ABCMdb

ABCA4 p.Arg2107His

ClinVar:	c.6320G>A , p.Arg2107His ? , Uncertain significance c.6320G>C , p.Arg2107Pro ? , not provided
Predicted by SNAP2:	A: D (66%), C: D (75%), D: D (71%), E: D (71%), F: D (71%), G: D (71%), H: D (91%), I: D (63%), K: N (61%), L: D (66%), M: D (66%), N: D (53%), P: D (95%), Q: D (59%), S: D (80%), T: N (53%), V: D (66%), W: D (80%), Y: D (66%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Spectrum of ABCR gene mutations in autosomal reces... Eur J Hum Genet. 1998 May-Jun;6(3):291-5. Rozet JM, Gerber S, Souied E, Perrault I, Chatelin S, Ghazi I, Leowski C, Dufier JL, Munnich A, Kaplan J
Spectrum of ABCR gene mutations in autosomal recessive macular dystrophies.
Eur J Hum Genet. 1998 May-Jun;6(3):291-5., [PMID:9781034]

Abstract [show]
Stargardt disease (STGD) and late-onset fundus flavimaculatus (FFM) are autosomal recessive conditions leading to macular degenerations in childhood and adulthood, respectively. Recently, mutations of the photoreceptor cell-specific ATP binding transporter gene (ABCR) have been reported in Stargardt disease. Here, we report on the screening of the whole coding sequence of the ABCR gene in 40 unrelated STGD and 15 FFM families and we show that mutations truncating the ABCR protein consistently led to STGD. Conversely, all mutations identified in FFM were missense mutations affecting uncharged amino acids. These results provide the first genotype-phenotype correlations in ABCR gene mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 Furthermore, all ABCR missense mutations Table 1 Mutations in the ABCR gene in STGD and FFM families Conserved aa in: Nucleotide change Amino acid change Domain ABCs RmP Phenotype Families Comment (571-2)A®G splicing mutation STGD 1 HAD1 (1938-2)A®G splicing mutation STGD 1 (4668+2)T®C splicing mutation STGD 1 (4735+2)T®A splicing mutation STGD 1 del(5196+1-5196+6 splicing mutation STGD 1 LOZ2 2570 delT frameshift mutation STGD 1 3209insGT frameshift mutation STGD 2 CHE2 G3754T E1252X STGD 1 C3994T Q1332X STGD 1 C6337G I2113X STGD 1 JEG2 C52T R18W IC - + STGD 1 C634T R212C EC - + STGD 5 GEN2, JEG2 G1908T Q636H IC - + STGD 1 LOZ2 C3056T T1019M IC - + STGD 1 C3322T R1107C IC - + STGD 1 JUL2 C4916T R1640W IC + + STGD 2 MAR1 G5929A G1977S ATP2 + + STGD 1 GEN2 G6320A R2107H IC + + STGD 1 JUL2 C3114T A1038V IC - + STGD 2 CHE2 +FFM +1 VII2 T1622C L541P EC - + FFM 1 VII2 T31C L11P IC + + FFM 1 G3272A G1090E IC + + FFM 1 G4522T G1508C IC + + FFM 1 C5908T L1970F IC + + FFM 1 GON2 T5912G L1971R IC + + FFM 1 GON2 Mutations refer to the standard nomenclature. Login to comment

[hide] Stargardt macular dystrophy: common ABCA4 mutation... Mol Vis. 2012;18:280-9. Epub 2012 Feb 1. Roberts LJ, Nossek CA, Greenberg LJ, Ramesar RS
Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients.
Mol Vis. 2012;18:280-9. Epub 2012 Feb 1., [PMID:22328824]

Abstract [show]
PURPOSE: Based on the previous indications of founder ATP-binding cassette sub-family A member 4 gene (ABCA4) mutations in a South African subpopulation, the purpose was to devise a mechanism for identifying common disease-causing mutations in subjects with ABCA4-associated retinopathies (AARs). Facilitating patient access to this data and determining the frequencies of the mutations in the South African population would enhance the current molecular diagnostic service offered. METHODS: The majority of subjects in this study were of Caucasian ancestry and affected with Stargardt macular dystrophy. The initial cohort consisted of DNA samples from 181 patients, and was screened using the ABCR400 chip. An assay was then designed to screen a secondary cohort of 72 patients for seven of the most commonly occurring ABCA4 mutations in this population. A total of 269 control individuals were also screened for the seven ABCA4 mutations. RESULTS: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. The newly designed genetic assay identified two of the seven disease-associated mutations in 28/72 patients in a secondary patient cohort. In the control cohort, 12/269 individuals were found to be heterozygotes, resulting in an estimated background frequency of these mutations in this particular population of 4.46 per 100 individuals. CONCLUSIONS: The relatively high detection rate of seven ABCA4 mutations in the primary patient cohort led to the design and subsequent utility of a multiplex assay. This assay can be used as a viable screening tool and to reduce costs and laboratory time. The estimated background frequency of the seven ABCA4 mutations, together with the improved diagnostic service, could be used by counselors to facilitate clinical and genetic management of South African families with AARs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment

[hide] Analysis of autofluorescent retinal images and mea... Exp Eye Res. 2010 Aug;91(2):143-52. Epub 2010 Apr 14. Chen B, Tosha C, Gorin MB, Nusinowitz S
Analysis of autofluorescent retinal images and measurement of atrophic lesion growth in Stargardt disease.
Exp Eye Res. 2010 Aug;91(2):143-52. Epub 2010 Apr 14., [PMID:20398653]

Abstract [show]
Current retinal imaging techniques using scanning laser ophthalmoscopy (SLO) provide a powerful mechanism for characterizing the topographical distribution of lipofuscin fluorophores and atrophic lesions (ALs) in retinal disease. In this paper we describe a novel Edge-Flow-Driven Variational Image Segmentation analysis to measure and evaluate progressive change in the area of ALs as well as regions of hyperfluorescence (HF). The algorithm is embedded in a series of almost completely automated image processing steps that allow rapid comparison of serial images. The sensitivity of the methodology to detect change was evaluated by measuring progression of AF lesion size in a cohort of Stargardt Macular Dystrophy (STGD) patients. Fifty-two STGD subjects (mean age = 41.0 +/- 16.6 years, range 9-78 yrs) at varying stages of disease participated in this prospective study. Twenty-four of the 52 subjects presented with atrophic lesions in one or both eyes on first evaluation. For this subgroup of subjects, the mean (+/-1 sd) follow-up time was 2.92 (+0.26) years (range 0.57-3.26 years) and the mean (+/-1 sd) rate of change was found to be approximately 0.94 (+/-0.87) mm(2)/year (range 0.2-2.13 mm(2)/yr). With this methodology, progressive enlargement of AL area was detectable in as little as one year, while regions of HF generally decreased, although there was considerable variability in the appearnce of HF, presumably reflecting the combined effects of the creation or expansion of lipofuscin deposits and resorption and loss associated with retinal cell death. Our findings suggest that this methodology is sufficiently sensitive to detect change and provides a clinically relevant tool to monitor progression not only with regards to natural history, but also to evaluate the efficacy of potential therapeutic interventions in STGD. Finally, we evaluated the association between AL area and measures of rod- and cone-mediated retinal function, as assessed with electroretinography (ERG). In general, the larger the AL, the poorer the ERG response, with a greater impact of lesion size on cone- rather than rod-mediated retinal function, a finding that was expected on the basis of the location and size of the AL and the distribution of rod- and cone-photoreceptors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,þ1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, þ5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 þ 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND ¼ not done. Login to comment
81 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,&#fe;1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, &#fe;5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 &#fe; 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND &#bc; not done. Login to comment

[hide] The role of the photoreceptor ABC transporter ABCA... Biochim Biophys Acta. 2009 Jul;1791(7):573-83. Epub 2009 Feb 20. Molday RS, Zhong M, Quazi F
The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration.
Biochim Biophys Acta. 2009 Jul;1791(7):573-83. Epub 2009 Feb 20., [PMID:19230850]

Abstract [show]
ABCA4 is a member of the ABCA subfamily of ATP binding cassette (ABC) transporters that is expressed in rod and cone photoreceptors of the vertebrate retina. ABCA4, also known as the Rim protein and ABCR, is a large 2,273 amino acid glycoprotein organized as two tandem halves, each containing a single membrane spanning segment followed sequentially by a large exocytoplasmic domain, a multispanning membrane domain and a nucleotide binding domain. Over 500 mutations in the gene encoding ABCA4 are associated with a spectrum of related autosomal recessive retinal degenerative diseases including Stargardt macular degeneration, cone-rod dystrophy and a subset of retinitis pigmentosa. Biochemical studies on the purified ABCA4 together with analysis of abca4 knockout mice and patients with Stargardt disease have implicated ABCA4 as a retinylidene-phosphatidylethanolamine transporter that facilitates the removal of potentially reactive retinal derivatives from photoreceptors following photoexcitation. Knowledge of the genetic and molecular basis for ABCA4 related retinal degenerative diseases is being used to develop rationale therapeutic treatments for this set of disorders.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
134 Disease mutations, which are substituted in Stargardt disease, are shown in red italics - NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C); NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment
225 A subset of missense mutations reside in NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C, R1129L) and NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment

[hide] Lipofuscin- and melanin-related fundus autofluores... Am J Ophthalmol. 2009 May;147(5):895-902, 902.e1. Epub 2009 Feb 25. Kellner S, Kellner U, Weber BH, Fiebig B, Weinitz S, Ruether K
Lipofuscin- and melanin-related fundus autofluorescence in patients with ABCA4-associated retinal dystrophies.
Am J Ophthalmol. 2009 May;147(5):895-902, 902.e1. Epub 2009 Feb 25., [PMID:19243736]

Abstract [show]
PURPOSE: To compare melanin-related near-infrared fundus autofluorescence (NIA; excitation 787 nm, emission > 800 nm) to lipofuscin-related fundus autofluorescence (FAF; excitation 488 nm, emission > 500 nm) in patients with retinal dystrophies associated with ABCA4 gene mutations (ABCA4-RD). DESIGN: Observational case series. METHODS: Sixteen consecutive patients with ABCA4-RD diagnosed in one institution were included. FAF and NIA imaging were performed with a confocal scanning laser ophthalmoscope (Heidelberg Retina Angiograph 2; Heidelberg Engineering, Heidelberg, Germany). The pattern and size of retinal pigment epithelial (RPE) alterations detected with FAF and NIA were evaluated. RESULTS: FAF and NIA alterations were detected in all patients. In 7 of 16 patients, the alterations progressed beyond the vascular arcades, and in 9 of 16, they were confined to the macula. Spots of increased NIA (4/16) were less frequent compared with spots of increased FAF (15/16). Confluent patches of reduced NIA were frequent (12/16), and severely reduced NIA was observed in 3 cases. Areas with reduced NIA corresponded to either increased or reduced FAF. Preservation of subfoveal FAF or NIA corresponded to visual acuity > or = 0.4. Abnormalities detected with NIA were more extensive or more severe compared to FAF in 15 of 16 patients. CONCLUSION: Patterns of FAF and NIA indicate different involvement of lipofuscin and melanin and their derivates in the pathophysiologic process of ABCA4-RD. NIA imaging provides a noninvasive in vivo visualization of RPE abnormalities that may precede FAF alterations during the degenerative process. Combined FAF and NIA imaging will provide further insight in the development of ABCA4-RD and could help to monitor future therapeutic interventions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Age Gender ABCA4 Mutation VA RE/LE Full-field ERG Multifocal ERG Group 1a CRD 2808 34 F c.5413AϾG (p.Asn1805Asp) c.4880_4903dup24 (p.Leu1627_Ala1634dup) 0.05 0.05 DA and LA markedly reduced No recordable potentials CRD 2830 53 F c.2690CϾT (p.Thr897Ile), c.6176GϾC (p.Gly2059Ala) 0.5 0.7 DA and LA moderately reduced Pericentral amplitude reduction CRD 2797 54 M c.4297GϾA (p.Val1433Ile) 2. mutation not foundc 0.1 0.16 DA and LA moderately reduced Not done SD 2872 44 F c.4462TϾC (p.Cys1488Arg) 2. mutation not done 0.6 0.7 DA and LA borderline Central amplitude reduction CRD 2861 72 F c.122GϾA (p.Trp41Ter) 2. mutation not done 0.4 0.5 DA: mildly and LA: moderately reduced Central amplitude reduction CRD 2644 67 F c.634CϾT (p.Arg212Cys), c.656GϾC (p.Arg219Thr), c.2588GϾC (p.Gly863Ala/ delGly863) 0.6 0.04 DA and LA moderately reduced Central amplitude reduction CRD 2936 44 F c.1622TϾC (p.Leu541Pro)/ c.3113CϾT (p.Ala1038Val), 2. mutation not done 1.0 1.0 DA: mildly and LA: moderately reduced Pericentral amplitude reduction Group 2b SD 2837 42 M c.1622TϾC (p.Leu541Pro)/ c.3113CϾT (p.Ala1038Val), c.5882GϾA (p.Gly1961Glu) 0.16 0.16 Normal Central amplitude reduction SD 2780 37 M c.768GϾT (splice mutation) c.5882GϾA (p.Gly1961Glu) 0.1 0.1 Normal Central amplitude reduction SD 2942 47 F c.1622TϾC (p.Leu541Pro) c.6320 GϾA (p.Arg2107His) 0.1 0.16 Not done Central amplitude reduction SD 2930 40 F c.6089GϾA (p.Arg2030Gln) c.6543del36bp, (p.Leu2182_Phe2193del) 0.1 0.1 DA and LA mildly reduced Central amplitude reduction SD 2933 43 F c.1609CϾT (p.Arg537Cys) c.5882GϾA (p.Gly1961Glu) c.1654GϾA (p.Val552Ile) 0.05 0.1 Normal Not done SD 2669 13 F c.768GϾT (splice mutation) c.6449GϾA (p.Cys2150Tyr) 0.1 0.16 DA and LA borderline Central amplitude reduction SD 2700 22 F c.1609CϾT (p.Arg537Cys) c.2588GϾC (p.Gly863Ala) 0.1 0.1 Normal Central amplitude reduction SD 2833 29 M c.1928TϾG (p.Val643Gly) 2. mutation not foundc 0.1 0.1 Normal Not done SD 2799 13 M c.3113CϾT (p.Ala1038Val) c.5461-10TϾC 0.4 0.4 Not done Central amplitude reduction CRD ϭ cone-rod dystrophy; DA ϭ dark adaptation; ERG ϭ electroretinography; F ϭ female; LA ϭ light adaptation; LE ϭ left eye; M ϭ male; RE ϭ right eye; SD ϭ Stargardt disease; VA ϭ visual acuity. Login to comment

