Gln 2 0.71% 37 c.5222_5233delTGGTGGTGGGC, p.Lys1741Hisfs 1 0.36% 37 c.5281_5289delCTT CCT GCC, p.Pro1761_Leu1763del 2 0.71% Int 38 c.5461-10T>C 23 8.21% Int 39 c.5585-1G>A, Splice site 1 0.36% Int 40 c.5714&#fe;5G>A, Splice site 5 1.79% 42 c.5882G>A, p.Gly1961Glu 17 6.07% 43 c.5908C>T, p.Leu1970Phe 2 0.71% 43 c.5917delG, p.Val1973* 1 0.36% 44 c.6079C>T, p.Leu2027Phe 10 3.57% 44 c.6089G>A, p.Arg2030Gln 3 1.07% 44 c.6118C>T, p.Arg2040* 1 0.36% 45 c.6148G>C, p.Val2050Leu 3 1.43% 46 c.6286G>A, p.Glu2096Lys 1 0.36% 46 c.6320G>A, p.Arg2107His 4 1.43% 47 c.6445C>T, p.Arg2149* 1 0.36% 47 c.6449G>A, p.Cys2150Tyr 3 1.07% 48 c.6658C>T, p.Gln2220* 3 1.07% 48 c.6709_6710insG, p.Thr2237Serfs 1 0.36% Int &#bc; Intron. Login to comment
145 p. Pro1380Leu, c.5461-10T>C, and p.Gly1961Glu, occurring in 19, 14, 23, and 17 patients, respectively. Login to comment
160 Thirty likely disease-causing variants were identified in 31 patients, including 29 previously reported disease-causing variants and the 1 novel putative disease-causing splice site variant, c.1760&#fe;1G>T.8,20,46-54 Interestingly, there was a suggestion of a higher frequency of the substitution p.Arg2030Gln in the foveal-sparing cohort (incidence ratio: 6.5% for the foveal-sparing phenotype and 1.1% for typical Stargardt), with a possible lower incidence of p.Gly1961Glu in the foveal-sparing cohort (incidence ratio: 1.6% for the foveal-sparing phenotype and 6.1% for typical Stargardt). Login to comment
164 Comparison of the Most Prevalent ABCA4 Variants` Frequency Between the Cohort With the Foveal-Sparing Stargardt Disease and the Group With the Typical Stargardt Disease (Without Evidence of Foveal Sparing) Number of Alleles and Those Frequencies Foveal-Sparing Stargardt Disease (n &#bc; 31, Total 30 Variants in 62 Alleles) Typical Stargardt Disease (n &#bc; 140, Total 72 Variants in 280 Alleles) c.2588G>C, p.Gly863Ala 4 (6.45%) 19 (6.79%) c.4139C>T, p.Pro1380Leu 2 (3.23%) 14 (5.00%) c.6079C>T, p.Leu2027Phe 4 (6.45%) 10 (3.57%) c.6089G>A, p.Arg2030Gln 4 (6.45%) 3 (1.07%) c.5461-10T>C 3 (4.84%) 23 (8.21%) c.5882G>A, p.Gly1961Glu 1 (1.61%) 17 (6.07%) in the foveal-sparing phenotype compared to the typical phenotype; there was also clear concordance in sibships with the foveal-sparing phenotype, although a possible influence of genetic/environmental modifiers cannot be excluded. Login to comment

[hide] ABCA4 gene screening by next-generation sequencing... Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570. Fujinami K, Zernant J, Chana RK, Wright GA, Tsunoda K, Ozawa Y, Tsubota K, Webster AR, Moore AT, Allikmets R, Michaelides M
ABCA4 gene screening by next-generation sequencing in a British cohort.
Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570., [PMID:23982839]

Abstract [show]
PURPOSE: We applied a recently reported next-generation sequencing (NGS) strategy for screening the ABCA4 gene in a British cohort with ABCA4-associated disease and report novel mutations. METHODS: We identified 79 patients with a clinical diagnosis of ABCA4-associated disease who had a single variant identified by the ABCA4 microarray. Comprehensive phenotypic data were obtained, and the NGS strategy was applied to identify the second allele by means of sequencing the entire coding region and adjacent intronic sequences of the ABCA4 gene. Identified variants were confirmed by Sanger sequencing and assessed for pathogenicity by in silico analysis. RESULTS: Of the 42 variants detected by prescreening with the microarray, in silico analysis suggested that 34, found in 66 subjects, were disease-causing and 8, found in 13 subjects, were benign variants. We detected 42 variants by NGS, of which 39 were classified as disease-causing. Of these 39 variants, 31 were novel, including 16 missense, 7 splice-site-altering, 4 nonsense, 1 in-frame deletion, and 3 frameshift variants. Two or more disease-causing variants were confirmed in 37 (47%) of 79 patients, one disease-causing variant in 36 (46%) subjects, and no disease-causing variant in 6 (7%) individuals. CONCLUSIONS: Application of the NGS platform for ABCA4 screening enabled detection of the second disease-associated allele in approximately half of the patients in a British cohort where one mutation had been detected with the arrayed primer extension (APEX) array. The time- and cost-efficient NGS strategy is useful in screening large cohorts, which will be increasingly valuable with the advent of ABCA4-directed therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 40 c.4926C>G p.S1642R DC c.5041_5055del GTGGTTGCCATCTGC p.V1681_C1685del DC 2 41 c.4956T>G p.Y1652* DC 1 42 c.5018&#fe;2T>C Splice site DC 1 43 c.5461-10T>C DC c.6385A>G p.S2129G PDC 2 44 c.5461-10T>C DC 1 45 c.5461-10T>C DC 1 46 c.5461-10T>C DC 1 47 c.5461-10T>C DC 1 48 c.5461-10T>C DC 1 49 c.5461-10T>C DC 1 50 c.5461-10T>C DC 1 51 c.5585-1G>A Splice site DC 1 52 c.5714&#fe;5G>A Splice site DC c.6209C>G p.T2070R DC 2 53 c.5882G>A p.G1961E DC c.2686A>G p.K896E B 1 54 c.5882G>A p.G1961E DC c.3050&#fe;1G>C Splice site DC 2 55 c.5882G>A p.G1961E DC c.3392delC/3393C>G p.A1131Gfs DC 2 56 c.5882G>A p.G1961E DC c.4539&#fe;2T>G Splice site DC 2 57 c.5882G>A p.G1961E DC c.4552A>C p.S1518R DC 2 58 c.5882G>A p.G1961E DC c.5899-2delA Splice site DC 2 59 c.5882G>A p.G1961E DC 1 60 c.6079C>T p.L2027F DC c.1906C>T p.Q636* DC 2 61 c.6079C>T p.L2027F DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 62 c.6079C>T p.L2027F DC c.3370G>T p.D1124Y DC 2 63 c.6079C>T p.L2027F DC 1 64 c.6089G>A p.R2030Q DC c.4326C>A p.N1442K DC 2 65 c.6445C>T p.R2149* DC 1 66 c.6709A>C p.T2237P DC c.5899-3_5899-2delTA Splice site DC 2 67 c.2971G>C p.G991R B c.4538A>G p.Q1513R DC 1 68 c.3602T>G p.L1201R B c.1749G>C p.K583N DC 1 69 c.3602T>G p.L1201R B c.1982_1983insG p.A662fs DC 1 70 c.3602T>G p.L1201R B c.2972G>T p.G991V DC 1 71 c.4685T>C p.I1562T B c.3289A>T p.R1097* DC 1 72 c.6320G>A p.R2107H B c.2510T>C p.L837P DC 1 73 c.6320G>A p.R2107H B c.4352&#fe;1G>A Splice site DC 1 74 c.2701A>G p.T901A B 0 75 c.3602T>G p.L1201R B 0 76 c.4283C>T p.T1428M B 0 77 c.466A>G p.I156V B 0 78 c.466A>G p.I156V B 0 79 c.4715C>T p.T1572M B 0 Putative novel variants are shown in italics. Login to comment

[hide] Distinct characteristics of inferonasal fundus aut... Invest Ophthalmol Vis Sci. 2013 Oct 17;54(10):6820-6. doi: 10.1167/iovs.13-12895. Duncker T, Lee W, Tsang SH, Greenberg JP, Zernant J, Allikmets R, Sparrow JR
Distinct characteristics of inferonasal fundus autofluorescence patterns in stargardt disease and retinitis pigmentosa.
Invest Ophthalmol Vis Sci. 2013 Oct 17;54(10):6820-6. doi: 10.1167/iovs.13-12895., [PMID:24071957]

Abstract [show]
PURPOSE: To report distinct characteristics of fundus autofluorescence (AF) patterns inferior to the optic disc in recessive Stargardt disease (STGD1) and retinitis pigmentosa (RP). METHODS: Short-wavelength (SW) and near-infrared (NIR) AF images were acquired from patients with STGD1 and RP. In SW- and NIR-AF images of STGD1 patients, gray levels (GL) on both sides of the demarcation line were measured. RESULTS: In STGD1, a demarcation line, which has been assigned to the closed optic fissure, was visible on SW-AF and NIR-AF inferior to the optic disc. In healthy subjects, this demarcation line is only visible by SW-AF. At 20 degrees inferior to the disc center, AF levels on the nasal side were 25% (+/-11%) lower than on the temporal side in SW-AF images and 18% (+/-11%) lower in NIR-AF images. For both STGD1 and RP, the inferonasal quadrant exhibited distinct SW- and NIR-AF patterns compared with other fundus areas. Disease-related AF changes, such as flecks, appeared to respect the demarcation line as a boundary. CONCLUSIONS: Disease-related AF patterns originating in RPE in STGD1 and RP appear to respect the demarcation line in the inferonasal quadrant of the fundus as a border. The visibility of the inferonasal demarcation line by NIR-AF in STGD1 but not in healthy eyes may indicate that increased levels of RPE lipofuscin modulate the melanin-related NIR-AF signal. This feature of NIR-AF images may aid in the diagnosis of STGD1 patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Summary of Demographic, Clinical, and Genetic Data Patient Condition ABCA4 Mutations Sex Age, y Eye Iris Color Race/Ethnicity BCVA Snellen (logMAR) P1 STGD1 p.P1380L, p.G1961E M 12 OS Blue White 20/100 (0.70) P2 STGD1 p.P1380L, p.G1961E F 17 OS Brown White 20/150 (0.88) P3 STGD1 p.Q1003X, p.G1961E M 25 OS Brown White 20/40 (0.30) P4 STGD1 p.C54Y F 48 OD Blue White 20/30 (0.20) P5 STGD1 p.R2077W F 52 OD Blue White 20/40 (0.30) P6 STGD1 p.[L541P;A1038V] M 13 OS Brown White 20/150 (0.88) P7 STGD1 p.T972N, p.L2027F F 14 OS Blue White 20/80 (0.60) P8 STGD1 c.4537_4538insC, p.V1686M M 49 OS Brown White 20/50 (0.40) P9 STGD1 p.R1108H, p.P1380L M 50 OS Blue White 20/200 (1.00) P10 STGD1 c.5714&#fe;5G>A F 34 OD Blue White 20/200 (1.00) P11 STGD1 p.Q636H, p.G1961E M 46 OD Brown Indian 20/400 (1.30) P12 STGD1 c.5461-10T>C M 35 OD Brown Black 20/400 (1.30) P13 STGD1 p.R1640W F 20 OD Brown Black 20/125 (0.80) P14 STGD1 p.R290W M 47 OS Brown White 20/40 (0.30) P15 STGD1 p.A1773V, p.G1961E M 18 OD Brown White 20/150 (0.88) P16 AD RP p.T17M* F 23 OD Brown Hispanic 20/30 (0.20) P17 AD RP N/A M 39 OS Brown White 20/20 (0.00) P18 AR RP N/A M 50 OS Green White 20/20 (0.00) AD, autosomal dominant; AR, autosomal recessive; BCVA, best corrected visual acuity; F, female; logMAR, logarithm of the minimum angle of resolution; M, male; N/A, not available. Login to comment

[hide] A longitudinal study of Stargardt disease: quantit... Invest Ophthalmol Vis Sci. 2013 Dec 17;54(13):8181-90. doi: 10.1167/iovs.13-12104. Fujinami K, Lois N, Mukherjee R, McBain VA, Tsunoda K, Tsubota K, Stone EM, Fitzke FW, Bunce C, Moore AT, Webster AR, Michaelides M
A longitudinal study of Stargardt disease: quantitative assessment of fundus autofluorescence, progression, and genotype correlations.
Invest Ophthalmol Vis Sci. 2013 Dec 17;54(13):8181-90. doi: 10.1167/iovs.13-12104., [PMID:24265018]

Abstract [show]
PURPOSE: We characterized subtypes of fundus autofluorescence (AF) and the progression of retinal atrophy, and correlated these findings with genotype in Stargardt disease. METHODS: Full clinical examination and AF imaging was undertaken in 68 patients with Stargardt disease. The baseline data were compared to those at follow-up. Patients were classified into three AF subtypes: type 1 had a localized low signal at the fovea surrounded by a homogeneous background, type 2 had a localized low signal at the macula surrounded by a heterogeneous background with numerous foci of abnormal signal, and type 3 had multiple low signal areas at the posterior pole with a heterogeneous background. At baseline, there were 19 patients with type 1, 41 with type 2, and 8 with type 3 disease. The areas of reduced AF signal were measured and rate of atrophy enlargement (RAE) was calculated as the difference of the atrophy size over time (mm(2)) divided by the follow-up interval (years). Molecular screening of ABCA4 was undertaken. RESULTS: The mean follow-up interval was 9.1 years. A total of 42% cases with type 1 disease progressed to type 2, and 12% with type 2 progressed to type 3. The RAE (mm(2)/y) based upon baseline AF subtypes was significantly different; 0.06 in type 1, 0.67 in type 2, and 4.37 in type 3. ABCA4 variants were identified in 57 patients. There was a significant association between AF subtype and genotype. CONCLUSIONS: The AF pattern at baseline influences the enlargement of atrophy over time and has genetic correlates. These data are likely to assist in the provision of counseling on prognosis in Stargardt disease and be valuable for future clinical trials.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
134 The median size of atrophy at baseline and the median RAE of the five patients from five families harboring the missense variant p.Gly1961Glu also was relatively small; 0.47 mm2 and 0.20 mm2 /y respectively (Supplementary Table S1). Login to comment
167 Consistent with previous reports, four of nine patients with the c.5461-10 T>C variant had a severe phenotype, with multiple large areas of atrophy.9,33,55,56 In contrast, there were three patients with the c.5461-10 T>C variant with a lower atrophy enlargement, all of whom also harbored missense variants (p.Gly1961Glu in one patient, and p.Leu2027Phe in the remaining two subjects); considered to be associated with a milder phenotype.2,10,54,56,57 The substitutions p.Leu2027Phe, and to a greater extent p.Gly1961Glu, also were associated with a milder AF phenotype in our study. Login to comment
390 Cella W, Greenstein VC, Zernant-Rajang J, et al. G1961E mutant allele in the Stargardt disease gene ABCA4 causes bull`s eye maculopathy. Login to comment

[hide] Association between genotype and phenotype in fami... Mol Vis. 2014 Jan 7;20:89-104. eCollection 2014. Kjellstrom U
Association between genotype and phenotype in families with mutations in the ABCA4 gene.
Mol Vis. 2014 Jan 7;20:89-104. eCollection 2014., [PMID:24453473]

Abstract [show]
PURPOSE: To investigate the genotype and phenotype in families with adenosine triphosphate-binding cassette, sub-family A, member 4 (ABCA4)-associated retinal degeneration. METHODS: Three families with at least one family member with known homozygous or compound heterozygote mutations in the ABCA4 gene were studied. The investigations included full field electroretinography (ff-ERG), multifocal ERG (mERG), Goldmann visual fields, optical coherence tomography (OCT), and standard ophthalmological examination. Microarray (Asper) was used for ABCA4 genotyping. RESULTS: In family 1, the proband (age 23) was homozygote for the c768 G>T mutation. She was diagnosed with cone rod dystrophy (CRD) while her aunt (age 69) was compound heterozygote for the c768 G>T and c2894 A>G mutations and had autosomal recessive retinitis pigmentosa (arRP). The father (age 61) and the mother (age 60) of the proband were asymptomatic carriers of the c768 G>T mutation. In family 2, the proband (age 25) was homozygote for the c5917del. She was diagnosed with CRD. Her father and two sisters were compound heterozygote for the c5917del and c5882 G>A mutations. The eldest sister (age 23) suffered from Stargardt disease (STGD) while the youngest sister (age 12) and their father (age 48) had no visual complaints. Anyhow, their ERG measurements indicated changes corresponding to STGD. The mother (age 42), (heterozygote for the c5917 delG mutation) and the youngest child (age 9; heterozygote for the c5882 G>A mutation) had a normal phenotype. In family 3, the proband (age 43) was compound heterozygote for c768 G>T and c3113 C>T and had been diagnosed with STGD. Her son (age 12), who was homozygote for the c768 G>T mutation, had wider scotomas with earlier onset (age 6), ff-ERG cone responses in the lower range of normality, and reduced mERG. At the moment, he is classified as having STGD but may progress to CRD. The father (age 45) was asymptomatic and heterozygote for the c768 G>T mutation. The patients with progressive disorders (CRD or arRP) had prolonged implicit times for the 30 Hz flicker ff-ERG and the mERG. All patients with two mutations in the ABCA4 gene demonstrated attenuation of retinal thickness on the OCT macular map. CONCLUSIONS: This study confirms that ABCA4 mutations lead to a spectrum of retinal degenerations ranging from STGD to CRD or arRP. At the time of diagnosis, it is not possible to predict the severity of the condition only from genotyping. Our results suggest that prolongation of implicit times for the ff-ERG and/or mERG seem to be associated with progressive conditions such as CRD and arRP. Since ABCA4 mutations are common in the general population, different family members can harbor various combinations of mutations resulting in diverse phenotype and prognosis in the same family, further emphasizing the importance of a combination of genetic and electrophysiological tests at the first visit and follow-up.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
96 Subject ABCA4 allele 1 ABCA4 allele 2 Phenotype* Nucleotide change Effect Nucleotide change Effect 1 Ia c768 G>T V256V/splice c2894 A>G N965S/missense arRP 1 Ib c768 G>T V256V/splice ৄ ৄ NVP 1 Ic c768 G>T V256V/splice ৄ ৄ NVP 1 IIa c768 G>T V256V/splice c768 G>T V256V/splice CRD 2 Ia c5917 delG V1973X/frameshift ৄ ৄ NVP 2 Ib c5917 delG V1973X/frameshift c5882 G>A G1961E/missense STGD 2 IIa c5917 delG V1973X/frameshift c5917 delG V1973X/frameshift CRD 2 IIb c5917 delG V1973X/frameshift c5882 G>A G1961E/missense STGD 2 IIc c5917 delG V1973X/frameshift c5882 G>A G1961E/missense STGD 2 II d c5882 G>A G1961E/missense ৄ ৄ NVP 3 Ia c768 G>T V256V/splice c3113 C>T A1038V/missense STGD 3 Ib c768 G>T V256V/splice ৄ ৄ NVP 3 IIa c768 G>T V256V/splice c768 G>T V256V/splice STGD Abbreviations: arRP; autosomal recessive retinitis pigmentosa, CRD; cone rod dystrophy, STGD; Stargardt disease, NVP; no visual problems *clinical presentation at last visit T able 3. Login to comment

