ABCMdb

ABCA4 p.Asn965Ser

ClinVar:	c.2893A>G , p.Asn965Asp ? , not provided
Predicted by SNAP2:	A: D (66%), C: D (66%), D: D (95%), E: N (53%), F: D (75%), G: D (53%), H: N (57%), I: D (66%), K: N (57%), L: D (71%), M: D (71%), P: D (66%), Q: N (53%), R: N (57%), S: D (95%), T: N (61%), V: D (66%), W: D (91%), Y: D (75%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] The gene encoding ATP-binding cassette transporter... Nat Genet. 1999 Aug;22(4):347-51. Bodzioch M, Orso E, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ, Schmitz G
The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease.
Nat Genet. 1999 Aug;22(4):347-51., [PMID:10431237]

Abstract [show]
Tangier disease (TD) is an autosomal recessive disorder of lipid metabolism. It is characterized by absence of plasma high-density lipoprotein (HDL) and deposition of cholesteryl esters in the reticulo-endothelial system with splenomegaly and enlargement of tonsils and lymph nodes. Although low HDL cholesterol is associated with an increased risk for coronary artery disease, this condition is not consistently found in TD pedigrees. Metabolic studies in TD patients have revealed a rapid catabolism of HDL and its precursors. In contrast to normal mononuclear phagocytes (MNP), MNP from TD individuals degrade internalized HDL in unusual lysosomes, indicating a defect in cellular lipid metabolism. HDL-mediated cholesterol efflux and intracellular lipid trafficking and turnover are abnormal in TD fibroblasts, which have a reduced in vitro growth rate. The TD locus has been mapped to chromosome 9q31. Here we present evidence that TD is caused by mutations in ABC1, encoding a member of the ATP-binding cassette (ABC) transporter family, located on chromosome 9q22-31. We have analysed five kindreds with TD and identified seven different mutations, including three that are expected to impair the function of the gene product. The identification of ABC1 as the TD locus has implications for the understanding of cellular HDL metabolism and reverse cholesterol transport, and its association with premature cardiovascular disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 The mutation detected in TD3 does not affect these amino acids, but the identical exchange of asparagine 965 to serine in the first Walker A motif GHNGAGKT of ABCR is responsible for Stargardt macular dystrophy18. Login to comment

[hide] Molecular diagnosis of putative Stargardt disease ... BMC Med Genet. 2012 Aug 3;13:67. Strom SP, Gao YQ, Martinez A, Ortube C, Chen Z, Nelson SF, Nusinowitz S, Farber DB, Gorin MB
Molecular diagnosis of putative Stargardt disease probands by exome sequencing.
BMC Med Genet. 2012 Aug 3;13:67., [PMID:22863181]

Abstract [show]
ABSTRACT: BACKGROUND: The commonest genetic form of juvenile or early adult onset macular degeneration is Stargardt Disease (STGD) caused by recessive mutations in the gene ABCA4. However, high phenotypic and allelic heterogeneity and a small but non-trivial amount of locus heterogeneity currently impede conclusive molecular diagnosis in a significant proportion of cases. METHODS: We performed whole exome sequencing (WES) of nine putative Stargardt Disease probands and searched for potentially disease-causing genetic variants in previously identified retinal or macular dystrophy genes. Follow-up dideoxy sequencing was performed for confirmation and to screen for mutations in an additional set of affected individuals lacking a definitive molecular diagnosis. RESULTS: Whole exome sequencing revealed seven likely disease-causing variants across four genes, providing a confident genetic diagnosis in six previously uncharacterized participants. We identified four previously missed mutations in ABCA4 across three individuals. Likely disease-causing mutations in RDS/PRPH2, ELOVL, and CRB1 were also identified. CONCLUSIONS: Our findings highlight the enormous potential of whole exome sequencing in Stargardt Disease molecular diagnosis and research. WES adequately assayed all coding sequences and canonical splice sites of ABCA4 in this study. Additionally, WES enables the identification of disease-related alleles in other genes. This work highlights the importance of collecting parental genetic material for WES testing as the current knowledge of human genome variation limits the determination of causality between identified variants and disease. While larger sample sizes are required to establish the precision and accuracy of this type of testing, this study supports WES for inherited early onset macular degeneration disorders as an alternative to standard mutation screening techniques.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 Table 1 Clinical Information and Genetic Findings of Putative Stargardt Disease Cases\ SampleAge Sex Acuity OD Acuity OS Clinical Notes ERG Findings Color vision ABCA4 variants PRPH2 variants Other variants STGD-01 19 Male 20/400 20/160 Peripapillary sparing, discrete flecks; nummular atrophy Normal rod Abnormal cone No testing p.N965S p.R2038W . Login to comment
105 Exome sequencing identified two missense variants (p.N965S and p.R2038W) previously reported as disease-causing in STGD [19]. Login to comment
75 Table 1 Clinical Information and Genetic Findings of Putative Stargardt Disease Cases Sample Age Sex Acuity OD Acuity OS Clinical Notes ERG Findings Color vision ABCA4 variants PRPH2 variants Other variants STGD-01 19 Male 20/400 20/160 Peripapillary sparing, discrete flecks; nummular atrophy Normal rod Abnormal cone No testing p.N965S p.R2038W . Login to comment
101 Exome sequencing identified two missense variants (p.N965S and p.R2038W) previously reported as disease-causing in STGD [19]. Login to comment

[hide] Correlation between photoreceptor layer integrity ... Invest Ophthalmol Vis Sci. 2012 Jul 3;53(8):4409-15. doi: 10.1167/iovs.11-8201. Print 2012 Jul. Testa F, Rossi S, Sodi A, Passerini I, Di Iorio V, Della Corte M, Banfi S, Surace EM, Menchini U, Auricchio A, Simonelli F
Correlation between photoreceptor layer integrity and visual function in patients with Stargardt disease: implications for gene therapy.
Invest Ophthalmol Vis Sci. 2012 Jul 3;53(8):4409-15. doi: 10.1167/iovs.11-8201. Print 2012 Jul., [PMID:22661472]

Abstract [show]
PURPOSE: To perform a clinical characterization of Stargardt patients with ABCA4 gene mutation, and to investigate the correlation between the inner and outer segment (IS/OS) junction morphology and visual acuity, fundus lesions, electroretinogram abnormalities, and macular sensitivity. METHODS: Sixty-one patients with Stargardt disease (STGD) were given a comprehensive ophthalmic examination. Inner-outer photoreceptor junction morphology evaluated by spectral-domain optical coherence tomography was correlated with visual acuity, fundus lesions, fundus autofluorescence, full-field and multifocal electroretinography responses, and microperimetric macular sensitivities. We classified STGD patients into three groups: (1) IS/OS junction disorganization in the fovea, (2) IS/OS junction loss in the fovea, and (3) extensive loss of IS/OS junction. Mutation analysis of the ABCA4 gene was carried out by sequencing the complete coding region. RESULTS: A significant difference in visual acuity was observed between IS/OS groups 1 and 2 and between IS/OS groups 2 and 3 (P < 0.0001). A significant difference in microperimetry sensitivity was observed between IS/OS groups 2 and 3, and between IS/OS groups 1 and 3 (P < 0.0001). There was also a statistically significant correlation between IS/OS abnormalities and the extent of fundus lesions (Spearman P </= 0.01), as well as with the type of ERG and multifocal ERG results (Spearman P </= 0.01). Finally, the degree of IS/OS junction preservation showed a statistically significant correlation with the extension of foveal abnormalities assessed by fundus autofluorescence imaging (Spearman P </= 0.01). The G1961E mutation was more frequent in the patients without extensive loss of IS/OS junction (P = 0.01) confirming its association with a milder STGD phenotype. CONCLUSIONS: The results of this study suggest that a comprehensive approach in the examination of Stargardt patients has the potential to improve the understanding of vision loss and may provide a sensitive measure to evaluate the efficacy of future experimental therapies in patients with STGD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundus† FAF‡ ERG§ mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35þ2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35þ2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35þ2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45þ1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40þ5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35þ2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40þ5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35þ2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35þ2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40þ5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40þ5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35þ2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40þ5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45þ1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45þ1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35þ2t > c IVS40þ5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45þ1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram. Login to comment
67 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundusߤ FAFߥ ERG&#a7; mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35&#fe;2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35&#fe;2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35&#fe;2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45&#fe;1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40&#fe;5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35&#fe;2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40&#fe;5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35&#fe;2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35&#fe;2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40&#fe;5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40&#fe;5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35&#fe;2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40&#fe;5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45&#fe;1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45&#fe;1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35&#fe;2t > c IVS40&#fe;5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45&#fe;1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram. Statistics Our set of data is described by continuous (BCVA, OCT foveal thickness, and macular sensitivities) and categorical (fundus, FAF, IS/ OS, ERG, and mfERG groups) variables. Login to comment

[hide] ABCA4 is an N-retinylidene-phosphatidylethanolamin... Nat Commun. 2012 Jun 26;3:925. doi: 10.1038/ncomms1927. Quazi F, Lenevich S, Molday RS
ABCA4 is an N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine importer.
Nat Commun. 2012 Jun 26;3:925. doi: 10.1038/ncomms1927., [PMID:22735453]

Abstract [show]
ATP-binding cassette (ABC) transporters comprise a superfamily of proteins, which actively transport a variety of compounds across cell membranes. Mammalian and most eukaryotic ABC transporters function as exporters, flipping or extruding substrates from the cytoplasmic to the extracellular or lumen side of cell membranes. Prokaryotic ABC transporters function either as exporters or importers. Here we show that ABCA4, an ABC transporter found in retinal photoreceptor cells and associated with Stargardt macular degeneration, is a novel importer that actively flips N-retinylidene-phosphatidylethanolamine from the lumen to the cytoplasmic leaflet of disc membranes, thereby facilitating the removal of potentially toxic retinoid compounds from photoreceptors. ABCA4 also actively transports phosphatidylethanolamine in the same direction. Mutations known to cause Stargardt disease decrease N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine transport activity of ABCA4. These studies provide the first direct evidence for a mammalian ABC transporter that functions as an importer and provide insight into mechanisms underlying substrate transport and the molecular basis of Stargardt disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
145 To gain further insight into the molecular mechanisms underlying ABCA4-mediated transport activity and Stargardt disease, we examined the functional properties of ABCA4-containing G863A and N965S mutations associated with Stargardt disease and Walker A mutations, K969M in NBD1, K1978M in NBD2 and the double mutant K969M/1978M. Login to comment
146 The K1978M mutant expressed at the same level as WT ABCA4, whereas the G863A, N965S, K969M and K969M/ K1978M mutants expressed within 50% that of WT ABCA4. Login to comment
168 Percent-relative NBD-PE flipping plotted as a mean with error bars representing ± s.d. for n = 3. mutants showing essentially undetectable activity and the G863A and N965S Stargardt mutants displaying ~18 and 37% of WT activity (Fig. 6b). Login to comment
172 Addition of ATP resulted in release of the substrate from the G863A, N965S and K1978M mutants, but impaired release from the K969M mutant and no significant release from the K969M/K1978M double mutant. Login to comment
189 However, retinal readily reacts with PE, I a E ABCA4 W i l d - t y p e G 8 6 3 A N 9 6 5 S K 9 6 9 M K 9 6 9 M / K 1 9 7 8 M K 1 9 7 8 M ABCA4 kDa 250 250 I E I E I E I E I E 150 100 75 50 37 25 e % N-retinylidene PE binding 120 - ATP + ATP 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T b G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M 120 % Retinal transfer * * 100 80 60 40 20 0 W T c G863A N965S Retinal (µM) 250 % Basal ATPase activity 200 150 100 WT 50 0 0 10 20 30 40 50 60 d MM Retinal (µM) K969M K1978M % Basal ATPase activity 250 WT 200 150 100 50 0 0 10 20 30 40 50 60 f % NBD-PE flippase activity * * 120 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T Figure 6 | Effect of Walker A and Stargardt mutations on ATR transfer activity. Login to comment
219 The binding of N-retinyli- dene-PE and its release by ATP is not affected by the G863A and N965S mutations (Fig. 6e), but the basal- and retinal-stimulated ATPase activity and ATP-dependent retinal transfer activity are significantly reduced. Login to comment