[hide] Molecular analysis of the ABCA4 gene for reliable ... Br J Ophthalmol. 2009 May;93(5):614-21. Epub 2008 Nov 21. Aguirre-Lamban J, Riveiro-Alvarez R, Maia-Lopes S, Cantalapiedra D, Vallespin E, Avila-Fernandez A, Villaverde-Montero C, Trujillo-Tiebas MJ, Ramos C, Ayuso C
Molecular analysis of the ABCA4 gene for reliable detection of allelic variations in Spanish patients: identification of 21 novel variants.
Br J Ophthalmol. 2009 May;93(5):614-21. Epub 2008 Nov 21., [PMID:19028736]

Abstract [show]
BACKGROUND/AIMS: Mutations in ABCA4 have been associated with autosomal recessive Stargardt disease (STGD), a few cases with autosomal recessive cone-rod dystrophy (arCRD) and autosomal recessive retinitis pigmentosa (arRP). The purpose of the study was threefold: to molecularly characterise families with no mutations or partially characterised families; to determine the specificity and sensitivity of the genotyping microarray; and to evaluate the efficiency of different methodologies. METHODS: 23 STGD, five arCRD and three arRP Spanish patients who were previously analysed with the ABCR400 microarray were re-evaluated. Results were confirmed by direct sequencing. In patients with either none or only one mutant allele, ABCA4 was further analysed by denaturing high-performance liquid chromatography (dHPLC) and multiplex ligation-dependent probe amplification (MLPA). Haplotype analysis was also performed. RESULTS: In the first analysis performed with the microarray, 27 ABCA4 variants (27/62; 43.5%) were found. By dHPLC scanning, 12 novel mutations were additionally identified. In addition, two previously described mutations, one false negative (1/62; 1.6%) and one false positive (1.6%), were detected. MLPA analysis did not reveal additional substitutions. The new strategy yielded an increment of 21% compared with the approach used in the first round. CONCLUSION: ABCA4 should be analysed by optimal combination of high-throughput screening techniques such as microarray, dHPLC and direct sequencing. To the best of our knowledge, this strategy yielded significant mutational spectrum identification in Spanish patients with ABCA4-associated phenotypes. Follow-up of patients, presenting an early onset of the disease and severe mutations, seems essential to perform accurate genotype-phenotype correlations and further characterisation of pathological ABCA4 alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Clinical science Br J Ophthalmol 2009;93:614-621. doi:10.1136/bjo.2008.145193 Table 1 Clinical findings of the Spanish patients with Stargardt disease (STGD), autosomal recessive cone-rod dystrophy and autosomal recessive retinitis pigmentosa Pedigree Age (years) Age (years) of onset Visual acuity Diagnosis Allele 1 Allele 2 Segregation OD OS Nucleotide changes (exons) Amino acid change Nucleotide changes (exons) Amino acid change ARDM-135 42 24 0.4 0.6 STGD c.5882G.A(42) p.Gly1961Glu c.1029_1030insT(8) p.Asn344fsX NP ARDM-240 15 13 0.2 0.16 STGD c.5882G.A(42) p.Gly1961Glu c.2285C.A(15) p.Ala762Glu Yes ARDM-225 32 25 0.25 0.50 STGD c.5882G.A(42) p.Gly1961Glu c.6559C.T(48) p.Gln2187X Yes ARDM-164 21 11 NA STGD c.3386G.T(23) p.Arg1129Leu c.700C.T(6) p.Gln234X Yes ARDM-162 50 16 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND Yes ARDM-198 27 19 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND NP ARDM-125 31 9 0.3 0.4 STGD c.3211insGT(22) FS p.KNLFA1876dup Yes ARDM-158 24 9 0.2 0.2 STGD c.3211insGT(22) FS c.4537delC(30) p.Gln1513fsX1525 NP ARDM-165 40 30 NA STGD c.3211insGT(22) FS ND ND NP ARDM-167 49 23 0.05 0.05 STGD c.3211insGT(22) FS ND ND NP ARDM-146 32 13 0.06 0.1 STGD c.3056C.T(21) p.Thr1019Met c.6140T.A(44) p.Ile2047Asn Yes ARDM-40 46 9 0.1 0.1 STGD c.3056C.T(21) p.Thr1019Met c.3943C.T(27) p.Gln1315X Yes ARDM-90 26 8 Hand moving STGD c.5929G.A (43) p.Gly1977Ser IVS21-2A.T Yes ARDM-181 57 16 0.1 0.09 STGD c.3323G.A (22) p.Arg1108His IVS38+5G.A Yes ARDM-197 35 15 0.1 0.1 STGD c.4793C.A(34) (false +) p.Ala1598Asp (false +) c.5172G.T(36) p.Trp1724Cys Yes ARDM-183 63 55 0.150 0.175 STGD c.6079C.T(44) p.Leu2027Phe c.5929G.A(43) (false -) p.Gly1977Ser (false -) NP ARDM-38 35 6 0.01 0.02 STGD c.1804C.T(13) p.Arg602Trp c.4739delT(33) p.Leu1580fs Yes ARDM-163 48 32 0.01 0.32 STGD c.4457C.T(30) p.Pro1486Leu ND ND Yes ARDM-166 42 39 NA STGD c.6320G.A(46) p.Arg2107His ND ND Yes ARDM-222 26 23 NA STGD c.2791G.A(19) p.Val931Met ND ND NP ARDM-160 30 5 0.25 0.1 STGD ND ND ND ND Yes ARDM-173 49 7 NA STGD ND ND ND ND Yes ARDM-205 NA NA NA STGD c.4919G.A(35) p.Arg1640Gln ND ND NP ARDM-247 30 12 0.05 0.1 CRD c.3386G.T(23) p.Arg1129Leu c.6410G.A(47) p.Cys2137Tyr Yes ARDM-99 59 46 0.05 0.05 CRD c.4297G.A(29) p.Val1433Ile ND ND NP ARDM-131 27 15 0.9 0.7 CRD c.2701A.G(18) p.Thr901Ala ND ND Yes ARDM-100 28 4 0.2 0.16 CRD ND ND ND ND Yes ARDM-142 30 25 0.8 0.5 CRD ND ND ND ND Yes RP-773 38 20 0.05 0.05 RP c.33N86G.T(23) p.Arg1129Leu ND ND NP RP-959 53 10 0.1 0.1 RP c.466A.G(5) p.Ile156Val ND ND Yes RP-1058 37 6 0.2 0.6 RP c.4297G.A(29) p.Val1433Ile ND ND NP Twenty-seven out of 31 subjects were found to be compound heterozygous for mutations in the ABCA4 gene detected by microarray. Login to comment

[hide] Clinical utility of the ABCR400 microarray: basing... Arch Ophthalmol. 2009 Apr;127(4):549-54. Roberts LJ, Ramesar RS, Greenberg J
Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip.
Arch Ophthalmol. 2009 Apr;127(4):549-54., [PMID:19365039]

Abstract [show]
OBJECTIVES: To assess the clinical utility of ABCR400 microarray testing in patients with ABCA4-associated retinopathies and to report on possible issues that could arise should genetic results be delivered without validation. METHODS: One hundred thirty-two probands were genotyped with the microarray. Diagnostic assays were designed to verify all mutations identified in individuals in whom at least 2 causative mutations were found. Mutations were verified in the probands, and wherever possible cosegregation analysis was performed in additional family members. RESULTS: Eighty-five of the 132 probands (64.4%) genotyped with the microarray had 2 or more disease-associated mutations identified. Verification of the genotyping, however, resulted in only 80 families being able to benefit from genetic result delivery. The remaining families could not receive results owing to the confounding effect of multiple ABCA4 mutations or the incorrect identification of mutations. CONCLUSIONS: The ABCR400 microarray is useful for mutation screening; however, raw data cannot be delivered directly to patients. All mutations should be verified and, whenever possible, investigated in other family members. CLINICAL RELEVANCE: Validated ABCR400 results provide an unequivocal molecular diagnosis, allowing family members to be offered diagnostic, predictive, carrier, and prenatal testing. Use of the microarray can inform decision-making and identify candidates for future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 One proband was confirmed to have inherited the heterozygous R2107H mutation from her father. Login to comment
61 This insertion, 4535insC, causes a 41-amino acid frameshift followed by a stop codon at position 1554, leading to STGD.10,11 Compound heterozygosity of the R2107H and the 4535insC mutations is therefore causative of disease in this proband (Figure 5C). Login to comment
87 If the microarray probes position 4537 and the sequence containing the insertion displays a C/C genotype at position 4537, no mutation should C Het R2107H (No 4535insC) Het R2107H (No 4535insC) 150 160 170 200 190 180 A C C C C C C C C C C C C C C C C C C C C C C C C C C C A G G G G G G G G G G G G G G G G G G G T T T T T T A A A A A A A A A B 180 190 200 210 220 230 C C C C C C C C C C C C C C C C C C C C C C N N N N N N N N N N N N N N A A A A A A A G G G G G G G G G G G G G G G G G T T Figure 5. Login to comment
91 C, The pedigree of family RPS145, showing the compound heterozygosity of R2107H and 4535insC. Login to comment
60 One proband was confirmed to have inherited the heterozygous R2107H mutation from her father. Login to comment
63 This insertion, 4535insC, causes a 41-amino acid frameshift followed by a stop codon at position 1554, leading to STGD.10,11 Compound heterozygosity of the R2107H and the 4535insC mutations is therefore causative of disease in this proband (Figure 5C). Login to comment
89 If the microarray probes position 4537 and the sequence containing the insertion displays a C/C genotype at position 4537, no mutation should C Het R2107H (No 4535insC) Het R2107H (No 4535insC) 150 160 170 200 190 180 A C C C C C C C C C C C C C C C C C C C C C C C C C C C A G G G G G G G G G G G G G G G G G G G T T T T T T A A A A A A A A A B 180 190 200 210 220 230 C C C C C C C C C C C C C C C C C C C C C C N N N N N N N N N N N N N N A A A A A A A G G G G G G G G G G G G G G G G G T T Figure 5. Login to comment
93 C, The pedigree of family RPS145, showing the compound heterozygosity of R2107H and 4535insC. Login to comment

[hide] Macular pigment and lutein supplementation in ABCA... Invest Ophthalmol Vis Sci. 2007 Mar;48(3):1319-29. Aleman TS, Cideciyan AV, Windsor EA, Schwartz SB, Swider M, Chico JD, Sumaroka A, Pantelyat AY, Duncan KG, Gardner LM, Emmons JM, Steinberg JD, Stone EM, Jacobson SG
Macular pigment and lutein supplementation in ABCA4-associated retinal degenerations.
Invest Ophthalmol Vis Sci. 2007 Mar;48(3):1319-29., [PMID:17325179]

Abstract [show]
PURPOSE: To determine macular pigment (MP) optical density (OD) in patients with ABCA4-associated retinal degenerations (ABCA4-RD) and the response of MP and vision to supplementation with lutein. METHODS: Patients with Stargardt disease or cone-rod dystrophy and known or suspected disease-causing mutations in the ABCA4 gene were included. All patients had foveal fixation. MPOD profiles were measured with heterochromatic flicker photometry. Serum carotenoids, visual acuity, foveal sensitivity, and retinal thickness were quantified. Changes in MPOD and central vision were determined in a subset of patients receiving oral supplementation with lutein for 6 months. RESULTS: MPOD in patients ranged from normal to markedly abnormal. As a group, patients with ABCA4-RD had reduced foveal MPOD, and there was a strong correlation with retinal thickness. Average foveal tissue concentration of MP, estimated by dividing MPOD by retinal thickness, was normal in patients, whereas serum concentration of lutein and zeaxanthin was significantly lower than normal. After oral lutein supplementation for 6 months, 91% of the patients showed significant increases in serum lutein, and 63% of the patients' eyes showed a significant augmentation in MPOD. The retinal responders tended to be female and to have lower serum lutein and zeaxanthin, lower MPOD, and greater retinal thickness at baseline. Responding eyes had significantly lower baseline MP concentration than did nonresponding eyes. Central vision was unchanged after the period of supplementation. CONCLUSIONS: MP is strongly affected by the stage of ABCA4 disease leading to abnormal foveal architecture. MP could be augmented by supplemental lutein in some patients. There was no change in central vision after 6 months of lutein supplementation. Long-term influences of this supplement on the natural history of these macular degenerations require further study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Clinical and Molecular Characteristics of the Patients Patient Age (y)/Gender ABCA4 Mutation Visual Acuity* Refraction† Kinetic Visual Field Extent (V-4e)‡ Lutein Trial Participant?RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 -0.50 -0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 -1.00 -1.25 103 104 N 3 18/M ࿣ 20/20 20/125 -1.00 -1.00 126 105 N 4§ 19/F R1129L/L1940P 20/40 20/50 ϩ0.25 ϩ0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 -0.75 -0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 -1.25 -1.50 112 105 Y 7§ 26/M ࿣ 20/40 20/32 ϩ1.00 ϩ0.75 86 88 Y 8 30/F ࿣ 20/50 20/40 ϩ2.25 ϩ1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 -2.25 -3.50 99 93 Y 10 32/F V935A/IVS40ϩ5G3A 20/32 20/40 -0.75 -1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 -1.50 -1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 -3.00 -2.00 99 105 Y 13¶ 38/F V256V/G1961E 20/25 20/25 -1.00 -1.25 106 101 Y 14¶ 42/F V256V/G1961E 20/25 20/32 -0.50 -0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 ϩ0.75 ϩ0.25 108 103 N 16§ 49/M ࿣ 20/32 20/32 -4.50 -4.50 84 79 Y 17 56/M G1977S 20/25 20/25 -5.50 -5.50 99 109 N * Best corrected visual acuity. Login to comment
62 RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 afa;0.50 afa;0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 afa;1.00 afa;1.25 103 104 N 3 18/M $f3; 20/20 20/125 afa;1.00 afa;1.00 126 105 N 4&#a7; 19/F R1129L/L1940P 20/40 20/50 af9;0.25 af9;0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 afa;0.75 afa;0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 afa;1.25 afa;1.50 112 105 Y 7&#a7; 26/M $f3; 20/40 20/32 af9;1.00 af9;0.75 86 88 Y 8 30/F $f3; 20/50 20/40 af9;2.25 af9;1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 afa;2.25 afa;3.50 99 93 Y 10 32/F V935A/IVS40af9;5G3A 20/32 20/40 afa;0.75 afa;1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 afa;1.50 afa;1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 afa;3.00 afa;2.00 99 105 Y 13&#b6; 38/F V256V/G1961E 20/25 20/25 afa;1.00 afa;1.25 106 101 Y 14&#b6; 42/F V256V/G1961E 20/25 20/32 afa;0.50 afa;0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 af9;0.75 af9;0.25 108 103 N 16&#a7; 49/M $f3; 20/32 20/32 afa;4.50 afa;4.50 84 79 Y 17 56/M G1977S 20/25 20/25 afa;5.50 afa;5.50 99 109 N * Best corrected visual acuity. Login to comment