[hide] Inner and outer retinal changes in retinal degener... Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768. Huang WC, Cideciyan AV, Roman AJ, Sumaroka A, Sheplock R, Schwartz SB, Stone EM, Jacobson SG
Inner and outer retinal changes in retinal degenerations associated with ABCA4 mutations.
Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768., [PMID:24550365]

Abstract [show]
PURPOSE: To investigate in vivo inner and outer retinal microstructure and effects of structural abnormalities on visual function in patients with retinal degeneration caused by ABCA4 mutations (ABCA4-RD). METHODS: Patients with ABCA4-RD (n = 45; age range, 9-71 years) were studied by spectral-domain optical coherence tomography (OCT) scans extending from the fovea to 30 degrees eccentricity along horizontal and vertical meridians. Thicknesses of outer and inner retinal laminae were analyzed. Serial OCT measurements available over a mean period of 4 years (range, 2-8 years) allowed examination of the progression of outer and inner retinal changes. A subset of patients had dark-adapted chromatic static threshold perimetry. RESULTS: There was a spectrum of photoreceptor layer thickness changes from localized central retinal abnormalities to extensive thinning across central and near midperipheral retina. The inner retina also showed changes. There was thickening of the inner nuclear layer (INL) that was mainly associated with regions of photoreceptor loss. Serial data documented only limited change in some patients while others showed an increase in outer nuclear layer (ONL) thinning accompanied by increased INL thickening in some regions imaged. Visual function in regions both with and without INL thickening was describable with a previously defined model based on photoreceptor quantum catch. CONCLUSIONS: Inner retinal laminar abnormalities, as in other human photoreceptor diseases, can be a feature of ABCA4-RD. These changes are likely due to the retinal remodeling that accompanies photoreceptor loss. Rod photoreceptor-mediated visual loss in retinal regionswith inner laminopathy at the stages studied did not exceed the prediction from photoreceptor loss alone.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Characteristics of the ABCA4-Related Retinal Disease Patients Patient Age at Visits, y Sex Allele 1 Allele 2 Previous Report*ߤ P1 9, 12 M E341G F608I P2 9, 15 M R681X C2150Y P28* P3ߥ 12 M N965S W821R P1ߤ P4 13, 16 M V256V T1526M P21*, P15ߤ P5 14, 20 F W1408R IVS40&#fe;5 G>A P49* P6ߥ 16 F V989A IVS28&#fe;5 G>T P17ߤ P7ߥ 16 M N965S W821R P18ߤ P8 18, 20 F Y362X IVS38-10 T>C P9ߥ 18 F V989A IVS28&#fe;5 G>T P10 18, 22 M G1961E R1129L P3ߤ P11 20 M R1640Q c.5174_5175insG P12ߥ 20 M G1961E G1961E/P68L P13 22, 25 M G863A IVS35&#fe;2 T>C P20ߤ P14 22, 24 F G1961E R152X P12*, P21ߤ P15ߥ 23 M G1961E G1961E/P68L P16 25, 27 M G1961E R152X P11* P17 26, 32 F L1940P R1129L P64* P18 27, 34 F R1925G A1038V/L541P P19 27, 29 M c.4530_4531insC R1705Q P52*, P5ߤ P20 28, 30 F G1961E A1038V/L541P P23ߤ P21 31, 35 M T1019M G1961E P34* P22ߥ 32, 37 M P1486L Deletion of exon 7 P25ߤ P23 33, 35 M G863A R1108C P29*, P6ߤ P24 34, 37 F IVS40&#fe;5 G>A V935A P32*, P7ߤ P25 34 M G1961E &#a7; P8ߤ P26 37, 43 F C54Y G863A P4* P27 39, 44 F G863A C1490Y P30*, P26ߤ P28 40 M G1961E C54Y P7*, P10ߤ P29 41 F IVS38-10 T>C E1087D P59* P30ߥ 43, 47 F G1961E V256V P23*, P11ߤ P31ߥ 47, 51 F P1486L Deletion of exon 7 P32 47 M Y245X Y245X P20* P33ߥ 48, 51 F G1961E V256V P22*, P12ߤ P34 48, 50 F c.3208_3209insTG IVS40&#fe;5 G>A P35 50, 54 M V1433I L2027F P50* P36ߥ 52, 55 F T1526M R2030Q P55*, P28ߤ P37 53, 59 F G1961E P1380L P47*, P13ߤ P38ߥ 53, 61 M L1940P IVS40&#fe;5 G>A P61* P39 58 M D600E R18W P2*, P14ߤ P40 59, 62 M E1122K G1961E P44* P41 59, 62 F R1640Q G1961E P58* P42ߥ 62 F T1526M R2030Q P54* P43ߥ 64, 68 M L1940P IVS40&#fe;5 G>A P62* P44 68 F R1108C IVS40&#fe;5 G>A P42* P45 71 F IVS38-10 T>C &#a7; Novel variants are bold and italicized. Login to comment

[hide] Quantitative fundus autofluorescence in recessive ... Invest Ophthalmol Vis Sci. 2014 May 1;55(5):2841-52. doi: 10.1167/iovs.13-13624. Burke TR, Duncker T, Woods RL, Greenberg JP, Zernant J, Tsang SH, Smith RT, Allikmets R, Sparrow JR, Delori FC
Quantitative fundus autofluorescence in recessive Stargardt disease.
Invest Ophthalmol Vis Sci. 2014 May 1;55(5):2841-52. doi: 10.1167/iovs.13-13624., [PMID:24677105]

Abstract [show]
PURPOSE: To quantify fundus autofluorescence (qAF) in patients with recessive Stargardt disease (STGD1). METHODS: A total of 42 STGD1 patients (ages: 7-52 years) with at least one confirmed disease-associated ABCA4 mutation were studied. Fundus AF images (488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference to account for variable laser power and detector sensitivity. The gray levels (GLs) of each image were calibrated to the reference, zero GL, magnification, and normative optical media density to yield qAF. Texture factor (TF) was calculated to characterize inhomogeneities in the AF image and patients were assigned to the phenotypes of Fishman I through III. RESULTS: Quantified fundus autofluorescence in 36 of 42 patients and TF in 27 of 42 patients were above normal limits for age. Young patients exhibited the relatively highest qAF, with levels up to 8-fold higher than healthy eyes. Quantified fundus autofluorescence and TF were higher in Fishman II and III than Fishman I, who had higher qAF and TF than healthy eyes. Patients carrying the G1916E mutation had lower qAF and TF than most other patients, even in the presence of a second allele associated with severe disease. CONCLUSIONS: Quantified fundus autofluorescence is an indirect approach to measuring RPE lipofuscin in vivo. We report that ABCA4 mutations cause significantly elevated qAF, consistent with previous reports indicating that increased RPE lipofuscin is a hallmark of STGD1. Even when qualitative differences in fundus AF images are not evident, qAF can elucidate phenotypic variation. Quantified fundus autofluorescence will serve to establish genotype-phenotype correlations and as an outcome measure in clinical trials.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 In some cases where no mutations were detected by the array, or in more recently recruited patients, the next generation sequencing of the entire ABCA4 open reading frame and adjacent intronic sequences was performed on the Roche 454 platform.30 The four most common mutations found in six or more patients were: G1961E (12 patients from 11 families); L541P/ A1038V (eight patients from five families); L2027F (six patients from five families); and P1380L (six patients from six families). Login to comment
78 [L541P; A1038V] 413 1.9 2 F 25 11 0.80 0.80 II II p.G863A; c.5898&#fe;1G > A 710 675 3.4 3.3 3 M 11 6 0.80 0.70 I - p.G1961E; p.P1380L 267 2.3 4.1 M 35 10 0.30 0.18 I - p.G1961E; p. Login to comment
79 [L541P; A1038V] 426 2.1 4.2 M 35 10 0.40 0.48 I I p.G1961E; p. Login to comment
80 [L541P; A1038V] 356 354 1.7 1.8 5 F 14 1 0.60 0.60 II II p.L2027F; p.T972N 737 718 2.3 2.6 6 M 45 31 1.00 0.88 I I p.G1961E; p.P1380L 623 543 4.2 4.0 7 F 42 5 0.30 CF - I p.E1252* 557 2.1 8 M 15 4 0.80 0.80 II II p.L2027F; p.R2077W 728 697 3.2 3.2 9 F 24 2 0.60 0.40 II II p.R1161S 571 647 3.8 3.5 10 M 46 15 1.30 1.30 I I p.G1961E; p.Q636H 394 351 2.3 2.4 11.1 M 12 2 1.00 1.00 II - p. Login to comment
82 [L541P; A1038V]; p.R1640W 850 4.4 12 F 27 9 1.30 1.00 - III p.P1380L; p.P1380L 577 4.8 13 F 39 8 0.12 0.00 - I c.250_251insCAAA 616 2.3 14 M 23 4 0.88 0.60 - II p.C54Y 535 5.1 15.1 M 49 17 1.00 0.88 I I p.Y1557C 646 604 4.1 3.9 15.2 M 46 7 0.10 0.48 I I p.Y1557C 456 508 2.6 2.3 16.1 F 27 14 0.88 0.88 III III p.L2027F; p.G851D 448 459 6.0 6.3 16.2 F 29 19 1.30 1.18 III III p.L2027F; p.G851D 538 569 7.4 7.9 17 M 22 18 1.30 1.00 III III p.P1380L; p.R2030Q 434 411 5.7 6.0 18 M 37 16 0.70 0.70 I I p.G1961E; p.G1961E 281 279 2.6 2.2 19 F 33 5 0.88 0.70 I I p.G1961E; c.4540-2A > G 412 420 2.5 2.8 20 F 26 12 0.60 0.60 - I p.G1961E; p. Login to comment
83 [L541P; A1038V] 398 2.4 21 F 45 31 0.88 0.88 I I p.R1640W 647 613 2.6 2.8 22 M 43 7 1.00 0.00 - III p.A1773V; p.G1591G 640 6.9 23 F 41 1 0.10 CF II II p.P1486L; p.A1598D 613 572 6.0 6.5 24 F 19 4 0.60 0.70 I - p.G1961E; p.P1380L 368 2.4 25 F 23 4 0.88 0.80 - I p. Login to comment
84 [A854T; A1038V]; p.C2150Y 512 2.3 26 F 52 1 0.70 0.48 I - p.R212C 722 2.0 27 F 52 13 1.00 1.00 - I p.A1038V; p.A848D 459 4.1 28 M 20 5 0.30 0.40 I - p.L2027F; p.R1108H 507 2.3 29 M 23 7 1.00 1.00 I I p.G1961E; p.R2030Q 334 347 2.4 2.0 30 M 44 26 0.70 0.70 - II p.P1380L; p.R1108H 453 4.7 31 F 30 22 1.00 1.30 - I p.G1961E; c.6005&#fe;1G > T 428 2.3 32 M 12 8 0.40 0.40 I - p.W821R; p.C2150Y 306 2.0 33 F 20 9 0.88 0.88 III III p.R602W; p.M1882I 650 655 2.6 2.5 34 F 47 4 0.40 0.40 I - p.G1961E; p.R1129C 400 2.5 35 F 19 3 0.70 0.48 II II p. Login to comment
135 Comparing each of the four most common mutations separately with healthy eyes, G1961E (P &#bc; 0.001); L541P/ A1038V (P < 0.001); L2027F (P < 0.001); and P1380L (P &#bc; 0.024) eyes had qAF8 that was significantly higher than in FIGURE 2. Login to comment
146 When corrected for age (P &#bc; 0.04) and sex (P &#bc; 0.004), compared with all other patients who did not have that particular mutation, the mutations L2027F (P &#bc; 0.009) and L541P/A1038V (P &#bc; 0.015) were associated with higher qAF8, while A1038V (when not in conjunction with L541P, P &#bc; 0.06); G851D (P &#bc; 0.006); and G1961E (P < 0.001) were associated with lower qAF8 in this sample. Login to comment
153 Conversely, G1961E did not have higher TF than healthy eyes (P &#bc; 0.61). Login to comment
155 When compared with all other patients who did not have that particular mutation, G851D (P < 0.001) and P1380L (P &#bc; 0.008) were associated with higher TF, while G1961E (P &#bc; 0.01) was associated with lower TF in this sample. Login to comment
180 The mutations were confirmed in six or more patients (G1961E, L541P/A1038V, L2027F, and P1380L) or in two to four patients (R1640W, Y1557C, G851D, and R2030Q). Login to comment
221 In our cohort, the mutations G851D and P1380L had high AF texture while G1961E was associated with lower AF texture. Login to comment
226 For example, based on our cross-sectional data, the mutations L2027F and L541P/A1038V seem to confer a faster rate of accumulation, whereas G1961E and G851D seems to confer a slower increase (Fig. 5). Login to comment
230 binding domain (NBD)-1 and confers severe STGD1 with relatively early onset of retina-wide disease.44-47 In our study, the L541P/A1038V complex allele was in some patients associated with high qAF8 even at young ages, while in other patients, particularly in those compound heterozygous for L541P/A1038V and G1961E, qAF8 values were relatively lower (Fig. 5). Login to comment
232 Thus it is likely that in these cases, the lower qAF values do not reflect a decrease in qAF after an earlier rapid elevation, but rather a slower increase in qAF8 due to the presence of the G1961E allele (L541P/A1038V &#fe; G1961E). Login to comment
234 The L2027F mutation causes an amino acid change in NBD-2 and confers reduced ATP binding.11,48 P1380L is also a severe mutation and is suggested to cause either impaired ATP binding11 or altered transport of ABCA4 protein across the outer segment membrane.46 When P1380L is carried in compound heterozygosity with R2077W, autosomal recessive cone-rod dystrophy results.49 When harbored as a homozygous mutation or as a compound heterozygous mutation with R2030Q or IVS40 &#fe; 5G>A, the mutation is associated with central atrophy and peripapillary disease, the latter being an uncommon phenotype.50 The missense mutation G1961E in exon 42 of the ABCA4 gene is the most common ABCA4 mutation.51 This sequence change results in a glycine to glutamate substitution within the NBD-2 of the protein.11,45 The G1961E allele always cosegregates with the disease in families.45,52 Nevertheless, the G1961E mutation in ABCA4 is perplexing since in an in vitro assay this mutation conferred a markedly aberrant decrease in all-trans-retinal stimulated ABCA4 ATPase activity,11 yet it is considered to be associated with mild disease. Login to comment
235 For instance, in Fishman`s28 original classification of 29 STGD1 patients into three clinical phenotypes, patients with the G1961E variation on one ABCA4 allele were assigned to the mildest (Fishman I) of the three. Login to comment
237 The G1961E variant was reported to confer a tendency toward later disease onset51 (though not in our sample), and relatively long delay before retina-wide changes.46 Also characteristic of this mutation is an absence of a dark choroid.28 A dark choroid in fluorescein angiography is generally attributed to high content and absorption by lipofuscin in the RPE, a feature that also confers a vermillion fundus appearance.19 Thus, absence of dark choroid is considered to reflect less pronounced lipofuscin accumulation; this interpretation is consistent with our finding that in the presence of the G1961E mutation, qAF levels outside the parafovea are lower when compared with other ABCA4 mutations. Login to comment
238 In fundus AF images, the G1961E allele in both the homozygous and compound heterozygous state is commonly associated with bull`s eye maculopathy.53 Taken together, the clinical features of the disease associated with G1961E indicate a phenotype chiefly confined to cone-rich fovea and parafovea (central macula). Login to comment
243 Perhaps abnormal accretion of bisretinoid lipofuscin in photoreceptor inner and outer segments in the presence of the G1961E mutation is a feature deserving future investigation. Login to comment
429 Burke TR, Fishman GA, Zernant J, et al. Retinal phenotypes in patients homozygous for the G1961E mutation in the ABCA4 gene. Login to comment
435 Cella W, Greenstein VC, Zernant-Rajang J, et al. G1961E mutant allele in the Stargardt disease gene ABCA4 causes bull`s eye maculopathy. Login to comment

[hide] Molecular diagnostic testing by eyeGENE: analysis ... Invest Ophthalmol Vis Sci. 2014 Jul 31;55(9):5510-21. doi: 10.1167/iovs.14-14359. Alapati A, Goetz K, Suk J, Navani M, Al-Tarouti A, Jayasundera T, Tumminia SJ, Lee P, Ayyagari R
Molecular diagnostic testing by eyeGENE: analysis of patients with hereditary retinal dystrophy phenotypes involving central vision loss.
Invest Ophthalmol Vis Sci. 2014 Jul 31;55(9):5510-21. doi: 10.1167/iovs.14-14359., [PMID:25082885]

