ABCMdb

ABCA4 p.Leu2027Phe

ClinVar:	c.6079C>T , p.Leu2027Phe D , Pathogenic
Predicted by SNAP2:	A: D (53%), C: N (57%), D: D (75%), E: D (59%), F: D (95%), G: D (75%), H: N (53%), I: N (87%), K: D (63%), M: D (85%), N: D (63%), P: D (66%), Q: N (53%), R: D (63%), S: D (59%), T: N (57%), V: N (82%), W: D (66%), Y: N (61%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: N, K: D, M: N, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Correlation between photoreceptor layer integrity ... Invest Ophthalmol Vis Sci. 2012 Jul 3;53(8):4409-15. doi: 10.1167/iovs.11-8201. Print 2012 Jul. Testa F, Rossi S, Sodi A, Passerini I, Di Iorio V, Della Corte M, Banfi S, Surace EM, Menchini U, Auricchio A, Simonelli F
Correlation between photoreceptor layer integrity and visual function in patients with Stargardt disease: implications for gene therapy.
Invest Ophthalmol Vis Sci. 2012 Jul 3;53(8):4409-15. doi: 10.1167/iovs.11-8201. Print 2012 Jul., [PMID:22661472]

Abstract [show]
PURPOSE: To perform a clinical characterization of Stargardt patients with ABCA4 gene mutation, and to investigate the correlation between the inner and outer segment (IS/OS) junction morphology and visual acuity, fundus lesions, electroretinogram abnormalities, and macular sensitivity. METHODS: Sixty-one patients with Stargardt disease (STGD) were given a comprehensive ophthalmic examination. Inner-outer photoreceptor junction morphology evaluated by spectral-domain optical coherence tomography was correlated with visual acuity, fundus lesions, fundus autofluorescence, full-field and multifocal electroretinography responses, and microperimetric macular sensitivities. We classified STGD patients into three groups: (1) IS/OS junction disorganization in the fovea, (2) IS/OS junction loss in the fovea, and (3) extensive loss of IS/OS junction. Mutation analysis of the ABCA4 gene was carried out by sequencing the complete coding region. RESULTS: A significant difference in visual acuity was observed between IS/OS groups 1 and 2 and between IS/OS groups 2 and 3 (P < 0.0001). A significant difference in microperimetry sensitivity was observed between IS/OS groups 2 and 3, and between IS/OS groups 1 and 3 (P < 0.0001). There was also a statistically significant correlation between IS/OS abnormalities and the extent of fundus lesions (Spearman P </= 0.01), as well as with the type of ERG and multifocal ERG results (Spearman P </= 0.01). Finally, the degree of IS/OS junction preservation showed a statistically significant correlation with the extension of foveal abnormalities assessed by fundus autofluorescence imaging (Spearman P </= 0.01). The G1961E mutation was more frequent in the patients without extensive loss of IS/OS junction (P = 0.01) confirming its association with a milder STGD phenotype. CONCLUSIONS: The results of this study suggest that a comprehensive approach in the examination of Stargardt patients has the potential to improve the understanding of vision loss and may provide a sensitive measure to evaluate the efficacy of future experimental therapies in patients with STGD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundus† FAF‡ ERG§ mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35þ2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35þ2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35þ2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45þ1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40þ5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35þ2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40þ5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35þ2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35þ2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40þ5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40þ5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35þ2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40þ5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45þ1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45þ1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35þ2t > c IVS40þ5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45þ1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram. Login to comment
67 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundusߤ FAFߥ ERG&#a7; mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35&#fe;2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35&#fe;2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35&#fe;2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45&#fe;1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40&#fe;5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35&#fe;2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40&#fe;5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35&#fe;2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35&#fe;2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40&#fe;5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40&#fe;5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35&#fe;2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40&#fe;5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45&#fe;1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45&#fe;1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35&#fe;2t > c IVS40&#fe;5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45&#fe;1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram. Statistics Our set of data is described by continuous (BCVA, OCT foveal thickness, and macular sensitivities) and categorical (fundus, FAF, IS/ OS, ERG, and mfERG groups) variables. Login to comment

[hide] Stargardt macular dystrophy: common ABCA4 mutation... Mol Vis. 2012;18:280-9. Epub 2012 Feb 1. Roberts LJ, Nossek CA, Greenberg LJ, Ramesar RS
Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients.
Mol Vis. 2012;18:280-9. Epub 2012 Feb 1., [PMID:22328824]

Abstract [show]
PURPOSE: Based on the previous indications of founder ATP-binding cassette sub-family A member 4 gene (ABCA4) mutations in a South African subpopulation, the purpose was to devise a mechanism for identifying common disease-causing mutations in subjects with ABCA4-associated retinopathies (AARs). Facilitating patient access to this data and determining the frequencies of the mutations in the South African population would enhance the current molecular diagnostic service offered. METHODS: The majority of subjects in this study were of Caucasian ancestry and affected with Stargardt macular dystrophy. The initial cohort consisted of DNA samples from 181 patients, and was screened using the ABCR400 chip. An assay was then designed to screen a secondary cohort of 72 patients for seven of the most commonly occurring ABCA4 mutations in this population. A total of 269 control individuals were also screened for the seven ABCA4 mutations. RESULTS: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. The newly designed genetic assay identified two of the seven disease-associated mutations in 28/72 patients in a secondary patient cohort. In the control cohort, 12/269 individuals were found to be heterozygotes, resulting in an estimated background frequency of these mutations in this particular population of 4.46 per 100 individuals. CONCLUSIONS: The relatively high detection rate of seven ABCA4 mutations in the primary patient cohort led to the design and subsequent utility of a multiplex assay. This assay can be used as a viable screening tool and to reduce costs and laboratory time. The estimated background frequency of the seven ABCA4 mutations, together with the improved diagnostic service, could be used by counselors to facilitate clinical and genetic management of South African families with AARs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Results: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. Login to comment
52 Four of the mutations were detected with SNaPshot PCR (p.Cys1490Tyr, p.Arg602Trp, c.5461-10T>C, and p.Leu2027Phe mutations; Table 2, Figure 1, Figure 2, and Figure 3) using the SNaPshot® Multiplex Ready Reaction Mix (Applied Biosystems, Warrington, UK), resolved on the ABI 3100 Genetic Analyzer (Applied Biosystems) and subsequently analyzed using the GeneMapper 3.0 GeneScan software (Applied Biosystems). Login to comment
61 Exon (mutation) Primer 5'-3' Annealing temperature Mutation detection technique Exon 5 (p.Arg152*) F: gacccatttccccttcaac 60 °C dHPLC, Cycle sequencing using the reverse primer R: aggctgggtgcttccctc Exon 6 (c.768G>T) F: ggtgtctttcctaccacag 57.9 °C dHPLC, Cycle sequencing using the forward primer R: aggaatcaccttgcaattgg Exon 13 (p.Arg602Trp) F: agctatccaagcccgttcc 63 °C SNaPshot PCR R: ccattagcgtgtcatggag Exon 17 (p.Gly863Ala) F: ctgcggtaaggtaggataggg 60 °C Allele-specific PCR R: cacaccgtttacatagagggc Exon 30 (p.Cys1490Tyr) F: gtcagcaactttgaggctg 63 °C SNaPshot PCR R: tccctctgtggcaggcag Intron38/Exon39 (c.5461-10T>C) F: gccccacctgctgaagag 63 °C SNaPshot PCR R: tcccagctttggacccag Exon 44 (p.Leu2027Phe) F: gaagcttctccagccctagc 63 °C SNaPshot PCR R: tgcactctcatgaaacaggc TABLE 2. Login to comment
63 Exon (mutation) Primer length (bp) with tail Primer sequence (with tail, 5'-3')* 13 (p.Arg602Trp) 34 R: tgttccagtgccacgaacccgccccagatgtacc 30 (p.Cys1490Tyr) 32 R: cttcgtggttactgagcttctccctggtgctg 39 (Intron 38) (c.5461-10T>C) 37 F: ccgatgtagttgaccccgtttccaacagtcctacttc 44 (p.Leu2027Phe) 41 R: tactctggatcttagtaggtaaagatgttctcgtcctgtga *ThenucleotidesequenceinboldisthesequencedesignedtobindcomplementarytothegenomicDNAsequence.Thenucleotide sequence not written in bold is the random nucleotide tail added to the primer sequence. Figure 1. Login to comment
73 However, seven mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a significantly higher frequency, compared to the other variants in the cohort (Table 4). Login to comment
91 An electropherogram of the multiplex SNaPshot reaction showing the results obtained for a sample that is heterozygous for the p.Leu2027Phe mutation. Login to comment
95 The p.Leu2027Phe alleles are represented by blue and green peaks at 45 bp and 46 bp, respectively. Login to comment
101 Functional analysis of the Nucleotide Binding Domain 2 of ABCA4, which contains the p.Leu2027Phe mutation, has indicated that mutations in this domain cause inhibition of ATP hydrolysis [14]. Login to comment
139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment
142 The results obtained from the control cohort screening indicate that the carrier frequency of the p.Cys1490Tyr, p.Arg602Trp, and p.Gly863Ala mutations is slightly higher compared to the other mutations (p.Leu2027Phe, c.768G>T, and p.Arg152*), with the c.5461-10T>C mutation not detected at all. Login to comment
166 Mutant alleles Cohort p.Cys1490Tyr p.Arg602Trp p.Leu2027Phe c.5461-10T>C c.768G>T p.Gly863Ala p.Arg152* Patient (n=72; 144 alleles) 16 (11.11%) 10 (6.94%) 12 (8.33%) 13 (9.03%) 13 (9.03%) 7 (4.86%) 7 (4.86%) Control (total; n=269; 538 alleles) 2 (0. Login to comment

[hide] Quantification of peripapillary sparing and macula... Invest Ophthalmol Vis Sci. 2011 Oct 10;52(11):8006-15. Print 2011. Burke TR, Rhee DW, Smith RT, Tsang SH, Allikmets R, Chang S, Lazow MA, Hood DC, Greenstein VC
Quantification of peripapillary sparing and macular involvement in Stargardt disease (STGD1).
Invest Ophthalmol Vis Sci. 2011 Oct 10;52(11):8006-15. Print 2011., [PMID:21873672]

Abstract [show]
PURPOSE: To quantify and compare structure and function across the macula and peripapillary area in Stargardt disease (STGD1). METHODS: Twenty-seven patients (27 eyes) and 12 age-similar controls (12 eyes) were studied. Patients were classified on the basis of full-field electroretinogram (ERG) results: Fundus autofluorescence (FAF) and spectral domain-optical coherence tomography (SD-OCT) horizontal line scans were obtained through the fovea and peripapillary area. The thicknesses of the outer nuclear layer plus outer plexiform layer (ONL+), outer segment (OS), and retinal pigment epithelium (RPE) were measured through the fovea, and peripapillary areas from 1 degrees to 4 degrees temporal to the optic disc edge using a computer-aided, manual segmentation technique. Visual sensitivities in the central 10 degrees were assessed using microperimetry and related to retinal layer thicknesses. RESULTS: Compared to the central macula, the differences between controls and patients in ONL+, OS, and RPE layer thicknesses were less in the nasal and temporal macula. Relative sparing of the ONL+ and/or OS layers was detected in the nasal (i.e., peripapillary) macula in 8 of 13 patients with extramacular disease on FAF; relative functional sparing was also detected in this subgroup. All 14 patients with disease confined to the central macula, as detected on FAF, showed ONL+ and OS layer thinning in regions of normal RPE thickness. CONCLUSIONS: Relative peripapillary sparing was detected in STGD1 patients with extramacular disease on FAF. Photoreceptor thinning may precede RPE degeneration in STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 Summary of Clinical, Demographic, and Genetic Data Patient Sex Age at Exam (y) Eye VA BCEA 1 SD (deg 2 ) Eccentricity of PRL (deg) ERG Group FAF Abnormalities Allele 1 Allele 2 Allele 3 Distribution Peripapillary Area 1 F 43 OS 20/20 0.73 0 II M - A1799D ND ND 2 M 30 OS 20/150 3.21 6 I M - T1253M G1961E ND 3 F 55 OD 20/30 1.82 0 I EM - G863A IVS28af9;5 Gb0e;T ND 4 M 44 OD 20/25 0.65 0 I M - E161K ND ND 5.1 F 24 OD 20/200 1.57 1 I M - L541P/A1038V G1961E ND 5.2 F 22 OD 20/30 2.74 1 I M - L541P/A1038V G1961E ND 6.1 F 21 OD 20/150 2.01 1 I M - L541P/A1038V G1961E ND 6.2 F 18 OS 20/100 3.09 4 I M - L541P/A1038V G1961E ND 7 F 27 OS 20/400 2.97 9* II EM Peripapillary atrophy L2027F G851D ND 8 M 34 OS 20/100 2.16 4 I M - G1961E G1961E ND 9 M 20 OS 20/150 2.77 4 I M - IVS20af9;5 Gb0e;A G1961E ND 10 F 23 OS 20/150 9.05 5 I M - L541P/A1038V I1846T ND 11 M 59 OS 20/100 6.52 10 II EM - P1380L S1696N ND 12 M 49 OD 20/150 9.97 1 I EM Nasalaf9;temporal flecks R1108H P1380L ND 13 M 47 OS 20/80 5.62 7 I EM - G863A Y106X ND 14 F 42 OD 20/200 9.53 9 I EM Temporal flecks N965S ND ND 15 M 14 OD 20/200 23.84 1 II EM Nasal flecks IVS38-10 Tb0e;C IVS40af9;5 Gb0e;A ND 16 M 52 OS 20/20 1.3 0 I M - IVS38-10 Tb0e;C ND ND 17 M 34 OS 20/30 2.8 1 I M - L541P/A1038V G1961E ND 18 F 33 OD 20/100 6 6 I M - G1961E R2077W ND 19 F 22 OS 20/60 11 4 I M - A854T A1038V C2150Y 20 F 34 OS 20/200 14.2 14 I EM - G1961E ND ND 21 F 19 OD 20/200 3.7 12 I EM - R602W M18821 ND 22 F 27 OD 20/400 9.6 9 II EM Peripapillary atrophy P1380L P1380L ND 23 F 18 OS 20/50 4.9 5 I EM - R1640W V1693I ND 24 M 22 OS 20/150 10.5 2 I EM - C54Y ND ND 25 M 44 OS 20/150 9.1 5 I EM - R1640W ND ND VA, visual acuity; Rel. Login to comment

[hide] Loss of peripapillary sparing in non-group I Starg... Exp Eye Res. 2010 Nov;91(5):592-600. Epub 2010 Aug 7. Burke TR, Allikmets R, Smith RT, Gouras P, Tsang SH
Loss of peripapillary sparing in non-group I Stargardt disease.
Exp Eye Res. 2010 Nov;91(5):592-600. Epub 2010 Aug 7., [PMID:20696155]

Abstract [show]
The aim of this study was to assess peripapillary sparing in patients with non-group I Stargardt disease. We suggest this as a useful clinical sign for formulating disease severity. Patients with a diagnosis of Stargardt disease were grouped by electroretinogram (ERG). Fundus autofluorescence was used to assess the peripapillary area for involvement in the Stargardt disease process. From a cohort of 32 patients (64 eyes), 17 patients (33 eyes) demonstrated loss of peripapillary sparing. One of 15 patients in Group I, six of 7 patients in group II and 9 of 10 patients in group III demonstrated peripapillary atrophy. One patient in group II had peripapillary flecks. All patients had at least one mutation detected in the ABCA4 gene. Both mutations were detected in 21 patients. Patients in groups II and III had the earliest ages of onset and the poorest visual acuities. Two novel disease causing mutation in the ABCA4 gene were detected. Our data supports the observation that peripapillary sparing is not universal finding for Stargardt disease and peripapillary atrophy is a useful clinical sign for identifying patients with Stargardt disease who fall into the more severe ERG groups, i.e. groups II and III. The presence of atrophy suggests a continuum of disease between groups II and III. Loss of peripapillary sparing is likely associated with the more deleterious mutations of the ABCA4 gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
184 Also, the type of involvement of the peripapillary area Table 1 Summary of clinical and genetic information for patients with ERG Group I Stargardt Disease. Case Mutation Mutation OA Duration Age at AF Visual Acuity Flecks Atrophy GA (mm2 ) PPA # Sex Allele 1 Allele 2 PPA (years) (years) (years) OD OS OD OS OD OS OD OS Pattern RON 1 Male G1961E G1961E e 19 13 32 20/70 20/70 M M M M 1.6 0.2 None 2 Female G1961E *IVS43 þ 1 G > T e 8 21 27 20/200 20/200 M M M M na na None 3.1 Male L541P/A1038V G1961E e 28 3 31 20/50 20/30 M M M M na na None 3.2 Male L541P/A1038V G1961E e 28 5 33 20/60 20/50 M M M M na na None 4.1 Female L541P/A1038V G1961E e 14 3 17 20/30 20/25 None None None None na na None 4.2 Female L541P/A1038V G1961E e 14 10 24 20/150 20/200 M M M M na na None 5 Female G1961E R2077W e 25 5 30 20/60 20/50 None None M M na na None 6.1 Female G1961E L541P/A1038V e 18 3 21 20/150 20/150 None None M M na na None 6.2 Female G1961E L541P/A1038V e 15 3 18 20/150 20/150 None None M M na na None 7 Female R602Q R602Q e 31 5 36 20/20 20/60 M,EM M,EM M M 0.7 0.3 None 8 Male L541P/A1038V ND e 22 24 46 20/200 20/200 M M M M 13.2 4.1 None 9 Femlae A1038V ND e 27 10 37 20/100 20/60 M,EM M,EM M M na na None 10 Female G1961E ND e 27 6 33 20/150 20/150 M M M M na na None 11 Female G1961E ND e 43 24 67 20/40 20/200 M M M M 4.8 na None 12 Male R212C ND OU 5 23 28 20/200 20/200 M,EM M,EM M M 1.6 4.2 Patchy N,T Abbreviations: ERG, electroretinogram; PPA, peripapillary atrophy; OD, right eye; OS, left eye; OU, both eyes; OA, onset age; AF, autofluoresence; M, macula; EM, extramacular retina; GA, geographic atrophy; na, not available; RON, relation to optic nerve; N, nasal; T, temporal; ND, mutation was not detected by the ABCR array e suggesting the presence of a currently unknown mutant allele; and *newly described mutation. Login to comment
185 Table 2 Summary of clinical and genetic information for patients with ERG Groups II or III Stargardt Disease. Case Mutation Mutation ERG OA Duration Age at AF Visual Acuity Flecks GA position GA (mm2) PPA # Sex Allele 1 Allele 2 PPA Group (years) (years) (years) OD OS OD OS OD OS OD OS Pattern RON 13 Female P1380L R1640Q OU II 11 24 35 HM HM EM EM M,EM M,EM na na Scalloped - 14 Male IVS38-10 T>C IVS40+5 G>A OU II 7 6 13 20/150 20/150 M,EM M,EM M M na na Flecks N 15 Female M1 V/R2030Q P1380L OU II 8 10 18 20/150 20/150 M,EM M,EM M M 3.52 na Patchy N,T 16 Female P1380L P1380L OU II 18 8 26 20/400 20/400 M,EM M,EM M M 0.25 na Patchy N,T 17 Female L541P/A1038 V L2027F OU II 10 22 32 CF CF M,EM M,EM M M 11.7 5.1 Patchy N,T 18 Male A1773 V ND OU II 35 6 41 CF 20/30 M,EM M,EM M M 4.2 3.7 Patchy N,T 19 Female L2027F ND OU I/II 10 17 27 20/400 20/400 M,EM M,EM M M 1.6 0.1 Patchy N,T 20 Male R602 W R1300X OU III 8 18 26 CF CF None None M,EM M,EM na na Scalloped N,T 21 Female C54Y IVS14+1 G>C OU III 8 55 63 CF HM EM None M,EM M,EM na na Complete - 22.1 Male 4537delC *R107X OU III 5 8 13 20/200 20/200 EM EM M M 2.3 1.7 Patchy N,T 22.2 Female 4537delC *R107X - III 6 2 8 20/200 20/200 M,EM M,EM M M na na - - 23 Male P1380L IVS40+5 G>A OU III 29 26 55 20/400 20/400 EM EM M,EM M,EM na na Complete - 24 Male A1598D A1598D OU III 13 40 53 20/400 20/400 NA NA M,EM M,EM na na Scalloped N,T 25 Male G172S ND OU III 25 7 32 CF CF None None M,EM M,EM na na Complete - 26 Female R1108C ND OU III 9 50 59 20/400 20/400 EM EM M,EM M,EM na na Complete - 27 Male V767D ND OD III 5 10 15 20/400 20/400 EM EM M M na na Patchy T 28 Male P1380L ND OU II/III 9 21 30 20/400 20/400 EM EM M M na na Patchy N,T Abbreviations: ERG, electroretinogram; PPA, peripapillary atrophy; OD, right eye; OS, left eye; OU, both eyes; OA, onset age; AF, autofluoresence; M, macula; EM, extramacular retina; GA, geographic atrophy; na, not available; RON, relation to optic nerve; N, nasal; T, temporal; ND, mutation was not detected by the ABCR array, suggesting the presence of a currently unknown mutant allele; and *newly described mutation. Login to comment

[hide] Deducing the pathogenic contribution of recessive ... Hum Mol Genet. 2010 Oct 1;19(19):3693-701. Epub 2010 Jul 20. Schindler EI, Nylen EL, Ko AC, Affatigato LM, Heggen AC, Wang K, Sheffield VC, Stone EM
Deducing the pathogenic contribution of recessive ABCA4 alleles in an outbred population.
Hum Mol Genet. 2010 Oct 1;19(19):3693-701. Epub 2010 Jul 20., [PMID:20647261]

Abstract [show]
Accurate prediction of the pathogenic effects of specific genotypes is important for the design and execution of clinical trials as well as for meaningful counseling of individual patients. However, for many autosomal recessive diseases, it can be difficult to deduce the relative pathogenic contribution of individual alleles because relatively few affected individuals share the same two disease-causing variations. In this study, we used multiple regression analysis to estimate the pathogenicity of specific alleles of ABCA4 in patients with retinal phenotypes ranging from Stargardt disease to retinitis pigmentosa. This analysis revealed quantitative allelic effects on two aspects of the visual phenotype, visual acuity (P < 10(-3)) and visual field (P < 10(-7)). Discordance between visual acuity and visual field in individual patients suggests the existence of at least two non-ABCA4 modifying factors. The findings of this study will facilitate the discovery of factors that modify ABCA4 disease and will also aid in the optimal selection of subjects for clinical trials of new therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment
57 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment

[hide] Analysis of autofluorescent retinal images and mea... Exp Eye Res. 2010 Aug;91(2):143-52. Epub 2010 Apr 14. Chen B, Tosha C, Gorin MB, Nusinowitz S
Analysis of autofluorescent retinal images and measurement of atrophic lesion growth in Stargardt disease.
Exp Eye Res. 2010 Aug;91(2):143-52. Epub 2010 Apr 14., [PMID:20398653]

Abstract [show]
Current retinal imaging techniques using scanning laser ophthalmoscopy (SLO) provide a powerful mechanism for characterizing the topographical distribution of lipofuscin fluorophores and atrophic lesions (ALs) in retinal disease. In this paper we describe a novel Edge-Flow-Driven Variational Image Segmentation analysis to measure and evaluate progressive change in the area of ALs as well as regions of hyperfluorescence (HF). The algorithm is embedded in a series of almost completely automated image processing steps that allow rapid comparison of serial images. The sensitivity of the methodology to detect change was evaluated by measuring progression of AF lesion size in a cohort of Stargardt Macular Dystrophy (STGD) patients. Fifty-two STGD subjects (mean age = 41.0 +/- 16.6 years, range 9-78 yrs) at varying stages of disease participated in this prospective study. Twenty-four of the 52 subjects presented with atrophic lesions in one or both eyes on first evaluation. For this subgroup of subjects, the mean (+/-1 sd) follow-up time was 2.92 (+0.26) years (range 0.57-3.26 years) and the mean (+/-1 sd) rate of change was found to be approximately 0.94 (+/-0.87) mm(2)/year (range 0.2-2.13 mm(2)/yr). With this methodology, progressive enlargement of AL area was detectable in as little as one year, while regions of HF generally decreased, although there was considerable variability in the appearnce of HF, presumably reflecting the combined effects of the creation or expansion of lipofuscin deposits and resorption and loss associated with retinal cell death. Our findings suggest that this methodology is sufficiently sensitive to detect change and provides a clinically relevant tool to monitor progression not only with regards to natural history, but also to evaluate the efficacy of potential therapeutic interventions in STGD. Finally, we evaluated the association between AL area and measures of rod- and cone-mediated retinal function, as assessed with electroretinography (ERG). In general, the larger the AL, the poorer the ERG response, with a greater impact of lesion size on cone- rather than rod-mediated retinal function, a finding that was expected on the basis of the location and size of the AL and the distribution of rod- and cone-photoreceptors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,þ1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, þ5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 þ 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND ¼ not done. Login to comment
81 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,&#fe;1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, &#fe;5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 &#fe; 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND &#bc; not done. Login to comment