[hide] Macular function in macular degenerations: repeata... Invest Ophthalmol Vis Sci. 2012 Feb 21;53(2):841-52. Print 2012 Feb. Cideciyan AV, Swider M, Aleman TS, Feuer WJ, Schwartz SB, Russell RC, Steinberg JD, Stone EM, Jacobson SG
Macular function in macular degenerations: repeatability of microperimetry as a potential outcome measure for ABCA4-associated retinopathy trials.
Invest Ophthalmol Vis Sci. 2012 Feb 21;53(2):841-52. Print 2012 Feb., [PMID:22247458]

Abstract [show]
PURPOSE: To measure macular visual function in patients with unstable fixation, to define the photoreceptor source of this function, and to estimate its test-retest repeatability as a prerequisite to clinical trials. METHODS: Patients (n = 38) with ABCA4-associated retinal degeneration (RD) or with retinitis pigmentosa (RP) were studied with retina-tracking microperimetry along the foveo-papillary profile between the fovea and the optic nerve head, and point-by-point test-retest repeatability was estimated. A subset with foveal fixation was also studied with dark-adapted projection perimetry using monochromatic blue and red stimuli along the horizontal meridian. RESULTS: Macular function in ABCA4-RD patients transitioned from lower sensitivity at the parafovea to higher sensitivity in the perifovea. RP patients had the inverse pattern. Red-on-red microperimetric sensitivities successfully avoided ceiling effects and were highly correlated with absolute sensitivities. Point-by-point test-retest limits (95% confidence intervals) were +/-4.2 dB; repeatability was not related to mean sensitivity, eccentricity from the fovea, age, fixation location, or instability. Repeatability was also not related to the local slope of sensitivity and was unchanged in the parapapillary retina. CONCLUSIONS: Microperimetry allows reliable testing of macular function in RD patients without foveal fixation in longitudinal studies evaluating natural disease progression or efficacy of therapeutic trials. A single estimate of test-retest repeatability can be used to determine significant changes in visual function at individual retinal loci within diseased regions that are homogeneous and those that are heterogeneous and also in transition zones at high risk for disease progression.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Clinical and Molecular Characteristics of the ABCA4 Patients Patient Age (y)/Sex ABCA4 Mutation Clinical Diagnosis Visual Acuity* Kinetic Visual Field Extent (V-4e)†Allele 1 Allele 2 Foveal Fixation P1‡ 12/M N965S W821R STGD 20/20 97 P2‡ 17/F V989A IVS28ϩ5 GϾT STGD 20/100 90 P3 18/M G1961E R1129L§ STGD 20/100 105 P4 21/F R212C P68R STGD 20/125 101 P5 24/M P1511 del1ccgC R1705Q STGD 20/25 114 P6 31/M G863A R1108C STGD 20/25 105 P7 32/F IVS40ϩ5 GϾA V935A STGD 20/32 103 P8 34/M G1961E - CRD 20/32 98 P9 37/F R681X P309R STGD 20/20 109 P10 39/M G1961E C54Y§ STGD 20/40 101 P11‡ 42/F G1961E V256V STGD 20/32 105 P12‡ 46/F G1961E V256V STGD 20/32 106 P13 52/F G1961E P1380L STGD 20/40 105 P14 58/M D600E R18W§ STGD 20/40 84 Extrafoveal Fixation P15 11/M V256V T1526M CRD 20/200 102 P16 15/M C54Y IVS35ϩ2 TϾC STGD 20/200 96 P17‡ 16/F V989A IVS28ϩ5 GϾT STGD 20/100 100 P18 21; 16/M N965S W821R STGD 20/125 100 P19 19/F A1038V/L541P N965S STGD 20/400 90 P20 21/M G863A IVS35ϩ2 TϾC STGD 20/200 99 P21 22/F G1961E R152X STGD 20/50 104 P22 27/M G863A P1660S§ STGD 20/100 98 P23 27/F G1961E A1038V/L541P STGD 20/100 109 P24 29/M G1961E T1019M STGD 20/100 104 P25 33/M P1486L deletion of exon 7 STGD 20/400 98 P26 36/F G863A C1490Y STGD 20/100 93 P27 41/M A1038V/L541P - STGD 20/125 108 P28 49/F T1526M R2030Q STGD 20/125 98 P29 55/F W855X - STGD 20/160 87 P30 56/F G1961E IVS37ϩ1 GϾA§ STGD 20/125 89 P31 60/F G1961E M669 del2ccAT STGD 20/125 104 STGD, Stargardt disease; CRD, cone-rod dystrophy. Login to comment

[hide] Phenotypic and genetic spectrum of Danish patients... Ophthalmic Genet. 2012 Dec;33(4):225-31. doi: 10.3109/13816810.2011.643441. Epub 2012 Jan 9. Duno M, Schwartz M, Larsen PL, Rosenberg T
Phenotypic and genetic spectrum of Danish patients with ABCA4-related retinopathy.
Ophthalmic Genet. 2012 Dec;33(4):225-31. doi: 10.3109/13816810.2011.643441. Epub 2012 Jan 9., [PMID:22229821]

Abstract [show]
Background: Pathogenic variations in the ABCA4 gene were originally recognized as genetic background for the autosomal recessive disorders Stargardt disease and fundus flavimaculatus, but have expanded to embrace a diversity of retinal diseases, giving rise to the new diagnostic term, ABCA4-related retinopathy. Diagnostic genotyping of ABCA4 is complicated by the large size of the gene and the existence of approximately 600 known pathogenic variations, along with numerous rare polymorphisms. A commercial diagnostic array-based assay has been developed targeting known mutations, however a conclusive genetic diagnosis must rely on a comprehensive genetic screening as the mutation spectrum of ABCA4-related retinopathies continues to expand. Material and methods: Among 161 patients with a Stargardt-related phenotype previously assessed with the commercial ABCA4 mutation microarray, we analyzed the ABCA4 gene with High-resolution melting (HRM) in patients in whom the array analysis identified either a heterozygous mutation (n = 50) or no mutation (n = 30). Results: The HRM method detected each of the already known mutations and polymorphisms. We identified the second ABCA4 mutation in 31 of 50 heterozygous patients (62%). Several novel mutations were identified of which four were identified multiple times. The recurrent novel mutations were subsequently assessed among the 30 patients with possible ABCA4-related diseases, previously found to be negative for known ABCA4 mutations by array analysis. In total, 30 different mutations were identified of which 21 have not been described before. Conclusion: Scandinavian patients with ABCA4-related retinopathy appear to have a distinct mutation spectrum, which can be identified in patients of diverse clinical phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Table 1 Mutations identified by HRM in the initial 50 heterozygous patients Patient Mutation 1 (Asper) Mutation 2 (HRM) RefDNA Protein Exon/intron DNA Protein Exon/intron D043 c.2588G>C p.G863A 17 c.184 C>T p.P62S 3 New D069 c.3113C>T p.A1038V 21 c.1529 T>G p.L510R 11 New D050 c.2588G>C p.G863A 17 c.1529 T>G p.L510R 11 New D112 c.2894A>G p.N965S 19 c.1529 T>G p.L510R 11 New D099 c.6089G>A p.R2030Q 44 c.1529 T>G p.L510R 11 New D165 c.1822T>C p.F608L 13 c.2243 G>A p.C748Y 15 New D166 c.2588G>C p.G863A 17 c.2300 T>A p.V767D 15 Known D117 c.3191-2A>G na IVS21 c.2408delG na 16 New D135 c.2894A>G p.N965S 19 c.2408delG na 16 New D147 c.2894A>G p.N965S 19 c.2408delG na 16 New D173 c.4469G>A p.C1490Y 30 c.2915C>A p.T972N 19 Known D013* c.1622C>T p.L541P 12 c.1313C>T p.A1038V 21 Known D181 c.6089G>A p.R2030Q 44 c.3380 G>A p.G1127E 23 New D018 c.6449G>A p.C2150Y 47 c.3736 C>G p.L1246V 25 New D191 c.2588G>C p.G863A 17 c.4069 G>A p.A1357T 27 New D167 c.5461-10T>C na IVS38 c.4102 C>T p.R1368C 27 New D022 c.4462T>C p.C1488R 30 c.4102 C>T p.R1368C 27 New D108 c.1648G>A p.G550R 12 c.4102 C>T p.R1368C 27 New D414 c.2588G>C p.G863A 17 c.4653 G>A p.W1551X 32 New D027 c.2588G>C p.G863A 17 c.4668-2A>G na IVS32 New D136 c. Login to comment
58 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.5584 + 1G>A na IVS39 New D188 c.5461-10T>C na IVS38 c.5693G>A p.R1898H 40 Known D433 c.5882G>A p.G1961E 42 c.6005 + 1G>A na IVS43 Known D134 c.4667 + 2G>T na IVS32 c.6098 T>G p.L2033R 44 New D186 c.3322C>T p.R1108C 22 c.6386 + 1G>A na IVS46 New D182 c.6089G>A p.R2030Q 44 c.6386 + 1G>A na IVS46 New D189 c.2894A>G p.N965S 19 c.6478 A>G p.K2160E 47 New *p.L541P and p.A1038V might be located on the same allele. Login to comment
76 Among the novel mutations detected, the four p.L510R-carrying alleles are found in the Stargardt-flavimaculatus group in combination with p.G863A, p.2030Q, and the Danish founder mutation p.N965S (Table 4). Login to comment
77 In the generalized retinal dystrophy group the three c.2408delG mutations are found in combination with c.3191-2A>G and N965S. Login to comment
78 The stop mutation p.W1551X is combined with the mild mutation p.G863A though resulting in a serious phenotype. Login to comment
97 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773 + 5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005 + 1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773 + 3A>G* D110 p.[L541P+A1038V] c.5584 + 1G>A* D182 p.R2030Q c.6386 + 1G>A* D186 p.R1108C c.6386 + 1G>AA* D133 p.L510R IVS46 + 1G>A* Cone-rod dystrophy D134 c.4667 + 2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame. Login to comment
99 We have previously found the known p.N965S (c.2894A>G) mutation to account for 16.2% of the pathogenic alleles among patients of Danish origin,9 and together with the four new prevalent mutations, these five mutations account for 20% (49/240) of the pathogenic alleles. Login to comment
102 In fact p.[P541L+A1038V] was the third most common allele in our initial array analysis and is one of the most prevalent European mutations.23 HRM identified p.A1038V as the second mutation in D013, thus this mutation was missed by array analysis, and the patient is most likely "only" a carrier for the p.[P541L+A1038V]. Login to comment
60 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.5584ߙ+ߙ1G>A na IVS39 New D188 c.5461-10T>C na IVS38 c.5693G>A p.R1898H 40 Known D433 c.5882G>A p.G1961E 42 c.6005ߙ+ߙ1G>A na IVS43 Known D134 c.4667ߙ+ߙ2G>T na IVS32 c.6098 T>G p.L2033R 44 New D186 c.3322C>T p.R1108C 22 c.6386ߙ+ߙ1G>A na IVS46 New D182 c.6089G>A p.R2030Q 44 c.6386ߙ+ߙ1G>A na IVS46 New D189 c.2894A>G p.N965S 19 c.6478 A>G p.K2160E 47 New *p.L541P and p.A1038V might be located on the same allele. Login to comment
79 In the generalized retinal dystrophy group the three c.2408delG mutations are found in combination with c.3191-2A>G and N965S. Login to comment
100 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773ߙ+ߙ5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005ߙ+ߙ1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773ߙ+ߙ3A>G* D110 p.[L541P+A1038V] c.5584ߙ+ߙ1G>A* D182 p.R2030Q c.6386ߙ+ߙ1G>A* D186 p.R1108C c.6386ߙ+ߙ1G>AA* D133 p.L510R IVS46ߙ+ߙ1G>A* Cone-rod dystrophy D134 c.4667ߙ+ߙ2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame. Login to comment