Abstract [show]
PURPOSE: To analyze the genetic test results of probands referred to eyeGENE with a diagnosis of hereditary maculopathy. METHODS: Patients with Best macular dystrophy (BMD), Doyne honeycomb retinal dystrophy (DHRD), Sorsby fundus dystrophy (SFD), or late-onset retinal degeneration (LORD) were screened for mutations in BEST1, EFEMP1, TIMP3, and CTRP5, respectively. Patients with pattern dystrophy (PD) were screened for mutations in PRPH2, BEST1, ELOVL4, CTRP5, and ABCA4; patients with cone-rod dystrophy (CRD) were screened for mutations in CRX, ABCA4, PRPH2, ELOVL4, and the c.2513G>A p.Arg838His variant in GUCY2D. Mutation analysis was performed by dideoxy sequencing. Impact of novel variants was evaluated using the computational tool PolyPhen. RESULTS: Among the 213 unrelated patients, 38 had BMD, 26 DHRD, 74 PD, 8 SFD, 6 LORD, and 54 CRD; six had both PD and BMD, and one had no specific clinical diagnosis. BEST1 variants were identified in 25 BMD patients, five with novel variants of unknown significance (VUS). Among the five patients with VUS, one was diagnosed with both BMD and PD. A novel EFEMP1 variant was identified in one DHRD patient. TIMP3 novel variants were found in two SFD patients, PRPH2 variants in 14 PD patients, ABCA4 variants in four PD patients, and p.Arg838His GUCY2D mutation in six patients diagnosed with dominant CRD; one patient additionally had a CRX VUS. ABCA4 mutations were identified in 15 patients with recessive CRD. CONCLUSIONS: Of the 213 samples, 55 patients (26%) had known causative mutations, and 13 (6%) patients had a VUS that was possibly pathogenic. Overall, selective screening for mutations in BEST1, PRPH2, and ABCA4 would likely yield the highest success rate in identifying the genetic basis for macular dystrophy phenotypes. Because of the overlap in phenotypes between BMD and PD, it would be beneficial to screen genes associated with both diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Mutations and Unknown Variants Detected in Patients With Central Vision Loss Patient Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Molecular Diagnosis Late-onset retinal degeneration NA CTRP5 NA NA NA NA NA NA Sorsby fundus dystrophy Patient 1 TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 Positive Patient 2 TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 Positive Patient 3 TIMP3 5 c.610A>T p.Ser204Cys Het Mut Positive Doyne honeycomb dystrophy Patient 1 EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut Positive Patient 2 EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut Positive Patient 3 EFEMP1 IVS10 c.IVS10-14C>T None Het vAR/us NA NA Unconfirmed Best macular dystrophy Patient 1 BEST1 2 c.28G>A p.Ala10Thr Het Mut Positive Patient 2 BEST1 2 c.47C>T p.Ser16Phe Het Mut Positive Patient 3 BEST1 2 c.72G>T p.Trp24Cys Het Mut Positive Patient 4 BEST1 3 c.240C>A p.Phe80Leu Het Mut Positive Patient 5 BEST1 3 c.240C>A p.Phe80Leu Het Mut Positive Patient 6 BEST1 4 c.248G>C p.Gly83Ala Het vAR/us Probably damaging 1 Positive Patient 7 BEST1 4 c.277T>C p.Trp93Arg Het vAR/us Probably damaging 1 Positive Patient 8 BEST1 4 c.279G>C p.Trp93Cys Het Mut Positive Patient 9 BEST1 6 c.652C>T p.Arg218Cys Het Mut Positive Patient 10 BEST1 6 c.652C>T p.Arg218Cys Het Mut Positive Patient 11 BEST1 6 c.680A>G p.Tyr227Cys Het Mut Positive Patient 12 BEST1 6 c.741G>A p.Arg218His Het Mut Positive Patient 13 BEST1 6 c.741G>A p.Arg218His Het Mut Positive Patient 14 BEST1 7 c.727G>A p.Ala243Thr Het Mut Positive Patient 15 BEST1 7 c.727G>A p.Ala243Thr Het Mut Positive Patient 16 BEST1 7 c.728C>T p.Ala243Val Het Mut Positive Patient 17 BEST1 7 c.728C>T p.Ala243Val Het Mut Positive Patient 18 BEST1 8 c.880C>T p.Leu294Phe Het vAR/us Probably damaging 1 Positive Patient 19 BEST1 8 c.887A>G p.Asn296Ser Het Mut Positive Patient 20 BEST1 8 c.903T>G p.Asp301Glu Het Mut Positive Patient 21 BEST1 8 c.903T>G p.Asp301Glu Het Mut Positive Patient 22 BEST1 8 c.910G>A p.Asp304Asn Het Mut Positive Patient 23 BEST1 8 c.925T>C p.Trp309Arg Het vAR/us Probably damaging 1 Positive Patient 24 BEST1 8 c.929T>C p.Ile310Thr Het Mut Positive Patient 25, case 3 BEST1 4 c.250T>G p.Phe84Val Het vAR/us Probably damaging 1 Positive Pattern dystrophy Patient 1 ABCA4 6 c.634C>T p.Arg212Cys Het Mut Positive ABCA4 30 c.4469G>A p.Cys1490Tyr Het Mut Patient 2 ABCA4 17 c.2588G>C p.Gly863Ala Het Mut Unconfirmed Patient 3 ABCA4 IVS26 c.3862&#fe;3A>G Abnormal splicing Het vAR/us Unconfirmed Patient 4 PRPH2 1 c.271T>A p.Tyr91Asn Het vAR/us Probably damaging 0.909 Positive PRPH2 1 c.310-313del(AT) p.Ile104Val Het Mut Patient 5, case 6 PRPH2 1 c.422A>G p.Tyr141Cys Het Mut Positive Patient 6 PRPH2 1 c.422A>G p.Tyr141Cys Het Mut Positive Patient 7 PRPH2 1 c.515G>A p.Arg172Gln Het Mut Positive Patient 8 PRPH2 2 c.583C>T p.Arg195Stop Het Mut Positive Patient 9 PRPH2 2 c.629C>G p.Pro210Arg Het Mut Positive Patient 10 PRPH2 2 c.635G>C p.Ser212Thr Het Mut Positive Patient 11 PRPH2 2 c.683C>T p.Thr228Ile Het Mut Positive Patient 12 PRPH2 2 c.708C>G p.Tyr236Stop Het Mut Positive Patient 13, case 4 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive TABLE 2. Continued Patient Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Molecular Diagnosis Patient 14 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 15 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 16 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 17, case 2 ABCA4 IVS38 c.5461-10T>C None Het Mut Unconfirmed Patient 18 PRPH2 2 c.584G>A p.Arg195Gln Het vAR/us Probably damaging 1 Positive Cone-rod dystrophy Patient 1, dominant GUCY2D 13 c.2512C>T p.Arg838Cys Het Mut Positive Patient 2, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 3, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 4, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 5, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive CRX 3 c.607T>C p.Ser213Pro Het vAR/us Probably damaging 0.999 Patient 6, recessive ABCA4 2 c.156T>G p.His52Gln Het vAR/us Probably damaging 0.998 Positive ABCA4 3 c.161G>A p.Cys54Tyr Het Mut ABCA4 28 c.4169T>C p.Leu1390Pro Het Mut Patient 7, recessive ABCA4 16 c.2385C>T p.Ser795Arg Het vAR/us Probably damaging 0.99 Positive ABCA4 IVS40 c.5714&#fe;5G>A Splice Het Mut Patient 8, recessive ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut Positive ABCA4 45 c.6221G>T p.Gly2074Val Het vAR/us Probably damaging 1 Patient 9, recessive ABCA4 IVS42 c.5898&#fe;1G<A Splice Het Mut Positive ABCA4 IVS42 c.5899-2delA Splice Het Mut Patient 10, recessive ABCA4 5 c.559C>T p.Arg187Cys Het Mut Positive ABCA4 40 c.5645T>C p.Met1882Thr Het Mut Patient 11, recessive ABCA4 6 c.768G>T p.Val256Val (abnlspl) Het Mut Positive ABCA4 31 c.4577C>T p.Thr1526Met Het Mut Patient 12, recessive ABCA4 12 c.1622T>C p.Leu541Pro Het Mut Positive ABCA4 21 c.3113C>T p.Ala1038Val Het Mut ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut ABCA4 22 c.3322C>T p.Arg1108Cys Het Mut Patient 13, recessive ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut Positive ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut Patient 14, recessive ABCA4 13 c.1927G>A p.Val643Met Het Mut Positive ABCA4 24 c.3602T>G p.Leu1201Arg Het Mut ABCA4 36 c.5186T>C p.Leu1729Pro Het Mut Patient 15, recessive ABCA4 23 c.3364G>A p.Glu1122Lys Het Mut Positive ABCA4 48 c.6529G>A p.Asp2177Asn Het Mut Patient 16, recessive ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut Positive ABCA4 28 c.4222T>C p.Trp1408Arg Het Mut Patient 17, recessive ABCA4 11 c.1532G>A p.Arg511His Het Mut Unconfirmed Patient 18, recessive ABCA4 27 c.3899G>A p.Arg1300Gln Het vAR/us Benign 0.143 Unconfirmed Patient 19, recessive ABCA4 13 c.1933G>A p.Asp645Asn Het Mut Unconfirmed Patient 20, recessive ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut Unconfirmed Patient 21, recessive ABCA4 IVS7 c.859-9T>C Unknown Hom vAR/us NA NA Unconfirmed Molecular Diagnostic Testing by eyeGENE IOVS j September 2014 j Vol. 55 j No. 9 j were screened for the p.Arg838His mutation in GUCY2D, and mutations in the CRX, ELOVL4, PRPH2, and/or ABCA4 genes. Login to comment
66 Mutations in PRPH2 (peripherin TABLE 2. Continued Patient Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Molecular Diagnosis Patient 22 ABCA4 42 c.5882G>A p.Gly1961Glu Hom Mut Positive Patient 23, recessive ABCA4 43 c.5917delG Deletion Hom Mut Positive Patient 24, recessive ABCA4 32 c.4661A>G p.Glu1554Gly Het vAR/us Benign 0.326 Unconfirmed ABCA4 30 c.4383G>A p.Trp1461Stop Het Mut Patient 25, recessive ABCA4 IVS38 c.5461-10T>C None Het Mut Positive ABCA4 22 c.3259G>A p.Glu1087Lys Het Mut Patient 26, recessive ABCA4 IVS38 c.5461-10T>C None Het Mut Positive ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut Patient 27, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 28, recessive, case 5 PRPH2 1 c.514C>T p.Arg172Trp Het Mut Positive No specific clinical diagnosis Patient 1, case 1 ABCA4 35 c.4919G>A p.Arg1640Gln Het Mut Positive ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut ABCA4 IVS42 c.5898-11G>A NA Het vAR/us NA NA ABCA4 IVS48 c.6729&#fe;21C>T NA Het vAR/us NA NA Het, heterozygous; Mut, mutation; vAR, variant; VUS, variant of unknown significance. Login to comment
116 Mutations or Unknown Variants Detected in Patients With Central Vision Loss Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Frequency* Variant ID Late-onset retinal degeneration CTRP5 NA NA NA NA NA NA NA NA NA Sorsby fundus dystrophy TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 2 TIMP3 5 c.610A>T p.Ser204Cys Het Mut 1 CM941325/ rs137853298 Doyne honeycomb dystrophy EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut 2 CM990504 EFEMP1 IVS10 c.IVS10-14C>T None Het vAR/us NA NA 1 Best macular dystrophy BEST1 2 c.28G>A p.Ala10Thr Het Mut 1 CM982017 BEST1 2 c.47C>T p.Ser16Phe Het Mut 1 CM010520 BEST1 2 c.72G>T p.Trp24Cys Het Mut 1 CM982018 BEST1 3 c.240C>A p.Phe80Leu Het Mut 2 CM004423 BEST1 4 c.248G>C p.Gly83Ala Het vAR/us Probably damaging 1 1 BEST1 4 c.277T>C p.Trp93Arg Het vAR/us Probably damaging 1 1 BEST1 4 c.279G>C p.Trp93Cys Het Mut 1 rs28940273/ CM982021 BEST1 6 c.652C>T p.Arg218Cys Het Mut 2 CM982023 BEST1 6 c.680A>G p.Tyr227Cys Het Mut 1 CM982024 BEST1 6 c.741G>A p.Arg218His Het Mut 2 CM003486 BEST1 7 c.727G>A p.Ala243Thr Het Mut 2 CM004434 BEST1 7 c.728C>T p.Ala243Val Het Mut 2 rs28940570/ CM00841 BEST1 8 c.880C>T p.Leu294Phe Het vAR/us Probably damaging 1 1 BEST1 8 c.887A>G p.Asn296Ser Het Mut 1 CM010524 BEST1 8 c.903T>G p.Asp301Glu Het Mut 2 CM991243 BEST1 8 c.910G>A p.Asp304Asn Het Mut 1 CM024219 BEST1 8 c.925T>C p.Trp309Arg Het vAR/us Probably damaging 1 1 BEST1 8 c.929T>C p.Ile310Thr Het Mut 1 CM000843 BEST1 4 c.250T>G p.Phe84Val Het vAR/us Probably damaging 1 1 Pattern dystrophy ABCA4 6 c.634C>T p.Arg212Cys Het Mut 1 rs61750200 ABCA4 17 c.2588G>C p.Gly863Ala Het Mut 1 CM970003/ rs76157638 ABCA4 IVS26 c.3862&#fe;3A>G Abnormal splicing Het vAR/us 1 NA ABCA4 30 c.4469G>A p.Cys1490Tyr Het Mut 1 CM990056/ rs61751402 ABCA4 IVS38 c.5461-10T>C None Het Mut 1 CS057513 PRPH2 1 c.271T>A p.Tyr91Asn Het vAR/us Probably damaging .909 1 PRPH2 1 c.310-313del(AT) p.Ile104Val Het Mut 1 NA/Deletion PRPH2 1 c.422A>G p.Tyr141Cys Het Mut 2 CM010125/ rs61755781 PRPH2 1 c.515G>A p.Arg172Gln Het Mut 1 CM930637/ rs61755792 PRPH2 2 c.583C>T p.Arg195Stop Het Mut 1 CM032999 PRPH2 2 c.629C>G p.Pro210Arg Het Mut 1 CM941210 PRPH2 2 c.635G>C p.Ser212Thr Het Mut 1 CM971289/ rs61755801 PRPH2 2 c.683C>T p.Thr228Ile Het Mut 1 TMP_ESP_6_ 42672248 PRPH2 2 c.708C>G p.Tyr236Stop Het Mut 1 rs61755813 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut 4 CS010139 PRPH2 2 c.584G>A p.Arg195Gln Het vAR/us Probably damaging 1 1 TABLE 3. Continued Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Frequency* Variant ID Cone-rod dystrophy ABCA4 2 c.156T>G p.His52Gln Het vAR/us Probably damaging 0.998 1 ABCA4 3 c.161G>A p.Cys54Tyr Het Mut 1 CM990012/ rs150774447 ABCA4 28 c.4169T>C p.Leu1390Pro Het Mut 1 CM014810/ rs61752430 ABCA4 16 c.2385C>T p.Ser795Arg Het vAR/us Probably damaging 0.99 1 ABCA4 IVS40 c.5714&#fe;5G>A Splice Het Mut 1 CS982057 ABCA4 27 c.3899G>A p.Arg1300Gln Het vAR/us Benign 0.143 1 ABCA4 32 c.4661A>G p.Glu1554Gly Het vAR/us Benign 0.326 1 ABCA4 30 c.4383G>A p.Trp1461Stop Het Mut 1 Stop/NA ABCA4 IVS38 c.5461-10T>C None Het Mut NA NA 2 CS057513 ABCA4 22 c.3259G>A p.Glu1087Lys Het Mut 1 CM970008/ rs61751398 ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut 2 CM970016/ rs1800553 ABCA4 45 c.6221G>T p.Gly2074Val Het vAR/us Probably damaging 1 1 ABCA4 IVS42 c.5898&#fe;1G<A Splice Het Mut 1 CS011524 ABCA4 IVS42 c.5899-2delA Splice Het Mut 1 rs3112831 CRX 3 c.607T>C p.Ser213Pro Het vAR/us Probably damaging 0.999 1 ABCA4 5 c.559C>T p.Arg187Cys Het Mut 1 COSM913472 ABCA4 40 c.5645T>C p.Met1882Thr Het Mut 1 rs4147830 ABCA4 6 c.768G>T p.Val256Val (abnlspl) Het Mut 1 CM990057/ rs61750152 ABCA4 31 c.4577C>T p.Thr1526Met Het Mut 1 rs62645944 ABCA4 11 c.1532G>A p.Arg511His Het Mut 1 rs140482171 ABCA4 12 c.1622T>C p.Leu541Pro Het Mut 1 CM990022/ rs61751392 ABCA4 21 c.3113C>T p.Ala1038Val Het Mut 1 CM970006/ rs61751374 ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut 2 CM990022/ rs61751392 ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut 2 CM970006/ rs61751374 ABCA4 22 c.3322C>T p.Arg1108Cys Het Mut 1 CM990039/ rs61750120 ABCA4 13 c.1927G>A p.Val643Met Het Mut 1 CM014293/ rs61749417/ rs143548435 ABCA4 24 c.3602T>G p.Leu1201Arg Het Mut 1 CM990042/ rs61750126 ABCA4 36 c.5186T>C p.Leu1729Pro Het Mut 1 CM990062/ rs61750567 ABCA4 13 c.1933G>A p.Asp645Asn Het Mut 1 rs617494181933 ABCA4 23 c.3364G>A p.Glu1122Lys Het Mut 1 CM990041 ABCA4 48 c.6529G>A p.Asp2177Asn Het Mut 1 CM970023/ rs1800555 ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut 2 CM983728/ rs61751404 ABCA4 28 c.4222T>C p.Trp1408Arg Het Mut 1 CM990048/ rs61750135 GUCY2D 13 c.2512C>T p.Arg838Cys Het Mut 1 rs61750172 GUCY2D 13 c.2513G>A p.Arg838His Het Mut 5 CM012606/ rs61750173 ABCA4 IVS7 c.859-9T>C Unknown Hom vAR/us NA NA 1 ABCA4 42 c.5882G>A p.Gly1961Glu Hom Mut 1 CM970016/ rs1800553 ABCA4 43 c.5917delG Deletion Hom Mut 1 RISN_ABCR: c.5917delG Molecular Diagnostic Testing by eyeGENE IOVS j September 2014 j Vol. 55 j No. 9 j Six patients with late-onset retinal pathology and drusen had well-characterized clinical data. Login to comment
117 Case 1 had two known mutations, c.4919 G>A (p.Arg1640Gln) and c.5882G>A (p.Gly1961Glu), in exons 35 and 42 of ABCA4. Login to comment
154 MacDonald IM, Hebert M, Yau RJ, et al. Effect of docosahexaenoic acid supplementation on retinal function in a patient TABLE 3. Continued Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Frequency* Variant ID PRPH2 1 c.514C>T p.Arg172Trp Het Mut 1 CM930639 No specific clinical diagnosis ABCA4 35 c.4919G>A p.Arg1640Gln Het Mut 1 CM003577 ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut 1 CM970016/ rs1800553 ABCA4 IVS42 c.5898-11G>A NA Het vAR/us NA NA 1 ABCA4 IVS48 c.6729&#fe;21C>T NA Het vAR/us NA NA 1 * Frequency signifies number of times a mutation is observed within the data set. Login to comment

[hide] Mutation screening of retinal dystrophy patients b... PLoS One. 2014 Aug 18;9(8):e104281. doi: 10.1371/journal.pone.0104281. eCollection 2014. Watson CM, El-Asrag M, Parry DA, Morgan JE, Logan CV, Carr IM, Sheridan E, Charlton R, Johnson CA, Taylor G, Toomes C, McKibbin M, Inglehearn CF, Ali M
Mutation screening of retinal dystrophy patients by targeted capture from tagged pooled DNAs and next generation sequencing.
PLoS One. 2014 Aug 18;9(8):e104281. doi: 10.1371/journal.pone.0104281. eCollection 2014., [PMID:25133751]

Abstract [show]
PURPOSE: Retinal dystrophies are genetically heterogeneous, resulting from mutations in over 200 genes. Prior to the development of massively parallel sequencing, comprehensive genetic screening was unobtainable for most patients. Identifying the causative genetic mutation facilitates genetic counselling, carrier testing and prenatal/pre-implantation diagnosis, and often leads to a clearer prognosis. In addition, in a proportion of cases, when the mutation is known treatment can be optimised and patients are eligible for enrolment into clinical trials for gene-specific therapies. METHODS: Patient genomic DNA was sheared, tagged and pooled in batches of four samples, prior to targeted capture and next generation sequencing. The enrichment reagent was designed against genes listed on the RetNet database (July 2010). Sequence data were aligned to the human genome and variants were filtered to identify potential pathogenic mutations. These were confirmed by Sanger sequencing. RESULTS: Molecular analysis of 20 DNAs from retinal dystrophy patients identified likely pathogenic mutations in 12 cases, many of them known and/or confirmed by segregation. These included previously described mutations in ABCA4 (c.6088C>T,p.R2030*; c.5882G>A,p.G1961E), BBS2 (c.1895G>C,p.R632P), GUCY2D (c.2512C>T,p.R838C), PROM1 (c.1117C>T,p.R373C), RDH12 (c.601T>C,p.C201R; c.506G>A,p.R169Q), RPGRIP1 (c.3565C>T,p.R1189*) and SPATA7 (c.253C>T,p.R85*) and new mutations in ABCA4 (c.3328+1G>C), CRB1 (c.2832_2842+23del), RP2 (c.884-1G>T) and USH2A (c.12874A>G,p.N4292D). CONCLUSIONS: Tagging and pooling DNA prior to targeted capture of known retinal dystrophy genes identified mutations in 60% of cases. This relatively high success rate may reflect enrichment for consanguineous cases in the local Yorkshire population, and the use of multiplex families. Nevertheless this is a promising high throughput approach to retinal dystrophy diagnostics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 T,p.R2030*; c.5882G.A,p.G1961E), BBS2 (c.1895G.C,p.R632P), GUCY2D (c.2512C.T,p.R838C), PROM1 (c.1117C.T,p.R373C), RDH12 (c.601T.C,p.C201R; c.506G.A,p.R169Q), RPGRIP1 (c.3565C.T,p.R1189*) and SPATA7 (c.253C.T,p.R85*) and new mutations in ABCA4 (c.3328+1G.C), CRB1 (c.2832_2842+23del), RP2 (c.884-1G.T) and USH2A (c.12874A.G,p.N4292D). Login to comment
151 doi:10.1371/journal.pone.0104281.t002 previously reported missense variant (c.5882G.A, p.G1961E) [30,31] as well as the heterozygous splicing variant (c.3328+1G. Login to comment
162 To summarise, the mutations consisted of previously reported mutations of clinical significance in ABCA4 (c.6088C.T, p.R2030* [19] and c.5882G.A, p.G1961E [30,31]), RDH12 (c.601T.C, p.C201R [21] and c.506G.A, p.R169Q [29]), PROM1 (c.1117C.T, p.R373C [22,23]), GUCY2D (c.2512C. Login to comment
185 NA NA NA NA Het 94473807 ABCA4 missense NM_000350.2:c.5882G.A p.Gly1961Glu 22 C65 Deleterious bad Het [30,31] MA19 RCD Rec. None confirmed MA20 RP Rec. None confirmed The ID and diagnosis of the cases studied as well as the chromosome and position of the mutation according to the human genome assembly hg19, gene, coding effect, cDNA and protein nomenclature, BLOSUM62, AGVGD class, SIFT prediction, MAPP prediction, zygosity and whether the mutation has been previously implicated into causing disease are shown. Login to comment