[hide] The role of the photoreceptor ABC transporter ABCA... Biochim Biophys Acta. 2009 Jul;1791(7):573-83. Epub 2009 Feb 20. Molday RS, Zhong M, Quazi F
The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration.
Biochim Biophys Acta. 2009 Jul;1791(7):573-83. Epub 2009 Feb 20., [PMID:19230850]

Abstract [show]
ABCA4 is a member of the ABCA subfamily of ATP binding cassette (ABC) transporters that is expressed in rod and cone photoreceptors of the vertebrate retina. ABCA4, also known as the Rim protein and ABCR, is a large 2,273 amino acid glycoprotein organized as two tandem halves, each containing a single membrane spanning segment followed sequentially by a large exocytoplasmic domain, a multispanning membrane domain and a nucleotide binding domain. Over 500 mutations in the gene encoding ABCA4 are associated with a spectrum of related autosomal recessive retinal degenerative diseases including Stargardt macular degeneration, cone-rod dystrophy and a subset of retinitis pigmentosa. Biochemical studies on the purified ABCA4 together with analysis of abca4 knockout mice and patients with Stargardt disease have implicated ABCA4 as a retinylidene-phosphatidylethanolamine transporter that facilitates the removal of potentially reactive retinal derivatives from photoreceptors following photoexcitation. Knowledge of the genetic and molecular basis for ABCA4 related retinal degenerative diseases is being used to develop rationale therapeutic treatments for this set of disorders.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
134 Disease mutations, which are substituted in Stargardt disease, are shown in red italics - NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C); NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment
225 A subset of missense mutations reside in NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C, R1129L) and NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment

[hide] Molecular analysis of the ABCA4 gene for reliable ... Br J Ophthalmol. 2009 May;93(5):614-21. Epub 2008 Nov 21. Aguirre-Lamban J, Riveiro-Alvarez R, Maia-Lopes S, Cantalapiedra D, Vallespin E, Avila-Fernandez A, Villaverde-Montero C, Trujillo-Tiebas MJ, Ramos C, Ayuso C
Molecular analysis of the ABCA4 gene for reliable detection of allelic variations in Spanish patients: identification of 21 novel variants.
Br J Ophthalmol. 2009 May;93(5):614-21. Epub 2008 Nov 21., [PMID:19028736]

Abstract [show]
BACKGROUND/AIMS: Mutations in ABCA4 have been associated with autosomal recessive Stargardt disease (STGD), a few cases with autosomal recessive cone-rod dystrophy (arCRD) and autosomal recessive retinitis pigmentosa (arRP). The purpose of the study was threefold: to molecularly characterise families with no mutations or partially characterised families; to determine the specificity and sensitivity of the genotyping microarray; and to evaluate the efficiency of different methodologies. METHODS: 23 STGD, five arCRD and three arRP Spanish patients who were previously analysed with the ABCR400 microarray were re-evaluated. Results were confirmed by direct sequencing. In patients with either none or only one mutant allele, ABCA4 was further analysed by denaturing high-performance liquid chromatography (dHPLC) and multiplex ligation-dependent probe amplification (MLPA). Haplotype analysis was also performed. RESULTS: In the first analysis performed with the microarray, 27 ABCA4 variants (27/62; 43.5%) were found. By dHPLC scanning, 12 novel mutations were additionally identified. In addition, two previously described mutations, one false negative (1/62; 1.6%) and one false positive (1.6%), were detected. MLPA analysis did not reveal additional substitutions. The new strategy yielded an increment of 21% compared with the approach used in the first round. CONCLUSION: ABCA4 should be analysed by optimal combination of high-throughput screening techniques such as microarray, dHPLC and direct sequencing. To the best of our knowledge, this strategy yielded significant mutational spectrum identification in Spanish patients with ABCA4-associated phenotypes. Follow-up of patients, presenting an early onset of the disease and severe mutations, seems essential to perform accurate genotype-phenotype correlations and further characterisation of pathological ABCA4 alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Clinical science Br J Ophthalmol 2009;93:614-621. doi:10.1136/bjo.2008.145193 Table 1 Clinical findings of the Spanish patients with Stargardt disease (STGD), autosomal recessive cone-rod dystrophy and autosomal recessive retinitis pigmentosa Pedigree Age (years) Age (years) of onset Visual acuity Diagnosis Allele 1 Allele 2 Segregation OD OS Nucleotide changes (exons) Amino acid change Nucleotide changes (exons) Amino acid change ARDM-135 42 24 0.4 0.6 STGD c.5882G.A(42) p.Gly1961Glu c.1029_1030insT(8) p.Asn344fsX NP ARDM-240 15 13 0.2 0.16 STGD c.5882G.A(42) p.Gly1961Glu c.2285C.A(15) p.Ala762Glu Yes ARDM-225 32 25 0.25 0.50 STGD c.5882G.A(42) p.Gly1961Glu c.6559C.T(48) p.Gln2187X Yes ARDM-164 21 11 NA STGD c.3386G.T(23) p.Arg1129Leu c.700C.T(6) p.Gln234X Yes ARDM-162 50 16 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND Yes ARDM-198 27 19 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND NP ARDM-125 31 9 0.3 0.4 STGD c.3211insGT(22) FS p.KNLFA1876dup Yes ARDM-158 24 9 0.2 0.2 STGD c.3211insGT(22) FS c.4537delC(30) p.Gln1513fsX1525 NP ARDM-165 40 30 NA STGD c.3211insGT(22) FS ND ND NP ARDM-167 49 23 0.05 0.05 STGD c.3211insGT(22) FS ND ND NP ARDM-146 32 13 0.06 0.1 STGD c.3056C.T(21) p.Thr1019Met c.6140T.A(44) p.Ile2047Asn Yes ARDM-40 46 9 0.1 0.1 STGD c.3056C.T(21) p.Thr1019Met c.3943C.T(27) p.Gln1315X Yes ARDM-90 26 8 Hand moving STGD c.5929G.A (43) p.Gly1977Ser IVS21-2A.T Yes ARDM-181 57 16 0.1 0.09 STGD c.3323G.A (22) p.Arg1108His IVS38+5G.A Yes ARDM-197 35 15 0.1 0.1 STGD c.4793C.A(34) (false +) p.Ala1598Asp (false +) c.5172G.T(36) p.Trp1724Cys Yes ARDM-183 63 55 0.150 0.175 STGD c.6079C.T(44) p.Leu2027Phe c.5929G.A(43) (false -) p.Gly1977Ser (false -) NP ARDM-38 35 6 0.01 0.02 STGD c.1804C.T(13) p.Arg602Trp c.4739delT(33) p.Leu1580fs Yes ARDM-163 48 32 0.01 0.32 STGD c.4457C.T(30) p.Pro1486Leu ND ND Yes ARDM-166 42 39 NA STGD c.6320G.A(46) p.Arg2107His ND ND Yes ARDM-222 26 23 NA STGD c.2791G.A(19) p.Val931Met ND ND NP ARDM-160 30 5 0.25 0.1 STGD ND ND ND ND Yes ARDM-173 49 7 NA STGD ND ND ND ND Yes ARDM-205 NA NA NA STGD c.4919G.A(35) p.Arg1640Gln ND ND NP ARDM-247 30 12 0.05 0.1 CRD c.3386G.T(23) p.Arg1129Leu c.6410G.A(47) p.Cys2137Tyr Yes ARDM-99 59 46 0.05 0.05 CRD c.4297G.A(29) p.Val1433Ile ND ND NP ARDM-131 27 15 0.9 0.7 CRD c.2701A.G(18) p.Thr901Ala ND ND Yes ARDM-100 28 4 0.2 0.16 CRD ND ND ND ND Yes ARDM-142 30 25 0.8 0.5 CRD ND ND ND ND Yes RP-773 38 20 0.05 0.05 RP c.33N86G.T(23) p.Arg1129Leu ND ND NP RP-959 53 10 0.1 0.1 RP c.466A.G(5) p.Ile156Val ND ND Yes RP-1058 37 6 0.2 0.6 RP c.4297G.A(29) p.Val1433Ile ND ND NP Twenty-seven out of 31 subjects were found to be compound heterozygous for mutations in the ABCA4 gene detected by microarray. Login to comment

[hide] Clinical utility of the ABCR400 microarray: basing... Arch Ophthalmol. 2009 Apr;127(4):549-54. Roberts LJ, Ramesar RS, Greenberg J
Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip.
Arch Ophthalmol. 2009 Apr;127(4):549-54., [PMID:19365039]

Abstract [show]
OBJECTIVES: To assess the clinical utility of ABCR400 microarray testing in patients with ABCA4-associated retinopathies and to report on possible issues that could arise should genetic results be delivered without validation. METHODS: One hundred thirty-two probands were genotyped with the microarray. Diagnostic assays were designed to verify all mutations identified in individuals in whom at least 2 causative mutations were found. Mutations were verified in the probands, and wherever possible cosegregation analysis was performed in additional family members. RESULTS: Eighty-five of the 132 probands (64.4%) genotyped with the microarray had 2 or more disease-associated mutations identified. Verification of the genotyping, however, resulted in only 80 families being able to benefit from genetic result delivery. The remaining families could not receive results owing to the confounding effect of multiple ABCA4 mutations or the incorrect identification of mutations. CONCLUSIONS: The ABCR400 microarray is useful for mutation screening; however, raw data cannot be delivered directly to patients. All mutations should be verified and, whenever possible, investigated in other family members. CLINICAL RELEVANCE: Validated ABCR400 results provide an unequivocal molecular diagnosis, allowing family members to be offered diagnostic, predictive, carrier, and prenatal testing. Use of the microarray can inform decision-making and identify candidates for future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 3Ј; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 3Ј; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction. Login to comment

[hide] ABCA4 disease progression and a proposed strategy ... Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12. Cideciyan AV, Swider M, Aleman TS, Tsybovsky Y, Schwartz SB, Windsor EA, Roman AJ, Sumaroka A, Steinberg JD, Jacobson SG, Stone EM, Palczewski K
ABCA4 disease progression and a proposed strategy for gene therapy.
Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12., [PMID:19074458]

Abstract [show]
Autosomal recessive retinal diseases caused by mutations in the ABCA4 gene are being considered for gene replacement therapy. All individuals with ABCA4-disease show macular degeneration, but only some are thought to progress to retina-wide blindness. It is currently not predictable if or when specific ABCA4 genotypes will show extramacular disease, and how fast it will progress thereafter. Early clinical trials of focal subretinal gene therapy will aim to arrest disease progression in the extramacular retina. In 66 individuals with known disease-causing ABCA4 alleles, we defined retina-wide disease expression by measuring rod- and cone-photoreceptor-mediated vision. Serial measurements over a mean period of 8.7 years were consistent with a model wherein a normal plateau phase of variable length was followed by initiation of retina-wide disease that progressed exponentially. Once initiated, the mean rate of disease progression was 1.1 log/decade for rods and 0.45 log/decade for cones. Spatio-temporal progression of disease could be described as the sum of two components, one with a central-to-peripheral gradient and the other with a uniform retina-wide pattern. Estimates of the age of disease initiation were used as a severity metric and contributions made by each ABCA4 allele were predicted. One-third of the non-truncating alleles were found to cause more severe disease than premature truncations supporting the existence of a pathogenic component beyond simple loss of function. Genotype-based inclusion/exclusion criteria and prediction of the age of retina-wide disease initiation will be invaluable for selecting appropriate candidates for clinical trials in ABCA4 disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
151 Estimated severity of ABCA4 alleles and their properties ABCA4 allele Delay of retina-wide disease initiation (years)a In vitro or in vivo studiesb Molecular structural localizationc C2150Y 225.8 NBD-2 A1038V;L541P 214.0 35, 38 ECD-1/NBD-1 IVS38-10 T.C 211.1 L244P 25.7 ECD-1 E1122K 23.5 NBD-1 C54Y 22.1 35 ECD-1 IVS35þ2 T.C 22.1 R602W 21.8 38 ECD-1 V1896D 21.8 TM12 L1940P 21.4 NBD-2 Truncation mutationsd 0.0 E1087D 2.8 NBD-1 R220C 3.9 ECD-1 A1598D 3.9 ECD-2 R1640Q 3.9 ECD-2 R1098C 4.9 NBD-1 P1380L 7.4 35 TM7 N965S 7.6 35 NBD-1 V1433I 8.6 ECD-2 R1108C 10.4 35 NBD-1 T1526M 14.5 35 ECD-2 R2030Q 14.5 NBD-2 L2027F 15.1 35,37 NBD-2 G818E 17.3 35 TM5/TM6 S100P 18.2 ECD-1 L1201R 18.2 NBD-1 R18W 18.5 Nt D600E 18.5 ECD-1 L11P 21.7 Nt D654N 25.3 36 ECD-1 K2172R 27.9 NBD-2 IVS40þ5 G.A 28.1 G1961E 37.9 35 NBD-2 G1961R 44.0 NBD-2 a Delay of retina-wide disease initiation relative to the standard of age 10.6 years. Login to comment

[hide] ABCA4 mutations in Portuguese Stargardt patients: ... Mol Vis. 2009;15:584-91. Epub 2009 Mar 25. Maia-Lopes S, Aguirre-Lamban J, Castelo-Branco M, Riveiro-Alvarez R, Ayuso C, Silva ED
ABCA4 mutations in Portuguese Stargardt patients: identification of new mutations and their phenotypic analysis.
Mol Vis. 2009;15:584-91. Epub 2009 Mar 25., [PMID:19365591]

Abstract [show]
PURPOSE: To resolve the spectrum of causative retina-specific ATP-binding cassette transporter gene (ABCA4) gene mutations in Portuguese Stargardt (STGD) patients and compare allele frequencies obtained in this cohort with those of previous population surveys. METHODS: Using a microarray technique (ABCR400 gene chip), we screened all previously reported ABCA4 gene mutations in the genomic DNA of 27 patients from 21 unrelated Stargardt families whose phenotypes had been clinically evaluated using psychophysics and electrophysiological measurements. Furthermore, we performed denaturing high performance liquid chromatography whenever one or both mutant alleles failed to be detected using the ABCR gene chip. RESULTS: A total of 36 mutant alleles (out of the 54 tested) were identified in STGD patients, resulting in a detection rate of 67%. Two mutant alleles were present in 12 out of 21 STGD families (57%), whereas in four out of 21 (19%) of the families, only one mutant allele was found. We report the presence of 22 putative pathogenic alterations, including two sequence changes not found in other populations, c.2T>C (p.Met1Thr) and c.4036_4037delAC (p.Thr1346fs), and two novel disease-associated variants, c.400C>T (p.Gln134X) and c.4720G>T (p.Glu1574X). The great majority of the mutations were missense (72.7%). Seven frameshift variants (19.4%), three nonsense mutations (8.3%), and one splicing sequence change (2.7%) were also found in STGD chromosomes. The most prevalent pathologic variant was the missense mutation p.Leu11Pro. Present in 19% of the families, this mutation represents a quite high prevalence in comparison to other European populations. In addition, 23 polymorphisms were also identified, including four novel intronic sequence variants. CONCLUSIONS: To our knowledge, this study represents the first report of ABCA4 mutations in Portuguese STGD patients and provides further evidence of different mutation frequency across populations. Phenotypic characterization of novel putative mutations was addressed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 [Met1Val]+ [Arg2030Gln], found in 4.8% of the families (for details, see Table 1). Login to comment
64 Most of the mutations detected have been reported as STGD-associated variants: p.Met1Val, p.Asn96Asp, p.Arg290Trp, p.Val931Met, p.Gly1961Glu, p.Leu2027Phe, p.Arg2030Gln, p.Asp1048fs, and IVS40+5G>A. Login to comment
69 4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 2 4458 Mi 5 8/10 / 6/10 ND / ND ND/ND 4455 S 8 1/10 / 8/10 ND / ND ND/ND 3 4431 Mo 6 1,6/10 / 1,6/10 c.1804C>T(13) / c.IVS+5G>A(40) p.Arg602Trp [30]/SPLICE [11] 4 4626 S 6 FC / FC c.3211_3212insGT(22) / c.3211_3212insGT(22) p.Asp1048fs [5]/p.Asp1048fs [5] 5 4514 S 12 1/10 / 1/10 c.32T>C(1) / c. Login to comment
70 [1A>G(1)]+[6089G>A(44)] p.Leu11Pro [12]/p.(Met1Val [6])+(Arg2030Gln [9]) 6 4525 Mo 14 1/10 / 1/10 ND / c.868C>T(8) ND/p.Arg290Trp [6] 7 4585 Mo 11 0.5/10 / 0.5/10 c.6079C>T(44) / ND p.Leu2027Phe [5]/ND 8 4678 Mo 9 0.5/10 / 1/10 c.3113C>T(21) / c.3602T>G(24) p.Ala1038Val [5]/p.Leu1201Arg [9] 9 4675 Mo 7 0.5/10 / 1/10 c.2T<C(1) / c.2T<C(1) p.Met1Thr/p.Met1Thr 10 4737 Mo 24 1.2/10 / 1.2/10 c.5882G>A(42) / c.3211_3212insGT(22) p.Gly1961Glu [4]/p.Asp1048fs 11 4613 S 9 FC / FC c. Login to comment

[hide] Evidence of widespread retinal dysfunction in pati... Invest Ophthalmol Vis Sci. 2008 Mar;49(3):1191-9. Maia-Lopes S, Silva ED, Silva MF, Reis A, Faria P, Castelo-Branco M
Evidence of widespread retinal dysfunction in patients with stargardt disease and morphologically unaffected carrier relatives.
Invest Ophthalmol Vis Sci. 2008 Mar;49(3):1191-9., [PMID:18326749]

Abstract [show]
PURPOSE: To characterize contrast sensitivity (CS) across the visual field for two achromatic spatial-temporal frequencies in 21 families with Stargardt disease (STGD) and to correlate psychophysical impairment with patterns of change in multifocal electroretinography (mfERG). METHODS: Twenty-seven eyes from patients with STGD, 16 eyes from asymptomatic relatives, and 44 age-matched control eyes were included. Chromatic CS function was assessed by comparing protan, deutan, and tritan (Cambridge Color Test; Cambridge Research Systems Ltd., Rochester, UK) and anomaloscope measures (IF-2; Roland Consult, Wiesbaden, Germany). Achromatic CS measures were obtained with custom-made software in nine locations by using randomly interleaved staircases. The first task-low spatial frequency (LSF)-matched the known frequency-doubling method that is believed to activate the magnocellular pathway preferentially. The second included an intermediate spatial frequency (ISF, 3.5 cyc/deg). mfERGs (RETIscan; Roland Consult) were also obtained. Relatives were screened for ABCA4 mutations by ABCR400 microarray and direct sequencing. RESULTS: Central impairment of achromatic and chromatic CS (along the three isolation axes) was observed in STGD. LSF and ISF tasks revealed significant and widespread dysfunction in patients and their morphologically unaffected relatives, 80% of whom were found to be ABCA4 mutation carriers. Significant reduction of P1 amplitudes was also observed in both groups. CONCLUSIONS: CS function is impaired in patients with STGD at distinct spatial-temporal frequencies, which, in addition to the color vision deficits, suggests dual impairment of the magno- parvocellular pathways. STGD morphologically unaffected carriers may show patterns of psychophysical dysfunction that are mirrored by abnormal mfERG responses.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
150 Several other sequence changes that have been significantly correlated to the STGD phenotype (M1V, N96D, R290W, L2027F, R2030Q, V2050L, 3211insGT, and IVS40ϩ5GϾA) were also identified. Login to comment
134 Several other sequence changes that have been significantly correlated to the STGD phenotype (M1V, N96D, R290W, L2027F, R2030Q, V2050L, 3211insGT, and IVS40af9;5Gb0e;A) were also identified. Login to comment

[hide] ABCA4 mutations causing mislocalization are found ... Hum Mol Genet. 2005 Oct 1;14(19):2769-78. Epub 2005 Aug 15. Wiszniewski W, Zaremba CM, Yatsenko AN, Jamrich M, Wensel TG, Lewis RA, Lupski JR
ABCA4 mutations causing mislocalization are found frequently in patients with severe retinal dystrophies.
Hum Mol Genet. 2005 Oct 1;14(19):2769-78. Epub 2005 Aug 15., [PMID:16103129]

Abstract [show]
ABCA4, also called ABCR, is a retinal-specific member of the ATP-binding cassette (ABC) family that functions in photoreceptor outer segments as a flipase of all-trans retinal. Homozygous and compound heterozygous ABCA4 mutations are associated with various autosomal recessive retinal dystrophies, whereas heterozygous ABCA4 mutations have been associated with dominant susceptibility to age-related macular degeneration in both humans and mice. We analyzed a cohort of 29 arRP families for the mutations in ABCA4 with a commercial microarray, ABCR-400 in addition to direct sequencing and segregation analysis, and identified both mutant alleles in two families (7%): compound heterozygosity for missense (R602W) and nonsense (R408X) alleles and homozygosity for a complex [L541P; A1038V] allele. The missense mutations were analyzed functionally in the photoreceptors of Xenopus laevis tadpoles, which revealed mislocalization of ABCA4 protein. These mutations cause retention of ABCA4 in the photoreceptor inner segment, likely by impairing correct folding, resulting in the total absence of physiologic protein function. Patients with different retinal dystrophies harboring two misfolding alleles exhibit early age-of-onset (AO) (5-12 years) of retinal disease. Our data suggest that a class of ABCA4 mutants may be an important determinant of the AO of disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
146 Genotype-phenotype correlations among patients bearing one and two mislocalization-mutations Two mislocalization-alleles One mislocalization-allele RP STGD Allele 1 Allele 2 AO Allele 1 Allele 2 AO [L541P; A1038V] [L541P; A1038V] 7 [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 9 [L541P; A1038V] R1108H 13 [L541P; A1038V] G1961E 16 CRD [L541P; A1038V] G1961E 28 Allele 1 Allele 2 AO [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 10 [L541P; A1038V] L2027F 12 [L541P; A1038V] C1490Y 12 [L541P; A1038V] P1380L 5 R602W R602W 7 [L541P; A1038V] T1019M 6 [L541P; A1038V] G1961E 7 STGD [L541P; A1038V] T1019M 6 Allele 1 Allele 2 AO R602W L2027F 9 [L541P; A1038V] [L541P; A1038V] 12 C1490Y G1961E 28 C1490Y C1490Y 7 C1490Y G1961E 13 C1490Y R602W 9 C1490Y L2027F 10 C1490Y R602W 10 C1490Y L2027F 18 C1490 L2027F 18 AO-age of onset (in years). Login to comment

[hide] Evolution of ABCA4 proteins in vertebrates. J Mol Evol. 2005 Jan;60(1):72-80. Yatsenko AN, Wiszniewski W, Zaremba CM, Jamrich M, Lupski JR
Evolution of ABCA4 proteins in vertebrates.
J Mol Evol. 2005 Jan;60(1):72-80., [PMID:15696369]

Abstract [show]
The ABCA4 (ABCR) gene encodes a retinal-specific ATP-binding cassette transporter. Mutations in ABCA4 are responsible for several recessive macular dystrophies and susceptibility to age related macular degeneration (AMD). The protein appears to function as a flippase of all-trans-retinaldehyde and/or its derivatives across the membrane of outer segment disks and is a potentially important element in recycling visual cycle metabolites. However, the understanding of ABCA4's role in the visual cycle is limited due to the lack of a direct functional assay. An evolutionary analysis of ABCA4 may aid in the identification of conserved elements, the preservation of which implies functional importance. To date, only human, murine, and bovine ABCA4 genes are described. We have identified ABCA4 genes from African (Xenopus laevis) and Western (Silurana tropicalis) clawed frogs. A comparative analysis describing the evolutionary relationships between the frog ABCA4s, annotated T. rubripes ABCA4, and mammalian ABCA4 proteins was carried out. Several segments are conserved in both intradiscal loop (IL) domains, in addition to the transmembrane and ATP-binding domains. Nonconserved segments were found in the IL and cytoplasmic linker domains. Maximum likelihood analyses of the aligned sequences strongly suggest that ABCA4 was subject to purifying selection. Collectively, these data corroborate the current evolutionary model where two distinct ABCA half-transporter progenitors were combined to form a full ABCA4 progenitor in ancestral chordates. We speculate that evolutionary alterations may increase the retinoid metabolite recycling capacity of ABCA4 and may improve dark adaptation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
130 As anticipated, the most frequently occurring STGD- associated missense ABCA4 alterations (R212C, L541P, D645N, G863A, A1038V, R1108C, R1380L, W1408R, T1526M, R1640W, G1961E, L2027F, and L2030Q) map to highly conserved regions. Login to comment

[hide] Electroretinographic findings in patients with Sta... Retina. 2004 Dec;24(6):920-8. Oh KT, Weleber RG, Stone EM, Oh DM, Rosenow J, Billingslea AM
Electroretinographic findings in patients with Stargardt disease and fundus flavimaculatus.
Retina. 2004 Dec;24(6):920-8., [PMID:15579991]