[hide] Stargardt macular dystrophy: common ABCA4 mutation... Mol Vis. 2012;18:280-9. Epub 2012 Feb 1. Roberts LJ, Nossek CA, Greenberg LJ, Ramesar RS
Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients.
Mol Vis. 2012;18:280-9. Epub 2012 Feb 1., [PMID:22328824]

Abstract [show]
PURPOSE: Based on the previous indications of founder ATP-binding cassette sub-family A member 4 gene (ABCA4) mutations in a South African subpopulation, the purpose was to devise a mechanism for identifying common disease-causing mutations in subjects with ABCA4-associated retinopathies (AARs). Facilitating patient access to this data and determining the frequencies of the mutations in the South African population would enhance the current molecular diagnostic service offered. METHODS: The majority of subjects in this study were of Caucasian ancestry and affected with Stargardt macular dystrophy. The initial cohort consisted of DNA samples from 181 patients, and was screened using the ABCR400 chip. An assay was then designed to screen a secondary cohort of 72 patients for seven of the most commonly occurring ABCA4 mutations in this population. A total of 269 control individuals were also screened for the seven ABCA4 mutations. RESULTS: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. The newly designed genetic assay identified two of the seven disease-associated mutations in 28/72 patients in a secondary patient cohort. In the control cohort, 12/269 individuals were found to be heterozygotes, resulting in an estimated background frequency of these mutations in this particular population of 4.46 per 100 individuals. CONCLUSIONS: The relatively high detection rate of seven ABCA4 mutations in the primary patient cohort led to the design and subsequent utility of a multiplex assay. This assay can be used as a viable screening tool and to reduce costs and laboratory time. The estimated background frequency of the seven ABCA4 mutations, together with the improved diagnostic service, could be used by counselors to facilitate clinical and genetic management of South African families with AARs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment

[hide] Transition zones between healthy and diseased reti... Invest Ophthalmol Vis Sci. 2011 Dec 20;52(13):9581-90. Print 2011. Lazow MA, Hood DC, Ramachandran R, Burke TR, Wang YZ, Greenstein VC, Birch DG
Transition zones between healthy and diseased retina in choroideremia (CHM) and Stargardt disease (STGD) as compared to retinitis pigmentosa (RP).
Invest Ophthalmol Vis Sci. 2011 Dec 20;52(13):9581-90. Print 2011., [PMID:22076985]

Abstract [show]
PURPOSE: To describe the structural changes across the transition zone (TZ) in choroideremia (CHM) and Stargardt disease (STGD) and to compare these to the TZ in retinitis pigmentosa (RP). METHODS: Frequency-domain (Fd)OCT line scans were obtained from seven patients with CHM, 20 with STGD, and 12 with RP and compared with those of 30 previously studied controls. A computer-aided manual segmentation procedure was used to determine the thicknesses of the outer segment (OS) layer, the outer nuclear layer plus outer plexiform layer (ONL+), the retinal pigment epithelium plus Bruch's membrane (RPE+BM), and the outer retina (OR). RESULTS: The TZ, while consistent within patient groups, showed differences across disease groups. In particular, (1) OS loss occurred before ONL+ loss in CHM and RP, whereas ONL+ loss occurred before OS loss in STGD; (2) ONL+ was preserved over a wider region of the retina in CHM than in RP; (3) RPE+BM remained normal across the RP TZ, but was typically thinned in CHM. In some CHM patients, it was abnormally thin in regions with normal OS and ONL+ thickness. In STGD, RPE+BM was thinned by the end of the TZ; and (4) the disappearances of the IS/OS and OLM were more abrupt in CHM and STGD than in RP. CONCLUSIONS: On fdOCT scans, patients with RP, CHM, and STGD all have a TZ between relatively healthy and severely affected retina. The patterns of changes in the receptor layers are similar within a disease category, but different across categories. The findings suggest that the pattern of progression of each disease is distinct and may offer clues for strategies in the development of future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20ϩ5 GϾA, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing. Login to comment
31 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20af9;5 Gb0e;A, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing. Login to comment

[hide] Quantification of peripapillary sparing and macula... Invest Ophthalmol Vis Sci. 2011 Oct 10;52(11):8006-15. Print 2011. Burke TR, Rhee DW, Smith RT, Tsang SH, Allikmets R, Chang S, Lazow MA, Hood DC, Greenstein VC
Quantification of peripapillary sparing and macular involvement in Stargardt disease (STGD1).
Invest Ophthalmol Vis Sci. 2011 Oct 10;52(11):8006-15. Print 2011., [PMID:21873672]

Abstract [show]
PURPOSE: To quantify and compare structure and function across the macula and peripapillary area in Stargardt disease (STGD1). METHODS: Twenty-seven patients (27 eyes) and 12 age-similar controls (12 eyes) were studied. Patients were classified on the basis of full-field electroretinogram (ERG) results: Fundus autofluorescence (FAF) and spectral domain-optical coherence tomography (SD-OCT) horizontal line scans were obtained through the fovea and peripapillary area. The thicknesses of the outer nuclear layer plus outer plexiform layer (ONL+), outer segment (OS), and retinal pigment epithelium (RPE) were measured through the fovea, and peripapillary areas from 1 degrees to 4 degrees temporal to the optic disc edge using a computer-aided, manual segmentation technique. Visual sensitivities in the central 10 degrees were assessed using microperimetry and related to retinal layer thicknesses. RESULTS: Compared to the central macula, the differences between controls and patients in ONL+, OS, and RPE layer thicknesses were less in the nasal and temporal macula. Relative sparing of the ONL+ and/or OS layers was detected in the nasal (i.e., peripapillary) macula in 8 of 13 patients with extramacular disease on FAF; relative functional sparing was also detected in this subgroup. All 14 patients with disease confined to the central macula, as detected on FAF, showed ONL+ and OS layer thinning in regions of normal RPE thickness. CONCLUSIONS: Relative peripapillary sparing was detected in STGD1 patients with extramacular disease on FAF. Photoreceptor thinning may precede RPE degeneration in STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 Summary of Clinical, Demographic, and Genetic Data Patient Sex Age at Exam (y) Eye VA BCEA 1 SD (deg 2 ) Eccentricity of PRL (deg) ERG Group FAF Abnormalities Allele 1 Allele 2 Allele 3 Distribution Peripapillary Area 1 F 43 OS 20/20 0.73 0 II M - A1799D ND ND 2 M 30 OS 20/150 3.21 6 I M - T1253M G1961E ND 3 F 55 OD 20/30 1.82 0 I EM - G863A IVS28af9;5 Gb0e;T ND 4 M 44 OD 20/25 0.65 0 I M - E161K ND ND 5.1 F 24 OD 20/200 1.57 1 I M - L541P/A1038V G1961E ND 5.2 F 22 OD 20/30 2.74 1 I M - L541P/A1038V G1961E ND 6.1 F 21 OD 20/150 2.01 1 I M - L541P/A1038V G1961E ND 6.2 F 18 OS 20/100 3.09 4 I M - L541P/A1038V G1961E ND 7 F 27 OS 20/400 2.97 9* II EM Peripapillary atrophy L2027F G851D ND 8 M 34 OS 20/100 2.16 4 I M - G1961E G1961E ND 9 M 20 OS 20/150 2.77 4 I M - IVS20af9;5 Gb0e;A G1961E ND 10 F 23 OS 20/150 9.05 5 I M - L541P/A1038V I1846T ND 11 M 59 OS 20/100 6.52 10 II EM - P1380L S1696N ND 12 M 49 OD 20/150 9.97 1 I EM Nasalaf9;temporal flecks R1108H P1380L ND 13 M 47 OS 20/80 5.62 7 I EM - G863A Y106X ND 14 F 42 OD 20/200 9.53 9 I EM Temporal flecks N965S ND ND 15 M 14 OD 20/200 23.84 1 II EM Nasal flecks IVS38-10 Tb0e;C IVS40af9;5 Gb0e;A ND 16 M 52 OS 20/20 1.3 0 I M - IVS38-10 Tb0e;C ND ND 17 M 34 OS 20/30 2.8 1 I M - L541P/A1038V G1961E ND 18 F 33 OD 20/100 6 6 I M - G1961E R2077W ND 19 F 22 OS 20/60 11 4 I M - A854T A1038V C2150Y 20 F 34 OS 20/200 14.2 14 I EM - G1961E ND ND 21 F 19 OD 20/200 3.7 12 I EM - R602W M18821 ND 22 F 27 OD 20/400 9.6 9 II EM Peripapillary atrophy P1380L P1380L ND 23 F 18 OS 20/50 4.9 5 I EM - R1640W V1693I ND 24 M 22 OS 20/150 10.5 2 I EM - C54Y ND ND 25 M 44 OS 20/150 9.1 5 I EM - R1640W ND ND VA, visual acuity; Rel. Login to comment

[hide] Deducing the pathogenic contribution of recessive ... Hum Mol Genet. 2010 Oct 1;19(19):3693-701. Epub 2010 Jul 20. Schindler EI, Nylen EL, Ko AC, Affatigato LM, Heggen AC, Wang K, Sheffield VC, Stone EM
Deducing the pathogenic contribution of recessive ABCA4 alleles in an outbred population.
Hum Mol Genet. 2010 Oct 1;19(19):3693-701. Epub 2010 Jul 20., [PMID:20647261]

Abstract [show]
Accurate prediction of the pathogenic effects of specific genotypes is important for the design and execution of clinical trials as well as for meaningful counseling of individual patients. However, for many autosomal recessive diseases, it can be difficult to deduce the relative pathogenic contribution of individual alleles because relatively few affected individuals share the same two disease-causing variations. In this study, we used multiple regression analysis to estimate the pathogenicity of specific alleles of ABCA4 in patients with retinal phenotypes ranging from Stargardt disease to retinitis pigmentosa. This analysis revealed quantitative allelic effects on two aspects of the visual phenotype, visual acuity (P < 10(-3)) and visual field (P < 10(-7)). Discordance between visual acuity and visual field in individual patients suggests the existence of at least two non-ABCA4 modifying factors. The findings of this study will facilitate the discovery of factors that modify ABCA4 disease and will also aid in the optimal selection of subjects for clinical trials of new therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment
57 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment

[hide] Novel mutations in of the ABCR gene in Italian pat... Eye (Lond). 2010 Jan;24(1):158-64. Epub 2009 Mar 6. Passerini I, Sodi A, Giambene B, Mariottini A, Menchini U, Torricelli F
Novel mutations in of the ABCR gene in Italian patients with Stargardt disease.
Eye (Lond). 2010 Jan;24(1):158-64. Epub 2009 Mar 6., [PMID:19265867]

Abstract [show]
PURPOSE: Stargardt disease (STGD) is the most prevalent juvenile macular dystrophy, and it has been associated with mutations in the ABCR gene, encoding a photoreceptor-specific transport protein. In this study, we determined the mutation spectrum in the ABCR gene in a group of Italian STGD patients. METHODS: The DNA samples of 71 Italian patients (from 62 independent pedigrees), affected with autosomal recessive STGD, were analysed for mutations in all 50 exons of the ABCR gene by the DHPLC approach (with optimization of the DHPLC conditions for mutation analysis) and direct sequencing techniques. RESULTS: In our group of STGD patients, 71 mutations were identified in 68 patients with a detection rate of 95.7%. Forty-three mutations had been already reported in the literature, whereas 28 mutations had not been previously described and were not detected in 150 unaffected control individuals of Italian origin. Missense mutations represented the most frequent finding (59.2%); G1961E was the most common mutation and it was associated with phenotypes in various degrees of severity. CONCLUSIONS: Some novel mutations in the ABCR gene were reported in a group of Italian STGD patients confirming the extensive allelic heterogeneity of this gene-probably related to the vast number of exons that favours rearrangements in the DNA sequence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Table 2 Summary of the mutations identified in the ABCR gene in our series of STGD Italian patients Patient Allele 1 mutation Allele 2 mutation S 1 R212C T1019M S 8 V1433I V1433I S 21 A1598D A1598D S 33 N96K G978D S 56 A1598D G1961E S 70 R212C T1019M S 71 W700X WT S 74 6750delA V767D S 77 G1961E WT S 82 Q21X G1961E S 106 C1177X G1961E S 107 C1177X G1961E S 114 T970P-F1015E - S 115 T970P-F1015E - S 120 N415K G1961E S 162 324-327insT 324-327insT S 181 W1408X G1961E S 190 C1177X A1598D S 201 G1961E WT S 202 Q21X T970P-F1015E S 213 M840R G1961E S 231 WT WT S 236 C1177X G1961E S 237 WT WT S 241 V256 splice WT S 246 IVS6-1g4t R1108C S 260 L2221P 5109delG-I156V S 321 IVS9 þ 1G4C S1099X S 328 IVS42 þ 4delG IVS35 þ 2t4c S 346 E2096K WT S 347 IVS28 þ 5g4a WT S 353 P1484S-G1961E P68L S 354 P1484S-G1961E P68L S 355 P1484S-G1961E P68L S 360 G1961E 5961delGGAC S 364 IVS35 þ 2t4c G1961E S 365 L541P/A1038V G1961E S 377 IVS42 þ 4delG IVS35 þ 2t4c S 380 R653C WT S 413 R212C T1019M S 414 A1598D G1961E S 417 G1078E G1961E S 438 R1055W WT S 440 4021ins24bp T1526M-G1961E S 449 W1479X L2140Q S 450 W1479X L2140Q S 474 W1461X G 1977S S 486 WT WT S 492 R1098C/L1970F 6548insTGAA S 528 T977P IVS40 þ 5g4a S 531 G690V Q1332X S 532 R572X L1473M-4733delGTTT S 535 IVS40 þ 5g4a 5917delG S 550 IVS40 þ 5g4a 6750delA S 555 250insCAAA WT S 556 250insCAAA WT S 575 N96H G1961E S 590 W821R IVS40 þ 5g4a S 592 V931M R1108C S 593 V767D R2030X Table 2 (Continued ) Patient Allele 1 mutation Allele 2 mutation S 594 G172S G1961E S 602 P1380L G1961E S 607 E616K L1580S-K2172R S 640 250insCAAA S1696N S 694 IVS35 þ 2t4c G1961E S 725 IVS13 þ 1g4a Q1376 splice S 731 L541P-A1038V G1961E S 755 N965S IVS40 þ 5g4a S 789 E1087K G1977S S 968 T1019M G1961E S 992 R212C G1961E Bold values indicate novel mutations. Login to comment

[hide] The role of the photoreceptor ABC transporter ABCA... Biochim Biophys Acta. 2009 Jul;1791(7):573-83. Epub 2009 Feb 20. Molday RS, Zhong M, Quazi F
The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration.
Biochim Biophys Acta. 2009 Jul;1791(7):573-83. Epub 2009 Feb 20., [PMID:19230850]

Abstract [show]
ABCA4 is a member of the ABCA subfamily of ATP binding cassette (ABC) transporters that is expressed in rod and cone photoreceptors of the vertebrate retina. ABCA4, also known as the Rim protein and ABCR, is a large 2,273 amino acid glycoprotein organized as two tandem halves, each containing a single membrane spanning segment followed sequentially by a large exocytoplasmic domain, a multispanning membrane domain and a nucleotide binding domain. Over 500 mutations in the gene encoding ABCA4 are associated with a spectrum of related autosomal recessive retinal degenerative diseases including Stargardt macular degeneration, cone-rod dystrophy and a subset of retinitis pigmentosa. Biochemical studies on the purified ABCA4 together with analysis of abca4 knockout mice and patients with Stargardt disease have implicated ABCA4 as a retinylidene-phosphatidylethanolamine transporter that facilitates the removal of potentially reactive retinal derivatives from photoreceptors following photoexcitation. Knowledge of the genetic and molecular basis for ABCA4 related retinal degenerative diseases is being used to develop rationale therapeutic treatments for this set of disorders.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
134 Disease mutations, which are substituted in Stargardt disease, are shown in red italics - NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C); NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment
225 A subset of missense mutations reside in NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C, R1129L) and NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment
226 Several of these, including N965S, T971N, E1087K, L1971R, G1977S, reside inside or close to the Walker A and B motifs [29,90,92,95,97,100,102]. Login to comment

[hide] Clinical utility of the ABCR400 microarray: basing... Arch Ophthalmol. 2009 Apr;127(4):549-54. Roberts LJ, Ramesar RS, Greenberg J
Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip.
Arch Ophthalmol. 2009 Apr;127(4):549-54., [PMID:19365039]

Abstract [show]
OBJECTIVES: To assess the clinical utility of ABCR400 microarray testing in patients with ABCA4-associated retinopathies and to report on possible issues that could arise should genetic results be delivered without validation. METHODS: One hundred thirty-two probands were genotyped with the microarray. Diagnostic assays were designed to verify all mutations identified in individuals in whom at least 2 causative mutations were found. Mutations were verified in the probands, and wherever possible cosegregation analysis was performed in additional family members. RESULTS: Eighty-five of the 132 probands (64.4%) genotyped with the microarray had 2 or more disease-associated mutations identified. Verification of the genotyping, however, resulted in only 80 families being able to benefit from genetic result delivery. The remaining families could not receive results owing to the confounding effect of multiple ABCA4 mutations or the incorrect identification of mutations. CONCLUSIONS: The ABCR400 microarray is useful for mutation screening; however, raw data cannot be delivered directly to patients. All mutations should be verified and, whenever possible, investigated in other family members. CLINICAL RELEVANCE: Validated ABCR400 results provide an unequivocal molecular diagnosis, allowing family members to be offered diagnostic, predictive, carrier, and prenatal testing. Use of the microarray can inform decision-making and identify candidates for future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 3Ј; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 3Ј; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction. Login to comment

[hide] ABCA4 disease progression and a proposed strategy ... Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12. Cideciyan AV, Swider M, Aleman TS, Tsybovsky Y, Schwartz SB, Windsor EA, Roman AJ, Sumaroka A, Steinberg JD, Jacobson SG, Stone EM, Palczewski K
ABCA4 disease progression and a proposed strategy for gene therapy.
Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12., [PMID:19074458]

Abstract [show]
Autosomal recessive retinal diseases caused by mutations in the ABCA4 gene are being considered for gene replacement therapy. All individuals with ABCA4-disease show macular degeneration, but only some are thought to progress to retina-wide blindness. It is currently not predictable if or when specific ABCA4 genotypes will show extramacular disease, and how fast it will progress thereafter. Early clinical trials of focal subretinal gene therapy will aim to arrest disease progression in the extramacular retina. In 66 individuals with known disease-causing ABCA4 alleles, we defined retina-wide disease expression by measuring rod- and cone-photoreceptor-mediated vision. Serial measurements over a mean period of 8.7 years were consistent with a model wherein a normal plateau phase of variable length was followed by initiation of retina-wide disease that progressed exponentially. Once initiated, the mean rate of disease progression was 1.1 log/decade for rods and 0.45 log/decade for cones. Spatio-temporal progression of disease could be described as the sum of two components, one with a central-to-peripheral gradient and the other with a uniform retina-wide pattern. Estimates of the age of disease initiation were used as a severity metric and contributions made by each ABCA4 allele were predicted. One-third of the non-truncating alleles were found to cause more severe disease than premature truncations supporting the existence of a pathogenic component beyond simple loss of function. Genotype-based inclusion/exclusion criteria and prediction of the age of retina-wide disease initiation will be invaluable for selecting appropriate candidates for clinical trials in ABCA4 disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 At age 11, P36 (A1038V;L541P/ N965S) had a sensitivity loss of 5.3 dB which was within normal limits; 8 years later at age 19 there was no significant change in sensitivity loss (5.6 dB). Login to comment
126 For four missense mutations occurring homozygously (L244P, R220C, N965S and P1380L), we assumed that each allele contributed equally to disease severity. Login to comment
151 Estimated severity of ABCA4 alleles and their properties ABCA4 allele Delay of retina-wide disease initiation (years)a In vitro or in vivo studiesb Molecular structural localizationc C2150Y 225.8 NBD-2 A1038V;L541P 214.0 35, 38 ECD-1/NBD-1 IVS38-10 T.C 211.1 L244P 25.7 ECD-1 E1122K 23.5 NBD-1 C54Y 22.1 35 ECD-1 IVS35þ2 T.C 22.1 R602W 21.8 38 ECD-1 V1896D 21.8 TM12 L1940P 21.4 NBD-2 Truncation mutationsd 0.0 E1087D 2.8 NBD-1 R220C 3.9 ECD-1 A1598D 3.9 ECD-2 R1640Q 3.9 ECD-2 R1098C 4.9 NBD-1 P1380L 7.4 35 TM7 N965S 7.6 35 NBD-1 V1433I 8.6 ECD-2 R1108C 10.4 35 NBD-1 T1526M 14.5 35 ECD-2 R2030Q 14.5 NBD-2 L2027F 15.1 35,37 NBD-2 G818E 17.3 35 TM5/TM6 S100P 18.2 ECD-1 L1201R 18.2 NBD-1 R18W 18.5 Nt D600E 18.5 ECD-1 L11P 21.7 Nt D654N 25.3 36 ECD-1 K2172R 27.9 NBD-2 IVS40þ5 G.A 28.1 G1961E 37.9 35 NBD-2 G1961R 44.0 NBD-2 a Delay of retina-wide disease initiation relative to the standard of age 10.6 years. Login to comment

[hide] Denaturing HPLC profiling of the ABCA4 gene for re... Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10. Stenirri S, Fermo I, Battistella S, Galbiati S, Soriani N, Paroni R, Manitto MP, Martina E, Brancato R, Allikmets R, Ferrari M, Cremonesi L
Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations.
Clin Chem. 2004 Aug;50(8):1336-43. Epub 2004 Jun 10., [PMID:15192030]