[hide] The external limiting membrane in early-onset Star... Invest Ophthalmol Vis Sci. 2014 Aug 19;55(10):6139-49. doi: 10.1167/iovs.14-15126. Lee W, Noupuu K, Oll M, Duncker T, Burke T, Zernant J, Bearelly S, Tsang SH, Sparrow JR, Allikmets R
The external limiting membrane in early-onset Stargardt disease.
Invest Ophthalmol Vis Sci. 2014 Aug 19;55(10):6139-49. doi: 10.1167/iovs.14-15126., [PMID:25139735]

Abstract [show]
PURPOSE: To describe pathologic changes of the external limiting membrane (ELM) in young patients with early-onset Stargardt (STGD1) disease. METHODS: Twenty-six STGD1 patients aged younger than 20 years with confirmed disease-causing adenosine triphosphate-binding cassette, subfamily A, member 4 (ABCA4) alleles and 30 age-matched unaffected individuals were studied. Spectral-domain optical coherence tomography (SD-OCT), fundus autofluorescence (AF), and color fundus photography (CFP) images, as well as full-field electroretinograms were obtained and analyzed for one to four visits in each patient. RESULTS: The ELM in all patients exhibited a distinct thickening that was not observed in unaffected individuals. In addition, accumulations of reflective deposits were noted in the outer nuclear layer in every patient. Four patients exhibited a concave protuberance or bulging of a thickened and hyperreflective ELM band within the fovea containing preserved photoreceptors. Longitudinal SD-OCT data in several patients revealed the persistence of this ELM abnormality over a period of time (1-4 years). Furthermore, the edges of the inner segment ellipsoid band appeared to recede earlier than the ELM band in active lesions. CONCLUSIONS: Structural changes seen in the ELM of this cohort may reflect a gliotic response to cellular stress at the photoreceptor level in early-onset STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 [L541P;A1038V] p.L2027F P8 10 Caucasian 20/40 (0.30) 20/80 (0.60) 1 1 None-early 1 p.R1108C p.Q1412* P9 14 Caucasian 20/100 (0.70) 20/100 (0.70) 2 1 Early-late 0.5 p.T972N p.L2027F P10 9 Caucasian 20/150 (0.88) 20/400 (1.30) 2 1 Late ND c.5312&#fe;1G>A p.R2030* P11 15 Caucasian 20/200 (1.00) 20/200 (1.00) 2 2 Mid-late 3 p.L2027F p.R2077W P12 5 Caucasian 20/30 (0.18) 20/40 (0.30) 1 n/a ND c.5018&#fe;2T>C p.G1961E P13 10 Caucasian 20/200 (1.00) 20/200 (1.00) 2 2 Mid 4 p. Login to comment
91 [L541P;A1038V] p.R1640W P15 16 Caucasian 20/200 (1.00) 20/200 (1.00) 2 n/a Mid-late 8 p.K346T p.T1117I P16 9 Caucasian 20/150 (0.88) 20/150 (0.88) 1 n/a 1 p.P1380L p.G1961E P17 18 Caucasian 20/40 (0.30) 20/150 (0.88) 1 1 Early 3 p.P1380L p.G1961E P18ߥ 18 Caucasian 20/150 (0.88) 20/150 (0.88) 2 1 Late 4 p. Login to comment
93 [W1408R;R1640W] P20 18 African American 20/125 (0.80) 20/50 (0.40) 2 2 Mid 5 p.R1640W ND P21 12 Caucasian 20/50 (0.40) 20/50 (0.40) 1 1 6 p.W821R p.C2150Y P22 17 Indian 20/40 (0.30) 20/100 (0.70) 1 n/a Mid 3 p.G1961E c.6729&#fe;4_&#fe;18del P23 10 Indian 20/400 (1.30) 20/400 (1.30) 2 2 Early 3 c.885delC p.R537C P24 19 Caucasian 20/20 (0.00) 20/20 (0.00) 1 n/a ND p.G863A c.5898&#fe;1G>A P25 16 Middle Eastern 20/80 (0.60) 20/100 (0.70) 1 1 4 p.A1773V p.G1961E P26 17 Caucasian 20/150 (0.88) 20/200 (1.00) 1 1 2 p.K1547* p.R2030Q ND, not determined; n/a, not available. Login to comment

[hide] Quantitative fundus autofluorescence distinguishes... Ophthalmology. 2015 Feb;122(2):345-55. doi: 10.1016/j.ophtha.2014.08.017. Epub 2014 Oct 3. Duncker T, Tsang SH, Lee W, Zernant J, Allikmets R, Delori FC, Sparrow JR
Quantitative fundus autofluorescence distinguishes ABCA4-associated and non-ABCA4-associated bull's-eye maculopathy.
Ophthalmology. 2015 Feb;122(2):345-55. doi: 10.1016/j.ophtha.2014.08.017. Epub 2014 Oct 3., [PMID:25283059]

Abstract [show]
PURPOSE: Quantitative fundus autofluorescence (qAF) and spectral-domain optical coherence tomography (SD OCT) were performed in patients with bull's-eye maculopathy (BEM) to identify phenotypic markers that can aid in the differentiation of ABCA4-associated and non-ABCA4-associated disease. DESIGN: Prospective cross-sectional study at an academic referral center. SUBJECTS: Thirty-seven BEM patients (age range, 8-60 years) were studied. All patients exhibited a localized macular lesion exhibiting a smooth contour and qualitatively normal-appearing surrounding retina without flecks. Control values consisted of previously published data from 277 healthy subjects (374 eyes; age range, 5-60 years) without a family history of retinal dystrophy. METHODS: Autofluorescence (AF) images (30 degrees , 488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference to account for variable laser power and detector sensitivity. The grey levels (GLs) from 8 circularly arranged segments positioned at an eccentricity of approximately 7 degrees to 9 degrees in each image were calibrated to the reference (0 GL), magnification, and normative optical media density to yield qAF. In addition, horizontal SD OCT images through the fovea were obtained. All patients were screened for ABCA4 mutations using the ABCR600 microarray, next-generation sequencing, or both. MAIN OUTCOME MEASURES: Quantitative AF, correlations between AF and SD OCT, and genotyping for ABCA4 variants. RESULTS: ABCA4 mutations were identified in 22 patients, who tended to be younger (mean age, 21.9+/-8.3 years) than patients without ABCA4 mutations (mean age, 42.1+/-14.9 years). Whereas phenotypic differences were not obvious on the basis of qualitative fundus AF and SD OCT imaging, with qAF, the 2 groups of patients were clearly distinguishable. In the ABCA4-positive group, 37 of 41 eyes (19 of 22 patients) had qAF8 of more than the 95% confidence interval for age. Conversely, in the ABCA4-negative group, 22 of 26 eyes (13 of 15 patients) had qAF8 within the normal range. CONCLUSIONS: The qAF method can differentiate between ABCA4-associated and non-ABCA4-associated BEM and may guide clinical diagnosis and genetic testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Sex Age (yrs) Race or Ethnicity Best-Corrected Visual Acuity (Logarithm of the Minimum Angle of Resolution Units) Genetic Data Average of Quantitative Fundus Autofluorescence Values of the 8 Segments ABCA4 Mutations Right Eye Left Eye Allele 1 Allele 2 Right Eye Left Eye 1 M 36 White 0.70 0.70 p.G1961E p.G1961E 282 279 2 F 46 White 0.40 0.40y p.G1961E p.R1129C 391 3 M 17 Asian Indian 0.70 0.88 p.G1961E c.6729&#fe;4_&#fe;18del 340 363 4 M 17 White 0.88 0.88 p.G1961E p.A1773V 340 366 5 M 21 White 0.88 0.88 p.G1961E p.W15* 341 325 6 F 22 White 0.70 0.48 p.G1961E p.G863A 361 351 7 F 20 White 0.70z 0.88z p.G1961E p.L541P 317 8 M 12 White 0.80 0.70 p.G1961E p.P1380L 251 242 9 F 21 White 0.88 0.88 p.G1961E p.R212C 407 439 10 F 26 White 0.40z 0.70z p.G1961E c.5196&#fe;1056A/G 379 344 11 F 24 White 0.88z 0.88z p.G1961E p.C2150R 405 396 12 F 24 White 0.30z 0.18z p.G1961E p.N96D 513 549 13 F 20 White 0.30 0.40 p.G1961E p.N96D 397 355 14 M 25 White 0.00y 0.30 p.G1961E p.Q1003* 322 328 15 M 8.2 White 0.88 0.88 p. Login to comment
82 One patient was homozygous and 13 patients were compound heterozygous for the p.G1961E variant. Login to comment
103 younger than 30 years, we found that mean qAF8 was 36672 qAF units for patients carrying the p.G1961E mutation and 41689 for patients carrying variants other than p.G1961E, but the difference was not significant (P &#bc; 0.2, 2-tailed t test). Login to comment
104 There was no difference in age between ABCA4-positive patients who carried the p.G1961E variant and those who did not (P &#bc; 0.1, unpaired t test). Login to comment
139 It is also worth noting that in the case of G1961E mutations in ABCA4, neither fluorescein angiography nor qAF may be helpful imaging methods; a dark choroid is absent in these individuals,27 and in the presence of the G1961E mutation, qAF values can be within the normal range for age (Fig 5). Login to comment
158 One possibility is that certain ABCA4 mutations, for instance, the p.G1961E variant, may elicit a stronger effect on cones than rods. Login to comment
159 Although p.G1961E is the most frequent ABCA4 variant in STGD1 (allele frequency, approximately 10%),32,33 it is still remarkable that 14 of 22 ABCA4-positive BEM patients (64%) carried this variant. Login to comment
160 It has been noted before, however, that the p.G1961E variant seems to be associated with the BEM phenotype and a milder disease spectrum.2,20,32,34 The notion that STGD1 patients with a BEM phenotype have less widespread disease is supported further by Figure 7, which shows the qAF8 levels of the white ABCA4-positve BEM patients in comparison with previously published20 results from white STGD1 patients with phenotypes other than BEM, including patients with extramacular fundus changes. Login to comment

[hide] Structural and genetic assessment of the ABCA4-ass... Invest Ophthalmol Vis Sci. 2014 Oct 9;55(11):7217-26. doi: 10.1167/iovs.14-14674. Noupuu K, Lee W, Zernant J, Tsang SH, Allikmets R
Structural and genetic assessment of the ABCA4-associated optical gap phenotype.
Invest Ophthalmol Vis Sci. 2014 Oct 9;55(11):7217-26. doi: 10.1167/iovs.14-14674., [PMID:25301883]

Abstract [show]
PURPOSE: To investigate the developmental stages and genetic etiology of the optical gap phenotype in recessive Stargardt disease (STGD1). METHODS: Single and longitudinal data points from 15 patients, including four sibling pairs, exhibiting an optical gap phenotype on spectral-domain optical coherence tomography (SD-OCT) with confirmed disease-causing ABCA4 alleles were retrospectively analyzed. Fundus images with corresponding SD-OCT scans were collected with a confocal scanning laser ophthalmoscope. Structural phenotypes were assigned to three developmental stages according to SD-OCT. The ABCA4 gene was screened in all patients. RESULTS: At least two disease-causing ABCA4 variants where identified in each patient; all except one (91%) were compound heterozygous for the p.G1961E mutation. All patients exhibited structural findings on SD-OCT that grouped into three progressive developmental stages over several years. Stage 1 was characterized by mild disruptions of the ellipsoid zone (EZ) band over the fovea. Stage 2 was a progressive expansion of the EZ band loss resulting in an empty lesion devoid of photoreceptors. Stage 3 observed a structural collapse of the inner retinal layers into the optical gap space leading to involvement and atrophy of the RPE thereafter. CONCLUSIONS: The optical gap phenotype in STGD1 can be structurally divided into three progressive stages spanning several years. This particular phenotype also appears to be highly associated with the p.G1961E mutation of ABCA4. Taken together, it appears that a focal loss of photoreceptors sequentially precedes RPE dysfunction in the early development of ABCA4-associated optical gap lesions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
12 At least two disease-causing ABCA4 variants where identified in each patient; all except one (91%) were compound heterozygous for the p.G1961E mutation. Login to comment
18 This particular phenotype also appears to be highly associated with the p.G1961E mutation of ABCA4. Login to comment
20 Keywords: ABCA4, Stargardt disease, optical gap, p.G1961E mutation, optical coherence tomography Stargardt disease (STGD1) is an early-onset autosomal recessive macular dystrophy with a reported prevalence between 1:8000 to 1:10,000, making it the most common form of juvenile macular disease.1 Stargardt disease is caused by mutations in the ABCA4 gene, which encodes an adenosine triphosphatase (ATP)-binding cassette transporter located in the outer segments of photoreceptors.2 ABCA4 performs an important function in the visual cycle being responsible for flipping of all-trans- and 11-cis-retinoids from the intradiscal space to the cytoplasm.3 Mutations in ABCA4 result in the accumulation of protonated N-retinylidene-PE (N-ral-PE) in the photoreceptor outer segments along with a secondary accumulation of N-retinylidene-N-retinyl-ethanolamine (A2E) in the RPE cells during the process of disc shedding and subsequent phagocytosis.4,5 The excess of A2E has been associated with a toxic effect on RPE cells resulting in cell death.6,7 In addition to phenotypic heterogeneity within the clinical spectrum of STGD1,8 mutations in ABCA4 have been reported in other retinal degenerative diseases such as cone-rod dystrophy,9 autosomal recessive retinitis pigmentosa,10,11 and AMD.12 Stargardt disease often initially presents with early atrophic changes in the macula and white-yellow pisciform flecks, but can vary in time from the appearance of bull`s eye maculopathy13 to extensive chorioretinal atrophy.14,15 Several grading systems have been established to characterize the overall progression of STGD1 phenotype.14,16 Functionally, STGD1 can be staged into three groups with respect to electrophysiological findings of the outer retina: Group 1 exhibits pattern electroretinography (pERG) abnormalities, but normal full-field photopic and scotopic responses, group 2 exhibits changes in isolated photopic function and group 3 exhibits significant dysfunction in both the scotopic and photopic systems.16 A less common previously documented phenotype within the STGD1 clinical spectrum is the optical gap, also referred to as an optical empty lesion or foveal cavitation.13,17,18 In addition to STGD1, optical gaps have been described in solar retinopathy, rod monochromatism, and maculopathies associated with RP1L1 mutations.19-23 The optical gap is exclusively detectable by spectral-domain optical coherence tomography (SD-OCT) and appears to represent a focal loss of ellipsoid zone (EZ) reflectance in the outer fovea.17 The aim of this study was to characterize the optical gap phenotype according to its developmental stages and to investigate its association with specific ABCA4 mutations. Login to comment
67 Interestingly, 91% of unrelated cases were compound heterozygous for the p.G1961E variant. Login to comment
68 Therefore, the allele frequency of p.G1961E in patients with the optical gap phenotype in this study was 46.7% and in our entire STGD1 cohort it is 13.4% (see below and Supplementary Tables S1, S2), which results in a highly statistically significant difference (v2 &#bc; 20.9; P &#bc; 5 3 106). Login to comment
79 [286A > G];[5882G > A] p.[(N96D)];[(G1961E)] P2, F*ߤ c. Login to comment
80 [286A > G];[5882G > A] p.[(N96D)];[(G1961E)] P3, M* c. Login to comment
83 [1622T > C;3113C > T];[5882G > A] p.[(L541P;A1038V)];[(G1961E)] P6, F*ߤ c. Login to comment
84 [1622T > C;3113C > T];[5882G > A] p.[(L541P;A1038V)];[(G1961E)] P7, F*ߤ c. Login to comment
85 [1622T > C];[5882G > A] p.[(L541P)];[(G1961E)] P8, F*ߤ c. Login to comment
86 [1622T > C];[5882G > A] p.[(L541P)];[(G1961E)] P9, Fߤ c. Login to comment
87 [5882G > A];[6448T > C] p.[(G1961E)];[(C2150R)] P10, Fߤ c. Login to comment
88 [4139C > T];[5882G > A] p.[(P1380L)];[(G1961E)] P11, M c. Login to comment
91 ];[(G1961E)] P13, Mߤ c. Login to comment
94 [1622T > C;4328G > A];[5882G > A] p.[(L541P;R1443H)];[(G1961E)] * Sibling pairs: P1 and P2, P3 and P4, P5 and P6, P7 and P8. Login to comment
182 Interestingly, the p.G1961E variant was present in 10 of 11 unrelated cases (91%). Login to comment
183 The p.G1961E mutation is the most frequent disease-associated ABCA4 allele seen in approximately 10% of STGD1 patients of European origin.34 This fraction was almost the same in our cohort of 179 patients, including 157 unrelated individuals (42/157; 13.4%), but strikingly higher in patients with the optical gap phenotype (46.7% vs. 13.4%, P < 0.0001). Login to comment
184 It has to be noted, however, that while the optical gap phenotype is definitely associated with the p.G1961E variant, the reverse is not the case since a larger fraction (32 unrelated individuals) who harbored the p.G1961E allele did not present with optical gap. Login to comment
186 Of the other disease-associated ABCA4 alleles compound heterozygous with p.G1961E, the p.L541P mutation, presenting alone or as a complex allele with the p.A1038V variant, was observed in seven cases (four unrelated) with optical gap (Table 2 and Supplementary Table S1) while only once in patients without the phenotype (Supplementary Table S1). Login to comment
188 With the exception of P13, the optical gap was not observed in the SD-OCT scans of any other non-p.G1961E patients (n &#bc; 131) whose age at time of examination, age of onset and estimated disease duration were not statistically different from those of p.G1961E (n &#bc; 48) patients (Supplementary Table S2). Login to comment
189 Therefore, we can conclude that the p.G1961E variant, maybe sometimes together with the p.L541P or p. (L541P; A1038V) allele, is currently the only ABCA4 mutation associated with the optical gap phenotype. Login to comment
191 A striking association of the optical gap phenotype with the p.G1961E mutant allele in the ABCA4 gene was observed; however, further studies on larger patient cohorts are needed to validate this phenotype-genotype correlation and determine the functional association. Login to comment
241 Cella W, Greenstein VC, Zernant-Rajang J, et al. G1961E mutant allele in the Stargardt disease gene ABCA4 causes bull`s eye maculopathy. Login to comment
317 Burke TR, Fishman GA, Zernant J, et al. Retinal phenotypes in patients homozygous for the G1961E mutation in the ABCA4 gene. Login to comment