Abstract [show]
PURPOSE: To characterize the clinical and electroretinogram (ERG) features of our cohort of patients with Stargardt disease (STGD) exhibiting coding sequence variations in the ABCA4 gene. METHODS: Review of 76 patients with the clinical diagnosis of Stargardt disease/fundus flavimaculatus (STGD/FF) from the University of Iowa Department of Ophthalmology and Visual Sciences (41 patients) and the Casey Eye Institute (35 patients). Clinical examination, Goldmann perimetry, and electroretinography were performed on all 76 patients. Patients were divided into three groups on the basis of their funduscopic and electroretinographic features: (1) a normal ERG by the standards of the laboratory; (2) minimal rod or cone abnormalities; (3) severe ERG dysfunction. The latter category was further subdivided on the basis of a cone-dominated loss of function (C > R or "cone-rod dystrophy") or diffuse depression of rods and cones (C = R). Mutational analysis of the coding sequence of the ABCA4 gene was performed by single strand conformation polymorphism analysis followed by automated DNA sequencing. Each electroretinographic group was analyzed for the presence of disease causing changes using exact tests of binomial proportions corrected for multiple comparisons by Bonferroni method. Quantitative polymerase chain reaction (QPCR) was performed on patients who were homozygous for disease causing changes in the ABCA4 gene to rule out the possibility of deletions. RESULTS: Overall, 56 of 76 patients (and 77 of 152 alleles) exhibited coding sequence variations that were compatible with high-penetrance disease-causing mutations. The most common of these were His423Arg (9), frameshift mutations (7), Ala1038Val (7), and Pro1380Leu (6). Although no patients with His423Arg presented with normal ERGs, no significant correlation was observed between specific sequence variations and the electroretinographic characteristics or fundus appearance. However, a significantly greater fraction of patients with normal ERG studies failed to exhibit detectable disease-causing coding sequence variations in the ABCA4 gene identified on either allele (P = 0.0006). CONCLUSION: STGD/FF patients in our cohort exhibit a wide range of electroretinographic abnormalities, some of which are more prevalent than previously suspected. No direct correlation between clinical appearance, electrophysiologic characteristics and specific ABCA4 alleles could be identified, although a significantly lower number of our cohort with a normal ERG exhibited detectable coding sequence variations in the ABCA4 gene. However, four patients with ERG dysfunction were homozygous for a His423Arg change proven by QPCR not to be an artifact of a deletion. The presence of electrophysiologic dysfunction is not uncommon in our cohort of patients with STGD. Thus, the ERG provides clinically important information of retinal function for STGD/FF and, as such, is still indicated as part of the evaluation of these patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
165 In fact, the six most common HPRDCV, with the exception of His423Arg, (frameshift changes, Ala1038Val, Pro1380Leu, Arg1108Cys, Leu2027Phe) were observed with all three ERG classes: severe ERG derangements, mild ERG derangements, and normal ERG studies. Login to comment

[hide] Denaturing HPLC profiling of the ABCA4 gene for re... Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10. Stenirri S, Fermo I, Battistella S, Galbiati S, Soriani N, Paroni R, Manitto MP, Martina E, Brancato R, Allikmets R, Ferrari M, Cremonesi L
Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations.
Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10., [PMID:15192030]

Abstract [show]
BACKGROUND: Mutations in the retina-specific ABC transporter (ABCA4) gene have been associated with several forms of macular degenerations. Because the high complexity of the molecular genotype makes scanning of the ABCA4 gene cumbersome, we describe here the first use of denaturing HPLC (DHPLC) to screen for ABCA4 mutations. METHODS: Temperature conditions were designed for all 50 exons based on effective separation of 83 samples carrying 86 sequence variations and 19 mutagenized controls. For validation, samples from 23 previously characterized Stargardt patients were subjected to DHPLC profiling. Subsequently, samples from a cohort of 30 patients affected by various forms of macular degeneration were subjected to DHPLC scanning under the same conditions. RESULTS: DHPLC profiling not only identified all 132 sequence alterations previously detected by double-gradient denaturing gradient gel electrophoresis but also identified 5 sequence alterations that this approach had missed. Moreover, DHPLC scanning of an additional panel of 30 previously untested patients led to the identification of 26 different mutations and 29 polymorphisms, accounting for 203 sequence variations on 29 of the 30 patients screened. In total, the DHPLC approach allowed us to identify 16 mutations that had never been reported before. CONCLUSIONS: These results provide strong support for the use of DHPLC for molecular characterization of the ABCA4 gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment
34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment

[hide] Mutation spectrum and founder chromosomes for the ... Invest Ophthalmol Vis Sci. 2004 Jun;45(6):1705-11. September AV, Vorster AA, Ramesar RS, Greenberg LJ
Mutation spectrum and founder chromosomes for the ABCA4 gene in South African patients with Stargardt disease.
Invest Ophthalmol Vis Sci. 2004 Jun;45(6):1705-11., [PMID:15161829]

Abstract [show]
PURPOSE: To assess the mutation spectrum of ABCA4 underlying Stargardt disease (STGD) in South Africa (SA) and to determine whether there is a single or a few founder chromosomes in SA STGD families. METHODS: Sixty-four probands exhibiting the STGD phenotype were screened for mutations in the 50 exons of ABCA4 by single-strand conformational polymorphism-heteroduplex analysis sequencing and restriction fragment length polymorphism analysis. Microsatellite marker haplotyping was used to determine the ancestry in 10 families. RESULTS: Fifty-seven ABCA4 disease-associated alleles were identified that comprised 16 different sequence variants, of which two were novel, in 40 individuals of the cohort of 64 subjects. The most common variants identified included the C1490Y, L2027F, R602W, V256splice, R152X, and 2588G-->C mutations. The C1490Y variant was the most common disease-associated variant identified (19/64 subjects) and was absent in 392 control chromosomes. At least 10 ABCA4 disease-associated haplotypes were identified. Two of these haplotypes, which carried the C1490Y mutation, were identified in three unrelated families. CONCLUSIONS: Results suggest that ABCA4 is the major gene underlying STGD in the cohort investigated. Five of the six common sequence variants identified were at a higher frequency in the SA cohort than reported in published data on individuals of similar ancestry. The mutation and haplotype data suggests that there are several ancestral haplotypes underlying STGD in SA. There seems to be at least two different origins for the common C1490Y mutation, as well as two for the R602W mutation, thereby suggesting several founder effects for STGD in SA.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 The most common variants identified included the C1490Y, L2027F, R602W, V256splice, R152X, and 2588G3C mutations. Login to comment
71 List of 16 Different Potential Disease-Associated Sequence Variants Identified in 64 SA Subjects with arSTGD Nucleotide Change Amino Acid Change Families (N ‫؍‬ 64) Exon Reference C454T R152X 4 5 3,33 G455A R152Q 1 5 35 C634T R212C 1 6 16,27 G768T (Splice donor) V256splice 5 6 15 C1885T R602W 6 13 9 2588G3C G863A 4 17 8 T3047C V989A 1 20 11 T4319C F1440S 1 29 9 G4328A* R1443H 1 29 This study G4469A C1490Y 19 30 15,9 G5077A V16931 1 36 36 C6079T L2027F 8 44 8 C6088A R2030X 1 44 9,37 C6112T R2038W 2 44 5 IVS45ϩ7G3A Splice donor 1 45 26 6352⌬A* Frameshift 1 46 This study No individuals positive for the R1443H variant were identified in 47 control individuals of Indian ancestry. Login to comment
84 Of note, individual 209.1 and 113.3 were compound heterozygotes for the C1490Y and L2027F variations; however, their AOs differ considerably (18 and 10 years, respectively). Login to comment
96 A single STGD-associated haplotype was identified for the (1) L2027F sequence variant, in two unrelated families; (2) V256splice variant, in two unrelated families; (3) R152X variant, three unrelated families; (4) 2588G3C variant, in one family; (5) F1440S variant, in one family; and (6) IVS45ϩ7G3A variant, in one family. Login to comment
119 The C1490Y sequence variant was the most common disease-associated variant identified in this study (19/64; 30%), followed by the L2027F (8/64; 13%), the R602W variant (6/64; 9%), the V256splice variant (5/64; 8%), and the 2588G3C and R152X sequence variants occurred at equal frequencies (4/64; 6%). Login to comment
121 Five (C1490Y, L2027F, R602W, V256splice and R152X) of the six common sequence variants identified were at a higher frequency in the SA STGD cohort than in populations from Europe and the United States. Login to comment
125 AO (y) Phenotype Mutation 1 Mutation 2 224.1 9 STGD C1490Y R602W 170.2 10 STGD C1490Y R602W 241.1 9 STGD C1490Y 25883C 448.1 20 STGD C1490Y 2588G3C 113.3 10 STGD C1490Y L2027F 209.1 18 STGD C1490Y L2027F 165.4 10 STGD C1490Y V256splice 166.3 27 STGD C1490Y R152X 151.4 5 STGD C1490Y ND 219.1 5 (rapid clinical progression was observed by 9 years) STGD C1490Y ND 223.1 9 STGD C1490Y ND 307.1 9 STGD C1490Y ND 319.3 9 STGD C1490Y ND 385.1 10 STGD C1490Y ND 226.1 10 STGD C1490Y ND 142.2 10 STGD C1490Y ND 273.1 11 STGD C1490Y ND 382.1 12 STGD C1490Y ND 449.1 14 STGD C1490Y ND 344.2 ND STGD C1490Y ND 374.1 10 STGD L2027F 6352⌬A† 305.1 18 STGD L2027F R2038W 377.1 25 STGD L2027F R2038W 276.1 27 STGD L2027F R212C 204.4 8 STGD L2027F ND 135.4 13 STGD L2027F ND 446.1 9 STGD R602W ND 109.3 11 STGD R602W ND 110.7 13 STGD R602W ND 438.3 12 STGD R602W ND 123.1 9 STGD V256splice R152X 105.1* 10 STGD AND atypical RP V256splice R152X 24 129.3* 10 (rapid clinical progression was observed) STGD V256splice ND 163.22 10 STGD V256splice ND 173.1 8 STGD 2588G3C ND 9.4 27 STGD 2588G3C R152X 330.2 29 STGD R152Q V989A 372.1 31 STGD R1443H† R2030X 141.3 11 STGD F1440S IVS45ϩ7G3A (splice site mutation) 206.3 ND STGD V1693I ND Rows are arranged according to the age of onset (AO) starting with the earliest AO for the most common sequence variant. Login to comment
137 The 10 ABCA4 Disease-Associated Haplotypes Identified in the 10 STGD Families Investigated Family D1S188 Marker ABCA4 MutationD1S406 D1S236 166 14 6 12 C1490Y 170 15 4 9 C1490Y 151 15 4 9 C1490Y 204 9 5 14 L2027F 135 9 5 14 L2027F 105 8 4 14 V256splice 129 8 4 14 V256splice 170 10 5 12 R602W 110 16 6 3 R602W 9 7 5 14 2588G3C 9 16 5 4 R152X 105 16 5 4 R152X 166 16 5 4 R152X 141 8 3 6 F1440S 141 9 5 14 IVS45ϩ7G3A The numbers in column 1 denote the identity number of the family. Login to comment
152 The severe phenotype noted in this patient was therefore attributed to the subject`s heterozygosity for the 6352⌬A and L2027F mutations, with the latter being the major contributor to the disease phenotype. Login to comment
153 Further investigation into the AO reported to be associated with L2027F (data not presented), however, highlights a correlation between the L2027F variant with a milder clinical phenotype associated with a late AO (second and third decade of life). Login to comment
154 It is therefore reasonable to hypothesize that regarding individual 374.1, who was heterozygous for the two mutations, L2027F and the novel mutation 6352⌬A, (1) both mutations contribute equally to the severity of the phenotype, (2) modifying sequences within ABCA4 or other genes modulate the effect of the compound heterozygous mutations 6352⌬A/L2027F on the ABCA4 protein, and hence the phenotype, or (3) environmental factors such as diet, smoking, and UV radiation may all contribute to the scenario in (2). Login to comment

[hide] Functional analysis of genetic mutations in nucleo... Biochemistry. 2003 Sep 16;42(36):10683-96. Biswas-Fiss EE
Functional analysis of genetic mutations in nucleotide binding domain 2 of the human retina specific ABC transporter.
Biochemistry. 2003 Sep 16;42(36):10683-96., [PMID:12962493]

Abstract [show]
The rod outer segment (ROS) ABC transporter (ABCR) plays an important role in the outer segment of retinal rod cells, where it functions as a transporter of all-trans retinal, most probably as the complex lipid, retinylidene-phosphatidyl-ethanolamine. We report here a quantitative analysis of the structural and functional effects of genetic mutations, associated with several macular degenerations, in the second nucleotide-binding domain of ABCR (NBD2). We have analyzed the ATP binding, kinetics of ATP hydrolysis, and structural changes. The results of these multifaceted analyses were correlated with the disease severity and prognosis. Results presented here demonstrated that, in wild type NBD2, distinct conformational changes accompany nucleotide (ATP and ADP) binding. Upon ATP binding, NBD2 protein changed to a relaxed conformation where tryptophans became more solvent-exposed, while ADP binding reverses this process and leads back to a taut conformation that is also observed with the unbound protein. This sequence of conformational change appears to be important in the energetics of the ATP hydrolysis and may have important structural consequences in the ability of the NBD2 domain to act as a regulator of the nucleotide-binding domain 1. Some of the mutant proteins displayed strikingly different patterns of conformational changes upon nucleotide binding that pointed to unique structural consequences of these genetic mutations. The ABCR dysfunctions, associated with various retinopathies, are multifaceted in nature and include alterations in protein structure as well as the attenuation of ATPase activity and nucleotide binding.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 The pET29aNBD2 construct harboring the L2027F mutation was already available in our laboratory and prepared as previously described (12, 13). Login to comment
103 The locations of the disease associated mutations investigated in this study; L1971R, R2038W, G2146D, L2027F, and D2177N are indicated. Login to comment
144 Here, we have used site-specific mutagenesis to create disease-related genetic mutations: L1971R, D2177N, L2027F, R2038W, and G2146D as well as a synthetic mutation, K2175A. Login to comment
153 Lane 1: protein molecular weight standards; lane 2, wild-type NBD2; lane 3, L2027F mutant; lane 4, L1971R mutant; lane 5, D2177N; lane 6, G2146D; lane 7, R2038W mutant; lane 8, K2175A. Login to comment
231 Previously, we reported that the STGD1-associated mutant L2027F resulted in a significantly impaired in ATP hydrolysis (12). Login to comment
232 Here, we have examined any possible changes in the nucleotide binding by the L2027F mutant. Login to comment
233 Fluorescence anisotropy analysis demonstrated that L2027F was defective in ATP binding, as saturation of binding was not observed (Figure 6F, Table 1). Login to comment
263 Significant changes were observed in the Stern-Volmer plot for the L2027F mutant (Figure 7C, Table 1). Login to comment
265 Thus, there is a significant difference between the wild-type NBD2 protein and the L2027F mutant. Login to comment
267 Stern Volmer plots of the (A) wild-type NBD2, (B) L1971R mutant, (C) L2027F mutant, (D) D2177N mutant, (E) R2038W mutant, (F) G2146D mutant, and (F) K2175A mutant. Login to comment
357 The L2027F mutant, with very low ATPase activity as demonstrated earlier, had a dramatically altered quenching profile (Table 1). Login to comment

[hide] Detailed analysis of allelic variation in the ABCA... Invest Ophthalmol Vis Sci. 2003 Jul;44(7):2868-75. Schmidt S, Postel EA, Agarwal A, Allen IC Jr, Walters SN, De la Paz MA, Scott WK, Haines JL, Pericak-Vance MA, Gilbert JR
Detailed analysis of allelic variation in the ABCA4 gene in age-related maculopathy.
Invest Ophthalmol Vis Sci. 2003 Jul;44(7):2868-75., [PMID:12824224]

Abstract [show]
PURPOSE: Age-related maculopathy (ARM) is one of the most common causes of blindness in older adults worldwide. Sequence variants in a gene coding for a retina-specific ATP-binding cassette (ABCA4) transporter protein, which is responsible for a phenotypically similar Mendelian form of retinal disease, were proposed to increase the risk of ARM. To examine the potential relationship of ABCA4 sequence variation and ARM risk in an independent data set, a clinically well-characterized population of 165 multiplex patients with ARM from 70 families, 33 unaffected relatives, and 59 unrelated control subjects with confirmed absence of ARM was screened for variants in any of the 50 exons and exon-intron boundaries of this gene. METHODS: A combination of denaturing high-performance liquid chromatography (DHPLC) and bidirectional sequencing was used to detect ABCA4 sequence variants. The data set was analyzed with both case-control and family-based association analysis methods. RESULTS: No evidence was found of significantly different allele frequencies of ABCA4 sequence variants in patients compared with control subjects, and no evidence for association or cosegregation with disease in family-based analyses. CONCLUSIONS: This study confirmed the very high degree of ABCA4 sequence polymorphism in the general population, which makes the detection of potential disease-associated alleles particularly challenging. While this study does not definitively exclude ABCA4 from contributing to a small or moderate fraction of ARM, it adds to the body of evidence suggesting that ABCA4 is not a major susceptibility gene for this disorder.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
123 Polymorphisms and Rare Sequence Variants in Exons of the ABCA4 Gene Exon Nucleotide Change Effect Allele Frequency* P† P§ Referenceሻ Independent ARM (n ‫؍‬ 140) All ARM (n ‫؍‬ 330) Control Subjects (n ‫؍‬ 118) 6 589G3C Asp197Asn 0.000 0.000 0.009 0.46 0.12 - 6 635G3A Arg212His 0.030 0.026 0.000 0.13 0.11 W, R 10 1268A3G His423Arg 0.394 0.371 0.427 0.62‡ 0.34 W, R 10 1269C3T His423His(syn) 0.033 0.039 0.031 1.0 0.74 W 18 2701A3G Thr901Ala 0.000 0.003 0.000 NA 0.58 W, R 23 3495C3T Asn1165Asn(syn) 0.000 0.003 0.000 NA 0.75 - 30 4469G3A Cys1490Tyr 0.007 0.003 0.000 1.0 0.59 W 37 5206T3C Ser1736Pro 0.009 0.008 0.000 1.0 0.44 W 40 5603T3A Asn1868Ile 0.100 0.102 0.054 0.29 0.18 W 40 5682G3C Leu1894Leu(syn) 0.293 0.272 0.298 1.0 0.64 W 41 5814A3G Leu1938Leu(syn) 0.160 0.169 0.218 0.33 0.38 W 42 5843C3T Pro1948Leu 0.052 0.038 0.054 1.0 0.50 W 42 5844A3G Pro1948Pro(syn) 0.199 0.192 0.205 1.0 0.77 W 44 6069C3T Ile2023Ile(syn) 0.040 0.050 0.044 1.0 0.82 W 44 6079C3T Leu2027Phe 0.000 0.000 0.009 0.48 0.13 W * Actual n (number of chromosomes) varies, as frequencies were calculated relative to nonmissing data only. Login to comment

[hide] ABCA4 gene sequence variations in patients with au... Arch Ophthalmol. 2003 Jun;121(6):851-5. Fishman GA, Stone EM, Eliason DA, Taylor CM, Lindeman M, Derlacki DJ
ABCA4 gene sequence variations in patients with autosomal recessive cone-rod dystrophy.
Arch Ophthalmol. 2003 Jun;121(6):851-5., [PMID:12796258]

Abstract [show]
OBJECTIVE: To identify sequence variations in the ABCA4 gene in a cohort of patients with autosomal recessive cone-rod dystrophy. METHODS: The coding sequences of the ABCA4 gene were analyzed in 30 unrelated probands. In those patients with plausible disease-causing variations, correlations were made between genotype and fundus phenotype as well as with electrophysiological and visual field findings. RESULTS: Sixteen (53%) of 30 probands were found to harbor plausible disease-causing variations in the ABCA4 gene. Two distinctly different fundus phenotypes were observed in our cohort of patients. Twelve patients showed diffuse pigmentary degenerative changes, whereas 4 showed either no pigmentary changes or only a mild degree of peripheral pigment degeneration. An associa-tion between certain sequence variations and each of these 2 different phenotypes was observed. CONCLUSIONS: Our findings confirm that a substantial percentage of patients with autosomal recessive cone-rod dystrophy are likely to harbor a mutation in the ABCA4 gene as the cause of their disease. The fundus phenotype observed in such patients is quite variable, and certain fundus phenotypes may be more associated with certain genotypes. Clinical Relevance Identification of the molecular genetic basis for various inherited human retinal dystrophies, such as cone-rod dystrophy, facilitates a potentially better understanding of the mechanisms by which photoreceptor cells degenerate. This in turn provides guidance as to how to better proceed in identifying the most optimal future therapeutic strategies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 In 2 instances, the variation was Leu1201Arg, and in another 2 patients it was Leu2027Phe. Login to comment
94 Patients With Cone-Rod Dystrophy Patient No./ Age, y/Sex Race/ Ethnicity Visual Acuity Visual Field Fundus Type* Mutation Cone vs Rod ERG ReductionOD OS 1/74/F AA 20/60 - 2 5/600 Central and peripheral loss 1 Gly1448Arg C = R 2/35/F W 10/350 5/400 Central and peripheral loss 1 Ala1038Val Leu541Pro C = R 3/42/F H 20/400 20/400 Central and peripheral loss 1 Ala1038Val Trp1618stop C = R 4/54/F W 10/180 10/140 Central scotoma 1 Donor splice, 5bp3Ј g-a intron 40 C = R 5/36/F W 10/120 10/60 - 1 Central scotoma 1 Leu541Pro Asp600Tyr C ↓ R 6/49/F W 5/160 5/180 Central and peripheral loss 1 Donor splice 5bp3Ј g-a intron 40 C = R 7/49/F W 10/350 4/350 Central and peripheral loss 1 Glu328Stop Val767Asp C = R 8/40/M W 10/225 20/400 Central and peripheral loss 1 Ala1038Val C = R 9/36/M W 5/600 5/350 Central and peripheral loss 1 Gly550Arg C = R 10/39/F AA 20/100 - 2 20/400 Central scotoma 1 Ala1038Val C = R 11/26/F W 20/200 20/200 Central and peripheral loss 1 Val2050Leu C ↓ R 12/36/M W 20/200 20/80+1 Central scotoma 1 Donor splice 5bp3Ј g-a intron 40 C = R 13/43/M AA 20/400 20/200 Central and peripheral loss 2 Leu1201Arg C = R (ND) 14/33/M P 20/40+1 20/50 Central scotoma 2 Leu2027Phe C ↓ R 15/44/M AA CF 20/400 Central and peripheral loss 2 Leu1201Arg C = R (ND) 16/56/M AA 20/40 20/40 Central scotoma 2 Leu2027Phe C = R Abbreviations: AA, African American; C ↓ R, cone responses more reduced than rod amplitudes; C = R, cone and rod amplitudes were similarly reduced; CF, counting fingers; ERG, electroretinogram; H, Hispanic; ND, nondetectable; P, Palestinian; W, white. Login to comment
73 In 2 instances, the variation was Leu1201Arg, and in another 2 patients it was Leu2027Phe. Login to comment

[hide] Cosegregation and functional analysis of mutant AB... Hum Mol Genet. 2001 Nov 1;10(23):2671-8. Shroyer NF, Lewis RA, Yatsenko AN, Wensel TG, Lupski JR
Cosegregation and functional analysis of mutant ABCR (ABCA4) alleles in families that manifest both Stargardt disease and age-related macular degeneration.
Hum Mol Genet. 2001 Nov 1;10(23):2671-8., [PMID:11726554]