Abstract [show]
BACKGROUND: Mutations in the retina-specific ABC transporter (ABCA4) gene have been associated with several forms of macular degenerations. Because the high complexity of the molecular genotype makes scanning of the ABCA4 gene cumbersome, we describe here the first use of denaturing HPLC (DHPLC) to screen for ABCA4 mutations. METHODS: Temperature conditions were designed for all 50 exons based on effective separation of 83 samples carrying 86 sequence variations and 19 mutagenized controls. For validation, samples from 23 previously characterized Stargardt patients were subjected to DHPLC profiling. Subsequently, samples from a cohort of 30 patients affected by various forms of macular degeneration were subjected to DHPLC scanning under the same conditions. RESULTS: DHPLC profiling not only identified all 132 sequence alterations previously detected by double-gradient denaturing gradient gel electrophoresis but also identified 5 sequence alterations that this approach had missed. Moreover, DHPLC scanning of an additional panel of 30 previously untested patients led to the identification of 26 different mutations and 29 polymorphisms, accounting for 203 sequence variations on 29 of the 30 patients screened. In total, the DHPLC approach allowed us to identify 16 mutations that had never been reported before. CONCLUSIONS: These results provide strong support for the use of DHPLC for molecular characterization of the ABCA4 gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment
34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment

[hide] Mutations in ABCA4 result in accumulation of lipof... Hum Mol Genet. 2004 Mar 1;13(5):525-34. Epub 2004 Jan 6. Cideciyan AV, Aleman TS, Swider M, Schwartz SB, Steinberg JD, Brucker AJ, Maguire AM, Bennett J, Stone EM, Jacobson SG
Mutations in ABCA4 result in accumulation of lipofuscin before slowing of the retinoid cycle: a reappraisal of the human disease sequence.
Hum Mol Genet. 2004 Mar 1;13(5):525-34. Epub 2004 Jan 6., [PMID:14709597]

Abstract [show]
Mutations in ABCA4, which encodes a photoreceptor specific ATP-binding cassette transporter (ABCR), cause autosomal recessive forms of human blindness due to retinal degeneration (RD) including Stargardt disease. The exact disease sequence leading to photoreceptor and vision loss in ABCA4-RD is not known. Extrapolation from murine and in vitro studies predicts that two of the earliest pathophysiological features resulting from disturbed ABCR function in man would be slowed kinetics of the retinoid cycle and accelerated deposition of lipofuscin in the retinal pigment epithelium (RPE). To determine the human pathogenetic sequence, we studied surrogate measures of retinoid cycle kinetics, lipofuscin accumulation, and rod and cone photoreceptor and RPE loss in ABCA4-RD patients with a wide spectrum of disease severities. There were different extents of photoreceptor/RPE loss and lipofuscin accumulation in different regions of the retina. Slowing of retinoid cycle kinetics was not present in all patients; when present, it was not homogeneous across the retina; and the extent of slowing correlated well with the degree of degeneration. The orderly relationship between these phenotypic features permitted the development of a model of disease sequence in ABCA4-RD. The model predicted lipofuscin accumulation as a key and early component of the disease expression in man, as in mice. In man, however, abnormal slowing of the rod and cone retinoid cycle occurs at later stages of the disease sequence. Knowledge of the human ABCA4 disease sequence will be critical for defining rates of progression, selecting appropriate patients and retinal locations for future therapy, and choosing appropriate treatment outcomes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Alleles demonstrated to have major abnormalities in vitro (7) could result in mild disease (P10: E1087K/G1961E) or severe disease (P5: G818E/ L541Pþ A1038V; or P9: N965S/N965S). Login to comment

[hide] Macular pigment and visual acuity in Stargardt mac... Graefes Arch Clin Exp Ophthalmol. 2002 Oct;240(10):802-9. Epub 2002 Sep 14. Zhang X, Hargitai J, Tammur J, Hutchinson A, Allikmets R, Chang S, Gouras P
Macular pigment and visual acuity in Stargardt macular dystrophy.
Graefes Arch Clin Exp Ophthalmol. 2002 Oct;240(10):802-9. Epub 2002 Sep 14., [PMID:12397427]

Abstract [show]
PURPOSE: To test the hypothesis that macular pigment reflects foveal cone function and possibly the presence of foveal cones in recessive Stargardt macular dystrophy. METHODS: Sixteen patients (32 eyes) diagnosed to have Stargardt macular dystrophy by clinical criteria were studied with a scanning laser ophthalmoscope (SLO) comparing argon laser blue (488 nm), green (514), helium-neon laser red (633 nm) and infrared diode laser (780 nm) images for the presence or absence of macular pigment in the fovea. Fifteen of the patients were screened for mutations in the ABCR gene. Eyes were graded into three categories: those without foveal macular pigment, those with partial pigment and those with normal amounts of macular pigment. These categories were compared with visual acuity determined by the Snellen chart. RESULTS: All patients with a visual acuity of 20/200 or worse had no macular pigment in the fovea. All patients with visual acuity of 20/40 or better had a normal amount of macular pigment in the fovea. Patients with partial macular pigment had intermediary acuity values except for two eyes, one with 20/20 and another with 20/200 acuity. Infrared light revealed more retinal abnormalities than blue light at early stages of the disease. CONCLUSION: Foveal macular pigment is related to foveal cone acuity in Stargardt macular dystrophy and may be a marker for the presence of foveal cones. Infrared light is a sensitive monitor of early Stargardt macular dystrophy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Blue light images (A, C); infrared images (B, D) Table 1 Visual acuity, macular pigment and ABCR mutations in patients with Stargardt dystrophy Patient Age/Sex Visual Acuity Macular Pigment Exon Allele 1 Exon Allele 2 OD OS OD OS 1 33F 0.67 0.38 + + ND ND 2 36F 1 0.5 + + ND ND 3 54F 0.48 0.6 + + 42 G1961E 42 G1061E 4 11M 0.8 1 + + NS NS 5 33F 0.67 0.4 +- + 20 V989A ND 6 12F 0.5 0.2 +- +- 30 C1490Y 40 GIVS+5A 7 47M 0.5 0.4 +- +- 17 G863A/R943Q 45 R2077W 8 53M 0.1 1 +- +- 14 W663X ND 9 29F 0.1 0.1 +- +- 26 3819insT ND 10 43M 0.005 0.005 - - 17 G863A/R943Q ND 11 32F 0.1 0.1 - - 19 N965S ND 12 29F 0.005 0.005 - - 23 R1129H ND 13 30F 0.1 0.1 - - 5 R152Q ND 14 63F 0.1 0.1 - - 42 G1961E ND 15 36M 0.07 0.1 - +- 13 Q636H 42 G1961E 16 41F 0.005 0.005 - - 12 L514P/A1038V ND NS: Not screened; ND: Not detected + Normal macular pigment; +- Partial macular pigment; - Absent macular pigment absorption of infrared light in the center of the macula where maximum absorption of blue light occurs, implying that the macula pigments in this subject`s foveas are normal. Login to comment

[hide] Visual function in patients with cone-rod dystroph... Exp Eye Res. 2001 Dec;73(6):877-86. Birch DG, Peters AY, Locke KL, Spencer R, Megarity CF, Travis GH
Visual function in patients with cone-rod dystrophy (CRD) associated with mutations in the ABCA4(ABCR) gene.
Exp Eye Res. 2001 Dec;73(6):877-86., [PMID:11846518]

Abstract [show]
Mutations in the ABCA4(ABCR) gene cause autosomal recessive Stargardt disease (STGD). ABCR mutations were identified in patients with cone-rod dystrophy (CRD) and retinitis pigmentosa (RP) by direct sequencing of all 50 exons in 40 patients. Of 10 patients with RP, one contained two ABCR mutations suggesting a compound heterozygote. This patient had a characteristic fundus appearance with attenuated vessels, pale disks and bone-spicule pigmentation. Rod electroretinograms (ERGs) were non-detectable, cone ERGs were greatly reduced in amplitude and delayed in implicit time, and visual fields were constricted to 10 degrees diameter. Eleven of 30 (37%) patients with CRD had mutations in ABCR. In general, these patients showed reduced but detectable rod ERG responses, reduced and delayed cone responses, and poor visual acuity. Rod photoresponses to high intensity flashes were of reduced maximum amplitude but showed normal values for the gain of phototransduction. Most CRD patients with mutations in ABCR showed delayed recovery of sensitivity (dark adaptation) following exposure to bright light. Pupils were also significantly smaller in these patients compared to controls at 30 min following light exposure, consistent with a persistent 'equivalent light' background due to the accumulation of a tentatively identified 'noisy' photoproduct.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
207 In contrast, the ®t of the T ABLE III ABCR mutations in patients with ARRP and CRD hRmP exon # Base variation site Codon variation site # WT with mutation New mutation WT genotype RP CRD 3195 3424 5402 5398 4317 146 3793 2566 4800 4512 5581 4770 3 3 H Jxn 1 3 H Jxn 0 in 53 Yes G/G G/A 3 G161A C054Y 0 in 53 No G/G A/A G/A 6 C618G S206R 0 in 53 No C/C C/G 6 G574A A192T 0 in 53 No G/G G/A 9 C1222T R408stop 0 in 53 No C/C C/T 18 A2701G T901A 0 in 53 No A/A A/G 19 A2894G N965S 0 in 53 No A/A A/G 28 T4169C L1390P 0 in 53 Yes T/T T/C 33 3 H Jxn 2 3 H Jxn 0 in 53 Yes T/T T/C 35 C4926G S1642R 0 in 53 Yes C/C C/G 36 G5115T R1705L 0 in 53 No G/G G/T 36 deletion deletion 0 in 53 Yes no del deln 37 T5206C S1736P 0 in 53 No T/T T/C 42 G5882A G1961E 0 in 53 No G/G A/G 47 G6449A C2150Y 0 in 53 No G/G G/A phototransduction model to the cone a-waves revealed a reduction in gain of approximately 0.5 log unit. Login to comment

[hide] Mechanistic studies of ABCR, the ABC transporter i... J Bioenerg Biomembr. 2001 Dec;33(6):523-30. Sun H, Nathans J
Mechanistic studies of ABCR, the ABC transporter in photoreceptor outer segments responsible for autosomal recessive Stargardt disease.
J Bioenerg Biomembr. 2001 Dec;33(6):523-30., [PMID:11804194]

Abstract [show]
ABCR is an ABC transporter that is found exclusively in vertebrate photoreceptor outer segments. Mutations in the human ABCR gene are responsible for autosomal recessive Stargardt disease, the most common cause of early onset macular degeneration. In this paper we review our recent work with purified and reconstituted ABCR derived from bovine retina and from cultured cells expressing wild type or site-directed mutants of human ABCR. These experiments implicate all-trans-retinal (or Schiff base adducts between all-trans-retinal and phosphatidylethanolamine) as the transport substrate, and they reveal asymmetric roles for the two nucleotide binding domains in the transport reaction. A model for the retinal transport reaction is presented which accounts for these experimental observations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 basal ATPase activity than N965S, and all three show little or no retinal-stimulated ATP hydrolysis. Login to comment