[hide] Correlations among near-infrared and short-wavelen... Invest Ophthalmol Vis Sci. 2014 Oct 23;55(12):8134-43. doi: 10.1167/iovs.14-14848. Duncker T, Marsiglia M, Lee W, Zernant J, Tsang SH, Allikmets R, Greenstein VC, Sparrow JR
Correlations among near-infrared and short-wavelength autofluorescence and spectral-domain optical coherence tomography in recessive Stargardt disease.
Invest Ophthalmol Vis Sci. 2014 Oct 23;55(12):8134-43. doi: 10.1167/iovs.14-14848., [PMID:25342616]

Abstract [show]
PURPOSE: Short-wavelength (SW) fundus autofluorescence (AF) is considered to originate from lipofuscin in retinal pigment epithelium (RPE) and near-infrared (NIR) AF from melanin. In patients with recessive Stargardt disease (STGD1), we correlated SW-AF and NIR-AF with structural information obtained by spectral-domain optical coherence tomography (SD-OCT). METHODS: Twenty-four STGD1 patients (45 eyes; age 8 to 61 years) carrying confirmed disease-associated ABCA4 mutations were studied prospectively. Short-wavelength AF, NIR-AF, and SD-OCT images were acquired. RESULTS: Five phenotypes were identified according to features of the central lesion and extent of fundus change. Central zones of reduced NIR-AF were typically larger than areas of diminished SW-AF and reduced NIR-AF usually approximated areas of ellipsoid zone (EZ) loss identified by SD-OCT (group 1; r, 0.93, P < 0.0001). In patients having a central lesion with overlapping parafoveal rings of increased NIR-AF and SW-AF (group 3), the extent of EZ loss was strongly correlated with the inner diameter of the NIR-AF ring (r, 0.89, P < 0.0001) and the eccentricity of the outer border of the NIR-AF ring was greater than that of the SW-AF ring. CONCLUSIONS: Lesion areas were more completely delineated in NIR-AF images than with SW-AF. In most cases, EZ loss was observed only at locations where NIR-AF was reduced or absent, indicating that RPE cell atrophy occurs in advance of photoreceptor cell degeneration. Because SW-AF was often increased within the central area of EZ disruption, degenerating photoreceptor cells may produce lipofuscin at accelerated levels. Consideration is given to mechanisms underlying hyper-NIR-AF in conjunction with increased SW-AF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 Age Sex Ethnicity Iris Color BCVA, logMAR ABCA4 Mutation Patient Group OD OS Allele 1 Allele 2 1 35.5 F White Brown 0.8 0.8 p.G1961E c.2382&#fe;1G>A 1 2 11.4 M White Hazel 0.5 0.6 p. Login to comment
88 [L541P;A1038V] 4 4 17.9 M Indian Brown 0.7 0.9 p.G1961E c.6729&#fe;4_&#fe;18del 3 5 12.1 M White Green 0.8 0.7 p.G1961E p.P1380L 3 6 46.4 M Black Brown 0.3 0.8 p.T1526M 2 7 42.6 F White Brown 1.3 1.3 p.G1961E p. Login to comment
89 [L541P;A1038V] 2 8 42.8 M White Blue 0.9 0.4 c.571-1G>T 1 9 24.6 F White Hazel 0.3 0.2 p.G1961E p.N96D 5 10 21.9 F White Brown 0.3 0.4 p.G1961E p.N96D 5 11 25.3 M White Brown 0.0 0.3 p.G1961E p.Q1003* 3 12 8.5 M White Green n/a (n/a) p. Login to comment
90 [L541P;A1038V] p.L2027F 4 13 19.7 M White Brown 0.9 0.9 p.G1961E p. Login to comment
91 [L541P;A1038V] 5 14 22.4 F White Brown 0.8 0.8 p.R212C 3 15 20.2 M White Brown 0.9 0.9 p.G1961E p.P1380L 1 16 27.6 M Arabic Brown 0.0 0.0 p.R1300* p.R2106C 3 17 26.8 M White Blue 0.5 0.5 p.G1961E c.3050&#fe;5G>A 1 18 24.9 F White Hazel 0.9 0.9 p.G1961E p.C2150R 5 19 13.2 M White Blue 0.9 1.0 p.W821R p.C2150Y 3 20 61.0 F White Green 2.0 0.0 c.250_251insCAAA 2 21 36.3 F White Blue 1.3 0.1 p.N1799D 1 22 14.1 F White Green 1.0 0.9 p.R1108C p.Q1412* 2 23 18.6 M White Brown 0.9 0.9 p.G1961E p.A1773V 3 24 53.3 F White Blue 0.3 (0.2) p.R2077W 2 BCVA values in parenthesis indicate fellow eyes that were not included in the study. Login to comment
194 2. Burke TR, Fishman GA, Zernant J, et al. Retinal phenotypes in patients homozygous for the G1961E mutation in the ABCA4 gene. Login to comment

[hide] Early-onset stargardt disease: phenotypic and geno... Ophthalmology. 2015 Feb;122(2):335-44. doi: 10.1016/j.ophtha.2014.08.032. Epub 2014 Oct 17. Lambertus S, van Huet RA, Bax NM, Hoefsloot LH, Cremers FP, Boon CJ, Klevering BJ, Hoyng CB
Early-onset stargardt disease: phenotypic and genotypic characteristics.
Ophthalmology. 2015 Feb;122(2):335-44. doi: 10.1016/j.ophtha.2014.08.032. Epub 2014 Oct 17., [PMID:25444351]

Abstract [show]
OBJECTIVE: To describe the phenotype and genotype of patients with early-onset Stargardt disease. DESIGN: Retrospective cohort study. PARTICIPANTS: Fifty-one Stargardt patients with age at onset </=10 years. METHODS: We reviewed patient medical records for age at onset, medical history, initial symptoms, best-corrected visual acuity (BCVA), ophthalmoscopy, fundus photography, fundus autofluorescence (FAF), fluorescein angiography (FA), spectral-domain optical coherence tomography (SD-OCT), and full-field electroretinography (ffERG). The ABCA4 gene was screened for mutations. MAIN OUTCOME MEASURES: Age at onset, BCVA, fundus appearance, FAF, FA, SD-OCT, ffERG, and presence of ABCA4 mutations. RESULTS: The mean age at onset was 7.2 years (range, 1-10). The median times to develop BCVA of 20/32, 20/80, 20/200, and 20/500 were 3, 5, 12, and 23 years, respectively. Initial ophthalmoscopy in 41 patients revealed either no abnormalities or foveal retinal pigment epithelium (RPE) changes in 10 and 9 patients, respectively; the other 22 patients had foveal atrophy, atrophic RPE lesions, and/or irregular yellow-white fundus flecks. On FA, there was a "dark choroid" in 21 out of 29 patients. In 14 out of 50 patients, foveal atrophy occurred before flecks developed. On FAF, there was centrifugal expansion of disseminated atrophic spots, which progressed to the eventual profound chorioretinal atrophy. Spectral-domain OCT revealed early photoreceptor damage followed by atrophy of the outer retina, RPE, and choroid. On ffERG in 26 patients, 15 had normal amplitudes, and 11 had reduced photopic and/or scotopic amplitudes at their first visit. We found no correlation between ffERG abnormalities and the rate of vision loss. Thirteen out of 25 patients had progressive ffERG abnormalities. Finally, genetic screening of 44 patients revealed >/=2 ABCA4 mutations in 37 patients and single heterozygous mutations in 7. CONCLUSIONS: In early-onset Stargardt, initial ophthalmoscopy can reveal no abnormalities or minor retinal abnormalities. Yellow-white flecks can be preceded by foveal atrophy and may be visible only on FAF. Although ffERG is insufficient for predicting the rate of vision loss, abnormalities can develop. Over time, visual acuity declines rapidly in parallel with progressive retinal degeneration, resulting in profound chorioretinal atrophy. Thus, early-onset Stargardt lies at the severe end of the spectrum of ABCA4-associated retinal phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
115 Fundus photographs and autofluorescence (FAF) imaging of patient 37 (age at onset, 8 years; ABCA4 genotype: p.Phe608Ile and p.Gly1961Glu) at 15 (A1,2) and 22 years (B1,2) of age, showing isolated foveal pigment alterations and a hypoautofluorescent lesion (best-corrected visual acuity [BCVA], 0.52 logarithm of the minimum angle of resolution [logMAR], Snellen 20/66). Login to comment
143 1 1 1, 23, 32, 41, 43 c.5762_5763dup p.Ala1922fs 1 1 34 c.5882G>A p.Gly1961Glu 5 6 18, 31, 32, 44, 49 c.6320G>A p.Arg2107His 2 2 8, 31, 40, 45, 50 c.6411T>A p.Cys2137* 1 1 34 c.6543_6578del p.Leu2182_Phe2193del 1 1 1 del &#bc; deletion; dup &#bc; duplication; fs &#bc; frame shift. Login to comment

[hide] Common synonymous variants in ABCA4 are protective... BMC Ophthalmol. 2015 Mar 6;15:18. doi: 10.1186/s12886-015-0008-0. Grassmann F, Bergholz R, Mandl J, Jagle H, Ruether K, Weber BH
Common synonymous variants in ABCA4 are protective for chloroquine induced maculopathy (toxic maculopathy).
BMC Ophthalmol. 2015 Mar 6;15:18. doi: 10.1186/s12886-015-0008-0., [PMID:25884411]

Abstract [show]
BACKGROUND: Chloroquine (CQ) and hydroxychloroquine (HCQ) are used to treat auto-immune related diseases such as rheumatoid arthritis (RA) or systemic lupus erythematosus. Both drugs however can cause retinal toxicity eventually leading to irreversible maculopathy and retinopathy. Established risk factors are duration and dosage of treatment while the involvement of genetic factors contributing to toxic maculopathy is largely unclear. To address the latter issue, this study aimed to expand on earlier efforts by (1) evaluating risk-altering variants known to be associated with age-related macular degeneration (AMD), a frequent maculopathy in individuals over 55 years of age, and (2) determining the contribution of genetic variants in the coding sequence of the ABCA4 gene. METHODS: The ABCA4 gene was analyzed by deep sequencing technology using a personal genome machine (Ion Torrent) with 200 bp read length. Assessment of AMD variants was done by restriction enzyme digestion of PCR products and TaqMan SNP genotyping. Effect sizes, p-values and confidence intervals of common variants were evaluated by logistic regression (Firth's bias corrected). To account for multiple testing, p-values were adjusted according to the false discovery rate. RESULTS: We found no effects of known AMD-associated variants on the risk of toxic maculopathy. In contrast, we report a statistically significant association of common variants in the ABCA4 gene with retinal disease, assessed by a score-based variance-component test (PSKAT = 0.0055). This association remained significant after adjustment for environmental factors like age and duration of medication and was driven by three common variants in ABCA4 (c.5682G > C, c.5814A > G, c.5844A > G), all conferring a reduced risk for toxic maculopathy. CONCLUSIONS: Our findings demonstrate that minor alleles of common genetic variants in ABCA4 significantly reduce susceptibility to develop toxic maculopathy under CQ treatment. A refined risk profile based on genetic and environmental factors may have implications for revised recommendations in CQ as well as HCQ treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
212 Cella W, Greenstein VC, Zernant-Rajang J, Smith TR, Barile G, Allikmets R, et al. G1961E mutant allele in the Stargardt disease gene ABCA4 causes bull`s eye maculopathy. Login to comment

[hide] Associations of the G1961E and D2177N variants in ... Gene. 2015 Aug 1;567(1):51-7. doi: 10.1016/j.gene.2015.04.068. Epub 2015 Apr 25. Zhang R, Wang LY, Wang YF, Wu CR, Lei CL, Wang MX, Ma L
Associations of the G1961E and D2177N variants in ABCA4 and the risk of age-related macular degeneration.
Gene. 2015 Aug 1;567(1):51-7. doi: 10.1016/j.gene.2015.04.068. Epub 2015 Apr 25., [PMID:25921964]

Abstract [show]
OBJECTIVE: The aim of this study was to identify the relationship between G1961E and D2177N variants in the ABCA4 gene with AMD susceptibility. DESIGN AND METHODS: All eligible studies published up to October 2014 were obtained from MEDLINE, EMBASE, and ISI Web of Science. The pooled odds ratio (OR) with 95% confidence intervals (CIs) was calculated to evaluate the strength of this association. RESULTS: Twenty-four studies enrolling 4580 AMD cases and 5180 controls were identified. Both G1961E (OR = 3.22, 95% CI: 1.74-5.95) and D2177N (OR = 2.36, 95% CI: 1.41-3.93) variations showed significant associations with increased risk of AMD. In addition, a more significant relationship in the D2177N mutation with increased risk for AMD was found in Americans (OR = 4.31, 95% CI: 1.90-9.73), while no association was demonstrated in Europeans. For Asians, no carriers of the risk factor A allele in either variant were detected in any of AMD patients and control subjects. CONCLUSIONS: Significant evidence was found for a relationship between the G1961E and D2177N variants in ABCA4 with increased susceptibility to AMD, specifically for Americans. However, large-scale studies are still required to further validate these findings in different ethnicities.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Research paper Associations of the G1961E and D2177N variants in ABCA4 and the risk of age-related macular degeneration Rui Zhang a,1 , Li-Yuan Wang a,1 , Ya-Feng Wang a , Chang-Rui Wu b , Chun-Ling Lei c , Ming-Xu Wang a, Ìe;, Le Ma a, Ìe; a School of Public Health, Xi'an Jiaotong University Health Science Center, Xi'an, China b The First Affiliated Hospital, Xi'an Jiaotong University College of Medicine, Xi'an, China c The Fourth Hospital of Xi'an, Xi'an Jiaotong University, Xi'an, China a b s t r a c t a r t i c l e i n f o Article history: Received 22 January 2015 Received in revised form 21 April 2015 Accepted 23 April 2015 Available online 25 April 2015 Keywords: Age-related macular degeneration ABCA4 Polymorphism Objective: The aim of this study was to identify the relationship between G1961E and D2177N variants in the ABCA4 gene with AMD susceptibility. Login to comment
4 Both G1961E (OR = 3.22, 95% CI: 1.74-5.95) and D2177N (OR = 2.36, 95% CI: 1.41-3.93) variations showed significant associations with increased risk of AMD. Login to comment
7 Conclusions: Significant evidence was found for a relationship between the G1961E and D2177N variants in ABCA4 with increased susceptibility to AMD, specifically for Americans. Login to comment
20 Two common sequence variants in ABCA4, G1961E (c.5882G N A) and D2177N (c.6529G N A) accounted for over half of the reported disease-associated variants; many investigators have assessed the role of ABCA4 in AMD through these two mutations (Allikmets et al., 1997; Allikmets, 2000; Souied et al., 2000). Login to comment
29 We performed a meta-analysis based on published data to clarify the contributions of G1961E and D2177N sequence variants towards the risk of AMD for different populations. Login to comment
38 First, an initial review of the identified abstracts and titles in all of the relevant articles was conducted to exclude those studies that did not address the association between G1961E or D2177N mutations and the risk of AMD. Login to comment
53 Statistical methods An odds ratio (OR) with a corresponding 95% confidence interval (CI) was used to assess the strength of the association between each variant and susceptibility of AMD under an allelic model (G1961E: c.5882G N A and D2177N: c.6529G N A). Login to comment
77 G1961E variation and AMD risk All of the included studies assessed the relationship between the G1961E variant in ABCA4 and susceptibility to AMD, whereas eight studies were ultimately excluded from the final meta-analysis due to the variation having not been detected in any of the cases or controls (Baum et al., 2003; Souied et al., 2000; Allikmets, 2000; Kuroiwa et al., 1999; De La Paz et al., 1999; Schmidt et al., 2003; Fuse et al., 2000). Login to comment
79 The frequency for A (mutation allele) was noted to be significantly higher in AMD subjects compared with normal control subjects (P b 0.001), with 37 (1.39%) and 9 (0.32%) carriers of the G1961E variant being determined in cases and controls, respectively. Login to comment
80 In the present meta-analysis, there was no significant heterogeneity across the studies (I2 = 0%; P = 0.92 for heterogeneity) and the fixed-effects pooled OR across all datasets revealed significant evidence for a relationship between G1961E and susceptibility to AMD under the allelic model (A vs. T: OR = 3.22, 95% CI: 1.745.95; Fig. 2). Login to comment
82 Compared with a wider confidence interval for the studies with hospital-based controls (OR = 1.59, 95% CI: 0.06-39.31), population-based studies tended to show a slightly stronger association of the G1961E polymorphism with AMD risk (OR = 3.31, 95% CI: 1.77-6.18, P = 0.89 for heterogeneity). Login to comment
86 D2177N variation and AMD risk Similar to the G1961E variant, all of the included studies reported data for the frequency of the D2177N variation in cases and controls. Login to comment
98 Discussion In the current study, we evaluated the effects of the G1961E and D2177N variants in ABCA4 on AMD susceptibility based on data from 24 case-control studies. Login to comment
107 Two common coding polymorphisms located in ABCA4, G1961E and D2177N have been considered to be related to the risk for AMD. Login to comment
113 Sun et al. suggested that the G1961E protein and the D2177N protein could significantly decrease ATPase activity by retinal compared with the wild-type ABCA4 protein (Sun et al., 1999). Login to comment
117 First author and year Country Variation location Number Source of control Diagnostic criteria Classification criteria Genotyping methods Quality scorea Cases Controls De La Paz et al. (1999) USA G1961E, D2177N 169 56 HB Fundus photography ICGS SSCP + HA 8 Kuroiwa et al. (1999) Japan G1961E, D2177N 80 100 HB Fundus photography ICGS PCR + SSCP 8 McNeill et al. (2000) USA G1961E, D2177N 177 150 PB NR NR NR 4 Souied et al. (2000) France G1961E, D2177N 52 90 PB Fundus photography ICGS SSCP 7 Allikmets (2000) USA G1961E, D2177N 229 200 PB NR NR NR 7 USA G1961E, D2177N 101 100 PB NR NR NR 7 USA G1961E, D2177N 103 158 PB NR NR NR 6 Germany G1961E, D2177N 200 100 PB NR NR NR 7 Holland G1961E, D2177N 83 168 PB NR NR NR 6 USA G1961E, D2177N 115 100 PB NR NR NR 7 Italy G1961E, D2177N 92 171 PB NR NR NR 6 Spain G1961E, D2177N 36 34 PB NR NR NR 7 Sweden G1961E, D2177N 102 100 PB NR NR NR 6 UK G1961E, D2177N 90 20 PB NR NR NR 7 France G1961E, D2177N 67 107 PB NR NR NR 6 Rivera et al. (2000) Germany G1961E, D2177N 200 220 PB Fundus photography ICGS DGGE + DHPLC + SSCP 8 Fuse et al. (2000) Japan G1961E, D2177N 25 40 PB Fundus photography ICGS PCR 7 Webster et al. (2001) USA G1961E, D2177N 182 96 HP Fundus photography ICGS SSCP 7 Guymer et al. (2001) USA G1961E, D2177N 304 408 PB Fundus photography ICGS PCR 8 Australia G1961E, D2177N 201 187 PB Fundus photography ICGS PCR 8 Switzerland G1961E, D2177N 39 94 PB Fundus photography ICGS PCR 8 Bernstein et al. (2002) USA G1961E, D2177N 167 220 PB Fundus photography AREDS direct sequencing 7 Schmidt et al. (2003) USA G1961E, D2177N 165 59 PB Fundus photography ICGS DHPLC + PCR 8 Baum et al. (2003) China G1961E, D2177N 140 95 HP Fundus photography NR PCR 6 AREDS, Age-Related Eye Disease Study; DGGE, denaturing gradient gel electrophoresis; DHPLC, denaturing high performance liquid chromatography; HA, heteroduplex analysis; HP, hospital-based; ICGS, International Classification and Grading System; NR, not reported; PB, population-based; PCR, polymerase chain reaction; SSCP, single-strand conformation polymorphism. Login to comment
119 Fig. 2. Forest plot on the association between the G1961E variation and AMD risk under the allelic model (A vs. G). Login to comment
124 The results of our study showed that the frequency of the A allele for D2177N in control subjects was significantly higher in Europeans compared to Americans, which also supported the hypothesis that Americans were more likely than Europeans to Table 2 Stratified analysis of the association between the G1961E and D2177N variations and AMD. Login to comment
125 Subgroup G1961E D2177N N OR (95% CI) I2 (%) Pz Ph N OR (95% CI) I2 (%) Pz Ph Country of origin Europe 10 2.81 (1.14, 6.69) 0 0.82 0.60 10 1.18 (0.54, 2.57) 0 0.92 0.04 United States 10 3.89 (1.59, 9.56) 0 0.67 10 4.31 (1.90, 9.73) 0 0.78 Asia 3 NA NA NA 3 NA NA NA Australia 1 1.86 (0.17, 20.69) NA NA 1 2.33 (0.45, 12.13) NA NA Source of controls Population-based 20 3.31 (1.77, 6.18) 0 0.89 0.54 20 2.37 (1.40, 4.02) 0 0.68 0.58 Hospital-based 4 1.59 (0.06, 39.31) NA NA 4 2.12 (0.25, 18.30) 0 0.83 Age of case (years) b75 3 NA NA NA NP 3 NA NA NA NP ࣙ75 4 2.31 (0.77, 6.93) 0 0.91 4 1.46 (0.60, 3.53) 0 0.87 Classification criteria ICGS 10 2.11 (0.78, 6.28) 0 0.91 NP 10 1.54 (0.66, 3.59) 0 0.93 0.18 AREDS 1 17.11 (0.96, 305.92) NA NA 1 9.22 (1.12, 75.68) NA NA Genotyping methods PCR 5 2.39 (0.57, 10.18) 0 0.76 0.38 5 2.05 (0.61, 6.92) 0 0.82 0.33 SSCP 2 1.59 (0.06, 39.31) NA NA 2 2.64 (0.13, 55.62) NA NA Direct sequencing 1 17.11 (0.96, 305.92) NA NA 1 9.22 (1.12, 75.68) NA NA Quality scorea High 17 2.63 (1.27, 5.43) 0 0.88 0.38 17 1.96 (1.08, 3.54) 0 0.82 0.26 Moderate 6 5.47 (1.54, 19.36) 0 0.60 6 3.20 (1.05, 9.76) 0 0.42 Low 1 4.19 (0.20, 88.00) NA NA 1 9.33 (0.51, 170.05) NA NA AREDS, Age-Related Eye Disease Study; ICGS, International Classification and Grading System; OR, odds ratio; CI, confidence interval; PCR, polymerase chain reaction; Pz, P for Z test; Ph, P for between-study heterogeneity; NA, not applicable; NP, meta-regression was not possible. Login to comment
134 First, the relatively small sample sizes might reduce the statistical power to assess the association between G1961E and D2177N variations and the susceptibility to AMD. Login to comment
142 In conclusion, the present meta-analysis demonstrated that the variants of G1961E and D2177N in ABCA4 were significantly associated with increased risk of AMD, specifically for Americans. Login to comment