Abstract [show]
Mutations in ABCR (ABCA4) have been reported to cause a spectrum of autosomal recessively inherited retinopathies, including Stargardt disease (STGD), cone-rod dystrophy and retinitis pigmentosa. Individuals heterozygous for ABCR mutations may be predisposed to develop the multifactorial disorder age-related macular degeneration (AMD). We hypothesized that some carriers of STGD alleles have an increased risk to develop AMD. We tested this hypothesis in a cohort of families that manifest both STGD and AMD. With a direct-sequencing mutation detection strategy, we found that AMD-affected relatives of STGD patients are more likely to be carriers of pathogenic STGD alleles than predicted based on chance alone. We further investigated the role of AMD-associated ABCR mutations by testing for expression and ATP-binding defects in an in vitro biochemical assay. We found that mutations associated with AMD have a range of assayable defects ranging from no detectable defect to apparent null alleles. Of the 21 missense ABCR mutations reported in patients with AMD, 16 (76%) show abnormalities in protein expression, ATP-binding or ATPase activity. We infer that carrier relatives of STGD patients are predisposed to develop AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Pedigree Maternal allele Paternal allele AMD relative A priori Cosegregation AR19 pGM, -6 0.5 - AR33 [W1408R; R1640W] R24H and D1532N mA, -16 0.5 Yes AR59 4232insTATG C1488R pGM, -6 0.5 No AR80 T1526M pGF, -5 0.5 - AR80 T1526M mGF, -7 0.5 Yes AR125 4947delC C1488R pGM, -7 0.5 Yes AR215 [H1406Y; V2050L] pGM, -5 0.5 - AR218 2160+1G→C G1961E mA, -8 0.5 No AR262 W821R pGGF, -7 0.25 No AR271 P68R E1087K mGA, -6 0.25 No AR335 D645N F608I mGM, -9 0.5 Yes AR382 R1108C mGM, -6 0.5 Yes AR389 E2096K 5714+5G→A pGM, -8 0.5 Yes AR397 5196+1G→A 5585-1G→A mA, -5 0.5 No AR410 A1038V 768G→T pC, -5 0.25 Yes AR422 pGM, -6 0.5 - AR423 P1380L D1532N pGF, -4 0.5 No AR468 P1380L P1380L mU, -9 0.5 Yes AR484 L2027F G550R mGU, -5 0.25 Yes AR562 R2107H 3050+5G→A pGU, -5 0.25 No AR643 5196+2T→C L2027F mU, -4 0.5 Yes AR661 P1380L C54Y mGF, -6 0.5 Yes AR669 664del13 pGF, -4 0.5 No AR534 W821R P1380L pGM, -7 0.5 Yes (17) Family 1 R212C I2113M mGM, I-2 0.5 Yes (27) Family 2 R1108C R2107H mGM, I-2 0.5 Yes (27) Family 3 R212C G1977S mGF, I-1 0.5 Yes (27) 10.25 15 unlikely to account for many of the remaining alleles (our unpublished observations). Login to comment
114 Sun et al. (28) reported substantial defects in protein expression or ATP binding of eight AMD-associated mutations (R212C, G863A, A1038V, R1108C, R1129L, P1380L, G1961E and L2027F) and an abnormal increase in the ATPase activity of the D2177N mutation, and they reported mild defects or wild-type activity within the sensitivity of the assay in four other AMD-associated variants (E471K, C1488R, T1526M and R1898H). Login to comment

[hide] Mutational scanning of the ABCR gene with double-g... Hum Genet. 2001 Sep;109(3):326-38. Fumagalli A, Ferrari M, Soriani N, Gessi A, Foglieni B, Martina E, Manitto MP, Brancato R, Dean M, Allikmets R, Cremonesi L
Mutational scanning of the ABCR gene with double-gradient denaturing-gradient gel electrophoresis (DG-DGGE) in Italian Stargardt disease patients.
Hum Genet. 2001 Sep;109(3):326-38., [PMID:11702214]

Abstract [show]
Mutations in the retina-specific ABC transporter (ABCR) gene are responsible for autosomal recessive Stargardt disease (arSTGD). Mutation detection efficiency in ABCR in arSTGD patients ranges between 30% and 66% in previously published studies, because of high allelic heterogeneity and technical limitations of the employed methods. Conditions were developed to screen the ABCR gene by double-gradient denaturing-gradient gel electrophoresis. The efficacy of this method was evaluated by analysis of DNA samples with previously characterized ABCR mutations. This approach was applied to mutation detection in 44 Italian arSTGD patients corresponding to 36 independent genomes, in order to assess the nature and frequency of the ABCR mutations in this ethnic group. In 34 of 36 (94.4%) STGD patients, 37 sequence changes were identified, including 26 missense, six frameshift, three splicing, and two nonsense variations. Among these, 20 had not been previously described. Several polymorphisms were detected in affected individuals and in matched controls. Our findings extend the spectrum of mutations identified in STGD patients and suggest the existence of a subset of molecular defects specific to the Italian population. The identification of at least two disease-associated mutations in four healthy control individuals indicates a higher than expected carrier frequency of variant ABCR alleles in the general population. Genotype-phenotype analysis in our series showed a possible correlation between the nature and location of some mutations and specific ophthalmoscopic features of STGD disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 DNA samples (n=22) carrying previously identified mutations in the ABCR gene were employed as controls for evaluating the efficacy of the DG-DGGE approach in detecting sequence variations R572Q (Lewis et al. 1999), Y639X (Lewis et al. 1999), G863A (Lewis et al. 1999; Maugeri et al. 1999), A1038V (Rozet et al. 1998), T1019M (Rozet et al. 1998), 3211insGT (Lewis et al. 1999), P1380L (Lewis et al. 1999), H1406Y (Lewis et al. 1999), 4947delC (Lewis et al. 1999), H1838Y (Lewis et al. 1999), 5714+5G→A (Cremers et al. 1998), N1868I (De La Paz et al. 1999), L1938L (Rivera et al. 2000), G1961E (Allikmets et al. 1997a, 1997b), L1970F (Lewis et al. 1999), L2027F (Nasonkin et al. 1998), V2050L (Lewis et al. 1999), E2131K (Lewis et al. 1999), R2139W (Lewis et al. 1999), 6709insG (Lewis et al. 1999), D2177N (Allikmets et al. 1997a, 1997b), 2181del12 (Lewis et al. 1999). Login to comment

[hide] Mutations in ABCR (ABCA4) in patients with Stargar... Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36. Briggs CE, Rucinski D, Rosenfeld PJ, Hirose T, Berson EL, Dryja TP
Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.
Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2229-36., [PMID:11527935]

Abstract [show]
PURPOSE: To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). METHODS: One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. RESULTS: The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. CONCLUSIONS: This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Specifically, Leu541Pro, Pro1380Leu, Gly1961Glu, and Leu2027Phe were not identified in any of the control individuals (P Ͻ 0.04). Login to comment
89 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 ϩ 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 ϩ 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 ϩ 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 ϩ 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 ϩ 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 ϩ 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. Login to comment
62 Specifically, Leu541Pro, Pro1380Leu, Gly1961Glu, and Leu2027Phe were not identified in any of the control individuals (P b0d; 0.04). Login to comment
88 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 af9; 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 af9; 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 af9; 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 af9; 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 af9; 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 af9; 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None IOVS, September 2001, Vol. 42, No. 10 ABCR in Stargardt Macular Degeneration Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. 10 TABLE 1 (continued). Login to comment

[hide] Nucleotide binding domain 1 of the human retinal A... Biochemistry. 2001 Jul 27;40(28):8181-7. Biswas EE
Nucleotide binding domain 1 of the human retinal ABC transporter functions as a general ribonucleotidase.
Biochemistry. 2001 Jul 27;40(28):8181-7., [PMID:11444963]

Abstract [show]
Members of the ATP binding cassette (ABC) superfamily are transmembrane proteins that are found in a variety of tissues which transport substances across cell membranes in an energy-dependent manner. The retina-specific ABC protein (ABCR) has been linked through genetic studies to a number of inherited visual disorders, including Stargardt macular degeneration and age-related macular degeneration (ARMD). Like other ABC transporters, ABCR is characterized by two nucleotide binding domains and two transmembrane domains. We have cloned and expressed the 522-amino acid (aa) N-terminal cytoplasmic region (aa 854-1375) of ABCR containing nucleotide binding domain 1 (NBD1) with a purification tag at its amino terminus. The expressed recombinant protein was found to be soluble and was purified using single-step affinity chromatography. The purified protein migrated as a 66 kDa protein on SDS-PAGE. Analysis of the ATP binding and hydrolysis properties of the NBD1 polypeptide demonstrated significant differences between NBD1 and NBD2 [Biswas, E. E., and Biswas, S. B. (2000) Biochemistry 39, 15879-15886]. NBD1 was active as an ATPase, and nucleotide inhibition studies suggested that nucleotide binding was not specific for ATP and all four ribonucleotides can compete for binding. Further analysis demonstrated that NBD1 is a general nucleotidase capable of hydrolysis of ATP, CTP, GTP, and UTP. In contrast, NBD2 is specific for adenosine nucleotides (ATP and dATP). NBD1 bound ATP with a higher affinity than NBD2 (K(mNBD1) = 200 microm vs K(mNBD2) = 631 microm) but was less efficient as an ATPase (V(maxNBD1) = 28.9 nmol min(-)(1) mg(-)(1) vs V(maxNBD2) = 144 nmol min(-)(1) mg(-)(1)). The binding efficiencies for CTP and GTP were comparable to that observed for ATP (K(mCTP) = 155 microm vs K(mGTP) = 183 microm), while that observed for UTP was decreased 2-fold (K(mUTP) = 436 microm). Thus, the nucleotide binding preference of NBD1 is as follows: CTP > GTP > ATP >> UTP. These studies demonstrate that NBD1 of ABCR is a general nucleotidase, whereas NBD2 is a specific ATPase.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Site-directed mutagenesis was then used to introduce the Leu2027Phe mutation, which is genetically linked to Stargardt macular degeneration, into the recombinant polypeptide. Login to comment

[hide] An analysis of allelic variation in the ABCA4 gene... Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89. Webster AR, Heon E, Lotery AJ, Vandenburgh K, Casavant TL, Oh KT, Beck G, Fishman GA, Lam BL, Levin A, Heckenlively JR, Jacobson SG, Weleber RG, Sheffield VC, Stone EM
An analysis of allelic variation in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89., [PMID:11328725]

Abstract [show]
PURPOSE: To assess the allelic variation of the ATP-binding transporter protein (ABCA4). METHODS: A combination of single-strand conformation polymorphism (SSCP) and automated DNA sequencing was used to systematically screen this gene for sequence variations in 374 unrelated probands with a clinical diagnosis of Stargardt disease, 182 patients with age-related macular degeneration (AMD), and 96 normal subjects. RESULTS: There was no significant difference in the proportion of any single variant or class of variant between the control and AMD groups. In contrast, truncating variants, amino acid substitutions, synonymous codon changes, and intronic variants were significantly enriched in patients with Stargardt disease when compared with their presence in subjects without Stargardt disease (Kruskal-Wallis P < 0.0001 for each variant group). Overall, there were 2480 instances of 213 different variants in the ABCA4 gene, including 589 instances of 97 amino acid substitutions, and 45 instances of 33 truncating variants. CONCLUSIONS: Of the 97 amino acid substitutions, 11 occurred at a frequency that made them unlikely to be high-penetrance recessive disease-causing variants (HPRDCV). After accounting for variants in cis, one or more changes that were compatible with HPRDCV were found on 35% of all Stargardt-associated alleles overall. The nucleotide diversity of the ABCA4 coding region, a collective measure of the number and prevalence of polymorphic sites in a region of DNA, was found to be 1.28, a value that is 9 to 400 times greater than that of two other macular disease genes that were examined in a similar fashion (VMD2 and EFEMP1).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
148 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His. Login to comment
103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
149 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His. Login to comment

[hide] Late-onset Stargardt disease is associated with mi... Hum Genet. 2001 Apr;108(4):346-55. Yatsenko AN, Shroyer NF, Lewis RA, Lupski JR
Late-onset Stargardt disease is associated with missense mutations that map outside known functional regions of ABCR (ABCA4).
Hum Genet. 2001 Apr;108(4):346-55., [PMID:11379881]

Abstract [show]
Based on recent studies of the photoreceptor-specific ABC transporter gene ABCR (ABCA4) in Stargardt disease (STGD1) and other retinal dystrophies, we and others have developed a model in which the severity of retinal disease correlates inversely with residual ABCR activity. This model predicts that patients with late-onset STGDI may retain partial ABCR activity attributable to mild missense alleles. To test this hypothesis, we used late-onset STGDI patients (onset: > or =35 years) to provide an in vivo functional analysis of various combinations of mutant alleles. We sequenced directly the entire coding region of ABCR and detected mutations in 33/50 (66%) disease chromosomes, but surprisingly, 11/33 (33%) were truncating alleles. Importantly, all 22 missense mutations were located outside the known functional domains of ABCR (ATP-binding or transmembrane), whereas in our general cohort of STGDI subjects, alterations occurred with equal frequency across the entire protein. We suggest that these missense mutations in regions of unknown function are milder alleles and more susceptible to modifier effects. Thus, we have corroborated a prediction from the model of ABCR pathogenicity that (1) one mutant ABCR allele is always missense in late-onset STGD1 patients, and (2) the age-of-onset is correlated with the amount of ABCR activity of this allele. In addition, we report three new pseudodominant families that now comprise eight of 178 outbred STGD1 families and suggest a carrier frequency of STGD1-associated ABCR mutations of about 4.5% (approximately 1/22).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Allele 1 nucleotide Amino acid Allele 2 Amino acid Age of change nucleotide change onset (years) AR129-08 37 AR140-01 6079C→T L2027F 3322C→T R1108C 36 AR204-04 35 AR280-03 6316C→T R2106C 6710insA T2237fs 35 AR311-04 4462T→C C1488R 35 AR336-03 2588G→C G863A 5898+1G→A E1966splice 39 AR343-06 2588G→C G863A 3322C→T R1108C 43 AR387-03 4919G→A R1640Q 2971G→C G991R 40 AR410-04 768G→T V256splice 3113C→T A1038V 38 AR440-03 6238-6239del2 bp S2080fs 44 AR448-01a 454C→T R152X 6089G→A R2030Q 52 AR452-04 2005-2006del2 bp M669fs 6089G→A R2030Q 40 AR455-05 [1622T→C;3113C→T] [L541P;A1038V] 43 AR474-02 36 AR516-01a 5196+1G→A I1732splice 3113C→T A1038V 47 AR518-03 3322C→T R1108C 35 AR540-01a 4685T→C I1562T 51 AR594-02a 5196+1G→A I1732splice 36 AR606-04 3322C→T R1108C 2588G→C G863A 39 AR608-02 1025-1038del14 bp D342fs 40 AR617-03 2827C→T R943W 39 AR632-02a 3386G→T R1129L 50 AR649-03 3303G→A W1101X 3113C→T A1038V 36 AR662-02a 1015T→G W339G 50 AR723-01a 3602T→G L1201R 65 Fig.1 Pedigrees of late-onset Stargardt disease families (filled symbols STGD1-affected individuals). Login to comment
87 Proband AR140-01 is a father with onset of STGD at 36 years and who carries two missense mutant alleles (L2027F, R1108C; Fig.1). Login to comment
111 To compare this observation directly with our previous report (Lewis et al. 1999), we replaced five mutations (A1038V, L2027F, R2030Q, R2038W, V2050L) to linker regions. Login to comment

[hide] The C-terminal nucleotide binding domain of the hu... Biochemistry. 2000 Dec 26;39(51):15879-86. Biswas EE, Biswas SB
The C-terminal nucleotide binding domain of the human retinal ABCR protein is an adenosine triphosphatase.
Biochemistry. 2000 Dec 26;39(51):15879-86., [PMID:11123914]

Abstract [show]
The rod outer segment ATP binding cassette (ABC) transporter protein (ABCR) plays an important role in retinal rod cells presumably transporting retinal. Genetic studies in humans have linked mutations in the ABCR gene to a number of inherited retinal diseases particularly Stargardt macular degeneration and age-related macular degeneration (ARMD). The ABCR protein is characterized by two nucleotide binding domains and two transmembrane domains, each consisting of six membrane-spanning helices. We have cloned and expressed the 376 amino acid (aa) C-terminal end of this protein (amino acid residues 1898-2273) containing the second nucleotide binding domain (NBD2) with a purification tag at its amino terminus. The expressed protein was found to be soluble and was purified using a rapid and high-yield single-step procedure. The purified protein was monomeric and migrated as a 43 kDa protein in SDS-PAGE. The purified NBD2 protein had strong ATPase activity with a K(m) of 631 microM and V(max) of 144 nmol min(-1) mg(-1). This ATPase activity on normalization was kinetically comparable to that observed for purified and reconstituted native ABCR. Nucleotide inhibition studies suggest that the binding of NBD2 is specific for ATP/dATP, and that none of the other ribonucleotides appeared to compete for binding at this site. These studies demonstrate that cloned and expressed NBD2 protein is a fully functional ATPase in the absence of the remainder of the molecule. The level of ATPase activity was comparable to that of trans-retinal-stimulated ABCR ATPase. The NBD2 expression plasmid was used to generate a Leu2027Phe mutation associated with Stargardt disease. Analysis of the ATPase activity of the mutant protein demonstrated that it had a 14-fold increase in binding affinity (K(m) = 46 microM) with a corresponding 9-fold decrease in the rate of hydrolysis (V(max) = 16.6 nmol min(-1) mg(-1)), indicating a significant alteration of the ATPase function. It also provided a molecular basis of Stargardt disease involving this mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 The NBD2 expression plasmid was used to generate a Leu2027Phe mutation associated with Stargardt disease. Login to comment
77 The NBD2 expression vector pET29aNBD2 was used as template, 12 cycles of PCR, and each cycle was 30 s at 95 °C, 30 s at 50 °C, and 15 min at 68 °C using the complementary oligonucleotides 5'-AGT TTG ATG CAA TCG ATG AGC TGT TCA CAG GAC GAG AAC ATC TTT AAC ATC TTT ACC TT-3' and 5'-AAG GTA AAG ATG TTC TCG TCC TGT GAA CAG CTC ATC GAT TGC ATC AAA CT-3') as mutagenic primers to generate NBD2 L2027F. Login to comment
162 Influence of a Leu2027Phe Mutation on ATP Hydrolysis by NBD2 Polypeptide. Login to comment
163 The mutation L2027F has been previously reported in some patients suffering from Stargardt macular degeneration (9, 21). Login to comment
165 Using a site-directed mutagenesis protocol, the mutation (L2027F) was introduced into the pET29aNBD2 plasmid, following which the mutant protein was expressed and purified. Login to comment
168 The L2027F point mutation in the NBD2 polypeptide increased the affinity of binding Km (46 µM) and resulted in a decrease in the rate of ATP hydrolysis, 16.6 nmol of ATP min-1 mg-1 . Login to comment
194 This protein was also able to utilize dATP as a substrate, but appeared to do so with FIGURE 5: (A) DNA sequence analysis of NBD2mut1 (L2027F). Login to comment
195 Chromatogram of DNA sequence analysis surrounding the region of the L2027F mutation of NBD2. Login to comment
197 (B) ATPase activity of the Leu2027Phe NBD2 mutant protein. Login to comment
215 As we indicated under Results, this increase in binding affinity (also observed with the Leu2027Phe mutant) was accompanied by a decrease in the rate of hydrolysis (Vmax). Login to comment
216 Functional Consequence of L2027F Mutation Associated with Stargardt Disease. Login to comment
217 The L2027F mutation in the full-length ABCR gene is associated with Stargardt disease (SGD1) (9, 21). Login to comment
219 Introduction of the point mutation L2027F in the NBD2 polypeptide was observed to increase the affinity of ATP binding 14-fold (Km ) 46 µM) while decreasing the rate of ATP hydrolysis (Vmax ) 16.6 nmol of ATP min-1 mg-1). Login to comment
222 The observed defects in retinal transport associated with the L2027F mutation may be related, at least in part, to the decreased rate of ATP hydrolysis. Login to comment
230 What we have demonstrated in this report is that the Leu2027Phe mutation does indeed lead to a significant decrease in the basal level of ATPase of the NBD2 domain of ABCR. Login to comment

[hide] Molecular genetic analysis of ABCR gene in Japanes... Jpn J Ophthalmol. 2000 May-Jun;44(3):245-9. Fuse N, Suzuki T, Wada Y, Yoshida M, Shimura M, Abe T, Nakazawa M, Tamai M
Molecular genetic analysis of ABCR gene in Japanese dry form age-related macular degeneration.
Jpn J Ophthalmol. 2000 May-Jun;44(3):245-9., [PMID:10913642]

Abstract [show]
PURPOSE: To explore whether the mutation in the retina-specific ATP-binding cassette transporter (ABCR) gene, the Stargardt's disease gene, contributes to the prevalence of the dry form of age-related macular degeneration (dry AMD) in Japanese unrelated patients. METHODS: Twenty-five Japanese unrelated patients with dry AMD who were diagnosed by fluorescein angiography and indocyanine green angiography were chosen as the dry AMD group. None of these cases had apparent choroidal neovascularization. To detect the mutations in the ABCR gene, genomic DNA was extracted from leukocytes of peripheral blood, and 26 exons of the ABCR gene were amplified by polymerase chain reaction (PCR). All the PCR products were then directly sequenced. When a mutation was detected, the occurrence of a mutation was compared between these AMD patients and the control group. RESULTS: After direct sequencing, a point mutation in exon 29 was found in one of the 25 dry AMD patients. In addition, a polymorphism in exon 45 was found in two other patients, and three sequence variations in exon 23 were detected in all patients. The incidence in AMD patients in whom a mutation in exon 29 (4%) was detected was less than that in controls (5%). Screening of the intron-exon boundaries also led to the identification of intronic mutation in intron 33. CONCLUSION: In this study we found no relationship between allelic variation in the ABCR gene and the prevalence of dry AMD in Japanese unrelated patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Mutations Found in ABCR* Gene in 26 Exons Examined in This Study Exon AMD† Stargardt`s Disease Exon AMD Stargardt`s Disease 11 E471K 29 T1428M 15 31 R1517S 16 G818E, G863A (D847H) 33 I1562T G1578R 17 34 N1614FS 18 35 19 V931M, 2884delC N965M, (R943Q) 36 5196ϩ1G→A 5041deL15 5196ϩ2T→C 20 40 R1898H R1898H 21 A1028V 42 G1961E G1961E 22 3211insGT, V1072A E1087K 43 L1970F 6006ϩ1G→T 23 R1129L 44 L2027F, R2038W (I2023I) 24 45 V2050L, R2077W (I2083I) 25 46 R2106C (V2094V) 27 48 6519⌬11bp D2177N 6568⌬C 6519⌬11bp 6709insG *ABCR: ATP-binding cassette transporter. Login to comment

[hide] Genotype/Phenotype analysis of a photoreceptor-spe... Am J Hum Genet. 1999 Feb;64(2):422-34. Lewis RA, Shroyer NF, Singh N, Allikmets R, Hutchinson A, Li Y, Lupski JR, Leppert M, Dean M
Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease.
Am J Hum Genet. 1999 Feb;64(2):422-34., [PMID:9973280]

Abstract [show]
Mutation scanning and direct DNA sequencing of all 50 exons of ABCR were completed for 150 families segregating recessive Stargardt disease (STGD1). ABCR variations were identified in 173 (57%) disease chromosomes, the majority of which represent missense amino acid substitutions. These ABCR variants were not found in 220 unaffected control individuals (440 chromosomes) but do cosegregate with the disease in these families with STGD1, and many occur in conserved functional domains. Missense amino acid substitutions located in the amino terminal one-third of the protein appear to be associated with earlier onset of the disease and may represent misfolding alleles. The two most common mutant alleles, G1961E and A1038V, each identified in 16 of 173 disease chromosomes, composed 18.5% of mutations identified. G1961E has been associated previously, at a statistically significant level in the heterozygous state, with age-related macular degeneration (AMD). Clinical evaluation of these 150 families with STGD1 revealed a high frequency of AMD in first- and second-degree relatives. These findings support the hypothesis that compound heterozygous ABCR mutations are responsible for STGD1 and that some heterozygous ABCR mutations may enhance susceptibility to AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift. Login to comment
101 For the double-mutant chromosomes in the compound heterozygous families (AR31: Y340D and R572Q; AR106: E471K and E2131K; AR128: R572Q and G863A; and AR189: L541P and A1038V) and in those families in which the second disease chromosome was not identified (AR215: H1406Y and V2050L; AR264: D1204N and L2027F; AR254: D249G and R1898H; AR265: G863A and R1898H; AR285: 2714ϩ5GrA and 2884delC; and AR305: G863A and R1898H), in three cases (AR128, AR265, and AR305) each mutation on the double-mutant chromosome had been identified independently as disease causing in other, unrelated families with STGD1 (table 1). Login to comment
110 Seven mutant alleles, including six missense amino acid substitutions and one splice-site mutation (G863A, A1038V, R1108C, T1526M, G1961E, L2027F, and 5714ϩ5GrA) accounted for 41% of the disease-causing mutations identified in this cohort. Login to comment
111 In three instances, identical codons were affected by different base-pair substitutions, yielding different predicted missense amino acid substitutions (R572Q and R572P; R1129C and R1129L) or a missense substitution and a stop codon (R2030Q and R2030X). Login to comment
139 Different families with the same combination of alleles (e.g., AR326 and AR391, both with genotype L2027F/T1526M; AR376 and AR393, both with genotype A1038V/R1108C) usually have similar ages at onset, as was shown for Figure 4 Pedigree AR33, a family with STGD that manifests a pseudodominant inheritance pattern. Login to comment
178 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET ‫ע‬ SD (YEARS)Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 ‫ע‬ 12.7 51961GrA AR307 10 A1038V AR290 16 5714ϩ5GrA AR314 25 5898ϩ1GrT AR336 39 A1038V R572P AR321 6 12.5 ‫ע‬ 6.9 S1071L AR358 6 L1970F AR428 6 5196ϩ2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 ‫ע‬ 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 ‫ע‬ 4.5 C75G AR427 12 C1490Y AR370 13 2160ϩ1GrC AR218 14 4253ϩ5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 ‫ע‬ 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment
77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift. Login to comment
102 For the double-mutant chromosomes in the compound heterozygous families (AR31: Y340D and R572Q; AR106: E471K and E2131K; AR128: R572Q and G863A; and AR189: L541P and A1038V) and in those families in which the second disease chromosome was not identified (AR215: H1406Y and V2050L; AR264: D1204N and L2027F; AR254: D249G and R1898H; AR265: G863A and R1898H; AR285: 2714af9;5GrA and 2884delC; and AR305: G863A and R1898H), in three cases (AR128, AR265, and AR305) each mutation on the double-mutant chromosome had been identified independently as disease causing in other, unrelated families with STGD1 (table 1). Login to comment
140 Different families with the same combination of alleles (e.g., AR326 and AR391, both with genotype L2027F/T1526M; AR376 and AR393, both with genotype A1038V/R1108C) usually have similar ages at onset, as was shown for Figure 4 Pedigree AR33, a family with STGD that manifests a pseudodominant inheritance pattern. Login to comment
179 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET cf2; SD (YEARS) Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 cf2; 12.7 51961GrA AR307 10 A1038V AR290 16 5714af9;5GrA AR314 25 5898af9;1GrT AR336 39 A1038V R572P AR321 6 12.5 cf2; 6.9 S1071L AR358 6 L1970F AR428 6 5196af9;2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 cf2; 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 cf2; 4.5 C75G AR427 12 C1490Y AR370 13 2160af9;1GrC AR218 14 4253af9;5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 cf2; 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment

[hide] Mapping of the rod photoreceptor ABC transporter (... Hum Genet. 1998 Jan;102(1):21-6. Nasonkin I, Illing M, Koehler MR, Schmid M, Molday RS, Weber BH
Mapping of the rod photoreceptor ABC transporter (ABCR) to 1p21-p22.1 and identification of novel mutations in Stargardt's disease.
Hum Genet. 1998 Jan;102(1):21-6., [PMID:9490294]

Abstract [show]
Using a bovine rod photoreceptor cell-specific ATP-binding cassette (ABC) transporter cDNA we have cloned the full-length transcript of the homologous human gene and demonstrate that it is identical to the photoreceptor cell-specific ABC transporter (ABCR) recently shown to be mutated in Stargardt's disease. By fluorescence in situ hybridization we have mapped the ABCR gene to chromosomal band 1p21-p22.1. Mutational analysis of part of the gene in 15 Stargardt's disease patients has identified four disease-causing mutations, of which two represent potential null alleles. This brings the total number of independently identified mutations to 23, providing further evidence that the human ABCR gene is associated with Stargardt's disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Subsequently, the disease-associated mobility shifts were sequenced and revealed the following: a G→A transition at nucleotide 2565 resulting in a stop at codon 855, a G→A transition at 3106 replacing the negatively charged glutamic acid with the positively charged lysine residue at codon 1036, an insertion of two bases, GT, at 3211 causing a frameshift at codon 1071 and leading to protein termination 11 amino acids further downstream, and finally a C→T transition at 6079 resulting in a leucine to phenylalanine change at codon 2027 (Fig.3, Table 1). Login to comment
79 The family numbers correspond to those of Weber et al. (1996) Family Base change at Exon Consequence nucleotide positiona 1 G3106A 3188 E1036K 1 C6007T 6007a I20231 6 3211insGTb 3188 S1071 frameshift 9 G2565A 2383 W855Stop 13 C6079Tb 6007a L2027F 16 6816+21C→T 6480a Silent polymorphism (?) Login to comment

[hide] Detection rate of pathogenic mutations in ABCA4 us... Arch Ophthalmol. 2012 Nov;130(11):1486-90. doi: 10.1001/archophthalmol.2012.1697. Downes SM, Packham E, Cranston T, Clouston P, Seller A, Nemeth AH
Detection rate of pathogenic mutations in ABCA4 using direct sequencing: clinical and research implications.
Arch Ophthalmol. 2012 Nov;130(11):1486-90. doi: 10.1001/archophthalmol.2012.1697., [PMID:23143460]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 In 5 of the 11 patients, the identification of 2 pathogenic mutations confirmed the historical diagnosis and all had chorioretinal atro- Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 1 1Ab0e;G M1V 2588Gb0e;C G863A In trans Unaffected parents carriers 30 STGD maf9;/0/0 R2030Q 3 PVs 2 161Gb0e;A C54Y 2588Gb0e;C G863A In trans Affected sibling with same mutations 12 STGD m/0/0 0 2 PVs 3 161Gb0e;A C54Y 5882Gb0e;A G1961E NK NK 18 STGD m/0/0 0 2 PVs 4 634Cb0e;T R212C 4457Cb0e;T P1486L In trans Unaffected parents carriers 17 STGD m/0/0 0 2 PVs 5 2588Gb0e;C G863A 4469Gb0e;A C1490Y NK NK 48 STGD maf9;/0/1 0 2 PVs 6 2971Gb0e;C G991R 4254-2Ab0e;G Splice NK NK 21 STGD m/0/0 0 2 PVs 7 2971Gb0e;C G991R 3602Tb0e;G L1201R NK NK 18 STGD maf9;af9;/NP/NP V643M (likely), G885E (likely), G1441D (unlikely), V2244V (highly likely) b0e;2 PVs 8 3322Cb0e;T R1108C 768Gb0e;T V256V NK NK 13 STGD maf9;af9;/1/1 0 2 PVs 9 3322Cb0e;T R1108C 6079Cb0e;T L2027F NK NK 26 STGD maf9;/0/0 0 2 PVs 10 3386Gb0e;T R1129L 4469Gb0e;A C1490Y In trans Unaffected parents carriers 15 STGD maf9;/0/0 R152Q (unlikely) 2 PVs (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1486 phy on current clinical examination, consistent with progression of the disorder.5 One of the 11 patients with chorioretinal atrophy (subject 40) had a single stop codon, again strongly supporting the original clinical diagnosis. Six of the 11 patients did not have pathogenic mutations in ABCA4. Login to comment
30 In 3 of the 6 patients with a historical diagnosis Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients (continued) Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 11 4139Cb0e;T P1380L 5714 af9; 5Gb0e;A Splice NK NK 19 STGD m/0/0 0 2 PVs 12 4457Cb0e;T P1486L 4457Cb0e;T P1486L In trans Unaffected sibling carries 1 mutation 25 STGD maf9;af9;/1/1 0 2 PVs 13 4537dupC Q1513fs 6391Gb0e;A E2131K In trans Unaffected parents carriers 10 STGD maf9;/0/0 R152Q in cis with Q1513fs, E2131K in cis with E471K 2 PVs 14 6079Cb0e;T L2027F 6079Cb0e;T L2027F In trans Unaffected sibling carrier 28 STGD maf9;af9;/0/0 0 2 PVs 15 5018 af9; 2Tb0e;C NA 6316Cb0e;T R2106C In trans Affected sibling with same mutations 17 STGD m/0/1 0 2 PVs 16 3004Cb0e;T R1002Wb 1957Cb0e;T R653C In trans NK 16 STGD m/0/1 0 2 PVs 17 1253Tb0e;C F418S 2588Gb0e;C G863A NK NK 52 STGD maf9;/0/0 0 2 PVs 18 6709Ab0e;C T2237Pb 3064Gb0e;A E1022K In trans 2 Affected siblings with same mutations 6 STGD maf9;af9;/0/0 0 2 PVs 19 5260Tb0e;G Y1754D 4469Gb0e;A C1490Y In trans NK 12 STGD maf9;af9;/0/0 0 2 PVs 20 551Cb0e;T S184Fb 4793Cb0e;A A1598D NK 2 Affected siblings with same mutations 58 STGD m/NP/NP 0 2 PVs 21 550-551TCb0e;CG S184Rb 5882Gb0e;A G1961E In trans Affected sibling with same mutations 25 STGD maf9;af9;/0/0 0 2 PVs 22 5313-3Cb0e;G Spliceb 5882Gb0e;A G1961E In trans Unaffected parents carriers 47 STGD m/0/1 0 2 PVs 23 2588Gb0e;C G863A 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans NA 26 STGD maf9;af9;/3/1 1 In cis with G863A 2 PVs 24 5537Tb0e;C I1846T 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected son carries I1846T only 17 STGD maf9;af9;/3/3 0 2 PVs 25 6089Gb0e;A R2030Q 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected sibling carries R2030Q 4 STGD m/NP/NP 0 2 PVs 26 6730-1Gb0e;C Spliceb 2588Gb0e;C G863A NK NK 15 STGD NP/NP/NP 0 2 PVs 27 3291Ab0e;T R1097Sb 3056Cb0e;T T1019M In trans NK 9 STGD NP/NP/NP 1 In cis with R1097S 2 PVs 28 498delT L167HisfsX2b Not present NA NA NK 28 STGD m/1/1 0 1 PV 29 2345Gb0e;A W782Xb Not present NA NA Unaffected mother carries mutation 25 STGD m/1/1 0 1 PV 30 2588Gb0e;C G863A 4326Cb0e;A N1442K NK NK 36 STGD maf9;/0/0 0 1 PV af9; N1442K (unlikely) 31 2966Tb0e;C V989A Not present NA NA NK 49 STGD m/1/1 0 1 PV (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1487 (c)2012 American Medical Association. All rights reserved. Downloaded From: http://archopht.jamanetwork.com/ by a Semmelweis University Budapest User on 12/06/2015 lopathy is genetically heterogeneous. A total of 10 novel mutations were identified (Table). Login to comment

[hide] A longitudinal study of stargardt disease: clinica... Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15. Fujinami K, Lois N, Davidson AE, Mackay DS, Hogg CR, Stone EM, Tsunoda K, Tsubota K, Bunce C, Robson AG, Moore AT, Webster AR, Holder GE, Michaelides M
A longitudinal study of stargardt disease: clinical and electrophysiologic assessment, progression, and genotype correlations.
Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15., [PMID:23499370]

Abstract [show]
PURPOSE: To investigate the clinical and electrophysiologic natural history of Stargardt disease and correlate with the genotype. DESIGN: Cohort study of 59 patients. METHODS: Clinical history, examination, and electrophysiologic assessment were undertaken in a longitudinal survey. Patients were classified into 3 groups based on electrophysiologic findings, as previously published: Group 1 had dysfunction confined to the macula; Group 2 had macular and generalized cone system dysfunction; and Group 3 had macular and both generalized cone and rod system dysfunction. At baseline, there were 27 patients in Group 1, 17 in Group 2, and 15 in Group 3. Amplitude reduction of >50% in the relevant electroretinogram (ERG) component or a peak time shift of >3 ms for the 30 Hz flicker ERG or bright flash a-wave was considered clinically significant ERG deterioration. Molecular screening of ABCA4 was undertaken. RESULTS: The mean age at baseline was 31.7 years, with the mean follow-up interval being 10.5 years. A total of 22% of patients from Group 1 showed ERG group transition during follow-up, with 11% progressing to Group 2 and 11% to Group 3. Forty-seven percent of patients in Group 2 progressed to Group 3. There was clinically significant ERG deterioration in 54% of all subjects: 22% of Group 1, 65% of Group 2, and 100% of Group 3. At least 1 disease-causing ABCA4 variant was identified in 47 patients. CONCLUSIONS: All patients with initial rod ERG involvement demonstrated clinically significant electrophysiologic deterioration; only 20% of patients with normal full-field ERGs at baseline showed clinically significant progression. Such data assist counseling by providing more accurate prognostic information and are also highly relevant in the design, patient selection, and monitoring of potential therapeutic interventions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Clinical Data and Molecular Genetic Status of 59 Patients With Stargardt Disease Pt Onset (y) Age (y) logMAR VA Variants Identifieda BL FU BL FU 1 16 17 26 0.0/1.0 0.0/0.48 c.768G>T / p.Gly863Ala / p.Arg943Gln 2 15 17 25 0.78/0.78 1.0/1.0 p. Arg1443His 3 11 18 27 0.78/1.0 1.0/1.0 p.Trp439* / p.Gly863Ala / p.Leu1970Phe 4 19 21 32 0.78/0.78 1.0/1.0 p.Leu2027Phe 5 10 22 30 0.48/0.48 1.0/0.78 p.Gly863Ala / p.Arg943Gln / c.5461-10 T>C 6 18 26 37 0.78/1.0 1.0/1.0 p.Pro1380Phe 7 25 28 40 0.78/1.0 1.3/0.78 ND 8 24 29 38 1.0/0.78 1.0/1.0 p.Phe418Ser / p.Leu2027Phe 9 24 31 44 1.0/1.0 1.3/1.0 c.4253&#fe;5 G>T / p.Gly1507Arg 10 26 32 44 0.78/0.78 1.0/1.0 p.Cys1490Tyr / p.Arg2030Gln 11 31 34 46 0.18/0.3 0.6/0.7 ND 12 17 35 47 1.0/1.0 1.0/1.0 p.Asn96His 13 23 35 45 1.0/0.3 1.0/0.48 p.Gly1513Profs*1554 14 33 37 48 0.18/1.48 1.0/1.3 ND 15 38 40 51 0.18/0.78 1.0/1.0 p.Arg2107His 16 42 43 53 0.0/0.0 1.0/1.0 ND 17 22 48 59 1.0/1.0 1.0/1.0 p.Cys54Tyr 18 20 49 59 1.0/0.6 1.0/1.0 p.Pro1380Leu / p.Gly1961Glu 19 35 50 61 1.0/0.3 1.0/1.0 p.Arg1108Cys 20 25 56 67 1.3/0.18 1.0/1.0 p.Trp439* / p.Gly863Ala 21 48 59 71 1.0/0.78 1.0/1.0 p. Ile156 Val / p. Cys1455Arg / p. Phe1839Ser 22 21 22 31 0.3/1.0 1.0/1.0 p.Arg2107His 23 21 23 33 1.0/1.0 1.0/1.0 p.Gly863Ala 24 48 64 73 0.0/1.0 0.18/3.0 p.Tyr1652* 25 17 19 29 0.78/0.3 1.0/1.0 c.5461-10 T>C 26 17 21 33 1.0/0.78 1.0/1.0 ND 27 27 53 66 1.78/1.78 1.3/1.0 p.Ser1071Cysfs*1084 28 5 14 21 0.78/0.78 1.0/1.0 p.Arg408* / p.Val675lle 29 9 15 27 1.08/1.08 1.0/1.0 p.Cys2150Tyr 30 14 24 32 1.0/0.78 1.0/1.0 ND 31 18 28 39 1.0/1.0 1.0/1.0 p.Gly863Ala / p.Arg1108Cys / p.Arg943Gln 32 14 29 37 1.0/1.0 1.0/1.0 p.Arg653Cys / p.Arg2030Gln 33 19 29 40 1.0/1.0 1.0/1.08 ND 34 34 40 49 0.3/0.48 1.0/1.0 p.Gly863Ala / p.Glu1087Lys 35 25 43 54 1.0/1.0 1.0/1.0 p.Cys54Tyr / p.Gly863Ala 36 38 60 69 1.0/1.0 1.3/1.08 p.Val931Met / c.5461-10 T>C 37 10 11 20 1.0/0.78 1.3/1.3 p.Pro1380Leu 38 10 15 23 1.0/1.0 1.3/1.3 p.Ser1071Cysfs*1084 / p.Pro1380Leu 39 24 25 38 1.56/0.3 2.0/2.0 c.5461-10 T>C / c.5714&#fe;5 G>A 40 18 26 36 1.3/1.3 2.0/1.3 ND 41 32 33 45 0.48/0.48 1.0/1.0 ND 42 32 35 46 1.3/0.0 3.0/1.0 p.Cys54Tyr 43 30 35 45 0.48/0.48 2.0/1.3 ND 44 15 41 49 1.3/1.3 2.0/1.3 p.Asn965Ser 45 8 8 20 0.78/0.78 1.0/1.0 p.Thr1019Met 46 10 11 23 1.0/1.0 1.0/1.0 p.Thr1019Met 47 8 12 24 2.0/1.56 1.78/1.48 p.Cys2150Tyr 48 17 18 26 1.0/0.78 1.3/1.0 c.5461-10 T>C / p.Leu2027Phe 49 8 21 33 1.3/1.3 2.0/2.0 p.Asp574Aspfs*582 50 8 27 39 2.0/1.56 1.78/1.48 c.5461-10 T>C 51 24 31 43 1.18/1.18 1.08/1.3 p.Arg1640Trp / p.Leu2027Phe Continued on next page respective electrophysiologic traces appear in Figure 2. Login to comment

[hide] Stargardt disease: towards developing a model to p... Eur J Hum Genet. 2013 Oct;21(10):1173-6. doi: 10.1038/ejhg.2013.92. Epub 2013 May 22. Heathfield L, Lacerda M, Nossek C, Roberts L, Ramesar RS
Stargardt disease: towards developing a model to predict phenotype.
Eur J Hum Genet. 2013 Oct;21(10):1173-6. doi: 10.1038/ejhg.2013.92. Epub 2013 May 22., [PMID:23695285]

Abstract [show]
Stargardt disease is an ABCA4-associated retinopathy, which generally follows an autosomal recessive inheritance pattern and is a frequent cause of macular degeneration in childhood. ABCA4 displays significant allelic heterogeneity whereby different mutations can cause retinal diseases with varying severity and age of onset. A genotype-phenotype model has been proposed linking ABCA4 mutations, purported ABCA4 functional protein activity and severity of disease, as measured by degree of visual loss and the age of onset. It has, however, been difficult to verify this model statistically in observational studies, as the number of individuals sharing any particular mutation combination is typically low. Seven founder mutations have been identified in a large number of Caucasian Afrikaner patients in South Africa, making it possible to test the genotype-phenotype model. A generalised linear model was developed to predict and assess the relative pathogenic contribution of the seven mutations to the age of onset of Stargardt disease. It is shown that the pathogenicity of an individual mutation can differ significantly depending on the genetic context in which it occurs. The results reported here may be used to identify suitable candidates for inclusion in clinical trials, as well as guide the genetic counselling of affected individuals and families.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 This study considers a South African cohort of 118 individuals who express biallelic combinations of seven founder mutations in ABCA4 (c.454C4T (p.Arg152*), c.768G4T (p.Val256Val), c.1804C4T (p.Arg602Trp), c.2588G4C (p.Gly863Ala), c.4469G4A (p.Cys1490Tyr), c.5461-10T4C, c.6079C4T (p.Leu2027Phe)), which collectively account for 36% of STGD cases studied to date in South Africa.19,20 These data, together with clinical information for each patient, were used to test the genotype-phenotype model. Login to comment
33 Table 1 A summary of the 23 mutation combinations observed in 118 patients with STGD, showing the number of patients per combination and the average and median AOO (in years) per combination Mutation 1 Mutation 2 Number of patients Average AOO (years) Median AOO (years) c.5461-10T4C c.768G4T (p.Val256Val) 1 6 6 c.5461-10T4C c.5461-10T4C 2 6.5 6.5 c.1804C4T (p.Arg602Trp) c.768G4T (p.Val256Val) 3 6.7 6 c.5461-10T4C c.454C4T (p.Arg152*) 3 7 8 c.4469G4A (p.Cys1490Tyr) c.454C4T (p.Arg152*) 6 7.8 8 c.768G4T (p.Val256Val) c.454C4T (p.Arg152*) 4 8 9 c.768G4T (p.Val256Val) c.768G4T (p.Val256Val) 1 8 8 c.4469G4A (p.Cys1490Tyr) c.4469G4A (p.Cys1490Tyr) 9 8.1 8 c.6079C4T (p.Leu2027Phe) c.454 C4T (p.Arg152*) 7 8.2 7 c.4469G4A (p.Cys1490Tyr) c.1804C4T (p.Arg602Trp) 13 8.6 8 c.4469G4A (p.Cys1490Tyr) c.5461-10T4C 13 8.8 9 c.4469G4A (p.Cys1490Tyr) c.768G4T (p.Val256Val) 10 10.3 9 c.4469G4A (p.Cys1490Tyr) c.6079C4T (p.Leu2027Phe) 12 10.3 9.5 c.6079C4T (p.Leu2027Phe) c.5461-10T4C 3 11 10 c.1804C4T (p.Arg602Trp) c.5461-10T4C 1 11 11 (c.1804C4T (p.Arg602Trp) c.6079C4T (p.Leu2027Phe) 8 12 11 c.6079C4T (p.Leu2027Phe) c.768G4T (p.Val256Val) 6 12.5 13 c.768G4T (p.Val256Val) c.2588G4C (p.Gly863Ala) 3 16.7 18 c.1804C4T (p.Arg602Trp) c.2588G4C (p.Gly863Ala) 2 17.5 17.5 c.4469G4A (p.Cys1490Tyr) c.2588G4C (p.Gly863Ala) 4 18.5 19 c.5461-10T4C c.2588G4C (p.Gly863Ala) 1 20 20 c.6079C4T (p.Leu2027Phe) c.6079C4T (p.Leu2027Phe) 2 28 28 c.2588G4C (p.Gly863Ala) c.454C4T (p.Arg152*) 4 28 30 In some cases, the average AOO of a given mutation differed significantly depending on the mutational context in which it occurred. Login to comment
35 For example, the average AOO is significantly lower among individuals who are homozygous for the Cys1490Tyr mutation compared to individuals who express a single Cys1490Tyr mutation and the Leu2027Phe mutation. Login to comment
45 Table 2 Covariates included in the generalised linear model (with inverse link function) with their respective coefficients, standard errors and P-values Covariate Coefficient Standard error P-value (Intercept) 0.0460 0.0106 3.53e 05 c.4469G4A (p.Cys1490Tyr) 0.0528 0.0076 2.71e 10 c.1804C4T (p.Arg602Trp) 0.0468 0.0085 2.33e 07 c.6079C4T (p.Leu2027Phe) 0.0090 0.0089 0.3117 c.5461-10T4C 0.0562 0.0106 6.59e 07 c.768G4T (p.Val256Val) 0.0507 0.0083 2.06e 08 c.2588G4C (p.Gly863Ala) 0.0413 0.0081 1.58e 06 c.454C4T (p.Arg152*) 0.0311 0.0080 0.0002 c.4469G4A (p.Cys1490Tyr) (homozygous) 0.0336 0.0144 0.0214 c.4469G4A (p.Cys1490Tyr): c.5461-10T4C 0.0419 0.0146 0.0049 c.4469G4A (p.Cys1490Tyr): c.1804C4T (p.Arg602Trp) 0.0295 0.0145 0.0442 c.4469G4A (p.Cys1490Tyr): c.768G4T (p.Val256Val) 0.0520 0.0134 0.0002 c.6079C4T (p.Leu2027Phe): c.454C4T (p.Arg152*) 0.0519 0.0158 0.0013 Figure 1 Graph depicting the actual and predicted average AOO with 95% confidence bands for each mutation combination observed in five or more patients. Login to comment
53 The mutation combinations not detected in the cohort were c.454C4T (p.Arg152*) (homozygous), c.1804C4T (p.Arg602Trp) (homozygous), c.2588G4C (p.Gly863Ala) (homozygous), c.454C4T (p.Arg152*):c.1804C4T (p.Arg602Trp) and c.2588G4C (p.Gly863Ala): c.6079C4T (p.Leu2027Phe). Login to comment
57 The c.2588G4C (p.Gly863Ala): c.6079C4T (p.Leu2027Phe) combination may be an example of this, as this combination has not yet been reported in the literature, to the best of our knowledge, and c.2588G4C (p.Gly863Ala) was previously proposed as a mild mutation.16 Lastly, and least likely, the mutation combination may be so severe that it leads to panretinal atrophy and therefore would not be identified in this STGD patient cohort. Login to comment

[hide] The clinical effect of homozygous ABCA4 alleles in... Ophthalmology. 2013 Nov;120(11):2324-31. doi: 10.1016/j.ophtha.2013.04.016. Epub 2013 Jun 12. Fujinami K, Sergouniotis PI, Davidson AE, Mackay DS, Tsunoda K, Tsubota K, Robson AG, Holder GE, Moore AT, Michaelides M, Webster AR
The clinical effect of homozygous ABCA4 alleles in 18 patients.
Ophthalmology. 2013 Nov;120(11):2324-31. doi: 10.1016/j.ophtha.2013.04.016. Epub 2013 Jun 12., [PMID:23769331]