[hide] An analysis of allelic variation in the ABCA4 gene... Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89. Webster AR, Heon E, Lotery AJ, Vandenburgh K, Casavant TL, Oh KT, Beck G, Fishman GA, Lam BL, Levin A, Heckenlively JR, Jacobson SG, Weleber RG, Sheffield VC, Stone EM
An analysis of allelic variation in the ABCA4 gene.
Invest Ophthalmol Vis Sci. 2001 May;42(6):1179-89., [PMID:11328725]

Abstract [show]
PURPOSE: To assess the allelic variation of the ATP-binding transporter protein (ABCA4). METHODS: A combination of single-strand conformation polymorphism (SSCP) and automated DNA sequencing was used to systematically screen this gene for sequence variations in 374 unrelated probands with a clinical diagnosis of Stargardt disease, 182 patients with age-related macular degeneration (AMD), and 96 normal subjects. RESULTS: There was no significant difference in the proportion of any single variant or class of variant between the control and AMD groups. In contrast, truncating variants, amino acid substitutions, synonymous codon changes, and intronic variants were significantly enriched in patients with Stargardt disease when compared with their presence in subjects without Stargardt disease (Kruskal-Wallis P < 0.0001 for each variant group). Overall, there were 2480 instances of 213 different variants in the ABCA4 gene, including 589 instances of 97 amino acid substitutions, and 45 instances of 33 truncating variants. CONCLUSIONS: Of the 97 amino acid substitutions, 11 occurred at a frequency that made them unlikely to be high-penetrance recessive disease-causing variants (HPRDCV). After accounting for variants in cis, one or more changes that were compatible with HPRDCV were found on 35% of all Stargardt-associated alleles overall. The nucleotide diversity of the ABCA4 coding region, a collective measure of the number and prevalence of polymorphic sites in a region of DNA, was found to be 1.28, a value that is 9 to 400 times greater than that of two other macular disease genes that were examined in a similar fashion (VMD2 and EFEMP1).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment

[hide] Genotype/Phenotype analysis of a photoreceptor-spe... Am J Hum Genet. 1999 Feb;64(2):422-34. Lewis RA, Shroyer NF, Singh N, Allikmets R, Hutchinson A, Li Y, Lupski JR, Leppert M, Dean M
Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease.
Am J Hum Genet. 1999 Feb;64(2):422-34., [PMID:9973280]

Abstract [show]
Mutation scanning and direct DNA sequencing of all 50 exons of ABCR were completed for 150 families segregating recessive Stargardt disease (STGD1). ABCR variations were identified in 173 (57%) disease chromosomes, the majority of which represent missense amino acid substitutions. These ABCR variants were not found in 220 unaffected control individuals (440 chromosomes) but do cosegregate with the disease in these families with STGD1, and many occur in conserved functional domains. Missense amino acid substitutions located in the amino terminal one-third of the protein appear to be associated with earlier onset of the disease and may represent misfolding alleles. The two most common mutant alleles, G1961E and A1038V, each identified in 16 of 173 disease chromosomes, composed 18.5% of mutations identified. G1961E has been associated previously, at a statistically significant level in the heterozygous state, with age-related macular degeneration (AMD). Clinical evaluation of these 150 families with STGD1 revealed a high frequency of AMD in first- and second-degree relatives. These findings support the hypothesis that compound heterozygous ABCR mutations are responsible for STGD1 and that some heterozygous ABCR mutations may enhance susceptibility to AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift. Login to comment
77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift. Login to comment

[hide] Differential phospholipid substrates and direction... J Biol Chem. 2013 Nov 29;288(48):34414-26. doi: 10.1074/jbc.M113.508812. Epub 2013 Oct 4. Quazi F, Molday RS
Differential phospholipid substrates and directional transport by ATP-binding cassette proteins ABCA1, ABCA7, and ABCA4 and disease-causing mutants.
J Biol Chem. 2013 Nov 29;288(48):34414-26. doi: 10.1074/jbc.M113.508812. Epub 2013 Oct 4., [PMID:24097981]

Abstract [show]
ABCA1, ABCA7, and ABCA4 are members of the ABCA subfamily of ATP-binding cassette transporters that share extensive sequence and structural similarity. Mutations in ABCA1 cause Tangier disease characterized by defective cholesterol homeostasis and high density lipoprotein (HDL) deficiency. Mutations in ABCA4 are responsible for Stargardt disease, a degenerative disorder associated with severe loss in central vision. Although cell-based studies have implicated ABCA proteins in lipid transport, the substrates and direction of transport have not been firmly established. We have purified and reconstituted ABCA1, ABCA7, and ABCA4 into liposomes for fluorescent-lipid transport studies. ABCA1 actively exported or flipped phosphatidylcholine, phosphatidylserine, and sphingomyelin from the cytoplasmic to the exocytoplasmic leaflet of membranes, whereas ABCA7 preferentially exported phosphatidylserine. In contrast, ABCA4 transported phosphatidylethanolamine in the reverse direction. The same phospholipids stimulated the ATPase activity of these ABCA transporters. The transport and ATPase activities of ABCA1 and ABCA4 were reduced by 25% in the presence of 20% cholesterol. Nine ABCA1 Tangier mutants and the corresponding ABCA4 Stargardt mutants showed significantly reduced phospholipid transport activity and subcellular mislocalization. These studies provide the first direct evidence for ABCA1 and ABCA7 functioning as phospholipid transporters and suggest that this activity is an essential step in the loading of apoA-1 with phospholipids for HDL formation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Mutations introduced by overlap extension PCR using Pfu AD DNA polymerase in ABCA1 included S100C, W590S, F593L, N935S, T929I, C1477R, T1512M, R2081W, and P2150L. Login to comment
66 Corresponding ABCA4 mutations determined by amino acid alignment with ABCA1 included S100P, W605S, F608L, T959I, N965S, C1502R, T1537M, R2107P, and P2180L. Login to comment
220 Error bars show S.E. Lipid Transport Activity of ABCA Transporters 34420 gardt disease (S100P, F608L, N965S, T959I, T1537M, and R2107P) (Fig. 6A, red). Login to comment
223 Finally, the null mutant C1502X associated with Stargardt disease was modified to C1502R to reflect the primary sequence change of the corresponding C1477R mutant in ABCA1 linked to Tangier disease. Login to comment
68 Corresponding ABCA4 mutations determined by amino acid alignment with ABCA1 included S100P, W605S, F608L, T959I, N965S, C1502R, T1537M, R2107P, and P2180L. Login to comment
218 Error bars show S.E. Lipid Transport Activity of ABCA Transporters 34420 gardt disease (S100P, F608L, N965S, T959I, T1537M, and R2107P) (Fig. 6A, red). Login to comment

[hide] Allelic and phenotypic heterogeneity in ABCA4 muta... Ophthalmic Genet. 2011 Sep;32(3):165-74. doi: 10.3109/13816810.2011.565397. Epub 2011 Apr 21. Burke TR, Tsang SH
Allelic and phenotypic heterogeneity in ABCA4 mutations.
Ophthalmic Genet. 2011 Sep;32(3):165-74. doi: 10.3109/13816810.2011.565397. Epub 2011 Apr 21., [PMID:21510770]

Abstract [show]
Since the discovery of the ABCA4 gene as the cause of autosomal recessive Stargardt disease/fundus flavimaculatus much has been written of the phenotypic variability in ABCA4 retinopathy. In this review the authors discuss the findings seen on examination and the disease features detected using various clinical tests. Important differential diagnoses are presented and unusual presentations of ABCA4 disease highlighted.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 The most common, L541P/A1038V, has been reported as a founder mutation in Hungaro-German populations.14,16,17 Furthermore "ethnic group-specific" ABCA4 alleles have been described in other populations also, C1490Y and R602W in South African patients,18 and N965S in a Danish population19 among others.20 In an attempt to explain the variability seen in ABCA4 retinal phenotypes and to correlate this with individual mutation effect, a model was proposed which correlated disease severity with residual ABCA4 function.14,21 Maugeri classified ABCA4 mutant alleles as "mild", "moderate", and "severe" based on the predicted effect of the mutation on the transport function of the protein, ie, the more severe the effect of the mutation on ABCA4 function, the more aggressive the disease phenotype. Login to comment

[hide] Analysis of the ABCA4 gene by next-generation sequ... Invest Ophthalmol Vis Sci. 2011 Oct 31;52(11):8479-87. doi: 10.1167/iovs.11-8182. Zernant J, Schubert C, Im KM, Burke T, Brown CM, Fishman GA, Tsang SH, Gouras P, Dean M, Allikmets R
Analysis of the ABCA4 gene by next-generation sequencing.
Invest Ophthalmol Vis Sci. 2011 Oct 31;52(11):8479-87. doi: 10.1167/iovs.11-8182., [PMID:21911583]

Abstract [show]
PURPOSE: To find all possible disease-associated variants in coding sequences of the ABCA4 gene in a large cohort of patients diagnosed with ABCA4-associated diseases. METHODS: One hundred sixty-eight patients who had been clinically diagnosed with Stargardt disease, cone-rod dystrophy, and other ABCA4-associated phenotypes were prescreened for mutations in ABCA4 with the ABCA4 microarray, resulting in finding 1 of 2 expected mutations in 111 patients and 0 of 2 mutations in 57 patients. The next-generation sequencing (NGS) strategy was applied to these patients to sequence the entire coding region and the splice sites of the ABCA4 gene. Identified new variants were confirmed or rejected by Sanger sequencing and analyzed for possible pathogenicity by in silico programs and, where possible, by segregation analyses. RESULTS: Sequencing was successful in 159 of 168 patients and identified the second disease-associated allele in 49 of 103 (~48%) of patients with one previously identified mutation. Among those with no mutations, both disease-associated alleles were detected in 4 of 56 patients, and one mutation was detected in 10 of 56 patients. The authors detected a total of 57 previously unknown, possibly pathogenic, variants: 29 missense, 4 nonsense, 9 small deletions and 15 splice-site-altering variants. Of these, 55 variants were deemed pathogenic by a combination of predictive methods and segregation analyses. CONCLUSIONS: Many mutations in the coding sequences of the ABCA4 gene are still unknown, and many possibly reside in noncoding regions of the ABCA4 locus. Although the ABCA4 array remains a good first-pass screening option, the NGS platform is a time- and cost-efficient tool for screening large cohorts.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 (C) An example of a pedigree segregating a complex allele in which one variant (c.2894Ab0e;G, p.N965S) causes disease and the other, c.4283Cb0e;T, p.T1428M, is a benign polymorphism, although it was originally described as a rare mutation in patients of European descent. Login to comment

[hide] ABCA4 mutational spectrum in Mexican patients with... Exp Eye Res. 2013 Apr;109:77-82. doi: 10.1016/j.exer.2013.02.006. Epub 2013 Feb 16. Chacon-Camacho OF, Granillo-Alvarez M, Ayala-Ramirez R, Zenteno JC
ABCA4 mutational spectrum in Mexican patients with Stargardt disease: Identification of 12 novel mutations and evidence of a founder effect for the common p.A1773V mutation.
Exp Eye Res. 2013 Apr;109:77-82. doi: 10.1016/j.exer.2013.02.006. Epub 2013 Feb 16., [PMID:23419329]