[hide] Quantitative Fundus Autofluorescence and Optical C... Invest Ophthalmol Vis Sci. 2015 May;56(5):3159-70. doi: 10.1167/iovs.14-16343. Duncker T, Tsang SH, Woods RL, Lee W, Zernant J, Allikmets R, Delori FC, Sparrow JR
Quantitative Fundus Autofluorescence and Optical Coherence Tomography in PRPH2/RDS- and ABCA4-Associated Disease Exhibiting Phenotypic Overlap.
Invest Ophthalmol Vis Sci. 2015 May;56(5):3159-70. doi: 10.1167/iovs.14-16343., [PMID:26024099]

Abstract [show]
PURPOSE: To assess whether quantitative fundus autofluorescence (qAF), a measure of RPE lipofuscin, and spectral-domain optical coherence tomography (SD-OCT) can aid in the differentiation of patients with fundus features that could either be related to ABCA4 mutations or be part of the phenotypic spectrum of pattern dystrophies. METHODS: Autofluorescence images (30 degrees , 488-nm excitation) from 39 patients (67 eyes) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference and were quantified as previously described. In addition, horizontal SD-OCT images through the fovea were obtained. Patients were screened for ABCA4 and PRPH2/RDS mutations. RESULTS: ABCA4 mutations were identified in 19 patients (mean age, 37 +/- 12 years) and PRPH2/RDS mutations in 8 patients (mean age, 48 +/- 13 years); no known ABCA4 or PRPH2/RDS mutations were found in 12 patients (mean age, 48 +/- 9 years). Differentiation of the groups using phenotypic SD-OCT and AF features (e.g., peripapillary sparing, foveal sparing) was not reliable. However, patients with ABCA4 mutations could be discriminated reasonably well from other patients when qAF values were corrected for age and race. In general, ABCA4 patients had higher qAF values than PRPH2/RDS patients, while most patients without mutations in PRPH2/RDS or ABCA4 had qAF levels within the normal range. CONCLUSIONS: The high qAF levels of ABCA4-positive patients are a hallmark of ABCA4-related disease. The reason for high qAF among many PRPH2/RDS-positive patients is not known; higher RPE lipofuscin accumulation may be a primary or secondary effect of the PRPH2/RDS mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Summary of Demographic, Clinical, and Genetic Data Patient Sex Age Race BCVA, logMAR ABCA4 Mutation PRPH2/RDS Mutation qAF8 OD OS Allele 1 Allele 2 OD OS 1 F 35.5 White 0.80 0.80 p.G1961E c.2382&#fe;1G>A NS n/a 532 2ߤ M 34.5 White 0.30 0.18 p.G1961E p. Login to comment
61 [L541P;A1038V] NS 425 n/a 3ߤ M 34.5 White 0.18 0.18 p.G1961E p. Login to comment
62 [L541P;A1038V] NS 356 352 4 F 35.8 White 0.00 0.00 NF NF p.C213S 513 444 5 F 43.4 White 0.00 0.00 NF NF NF 489 424 6 M 34.2 White n/a n/a NF NF NF 293 302 7 M 58.9 White 1.00 0.88 NF NF NF 288 n/a 8 F 62.4 White 0.30 0.30 NF NF c.582-1G>A 479 535 9 F 60.3 White 0.88 0.88 c.4248_4250delCTT NF NF 510 457 10 M 57.9 White 0.60 0.60 NF NF NF n/a 384 11ߥ F 56.8 White 0.18 0.18 NF NF c.163delT 398 370 12* F 53.9 White 0.00 0.00 NF NF p.Y91N;c.310_313delATCT 536 564 13* F 47.9 White 0.00 0.30 NF NF p.Y91N;c.310_313delATCT 510 524 14 F 42.2 White 0.48 0.48 c.2069delG NF NF 541 571 15 F 52.8 White 0.00 0.00 NF NF NF 355 n/a 16 M 42.8 White 0.88 0.40 c.571-1G>T NF NF 518 529 17 M 42.8 White 0.10 0.00 NF NF NF 164 162 18 F 38.5 White 0.12 0.00 c.250_251insCAAA NF NF n/a 624 19 M 50.2 Asian&#a7; 0.60 0.70 p.V675I p.M1882I NF 471 502 20ߥ F 36.1 White 0.30 0.30 NF NF c.163delT 736 751 21 F 50.8 White 0.48 0.40 NF NF NF 396 367 22 M 48.6 Black 1.00 0.48 NF NF NF 351 339 23 F 25.6 White 1.00 1.00 p.G1961E p. Login to comment
63 [L541P;A1038V] NS n/a 443 24 F 20.2 White 0.88 0.88 p.G1961E p.P1380L NS 376 400 25 F 22.9 White 0.88 0.80 p. Login to comment
64 [A854T;A1038V] p.C2150Y NS 367 426 26 F 53.5 White 0.60 0.48 p.R212C NF NF 754 683 27 M 52.2 White 0.70 0.60 p.G1961E c.3050&#fe;5G>A NF 644 n/a 28 M 31.7 Asian&#a7; 0.48 0.48 c.859-9T>C c.859-9T>C NF n/a 317 29 F 49.8 White 0.00 0.00 NF NF NF 493 510 30 M 24.8 White 0.00 0.00 p.G1961E c.3050&#fe;5G>A NS 381 451 31 F 29.3 White 0.40 0.40 p.G1961E p. Login to comment
65 [L541P;R1443H] NS 479 487 32 F 23 White 0.30 0.18 p.G1961E p.P1380L NF 412 444 33 M 28.4 White 0.70 0.48 NF NF NF 388 n/a 34ߥ M 61.5 White 1.30 0.60 NF NF E191Xjj 490 459 35ߥ M 30.6 White 0.00 0.00 NF NF E191Xjj 345 324 36 M 51.5 White 0.30 0.54 NF NF NF 515 497 37 M 53.2 White 0.60 0.60 NF NF NF 212 239 38 F 35.3 White 0.88 0.10 p.N1799D NF NF n/a 387 39 F 55 White 0.00 0.00 p.R2077W NF NF 541 586 BCVA, best-corrected visual acuity; logMAR, logarithm of the minimum angle of resolution; OD, right eye; OS, left eye; qAF8, average quantitative autofluorescence of the 8 measurement sites from all available images per eye; n/a, not available; NF, not found. Login to comment
214 ABCA4-positive patients exhibiting a BEM phenotype were also reported to have lower qAF than ABCA4-positve patients with other phenotypes, including those with extramacular disease.23 In the case of ABCA4-positive BEM, many of the patients carried the G1961E mutation, which was also the case for 9/19 of the ABCA4-positive patients in this study. Login to comment

[hide] Near-infrared autofluorescence: its relationship t... Invest Ophthalmol Vis Sci. 2015 May;56(5):3226-34. doi: 10.1167/iovs.14-16050. Greenstein VC, Schuman AD, Lee W, Duncker T, Zernant J, Allikmets R, Hood DC, Sparrow JR
Near-infrared autofluorescence: its relationship to short-wavelength autofluorescence and optical coherence tomography in recessive stargardt disease.
Invest Ophthalmol Vis Sci. 2015 May;56(5):3226-34. doi: 10.1167/iovs.14-16050., [PMID:26024107]

Abstract [show]
PURPOSE: We compared hypoautofluorescent (hypoAF) areas detected with near-infrared (NIR-AF) and short-wavelength autofluorescence (SW-AF) in patients with recessive Stargardt disease (STGD1) to retinal structure using spectral domain optical coherence tomography (SD-OCT). METHODS: The SD-OCT volume scans, and SW-AF and NIR-AF images were obtained from 15 eyes of 15 patients with STGD1 and registered to each other. Thickness maps of the total retina, receptor-plus layer (R+, from distal border of the RPE to outer plexiform/inner nuclear layer boundary), and outer segment-plus layer (OS+, from distal border of the RPE to ellipsoid zone [EZ] band) were created from SD-OCT scans. These were compared qualitatively and quantitatively to the hypoAF areas in SW-AF and NIR-AF images. RESULTS: All eyes showed a hypoAF area in the central macula and loss of the EZ band in SD-OCT scans. The hypoAF area was larger in NIR than SW-AF images and it exceeded the area of EZ band loss for 12 eyes. The thickness maps showed progressive thinning towards the central macula, with the OS+ layer showing the most extensive and severe thinning. The central hypoAF areas on NIR corresponded to the OS+ thinned areas, while the hypoAF areas on SW-AF corresponded to the R+ thinned areas. CONCLUSIONS: Since the larger hypoAF area on NIR-AF exceeded the region of EZ band loss, and corresponded to the OS+ thinned area, RPE cell loss occurred before photoreceptor cell loss. The NIR-AF imaging may be an effective tool for following progression and predicting loss of photoreceptors in STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Selected Demographic, Clinical, and Genetic Characteristics of the Study Cohort Patient Sex Disease-Associated ABCA4 Variant(s) Age Eye BCVA 1 F p.G1961E; c2382&#fe;1G>A 36 OS 0.8 2 M p.[L541P;A1038V] 8 OS 0.6 3 M p.G1961E; c.6729&#fe;5_&#fe;19del 18 OS 0.9 4 M p.P1380L; p.G1961E 12 OD 0.8 5 M c.571-1G>T 43 OD 0.4 6 M p.Q1003*; p.G1961E 25 OS 0 7 M p.[L541P;A1038V]; p.L2027F 8 OD N/A 8 F p.R212C; p.G1961E 22 OD 0.8 9 F p.P1380L; p.G1961E 20 OD 0.9 10 M p.R1300*; p.R2106C 26 OS 0 11 M c.3050&#fe;5G>A; p.G1961E 27 OD 0.5 12 F p.G1961E; p.C2150R 25 OD 0.7 13 M p.W821R; p.C2150Y 13 OD 0.4 14 F p.N1799D 36 OD 1.3 15 M p.A1773V; p.G1961E 19 OD 0.7 FIGURE 1. Login to comment

[hide] Objective Analysis of Hyperreflective Outer Retina... Invest Ophthalmol Vis Sci. 2015 Jul;56(8):4662-7. doi: 10.1167/iovs.15-16955. Park JC, Collison FT, Fishman GA, Allikmets R, Zernant J, Liu M, McAnany JJ
Objective Analysis of Hyperreflective Outer Retinal Bands Imaged by Optical Coherence Tomography in Patients With Stargardt Disease.
Invest Ophthalmol Vis Sci. 2015 Jul;56(8):4662-7. doi: 10.1167/iovs.15-16955., [PMID:26207301]

Abstract [show]
PURPOSE: To develop and apply an objective algorithm for analyzing outer retinal layers imaged by spectral-domain optical coherence tomography (SD-OCT) in patients with Stargardt disease (STGD1). METHODS: Horizontal macular B-scans were acquired from 20 visually normal controls and 20 genetically confirmed stage 1 STGD1 patients. The number of outer retinal bands was quantified using a semiautomated algorithm that detected bands using the second derivative of longitudinal reflectivity profiles. The present analysis focused on the three outermost bands, currently associated with the ellipsoid zone (EZ), cone outer segment interdigitation zone (IZ), and retinal pigment epithelium (RPE) complex. RESULTS: The RPE complex and EZ bands were detected throughout the B-scan in all controls. The RPE complex was detected throughout the B-scan in all patients, but was atrophic appearing in some locations. The EZ band was detected only outside the central lesion. Interdigitation zone band detection varied as a function of eccentricity for both groups, with detection for controls being highest in the para- and perifovea and lowest in the fovea and near periphery. In patients, the IZ band was generally not present in the fovea or para- or perifovea due to the central lesion. Outside of the lesion, the IZ band was detected in 26% of patients (mean detection across the near periphery), which was approximately half of the detection in controls. CONCLUSIONS: An objective approach for quantifying the number of outer retinal OCT bands found reduced IZ detection in STGD1 patients. This occurred even outside the central lesion, demonstrating an inability to image the IZ, possibly due to enhanced RPE reflectivity or abnormal outer retinal structure.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 of ABCA4 Mutations Mutation(s) 1 13 M 20/70 2 p.[(L541P; A1038V)] (;)c.5714&#fe;5G>A 2 15 F 20/60 2 c.3050&#fe;5G>A(;)p.(G1961E) 3 15 F 20/80 2 p.[(R1129L(;)A1773V)] 4 16 F 10/1001 Sister of patient 3 5 20 M 20/160&#fe;2 2 p.[(R1129C(;)R2077W)] 6 20 F 20/1601 2 p.[(G1961E(;)R2040*)] 7 21 M 20/40 2 p.[(R219T(;)W439*(;)G863A)] 8 23 F 10/100 2 c.5461-10T>C(;)p.(G1961E) 9 23 F 20/1001 2 c.302&#fe;1G>A(;)p.(R2107H) 10 28 F 20/1001 2 c.5461-10T>C(;)p.(G1961E) 11 30 F 20/25&#fe;2 1 p.[(R2077W)];[?] Login to comment
53 12 31 F 20/200 2 p.(G1961E);c.6479&#fe;1G>A 13 31 F 20/1251 1 p.[(Q636*)];[?] Login to comment
54 14 33 F 20/200 2 p.[(L541P;A1038V(;)I1684N)] 15 41 F 20/25&#fe;1 2 p.[(V989A)];[(V989A)] 16 45 F 20/25 2 p.[(I975M(;)K1978E)] 17 45 M 20/200 2 p.[(R1108C;Q876P)];[(Q876P)] 18 47 F 20/200 2 p.[(R1108C(;)G1961E)] 19 48 M 20/253 2 p.[(G1961E)];[(G1961E)] 20 48 M 20/100 2 p.[(G863A)];[(G863A)] BCVA, best-corrected visual acuity; ''?`` indicates that the second mutation was not identified. Login to comment

[hide] Flecks in Recessive Stargardt Disease: Short-Wavel... Invest Ophthalmol Vis Sci. 2015 Jul;56(8):5029-39. doi: 10.1167/iovs.15-16763. Sparrow JR, Marsiglia M, Allikmets R, Tsang S, Lee W, Duncker T, Zernant J
Flecks in Recessive Stargardt Disease: Short-Wavelength Autofluorescence, Near-Infrared Autofluorescence, and Optical Coherence Tomography.
Invest Ophthalmol Vis Sci. 2015 Jul;56(8):5029-39. doi: 10.1167/iovs.15-16763., [PMID:26230768]