Abstract [show]
PURPOSE: To describe the phenotypic presentation of a cohort of individuals with homozygous disease-associated ABCA4 variants. DESIGN: Retrospective case series. PARTICIPANTS: Eighteen affected individuals from 13 families ascertained from a total cohort of 214 families with ABCA4-related retinal disease presenting to a single center. METHODS: A detailed history was obtained, and color fundus photography, autofluorescence (AF) imaging, optical coherence tomography (OCT), and electrophysiologic assessment were performed. Phenotypes based on ophthalmoscopy, AF, and electrophysiology were assigned using previously reported characteristics. ABCA4 mutation detection was performed using the ABCR400 microarray (Asper Biotech, Tartu, Estonia) and high-throughput DNA sequencing, with direct sequencing used to assess segregation. MAIN OUTCOME MEASURES: Detailed clinical, electrophysiologic, and molecular genetic findings. RESULTS: Eleven disease-associated homozygous ABCA4 alleles were identified, including 1 frame shift, 2 stops, 1 intronic variant causing splice-site alteration, 2 complex missense variants, and 5 missense variants: p.Glu905fsX916, p.Arg1300X, p.Gln2220X, c.4253+4 C>T, p.Leu541Pro and p.Ala1038Val (homozygosity for complex allele), p.Val931Met and p.Arg1705Gln (complex allele), p.Arg212Cys, p.Cys1488Arg, p.Arg1640Trp, p.Gly1961Glu, and p.Leu2027Phe. Eight of these 11 homozygous alleles have not been reported previously. Six of 7 patients with homozygous null alleles had early-onset (<10 years) disease, with all 7 having a severe phenotype. Two patients with homozygous missense variants (p.Leu541Pro and p.Ala1038Val [complex], and p.Arg1640Trp) presented with a severe phenotype. Three patients with homozygous p.Gly1961Glu had adult-onset disease and a mild phenotype. One patient with homozygous p.Leu2027Phe showed a spared fovea and preserved visual acuity. CONCLUSIONS: The phenotypes represented in patients identified as homozygous for presumed disease-associated ABCA4 variants gives insight into the effect of individual alleles. Null alleles have severe functional effects, and certain missense variants are similar to nulls, suggesting complete abrogation of protein function. The common alleles identified, p.Gly1961Glu and p. Leu2027Phe, both have a mild structural and functional effect on the adult retina; the latter is associated with relatively retained photoreceptor architecture and function at the fovea.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Results: Eleven disease-associated homozygous ABCA4 alleles were identified, including 1 frame shift, 2 stops, 1 intronic variant causing splice-site alteration, 2 complex missense variants, and 5 missense variants: p.Glu905fsX916, p.Arg1300X, p.Gln2220X, c.4253&#fe;4 C>T, p.Leu541Pro and p.Ala1038Val (homozygosity for complex allele), p.Val931Met and p.Arg1705Gln (complex allele), p.Arg212Cys, p.Cys1488Arg, p.Arg1640Trp, p.Gly1961Glu, and p.Leu2027Phe. Login to comment
12 One patient with homozygous p.Leu2027Phe showed a spared fovea and preserved visual acuity. Login to comment
13 Conclusions: The phenotypes represented in patients identified as homozygous for presumed disease-associated ABCA4 variants gives insight into the effect of individual alleles. Null alleles have severe functional effects, and certain missense variants are similar to nulls, suggesting complete abrogation of protein function. The common alleles identified, p.Gly1961Glu and p. Leu2027Phe, both have a mild structural and functional effect on the adult retina; the latter is associated with relatively retained photoreceptor architecture and function at the fovea. Login to comment
60 Sex Ethnicity Consanguinity Age at Onset (yrs) Age (yrs) Duration of Disease (yrs) LogMAR VA Fundus Appearance AF Pattern ERG Group OCT Central Foveal Thickness (mm) Mutation Status RE LE RE LE 1 1 M S Asian Yes (1st cousin) 11 33 22 1.0 1.0 2 2 1 64 69 c.634 C>T, p.Arg212Cys 2 1 F S Asian Yes (1st cousin) 11 36 25 1.0 1.0 2 2 3 31 41 c.634 C>T, p.Arg212Cys 3* 2 M European No 3 8 5 1.2 1.2 2 2 3y 41 36 c.1622 T>C, p.Leu541Pro / c.3113 C>T, p.Ala1038Val 4 3 F S Asian Yes (2nd cousin once removed) 5 8 3 1.0 1.0 2 2 3 NA NA c.2713delG, p.Glu905fsX916 5 4 M S Asian Yes (unknown) 10 25 15 1.0 1.08 2 2 3 64 60 c.2791 G>A, p.Val931Met / c.5114 G>A, p.Arg1705Gln 6 5 M S Asian Yes (1st cousin) 10 30 20 1.0 1.0 2 2 3 NA NA c.4462 T>C, p.Cys1488Arg 7 5 F S Asian Yes (1st cousin) 10 22 12 2.0 1.0 2 2 3 NA NA c.4462 T>C, p.Cys1488Arg 8 6 M ME Asian Yes (1st cousin) 30 36 6 1.08 2.0 3 3 3 103 95 c.4918 C>T, p.Arg1640Trp 9 7 F S Asian Yes (2nd cousin) 19 27 8 1.78 2.0 1 2 1 128 90 c.5882 G>A, p.Gly1961Glu 10 7 M S Asian Yes (2nd cousin) 30 34 4 0.48 0.48 1 2 1 NA NA c.5882 G>A, p.Gly1961Glu 11 8 F S Asian Yes (1st cousin) 17 26 9 0.78 0.78 1 1 1 54 47 c.5882 G>A, p.Gly1961Glu 12 9 F European No 44 44 0 0.18 0.0 2 2 1 NA NA c.6079 C>T, p.Leu2027Phe 13 10 M ME Asian Yes (1st cousin) 5 11 6 1.3 1.0 3 2 3 62 68 c.3898 C>T, p.Arg1300X 14 11 M S Asian Yes (unknown) 8 11 3 1.0 1.0 2 2 3 NA NA c.4253&#fe;4 C>T 15 12 M S Asian Yes (1st cousin) 9 48 39 3.0 3.0 3 NA 3 NA NA c.6658 C>T, p.Gln2220X 16 13 M S Asian Yes (uncle and niece) 4 7 3 1.08 1.08 1 NA 3 NA NA c.6658 C>T, p.Gln2220X 17 13 M S Asian Yes (uncle and niece) 6 8 2 1.08 1.0 1 NA 3 NA NA c.6658 C>T, p.Gln2220X 18 13 M S Asian Yes (1st cousin) 17 25 8 1.78 1.78 3 NA 3 NA NA c.6658 C>T, p.Gln2220X AF &#bc; autofluorescence; ERG &#bc; electroretinography; F &#bc; female; FM No. Login to comment
80 One putative novel variant (p.Glu905fsX916) was identified by NGS, and 7 have not been described in the homozygous state before: p.Val931Met, p.Cys1488Arg, p.Arg1705Gln, p.Leu2027Phe, p.Arg1300X, c.4253&#fe;4C>T, and p.Gln2220X (Table 4, available at http://aaojournal.org). Login to comment
89 Three heterozygous changes were found in patient 12, suggesting that the p.Leu2027Phe had occurred recurrently on 2 distinct chromosomal backgrounds. Login to comment
96 A very mild phenotype was observed in patient 12, homozygous for p.Leu2027Phe, with late onset (44 years), well-preserved visual acuity (0.18 and 0.0 for each eye), type 2 fundus appearance, type 2 AF pattern with spared AF signal at the fovea, and normal full-field ERGs (group 1). Login to comment
117 The 2 previously reported variants (p.Asn96Lys and p.His1838Asp) in complex with p.Gly1961Glu that were associated with a very severe phenotype were not detected in our patients.12 We observed a particularly late-onset mild disorder, with numerous flecks and foveal sparing, associated with p.Leu2027Phe, suggesting primary disease of the parafoveal RPE with preservation of foveal structure, a "foveal sparing" phenotype. Login to comment
118 This supports previous reports of p.Leu2027Phe in heterozygous patients.14,23 Of note, p.Gly1961Glu and p.Leu2027Phe are both situated in the nucleotide-binding domain 2 subunit, shown to be the site of adenosine triphosphatase activity (Fig 5, available at http://aaojournal.org).39,40 Subjects homozygous for p.Arg212Cys had phenotypes of moderate severity, and these findings are generally in keeping with previous reports.19 Patient 5, homozygous for p.Val931Met and p.Arg1705Gln in complex, and subjects 6 and 7, homozygous for p.Cys1488Arg, had "typical" Stargardt`s disease fundus and AF findings with macular atrophy surrounded by flecks with electrophysiologic evidence of generalized rod and cone system dysfunction. Login to comment

[hide] Clinical and molecular analysis of Stargardt disea... Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003. Fujinami K, Sergouniotis PI, Davidson AE, Wright G, Chana RK, Tsunoda K, Tsubota K, Egan CA, Robson AG, Moore AT, Holder GE, Michaelides M, Webster AR
Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function.
Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003., [PMID:23953153]

Abstract [show]
PURPOSE: To describe a cohort of patients with Stargardt disease who show a foveal-sparing phenotype. DESIGN: Retrospective case series. METHODS: The foveal-sparing phenotype was defined as foveal preservation on autofluorescence imaging, despite a retinopathy otherwise consistent with Stargardt disease. Forty such individuals were ascertained and a full ophthalmic examination was undertaken. Following mutation screening of ABCA4, the molecular findings were compared with those of patients with Stargardt disease but no foveal sparing. RESULTS: The median age of onset and age at examination of 40 patients with the foveal-sparing phenotype were 43.5 and 46.5 years. The median logMAR visual acuity was 0.18. Twenty-two patients (22/40, 55%) had patchy parafoveal atrophy and flecks; 8 (20%) had numerous flecks at the posterior pole without atrophy; 7 (17.5%) had mottled retinal pigment epithelial changes; 2 (5%) had multiple atrophic lesions, extending beyond the arcades; and 1 (2.5%) had a bull's-eye appearance. The median central foveal thickness assessed with spectral-domain optical coherence tomographic images was 183.0 mum (n = 33), with outer retinal tubulation observed in 15 (45%). Twenty-two of 33 subjects (67%) had electrophysiological evidence of macular dysfunction without generalized retinal dysfunction. Disease-causing variants were found in 31 patients (31/40, 78%). There was a higher prevalence of the variant p.Arg2030Gln in the cohort with foveal sparing compared to the group with foveal atrophy (6.45% vs 1.07%). CONCLUSIONS: The distinct clinical and molecular characteristics of patients with the foveal-sparing phenotype are described. The presence of 2 distinct phenotypes of Stargardt disease (foveal sparing and foveal atrophy) suggests that there may be more than 1 disease mechanism in ABCA4 retinopathy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 6089 G>A, p.Arg2030Gln] 16 44* 44 0.18 0 2 NA NA 1 A A NA NA [c.6079 C>T, p.Leu2027Phe/c.6079 C>T, p.Leu2027Phe] 17 48 73 0.18 3 4 135 86 U 2 A ND NA NA [c.4956 T>G, p.Tyr1652*] 18 56 57 0 0 2 254 273 1 ND A NA NA [c.5018&#fe;2 T>C, Splice site] 19 53* 53 0.48 0.18 1 137 133 1 A A NA NA [c.5461-10 T>C, Splice site] 20 49 58 0.18 0 1 256 222 U 1 A N 1 1 [c.5461-10 T>C, Splice site] 21 47** 47 0.3 0.3 1 239 202 U 1 A A 1 1 [c.1805 G>A, p.Arg602Gln] 22 50* 50 0.48 0.18 1 263 261 U 1 N N NA NA [c.1957 C>T, p.Arg653Cys] 23 39* 39 0 0.1 2 225 228 1 N N NA NA [c.2588 G>C, p. Gly863Ala] 24 55 57 0.48 0.48 1 117 74 1 ND ND NA NA [c.3602 T>G, p.Leu1201Arg] 25 50 54 0.48 0.18 1 147 144 U 3 ND ND NA NA [c.3602 T>G, p.Leu1201Arg] 26 43 47 2 0.18 1 70 52 1 ND ND NA NA [c.4319 T>C, p.Phe1440Ser] 27 30 51 0.3 0.3 1 75 79 U 3 A A NA NA [c.4685 T>C, p.Ile1562Thr] 28 29 34 0.18 0.18 3 132 107 1 A A NA NA [c.4926 C>G, p.Ser1642Arg] 29 52* 52 0.18 0.18 3 180 200 1 ND ND 2 2 [c.5882 G>A, p.Gly1961Glu] 30 28 28 0.1 0.1 2 NA NA 1 N ND NA NA [c.6079 C>T, p.Leu2027Phe] 31 40* 40 0.1 0.1 2 222 223 U NA NA NA NA NA [c.6079 C>T, p.Leu2027Phe] 32 45 48 0.18 3 1 237 252 U NA NA NA NA NA NA Continued on next page Tartu, Estonia) in all probands.43 The term ''variants`` used herein includes those sequence changes previously shown to be enriched in patients with Stargardt disease from prior studies. Login to comment
127 2588G>C, p.Gly863Ala 4 Het Allikmets46 Intol. 0.01 PRD 0.996 No change 68/13006 db SNP (rs76157638) 21 c.3113C>T, p.Ala1038Val 1 Het Webster53 Tol. NA Benign 0.014 Donor 43.5 70 New site (&#fe;61.72) 22/13006 db SNP (rs61751374) 24 c.3602T>G, p.Leu1201Arg 2 Het Lewis48 Tol. NA Benign 0.052 Donor 61.3 74 New site (&#fe;20.08) 416/13006 db SNP (rs61750126) 27 c.3898C>T, p.Arg1300* 1 Het Rivera49 NA NA ND 28 c.4139C>T, p.Pro1380Leu 2 Het Lewis48 Intol. 0.01 Benign 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4222 T>C, p.Trp1408Arg 2 Het Lewis48 Tol. NA PRD 0.845 No change ND dbSNP (rs61750135) 29 c.4319T>C, p.Phe1440Ser 1 Het Lewis48 Tol. NA PRD 0.744 No change ND dbSNP (rs61750141) 30 c.4469G>A, p.Cys1490Tyr 1 Het Webster53 Intol. 0.03 PRD 0.994 No change ND dbSNP (rs61751402) 31 c.4577C>T, p.Thr1526Met 1 Het Lewis48 Intol. 0.00 PRD 0.91 No change ND db SNP (rs61750152) 31 c.4594G>T, p.Asp1532Asn 3 Het Lewis48 Tol. NA PRD 0.853 No change ND 33 c.4685T>C, p.Ile1562Thr 1 Het Allikmets46 Tol. NA Benign 0.034 No change 18/13006 db SNP (rs1762111) 35 c.4956T>G, p.Tyr1652* 1 Het Fumagalli52 NA NA Acceptor 43 72 New site (&#fe;67.36) ND 35 c.4918C>T, p.Arg1640Trp 2 Het Rozet47 Intol. 0.00 PRD 1 No change ND dbSNP (rs61751404) 35 c.4926C>G, p.Ser1642Arg 1 Het Birch50 Tol. 0.68 Benign 0.116 No change ND db SNP (rs61753017) Int 35 c.5018&#fe;2T>C, Splice site 1 Het Fumagalli52 NA NA Donor 81.2 54 WT site broken (33.07) ND Int 38 c.5461-10T>C 3 Het Briggs50 NA NA No change 3/13006 db SNP (rs1800728) 40 c.5693G>A, p.Arg1898His 2 Het Allikmets46 NA Benign 0.00 No change 25/13006 db SNP (rs1800552) 42 c.5882G>A, p.Gly1961Glu 1 Het Allikmets46 Tol. 0.18 PRD 1 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T, p.Leu2027Phe 4 Homo Lewis48 Intol. 0.02 PRD 0.999 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A, p.Arg2030Gln 4 Het Lewis48 Tol. NA PRD 0.995 No change 8/13006 db SNP (rs61750641) 44 c.6118C>T, p.Arg2040* 1 Het Rosenberg54 NA NA ND 46 c.6320G>A, p.Arg2107His 1 Het Fishman8 Intol. 0.00 PRD 0.996 No change 91/13006 db SNP (rs62642564) EVS &#bc; Exome Variant Server; HSF &#bc; Human Splicing Finder program; Hum var score &#bc; Human var score; Int &#bc; intron; Intol &#bc; intolerant; Mt CV &#bc; mutant consensus value; NA &#bc; not applicable; ND &#bc; not detected; PRD &#bc; probably damaging; Pred. &#bc; prediction; SIFT &#bc; Sorting Intolerant from Tolerance program; Tol. &#bc; tolerant; Wt CV &#bc; wild-type consensus value. Login to comment
136 The most common variants identified were p.Gly863Ala, c.5461-10T>C, p.Leu2027Phe, and p.Arg2030Gln, occurring, respectively, in 4, 3, 3, and 4 patients with the foveal-sparing phenotype of Stargardt disease. Login to comment
137 One patient was identified to be homozygous for the p.Leu2027Phe variant; none had 2 or more null variants. Login to comment
142 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) (Continued) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency Int 33 c.4773&#fe;48C>T 1 0.36% 34 c.4793C>A, p.Ala1598Asp 1 0.36% 35 c.c.4918C>T, p.Arg1640Trp 1 0.36% Int 35 c.5018&#fe;2T>C, Splice site 2 0.71% 36 c.5114G>A, p.Arg1705Gln 2 0.71% 37 c.5222_5233delTGGTGGTGGGC, p.Lys1741Hisfs 1 0.36% 37 c.5281_5289delCTT CCT GCC, p.Pro1761_Leu1763del 2 0.71% Int 38 c.5461-10T>C 23 8.21% Int 39 c.5585-1G>A, Splice site 1 0.36% Int 40 c.5714&#fe;5G>A, Splice site 5 1.79% 42 c.5882G>A, p.Gly1961Glu 17 6.07% 43 c.5908C>T, p.Leu1970Phe 2 0.71% 43 c.5917delG, p.Val1973* 1 0.36% 44 c.6079C>T, p.Leu2027Phe 10 3.57% 44 c.6089G>A, p.Arg2030Gln 3 1.07% 44 c.6118C>T, p.Arg2040* 1 0.36% 45 c.6148G>C, p.Val2050Leu 3 1.43% 46 c.6286G>A, p.Glu2096Lys 1 0.36% 46 c.6320G>A, p.Arg2107His 4 1.43% 47 c.6445C>T, p.Arg2149* 1 0.36% 47 c.6449G>A, p.Cys2150Tyr 3 1.07% 48 c.6658C>T, p.Gln2220* 3 1.07% 48 c.6709_6710insG, p.Thr2237Serfs 1 0.36% Int &#bc; Intron. Login to comment
164 Comparison of the Most Prevalent ABCA4 Variants` Frequency Between the Cohort With the Foveal-Sparing Stargardt Disease and the Group With the Typical Stargardt Disease (Without Evidence of Foveal Sparing) Number of Alleles and Those Frequencies Foveal-Sparing Stargardt Disease (n &#bc; 31, Total 30 Variants in 62 Alleles) Typical Stargardt Disease (n &#bc; 140, Total 72 Variants in 280 Alleles) c.2588G>C, p.Gly863Ala 4 (6.45%) 19 (6.79%) c.4139C>T, p.Pro1380Leu 2 (3.23%) 14 (5.00%) c.6079C>T, p.Leu2027Phe 4 (6.45%) 10 (3.57%) c.6089G>A, p.Arg2030Gln 4 (6.45%) 3 (1.07%) c.5461-10T>C 3 (4.84%) 23 (8.21%) c.5882G>A, p.Gly1961Glu 1 (1.61%) 17 (6.07%) in the foveal-sparing phenotype compared to the typical phenotype; there was also clear concordance in sibships with the foveal-sparing phenotype, although a possible influence of genetic/environmental modifiers cannot be excluded. Login to comment

[hide] ABCA4 gene screening by next-generation sequencing... Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570. Fujinami K, Zernant J, Chana RK, Wright GA, Tsunoda K, Ozawa Y, Tsubota K, Webster AR, Moore AT, Allikmets R, Michaelides M
ABCA4 gene screening by next-generation sequencing in a British cohort.
Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570., [PMID:23982839]

Abstract [show]
PURPOSE: We applied a recently reported next-generation sequencing (NGS) strategy for screening the ABCA4 gene in a British cohort with ABCA4-associated disease and report novel mutations. METHODS: We identified 79 patients with a clinical diagnosis of ABCA4-associated disease who had a single variant identified by the ABCA4 microarray. Comprehensive phenotypic data were obtained, and the NGS strategy was applied to identify the second allele by means of sequencing the entire coding region and adjacent intronic sequences of the ABCA4 gene. Identified variants were confirmed by Sanger sequencing and assessed for pathogenicity by in silico analysis. RESULTS: Of the 42 variants detected by prescreening with the microarray, in silico analysis suggested that 34, found in 66 subjects, were disease-causing and 8, found in 13 subjects, were benign variants. We detected 42 variants by NGS, of which 39 were classified as disease-causing. Of these 39 variants, 31 were novel, including 16 missense, 7 splice-site-altering, 4 nonsense, 1 in-frame deletion, and 3 frameshift variants. Two or more disease-causing variants were confirmed in 37 (47%) of 79 patients, one disease-causing variant in 36 (46%) subjects, and no disease-causing variant in 6 (7%) individuals. CONCLUSIONS: Application of the NGS platform for ABCA4 screening enabled detection of the second disease-associated allele in approximately half of the patients in a British cohort where one mutation had been detected with the arrayed primer extension (APEX) array. The time- and cost-efficient NGS strategy is useful in screening large cohorts, which will be increasingly valuable with the advent of ABCA4-directed therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 40 c.4926C>G p.S1642R DC c.5041_5055del GTGGTTGCCATCTGC p.V1681_C1685del DC 2 41 c.4956T>G p.Y1652* DC 1 42 c.5018&#fe;2T>C Splice site DC 1 43 c.5461-10T>C DC c.6385A>G p.S2129G PDC 2 44 c.5461-10T>C DC 1 45 c.5461-10T>C DC 1 46 c.5461-10T>C DC 1 47 c.5461-10T>C DC 1 48 c.5461-10T>C DC 1 49 c.5461-10T>C DC 1 50 c.5461-10T>C DC 1 51 c.5585-1G>A Splice site DC 1 52 c.5714&#fe;5G>A Splice site DC c.6209C>G p.T2070R DC 2 53 c.5882G>A p.G1961E DC c.2686A>G p.K896E B 1 54 c.5882G>A p.G1961E DC c.3050&#fe;1G>C Splice site DC 2 55 c.5882G>A p.G1961E DC c.3392delC/3393C>G p.A1131Gfs DC 2 56 c.5882G>A p.G1961E DC c.4539&#fe;2T>G Splice site DC 2 57 c.5882G>A p.G1961E DC c.4552A>C p.S1518R DC 2 58 c.5882G>A p.G1961E DC c.5899-2delA Splice site DC 2 59 c.5882G>A p.G1961E DC 1 60 c.6079C>T p.L2027F DC c.1906C>T p.Q636* DC 2 61 c.6079C>T p.L2027F DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 62 c.6079C>T p.L2027F DC c.3370G>T p.D1124Y DC 2 63 c.6079C>T p.L2027F DC 1 64 c.6089G>A p.R2030Q DC c.4326C>A p.N1442K DC 2 65 c.6445C>T p.R2149* DC 1 66 c.6709A>C p.T2237P DC c.5899-3_5899-2delTA Splice site DC 2 67 c.2971G>C p.G991R B c.4538A>G p.Q1513R DC 1 68 c.3602T>G p.L1201R B c.1749G>C p.K583N DC 1 69 c.3602T>G p.L1201R B c.1982_1983insG p.A662fs DC 1 70 c.3602T>G p.L1201R B c.2972G>T p.G991V DC 1 71 c.4685T>C p.I1562T B c.3289A>T p.R1097* DC 1 72 c.6320G>A p.R2107H B c.2510T>C p.L837P DC 1 73 c.6320G>A p.R2107H B c.4352&#fe;1G>A Splice site DC 1 74 c.2701A>G p.T901A B 0 75 c.3602T>G p.L1201R B 0 76 c.4283C>T p.T1428M B 0 77 c.466A>G p.I156V B 0 78 c.466A>G p.I156V B 0 79 c.4715C>T p.T1572M B 0 Putative novel variants are shown in italics. Login to comment
63 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 30 c.4537_4538insC p.G1513fs 1 38 [ Briggs CE, et al. 19 ND False-negative in NGS in patient 38 31 c.4577C>T p.T1526M 1 39 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.910 No change ND db SNP (rs61750152) 33 c.4685T>C p.I1562T 1 71 [ [ Yatsenko, et al. 13 Tol. NA PRD 0.783 No change ND Benign 33 c.4715C>T p.T1572M 1 79 [ [ Pang CP and Lamm DS 23 Del. 0.02 B 0.326 No change ND db SNP (rs185093512) Benign 35 c.4926C>G p.S1642R 1 40 [ [ Birch DG, et al. 22 Tol. 0.68 B 0.116 No change ND db SNP (rs61753017) 35 c.4956T>G p.Y1652* 1 41 [ [ Fumagalli A, et al. 16 ND db SNP (rs61750561) IVS35 c.5018&#fe;2T>C Splice site 1 42 [ [ APEX Don. 81.2 54.3 WT site broken (33.07) ND 36 c.5113C>T p.R1705W 1 7 [ Ernest PJ, et al. 26 Del. NA PRD 0.996 Don. 46.5 73.3 No change ND IVS38 c.5461-10T>C 8 43, 44, 45, 46, 47, 48, 49, 50 [ [ Briggs CE, et al. 19 No change 3/13006 db SNP (rs1800728) IVS39 c.5585-1G>A Splice site 1 51 [ [ Shroyer NF, et al. 21 Acc. 86.3 57.4 WT site broken (33.53) ND IVS40 c.5714&#fe;5G>A Splice site 1 52 [ [ Cremers FP, et al. 8 Don. 85.5 73.3 Wild type site broken (14.23) ND 42 c.5882G>A p.G1961E 7 53, 54, 55, 56, 57, 58, 59 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.998 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T p.L2027F 4 60, 61, 62, 63 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 1.000 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A p.R2030Q 1 64 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.995 No change 8/13006 db SNP (rs61750641) 46 c.6320G>A p.R2107H 2 72, 73 [ [ Fishman GA, et al. 15 Del. 0.04 PRD 0.999 No change 91/13006 db SNP (rs62642564) Benign 47 c.6445C>T p.R2149* 1 65 [ [ Lewis RA, et al. 14 1/13006 db SNP (rs61750654) 48 c.6529G>A p.D2177N 1 19 [ Rivera A, et al. 17 Tol. 0.41 B 0.004 No change 116/13006 db SNP (rs1800555) Benign 48 c.6709A>C p.T2237P 1 66 [ [ APEX Del. NA POD 0.719 No change ND IVS48 c.6729&#fe;4_ &#fe;18del AGTTGGCCCTGGGGC Splice site 1 17 [ Littink KW, et al. 28 NA ND Splice-site alteration (described as splice site) includes the change expected to affect splicing, for example, when the splice donor or splice acceptor site is changed, and the change that might affect splicing, for example, changes close to the splice donor or splice acceptor site, or in the first or last nucleotide of an exon. SIFT (version 4.0.4) results are reported to be tolerant if tolerance index is ߥ0.05 or deleterious if tolerance index is <0.05. Login to comment