Abstract [show]
The aim of this study was to assess the mutational spectrum of the ABCA4 gene in a cohort of patients with Stargardt disease from Mexico, a previously uncharacterized population. Clinical diagnosis in each patient was supported by a complete ophthalmological assessment that included visual acuity measurement, a slit lamp examination, a fundus examination and photography, electroretinography, fluorescein angiography, and computerized visual fields testing. Molecular analysis was performed by PCR amplification and direct nucleotide sequence of the 50 exons of the ABCA4 gene in genomic DNA. A total of 31 unrelated subjects with the disease were enrolled in the study. Molecular analysis in the total group of 62 alleles allowed the identification of 46 mutant ABCA4 alleles carrying 29 different pathogenic disease-associated mutations. Two ABCA4 mutant alleles were detected in 20 of the 31 patients (64.5%), a single disease allele was identified in six (19.4%), and no mutant alleles were detected in five of the cases (16.1%). Most patients with two ABCA4 mutations (11/20, 55%) were compound heterozygotes. Twelve variants were novel ABCA4 mutations. Nucleotide substitutions were the most frequent type of variation, occurring in 26 out of 29 (89.7%) different mutations. The two most common mutations in our study were the missense changes p.A1773V and p.G818E, which were identified in eight (17%) and seven (15%) of the total 46 disease-associated alleles, respectively. Haplotype analyses of intragenic SNPs in four subjects carrying the p.A1773V mutation supported a common origin for this mutation. In conclusion, this is the first report of ABCA4 molecular screening in Latin American Stargardt disease patients. Our results expand the mutational spectrum of the disease by adding 12 novel ABCA4 pathogenic variants and support the occurrence of a founder effect for the p.A1773V mutation in the Mexican population. The identification of recurrent mutations in our cohort will direct future ABCA4 molecular screening in patients from this ethnic group.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 Allele 1 Allele 2 Genotype Exon Nucleotide change Polypeptide change Exon Nucleotide change Polypeptide change Familial case # 1 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous 2 e NI e e NI e e 3 6 c.634C>T p.R212C (D) 38 c.5318C>T p.A1773V (D) Compound heterozygous 4 23 c.3386G>T p.R1129L (D) 28 c.4139C>T p.P1380L (D) Compound heterozygous 5 e NI e e NI e e 6 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous 7 e NI e e NI e e 8 16 c.2453G>A p.G818E (D) 28 c.4249_4251 delTTC p.F1417del (D; N) Compound heterozygous 9 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous Sporadic case # 1 8 c.868C>T p.R290W (D) e IVS8&#fe;1G>A Splicing (D; N) Compound heterozygous 2 38 c.5318C>T p.A1773V (D) - NI - Heterozygous 3 20 c.3041T>G p.L1014R (D) 1; 49 c.52C>T; c.6764G>T p.R18W (D); p.S2255I (B) Compound heterozygous 4 13; 19 c.1804C>T; c.2828G>A p.R602W (D); p.R943Q (U) 16 c.2453G>A p.G818E (D) Compound heterozygous 5 38 c.5324T>A p. I1775N (D; N) 38 c.5324T>A p.I1775N (D; N) Homozygous 6 e NI e e NI e e 7 49 c.6764G>T p.S2255I (B) 49 c.6764 G>T p.S2255I (B) Homozygous 8 19; 40 c.2828 G>A; c.5503A>T p.R943Q (U); p.N1868I (U) 3 c.265G>T p.E89* (D; N) Compound heterozygous 9 38 c.5335T>C p.Y1779H (D;N) 38 c.5335T>C p.Y1779H (D;N) Homozygous 10 16 c.2453G>A p.G818E (D) 16 c.2453G>A p.G818E (D) Homozygous 11 6 c.723A>T p.E241D (D;N) 36 c.5114G>A p.R1705Q (D) Compound heterozygous 12 2 c.71G>A (D) p.R24H e NI e Heterozygous 13 30 c.4537_4538insC p.Q1513Pfs*41 (D; N) e NI e Heterozygous 14 32 c.4667G>C p.R1556T (D; N) 32 c.4667G>C p.R1556T (D; N) Homozygous 15 45 c.6221G>T p.G2074V (D; N) 16 c.2453G>A p.G818E (D) Compound heterozygous 16 16; 41 c.2453G>A; c.5824G>C p. G818E (D); p. E1942Q (B;N) 46 c.6384A>G p.H2128R (D) Compound heterozygous 17 16 c.2453G>A p. G818E (D) e NI e Heterozygous 18 32 c.4653G>A p. W1551* (D; N) e NI e Heterozygous 19 23 c.3386G>T p. R1129L (D) e NI e Heterozygous 20 36 c.5045_5059del GTTGCCATCTGCGTG p.V1682_ V1686del (D; N) 29; 49 c.4328G>A; c.6764G>T p.R1443H (D); p.S2255I (B) Compound heterozygous 21 19 c.2894A>G p.N965S (D) 19 c.2894A>G p.N965S (D) Homozygous 22 e NI e e NI e e STGD accounts for approximately 7% of all retinal dystrophies; it is one of the most common genetic forms of juvenile or early adult onset macular degeneration. Login to comment
119 ABCA4 Exon # Nucleotide change Predicted protein effect Number of alleles Population genotypic frequency in EVS Population allelic frequency in EVS (%) 1 c.52C>T p.R18W 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 2 c.71G>A p.R24H 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 3 c.265G>T p.E89* (N) 1 NR NR 6 c.634C>T p.R212C 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 6 c.723A>T p.E241D (N) 1 NR NR 8 c.868C>T p.R290W 1 NR NR IVS8 IVS8 &#fe; 1G>A Splicing mutation (N) 1 NR NR 13 c.1804C>T p.R602W 1 NR NR 16 c.2453G>A p.G818E 7 NR NR 19 c.2828G>A p.R943Q 2 AA &#bc; 8/AG &#bc; 400/GG &#bc; 6095 A &#bc; 3.199/G &#bc; 96.801 19 c.2894A>G p.N965S 2 GG &#bc; 0/GA &#bc; 1/AA &#bc; 6502 G &#bc; 0.008/A &#bc; 99.992 20 c.3041T>G p.L1014R 1 NR NR 23 c.3386G>T p.R1129L 2 NR NR 28 c.4139C>T p.P1380L 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 28 c.4249_4251del TTC p.F1417del (N) 1 NR NR 29 c.4328G>A p.R1443H 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 30 c.4537_4538insC p.Q1513Pfs*41 (N) 1 NR NR 32 c.4653G>A p.W1551* (N) 1 NR NR 32 c.4667G>C p.R1556T (N) 2 NR NR 36 c.5044_5058del GTTGCCATCTGCGTG p.V1682_V1686del (N) 1 NR NR 36 c.5114G>A p.R1705Q 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 38 c.5318C>T p.A1773V 8 NR NR 38 c.5324T>A p.I1775N (N) 2 NR NR 38 c.5335T>C p.Y1779H (N) 2 NR NR 40 c.5503A>T p.N1868I 1 TT &#bc; 16/TA &#bc; 589/AA &#bc; 5898 T &#bc; 4.775/A &#bc; 95.225 41 c.5824G>C p.E1942Q (N) 1 NR NR 45 c.6221G>T p.G2074V (N) 1 NR NR 46 c.6384A>G p.H2128R 1 NR NR 49 c.6764G>T p.S2255I 4 TT &#bc; 516/TG &#bc; 1473/GG &#bc; 4514 T &#bc; 19.26/G &#bc; 80.74 gold standard for ABCA4 mutational screening. Login to comment

[hide] A longitudinal study of stargardt disease: clinica... Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15. Fujinami K, Lois N, Davidson AE, Mackay DS, Hogg CR, Stone EM, Tsunoda K, Tsubota K, Bunce C, Robson AG, Moore AT, Webster AR, Holder GE, Michaelides M
A longitudinal study of stargardt disease: clinical and electrophysiologic assessment, progression, and genotype correlations.
Am J Ophthalmol. 2013 Jun;155(6):1075-1088.e13. doi: 10.1016/j.ajo.2013.01.018. Epub 2013 Mar 15., [PMID:23499370]

Abstract [show]
PURPOSE: To investigate the clinical and electrophysiologic natural history of Stargardt disease and correlate with the genotype. DESIGN: Cohort study of 59 patients. METHODS: Clinical history, examination, and electrophysiologic assessment were undertaken in a longitudinal survey. Patients were classified into 3 groups based on electrophysiologic findings, as previously published: Group 1 had dysfunction confined to the macula; Group 2 had macular and generalized cone system dysfunction; and Group 3 had macular and both generalized cone and rod system dysfunction. At baseline, there were 27 patients in Group 1, 17 in Group 2, and 15 in Group 3. Amplitude reduction of >50% in the relevant electroretinogram (ERG) component or a peak time shift of >3 ms for the 30 Hz flicker ERG or bright flash a-wave was considered clinically significant ERG deterioration. Molecular screening of ABCA4 was undertaken. RESULTS: The mean age at baseline was 31.7 years, with the mean follow-up interval being 10.5 years. A total of 22% of patients from Group 1 showed ERG group transition during follow-up, with 11% progressing to Group 2 and 11% to Group 3. Forty-seven percent of patients in Group 2 progressed to Group 3. There was clinically significant ERG deterioration in 54% of all subjects: 22% of Group 1, 65% of Group 2, and 100% of Group 3. At least 1 disease-causing ABCA4 variant was identified in 47 patients. CONCLUSIONS: All patients with initial rod ERG involvement demonstrated clinically significant electrophysiologic deterioration; only 20% of patients with normal full-field ERGs at baseline showed clinically significant progression. Such data assist counseling by providing more accurate prognostic information and are also highly relevant in the design, patient selection, and monitoring of potential therapeutic interventions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Clinical Data and Molecular Genetic Status of 59 Patients With Stargardt Disease Pt Onset (y) Age (y) logMAR VA Variants Identifieda BL FU BL FU 1 16 17 26 0.0/1.0 0.0/0.48 c.768G>T / p.Gly863Ala / p.Arg943Gln 2 15 17 25 0.78/0.78 1.0/1.0 p. Arg1443His 3 11 18 27 0.78/1.0 1.0/1.0 p.Trp439* / p.Gly863Ala / p.Leu1970Phe 4 19 21 32 0.78/0.78 1.0/1.0 p.Leu2027Phe 5 10 22 30 0.48/0.48 1.0/0.78 p.Gly863Ala / p.Arg943Gln / c.5461-10 T>C 6 18 26 37 0.78/1.0 1.0/1.0 p.Pro1380Phe 7 25 28 40 0.78/1.0 1.3/0.78 ND 8 24 29 38 1.0/0.78 1.0/1.0 p.Phe418Ser / p.Leu2027Phe 9 24 31 44 1.0/1.0 1.3/1.0 c.4253&#fe;5 G>T / p.Gly1507Arg 10 26 32 44 0.78/0.78 1.0/1.0 p.Cys1490Tyr / p.Arg2030Gln 11 31 34 46 0.18/0.3 0.6/0.7 ND 12 17 35 47 1.0/1.0 1.0/1.0 p.Asn96His 13 23 35 45 1.0/0.3 1.0/0.48 p.Gly1513Profs*1554 14 33 37 48 0.18/1.48 1.0/1.3 ND 15 38 40 51 0.18/0.78 1.0/1.0 p.Arg2107His 16 42 43 53 0.0/0.0 1.0/1.0 ND 17 22 48 59 1.0/1.0 1.0/1.0 p.Cys54Tyr 18 20 49 59 1.0/0.6 1.0/1.0 p.Pro1380Leu / p.Gly1961Glu 19 35 50 61 1.0/0.3 1.0/1.0 p.Arg1108Cys 20 25 56 67 1.3/0.18 1.0/1.0 p.Trp439* / p.Gly863Ala 21 48 59 71 1.0/0.78 1.0/1.0 p. Ile156 Val / p. Cys1455Arg / p. Phe1839Ser 22 21 22 31 0.3/1.0 1.0/1.0 p.Arg2107His 23 21 23 33 1.0/1.0 1.0/1.0 p.Gly863Ala 24 48 64 73 0.0/1.0 0.18/3.0 p.Tyr1652* 25 17 19 29 0.78/0.3 1.0/1.0 c.5461-10 T>C 26 17 21 33 1.0/0.78 1.0/1.0 ND 27 27 53 66 1.78/1.78 1.3/1.0 p.Ser1071Cysfs*1084 28 5 14 21 0.78/0.78 1.0/1.0 p.Arg408* / p.Val675lle 29 9 15 27 1.08/1.08 1.0/1.0 p.Cys2150Tyr 30 14 24 32 1.0/0.78 1.0/1.0 ND 31 18 28 39 1.0/1.0 1.0/1.0 p.Gly863Ala / p.Arg1108Cys / p.Arg943Gln 32 14 29 37 1.0/1.0 1.0/1.0 p.Arg653Cys / p.Arg2030Gln 33 19 29 40 1.0/1.0 1.0/1.08 ND 34 34 40 49 0.3/0.48 1.0/1.0 p.Gly863Ala / p.Glu1087Lys 35 25 43 54 1.0/1.0 1.0/1.0 p.Cys54Tyr / p.Gly863Ala 36 38 60 69 1.0/1.0 1.3/1.08 p.Val931Met / c.5461-10 T>C 37 10 11 20 1.0/0.78 1.3/1.3 p.Pro1380Leu 38 10 15 23 1.0/1.0 1.3/1.3 p.Ser1071Cysfs*1084 / p.Pro1380Leu 39 24 25 38 1.56/0.3 2.0/2.0 c.5461-10 T>C / c.5714&#fe;5 G>A 40 18 26 36 1.3/1.3 2.0/1.3 ND 41 32 33 45 0.48/0.48 1.0/1.0 ND 42 32 35 46 1.3/0.0 3.0/1.0 p.Cys54Tyr 43 30 35 45 0.48/0.48 2.0/1.3 ND 44 15 41 49 1.3/1.3 2.0/1.3 p.Asn965Ser 45 8 8 20 0.78/0.78 1.0/1.0 p.Thr1019Met 46 10 11 23 1.0/1.0 1.0/1.0 p.Thr1019Met 47 8 12 24 2.0/1.56 1.78/1.48 p.Cys2150Tyr 48 17 18 26 1.0/0.78 1.3/1.0 c.5461-10 T>C / p.Leu2027Phe 49 8 21 33 1.3/1.3 2.0/2.0 p.Asp574Aspfs*582 50 8 27 39 2.0/1.56 1.78/1.48 c.5461-10 T>C 51 24 31 43 1.18/1.18 1.08/1.3 p.Arg1640Trp / p.Leu2027Phe Continued on next page respective electrophysiologic traces appear in Figure 2. Login to comment