Abstract [show]
PURPOSE: We evaluated the incongruous observation whereby flecks in recessive Stargardt disease (STGD1) can exhibit increased short-wavelength autofluorescence (SW-AF) that originates from retinal pigment epithelium (RPE) lipofuscin, while near-infrared AF (NIR-AF), emitted primarily from RPE melanin, is usually reduced or absent at fleck positions. METHODS: Flecks in SW- and NIR-AF images and spectral-domain optical coherence tomography (SD-OCT) scans were studied in 19 STGD1 patients carrying disease-causing ABCA4 mutations. Fleck spatial distribution and progression were recorded in serial AF images. RESULTS: Flecks observed in SW-AF images typically colocalized with darkened foci in NIR-AF images; the NIR-AF profiles were larger. The decreased NIR-AF signal from flecks preceded apparent changes in SW-AF. Spatiotemporal changes in fleck distribution usually progressed centrifugally, but in one case centripetal expansion was observed. Flecks in SW-AF images corresponded to hyperreflective deposits that progressively traversed photoreceptor-attributable bands in SD-OCT images. Outer nuclear layer (ONL) thickness negatively correlated with expansion of flecks from outer to inner retina. CONCLUSIONS: In the healthy retina, RPE lipofuscin fluorophores form in photoreceptor cells but are transferred to RPE; thus the SW-AF signal from photoreceptor cells is negligible. In STGD1, NIR-AF imaging reveals that flecks are predominantly hypofluorescent and larger and that NIR-AF darkening occurs prior to heightened SW-AF signal. These observations indicate that RPE cells associated with flecks in STGD1 are considerably changed or lost. Spectral-domain OCT findings are indicative of ongoing photoreceptor cell degeneration. The bright SW-AF signal of flecks likely originates from augmented lipofuscin formation in degenerating photoreceptor cells impaired by the failure of RPE.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Summary of Demographic, Clinical, and Genetic Data Patient Sex Age Race/Ethnicity BCVA, logMAR ABCA4 Mutations OD OS 1 F 35.52 Caucasian 0.8 0.8 p. [G1961E]; c. Login to comment
48 [IVS15&#fe;1G>A 2 M 12.00 Caucasian 0.5 0.5 p. [L541P; A1038V] 3* M 9.00 Caucasian 1 1 p. [W855*]; [T1526M] 4 F 47.55 Caucasian 1.3 1.3 p. [L541P; A1038V]; [G1961E] 5* F 16.47 Caucasian 0.6 0.6 p. [T972N]; [L2027F] 6* M 16.98 Caucasian 1.3 1.3 p. [K346T]; [T1117I] 7 F 23.80 Caucasian 0.6 0.4 p. [R1161S] 8* F 28.67 Caucasian 1.3 1.3 p. [P1380L]; [P1380L] 9 M 42.83 Caucasian 0.9 0.4 c. Login to comment
49 [571-1G>T 10* M 13.89 Caucasian 0.4 0.4 p. [L541P; A1038V]; [L2027F] 11* F 20.20 Caucasian 0.9 0.9 p. [P1380L]; [G1961E] 12 M 27.61 African-Arab 0 0 p. [R1300*]; [R2106C] 13* M 46.93 Caucasian 0.3 0.4 p. [C1490Y]; [G1961E] 14* M 26.82 Caucasian 0 0 c. Login to comment
50 [3050&#fe;5G>A]; p. [G1961E] 15 M 48.36 African American 0 0 p. [G991R]; c. Login to comment

[hide] Cone and rod loss in Stargardt disease revealed by... JAMA Ophthalmol. 2015 Oct;133(10):1198-203. doi: 10.1001/jamaophthalmol.2015.2443. Song H, Rossi EA, Latchney L, Bessette A, Stone E, Hunter JJ, Williams DR, Chung M
Cone and rod loss in Stargardt disease revealed by adaptive optics scanning light ophthalmoscopy.
JAMA Ophthalmol. 2015 Oct;133(10):1198-203. doi: 10.1001/jamaophthalmol.2015.2443., [PMID:26247787]

Abstract [show]
IMPORTANCE: Stargardt disease (STGD1) is characterized by macular atrophy and flecks in the retinal pigment epithelium. The causative ABCA4 gene encodes a protein localizing to photoreceptor outer segments. The pathologic steps by which ABCA4 mutations lead to clinically detectable retinal pigment epithelium changes remain unclear. We investigated early STGD1 using adaptive optics scanning light ophthalmoscopy. OBSERVATIONS: Adaptive optics scanning light ophthalmoscopy imaging of 2 brothers with early STGD1 and their unaffected parents was compared with conventional imaging. Cone and rod spacing were increased in both patients (P < .001) with a dark cone appearance. No foveal cones were detected in the older brother. In the younger brother, foveal cones were enlarged with low density (peak cone density, 48.3 x 103 cones/mm2). The ratio of cone to rod spacing was increased in both patients, with greater divergence from normal approaching the foveal center, indicating that cone loss predominates centrally and rod loss increases peripherally. Both parents had normal photoreceptor mosaics. Genetic testing revealed 3 disease-causing mutations. CONCLUSIONS AND RELEVANCE: This study provides in vivo images of rods and cones in STGD1. Although the primary clinical features of STGD1 are retinal pigment epithelial lesions, adaptive optics scanning light ophthalmoscopy reveals increased cone and rod spacing in areas that appear normal in conventional images, suggesting that photoreceptor loss precedes clinically detectable retinal pigment epithelial disease in STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 Molecular genetic analysis revealed 3 disease-causing ABCA4 mutations: Gly1961Glu (paternal allele) and Gly863Ala and Arg2030Stop (maternal allele). Login to comment
87 Two of the 3 disease-causing mutations-Gly1961Glu (paternal) and Gly863Ala (maternal)-have been associated with a milder visual acuity and visual field phenotype.9 The additional Arg2030Stop mutation on the maternal allele is uncommon, and its pathogenic contribution has not been well described, but the 2 mutations on the maternal allele were not sufficient to cause disease in the carrier state. Login to comment

[hide] Recessive Stargardt disease phenocopying hydroxych... Graefes Arch Clin Exp Ophthalmol. 2015 Aug 28. Noupuu K, Lee W, Zernant J, Greenstein VC, Tsang S, Allikmets R
Recessive Stargardt disease phenocopying hydroxychloroquine retinopathy.
Graefes Arch Clin Exp Ophthalmol. 2015 Aug 28., [PMID:26311262]

Abstract [show]
PURPOSE: To describe a series of patients with Stargardt disease (STGD1) exhibiting a phenotype usually associated with hydroxychloroquine (HCQ) retinopathy on spectral domain-optical coherence tomography (SD-OCT). METHODS: Observational case series from Columbia University Medical Center involving eight patients with genetically-confirmed STGD1. Patients selected for the study presented no history of HCQ use. Horizontal macular SD-OCT scans and accompanying 488-nm autofluorescence (AF) images, color fundus photographs, and full-field electroretinograms were analyzed. RESULTS: All study patients exhibited an abrupt thinning of the parafoveal region or disruption of the outer retinal layers on SD-OCT resembling the transient HCQ retinopathy phenotype. Funduscopy and AF imaging revealed variations of bull's eye maculopathy (BEM). Five patients exhibited local fleck-like deposits around the lesion. Genetic screening confirmed two disease-causing ABCA4 mutations in five patients and one mutation in three patients. CONCLUSIONS: A transient SD-OCT phenotype ascribed to patients with HCQ retinopathy is associated with an early subtype of STGD1. This finding may also present with HCQ retinopathy-like BEM lesions on AF imaging and funduscopy. A possible phenotypic overlap is unsurprising, given certain shared mechanistic disease processes between the two conditions. A thorough work-up, including screening of genes that are causal in retinal dystrophies associated with foveal sparing, may prevent misdiagnosis of more ambiguous cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 [5461-10T > C] P2 55, F White 20/20 20/20 Mottling + flecks Mottling + flecks p. [A1357V]; [G1961E] P3 57, M African-American 20/20 20/20 BEM + flecks BEM + flecks p. [R2107H] P4 10, F White 20/30 20/25 BEM + flecks BEM + flecks p. [E160*]; [R1108C] P5 26, F African-American 20/30 20/20 Mottling + flecks Mottling + flecks p. [R2107H]; [E526A] P6 19, F Asian-Caucasian 20/25 20/25 BEM BEM p. [R602W] P7 26, M African-Arab 20/20 20/20 BEM BEM p. [R1300*]; [R2106C] P8 25, M White 20/20 20/40 BEM BEM p. [Q1003*]; [G1961E] Abbreviations: M male, F female, BCVA best-corrected visual acuity, OD right eye, OS left eye, BEM bull`s eye maculopathy Fig. 1 Thinning of the parafoveal region with relative foveal sparing presenting as the hydroxychloroquine retinopathy- associated parafoveal outer retina thinning phenotype in patients with recessive Stargardt disease (STGD1). Login to comment

[hide] Predicting Progression of ABCA4-Associated Retinal... Invest Ophthalmol Vis Sci. 2015 Sep;56(10):5946-55. doi: 10.1167/iovs.15-17698. Cideciyan AV, Swider M, Schwartz SB, Stone EM, Jacobson SG
Predicting Progression of ABCA4-Associated Retinal Degenerations Based on Longitudinal Measurements of the Leading Disease Front.
Invest Ophthalmol Vis Sci. 2015 Sep;56(10):5946-55. doi: 10.1167/iovs.15-17698., [PMID:26377081]

Abstract [show]
PURPOSE: To evaluate the progression of the earliest stage of disease in ABCA4-associated retinal degenerations (RDs). METHODS: Near-infrared excited reduced-illuminance autofluorescence imaging was acquired across the retina up to 80 degrees eccentricity in 44 patients with two ABCA4 alleles. The eccentricity of the leading disease front (LDF) corresponding to the earliest stage of disease was measured along the four meridians. A mathematical model describing the expansion of the LDF was developed based on 6 years of longitudinal follow-up. RESULTS: The extent of LDF along the superior, inferior, and temporal meridians showed a wide spectrum from 3.5 to 70 degrees. In patients with longitudinal data, the average centrifugal expansion rate was 2 degrees per year. The nasal extent of LDF between the fovea and ONH ranged from 4.3 to 16.5 degrees and expanded at 0.35 degrees per year. The extent of LDF beyond ONH ranged from 19 to 75 degrees and expanded on average at 2 degrees per year. A mathematical model fit well to the longitudinal data describing the expansion of the LDF. CONCLUSIONS: The eccentricity of the LDF in ABCA4-RD shows a continuum from parafovea to far periphery along all four meridians consistent with a wide spectrum of severity observed clinically. The model of progression may provide a quantitative prediction of the LDF expansion based on the age and eccentricity of the LDF at a baseline visit, and thus contribute significantly to the enrollment of candidates appropriate for clinical trials planning specific interventions, efficacy outcomes, and durations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
153 example, among the 14 patients compound heterozygous for the common G1961E allele (Supplementary Table S1), the model would predict foveal disease in the first decade of life for three alleles (P68L;G1961E, L541P;A1038V, and T1019M), second decade of life for four alleles (R1129L, C54Y, R152Stop, and V256V) and fourth decade of life for four alleles (P1380L, R1640Q, c.5312&#fe;1 G>A, and M669fs). Login to comment

[hide] Complex inheritance of ABCA4 disease: four mutatio... Hum Genet. 2016 Jan;135(1):9-19. doi: 10.1007/s00439-015-1605-y. Epub 2015 Nov 2. Lee W, Xie Y, Zernant J, Yuan B, Bearelly S, Tsang SH, Lupski JR, Allikmets R
Complex inheritance of ABCA4 disease: four mutations in a family with multiple macular phenotypes.
Hum Genet. 2016 Jan;135(1):9-19. doi: 10.1007/s00439-015-1605-y. Epub 2015 Nov 2., [PMID:26527198]

Abstract [show]
Over 800 mutations in the ABCA4 gene cause autosomal recessive Stargardt disease. Due to extensive genetic heterogeneity, observed variant-associated phenotypes can manifest tremendous variability of expression. Furthermore, the high carrier frequency of pathogenic ABCA4 alleles in the general population (~1:20) often results in pseudo-dominant inheritance patterns further complicating the diagnosis and characterization of affected individuals. This study describes a genotype/phenotype analysis of an unusual family with multiple macular disease phenotypes spanning across two generations and segregating four distinct ABCA4 mutant alleles. Complete sequencing of ABCA4 discovered two known missense mutations, p.C54Y and p.G1961E. Array comparative genomic hybridization revealed a large novel deletion combined with a small insertion, c.6148-698_c.6670del/insTGTGCACCTCCCTAG, and complete sequencing of the entire ABCA4 genomic locus uncovered a new deep intronic variant, c.302+68C>T. Patients with the p.G1961E mutation had the mildest, confined maculopathy phenotype with peripheral flecks while those with all other mutant allele combinations exhibited a more advanced stage of generalized retinal and choriocapillaris atrophy. This family epitomizes the clinical and genetic complexity of ABCA4-associated diseases. It contained variants from all classes of mutations, in the coding region, deep intronic, both single nucleotide variants and copy number variants that accounted for varying phenotypes segregating in an apparent dominant fashion. Unequivocally defining disease-associated alleles in the ABCA4 locus requires a multifaceted approach that includes advanced mutation detection methods and a thorough analysis of clinical phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
9 Complete sequencing of ABCA4 discovered two known missense mutations, p.C54Y and p.G1961E. Login to comment
11 Patients with the p.G1961E mutation had the mildest, confined maculopathy phenotype with peripheral flecks while those with all other mutant allele combinations exhibited a more advanced stage of generalized retinal and choriocapillaris atrophy. Login to comment
88 [302+68C>T;4539+2028C>T] I-4 68 Aunt F p.G1961E I-5 67 Aunt (P) F STGD1 c.6148-698_c.6670del/insTGTGCA CCTCCCTAG c. Login to comment
91 [302+68C>T;4539+2028C>T] p.G1961E II-3 37 Cousin M STGD1 c.6148-698_c.6670del/insTGTGCA CCTCCCTAG p.G1961E 1 3 Remarkably, both parents of the proband were also affected with macular diseases; however, with phenotypes usually not associated with ABCA4 mutations. Login to comment
98 Discovery of new diseaseߛassociated variants by nextߛgeneration sequencing Sequencing of the ABCA4 gene and the entire genomic locus in patients II-1 and II-3, at an average depth of coverage of 100&#d7;, identified the disease-associated missense variants, p.C54Y and p.G1961E, respectively. Login to comment
99 Both of these variants are known to cause STGD1, the p.G1961E being the most frequent disease-associated allele (Burke et al. 2012). Login to comment
115 Analysis of regulatory sequences To assess the potential functional effects of the two newly described ABCA4 intronic variants on putative regulatory regions we compared their location against the chromosome coordinates of the DNaseI hypersensitivity and Fig.Êf;3ߒߙThe paternal cousin (36-year-old son of the paternal uncle) harboring the p.G1961E allele and the c.6148-698_c.6670del/insTGTGCACCTCCCTAG variant presented at a comparatively milder disease stage. Login to comment
118 [302+68C>T;4539+2028C>T] Subject Onset (y) Duration (y) BCVA Geographic atrophy Extent of atrophy Fleck distribution Peripapillary sparing ABCA4 mutation OD OS Allele 1 Allele 2 I-3 5 67 CF CF Posterior pole Choriocapillaris Resorbed Partial del/insa intronicb I-5 5 62 CF 20/400 Extra-macular Choriocapillaris Resorbed Partial del/insa intronicb II-1 9 34 20/400 20/200 Macular Choriocapillaris Resorbed/ reticular Spared p.C54Y intronicb II-2 30 10 20/100 20/100 n/a Outer retina Scattered Spared intronicb p.G1961E II-3 30 7 20/150 20/150 n/a Outer retina Scattered Spared del/insa p.G1961E 1 3 transcription factor-binding clusters from ENCODE. Login to comment
161 This is likely due to the p.G1961E mutation shared by II-2 and II-3 on the opposite, maternal allele, which has been previously associated with a late-onset, milder disease phenotype characterized by more localized disease confined to the central macula (Burke et al. 2012; Cella et al. 2009). Login to comment
162 This apparent resistance to disease severity conferred by p.G1961E is clearly exemplified in this family; this could potentially be attributed to G1961E representing a hypomorphic allele, although its precise mechanism remains to be elucidated (Allikmets 2000; Lewis et al. 1999). Login to comment

[hide] Quantitative Fundus Autofluorescence and Optical C... Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7274-85. doi: 10.1167/iovs.15-17371. Duncker T, Stein GE, Lee W, Tsang SH, Zernant J, Bearelly S, Hood DC, Greenstein VC, Delori FC, Allikmets R, Sparrow JR
Quantitative Fundus Autofluorescence and Optical Coherence Tomography in ABCA4 Carriers.
Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7274-85. doi: 10.1167/iovs.15-17371., [PMID:26551331]