[hide] Denaturing HPLC profiling of the ABCA4 gene for re... Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10. Stenirri S, Fermo I, Battistella S, Galbiati S, Soriani N, Paroni R, Manitto MP, Martina E, Brancato R, Allikmets R, Ferrari M, Cremonesi L
Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations.
Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10., [PMID:15192030]

Abstract [show]
BACKGROUND: Mutations in the retina-specific ABC transporter (ABCA4) gene have been associated with several forms of macular degenerations. Because the high complexity of the molecular genotype makes scanning of the ABCA4 gene cumbersome, we describe here the first use of denaturing HPLC (DHPLC) to screen for ABCA4 mutations. METHODS: Temperature conditions were designed for all 50 exons based on effective separation of 83 samples carrying 86 sequence variations and 19 mutagenized controls. For validation, samples from 23 previously characterized Stargardt patients were subjected to DHPLC profiling. Subsequently, samples from a cohort of 30 patients affected by various forms of macular degeneration were subjected to DHPLC scanning under the same conditions. RESULTS: DHPLC profiling not only identified all 132 sequence alterations previously detected by double-gradient denaturing gradient gel electrophoresis but also identified 5 sequence alterations that this approach had missed. Moreover, DHPLC scanning of an additional panel of 30 previously untested patients led to the identification of 26 different mutations and 29 polymorphisms, accounting for 203 sequence variations on 29 of the 30 patients screened. In total, the DHPLC approach allowed us to identify 16 mutations that had never been reported before. CONCLUSIONS: These results provide strong support for the use of DHPLC for molecular characterization of the ABCA4 gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment
34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment

[hide] Dark adaptation of rod photoreceptors in normal su... Invest Ophthalmol Vis Sci. 2004 Jul;45(7):2447-56. Kang Derwent JJ, Derlacki DJ, Hetling JR, Fishman GA, Birch DG, Grover S, Stone EM, Pepperberg DR
Dark adaptation of rod photoreceptors in normal subjects, and in patients with Stargardt disease and an ABCA4 mutation.
Invest Ophthalmol Vis Sci. 2004 Jul;45(7):2447-56., [PMID:15223829]

Abstract [show]
PURPOSE: Psychophysical and electroretinographic (ERG) studies indicate that patients with Stargardt disease exhibit abnormally slow rod dark adaptation after illumination that bleaches a substantial fraction of rhodopsin. However, relatively little information is available concerning rod recovery in this disease after weaker adapting (i.e., conditioning) light. With the use of a paired-flash ERG method, properties of the derived rod response to a low-bleach (<1%) but rod-saturating conditioning flash were investigated in seven normal subjects and in five Stargardt patients with identified sequence variations in the ABCA4 gene. METHODS: In the first of two experiments, the interval between a fixed conditioning flash (67 or 670 scotopic cd s m(-2)) and a bright probe flash of fixed strength was varied to determine the falling-phase kinetics of the derived rod response to the conditioning flash. In the second, the instantaneous amplitude-intensity function for the rod response at an intermediate stage of recovery from the conditioning flash was determined by presenting a test flash of various strengths at a fixed time after the conditioning flash, and a probe flash at 200 ms after the test flash. RESULTS: The maximum peak amplitude of the dark-adapted, rod-mediated a-wave determined in Stargardt patients (211 +/- 87 microV) was on average lower than that determined in normal subjects (325 +/- 91 microV; P = 0.06). The derived rod response to the 670 scotopic cd s m(-2) conditioning flash determined in normal subjects and Stargardt patients exhibited a biphasic recovery, and the kinetics of the early stage of this recovery were similar in the two subject groups. For both normal subjects and patients, normalized amplitude-intensity functions describing the dark-adapted derived rod response exhibited half-saturation at approximately 1.5 log scotopic troland second. In both groups, the normalized amplitude-intensity function determined at approximately 2 seconds after the 67 scotopic cd s m(-2) conditioning flash and at approximately 9 seconds after the 670 scotopic cd s m(-2) conditioning flash exhibited an average desensitization (i.e., an increase of test flash strength at half-saturation) of approximately 0.5 to 0.6 log unit relative to that determined under dark-adapted conditions. CONCLUSIONS: The results indicate that, despite a reduction in the average dark-adapted maximum a-wave amplitude in the Stargardt/ABCA4 patients, the early-stage recovery kinetics of the derived rod response to a low-bleaching conditioning flash as well as the lingering rod desensitization produced by such a flash are similar to those determined in normal subjects.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Description of Subjects Subject Number Age* Sex ABCA4 Variation Dark-Adapted Maximum Peak a-Wave Amplitude (␮V)† Normal subjects 101 55 M - -243 102 37 F - -410 103 26 M - -188 104 23 F - -397 105 56 F - -268 111 29 F - -362 112 23 M - -410 -325 Ϯ 91 Stargardt patients 106 50 F val849ala, arg2107his -201 107 41 M gly1961glu, arg2077trp -306 108 22 M ala60val, 1 bp ins codon 1513 -82 109 34 M leu541pro/ala1038val,‡ gly1961glu -277 110 51 M gly1961glu -191 -211 Ϯ 87 * Age on the date of determination of the a-wave result shown in the right-hand column. Login to comment

[hide] Mutations in ABCA4 result in accumulation of lipof... Hum Mol Genet. 2004 Mar 1;13(5):525-34. Epub 2004 Jan 6. Cideciyan AV, Aleman TS, Swider M, Schwartz SB, Steinberg JD, Brucker AJ, Maguire AM, Bennett J, Stone EM, Jacobson SG
Mutations in ABCA4 result in accumulation of lipofuscin before slowing of the retinoid cycle: a reappraisal of the human disease sequence.
Hum Mol Genet. 2004 Mar 1;13(5):525-34. Epub 2004 Jan 6., [PMID:14709597]

Abstract [show]
Mutations in ABCA4, which encodes a photoreceptor specific ATP-binding cassette transporter (ABCR), cause autosomal recessive forms of human blindness due to retinal degeneration (RD) including Stargardt disease. The exact disease sequence leading to photoreceptor and vision loss in ABCA4-RD is not known. Extrapolation from murine and in vitro studies predicts that two of the earliest pathophysiological features resulting from disturbed ABCR function in man would be slowed kinetics of the retinoid cycle and accelerated deposition of lipofuscin in the retinal pigment epithelium (RPE). To determine the human pathogenetic sequence, we studied surrogate measures of retinoid cycle kinetics, lipofuscin accumulation, and rod and cone photoreceptor and RPE loss in ABCA4-RD patients with a wide spectrum of disease severities. There were different extents of photoreceptor/RPE loss and lipofuscin accumulation in different regions of the retina. Slowing of retinoid cycle kinetics was not present in all patients; when present, it was not homogeneous across the retina; and the extent of slowing correlated well with the degree of degeneration. The orderly relationship between these phenotypic features permitted the development of a model of disease sequence in ABCA4-RD. The model predicted lipofuscin accumulation as a key and early component of the disease expression in man, as in mice. In man, however, abnormal slowing of the rod and cone retinoid cycle occurs at later stages of the disease sequence. Knowledge of the human ABCA4 disease sequence will be critical for defining rates of progression, selecting appropriate patients and retinal locations for future therapy, and choosing appropriate treatment outcomes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Similarly, a compound heterozygote (P4) with V849A and R408X mutations showed less severe disease than a patient (P7) with V849A and R2107H changes. Login to comment

[hide] Cosegregation and functional analysis of mutant AB... Hum Mol Genet. 2001 Nov 1;10(23):2671-8. Shroyer NF, Lewis RA, Yatsenko AN, Wensel TG, Lupski JR
Cosegregation and functional analysis of mutant ABCR (ABCA4) alleles in families that manifest both Stargardt disease and age-related macular degeneration.
Hum Mol Genet. 2001 Nov 1;10(23):2671-8., [PMID:11726554]

Abstract [show]
Mutations in ABCR (ABCA4) have been reported to cause a spectrum of autosomal recessively inherited retinopathies, including Stargardt disease (STGD), cone-rod dystrophy and retinitis pigmentosa. Individuals heterozygous for ABCR mutations may be predisposed to develop the multifactorial disorder age-related macular degeneration (AMD). We hypothesized that some carriers of STGD alleles have an increased risk to develop AMD. We tested this hypothesis in a cohort of families that manifest both STGD and AMD. With a direct-sequencing mutation detection strategy, we found that AMD-affected relatives of STGD patients are more likely to be carriers of pathogenic STGD alleles than predicted based on chance alone. We further investigated the role of AMD-associated ABCR mutations by testing for expression and ATP-binding defects in an in vitro biochemical assay. We found that mutations associated with AMD have a range of assayable defects ranging from no detectable defect to apparent null alleles. Of the 21 missense ABCR mutations reported in patients with AMD, 16 (76%) show abnormalities in protein expression, ATP-binding or ATPase activity. We infer that carrier relatives of STGD patients are predisposed to develop AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Pedigree Maternal allele Paternal allele AMD relative A priori Cosegregation AR19 pGM, -6 0.5 - AR33 [W1408R; R1640W] R24H and D1532N mA, -16 0.5 Yes AR59 4232insTATG C1488R pGM, -6 0.5 No AR80 T1526M pGF, -5 0.5 - AR80 T1526M mGF, -7 0.5 Yes AR125 4947delC C1488R pGM, -7 0.5 Yes AR215 [H1406Y; V2050L] pGM, -5 0.5 - AR218 2160+1G→C G1961E mA, -8 0.5 No AR262 W821R pGGF, -7 0.25 No AR271 P68R E1087K mGA, -6 0.25 No AR335 D645N F608I mGM, -9 0.5 Yes AR382 R1108C mGM, -6 0.5 Yes AR389 E2096K 5714+5G→A pGM, -8 0.5 Yes AR397 5196+1G→A 5585-1G→A mA, -5 0.5 No AR410 A1038V 768G→T pC, -5 0.25 Yes AR422 pGM, -6 0.5 - AR423 P1380L D1532N pGF, -4 0.5 No AR468 P1380L P1380L mU, -9 0.5 Yes AR484 L2027F G550R mGU, -5 0.25 Yes AR562 R2107H 3050+5G→A pGU, -5 0.25 No AR643 5196+2T→C L2027F mU, -4 0.5 Yes AR661 P1380L C54Y mGF, -6 0.5 Yes AR669 664del13 pGF, -4 0.5 No AR534 W821R P1380L pGM, -7 0.5 Yes (17) Family 1 R212C I2113M mGM, I-2 0.5 Yes (27) Family 2 R1108C R2107H mGM, I-2 0.5 Yes (27) Family 3 R212C G1977S mGF, I-1 0.5 Yes (27) 10.25 15 unlikely to account for many of the remaining alleles (our unpublished observations). Login to comment

[hide] Mutations in ABCR (ABCA4) in patients with Stargar... Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36. Briggs CE, Rucinski D, Rosenfeld PJ, Hirose T, Berson EL, Dryja TP
Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.
Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36., [PMID:11527935]

Abstract [show]
PURPOSE: To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). METHODS: One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. RESULTS: The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. CONCLUSIONS: This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
147 Missense Changes Found in Patients with No Other Detected ABCR Changes Patient ID Missense Change Mouse abc134 Mouse abc234 Human ABCC35 032-069 Ala60Val Ala N/A Glu 032-028 Gly65Glu Gly N/A Leu 032-044 Gly550Arg* Gly N/A N/A 032-038 Trp821Arg‡ Trp N/A Trp 035-019, 032-097 Glu1122Lys Glu Glu Glu 032-063, 032-093 Arg2030Gln† Arg Arg Arg 071-002 Leu2035Pro Phe Leu Met 032-064 Val2050Leu Phe Val Cys 032-061 Arg2107His Arg Arg Arg 007-009 Gly2146Asp‡ Gly Gly Gly Residues at homologous locations in other ABCR proteins. Login to comment
144 Missense Changes Found in Patients with No Other Detected ABCR Changes Patient ID Missense Change Mouse abc134 Mouse abc234 Human ABCC35 032-069 Ala60Val Ala N/A Glu 032-028 Gly65Glu Gly N/A Leu 032-044 Gly550Arg* Gly N/A N/A 032-038 Trp821Argߥ Trp N/A Trp 035-019, 032-097 Glu1122Lys Glu Glu Glu 032-063, 032-093 Arg2030Glnߤ Arg Arg Arg 071-002 Leu2035Pro Phe Leu Met 032-064 Val2050Leu Phe Val Cys 032-061 Arg2107His Arg Arg Arg 007-009 Gly2146Aspߥ Gly Gly Gly Residues at homologous locations in other ABCR proteins. Login to comment

[hide] Analysis of the ABCR (ABCA4) gene in 4-aminoquinol... Am J Ophthalmol. 2001 Jun;131(6):761-6. Shroyer NF, Lewis RA, Lupski JR
Analysis of the ABCR (ABCA4) gene in 4-aminoquinoline retinopathy: is retinal toxicity by chloroquine and hydroxychloroquine related to Stargardt disease?
Am J Ophthalmol. 2001 Jun;131(6):761-6., [PMID:11384574]

Abstract [show]
PURPOSE: To determine if mutations in ABCR (ABCA4) are associated with chloroquine/hydroxychloroquine retinopathy. METHODS: DNA from eight patients with chloroquine or hydroxychloroquine retinopathy was studied. Controls were 80 individuals over age 65 years with normal retinal examinations. Ophthalmoscopy, color vision testing, visual fields, retinal photography, and fluorescein angiography were performed on the eight patients. Direct DNA sequencing of the exons and flanking intronic regions of the ABCR gene was completed for all patients. RESULTS: Clinical evaluation confirmed the diagnosis of chloroquine/hydroxychloroquine retinopathy and excluded Stargardt disease in each patient. Two patients had heterozygous ABCR missense mutations previously associated with Stargardt disease. None of the controls had these missense mutations. Three other patients had other missense polymorphisms. CONCLUSIONS: Some individuals who have ABCR mutations may be predisposed to develop retinal toxicity when exposed to chloroquine/hydroxychloroquine. We urge further study of a larger cohort of patients with chloroquine/hydroxychloroquine retinopathy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 This alteration was reported previously in an unrelated patient with Stargardt disease.23 In addition, subject 7 is homozygous for the transition 6320G3A, which encodes the missense substitution Arg2107His, reported previously in six unrelated patients with Stargardt disease.24-26 Thus, subject 7 is compound heterozygous for both the missense mutation Arg2107His and for the complex allele (Leu1201Arg; Arg2107His). Login to comment
73 Also, recent biochemical characterization of recombinant ABCR protein with the Arg1129Leu mutation revealed a substantial reduction in both expression and ATP binding when compared with wild type ABCR.27 Thus, the pathogenic allele Arg1129Cys is likely to cause severe reduction in ABCR activity and may predispose development of chloroquine/hydroxychloroquine maculopathy in the heterozygous state. Subject 7 is compound heterozygous for the missense mutation Arg2107His and the complex allele (Leu1201Arg; Arg2107His). Login to comment
76 Neither the Leu1201Arg nor the Arg2107His mutations was identified in 160 control chromosomes. Login to comment
77 The Arg2107His mutation has also been biochemically characterized by Sun and associates,27 who report a moderate effect on expression level and reduced ATP binding of this mutant protein. Login to comment
78 It is unknown how the combinations of the Leu1201Arg and Arg2107His mutations may combine to reduce ABCR activity; however, we predict that subject 7 may have very low remaining ABCR activity. Login to comment