[hide] Distinct characteristics of inferonasal fundus aut... Invest Ophthalmol Vis Sci. 2013 Oct 17;54(10):6820-6. doi: 10.1167/iovs.13-12895. Duncker T, Lee W, Tsang SH, Greenberg JP, Zernant J, Allikmets R, Sparrow JR
Distinct characteristics of inferonasal fundus autofluorescence patterns in stargardt disease and retinitis pigmentosa.
Invest Ophthalmol Vis Sci. 2013 Oct 17;54(10):6820-6. doi: 10.1167/iovs.13-12895., [PMID:24071957]

Abstract [show]
PURPOSE: To report distinct characteristics of fundus autofluorescence (AF) patterns inferior to the optic disc in recessive Stargardt disease (STGD1) and retinitis pigmentosa (RP). METHODS: Short-wavelength (SW) and near-infrared (NIR) AF images were acquired from patients with STGD1 and RP. In SW- and NIR-AF images of STGD1 patients, gray levels (GL) on both sides of the demarcation line were measured. RESULTS: In STGD1, a demarcation line, which has been assigned to the closed optic fissure, was visible on SW-AF and NIR-AF inferior to the optic disc. In healthy subjects, this demarcation line is only visible by SW-AF. At 20 degrees inferior to the disc center, AF levels on the nasal side were 25% (+/-11%) lower than on the temporal side in SW-AF images and 18% (+/-11%) lower in NIR-AF images. For both STGD1 and RP, the inferonasal quadrant exhibited distinct SW- and NIR-AF patterns compared with other fundus areas. Disease-related AF changes, such as flecks, appeared to respect the demarcation line as a boundary. CONCLUSIONS: Disease-related AF patterns originating in RPE in STGD1 and RP appear to respect the demarcation line in the inferonasal quadrant of the fundus as a border. The visibility of the inferonasal demarcation line by NIR-AF in STGD1 but not in healthy eyes may indicate that increased levels of RPE lipofuscin modulate the melanin-related NIR-AF signal. This feature of NIR-AF images may aid in the diagnosis of STGD1 patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Summary of Demographic, Clinical, and Genetic Data Patient Condition ABCA4 Mutations Sex Age, y Eye Iris Color Race/Ethnicity BCVA Snellen (logMAR) P1 STGD1 p.P1380L, p.G1961E M 12 OS Blue White 20/100 (0.70) P2 STGD1 p.P1380L, p.G1961E F 17 OS Brown White 20/150 (0.88) P3 STGD1 p.Q1003X, p.G1961E M 25 OS Brown White 20/40 (0.30) P4 STGD1 p.C54Y F 48 OD Blue White 20/30 (0.20) P5 STGD1 p.R2077W F 52 OD Blue White 20/40 (0.30) P6 STGD1 p.[L541P;A1038V] M 13 OS Brown White 20/150 (0.88) P7 STGD1 p.T972N, p.L2027F F 14 OS Blue White 20/80 (0.60) P8 STGD1 c.4537_4538insC, p.V1686M M 49 OS Brown White 20/50 (0.40) P9 STGD1 p.R1108H, p.P1380L M 50 OS Blue White 20/200 (1.00) P10 STGD1 c.5714&#fe;5G>A F 34 OD Blue White 20/200 (1.00) P11 STGD1 p.Q636H, p.G1961E M 46 OD Brown Indian 20/400 (1.30) P12 STGD1 c.5461-10T>C M 35 OD Brown Black 20/400 (1.30) P13 STGD1 p.R1640W F 20 OD Brown Black 20/125 (0.80) P14 STGD1 p.R290W M 47 OS Brown White 20/40 (0.30) P15 STGD1 p.A1773V, p.G1961E M 18 OD Brown White 20/150 (0.88) P16 AD RP p.T17M* F 23 OD Brown Hispanic 20/30 (0.20) P17 AD RP N/A M 39 OS Brown White 20/20 (0.00) P18 AR RP N/A M 50 OS Green White 20/20 (0.00) AD, autosomal dominant; AR, autosomal recessive; BCVA, best corrected visual acuity; F, female; logMAR, logarithm of the minimum angle of resolution; M, male; N/A, not available. Login to comment

[hide] A longitudinal study of Stargardt disease: quantit... Invest Ophthalmol Vis Sci. 2013 Dec 17;54(13):8181-90. doi: 10.1167/iovs.13-12104. Fujinami K, Lois N, Mukherjee R, McBain VA, Tsunoda K, Tsubota K, Stone EM, Fitzke FW, Bunce C, Moore AT, Webster AR, Michaelides M
A longitudinal study of Stargardt disease: quantitative assessment of fundus autofluorescence, progression, and genotype correlations.
Invest Ophthalmol Vis Sci. 2013 Dec 17;54(13):8181-90. doi: 10.1167/iovs.13-12104., [PMID:24265018]

Abstract [show]
PURPOSE: We characterized subtypes of fundus autofluorescence (AF) and the progression of retinal atrophy, and correlated these findings with genotype in Stargardt disease. METHODS: Full clinical examination and AF imaging was undertaken in 68 patients with Stargardt disease. The baseline data were compared to those at follow-up. Patients were classified into three AF subtypes: type 1 had a localized low signal at the fovea surrounded by a homogeneous background, type 2 had a localized low signal at the macula surrounded by a heterogeneous background with numerous foci of abnormal signal, and type 3 had multiple low signal areas at the posterior pole with a heterogeneous background. At baseline, there were 19 patients with type 1, 41 with type 2, and 8 with type 3 disease. The areas of reduced AF signal were measured and rate of atrophy enlargement (RAE) was calculated as the difference of the atrophy size over time (mm(2)) divided by the follow-up interval (years). Molecular screening of ABCA4 was undertaken. RESULTS: The mean follow-up interval was 9.1 years. A total of 42% cases with type 1 disease progressed to type 2, and 12% with type 2 progressed to type 3. The RAE (mm(2)/y) based upon baseline AF subtypes was significantly different; 0.06 in type 1, 0.67 in type 2, and 4.37 in type 3. ABCA4 variants were identified in 57 patients. There was a significant association between AF subtype and genotype. CONCLUSIONS: The AF pattern at baseline influences the enlargement of atrophy over time and has genetic correlates. These data are likely to assist in the provision of counseling on prognosis in Stargardt disease and be valuable for future clinical trials.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
131 Four of eight patients from eight families harboring the missense variant p.Leu2027Phe had small central atrophy (<0.18 mm2 ) at baseline (Supplementary Table S1). Login to comment
167 Consistent with previous reports, four of nine patients with the c.5461-10 T>C variant had a severe phenotype, with multiple large areas of atrophy.9,33,55,56 In contrast, there were three patients with the c.5461-10 T>C variant with a lower atrophy enlargement, all of whom also harbored missense variants (p.Gly1961Glu in one patient, and p.Leu2027Phe in the remaining two subjects); considered to be associated with a milder phenotype.2,10,54,56,57 The substitutions p.Leu2027Phe, and to a greater extent p.Gly1961Glu, also were associated with a milder AF phenotype in our study. Login to comment

[hide] Inner and outer retinal changes in retinal degener... Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768. Huang WC, Cideciyan AV, Roman AJ, Sumaroka A, Sheplock R, Schwartz SB, Stone EM, Jacobson SG
Inner and outer retinal changes in retinal degenerations associated with ABCA4 mutations.
Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768., [PMID:24550365]

Abstract [show]
PURPOSE: To investigate in vivo inner and outer retinal microstructure and effects of structural abnormalities on visual function in patients with retinal degeneration caused by ABCA4 mutations (ABCA4-RD). METHODS: Patients with ABCA4-RD (n = 45; age range, 9-71 years) were studied by spectral-domain optical coherence tomography (OCT) scans extending from the fovea to 30 degrees eccentricity along horizontal and vertical meridians. Thicknesses of outer and inner retinal laminae were analyzed. Serial OCT measurements available over a mean period of 4 years (range, 2-8 years) allowed examination of the progression of outer and inner retinal changes. A subset of patients had dark-adapted chromatic static threshold perimetry. RESULTS: There was a spectrum of photoreceptor layer thickness changes from localized central retinal abnormalities to extensive thinning across central and near midperipheral retina. The inner retina also showed changes. There was thickening of the inner nuclear layer (INL) that was mainly associated with regions of photoreceptor loss. Serial data documented only limited change in some patients while others showed an increase in outer nuclear layer (ONL) thinning accompanied by increased INL thickening in some regions imaged. Visual function in regions both with and without INL thickening was describable with a previously defined model based on photoreceptor quantum catch. CONCLUSIONS: Inner retinal laminar abnormalities, as in other human photoreceptor diseases, can be a feature of ABCA4-RD. These changes are likely due to the retinal remodeling that accompanies photoreceptor loss. Rod photoreceptor-mediated visual loss in retinal regionswith inner laminopathy at the stages studied did not exceed the prediction from photoreceptor loss alone.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Characteristics of the ABCA4-Related Retinal Disease Patients Patient Age at Visits, y Sex Allele 1 Allele 2 Previous Report*ߤ P1 9, 12 M E341G F608I P2 9, 15 M R681X C2150Y P28* P3ߥ 12 M N965S W821R P1ߤ P4 13, 16 M V256V T1526M P21*, P15ߤ P5 14, 20 F W1408R IVS40&#fe;5 G>A P49* P6ߥ 16 F V989A IVS28&#fe;5 G>T P17ߤ P7ߥ 16 M N965S W821R P18ߤ P8 18, 20 F Y362X IVS38-10 T>C P9ߥ 18 F V989A IVS28&#fe;5 G>T P10 18, 22 M G1961E R1129L P3ߤ P11 20 M R1640Q c.5174_5175insG P12ߥ 20 M G1961E G1961E/P68L P13 22, 25 M G863A IVS35&#fe;2 T>C P20ߤ P14 22, 24 F G1961E R152X P12*, P21ߤ P15ߥ 23 M G1961E G1961E/P68L P16 25, 27 M G1961E R152X P11* P17 26, 32 F L1940P R1129L P64* P18 27, 34 F R1925G A1038V/L541P P19 27, 29 M c.4530_4531insC R1705Q P52*, P5ߤ P20 28, 30 F G1961E A1038V/L541P P23ߤ P21 31, 35 M T1019M G1961E P34* P22ߥ 32, 37 M P1486L Deletion of exon 7 P25ߤ P23 33, 35 M G863A R1108C P29*, P6ߤ P24 34, 37 F IVS40&#fe;5 G>A V935A P32*, P7ߤ P25 34 M G1961E &#a7; P8ߤ P26 37, 43 F C54Y G863A P4* P27 39, 44 F G863A C1490Y P30*, P26ߤ P28 40 M G1961E C54Y P7*, P10ߤ P29 41 F IVS38-10 T>C E1087D P59* P30ߥ 43, 47 F G1961E V256V P23*, P11ߤ P31ߥ 47, 51 F P1486L Deletion of exon 7 P32 47 M Y245X Y245X P20* P33ߥ 48, 51 F G1961E V256V P22*, P12ߤ P34 48, 50 F c.3208_3209insTG IVS40&#fe;5 G>A P35 50, 54 M V1433I L2027F P50* P36ߥ 52, 55 F T1526M R2030Q P55*, P28ߤ P37 53, 59 F G1961E P1380L P47*, P13ߤ P38ߥ 53, 61 M L1940P IVS40&#fe;5 G>A P61* P39 58 M D600E R18W P2*, P14ߤ P40 59, 62 M E1122K G1961E P44* P41 59, 62 F R1640Q G1961E P58* P42ߥ 62 F T1526M R2030Q P54* P43ߥ 64, 68 M L1940P IVS40&#fe;5 G>A P62* P44 68 F R1108C IVS40&#fe;5 G>A P42* P45 71 F IVS38-10 T>C &#a7; Novel variants are bold and italicized. Login to comment

[hide] Quantitative fundus autofluorescence in recessive ... Invest Ophthalmol Vis Sci. 2014 May 1;55(5):2841-52. doi: 10.1167/iovs.13-13624. Burke TR, Duncker T, Woods RL, Greenberg JP, Zernant J, Tsang SH, Smith RT, Allikmets R, Sparrow JR, Delori FC
Quantitative fundus autofluorescence in recessive Stargardt disease.
Invest Ophthalmol Vis Sci. 2014 May 1;55(5):2841-52. doi: 10.1167/iovs.13-13624., [PMID:24677105]

Abstract [show]
PURPOSE: To quantify fundus autofluorescence (qAF) in patients with recessive Stargardt disease (STGD1). METHODS: A total of 42 STGD1 patients (ages: 7-52 years) with at least one confirmed disease-associated ABCA4 mutation were studied. Fundus AF images (488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference to account for variable laser power and detector sensitivity. The gray levels (GLs) of each image were calibrated to the reference, zero GL, magnification, and normative optical media density to yield qAF. Texture factor (TF) was calculated to characterize inhomogeneities in the AF image and patients were assigned to the phenotypes of Fishman I through III. RESULTS: Quantified fundus autofluorescence in 36 of 42 patients and TF in 27 of 42 patients were above normal limits for age. Young patients exhibited the relatively highest qAF, with levels up to 8-fold higher than healthy eyes. Quantified fundus autofluorescence and TF were higher in Fishman II and III than Fishman I, who had higher qAF and TF than healthy eyes. Patients carrying the G1916E mutation had lower qAF and TF than most other patients, even in the presence of a second allele associated with severe disease. CONCLUSIONS: Quantified fundus autofluorescence is an indirect approach to measuring RPE lipofuscin in vivo. We report that ABCA4 mutations cause significantly elevated qAF, consistent with previous reports indicating that increased RPE lipofuscin is a hallmark of STGD1. Even when qualitative differences in fundus AF images are not evident, qAF can elucidate phenotypic variation. Quantified fundus autofluorescence will serve to establish genotype-phenotype correlations and as an outcome measure in clinical trials.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 In some cases where no mutations were detected by the array, or in more recently recruited patients, the next generation sequencing of the entire ABCA4 open reading frame and adjacent intronic sequences was performed on the Roche 454 platform.30 The four most common mutations found in six or more patients were: G1961E (12 patients from 11 families); L541P/ A1038V (eight patients from five families); L2027F (six patients from five families); and P1380L (six patients from six families). Login to comment
80 [L541P; A1038V] 356 354 1.7 1.8 5 F 14 1 0.60 0.60 II II p.L2027F; p.T972N 737 718 2.3 2.6 6 M 45 31 1.00 0.88 I I p.G1961E; p.P1380L 623 543 4.2 4.0 7 F 42 5 0.30 CF - I p.E1252* 557 2.1 8 M 15 4 0.80 0.80 II II p.L2027F; p.R2077W 728 697 3.2 3.2 9 F 24 2 0.60 0.40 II II p.R1161S 571 647 3.8 3.5 10 M 46 15 1.30 1.30 I I p.G1961E; p.Q636H 394 351 2.3 2.4 11.1 M 12 2 1.00 1.00 II - p. Login to comment
82 [L541P; A1038V]; p.R1640W 850 4.4 12 F 27 9 1.30 1.00 - III p.P1380L; p.P1380L 577 4.8 13 F 39 8 0.12 0.00 - I c.250_251insCAAA 616 2.3 14 M 23 4 0.88 0.60 - II p.C54Y 535 5.1 15.1 M 49 17 1.00 0.88 I I p.Y1557C 646 604 4.1 3.9 15.2 M 46 7 0.10 0.48 I I p.Y1557C 456 508 2.6 2.3 16.1 F 27 14 0.88 0.88 III III p.L2027F; p.G851D 448 459 6.0 6.3 16.2 F 29 19 1.30 1.18 III III p.L2027F; p.G851D 538 569 7.4 7.9 17 M 22 18 1.30 1.00 III III p.P1380L; p.R2030Q 434 411 5.7 6.0 18 M 37 16 0.70 0.70 I I p.G1961E; p.G1961E 281 279 2.6 2.2 19 F 33 5 0.88 0.70 I I p.G1961E; c.4540-2A > G 412 420 2.5 2.8 20 F 26 12 0.60 0.60 - I p.G1961E; p. Login to comment
84 [A854T; A1038V]; p.C2150Y 512 2.3 26 F 52 1 0.70 0.48 I - p.R212C 722 2.0 27 F 52 13 1.00 1.00 - I p.A1038V; p.A848D 459 4.1 28 M 20 5 0.30 0.40 I - p.L2027F; p.R1108H 507 2.3 29 M 23 7 1.00 1.00 I I p.G1961E; p.R2030Q 334 347 2.4 2.0 30 M 44 26 0.70 0.70 - II p.P1380L; p.R1108H 453 4.7 31 F 30 22 1.00 1.30 - I p.G1961E; c.6005&#fe;1G > T 428 2.3 32 M 12 8 0.40 0.40 I - p.W821R; p.C2150Y 306 2.0 33 F 20 9 0.88 0.88 III III p.R602W; p.M1882I 650 655 2.6 2.5 34 F 47 4 0.40 0.40 I - p.G1961E; p.R1129C 400 2.5 35 F 19 3 0.70 0.48 II II p. Login to comment
85 [L541P; A1038V]; p.L2027F 733 749 3.9 4.0 36 F 20 7 0.88 1.00 II II p.R1640W 571 552 3.4 3.8 37 F 12 3 0.80 0.80 I I p.R1108C; p.Q1412* 536 501 1.7 1.7 * All subjects were white, except for patients 10, 22, and 36 who were Indian, Hispanic, and black, respectively. Login to comment
135 Comparing each of the four most common mutations separately with healthy eyes, G1961E (P &#bc; 0.001); L541P/ A1038V (P < 0.001); L2027F (P < 0.001); and P1380L (P &#bc; 0.024) eyes had qAF8 that was significantly higher than in FIGURE 2. Login to comment
146 When corrected for age (P &#bc; 0.04) and sex (P &#bc; 0.004), compared with all other patients who did not have that particular mutation, the mutations L2027F (P &#bc; 0.009) and L541P/A1038V (P &#bc; 0.015) were associated with higher qAF8, while A1038V (when not in conjunction with L541P, P &#bc; 0.06); G851D (P &#bc; 0.006); and G1961E (P < 0.001) were associated with lower qAF8 in this sample. Login to comment
152 Genotype-Phenotype Relations (TF) When compared separately with healthy eyes, three of the four most common mutations, L541P/A1038V (P < 0.001); L2027F (P < 0.001); and P1380L (P &#bc; 0.001), had TF that was significantly higher than in healthy eyes, when corrected for age. Login to comment
180 The mutations were confirmed in six or more patients (G1961E, L541P/A1038V, L2027F, and P1380L) or in two to four patients (R1640W, Y1557C, G851D, and R2030Q). Login to comment
226 For example, based on our cross-sectional data, the mutations L2027F and L541P/A1038V seem to confer a faster rate of accumulation, whereas G1961E and G851D seems to confer a slower increase (Fig. 5). Login to comment
233 Additional missense mutations found to associate with elevated qAF8 compared with other mutations in our sample were L2027F and P1380L. Login to comment
234 The L2027F mutation causes an amino acid change in NBD-2 and confers reduced ATP binding.11,48 P1380L is also a severe mutation and is suggested to cause either impaired ATP binding11 or altered transport of ABCA4 protein across the outer segment membrane.46 When P1380L is carried in compound heterozygosity with R2077W, autosomal recessive cone-rod dystrophy results.49 When harbored as a homozygous mutation or as a compound heterozygous mutation with R2030Q or IVS40 &#fe; 5G>A, the mutation is associated with central atrophy and peripapillary disease, the latter being an uncommon phenotype.50 The missense mutation G1961E in exon 42 of the ABCA4 gene is the most common ABCA4 mutation.51 This sequence change results in a glycine to glutamate substitution within the NBD-2 of the protein.11,45 The G1961E allele always cosegregates with the disease in families.45,52 Nevertheless, the G1961E mutation in ABCA4 is perplexing since in an in vitro assay this mutation conferred a markedly aberrant decrease in all-trans-retinal stimulated ABCA4 ATPase activity,11 yet it is considered to be associated with mild disease. Login to comment

[hide] Generalized choriocapillaris dystrophy, a distinct... Invest Ophthalmol Vis Sci. 2014 Apr 29;55(4):2766-76. doi: 10.1167/iovs.13-13391. Bertelsen M, Zernant J, Larsen M, Duno M, Allikmets R, Rosenberg T
Generalized choriocapillaris dystrophy, a distinct phenotype in the spectrum of ABCA4-associated retinopathies.
Invest Ophthalmol Vis Sci. 2014 Apr 29;55(4):2766-76. doi: 10.1167/iovs.13-13391., [PMID:24713488]