Abstract [show]
PURPOSE: To assess whether carriers of ABCA4 mutations have increased RPE lipofuscin levels based on quantitative fundus autofluorescence (qAF) and whether spectral-domain optical coherence tomography (SD-OCT) reveals structural abnormalities in this cohort. METHODS: Seventy-five individuals who are heterozygous for ABCA4 mutations (mean age, 47.3 years; range, 9-82 years) were recruited as family members of affected patients from 46 unrelated families. For comparison, 57 affected family members with biallelic ABCA4 mutations (mean age, 23.4 years; range, 6-67 years) and two noncarrier siblings were also enrolled. Autofluorescence images (30 degrees , 488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference. The gray levels (GLs) of each image were calibrated to the reference, zero GL, magnification, and normative optical media density to yield qAF. Horizontal SD-OCT scans through the fovea were obtained and the thicknesses of the outer retinal layers were measured. RESULTS: In 60 of 65 carriers of ABCA4 mutations (age range, 9-60), qAF levels were within normal limits (95% confidence level) observed for healthy noncarrier subjects, while qAF levels of affected family members were significantly increased. Perifoveal fleck-like abnormalities were observed in fundus AF images in four carriers, and corresponding changes were detected in the outer retinal layers in SD-OCT scans. Thicknesses of the outer retinal layers were within the normal range. CONCLUSIONS: With few exceptions, individuals heterozygous for ABCA4 mutations and between the ages of 9 and 60 years do not present with elevated qAF. In a small number of carriers, perifoveal fleck-like changes were visible.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 [L541P;A1038V] 0.10 0.10 OS n/a 141 S2.2 F 44.4 Indian Mother c.6729&#fe;5_&#fe;19del 0.10 0.00 OS 257 291 S2.3 M 56.2 Indian Father p.G1961E 0.00 0.00 OD 475 431 S3.4 F 54.1 White Mother p.G863A 0.00 0.00 OS 459 451 S3.5 F 82.0 White Grandmother p.G863A 0.00 0.00 OD n/a n/a S4.2 F 44.6 White Mother p.W855* 0.00 0.00 OD 330 n/a S4.3 M 40.9 White Father p.T1526M 0.00 0.00 OS 283 271 S5.2 F 71.5 White Sister p.C698Y 0.00 0.10 OD n/a n/a S5.3 F 67.5 White Sister c.2160&#fe;1G>C 0.00 0.00 OS n/a n/a S5.4 F 62.9 White Sister p.C698Y 0.00 0.00 OD n/a n/a S6.2 M 54.9 Black Brother p.T1526M 0.10 0.00 OS 477 423 S7.2 F 48.9 White Mother c.5196&#fe;1G>A 0.00 0.00 OS 443 415 S8.2 F 59.6 White Mother p.K346T 0.00 0.00 OD 546 483 S8.3 M 54.6 White Father p.T1117I 0.10 0.10 OD 289 n/a S9.2 F 51.5 White Mother c.5196&#fe;1137G>A 0.00 0.00 n/a 302 n/a S9.3 M 57.8 White Father p.C54Y 0.00 0.00 OS 419 375 S10.2 M 24.1 Indian Brother p.Q2220* 0.00 0.00 OD 227 227 S11.2 F 40.0 Asian Mother c.5923del 0.00 0.18 OD 229 191 S11.3 M 40.1 Asian Father p.R408* 0.00 0.00 OD 195 178 S12.2 F 53.2 White Mother p.L2027F 0.00 0.00 n/a 355 309 S13.2 F 49.8 White Mother p.R1161S 0.00 0.00 OS 367 372 S13.3 M 22.3 White Brother p.R1161S 0.00 0.00 OD 202 206 S14.2 F 67.0 White Mother p.P1380L 0.00 0.00 OD n/a n/a S14.3 F 24.4 White Sister p.P1380L 0.00 0.00 OS n/a 163 S15.3 F 26.8 White Sister c.3050&#fe;5G>A 0.00 0.00 n/a 293 281 S16.2 M 53.7 Black Father c.4253&#fe;5G>T 0.00 0.00 n/a n/a 204 S17.2 F 60.0 Hispanic Mother p.A1038V 0.00 0.00 n/a 247 n/a S18.2 F 41.8 Indian Father c.5917del 0.00 0.00 OD n/a 194 S18.3 M 48.6 Indian Mother c.859-9T>C 0.00 0.00 OD 253 215 S18.4 F 12.9 Indian Sister c.5917del 0.00 0.00 OD 84 93 S19.4 F 58.5 White Mother p.L2027F 0.00 0.00 OD 205 n/a S19.5 M 61.6 White Father p.G851D 0.10 0.10 OD n/a n/a S20.2 F 41.5 White Mother c.5312&#fe;1G>A 0.00 0.00 n/a 335 351 S20.3 M 39.0 White Father p.R2030* 0.00 0.10 n/a 442 n/a S21.3 F 53.1 White Mother p.G1961E 0.00 0.00 OD 490 488 S22.3 M 46.3 White Father p.L2027F 0.00 0.00 OS 386 376 S22.4 F 47.1 White Mother p. Login to comment
29 [L541P;A1038V] 0.00 0.00 OS 342 326 S23.2 F 37.4 White Sister p.G1961E 0.00 0.00 OS 220 n/a S24.2 F 37.5 White Daughter c.247_250dup 0.00 0.00 OD 298 288 S25.3 F 49.9 Black Mother p.R2107H 0.88 0.10 n/a n/a 385 S26.3 F 58.2 White Mother p.G1961E 0.00 0.00 OD 238 297 S26.4 M 57.2 White Father p. Login to comment
31 [L541P;A1038V] 0.10 0.00 OS 174 143 S27.2 F 46.2 White Mother p.P1380L 0.00 0.10 OD 379 320 S27.3 M 47.3 White Father p.G1961E 0.00 0.00 OD 413 384 S27.4 F 17.4 White Sister p.P1380L 0.00 0.00 OS 184 189 S28.2 F 58.9 White Mother p. Login to comment
34 [W1408R;R1640W] 0.00 0.00 n/a n/a 336 S33.2 F 46.5 White Mother p.G1961E 0.00 0.00 OD 422 n/a S33.3 M 48.0 White Father p.R2030Q 0.00 0.00 OD 298 n/a S34.2 M 50.3 White Brother p.G1961E 0.00 0.48 n/a 394 368 S35.2 F 55.7 White Mother p.G1961E 0.00 0.00 OS 328 362 S35.3 M 57.4 White Father c.3050&#fe;5G>A 0.00 0.00 OD n/a 265 S36.2 F 59.4 Hispanic Mother p.G1961E 0.00 0.00 OS 380 374 S37.2 F 55.1 White Mother p.G1961E 0.00 0.00 n/a n/a 352 S38.2 F 48.9 White Mother p.W821R 0.00 0.00 OD 252 279 tion in psychophysical and electrophysiological tests,21 and may demonstrate moderate to severe fundus changes.17,22 The increased accumulation of lipofuscin in the RPE of patients with biallelic mutations in ABCA4 has been documented by histology,9 by spectrofluorometry,23 and more recently by quantitative autofluorescence (qAF).24 It is still unknown, however, whether individuals heterozygous for ABCA4 mutations also have elevated lipofuscin levels due to reduced ABCA4 activity. Login to comment
62 Continued Subject Sex Age Race/ Ethnicity Relationship to Proband ABCA4 Mutation BCVA, logMAR Eye Segmented qAF8 OD OS OD OS S38.3 M 50.9 White Father p.C2150Y 0.00 0.00 OS 336 380 S39.3 F 42.5 White Mother c.5714&#fe;5G>A 0.00 0.00 n/a 462 393 S39.4 F 18.4 White Sister c.5714&#fe;5G>A 0.00 0.00 n/a 222 212 S40.2 F 50.1 White Mother p.R2030Q 0.00 0.00 OD 433 n/a S40.3 M 48.8 White Father p.K1547* 0.00 0.00 OS n/a 477 S41.2 F 60.3 White Mother p.C54Y 0.00 0.00 OS n/a n/a S42.2 F 44.5 White Mother p.Q1412* 0.10 0.00 OS 264 291 S42.3 M 44.2 White Father p.R1108C 0.30 0.18 OD 264 232 S43.2 F 44.9 White Mother p.G1961E 0.00 0.00 OS 404 n/a S44.3 M 37.1 Asian Father c.4248_4250del 0.00 0.00 OD 307 317 S45.2 F 66.3 White Mother p.N965Y 0.18 0.40 n/a n/a n/a S45.3 M 68.0 White Father p.P1486L 0.00 0.00 n/a n/a n/a S46 M 32.3 White Spouseߤ p.T897I 0.12 0.12 OD 194 200 BCVA, best-corrected visual acuity; logMAR, logarithm of the minimum angle of resolution; OD, right eye; OS, left eye; qAF8, average quantitative autofluorescence of the 8 measurement sites from all available images per eye; n/a, not available. Login to comment
67 [L541P;A1038V] c.768&#fe;358C>T 0.30 0.18 n/a 413 P 2.1ߤ M 17.9 Indian p.G1961E c.6729&#fe;5_&#fe;19del 0.70 0.88 340 363 P 3.1&#a7; F 25.1 White p.G863A c.5898&#fe;1G>A 0.80 0.80 710 675 P 3.2ߤ F 18.9 White p.G863A c.5898&#fe;1G>A 0.00 0.00 465 431 P 3.3 F 24.4 White p.G863A c.5898&#fe;1G>A 0.18 0.00 507 467 P 4.1 M 9.0 White p.W855* p.T1526M 1.00 1.00 538 n/a P 5.1 F 67.0 White p.C54Y c.2160&#fe;1G>C CF HM n/a n/a P 6.1 M 46.0 Black p.T1526M 0.30 0.80 n/a n/a P 7.1 F 25.3 White c.5196&#fe;1G>A p.S2235P 1.00 1.30 420 317 P 8.1 M 17.0 White p.K346T p.T1117I 1.30 0.70 871 828 P 9.1 M 21.5 White p.C54Y c.5196&#fe;1137G>A 0.18 0.18 609 608 P 10.1 M 31.0 Indian c. Login to comment
68 [66G>A;859-9T>C] p.Q2220* CF 1.30 n/a n/a P 11.1 M 15.0 Asian p.R408* c.5935del 1.10 1.30 n/a n/a P 12.1&#a7; M 15.1 White p.L2027F p.R2077W 0.80 0.80 728 697 P 13.1&#a7; F 23.8 White p.R1161S 0.60 0.40 571 647 P 14.1&#a7; F 27.3 White p.P1380L p.P1380L 1.30 1.00 n/a 577 P 15.1 M 17.0 White p.G1961E c.3050&#fe;5G>A 0.88 0.88 n/a n/a P 15.2 F 22.0 White p.G1961E c.3050&#fe;5G>A 0.88 0.88 n/a n/a P 16.1 F 19.1 Black p.V989A c.4253&#fe;5G>T 0.30 0.40 97 n/a P 17.1 F 21.8 Hispanic p.A1038V p.G1441D 0.70 0.88 551 528 P 18.1 M 22.0 Indian c.859-9T>C c.5917del 0.88 0.88 527 n/a P 19.1&#a7; F 27.2 White p.G851D p.L2027F 0.88 0.88 448 459 P 19.2&#a7; F 29.2 White p.G851D p.L2027F 1.30 1.18 538 569 P 19.3 F 34.2 White p.G851D p.L2027F 1.00 1.30 442 n/a P 20.1 F 9.5 White c.5312&#fe;1G>A p.R2030* 0.88 0.70 998 929 P 21.1ߤ F 24.6 White p.N96D p.G1961E 0.30 0.18 513 549 P 21.2ߤ F 20.9 White p.N96D p.G1961E 0.30 0.40 397 355 P 22.1 M 8.0 White p. Login to comment
70 [L541P;A1038V] p.L2027F 0.30 0.40 591 608 P 23.1ߤ F 26.0 White p.G1961E c.5196&#fe;1056A>G 0.40 0.70 379 344 P 24.1 F 52.0 White c.247_250dup 0.80 0.00 n/a n/a P 25.1 F 26.0 Black p.E526A p.R2107H 0.48 0.00 507 536 P 25.2 F 25.9 Black p.E526A p.R2107H 0.18 0.00 461 468 P 26.1&#a7; F 25.6 White p. Login to comment
71 [L541P;A1038V] p.G1961E 0.60 0.60 n/a 398 P 26.2 F 19.7 White p. Login to comment
72 [L541P;A1038V] p.G1961E 0.60 0.54 320 307 P 27.1&#a7; F 18.8 White p.P1380L p.G1961E 0.60 0.70 368 n/a P 28.1&#a7; F 22.9 White p. Login to comment
75 [W1408R;R1640W] 1.00 1.00 n/a n/a P 33.1&#a7; M 23.0 White p.R2030Q p.G1961E 1.00 1.00 334 347 P 34.1 M 46.9 White p.C1490Y p.G1961E 0.40 0.30 376 384 P 35.1ߥ M 24.8 White c.3050&#fe;5G>A p.G1961E 0.00 0.00 381 451 P 36.1ߥ F 29.3 Hispanic p.L541P p.G1961E 0.40 0.40 479 487 P 37.1ߤ F 24.7 White p.G1961E p.C2150R 0.88 0.88 405 396 P 38.1&#a7; M 11.7 White p.W821R p.C2150Y 0.40 0.40 306 n/a P 39.1 F 12.8 White p.P1380L c.5714&#fe;5G>A 0.60 0.40 558 573 P 39.2 M 14.1 White p.P1380L c.5714&#fe;5G>A 0.88 0.88 395 462 P 40.1ߤ F 16.2 White p.K1547* p.R2030Q 0.70 0.40 481 513 P 41.1 F 19.0 White p.C54Y 0.88 0.88 n/a n/a P 42.1ߤ F 13.0 White p.R1108C p.Q1412* 1.30 1.00 511 528 P 43.1ߤ M 17.4 White p.A1773V p.G1961E 0.88 0.88 340 366 P 44.1 M 14.0 Asian p.R408* c.4248_4250del 1.30 1.30 n/a n/a P 44.2 F 7.0 Asian p.R408* c.4248_4250del 1.30 1.30 n/a n/a P 45.1 F 42.4 White p.N965Y p.P1486L 0.10 0.40 n/a n/a BCVA, best-corrected visual acuity; logMAR, logarithm of the minimum angle of resolution; OD, right eye; OS, left eye; qAF8, average quantitative autofluorescence of the 8 measurement sites from all available images per eye; n/a, not available. Login to comment
110 The following ABCA4 mutations were frequently present in our cohort: p.G1961E in 11 carriers, p. Login to comment
123 Quantitative autofluorescence intensities associated with 4 common ABCA4 mutations: p.G1961E, p.P1380L, p. Login to comment
136 We previously demonstrated that STGD1 patients carrying the p.G1961E mutation on one allele have relatively lower qAF8 levels compared to patients with p. Login to comment
137 [L541P; A1038V], p.P1380L, and p.L2027F mutations (and no p.G1961E mutation on the other allele).24 To determine whether similar differences in the segregation of qAF8 levels could also be observed for ABCA4 mutations in carriers and whether specific ABCA4 mutations may be associated with higher qAF8 levels, we plotted qAF values for carriers and affected patients who carried one of the four most common mutations (p.G1961E, p. Login to comment
145 Color-coded maps of quantitative fundus autofluorescence and inheritance patterns of families carrying ABCA4 mutations p.P1380L (family 39) p.G1961E; p. Login to comment
147 [L541P; A1038V] (family 1), and p.G1961E; p.P1380L (family 27). Login to comment
162 In Figure 8, the segmentation profiles of carriers expressing the most common mutations, p.G1961E, p. Login to comment
170 [L541P; A1038V] conferred a faster rate of lipofuscin accumulation, whereas accumulation in the presence of the p.G1961E and p.G851D mutations was slower. Login to comment
185 Several years ago a case-control study of unrelated subjects with AMD identified heterozygous ABCA4 mutations in a subgroup of AMD cases; six of these patients harbored the p.G1961E mutation.18 A follow-up study detected the p.G1961E variant statistically significantly more frequently in AMD cases than in matched controls.36 The p.G1961E mutation is exceptional in that STGD1 patients homozygous for the mutation or compound FIGURE 7. Login to comment
191 heterozygous for p.G1961E and another disease-associated allele exhibit qAF levels (measured 78-98 from fovea) that are either within the normal range or modestly higher (Fig. 4).24 These observations with respect to G1961E are consistent with an earlier study wherein most patients with this mutation did not present with a dark choroid during fundus angiography.37 The dark choroid is thought to be conferred by high lipofuscin levels. Login to comment
192 Thus since STGD1 patients expressing the G1961E mutation have relatively normal qAF intensities, the finding that carriers of a G1961E mutation also do not exhibit elevated qAF is not informative with respect to the burden of disease. Login to comment
196 Thickness profiles acquired by segmentation of spectral-domain optical coherence tomography (SD-OCT) images of carriers of ABCA4 mutations p.G1961E, p.L541P/A1038V, p.P1380L, and p.L2027F. Login to comment
298 Zhang R, Wang LY, Wang YF, et al. Associations of the G1961E and D2177N variants in ABCA4 and the risk of age-related macular degeneration. Login to comment

[hide] Cerebral Involvement in Stargardt's Disease: A VBM... Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7388-97. doi: 10.1167/iovs.15-16899. Gaia O, Melillo P, Sirio C, D'Alterio FM, Prinster A, Testa F, Brunetti A, Simonelli F, Quarantelli M
Cerebral Involvement in Stargardt's Disease: A VBM and TBSS Study.
Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7388-97. doi: 10.1167/iovs.15-16899., [PMID:26574798]

Abstract [show]
PURPOSE: To assess whether and to what extent macro- and/or microstructural modifications are present in the brain of patients with selective central visual loss due to a juvenile macular degeneration, Stargardt's disease (STGD), taking advantage of the complementary information provided by voxel-based morphometry (VBM) and diffusion tensor imaging (DTI). METHODS: Eighteen patients with clinical and molecular diagnosis of STGD related to ABCA4 mutations and 23 normally sighted volunteers of comparable age and sex were enrolled. Structural T1-weighted (T1w) volumes, for brain tissue volume assessment by segmentation, and DTI, for the investigation of diffusivity parameters via a tract-based spatial statistics (TBSS) procedure, were acquired at 3 Tesla in all subjects. All patients underwent a complete ophthalmologic examination, including best-corrected visual acuity (BCVA), biomicroscopy, ophthalmoscopy, electroretinography (ERG), microperimetry, and optical coherence tomography (OCT). Correlations between imaging data and clinical measures were tested. RESULTS: Stargardt's disease patients showed a significant gray matter (GM) loss bilaterally in the occipital cortices, extending into the right precuneus, and in the fronto-orbital cortices. At TBSS, significant reductions in fractional anisotropy were detected throughout large regions in the supratentorial white matter (WM), more pronounced in the posterior areas. Gray matter volume correlated directly with mean visual sensitivity in the right middle frontal and left calcarine gyri, and inversely with retinal thickness in the left supramarginal gyrus. CONCLUSIONS: In STGD, widespread microstructural WM alterations are present, suggestive of minor fiber loss coupled with GM loss, also in cortical regions not traditionally linked to visual pathways, at least partly related to the retinal damage.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Demographic and Genetic Data of STGD Patients Age Sex ABCR Mutations Age of Onset 19 F 250insCAAA G1961E D498N 4017ins24bp 11 18 M L541P/A1038V IVS40&#fe;5g->a 14 25 M L541P/A1038V G1961E 17 15 F G1961E R2149X 13 48 M N96D IVS40&#fe;5G>A 38 29 M G1961E L1938L L1894L S1689P 25 23 F L541P/A1038V F655C 14 33 M R152Q G1961E 402ins24bp 18 21 M A60V G1961E 15 23 M G690V A1598D 11 27 M G1961E R2149X 11 51 F V615A G1961E 25 54 M N96D N1436I 28 21 M 250insCAAA P402A 13 25 F R1448K c.5018&#fe;2T>C 21 49 M 4538insC IVS40&#fe;5G>A 18 23 F G1961E c.6282&#fe;1G>C 18 46 M N96D N1436I 30 T ABLE 4. Login to comment

[hide] Next-generation sequencing of ABCA4: High frequenc... Exp Eye Res. 2015 Nov 22;145:93-99. doi: 10.1016/j.exer.2015.11.011. Sciezynska A, Ozieblo D, Ambroziak AM, Korwin M, Szulborski K, Krawczynski M, Stawinski P, Szaflik J, Szaflik JP, Ploski R, Oldak M
Next-generation sequencing of ABCA4: High frequency of complex alleles and novel mutations in patients with retinal dystrophies from Central Europe.
Exp Eye Res. 2015 Nov 22;145:93-99. doi: 10.1016/j.exer.2015.11.011., [PMID:26593885]

Abstract [show]
Variation in the ABCA4 locus has emerged as the most prevalent cause of monogenic retinal diseases. The study aimed to discover causative ABCA4 mutations in a large but not previously investigated cohort with ABCA4-related diseases originating from Central Europe and to refine the genetic relevance of all identified variants based on population evidence. Comprehensive clinical studies were performed to identify patients with Stargardt disease (STGD, n = 76) and cone-rod dystrophy (CRD, n = 16). Next-generation sequencing targeting ABCA4 was applied for a widespread screening of the gene. The results were analyzed in the context of exome data from a corresponding population (n = 594) and other large genomic databases. Our data disprove the pathogenic status of p.V552I and provide more evidence against a causal role of four further ABCA4 variants as drivers of the phenotype under a recessive paradigm. The study identifies 12 novel potentially pathogenic mutations (four of them recurrent) and a novel complex allele p.[(R152*; V2050L)]. In one third (31/92) of our cohort we detected the p.[(L541P; A1038V)] complex allele, which represents an unusually high level of genetic homogeneity for ABCA4-related diseases. Causative ABCA4 mutations account for 79% of STGD and 31% of CRD cases. A combination of p.[(L541P; A1038V)] and/or a truncating ABCA4 mutation always resulted in an early disease onset. Identification of ABCA4 retinopathies provides a specific molecular diagnosis and justifies a prompt introduction of simple precautions that may slow disease progression. The comprehensive, population-specific study expands our knowledge on the genetic landscape of retinal diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 The third ABCA4 complex allele contained the previously reported p.T1253M present in cis with p.G1961E (Paloma et al., 2001). Login to comment
101 [(T1253M; G1961E)] complex allele, the p.G1961E mutation was identified in 21 other unrelated probands, which makes it the second most frequent disease-causing ABCA4 change in our patients. Login to comment
151 [(T1253M; G1961E)] (1/184) x x ZGM: exome data for the Polish population; The number of mutant and total alleles detected is given in brackets; x e no ABCA4 diseases-associated variant detected. Login to comment
202 One of the major ABCA4 mutations identified among patients from different population is the p.G1961E (Cella et al., 2009) that was found in Slovenian (Jaakson et al., 2003), Italian (Fumagalli et al., 2001; Jaakson et al., 2003), German (Rivera et al., 2000), Dutch (Jaakson et al., 2003) and Spanish (Valverde et al., 2006) patients with an allele frequency ranging from 21% to 6.5%, respectively. Login to comment
203 The frequency of the p.G1961E-carrying allele, the second most common mutation in Polish patients (12.5%), fits almost exactly in the middle of the range. Login to comment
209 As it is clearly not the case, among the most frequent ABCA4 mutations are p.G1961E and p. Login to comment