[hide] Spectrum of ABCA4 (ABCR) gene mutations in Spanish... Hum Mutat. 2001 Jun;17(6):504-10. Paloma E, Martinez-Mir A, Vilageliu L, Gonzalez-Duarte R, Balcells S
Spectrum of ABCA4 (ABCR) gene mutations in Spanish patients with autosomal recessive macular dystrophies.
Hum Mutat. 2001 Jun;17(6):504-10., [PMID:11385708]

Abstract [show]
The ABCA4 gene has been involved in several forms of inherited macular dystrophy. In order to further characterize the complex genotype-phenotype relationships involving this gene, we have performed a mutation analysis of ABCA4 in 14 Spanish patients comprising eight STGD (Stargardt), four FFM (fundus flavimaculatus), and two CRD (Cone-rod dystrophy) patients. SSCP (single-strand conformation polymorphism) analysis and DNA sequencing of the coding and 5' upstream regions of this gene allowed the identification of 16 putatively pathogenic alterations, nine of which are novel. Most of these were missense changes, and no patient was found to carry two null alleles. Overall, the new data agree with a working model relating the different pathogenic phenotypes to the severity of the mutations. When considering the information presented here together with that of previous reports, a picture of the geographic distribution of three particular mutations emerges. The R212C change has been found in French, Italian, Dutch, German, and Spanish but not in British patients. In the Spanish collection, R212C was found in a CRD patient, indicating that it may be a rather severe change. In contrast, c.2588G>C, a very common mild allele in the Dutch population, is rarely found in Southern Europe. Interestingly, the c.2588G>C mutation has been found in a double mutant allele together with the missense R1055W. Finally, the newly described L1940P was found in two unrelated Spanish patients, and may be a moderate to severe allele.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Pathogenic Mutations In the absence of a functional assay, it is difficult to relate the structural alteration with the TABLE 1. Summary of the Pathogenic Variants Found in the Screening of the ABCA4 Gene Family (NAS) Paternal allele (E) Maternal allele (E) Onset (years) Phenotype SB1 c.3211-3212insGT (22) R212C (6) 9 CRD M266 (2) c.4253+5G>A (28) L2060R (46) 7/4 CRD SM3 [R152Q (5); R2107H (46)] [R152Q (5); R2107H (46)] 7 STGD SZ2 L1940P (41) ND 8 STGD SM1 N1799D (38) ND 9 STGD SM2 c.2888delG (19) [R1055W (21); C.2588G>C (17)] 11 STGD SP1 ND ND 12 STGD SZ3 ND ND 12 STGD M280 N1805D (39) N1805D (39) 14 STGD SB2 (2) R1108C (22) L686S (14) 18/11 STGD SZ4 ND ND 20/28 FFM SP2 ND ND 21 FFM SM4 [T1253L (25); G1961E (42)] ND 38 FFM SZ1 L1940P (41) ND 28 FFM Novel putative pathogenic variants are depicted in bold type and their corresponding nucleotide changes are as follows: L686S=c.2057T>C; R1055W=c.3163C>T; T1253L=c.3758C>T; N1799D=c.5396A>G; N1805D=c.5413A>G; L1940P=c.5819T>C; L2060R=c.6179T>G. Login to comment

[hide] An analysis of allelic variation in the ABCA4 gene... Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89. Webster AR, Heon E, Lotery AJ, Vandenburgh K, Casavant TL, Oh KT, Beck G, Fishman GA, Lam BL, Levin A, Heckenlively JR, Jacobson SG, Weleber RG, Sheffield VC, Stone EM
An analysis of allelic variation in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89., [PMID:11328725]

Abstract [show]
PURPOSE: To assess the allelic variation of the ATP-binding transporter protein (ABCA4). METHODS: A combination of single-strand conformation polymorphism (SSCP) and automated DNA sequencing was used to systematically screen this gene for sequence variations in 374 unrelated probands with a clinical diagnosis of Stargardt disease, 182 patients with age-related macular degeneration (AMD), and 96 normal subjects. RESULTS: There was no significant difference in the proportion of any single variant or class of variant between the control and AMD groups. In contrast, truncating variants, amino acid substitutions, synonymous codon changes, and intronic variants were significantly enriched in patients with Stargardt disease when compared with their presence in subjects without Stargardt disease (Kruskal-Wallis P < 0.0001 for each variant group). Overall, there were 2480 instances of 213 different variants in the ABCA4 gene, including 589 instances of 97 amino acid substitutions, and 45 instances of 33 truncating variants. CONCLUSIONS: Of the 97 amino acid substitutions, 11 occurred at a frequency that made them unlikely to be high-penetrance recessive disease-causing variants (HPRDCV). After accounting for variants in cis, one or more changes that were compatible with HPRDCV were found on 35% of all Stargardt-associated alleles overall. The nucleotide diversity of the ABCA4 coding region, a collective measure of the number and prevalence of polymorphic sites in a region of DNA, was found to be 1.28, a value that is 9 to 400 times greater than that of two other macular disease genes that were examined in a similar fashion (VMD2 and EFEMP1).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
148 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His. Login to comment
103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
149 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His. Login to comment

[hide] Age-related macular degeneration in grandparents o... Am J Ophthalmol. 1999 Aug;128(2):173-8. Souied EH, Ducroq D, Gerber S, Ghazi I, Rozet JM, Perrault I, Munnich A, Dufier JL, Coscas G, Soubrane G, Kaplan J
Age-related macular degeneration in grandparents of patients with Stargardt disease: genetic study.
Am J Ophthalmol. 1999 Aug;128(2):173-8., [PMID:10458172]

Abstract [show]
PURPOSE: To report clinical features and molecular genetic study in three unrelated families in which age-related macular degeneration was observed in grandparents of patients with Stargardt disease. METHODS: A complete ophthalmologic examination including best-corrected visual acuity measurement, fundus examination, and fluorescein angiography was performed on all members of the three families. The entire coding sequence of the ABCR gene was analyzed using a combination of single strand conformation polymorphism and direct sequence analysis of the 50 exons. RESULTS: Compound heterozygous missense mutations were observed in patients with Stargardt disease (Arg212Cys, Argl107Cys, Gly1977Ser, Arg2107His, and le2113Met). Heterozygous missense mutations were observed in the grandparents with age-related macular degeneration (Arg212Cys and Arg1107Cys). CONCLUSIONS: We report phenotype and genotype findings in three unrelated families segregating patients with Stargardt disease and age-related macular degeneration. The hypothesis that the Arg212Cys and Arg1107Cys ABCR gene mutations could be susceptibility factors for age-related macular degeneration is discussed. We speculate that the relatives of patients affected with Stargardt disease who are carriers of heterozygous ABCR gene mutations may have a higher risk of developing age-related macular degeneration.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 ● RESULTS: Compound heterozygous missense mutations were observed in patients with Stargardt disease (Arg212Cys, Arg1107Cys, Gly1977Ser, Arg2107His, and le2113Met). Login to comment
46 Compound heterozygous missense mutations were observed in patients with Stargardt disease: Arg212Cys and Ile2113Met (III.1 and III.2, family 1), Arg1107Cys and Arg2107His (III.1 and III.2, family 2), Arg212Cys and Gly1977Ser (III.1 family 3) (Figure 1). Login to comment
56 Clinical Data of Individuals From the Three Pedigrees Individual, Family Age (yrs) Visual Acuity Macular Involvement (fundus examination and FA) Genotype*RE LE I.2, fam 1 78 CF CF RPE atrophy, some hard drusen and choroidal new vessel (Figure 2, top left) Arg212Cys/wt I.2, fam 2 86 CF CF Progressive geographic atrophy since the age of 80 (Figure 2, top right) Arg1107Cys/wt I.1, fam 2 75 20/30 20/40 Patches of RPE atrophy and perimacular soft drusen (Figure 2, middle left) Arg212Cys/wt I.2, fam 3 72 20/20 20/20 None wt/wt II.1, fam 1 44 20/20 20/20 None Ile2113Met/wt II.2, fam 1 50 20/20 20/25 Diffuse hard drusen (Figure 2, middle right) Arg212Cys/wt II.1, fam 2 70 20/20 20/20 None Arg2107His/wt II.2, fam 2 66 20/20 20/25 Diffuse hard drusen (Figure 2, bottom) Arg1107Cys/wt II.1, fam 3 37 20/20 20/20 None Gly1977Ser/wt II.2, fam 3 39 20/20 20/20 None Arg212Cys/wt III.1, fam 1 10 20/200 20/200 RPE atrophy, fundus flavimaculatus and choroidal silent Arg212Cys/Ile2113Met III.2, fam 1 6 20/20 20/20 None Ile2113Met/wt III.1, fam 2 33 20/200 CF RPE atrophy, fundus flavimaculatus and choroidal silent Arg1107Cys/Arg2107His III.2, fam 2 28 CF CF RPE atrophy, fundus flavimaculatus and choroidal silent Arg1107Cys/Arg2107His III.3, fam 2 24 20/20 20/20 None Arg2107His/wt III.1, fam 3 12 CF 20/200 RPE atrophy, fundus flavimaculatus and choroidal silent Arg212Cys/Gly1977Ser III.2, fam 3 9 20/20 20/20 None wt/wt CF ϭ counting fingers; FA ϭ fluorescein angiography; None ϭ no macular degeneration; RPE ϭ retinal pigment epithelium; wt ϭ wild type. Login to comment

[hide] Variation of clinical expression in patients with ... Arch Ophthalmol. 1999 Apr;117(4):504-10. Fishman GA, Stone EM, Grover S, Derlacki DJ, Haines HL, Hockey RR
Variation of clinical expression in patients with Stargardt dystrophy and sequence variations in the ABCR gene.
Arch Ophthalmol. 1999 Apr;117(4):504-10., [PMID:10206579]

Abstract [show]
OBJECTIVE: To report the spectrum of ophthalmic findings in patients with Stargardt dystrophy or fundus flavimaculatus who have a specific sequence variation in the ABCR gene. PATIENTS: Twenty-nine patients with Stargardt dystrophy or fundus flavimaculatus from different pedigrees were identified with possible disease-causing sequence variations in the ABCR gene from a group of 66 patients who were screened for sequence variations in this gene. METHODS: Patients underwent a routine ocular examination, including slitlamp biomicroscopy and a dilated fundus examination. Fluorescein angiography was performed on 22 patients, and electroretinographic measurements were obtained on 24 of 29 patients. Kinetic visual fields were measured with a Goldmann perimeter in 26 patients. Single-strand conformation polymorphism analysis and DNA sequencing were used to identify variations in coding sequences of the ABCR gene. RESULTS: Three clinical phenotypes were observed among these 29 patients. In phenotype I, 9 of 12 patients had a sequence change in exon 42 of the ABCR gene in which the amino acid glutamic acid was substituted for glycine (Gly1961Glu). In only 4 of these 9 patients was a second possible disease-causing mutation found on the other ABCR allele. In addition to an atrophic-appearing macular lesion, phenotype I was characterized by localized perifoveal yellowish white flecks, the absence of a dark choroid, and normal electroretinographic amplitudes. Phenotype II consisted of 10 patients who showed a dark choroid and more diffuse yellowish white flecks in the fundus. None exhibited the Gly1961Glu change. Phenotype III consisted of 7 patients who showed extensive atrophic-appearing changes of the retinal pigment epithelium. Electroretinographic cone and rod amplitudes were reduced. One patient showed the Gly1961Glu change. CONCLUSIONS: A wide variation in clinical phenotype can occur in patients with sequence changes in the ABCR gene. In individual patients, a certain phenotype seems to be associated with the presence of a Gly1961Glu change in exon 42 of the ABCR gene. CLINICAL RELEVANCE: The identification of correlations between specific mutations in the ABCR gene and clinical phenotypes will better facilitate the counseling of patients on their visual prognosis. This information will also likely be important for future therapeutic trials in patients with Stargardt dystrophy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 Clinical Features of Patients With ABCR Gene Mutations* Patient No./ Sex/Age, y Clinical Phenotype Vision Silent Choroid Central Scotoma MutationOD OS 1/M/19 I 20/200 20/200 ND + Thr300Asn, exon 8 2/M/44 I 20/25 20/15 - + Cys1488Arg, exon 30 3/M/35 I 20/100 20/100 ND + Gly1961Glu, exon 42 Cys2150Tyr, exon 47 4/M/44 I 20/200 20/200 - + Gly1961Glu, exon 42 5/F/28 I 20/80 20/100 - + Gly1961Glu, exon 42 Gly65Glu, exon 3 6/M/36 I 20/25 20/200 - + Gly1961Glu, exon 42 Arg2077Trp, exon 45 7/F/44 I 20/200 20/200 - + Gly1961Glu, exon 42 8/M/41 I 20/200 20/200 - + Gly1961Glu, exon 42 9/F/32 I 20/25 20/30 - + Gly1961Glu, exon 42 10/F/36 I 20/50 20/200 - + Gly1961Glu, exon 42 11/M/31 I 20/200 20/200 - + Gly1961Glu, exon 42 Ala1038Val, exon 21 Leu541Pro, exon 12 12/M/35 I 20/200 20/200 - + Arg2107His, exon 46 Leu1729Pro, exon 36 13/M/22 II 20/200 20/200 + + 1bp del (g), codon 448, exon 10 14/F/9 II 20/200 20/40 ND + 9bp del, codon 1760/1761, exon 37 1bp ins (c), codon 1513, exon 30 15/M/19 II 10/120 10/160 + + 1bp ins (c), codon 1513, exon 30 Ala60Val, exon 3 16/M/25 II 20/200 20/200 + ND Ser974Pro, exon 20 17/F/12 II 20/200 20/200 ND + 2884 del (c), exon 19 18/F/73 II 20/30 20/25 + Paracentral scotoma 5bp del, codon 505, exon 11 19/F/35 II 10/160 10/120 ND + Val849Ala, exon 16 20/F/48 II 20/400 20/400 + +; Mild peripheral restriction Val849Ala, exon 16 Arg2107His, exon 46 21/M/54 II 20/200 20/200 + + Arg2030stop, exon 44 22/M/28 II 20/400 20/400 + + His2128Arg, exon 46 23/F/34 III 10/400 10/225 Diffuse hyperfluorescence ND Arg2038Trp, exon 44 24/F/53 III 10/700 10/600 Diffuse hyperfluorescence and notable choroidal atrophy + Arg1108Cys, exon 22 25/F/54 III 10/350 3/350 Diffuse hyperfluorescence +; Mild concentric restriction Tyr1652Asp, exon 35 Arg2107His, exon 46 26/M/57 III 20/50 20/80 ND ND Splice donor GϾA, exon 24 27/F/65 III 1/225 1/225 Diffuse choroidal atrophy Temporal islands Gly1961Glu, exon 42 frameshift del, codons 1620-1622, exon 35† 28/M/32 III 20/400 20/400 Diffuse hyperfluorescence +; Peripheral restriction Ala1038Val, exon 21 Leu541Pro, exon 12 Donor splice, exon 30 29/M/46 III 10/225 10/225 ND +; Peripheral restriction Trp1408Leu, exon 28 Ser206Arg, exon 6 Arg2107His, exon 46 *M indicates male; F, female; ND, angiography or visual field testing not done; +, present; and -, absent. Login to comment