Abstract [show]
PURPOSE: We describe a particular form of autosomal recessive generalized choriocapillaris dystrophy phenotype associated with ABCA4 mutations. METHODS: A cohort of 30 patients with identified ABCA4 mutations and a distinct phenotype was studied. A retrospective review of history, fundus photographs, electroretinography, visual field testing, dark adaptometry, and optical coherence tomography was performed. Genetic analyses were performed by ABCA4 microarray analysis, high resolution melting, and/or next generation sequencing of all protein-coding sequences of the ABCA4 gene. RESULTS: The earliest recorded manifestation of ABCA4-associated disease was a central bull's eye type of macular dystrophy that progressed to chorioretinal atrophy of the macula with coarse rounded hyperpigmentations and expanding involvement of the periphery. The mean age at first presentation was 10.3 years, the longest follow-up was 61 years. All patients had two ABCA4 mutations identified, confirming the molecular genetic diagnosis of an ABCA4-associated disease. Most patients harbored at least one mutation classified as "severe," the most common of which was the p.N965S variant that had been found previously at a high frequency among patients with ABCA4-associated retinal dystrophies in Denmark. CONCLUSIONS: Generalized choriocapillaris dystrophy is a progressive ABCA4-associated phenotype characterized by early-onset macular dystrophy that disperses and expands to widespread end-stage chorioretinal atrophy with profound visual loss. All cases in this study were confirmed as harboring two ABCA4 mutations. Most of the ABCA4 mutations were classified as "severe" explaining the early onset, panretinal degeneration, and fast progression of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
123 Summary of Detected Potential Pathogenic Variants (Known and Novel [in Bold Face]) Found in the ABCA4 Gene of Patients With Generalized Choriocapillaris Dystrophy Patient Method Mutation 1 Mutation 2 Nucleotide Protein Nucleotide Protein D513 NGS c.203C>T p.P68L c.2894A>G p.N965S D514 Microarray, NGS c.2894A>G p.N965S c.5461-10T>C - D516 NGS c.4926C>G p.S1642R c.5041_5055del p.V1681_C1685del D517 NGS c.5169C>G p.Y1723* c.6079C>T p.L2027F D137 Microarray, NGS c.2894A>G p.N965S c.2894A>G p.N965S D801 Microarray, NGS c.6386&#fe;1G>A Aberrant splicing c.4234C>T p.Q1412* D109 Microarray c.2894A>G p.N965S c.4234C>T p.Q1412* D040 Microarray c.6229C>T p.R2077W c.6229C>T p.R2077W D159 Microarray c.3113C>T p.L541P/A1038V c.3113C>T p.L541P/A1038V D129 Microarray c.2894A>G p.N965S c.3322C>T p.R1108C D115 Microarray c.2894A>G p.N965S c.3113C>T p.L541P/A1038V D033 Microarray c.2894A>G p.N965S c.2041C>T p.R681* D023 Microarray c.203C>T p.P68L c.3329-2A>G Aberrant splicing D001 Microarray c.666_678del p.K223_R226delfs c.4667&#fe;2T>C Aberrant splicing D147 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D162 Microarray c.3329-2A>G Aberrant splicing c.6089G>A p.R2030Q D022 Microarray, HRM c.4462T>C p.C1488R c.4102C>T p.R1368C D112 Microarray, HRM c.2894A>G p.N965S c.1529T>G p.L510R D108 Microarray, HRM c.1648G>A p.G550R c.4102C>T p.R1368C D107 Microarray c.666_678del p.K223_R226delfs c.2588G>C p.G863A D070 Microarray c.2588G>C p.G863A c.2588G>C p.G863A D116 Microarray c.2300T>A p.V767D c.5461-10T>C - D135 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D117 Microarray, HRM c.3191-2A>G Aberrant splicing c.2408delG p.G803fs D186 Microarray, HRM c.3322C>T p.R1108C c.6386&#fe;1G>A Aberrant splicing D173 Microarray, HRM c.4469G>A p.C1490Y c.2915C>A p.T972N TABLE 3. Login to comment
124 In Silico Analysis of ABCA4 Variants Detected in This Study Using Alamut 2.2 Software cDNA Variant Protein Variant Effect on Protein Function AGVGD Class SIFT Prediction Effect on Protein PPH2 Prediction Effect on Protein TASTER Prediction Effect on Splicing Missense variants c.203C>T p.P68L C65 Deleterious Probably damaging Disease causing c.1529T>G p.L510R C65 Deleterious Benign Polymorphism c.1622T>C p.L541P Reduced ATP binding mislocali- zation26,27 C65 Deleterious Probably damaging Disease causing c.1648G>A p.G550R C65 Deleterious Possibly damaging Disease causing New acceptor site c.2300T>A p.V767D Reduced protein28 C65 Deleterious Benign Disease causing c.2588G>C p.G863A Reduced protein level, reduced ATP binding, reduced ATPase activity26 C55 Deleterious Possibly damaging Disease causing Predicted change at acceptor site 1 bp upstream: 11.1%, creating a new stronger acceptor 3 bp downstream c.2894A>G p.N965S Reduced ATP binding26 C45 Deleterious Probably damaging Disease causing New acceptor site c.2915C>A p.T972N C55 Deleterious Probably damaging Disease causing c.3113C>T p.A1038V Reduced ATP binding, reduced ATP hydrolysis26 C65 Deleterious Benign Disease causing c.3322C>T p.R1108C Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing c.4102C>T p.R1368C C65 Deleterious Probably damaging Disease causing c.4462T>C p.C1488R C65 Deleterious Possibly damaging Disease causing c.4469G>A p.C1490Y Misfolding, mislocali- zation27 C65 Deleterious Probably damaging Disease causing Cryptic donor strongly activated c.4926C>G p.S1642R C25 Deleterious Benign Disease causing c.6079C>T p.L2027F Reduced ATP binding26,29 C15 Deleterious Probably damaging Disease causing c.6089G>A p.R2030Q C35 Deleterious Probably damaging Disease causing c.6229C>T p.R2077W Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing Deletion/frame-shift/stop variants c.666_678del p.K223_ R226delfs c.2041C>T p.R681* c.2408delG p.G803fs c.4234C>T p.Q1412* c.5041_5055del p.V1681_ C1685del c.5169C>G p.Y1723* Splicing affecting variants c.3191-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.3329-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.4667&#fe;2T>C Predicted change at donor site 2 bps upstream: 100% generalized choriocapillaris dystrophy have the occasional hallmarks of early Stargardt disease, such as vermillion fundus, fundus hyperautofluorescence, and a dark choroid on fluorescein angiograms. Login to comment

[hide] The external limiting membrane in early-onset Star... Invest Ophthalmol Vis Sci. 2014 Aug 19;55(10):6139-49. doi: 10.1167/iovs.14-15126. Lee W, Noupuu K, Oll M, Duncker T, Burke T, Zernant J, Bearelly S, Tsang SH, Sparrow JR, Allikmets R
The external limiting membrane in early-onset Stargardt disease.
Invest Ophthalmol Vis Sci. 2014 Aug 19;55(10):6139-49. doi: 10.1167/iovs.14-15126., [PMID:25139735]

Abstract [show]
PURPOSE: To describe pathologic changes of the external limiting membrane (ELM) in young patients with early-onset Stargardt (STGD1) disease. METHODS: Twenty-six STGD1 patients aged younger than 20 years with confirmed disease-causing adenosine triphosphate-binding cassette, subfamily A, member 4 (ABCA4) alleles and 30 age-matched unaffected individuals were studied. Spectral-domain optical coherence tomography (SD-OCT), fundus autofluorescence (AF), and color fundus photography (CFP) images, as well as full-field electroretinograms were obtained and analyzed for one to four visits in each patient. RESULTS: The ELM in all patients exhibited a distinct thickening that was not observed in unaffected individuals. In addition, accumulations of reflective deposits were noted in the outer nuclear layer in every patient. Four patients exhibited a concave protuberance or bulging of a thickened and hyperreflective ELM band within the fovea containing preserved photoreceptors. Longitudinal SD-OCT data in several patients revealed the persistence of this ELM abnormality over a period of time (1-4 years). Furthermore, the edges of the inner segment ellipsoid band appeared to recede earlier than the ELM band in active lesions. CONCLUSIONS: Structural changes seen in the ELM of this cohort may reflect a gliotic response to cellular stress at the photoreceptor level in early-onset STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 [L541P;A1038V] p.L2027F P7 8 Caucasian n/a n/a 1 n/a ND p. Login to comment
89 [L541P;A1038V] p.L2027F P8 10 Caucasian 20/40 (0.30) 20/80 (0.60) 1 1 None-early 1 p.R1108C p.Q1412* P9 14 Caucasian 20/100 (0.70) 20/100 (0.70) 2 1 Early-late 0.5 p.T972N p.L2027F P10 9 Caucasian 20/150 (0.88) 20/400 (1.30) 2 1 Late ND c.5312&#fe;1G>A p.R2030* P11 15 Caucasian 20/200 (1.00) 20/200 (1.00) 2 2 Mid-late 3 p.L2027F p.R2077W P12 5 Caucasian 20/30 (0.18) 20/40 (0.30) 1 n/a ND c.5018&#fe;2T>C p.G1961E P13 10 Caucasian 20/200 (1.00) 20/200 (1.00) 2 2 Mid 4 p. Login to comment
92 [L541P;A1038V] p.L2027F P19 16 Caucasian 20/150 (0.88) 20/150 (0.88) 1 n/a Early 6 p.G863A p. Login to comment

[hide] Correlations among near-infrared and short-wavelen... Invest Ophthalmol Vis Sci. 2014 Oct 23;55(12):8134-43. doi: 10.1167/iovs.14-14848. Duncker T, Marsiglia M, Lee W, Zernant J, Tsang SH, Allikmets R, Greenstein VC, Sparrow JR
Correlations among near-infrared and short-wavelength autofluorescence and spectral-domain optical coherence tomography in recessive Stargardt disease.
Invest Ophthalmol Vis Sci. 2014 Oct 23;55(12):8134-43. doi: 10.1167/iovs.14-14848., [PMID:25342616]

Abstract [show]
PURPOSE: Short-wavelength (SW) fundus autofluorescence (AF) is considered to originate from lipofuscin in retinal pigment epithelium (RPE) and near-infrared (NIR) AF from melanin. In patients with recessive Stargardt disease (STGD1), we correlated SW-AF and NIR-AF with structural information obtained by spectral-domain optical coherence tomography (SD-OCT). METHODS: Twenty-four STGD1 patients (45 eyes; age 8 to 61 years) carrying confirmed disease-associated ABCA4 mutations were studied prospectively. Short-wavelength AF, NIR-AF, and SD-OCT images were acquired. RESULTS: Five phenotypes were identified according to features of the central lesion and extent of fundus change. Central zones of reduced NIR-AF were typically larger than areas of diminished SW-AF and reduced NIR-AF usually approximated areas of ellipsoid zone (EZ) loss identified by SD-OCT (group 1; r, 0.93, P < 0.0001). In patients having a central lesion with overlapping parafoveal rings of increased NIR-AF and SW-AF (group 3), the extent of EZ loss was strongly correlated with the inner diameter of the NIR-AF ring (r, 0.89, P < 0.0001) and the eccentricity of the outer border of the NIR-AF ring was greater than that of the SW-AF ring. CONCLUSIONS: Lesion areas were more completely delineated in NIR-AF images than with SW-AF. In most cases, EZ loss was observed only at locations where NIR-AF was reduced or absent, indicating that RPE cell atrophy occurs in advance of photoreceptor cell degeneration. Because SW-AF was often increased within the central area of EZ disruption, degenerating photoreceptor cells may produce lipofuscin at accelerated levels. Consideration is given to mechanisms underlying hyper-NIR-AF in conjunction with increased SW-AF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
90 [L541P;A1038V] p.L2027F 4 13 19.7 M White Brown 0.9 0.9 p.G1961E p. Login to comment

[hide] Near-infrared autofluorescence: its relationship t... Invest Ophthalmol Vis Sci. 2015 May;56(5):3226-34. doi: 10.1167/iovs.14-16050. Greenstein VC, Schuman AD, Lee W, Duncker T, Zernant J, Allikmets R, Hood DC, Sparrow JR
Near-infrared autofluorescence: its relationship to short-wavelength autofluorescence and optical coherence tomography in recessive stargardt disease.
Invest Ophthalmol Vis Sci. 2015 May;56(5):3226-34. doi: 10.1167/iovs.14-16050., [PMID:26024107]

Abstract [show]
PURPOSE: We compared hypoautofluorescent (hypoAF) areas detected with near-infrared (NIR-AF) and short-wavelength autofluorescence (SW-AF) in patients with recessive Stargardt disease (STGD1) to retinal structure using spectral domain optical coherence tomography (SD-OCT). METHODS: The SD-OCT volume scans, and SW-AF and NIR-AF images were obtained from 15 eyes of 15 patients with STGD1 and registered to each other. Thickness maps of the total retina, receptor-plus layer (R+, from distal border of the RPE to outer plexiform/inner nuclear layer boundary), and outer segment-plus layer (OS+, from distal border of the RPE to ellipsoid zone [EZ] band) were created from SD-OCT scans. These were compared qualitatively and quantitatively to the hypoAF areas in SW-AF and NIR-AF images. RESULTS: All eyes showed a hypoAF area in the central macula and loss of the EZ band in SD-OCT scans. The hypoAF area was larger in NIR than SW-AF images and it exceeded the area of EZ band loss for 12 eyes. The thickness maps showed progressive thinning towards the central macula, with the OS+ layer showing the most extensive and severe thinning. The central hypoAF areas on NIR corresponded to the OS+ thinned areas, while the hypoAF areas on SW-AF corresponded to the R+ thinned areas. CONCLUSIONS: Since the larger hypoAF area on NIR-AF exceeded the region of EZ band loss, and corresponded to the OS+ thinned area, RPE cell loss occurred before photoreceptor cell loss. The NIR-AF imaging may be an effective tool for following progression and predicting loss of photoreceptors in STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Selected Demographic, Clinical, and Genetic Characteristics of the Study Cohort Patient Sex Disease-Associated ABCA4 Variant(s) Age Eye BCVA 1 F p.G1961E; c2382&#fe;1G>A 36 OS 0.8 2 M p.[L541P;A1038V] 8 OS 0.6 3 M p.G1961E; c.6729&#fe;5_&#fe;19del 18 OS 0.9 4 M p.P1380L; p.G1961E 12 OD 0.8 5 M c.571-1G>T 43 OD 0.4 6 M p.Q1003*; p.G1961E 25 OS 0 7 M p.[L541P;A1038V]; p.L2027F 8 OD N/A 8 F p.R212C; p.G1961E 22 OD 0.8 9 F p.P1380L; p.G1961E 20 OD 0.9 10 M p.R1300*; p.R2106C 26 OS 0 11 M c.3050&#fe;5G>A; p.G1961E 27 OD 0.5 12 F p.G1961E; p.C2150R 25 OD 0.7 13 M p.W821R; p.C2150Y 13 OD 0.4 14 F p.N1799D 36 OD 1.3 15 M p.A1773V; p.G1961E 19 OD 0.7 FIGURE 1. Login to comment

[hide] Flecks in Recessive Stargardt Disease: Short-Wavel... Invest Ophthalmol Vis Sci. 2015 Jul;56(8):5029-39. doi: 10.1167/iovs.15-16763. Sparrow JR, Marsiglia M, Allikmets R, Tsang S, Lee W, Duncker T, Zernant J
Flecks in Recessive Stargardt Disease: Short-Wavelength Autofluorescence, Near-Infrared Autofluorescence, and Optical Coherence Tomography.
Invest Ophthalmol Vis Sci. 2015 Jul;56(8):5029-39. doi: 10.1167/iovs.15-16763., [PMID:26230768]

Abstract [show]
PURPOSE: We evaluated the incongruous observation whereby flecks in recessive Stargardt disease (STGD1) can exhibit increased short-wavelength autofluorescence (SW-AF) that originates from retinal pigment epithelium (RPE) lipofuscin, while near-infrared AF (NIR-AF), emitted primarily from RPE melanin, is usually reduced or absent at fleck positions. METHODS: Flecks in SW- and NIR-AF images and spectral-domain optical coherence tomography (SD-OCT) scans were studied in 19 STGD1 patients carrying disease-causing ABCA4 mutations. Fleck spatial distribution and progression were recorded in serial AF images. RESULTS: Flecks observed in SW-AF images typically colocalized with darkened foci in NIR-AF images; the NIR-AF profiles were larger. The decreased NIR-AF signal from flecks preceded apparent changes in SW-AF. Spatiotemporal changes in fleck distribution usually progressed centrifugally, but in one case centripetal expansion was observed. Flecks in SW-AF images corresponded to hyperreflective deposits that progressively traversed photoreceptor-attributable bands in SD-OCT images. Outer nuclear layer (ONL) thickness negatively correlated with expansion of flecks from outer to inner retina. CONCLUSIONS: In the healthy retina, RPE lipofuscin fluorophores form in photoreceptor cells but are transferred to RPE; thus the SW-AF signal from photoreceptor cells is negligible. In STGD1, NIR-AF imaging reveals that flecks are predominantly hypofluorescent and larger and that NIR-AF darkening occurs prior to heightened SW-AF signal. These observations indicate that RPE cells associated with flecks in STGD1 are considerably changed or lost. Spectral-domain OCT findings are indicative of ongoing photoreceptor cell degeneration. The bright SW-AF signal of flecks likely originates from augmented lipofuscin formation in degenerating photoreceptor cells impaired by the failure of RPE.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 [IVS15&#fe;1G>A 2 M 12.00 Caucasian 0.5 0.5 p. [L541P; A1038V] 3* M 9.00 Caucasian 1 1 p. [W855*]; [T1526M] 4 F 47.55 Caucasian 1.3 1.3 p. [L541P; A1038V]; [G1961E] 5* F 16.47 Caucasian 0.6 0.6 p. [T972N]; [L2027F] 6* M 16.98 Caucasian 1.3 1.3 p. [K346T]; [T1117I] 7 F 23.80 Caucasian 0.6 0.4 p. [R1161S] 8* F 28.67 Caucasian 1.3 1.3 p. [P1380L]; [P1380L] 9 M 42.83 Caucasian 0.9 0.4 c. Login to comment
49 [571-1G>T 10* M 13.89 Caucasian 0.4 0.4 p. [L541P; A1038V]; [L2027F] 11* F 20.20 Caucasian 0.9 0.9 p. [P1380L]; [G1961E] 12 M 27.61 African-Arab 0 0 p. [R1300*]; [R2106C] 13* M 46.93 Caucasian 0.3 0.4 p. [C1490Y]; [G1961E] 14* M 26.82 Caucasian 0 0 c. Login to comment

[hide] Quantitative Fundus Autofluorescence and Optical C... Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7274-85. doi: 10.1167/iovs.15-17371. Duncker T, Stein GE, Lee W, Tsang SH, Zernant J, Bearelly S, Hood DC, Greenstein VC, Delori FC, Allikmets R, Sparrow JR
Quantitative Fundus Autofluorescence and Optical Coherence Tomography in ABCA4 Carriers.
Invest Ophthalmol Vis Sci. 2015 Nov 1;56(12):7274-85. doi: 10.1167/iovs.15-17371., [PMID:26551331]

Abstract [show]
PURPOSE: To assess whether carriers of ABCA4 mutations have increased RPE lipofuscin levels based on quantitative fundus autofluorescence (qAF) and whether spectral-domain optical coherence tomography (SD-OCT) reveals structural abnormalities in this cohort. METHODS: Seventy-five individuals who are heterozygous for ABCA4 mutations (mean age, 47.3 years; range, 9-82 years) were recruited as family members of affected patients from 46 unrelated families. For comparison, 57 affected family members with biallelic ABCA4 mutations (mean age, 23.4 years; range, 6-67 years) and two noncarrier siblings were also enrolled. Autofluorescence images (30 degrees , 488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference. The gray levels (GLs) of each image were calibrated to the reference, zero GL, magnification, and normative optical media density to yield qAF. Horizontal SD-OCT scans through the fovea were obtained and the thicknesses of the outer retinal layers were measured. RESULTS: In 60 of 65 carriers of ABCA4 mutations (age range, 9-60), qAF levels were within normal limits (95% confidence level) observed for healthy noncarrier subjects, while qAF levels of affected family members were significantly increased. Perifoveal fleck-like abnormalities were observed in fundus AF images in four carriers, and corresponding changes were detected in the outer retinal layers in SD-OCT scans. Thicknesses of the outer retinal layers were within the normal range. CONCLUSIONS: With few exceptions, individuals heterozygous for ABCA4 mutations and between the ages of 9 and 60 years do not present with elevated qAF. In a small number of carriers, perifoveal fleck-like changes were visible.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 [L541P;A1038V] 0.10 0.10 OS n/a 141 S2.2 F 44.4 Indian Mother c.6729&#fe;5_&#fe;19del 0.10 0.00 OS 257 291 S2.3 M 56.2 Indian Father p.G1961E 0.00 0.00 OD 475 431 S3.4 F 54.1 White Mother p.G863A 0.00 0.00 OS 459 451 S3.5 F 82.0 White Grandmother p.G863A 0.00 0.00 OD n/a n/a S4.2 F 44.6 White Mother p.W855* 0.00 0.00 OD 330 n/a S4.3 M 40.9 White Father p.T1526M 0.00 0.00 OS 283 271 S5.2 F 71.5 White Sister p.C698Y 0.00 0.10 OD n/a n/a S5.3 F 67.5 White Sister c.2160&#fe;1G>C 0.00 0.00 OS n/a n/a S5.4 F 62.9 White Sister p.C698Y 0.00 0.00 OD n/a n/a S6.2 M 54.9 Black Brother p.T1526M 0.10 0.00 OS 477 423 S7.2 F 48.9 White Mother c.5196&#fe;1G>A 0.00 0.00 OS 443 415 S8.2 F 59.6 White Mother p.K346T 0.00 0.00 OD 546 483 S8.3 M 54.6 White Father p.T1117I 0.10 0.10 OD 289 n/a S9.2 F 51.5 White Mother c.5196&#fe;1137G>A 0.00 0.00 n/a 302 n/a S9.3 M 57.8 White Father p.C54Y 0.00 0.00 OS 419 375 S10.2 M 24.1 Indian Brother p.Q2220* 0.00 0.00 OD 227 227 S11.2 F 40.0 Asian Mother c.5923del 0.00 0.18 OD 229 191 S11.3 M 40.1 Asian Father p.R408* 0.00 0.00 OD 195 178 S12.2 F 53.2 White Mother p.L2027F 0.00 0.00 n/a 355 309 S13.2 F 49.8 White Mother p.R1161S 0.00 0.00 OS 367 372 S13.3 M 22.3 White Brother p.R1161S 0.00 0.00 OD 202 206 S14.2 F 67.0 White Mother p.P1380L 0.00 0.00 OD n/a n/a S14.3 F 24.4 White Sister p.P1380L 0.00 0.00 OS n/a 163 S15.3 F 26.8 White Sister c.3050&#fe;5G>A 0.00 0.00 n/a 293 281 S16.2 M 53.7 Black Father c.4253&#fe;5G>T 0.00 0.00 n/a n/a 204 S17.2 F 60.0 Hispanic Mother p.A1038V 0.00 0.00 n/a 247 n/a S18.2 F 41.8 Indian Father c.5917del 0.00 0.00 OD n/a 194 S18.3 M 48.6 Indian Mother c.859-9T>C 0.00 0.00 OD 253 215 S18.4 F 12.9 Indian Sister c.5917del 0.00 0.00 OD 84 93 S19.4 F 58.5 White Mother p.L2027F 0.00 0.00 OD 205 n/a S19.5 M 61.6 White Father p.G851D 0.10 0.10 OD n/a n/a S20.2 F 41.5 White Mother c.5312&#fe;1G>A 0.00 0.00 n/a 335 351 S20.3 M 39.0 White Father p.R2030* 0.00 0.10 n/a 442 n/a S21.3 F 53.1 White Mother p.G1961E 0.00 0.00 OD 490 488 S22.3 M 46.3 White Father p.L2027F 0.00 0.00 OS 386 376 S22.4 F 47.1 White Mother p. Login to comment
68 [66G>A;859-9T>C] p.Q2220* CF 1.30 n/a n/a P 11.1 M 15.0 Asian p.R408* c.5935del 1.10 1.30 n/a n/a P 12.1&#a7; M 15.1 White p.L2027F p.R2077W 0.80 0.80 728 697 P 13.1&#a7; F 23.8 White p.R1161S 0.60 0.40 571 647 P 14.1&#a7; F 27.3 White p.P1380L p.P1380L 1.30 1.00 n/a 577 P 15.1 M 17.0 White p.G1961E c.3050&#fe;5G>A 0.88 0.88 n/a n/a P 15.2 F 22.0 White p.G1961E c.3050&#fe;5G>A 0.88 0.88 n/a n/a P 16.1 F 19.1 Black p.V989A c.4253&#fe;5G>T 0.30 0.40 97 n/a P 17.1 F 21.8 Hispanic p.A1038V p.G1441D 0.70 0.88 551 528 P 18.1 M 22.0 Indian c.859-9T>C c.5917del 0.88 0.88 527 n/a P 19.1&#a7; F 27.2 White p.G851D p.L2027F 0.88 0.88 448 459 P 19.2&#a7; F 29.2 White p.G851D p.L2027F 1.30 1.18 538 569 P 19.3 F 34.2 White p.G851D p.L2027F 1.00 1.30 442 n/a P 20.1 F 9.5 White c.5312&#fe;1G>A p.R2030* 0.88 0.70 998 929 P 21.1ߤ F 24.6 White p.N96D p.G1961E 0.30 0.18 513 549 P 21.2ߤ F 20.9 White p.N96D p.G1961E 0.30 0.40 397 355 P 22.1 M 8.0 White p. Login to comment
69 [L541P;A1038V] p.L2027F n/a n/a P 22.2 M 13.9 White p. Login to comment
70 [L541P;A1038V] p.L2027F 0.30 0.40 591 608 P 23.1ߤ F 26.0 White p.G1961E c.5196&#fe;1056A>G 0.40 0.70 379 344 P 24.1 F 52.0 White c.247_250dup 0.80 0.00 n/a n/a P 25.1 F 26.0 Black p.E526A p.R2107H 0.48 0.00 507 536 P 25.2 F 25.9 Black p.E526A p.R2107H 0.18 0.00 461 468 P 26.1&#a7; F 25.6 White p. Login to comment
111 [L541P; A1038V] in six carriers, p.P1380L in four carriers, and p.L2027F in three carriers. Login to comment
124 [L541P; A1038V], p.L2027F. Login to comment
137 [L541P; A1038V], p.P1380L, and p.L2027F mutations (and no p.G1961E mutation on the other allele).24 To determine whether similar differences in the segregation of qAF8 levels could also be observed for ABCA4 mutations in carriers and whether specific ABCA4 mutations may be associated with higher qAF8 levels, we plotted qAF values for carriers and affected patients who carried one of the four most common mutations (p.G1961E, p. Login to comment
138 [L541P;A1038V], p.P1380L, and p.L2027F) (Fig. 4). Login to comment
163 [L541P; A1038V], p.P1380L, and p.L2027F, are indicated in color. Login to comment
169 Nevertheless, we concluded that based on qAF values (measured at an eccentricity of 78-98), the mutations p.L2027F and p.P1380L and the complex allele p. Login to comment
196 Thickness profiles acquired by segmentation of spectral-domain optical coherence tomography (SD-OCT) images of carriers of ABCA4 mutations p.G1961E, p.L541P/A1038V, p.P1380L, and p.L2027F. Login to comment