[hide] A longitudinal study of stargardt disease: clinica... Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15. Fujinami K, Lois N, Davidson AE, Mackay DS, Hogg CR, Stone EM, Tsunoda K, Tsubota K, Bunce C, Robson AG, Moore AT, Webster AR, Holder GE, Michaelides M
A longitudinal study of stargardt disease: clinical and electrophysiologic assessment, progression, and genotype correlations.
Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15., [PMID:23499370]

Abstract [show]
PURPOSE: To investigate the clinical and electrophysiologic natural history of Stargardt disease and correlate with the genotype. DESIGN: Cohort study of 59 patients. METHODS: Clinical history, examination, and electrophysiologic assessment were undertaken in a longitudinal survey. Patients were classified into 3 groups based on electrophysiologic findings, as previously published: Group 1 had dysfunction confined to the macula; Group 2 had macular and generalized cone system dysfunction; and Group 3 had macular and both generalized cone and rod system dysfunction. At baseline, there were 27 patients in Group 1, 17 in Group 2, and 15 in Group 3. Amplitude reduction of >50% in the relevant electroretinogram (ERG) component or a peak time shift of >3 ms for the 30 Hz flicker ERG or bright flash a-wave was considered clinically significant ERG deterioration. Molecular screening of ABCA4 was undertaken. RESULTS: The mean age at baseline was 31.7 years, with the mean follow-up interval being 10.5 years. A total of 22% of patients from Group 1 showed ERG group transition during follow-up, with 11% progressing to Group 2 and 11% to Group 3. Forty-seven percent of patients in Group 2 progressed to Group 3. There was clinically significant ERG deterioration in 54% of all subjects: 22% of Group 1, 65% of Group 2, and 100% of Group 3. At least 1 disease-causing ABCA4 variant was identified in 47 patients. CONCLUSIONS: All patients with initial rod ERG involvement demonstrated clinically significant electrophysiologic deterioration; only 20% of patients with normal full-field ERGs at baseline showed clinically significant progression. Such data assist counseling by providing more accurate prognostic information and are also highly relevant in the design, patient selection, and monitoring of potential therapeutic interventions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Clinical Data and Molecular Genetic Status of 59 Patients With Stargardt Disease Pt Onset (y) Age (y) logMAR VA Variants Identifieda BL FU BL FU 1 16 17 26 0.0/1.0 0.0/0.48 c.768G>T / p.Gly863Ala / p.Arg943Gln 2 15 17 25 0.78/0.78 1.0/1.0 p. Arg1443His 3 11 18 27 0.78/1.0 1.0/1.0 p.Trp439* / p.Gly863Ala / p.Leu1970Phe 4 19 21 32 0.78/0.78 1.0/1.0 p.Leu2027Phe 5 10 22 30 0.48/0.48 1.0/0.78 p.Gly863Ala / p.Arg943Gln / c.5461-10 T>C 6 18 26 37 0.78/1.0 1.0/1.0 p.Pro1380Phe 7 25 28 40 0.78/1.0 1.3/0.78 ND 8 24 29 38 1.0/0.78 1.0/1.0 p.Phe418Ser / p.Leu2027Phe 9 24 31 44 1.0/1.0 1.3/1.0 c.4253&#fe;5 G>T / p.Gly1507Arg 10 26 32 44 0.78/0.78 1.0/1.0 p.Cys1490Tyr / p.Arg2030Gln 11 31 34 46 0.18/0.3 0.6/0.7 ND 12 17 35 47 1.0/1.0 1.0/1.0 p.Asn96His 13 23 35 45 1.0/0.3 1.0/0.48 p.Gly1513Profs*1554 14 33 37 48 0.18/1.48 1.0/1.3 ND 15 38 40 51 0.18/0.78 1.0/1.0 p.Arg2107His 16 42 43 53 0.0/0.0 1.0/1.0 ND 17 22 48 59 1.0/1.0 1.0/1.0 p.Cys54Tyr 18 20 49 59 1.0/0.6 1.0/1.0 p.Pro1380Leu / p.Gly1961Glu 19 35 50 61 1.0/0.3 1.0/1.0 p.Arg1108Cys 20 25 56 67 1.3/0.18 1.0/1.0 p.Trp439* / p.Gly863Ala 21 48 59 71 1.0/0.78 1.0/1.0 p. Ile156 Val / p. Cys1455Arg / p. Phe1839Ser 22 21 22 31 0.3/1.0 1.0/1.0 p.Arg2107His 23 21 23 33 1.0/1.0 1.0/1.0 p.Gly863Ala 24 48 64 73 0.0/1.0 0.18/3.0 p.Tyr1652* 25 17 19 29 0.78/0.3 1.0/1.0 c.5461-10 T>C 26 17 21 33 1.0/0.78 1.0/1.0 ND 27 27 53 66 1.78/1.78 1.3/1.0 p.Ser1071Cysfs*1084 28 5 14 21 0.78/0.78 1.0/1.0 p.Arg408* / p.Val675lle 29 9 15 27 1.08/1.08 1.0/1.0 p.Cys2150Tyr 30 14 24 32 1.0/0.78 1.0/1.0 ND 31 18 28 39 1.0/1.0 1.0/1.0 p.Gly863Ala / p.Arg1108Cys / p.Arg943Gln 32 14 29 37 1.0/1.0 1.0/1.0 p.Arg653Cys / p.Arg2030Gln 33 19 29 40 1.0/1.0 1.0/1.08 ND 34 34 40 49 0.3/0.48 1.0/1.0 p.Gly863Ala / p.Glu1087Lys 35 25 43 54 1.0/1.0 1.0/1.0 p.Cys54Tyr / p.Gly863Ala 36 38 60 69 1.0/1.0 1.3/1.08 p.Val931Met / c.5461-10 T>C 37 10 11 20 1.0/0.78 1.3/1.3 p.Pro1380Leu 38 10 15 23 1.0/1.0 1.3/1.3 p.Ser1071Cysfs*1084 / p.Pro1380Leu 39 24 25 38 1.56/0.3 2.0/2.0 c.5461-10 T>C / c.5714&#fe;5 G>A 40 18 26 36 1.3/1.3 2.0/1.3 ND 41 32 33 45 0.48/0.48 1.0/1.0 ND 42 32 35 46 1.3/0.0 3.0/1.0 p.Cys54Tyr 43 30 35 45 0.48/0.48 2.0/1.3 ND 44 15 41 49 1.3/1.3 2.0/1.3 p.Asn965Ser 45 8 8 20 0.78/0.78 1.0/1.0 p.Thr1019Met 46 10 11 23 1.0/1.0 1.0/1.0 p.Thr1019Met 47 8 12 24 2.0/1.56 1.78/1.48 p.Cys2150Tyr 48 17 18 26 1.0/0.78 1.3/1.0 c.5461-10 T>C / p.Leu2027Phe 49 8 21 33 1.3/1.3 2.0/2.0 p.Asp574Aspfs*582 50 8 27 39 2.0/1.56 1.78/1.48 c.5461-10 T>C 51 24 31 43 1.18/1.18 1.08/1.3 p.Arg1640Trp / p.Leu2027Phe Continued on next page respective electrophysiologic traces appear in Figure 2. Login to comment

[hide] Characterization of stargardt disease using polari... Invest Ophthalmol Vis Sci. 2013 Sep 27;54(9):6416-25. doi: 10.1167/iovs.12-11550. Ritter M, Zotter S, Schmidt WM, Bittner RE, Deak GG, Pircher M, Sacu S, Hitzenberger CK, Schmidt-Erfurth UM
Characterization of stargardt disease using polarization-sensitive optical coherence tomography and fundus autofluorescence imaging.
Invest Ophthalmol Vis Sci. 2013 Sep 27;54(9):6416-25. doi: 10.1167/iovs.12-11550., [PMID:23882696]

Abstract [show]
PURPOSE: To identify disease-specific changes in Stargardt disease (STGD) based on imaging with polarization-sensitive spectral-domain optical coherence tomography (PS-OCT) and to compare structural changes with those visible on blue light fundus autofluorescence (FAF) imaging. METHODS: Twenty-eight eyes of 14 patients diagnosed with STGD were imaged using a novel high-speed, large-field PS-OCT system and FAF (excitation 488 nm, emission > 500 nm). The ophthalmoscopic phenotype was classified into three groups. ABCA4 mutation testing detected 15 STGD alleles, six of which harbor novel mutations. RESULTS: STGD phenotype 1 (12 eyes) showed sharply delineated areas of absent RPE signal on RPE segmentation B-scans of PS-OCT correlating with areas of hypofluorescence on FAF. Adjacent areas of irregular fluorescence correlated with an irregular RPE segmentation line with absence of overlaying photoreceptor layers. Eyes characterized on OCT by a gap in the subfoveal outer segment layer (foveal cavitation) showed a normal RPE segmentation line on PS-OCT. Hyperfluorescent flecks on FAF in phenotype 2 STGD (8 eyes) were identified as clusters of depolarizing material at the level of the RPE. Distribution of flecks could be depicted on RPE elevation maps. An increased amount of depolarizing material in the choroid was characteristic for STGD Phenotype 3 (8 eyes). CONCLUSIONS: PS-OCT together with FAF identified characteristic patterns of changes in different stages of the disease. PS-OCT is a promising new tool for diagnosis and evaluation of future treatment modalities in STGD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Patient Characteristics Patient Number Sex Age Age of Onset Visual Acuity RE/LE Fundus Phenotype ERG Type ABCA4 Mutation Allele 1 ABCA4 Mutation Allele 2 Exon Position cDNA Effect on Protein Exon Position cDNA Effect on Protein 1 M 52 19 1.00/1.30 1 2 33 c.4738_4739delTT p.Leu1580Lysfs*16 46 c.6320G>A p.Arg2107His 2 F 32 9 1.30/1.00 1 1 19 c.2829delG p.Pro944Glnfs*6 42 c.5882G>A p.Gly1961Glu 3 M 29 16 1.30/1.00 1 1 IVS1 c.66&#fe;3A>C / 19 c.2791G>A p.Val931Met 4 F 32 20 1.00/1.00 1 1 17 c.2588G>C* p.Gly863Ala* 22 c.3266C>T p.Thr1089Ile 5 M 28 21 0.52/0.70 1 1 42 c.5882G>A p.Gly1961Glu 42 c.5882G>A p.Gly1961Glu 6 F 25 20 1.00/0.80 1 1 13 c.1865delG p.Ser622Thrfs*27 42 c.5882G>A p.Gly1961Glu 7 F 32 27 0.05/0.10 2 1 25 c.3626T>C p.Met1209Thr 33 c.4739T>C p.Leu1580Ser 8 F 42 17 1.00/1.00 2 1 12 c.1622T>C* p.Leu541Proߤ 42 c.5882G>A p.Gly1961Glu 9 F 23 23 0.00/0.00 2 1 IVS40 c.5714&#fe;5G>A / IVS40 c.5714&#fe;5G>A / 10 F 30 16 1.00/1.00 2 1 12 c.1622T>Cߤ p.Leu541Proߤ 19 c.2864A>G p.Glu955Gly 11 M 45 19 1.30/1.30 3 2 12 c.1622T>Cߤ p.Leu541Proߤ 17 c.2588G>C* p.Gly863Ala* 12 M 37 14 1.00/1.00 3 2 12 c.1622T>Cߤ p.Leu541Proߤ 19 c.2864A>G p.Glu955Gly 13 F 27 20 1.00/1.00 3 2 12 c.1622T>Cߤ p.Leu541Proߤ IVS40 c.5714&#fe;5G>A / 14 M 41 14 2.00/2.00 3 3 IVS13 c.1937&#fe;1G>A / 17 c.2588G>C* p.Gly863Ala* Patient number, sex, age, age of disease onset, visual acuity (logMAR), fundus phenotype (1, STGD phenotype 1; 2, STGD phenotype 2; 3, STGD phenotype 3), ERG type, ABCA4 mutation allele 1 and ABCA4 mutation allele 2; exons and coding DNA (cDNA) positions based on reference sequence NM_000350 (IVS: intervening sequence, intron) are shown. Login to comment
109 The four patients showing a central area of RPE atrophy were compound heterozygous for a known missense mutation and for a novel, previously not described, mutation: patient 1 harbored the known c.6320G>A (p.Arg2107His) mutation and a, so far not described, null mutation in exon 33, c.4738_4739delTT (p.Leu1580Lysfs*16), patient 2 the frequent mild missense mutation c.5882G>A (p.Gly1961Glu) and a novel single-base deletion, c.2829delG (p.Pro944Glnfs*6) in exon 19, and patient 3 the known c.2791G>A (p.Val931Met) mutation and a presumably destructive novel splice site mutation within the first intron (c.66&#fe;3A>C). Login to comment

[hide] Clinical and molecular analysis of Stargardt disea... Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003. Fujinami K, Sergouniotis PI, Davidson AE, Wright G, Chana RK, Tsunoda K, Tsubota K, Egan CA, Robson AG, Moore AT, Holder GE, Michaelides M, Webster AR
Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function.
Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003., [PMID:23953153]

Abstract [show]
PURPOSE: To describe a cohort of patients with Stargardt disease who show a foveal-sparing phenotype. DESIGN: Retrospective case series. METHODS: The foveal-sparing phenotype was defined as foveal preservation on autofluorescence imaging, despite a retinopathy otherwise consistent with Stargardt disease. Forty such individuals were ascertained and a full ophthalmic examination was undertaken. Following mutation screening of ABCA4, the molecular findings were compared with those of patients with Stargardt disease but no foveal sparing. RESULTS: The median age of onset and age at examination of 40 patients with the foveal-sparing phenotype were 43.5 and 46.5 years. The median logMAR visual acuity was 0.18. Twenty-two patients (22/40, 55%) had patchy parafoveal atrophy and flecks; 8 (20%) had numerous flecks at the posterior pole without atrophy; 7 (17.5%) had mottled retinal pigment epithelial changes; 2 (5%) had multiple atrophic lesions, extending beyond the arcades; and 1 (2.5%) had a bull's-eye appearance. The median central foveal thickness assessed with spectral-domain optical coherence tomographic images was 183.0 mum (n = 33), with outer retinal tubulation observed in 15 (45%). Twenty-two of 33 subjects (67%) had electrophysiological evidence of macular dysfunction without generalized retinal dysfunction. Disease-causing variants were found in 31 patients (31/40, 78%). There was a higher prevalence of the variant p.Arg2030Gln in the cohort with foveal sparing compared to the group with foveal atrophy (6.45% vs 1.07%). CONCLUSIONS: The distinct clinical and molecular characteristics of patients with the foveal-sparing phenotype are described. The presence of 2 distinct phenotypes of Stargardt disease (foveal sparing and foveal atrophy) suggests that there may be more than 1 disease mechanism in ABCA4 retinopathy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 Mutation screening of ABCA4 was performed with the arrayed primer extension (APEX) microarray (ABCR400 chip, Asper Ophthalmics, TABLE 1. Summary of Clinical Findings and Molecular Status of 40 Patients With a Foveal-Sparing Phenotypea of Stargardt Disease Patient Onsetb (y) Age (y) LogMAR Visual Acuity Fundus Patternc OCT ERGe Mutation Status CFTd (mm) ORT Group PERG mfERG OD OS OD OS OD OS OD OS 1 45 45 0 0 3 219 223 NA NA NA NA NA [c.1411 G>A, p.Glu471Lys/c.2588 G>C, p. Gly863Ala/c.4594 G>A, p.Asp1532Asn/c.5693 G>A, p.Arg1898His] 2 33 33 0.18 0.48 1 NA NA 3 ND ND NA NA [c.1622 T>C, p.Leu541Pro/c.3113 C>T, p.Ala1038Val/c.6089 G>A, p.Arg2030Gln] 3 53 66 0.18 0.18 1 NA NA 2 A A NA NA [c.768 G>T, Splice site/c. 6320 G>A, p. Arg2107His ] 4 37 54 1.48 0.18 1 32 39 U 3 ND ND 2 2 [c.1760 &#fe;1 G>T, Splice site/c.4594 G>T, p.Asg1532Tyr ] 5 57 57 0.3 0.18 1 NA NA 1 ND ND NA NA [c. Login to comment
127 2588G>C, p.Gly863Ala 4 Het Allikmets46 Intol. 0.01 PRD 0.996 No change 68/13006 db SNP (rs76157638) 21 c.3113C>T, p.Ala1038Val 1 Het Webster53 Tol. NA Benign 0.014 Donor 43.5 70 New site (&#fe;61.72) 22/13006 db SNP (rs61751374) 24 c.3602T>G, p.Leu1201Arg 2 Het Lewis48 Tol. NA Benign 0.052 Donor 61.3 74 New site (&#fe;20.08) 416/13006 db SNP (rs61750126) 27 c.3898C>T, p.Arg1300* 1 Het Rivera49 NA NA ND 28 c.4139C>T, p.Pro1380Leu 2 Het Lewis48 Intol. 0.01 Benign 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4222 T>C, p.Trp1408Arg 2 Het Lewis48 Tol. NA PRD 0.845 No change ND dbSNP (rs61750135) 29 c.4319T>C, p.Phe1440Ser 1 Het Lewis48 Tol. NA PRD 0.744 No change ND dbSNP (rs61750141) 30 c.4469G>A, p.Cys1490Tyr 1 Het Webster53 Intol. 0.03 PRD 0.994 No change ND dbSNP (rs61751402) 31 c.4577C>T, p.Thr1526Met 1 Het Lewis48 Intol. 0.00 PRD 0.91 No change ND db SNP (rs61750152) 31 c.4594G>T, p.Asp1532Asn 3 Het Lewis48 Tol. NA PRD 0.853 No change ND 33 c.4685T>C, p.Ile1562Thr 1 Het Allikmets46 Tol. NA Benign 0.034 No change 18/13006 db SNP (rs1762111) 35 c.4956T>G, p.Tyr1652* 1 Het Fumagalli52 NA NA Acceptor 43 72 New site (&#fe;67.36) ND 35 c.4918C>T, p.Arg1640Trp 2 Het Rozet47 Intol. 0.00 PRD 1 No change ND dbSNP (rs61751404) 35 c.4926C>G, p.Ser1642Arg 1 Het Birch50 Tol. 0.68 Benign 0.116 No change ND db SNP (rs61753017) Int 35 c.5018&#fe;2T>C, Splice site 1 Het Fumagalli52 NA NA Donor 81.2 54 WT site broken (33.07) ND Int 38 c.5461-10T>C 3 Het Briggs50 NA NA No change 3/13006 db SNP (rs1800728) 40 c.5693G>A, p.Arg1898His 2 Het Allikmets46 NA Benign 0.00 No change 25/13006 db SNP (rs1800552) 42 c.5882G>A, p.Gly1961Glu 1 Het Allikmets46 Tol. 0.18 PRD 1 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T, p.Leu2027Phe 4 Homo Lewis48 Intol. 0.02 PRD 0.999 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A, p.Arg2030Gln 4 Het Lewis48 Tol. NA PRD 0.995 No change 8/13006 db SNP (rs61750641) 44 c.6118C>T, p.Arg2040* 1 Het Rosenberg54 NA NA ND 46 c.6320G>A, p.Arg2107His 1 Het Fishman8 Intol. 0.00 PRD 0.996 No change 91/13006 db SNP (rs62642564) EVS &#bc; Exome Variant Server; HSF &#bc; Human Splicing Finder program; Hum var score &#bc; Human var score; Int &#bc; intron; Intol &#bc; intolerant; Mt CV &#bc; mutant consensus value; NA &#bc; not applicable; ND &#bc; not detected; PRD &#bc; probably damaging; Pred. &#bc; prediction; SIFT &#bc; Sorting Intolerant from Tolerance program; Tol. &#bc; tolerant; Wt CV &#bc; wild-type consensus value. Login to comment
142 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) (Continued) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency Int 33 c.4773&#fe;48C>T 1 0.36% 34 c.4793C>A, p.Ala1598Asp 1 0.36% 35 c.c.4918C>T, p.Arg1640Trp 1 0.36% Int 35 c.5018&#fe;2T>C, Splice site 2 0.71% 36 c.5114G>A, p.Arg1705Gln 2 0.71% 37 c.5222_5233delTGGTGGTGGGC, p.Lys1741Hisfs 1 0.36% 37 c.5281_5289delCTT CCT GCC, p.Pro1761_Leu1763del 2 0.71% Int 38 c.5461-10T>C 23 8.21% Int 39 c.5585-1G>A, Splice site 1 0.36% Int 40 c.5714&#fe;5G>A, Splice site 5 1.79% 42 c.5882G>A, p.Gly1961Glu 17 6.07% 43 c.5908C>T, p.Leu1970Phe 2 0.71% 43 c.5917delG, p.Val1973* 1 0.36% 44 c.6079C>T, p.Leu2027Phe 10 3.57% 44 c.6089G>A, p.Arg2030Gln 3 1.07% 44 c.6118C>T, p.Arg2040* 1 0.36% 45 c.6148G>C, p.Val2050Leu 3 1.43% 46 c.6286G>A, p.Glu2096Lys 1 0.36% 46 c.6320G>A, p.Arg2107His 4 1.43% 47 c.6445C>T, p.Arg2149* 1 0.36% 47 c.6449G>A, p.Cys2150Tyr 3 1.07% 48 c.6658C>T, p.Gln2220* 3 1.07% 48 c.6709_6710insG, p.Thr2237Serfs 1 0.36% Int &#bc; Intron. Login to comment

[hide] ABCA4 gene screening by next-generation sequencing... Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570. Fujinami K, Zernant J, Chana RK, Wright GA, Tsunoda K, Ozawa Y, Tsubota K, Webster AR, Moore AT, Allikmets R, Michaelides M
ABCA4 gene screening by next-generation sequencing in a British cohort.
Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570., [PMID:23982839]

Abstract [show]
PURPOSE: We applied a recently reported next-generation sequencing (NGS) strategy for screening the ABCA4 gene in a British cohort with ABCA4-associated disease and report novel mutations. METHODS: We identified 79 patients with a clinical diagnosis of ABCA4-associated disease who had a single variant identified by the ABCA4 microarray. Comprehensive phenotypic data were obtained, and the NGS strategy was applied to identify the second allele by means of sequencing the entire coding region and adjacent intronic sequences of the ABCA4 gene. Identified variants were confirmed by Sanger sequencing and assessed for pathogenicity by in silico analysis. RESULTS: Of the 42 variants detected by prescreening with the microarray, in silico analysis suggested that 34, found in 66 subjects, were disease-causing and 8, found in 13 subjects, were benign variants. We detected 42 variants by NGS, of which 39 were classified as disease-causing. Of these 39 variants, 31 were novel, including 16 missense, 7 splice-site-altering, 4 nonsense, 1 in-frame deletion, and 3 frameshift variants. Two or more disease-causing variants were confirmed in 37 (47%) of 79 patients, one disease-causing variant in 36 (46%) subjects, and no disease-causing variant in 6 (7%) individuals. CONCLUSIONS: Application of the NGS platform for ABCA4 screening enabled detection of the second disease-associated allele in approximately half of the patients in a British cohort where one mutation had been detected with the arrayed primer extension (APEX) array. The time- and cost-efficient NGS strategy is useful in screening large cohorts, which will be increasingly valuable with the advent of ABCA4-directed therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 40 c.4926C>G p.S1642R DC c.5041_5055del GTGGTTGCCATCTGC p.V1681_C1685del DC 2 41 c.4956T>G p.Y1652* DC 1 42 c.5018&#fe;2T>C Splice site DC 1 43 c.5461-10T>C DC c.6385A>G p.S2129G PDC 2 44 c.5461-10T>C DC 1 45 c.5461-10T>C DC 1 46 c.5461-10T>C DC 1 47 c.5461-10T>C DC 1 48 c.5461-10T>C DC 1 49 c.5461-10T>C DC 1 50 c.5461-10T>C DC 1 51 c.5585-1G>A Splice site DC 1 52 c.5714&#fe;5G>A Splice site DC c.6209C>G p.T2070R DC 2 53 c.5882G>A p.G1961E DC c.2686A>G p.K896E B 1 54 c.5882G>A p.G1961E DC c.3050&#fe;1G>C Splice site DC 2 55 c.5882G>A p.G1961E DC c.3392delC/3393C>G p.A1131Gfs DC 2 56 c.5882G>A p.G1961E DC c.4539&#fe;2T>G Splice site DC 2 57 c.5882G>A p.G1961E DC c.4552A>C p.S1518R DC 2 58 c.5882G>A p.G1961E DC c.5899-2delA Splice site DC 2 59 c.5882G>A p.G1961E DC 1 60 c.6079C>T p.L2027F DC c.1906C>T p.Q636* DC 2 61 c.6079C>T p.L2027F DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 62 c.6079C>T p.L2027F DC c.3370G>T p.D1124Y DC 2 63 c.6079C>T p.L2027F DC 1 64 c.6089G>A p.R2030Q DC c.4326C>A p.N1442K DC 2 65 c.6445C>T p.R2149* DC 1 66 c.6709A>C p.T2237P DC c.5899-3_5899-2delTA Splice site DC 2 67 c.2971G>C p.G991R B c.4538A>G p.Q1513R DC 1 68 c.3602T>G p.L1201R B c.1749G>C p.K583N DC 1 69 c.3602T>G p.L1201R B c.1982_1983insG p.A662fs DC 1 70 c.3602T>G p.L1201R B c.2972G>T p.G991V DC 1 71 c.4685T>C p.I1562T B c.3289A>T p.R1097* DC 1 72 c.6320G>A p.R2107H B c.2510T>C p.L837P DC 1 73 c.6320G>A p.R2107H B c.4352&#fe;1G>A Splice site DC 1 74 c.2701A>G p.T901A B 0 75 c.3602T>G p.L1201R B 0 76 c.4283C>T p.T1428M B 0 77 c.466A>G p.I156V B 0 78 c.466A>G p.I156V B 0 79 c.4715C>T p.T1572M B 0 Putative novel variants are shown in italics. Login to comment
63 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 30 c.4537_4538insC p.G1513fs 1 38 [ Briggs CE, et al. 19 ND False-negative in NGS in patient 38 31 c.4577C>T p.T1526M 1 39 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.910 No change ND db SNP (rs61750152) 33 c.4685T>C p.I1562T 1 71 [ [ Yatsenko, et al. 13 Tol. NA PRD 0.783 No change ND Benign 33 c.4715C>T p.T1572M 1 79 [ [ Pang CP and Lamm DS 23 Del. 0.02 B 0.326 No change ND db SNP (rs185093512) Benign 35 c.4926C>G p.S1642R 1 40 [ [ Birch DG, et al. 22 Tol. 0.68 B 0.116 No change ND db SNP (rs61753017) 35 c.4956T>G p.Y1652* 1 41 [ [ Fumagalli A, et al. 16 ND db SNP (rs61750561) IVS35 c.5018&#fe;2T>C Splice site 1 42 [ [ APEX Don. 81.2 54.3 WT site broken (33.07) ND 36 c.5113C>T p.R1705W 1 7 [ Ernest PJ, et al. 26 Del. NA PRD 0.996 Don. 46.5 73.3 No change ND IVS38 c.5461-10T>C 8 43, 44, 45, 46, 47, 48, 49, 50 [ [ Briggs CE, et al. 19 No change 3/13006 db SNP (rs1800728) IVS39 c.5585-1G>A Splice site 1 51 [ [ Shroyer NF, et al. 21 Acc. 86.3 57.4 WT site broken (33.53) ND IVS40 c.5714&#fe;5G>A Splice site 1 52 [ [ Cremers FP, et al. 8 Don. 85.5 73.3 Wild type site broken (14.23) ND 42 c.5882G>A p.G1961E 7 53, 54, 55, 56, 57, 58, 59 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.998 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T p.L2027F 4 60, 61, 62, 63 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 1.000 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A p.R2030Q 1 64 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.995 No change 8/13006 db SNP (rs61750641) 46 c.6320G>A p.R2107H 2 72, 73 [ [ Fishman GA, et al. 15 Del. 0.04 PRD 0.999 No change 91/13006 db SNP (rs62642564) Benign 47 c.6445C>T p.R2149* 1 65 [ [ Lewis RA, et al. 14 1/13006 db SNP (rs61750654) 48 c.6529G>A p.D2177N 1 19 [ Rivera A, et al. 17 Tol. 0.41 B 0.004 No change 116/13006 db SNP (rs1800555) Benign 48 c.6709A>C p.T2237P 1 66 [ [ APEX Del. NA POD 0.719 No change ND IVS48 c.6729&#fe;4_ &#fe;18del AGTTGGCCCTGGGGC Splice site 1 17 [ Littink KW, et al. 28 NA ND Splice-site alteration (described as splice site) includes the change expected to affect splicing, for example, when the splice donor or splice acceptor site is changed, and the change that might affect splicing, for example, changes close to the splice donor or splice acceptor site, or in the first or last nucleotide of an exon. SIFT (version 4.0.4) results are reported to be tolerant if tolerance index is ߥ0.05 or deleterious if tolerance index is <0.05. Login to comment

[hide] Identification of three ABCA4 sequence variations ... Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4. Utz VM, Chappelow AV, Marino MJ, Beight CD, Sturgill-Short GM, Pauer GJ, Crowe S, Hagstrom SA, Traboulsi EI
Identification of three ABCA4 sequence variations exclusive to African American patients in a cohort of patients with Stargardt disease.
Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4., [PMID:24011517]

Abstract [show]
PURPOSE: To describe the clinical and molecular findings in ten unrelated African American patients with Stargardt disease. DESIGN: Retrospective, observational case series. METHODS: We reviewed the clinical histories, examinations, and genotypes of 85 patients with molecular diagnoses of Stargardt disease. Three ABCA4 sequence variations identified exclusively in African Americans were evaluated in 300 African American controls and by in silico analysis. RESULTS: ABCA4 sequence changes were identified in 85 patients from 80 families, of which 11 patients identified themselves as African American. Of these 11 patients, 10 unrelated patients shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). The minor allele frequencies in the African American control population for each variation were 7.5%, 6.3%, and 2%, respectively. This is comparable to the allele frequency in African Americans in the Exome Variant Server. In contrast, the allele frequency of all three of these variations was less than or equal to 0.05% in European Americans. Although both c.3602T>G and c.3899G>A have been reported as likely disease-causing variations, one of our control patients was homozygous for each variant, suggesting that these are nonpathogenic. In contrast, the absence of c.6320G>A in the control population in the homozygous state, combined with the results of bioinformatics analysis, support its pathogenicity. CONCLUSIONS: Three ABCA4 sequence variations were identified exclusively in 10 unrelated African American patients: p.L1201R and p.R1300Q likely represent nonpathogenic sequence variants, whereas the p.R2107H substitution appears to be pathogenic. Characterization of population-specific disease alleles may have important implications for the development of genetic screening algorithms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 RESULTS: ABCA4 sequence changes were identified in 85 patients from 80 families, of which 11 patients identified themselves as African American.Of these 11 patients, 10 unrelated patients shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). Login to comment
10 CONCLUSIONS: Three ABCA4 sequence variations were identified exclusively in 10 unrelated African American patients: p.L1201R and p.R1300Q likely represent nonpathogenic sequence variants, whereas the p.R2107H substitution appears to be pathogenic. Login to comment
38 For p.R2107H, exons 46 and 47 were amplified together as one amplicon by PCR and analyzed. The forward primer sequence was 59 CCTTCTGTCAGCTCATCCTC CACA 39 and the reverse primer sequence was 59 CCAAGTGTCAATGGAGAACACAGG 39 . Login to comment
70 However, patient 5 possessed two additional sequence variations: c.618C>T (p.S206S), a synonymous sequence variation that has been found to cosegregate with disease in a family with Stargardt disease,41 and c.2546T>C (p.V849A).25 Patient 6 exhibited both a c.3113C>T mutation (p.A1038V), present in 15% of our cohort, and a c.1937&#fe;1G>C sequence variation that results in a splice site mutation in intron 13.27 The c.3113C>T mutation produces a biochemically altered protein product42 and has been detected in patients with Stargardt disease but not in control patients.18,20,25 The third sequence variation, c.6320 G>A (p.R2107H), existed as a heterozygous sequence variation in patients 7, 8, 9, and 10. Login to comment
82 DISCUSSION IN THE PRESENT STUDY, 10 UNRELATED AFRICAN AMERICAN patients with Stargardt disease shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). Login to comment
88 3113C>T (p.A1038V) 15 c.1937&#fe;1G>C (N/A) 0 7 c.6320G>A (p.R2107H) 0 c.IVS38-10T>C (N/A) 10 8 c.6320G>A (p.R2107H) 0 c.174C>G (p.N58K) 0 9 c.6320G>A (p.R2107H) 0 c.6286G>A (p.E2096K) 0 10 c.6320G>A (p.R2107H) 0 cDNA &#bc; complementary DNA; N/A &#bc; not applicable; % Popn &#bc; percentage of patients in the remaining population with the specific sequence variation; Pt &#bc; patient. Login to comment
94 In contrast to the c.3602T>G and c.3899G>A sequence variations, the c.6320G>A (p.R2107H) likely represents a pathogenic mutation. Login to comment
97 Allele Frequency of Sequence Variations Found in African American patients with Stargardt Disease in a Local African American Control Population and Corresponding Population Frequency in Those of African American and European Ancestry per the Exome Variant Server35 Sequence Variation and Amino Acid Substitution Allele Frequency in Control AA Patients (CEI) Allele Frequency in AA Population (EVS) Allele Frequency in European American Population (EVS) c.3602T>G (p.L1201R) 7.50% (n &#bc; 305) 9.35% (n &#bc; 2203) 0.05% (n &#bc; 4300) c.3899G>A (p.R1300Q) 6.30% (n &#bc; 301) 6.17% (n &#bc; 2203) 0.05% (n &#bc; 4300) c.6320G>A (p.R2107H) 2.00% (n &#bc; 294) 2.04% (n &#bc; 2203) 0.01% (n &#bc; 4300) AA &#bc; African American; CEI &#bc; Cole Eye Institute; EVS &#bc; Exome Variant Server; N &#bc; number of alleles tested. Login to comment
102 Of note, our control population of African Americans had a normal retinal phenotype, whereas the purpose of the Exome Variant Server is to provide general population reference, and ocular phenotyping was not part of the project; therefore, the ocular phenotype of the individual homozygous for c.6320G>A (p.R2107H) is unknown. Login to comment
116 In contrast to previous reports of potential pathogenicity, our study of controls and bioinformatic analyses suggests that c.3602T>G (p.L1201R) and c.3899G>A (p.R1300Q) are not directly pathogenic, whereas c.6320G>A (p.R2107H) likely alters protein structure and therefore is pathogenic. Login to comment
119 In Silico Analysis of ABCA4 Missense Variants Identified in African American Patients with Stargardt Disease Sequence Variation (Amino Acid Substitution) Polymorphism Phenotyping V2 PMut Sorting Intolerant from Tolerant Human Var Score Prediction NN output Reliability Prediction Score Prediction c.3602T>G (p.L1201R) 0.031 Benign 0.7702 5 Pathologic 0.52 Tolerant c.3899G>A (p.R1300Q) 0.143 Benign 0.6548 3 Pathologic 0.61 Tolerant c.6320G>A (p.R2107H) 1.00 Probably damaging 0.8993 7 Pathologic 0.00 Intolerant NN &#bc; neural network; V &#bc; version; Var &#bc; variability. Login to comment

[hide] Quantitative fundus autofluorescence distinguishes... Ophthalmology. 2015 Feb;122(2):345-55. doi: 10.1016/j.ophtha.2014.08.017. Epub 2014 Oct 3. Duncker T, Tsang SH, Lee W, Zernant J, Allikmets R, Delori FC, Sparrow JR
Quantitative fundus autofluorescence distinguishes ABCA4-associated and non-ABCA4-associated bull's-eye maculopathy.
Ophthalmology. 2015 Feb;122(2):345-55. doi: 10.1016/j.ophtha.2014.08.017. Epub 2014 Oct 3., [PMID:25283059]

Abstract [show]
PURPOSE: Quantitative fundus autofluorescence (qAF) and spectral-domain optical coherence tomography (SD OCT) were performed in patients with bull's-eye maculopathy (BEM) to identify phenotypic markers that can aid in the differentiation of ABCA4-associated and non-ABCA4-associated disease. DESIGN: Prospective cross-sectional study at an academic referral center. SUBJECTS: Thirty-seven BEM patients (age range, 8-60 years) were studied. All patients exhibited a localized macular lesion exhibiting a smooth contour and qualitatively normal-appearing surrounding retina without flecks. Control values consisted of previously published data from 277 healthy subjects (374 eyes; age range, 5-60 years) without a family history of retinal dystrophy. METHODS: Autofluorescence (AF) images (30 degrees , 488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference to account for variable laser power and detector sensitivity. The grey levels (GLs) from 8 circularly arranged segments positioned at an eccentricity of approximately 7 degrees to 9 degrees in each image were calibrated to the reference (0 GL), magnification, and normative optical media density to yield qAF. In addition, horizontal SD OCT images through the fovea were obtained. All patients were screened for ABCA4 mutations using the ABCR600 microarray, next-generation sequencing, or both. MAIN OUTCOME MEASURES: Quantitative AF, correlations between AF and SD OCT, and genotyping for ABCA4 variants. RESULTS: ABCA4 mutations were identified in 22 patients, who tended to be younger (mean age, 21.9+/-8.3 years) than patients without ABCA4 mutations (mean age, 42.1+/-14.9 years). Whereas phenotypic differences were not obvious on the basis of qualitative fundus AF and SD OCT imaging, with qAF, the 2 groups of patients were clearly distinguishable. In the ABCA4-positive group, 37 of 41 eyes (19 of 22 patients) had qAF8 of more than the 95% confidence interval for age. Conversely, in the ABCA4-negative group, 22 of 26 eyes (13 of 15 patients) had qAF8 within the normal range. CONCLUSIONS: The qAF method can differentiate between ABCA4-associated and non-ABCA4-associated BEM and may guide clinical diagnosis and genetic testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 [L541P; A1038V] 438 432 16 M 25 White 0.60 0.60 p.S84fs p.R2107H 294 17 F 24 Black 0.70 0.88 p.G991R p.L1138P 321 326 18 M 26 White 0.00y 0.00y p.R1300* p.R2106C 419 412 19 M 11 White 0.40z 0.40z p.W821R p.C2150Y 304 296 20 F 16 White 0.70 0.40 p.K1547* p.R2030Q 481 513 21 F 13 White 1.30 1.00 pR1108C p.Q1412* 511 528 22 F 18 White 0.00 0.00 p.G863A c.5898&#fe;1G/A 465 431 Mutations in Other Genes 23 F 16 White 0.40 0.48 GUCY2D e p.R838H 152 165 24 M 53 Black 0.88 0.88 CNGA3 e p. Login to comment

[hide] Early-onset stargardt disease: phenotypic and geno... Ophthalmology. 2015 Feb;122(2):335-44. doi: 10.1016/j.ophtha.2014.08.032. Epub 2014 Oct 17. Lambertus S, van Huet RA, Bax NM, Hoefsloot LH, Cremers FP, Boon CJ, Klevering BJ, Hoyng CB
Early-onset stargardt disease: phenotypic and genotypic characteristics.
Ophthalmology. 2015 Feb;122(2):335-44. doi: 10.1016/j.ophtha.2014.08.032. Epub 2014 Oct 17., [PMID:25444351]

Abstract [show]
OBJECTIVE: To describe the phenotype and genotype of patients with early-onset Stargardt disease. DESIGN: Retrospective cohort study. PARTICIPANTS: Fifty-one Stargardt patients with age at onset </=10 years. METHODS: We reviewed patient medical records for age at onset, medical history, initial symptoms, best-corrected visual acuity (BCVA), ophthalmoscopy, fundus photography, fundus autofluorescence (FAF), fluorescein angiography (FA), spectral-domain optical coherence tomography (SD-OCT), and full-field electroretinography (ffERG). The ABCA4 gene was screened for mutations. MAIN OUTCOME MEASURES: Age at onset, BCVA, fundus appearance, FAF, FA, SD-OCT, ffERG, and presence of ABCA4 mutations. RESULTS: The mean age at onset was 7.2 years (range, 1-10). The median times to develop BCVA of 20/32, 20/80, 20/200, and 20/500 were 3, 5, 12, and 23 years, respectively. Initial ophthalmoscopy in 41 patients revealed either no abnormalities or foveal retinal pigment epithelium (RPE) changes in 10 and 9 patients, respectively; the other 22 patients had foveal atrophy, atrophic RPE lesions, and/or irregular yellow-white fundus flecks. On FA, there was a "dark choroid" in 21 out of 29 patients. In 14 out of 50 patients, foveal atrophy occurred before flecks developed. On FAF, there was centrifugal expansion of disseminated atrophic spots, which progressed to the eventual profound chorioretinal atrophy. Spectral-domain OCT revealed early photoreceptor damage followed by atrophy of the outer retina, RPE, and choroid. On ffERG in 26 patients, 15 had normal amplitudes, and 11 had reduced photopic and/or scotopic amplitudes at their first visit. We found no correlation between ffERG abnormalities and the rate of vision loss. Thirteen out of 25 patients had progressive ffERG abnormalities. Finally, genetic screening of 44 patients revealed >/=2 ABCA4 mutations in 37 patients and single heterozygous mutations in 7. CONCLUSIONS: In early-onset Stargardt, initial ophthalmoscopy can reveal no abnormalities or minor retinal abnormalities. Yellow-white flecks can be preceded by foveal atrophy and may be visible only on FAF. Although ffERG is insufficient for predicting the rate of vision loss, abnormalities can develop. Over time, visual acuity declines rapidly in parallel with progressive retinal degeneration, resulting in profound chorioretinal atrophy. Thus, early-onset Stargardt lies at the severe end of the spectrum of ABCA4-associated retinal phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
143 1 1 1, 23, 32, 41, 43 c.5762_5763dup p.Ala1922fs 1 1 34 c.5882G>A p.Gly1961Glu 5 6 18, 31, 32, 44, 49 c.6320G>A p.Arg2107His 2 2 8, 31, 40, 45, 50 c.6411T>A p.Cys2137* 1 1 34 c.6543_6578del p.Leu2182_Phe2193del 1 1 1 del &#bc; deletion; dup &#bc; duplication; fs &#bc; frame shift. Login to comment

[hide] Common synonymous variants in ABCA4 are protective... BMC Ophthalmol. 2015 Mar 6;15:18. doi: 10.1186/s12886-015-0008-0. Grassmann F, Bergholz R, Mandl J, Jagle H, Ruether K, Weber BH
Common synonymous variants in ABCA4 are protective for chloroquine induced maculopathy (toxic maculopathy).
BMC Ophthalmol. 2015 Mar 6;15:18. doi: 10.1186/s12886-015-0008-0., [PMID:25884411]

Abstract [show]
BACKGROUND: Chloroquine (CQ) and hydroxychloroquine (HCQ) are used to treat auto-immune related diseases such as rheumatoid arthritis (RA) or systemic lupus erythematosus. Both drugs however can cause retinal toxicity eventually leading to irreversible maculopathy and retinopathy. Established risk factors are duration and dosage of treatment while the involvement of genetic factors contributing to toxic maculopathy is largely unclear. To address the latter issue, this study aimed to expand on earlier efforts by (1) evaluating risk-altering variants known to be associated with age-related macular degeneration (AMD), a frequent maculopathy in individuals over 55 years of age, and (2) determining the contribution of genetic variants in the coding sequence of the ABCA4 gene. METHODS: The ABCA4 gene was analyzed by deep sequencing technology using a personal genome machine (Ion Torrent) with 200 bp read length. Assessment of AMD variants was done by restriction enzyme digestion of PCR products and TaqMan SNP genotyping. Effect sizes, p-values and confidence intervals of common variants were evaluated by logistic regression (Firth's bias corrected). To account for multiple testing, p-values were adjusted according to the false discovery rate. RESULTS: We found no effects of known AMD-associated variants on the risk of toxic maculopathy. In contrast, we report a statistically significant association of common variants in the ABCA4 gene with retinal disease, assessed by a score-based variance-component test (PSKAT = 0.0055). This association remained significant after adjustment for environmental factors like age and duration of medication and was driven by three common variants in ABCA4 (c.5682G > C, c.5814A > G, c.5844A > G), all conferring a reduced risk for toxic maculopathy. CONCLUSIONS: Our findings demonstrate that minor alleles of common genetic variants in ABCA4 significantly reduce susceptibility to develop toxic maculopathy under CQ treatment. A refined risk profile based on genetic and environmental factors may have implications for revised recommendations in CQ as well as HCQ treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 In this report, however, patient #7 carried three pathologic mutations known to be associated with Stargardt disease (Arg2107His and Leu1201Arg/Arg2107His in a cis configuration). Login to comment

[hide] Objective Analysis of Hyperreflective Outer Retina... Invest Ophthalmol Vis Sci. 2015 Jul;56(8):4662-7. doi: 10.1167/iovs.15-16955. Park JC, Collison FT, Fishman GA, Allikmets R, Zernant J, Liu M, McAnany JJ
Objective Analysis of Hyperreflective Outer Retinal Bands Imaged by Optical Coherence Tomography in Patients With Stargardt Disease.
Invest Ophthalmol Vis Sci. 2015 Jul;56(8):4662-7. doi: 10.1167/iovs.15-16955., [PMID:26207301]

Abstract [show]
PURPOSE: To develop and apply an objective algorithm for analyzing outer retinal layers imaged by spectral-domain optical coherence tomography (SD-OCT) in patients with Stargardt disease (STGD1). METHODS: Horizontal macular B-scans were acquired from 20 visually normal controls and 20 genetically confirmed stage 1 STGD1 patients. The number of outer retinal bands was quantified using a semiautomated algorithm that detected bands using the second derivative of longitudinal reflectivity profiles. The present analysis focused on the three outermost bands, currently associated with the ellipsoid zone (EZ), cone outer segment interdigitation zone (IZ), and retinal pigment epithelium (RPE) complex. RESULTS: The RPE complex and EZ bands were detected throughout the B-scan in all controls. The RPE complex was detected throughout the B-scan in all patients, but was atrophic appearing in some locations. The EZ band was detected only outside the central lesion. Interdigitation zone band detection varied as a function of eccentricity for both groups, with detection for controls being highest in the para- and perifovea and lowest in the fovea and near periphery. In patients, the IZ band was generally not present in the fovea or para- or perifovea due to the central lesion. Outside of the lesion, the IZ band was detected in 26% of patients (mean detection across the near periphery), which was approximately half of the detection in controls. CONCLUSIONS: An objective approach for quantifying the number of outer retinal OCT bands found reduced IZ detection in STGD1 patients. This occurred even outside the central lesion, demonstrating an inability to image the IZ, possibly due to enhanced RPE reflectivity or abnormal outer retinal structure.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 of ABCA4 Mutations Mutation(s) 1 13 M 20/70 2 p.[(L541P; A1038V)] (;)c.5714&#fe;5G>A 2 15 F 20/60 2 c.3050&#fe;5G>A(;)p.(G1961E) 3 15 F 20/80 2 p.[(R1129L(;)A1773V)] 4 16 F 10/1001 Sister of patient 3 5 20 M 20/160&#fe;2 2 p.[(R1129C(;)R2077W)] 6 20 F 20/1601 2 p.[(G1961E(;)R2040*)] 7 21 M 20/40 2 p.[(R219T(;)W439*(;)G863A)] 8 23 F 10/100 2 c.5461-10T>C(;)p.(G1961E) 9 23 F 20/1001 2 c.302&#fe;1G>A(;)p.(R2107H) 10 28 F 20/1001 2 c.5461-10T>C(;)p.(G1961E) 11 30 F 20/25&#fe;2 1 p.[(R2077W)];[?] Login to comment

[hide] Flecks in Recessive Stargardt Disease: Short-Wavel... Invest Ophthalmol Vis Sci. 2015 Jul;56(8):5029-39. doi: 10.1167/iovs.15-16763. Sparrow JR, Marsiglia M, Allikmets R, Tsang S, Lee W, Duncker T, Zernant J
Flecks in Recessive Stargardt Disease: Short-Wavelength Autofluorescence, Near-Infrared Autofluorescence, and Optical Coherence Tomography.
Invest Ophthalmol Vis Sci. 2015 Jul;56(8):5029-39. doi: 10.1167/iovs.15-16763., [PMID:26230768]

Abstract [show]
PURPOSE: We evaluated the incongruous observation whereby flecks in recessive Stargardt disease (STGD1) can exhibit increased short-wavelength autofluorescence (SW-AF) that originates from retinal pigment epithelium (RPE) lipofuscin, while near-infrared AF (NIR-AF), emitted primarily from RPE melanin, is usually reduced or absent at fleck positions. METHODS: Flecks in SW- and NIR-AF images and spectral-domain optical coherence tomography (SD-OCT) scans were studied in 19 STGD1 patients carrying disease-causing ABCA4 mutations. Fleck spatial distribution and progression were recorded in serial AF images. RESULTS: Flecks observed in SW-AF images typically colocalized with darkened foci in NIR-AF images; the NIR-AF profiles were larger. The decreased NIR-AF signal from flecks preceded apparent changes in SW-AF. Spatiotemporal changes in fleck distribution usually progressed centrifugally, but in one case centripetal expansion was observed. Flecks in SW-AF images corresponded to hyperreflective deposits that progressively traversed photoreceptor-attributable bands in SD-OCT images. Outer nuclear layer (ONL) thickness negatively correlated with expansion of flecks from outer to inner retina. CONCLUSIONS: In the healthy retina, RPE lipofuscin fluorophores form in photoreceptor cells but are transferred to RPE; thus the SW-AF signal from photoreceptor cells is negligible. In STGD1, NIR-AF imaging reveals that flecks are predominantly hypofluorescent and larger and that NIR-AF darkening occurs prior to heightened SW-AF signal. These observations indicate that RPE cells associated with flecks in STGD1 are considerably changed or lost. Spectral-domain OCT findings are indicative of ongoing photoreceptor cell degeneration. The bright SW-AF signal of flecks likely originates from augmented lipofuscin formation in degenerating photoreceptor cells impaired by the failure of RPE.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 [5898&#fe;1G>A 17 F 35.33 Caucasian 0.9 0.1 p. [N1799D] 18* F 52.33 African American 0.2 0.3 p. [W339G]; [R2107H] 19 F 54.03 Caucasian 0.3 0.2 p. [R2077W] BCVA, best-corrected visual acuity; logMAR, logarithm of the minimum angle of resolution; OD, right eye; OS, left eye. Login to comment

[hide] Recessive Stargardt disease phenocopying hydroxych... Graefes Arch Clin Exp Ophthalmol. 2015 Aug 28. Noupuu K, Lee W, Zernant J, Greenstein VC, Tsang S, Allikmets R
Recessive Stargardt disease phenocopying hydroxychloroquine retinopathy.
Graefes Arch Clin Exp Ophthalmol. 2015 Aug 28., [PMID:26311262]

Abstract [show]
PURPOSE: To describe a series of patients with Stargardt disease (STGD1) exhibiting a phenotype usually associated with hydroxychloroquine (HCQ) retinopathy on spectral domain-optical coherence tomography (SD-OCT). METHODS: Observational case series from Columbia University Medical Center involving eight patients with genetically-confirmed STGD1. Patients selected for the study presented no history of HCQ use. Horizontal macular SD-OCT scans and accompanying 488-nm autofluorescence (AF) images, color fundus photographs, and full-field electroretinograms were analyzed. RESULTS: All study patients exhibited an abrupt thinning of the parafoveal region or disruption of the outer retinal layers on SD-OCT resembling the transient HCQ retinopathy phenotype. Funduscopy and AF imaging revealed variations of bull's eye maculopathy (BEM). Five patients exhibited local fleck-like deposits around the lesion. Genetic screening confirmed two disease-causing ABCA4 mutations in five patients and one mutation in three patients. CONCLUSIONS: A transient SD-OCT phenotype ascribed to patients with HCQ retinopathy is associated with an early subtype of STGD1. This finding may also present with HCQ retinopathy-like BEM lesions on AF imaging and funduscopy. A possible phenotypic overlap is unsurprising, given certain shared mechanistic disease processes between the two conditions. A thorough work-up, including screening of genes that are causal in retinal dystrophies associated with foveal sparing, may prevent misdiagnosis of more ambiguous cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 [5461-10T > C] P2 55, F White 20/20 20/20 Mottling + flecks Mottling + flecks p. [A1357V]; [G1961E] P3 57, M African-American 20/20 20/20 BEM + flecks BEM + flecks p. [R2107H] P4 10, F White 20/30 20/25 BEM + flecks BEM + flecks p. [E160*]; [R1108C] P5 26, F African-American 20/30 20/20 Mottling + flecks Mottling + flecks p. [R2107H]; [E526A] P6 19, F Asian-Caucasian 20/25 20/25 BEM BEM p. [R602W] P7 26, M African-Arab 20/20 20/20 BEM BEM p. [R1300*]; [R2106C] P8 25, M White 20/20 20/40 BEM BEM p. [Q1003*]; [G1961E] Abbreviations: M male, F female, BCVA best-corrected visual acuity, OD right eye, OS left eye, BEM bull`s eye maculopathy Fig. 1 Thinning of the parafoveal region with relative foveal sparing presenting as the hydroxychloroquine retinopathy- associated parafoveal outer retina thinning phenotype in patients with recessive Stargardt disease (STGD1). Login to comment
109 In fact, one of the two patients was homozygous for the missense mutation p.R2107H, but was thought to have HCQ maculopathy due to the classical appearance of this retinopathy in addition to the lack of dark choroid and flecks characteristic of STGD1. Login to comment
110 Interestingly, the p.R2107H mutation was also present in two of the eight patients with phenotypes resembling HCQ retinopathy in our study. Login to comment

[hide] Quantitative Fundus Autofluorescence and Optical C... Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7274-85. doi: 10.1167/iovs.15-17371. Duncker T, Stein GE, Lee W, Tsang SH, Zernant J, Bearelly S, Hood DC, Greenstein VC, Delori FC, Allikmets R, Sparrow JR
Quantitative Fundus Autofluorescence and Optical Coherence Tomography in ABCA4 Carriers.
Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7274-85. doi: 10.1167/iovs.15-17371., [PMID:26551331]

Abstract [show]
PURPOSE: To assess whether carriers of ABCA4 mutations have increased RPE lipofuscin levels based on quantitative fundus autofluorescence (qAF) and whether spectral-domain optical coherence tomography (SD-OCT) reveals structural abnormalities in this cohort. METHODS: Seventy-five individuals who are heterozygous for ABCA4 mutations (mean age, 47.3 years; range, 9-82 years) were recruited as family members of affected patients from 46 unrelated families. For comparison, 57 affected family members with biallelic ABCA4 mutations (mean age, 23.4 years; range, 6-67 years) and two noncarrier siblings were also enrolled. Autofluorescence images (30 degrees , 488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference. The gray levels (GLs) of each image were calibrated to the reference, zero GL, magnification, and normative optical media density to yield qAF. Horizontal SD-OCT scans through the fovea were obtained and the thicknesses of the outer retinal layers were measured. RESULTS: In 60 of 65 carriers of ABCA4 mutations (age range, 9-60), qAF levels were within normal limits (95% confidence level) observed for healthy noncarrier subjects, while qAF levels of affected family members were significantly increased. Perifoveal fleck-like abnormalities were observed in fundus AF images in four carriers, and corresponding changes were detected in the outer retinal layers in SD-OCT scans. Thicknesses of the outer retinal layers were within the normal range. CONCLUSIONS: With few exceptions, individuals heterozygous for ABCA4 mutations and between the ages of 9 and 60 years do not present with elevated qAF. In a small number of carriers, perifoveal fleck-like changes were visible.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 [L541P;A1038V] 0.00 0.00 OS 342 326 S23.2 F 37.4 White Sister p.G1961E 0.00 0.00 OS 220 n/a S24.2 F 37.5 White Daughter c.247_250dup 0.00 0.00 OD 298 288 S25.3 F 49.9 Black Mother p.R2107H 0.88 0.10 n/a n/a 385 S26.3 F 58.2 White Mother p.G1961E 0.00 0.00 OD 238 297 S26.4 M 57.2 White Father p. Login to comment
70 [L541P;A1038V] p.L2027F 0.30 0.40 591 608 P 23.1ߤ F 26.0 White p.G1961E c.5196&#fe;1056A>G 0.40 0.70 379 344 P 24.1 F 52.0 White c.247_250dup 0.80 0.00 n/a n/a P 25.1 F 26.0 Black p.E526A p.R2107H 0.48 0.00 507 536 P 25.2 F 25.9 Black p.E526A p.R2107H 0.18 0.00 461 468 P 26.1&#a7; F 25.6 White p. Login to comment