[hide] Clinical and molecular analysis of Stargardt disea... Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003. Fujinami K, Sergouniotis PI, Davidson AE, Wright G, Chana RK, Tsunoda K, Tsubota K, Egan CA, Robson AG, Moore AT, Holder GE, Michaelides M, Webster AR
Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function.
Am J Ophthalmol. 2013 Sep;156(3):487-501.e1. doi: 10.1016/j.ajo.2013.05.003., [PMID:23953153]

Abstract [show]
PURPOSE: To describe a cohort of patients with Stargardt disease who show a foveal-sparing phenotype. DESIGN: Retrospective case series. METHODS: The foveal-sparing phenotype was defined as foveal preservation on autofluorescence imaging, despite a retinopathy otherwise consistent with Stargardt disease. Forty such individuals were ascertained and a full ophthalmic examination was undertaken. Following mutation screening of ABCA4, the molecular findings were compared with those of patients with Stargardt disease but no foveal sparing. RESULTS: The median age of onset and age at examination of 40 patients with the foveal-sparing phenotype were 43.5 and 46.5 years. The median logMAR visual acuity was 0.18. Twenty-two patients (22/40, 55%) had patchy parafoveal atrophy and flecks; 8 (20%) had numerous flecks at the posterior pole without atrophy; 7 (17.5%) had mottled retinal pigment epithelial changes; 2 (5%) had multiple atrophic lesions, extending beyond the arcades; and 1 (2.5%) had a bull's-eye appearance. The median central foveal thickness assessed with spectral-domain optical coherence tomographic images was 183.0 mum (n = 33), with outer retinal tubulation observed in 15 (45%). Twenty-two of 33 subjects (67%) had electrophysiological evidence of macular dysfunction without generalized retinal dysfunction. Disease-causing variants were found in 31 patients (31/40, 78%). There was a higher prevalence of the variant p.Arg2030Gln in the cohort with foveal sparing compared to the group with foveal atrophy (6.45% vs 1.07%). CONCLUSIONS: The distinct clinical and molecular characteristics of patients with the foveal-sparing phenotype are described. The presence of 2 distinct phenotypes of Stargardt disease (foveal sparing and foveal atrophy) suggests that there may be more than 1 disease mechanism in ABCA4 retinopathy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
141 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency 2 c.71G>A, p.Arg24His 1 0.36% 2 c.161G>A, p.Cys54Tyr 3 1.07% 3 c.223T>G, p.Cys75Gly 1 0.36% 5 c.455G>A, p.Arg152Gln 1 0.36% 5 c.454C>T, p.Arg152* 1 0.36% 5 c.466 A>G, p.Ile156Val 2 0.71% 6 c.634C>T, p. Arg212Cys 3 1.07% 6 c.656G>C, p.Arg219Thr 1 0.36% 6 c.666_678delAAAGACGGTGCGC, p.Lys223_Arg226delfs 2 0.71% 6 c.768G>T, Splicing site 4 1.42% 8 c.1037A>C, p.Lys346Thr 1 0.36% 10 c.1222C>T, p.Arg408* 3 1.07% 12 c.1622T>C, p.Leu541Pro 2 0.71% 12 c.1648 G>T, p.Gly550* 1 0.36% 13 c.1804C>T, p.Arg602Trp 1 0.36% 13 c.1817G>A, p.Gly606Asp 1 0.36% 13 c.1922G>C, p.Cys641Ser 1 0.36% Int 13 c.1937&#fe;1G>A, Splicing site 2 0.71% 14 c.1957C>T, p.Arg653Cys 2 0.71% 17 c.2588G>C, p.Gly863Ala 19 6.79% 18 c.2701A>G, p.Thr901Ala 1 0.36% 19 c.2791G>A, p.Val931Met 2 0.71% 19 c.2894A>G, p.Asn965Ser 1 0.36% 20 c.2966T>C, p.Vla989Ala 3 1.07% 20 c.2971G>C, p.Gly991Arg 2 0.71% 21 c.3056C>T, p.Thr1019Met 1 0.36% 21 c.3113C>T, p.Ala1038Val 3 1.07% 21 c.3064G>A, p.Glu1022Lys 2 0.71% 22 c.3211_3212insGT, p.Ser1071Cysfs 6 2.14% 22 c.3259G>A, p.Glu1087Lys 4 1.43% 22 c.3292C>T, p.Arg1098Cys 1 0.36% 22 c.3322C>T, p.Arg1108Cys 5 1.79% 22 c.3323G>A, p.Arg1108His 1 0.36% 23 c.3364G>A, p.Glu1122Lys 1 0.36% 23 c.3386G>A, p.Arg1129His 1 0.36% 24 c.3602T>G, p.Leu1201Arg 3 1.07% 27 c.3898C>T, p.Arg1300* 2 0.71% 28 c.4139C>T, p.Pro1380Leu 14 5.00% 28 c.4222T>C, p.Trp1408Arg 1 0.36% 28 c.4234C>T, p.Gly1412* 1 0.36% 28 c.4253&#fe;5G>T, Splice site 1 0.36% 28 c.4253&#fe;4C>T, Splice site 1 0.36% 29 c.4283C>T, p.Thr1428Met 1 0.36% 29 c.4319T>C, p.Phe1440Ser 1 0.36% 29 c.4462T>C, p.Cys1488Arg 1 0.36% 30 c.4469G>A, p.Cys1490Tyr 5 1.79% 30 c.4537_4538insC, p.Gly1513Profs 1 0.36% 31 c.4577C>T, p.Thr1526Met 2 0.71% 33 c.4715C>T, p.Thr1572Met 1 0.36% Continued on next page TABLE 3. Login to comment

[hide] ABCA4 gene screening by next-generation sequencing... Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570. Fujinami K, Zernant J, Chana RK, Wright GA, Tsunoda K, Ozawa Y, Tsubota K, Webster AR, Moore AT, Allikmets R, Michaelides M
ABCA4 gene screening by next-generation sequencing in a British cohort.
Invest Ophthalmol Vis Sci. 2013 Oct 11;54(10):6662-74. doi: 10.1167/iovs.13-12570., [PMID:23982839]

Abstract [show]
PURPOSE: We applied a recently reported next-generation sequencing (NGS) strategy for screening the ABCA4 gene in a British cohort with ABCA4-associated disease and report novel mutations. METHODS: We identified 79 patients with a clinical diagnosis of ABCA4-associated disease who had a single variant identified by the ABCA4 microarray. Comprehensive phenotypic data were obtained, and the NGS strategy was applied to identify the second allele by means of sequencing the entire coding region and adjacent intronic sequences of the ABCA4 gene. Identified variants were confirmed by Sanger sequencing and assessed for pathogenicity by in silico analysis. RESULTS: Of the 42 variants detected by prescreening with the microarray, in silico analysis suggested that 34, found in 66 subjects, were disease-causing and 8, found in 13 subjects, were benign variants. We detected 42 variants by NGS, of which 39 were classified as disease-causing. Of these 39 variants, 31 were novel, including 16 missense, 7 splice-site-altering, 4 nonsense, 1 in-frame deletion, and 3 frameshift variants. Two or more disease-causing variants were confirmed in 37 (47%) of 79 patients, one disease-causing variant in 36 (46%) subjects, and no disease-causing variant in 6 (7%) individuals. CONCLUSIONS: Application of the NGS platform for ABCA4 screening enabled detection of the second disease-associated allele in approximately half of the patients in a British cohort where one mutation had been detected with the arrayed primer extension (APEX) array. The time- and cost-efficient NGS strategy is useful in screening large cohorts, which will be increasingly valuable with the advent of ABCA4-directed therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 1 c.161G>A p.C54Y DC c.2297G>T p.G766V DC 2 2 c.223T>G p.C75G DC c.5088C>G p.S1696R DC 2 3 c.740A>C p.N247T DC c.1433T>C p.I478T B c.2345G>A p.W782* DC 2 4 c.768G>T Splice site DC 1 5 c.1222C>T p.R408* DC c.2568C>A p.Y856* DC 2 6 c.1804C>T p.R602W DC c.859-9T>C Splice site PDC 2 7 c.1805G>A p.R602Q DC c.5113C>T p.R1705W DC 2 8 c.1922G>C p.C641S DC 1 9 c.1957C>T p.R653C DC 1 10 c.1957C>T p.R653C DC 1 11 c.2588G>C p.G863A DC c.655A>T p.R219* DC 2 Allele 2 (p.R219*) was APEX-false-negative 12 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 13 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 14 c.2588G>C p.G863A DC 1 15 c.2588G>C p.G863A DC 1 16 c.2894A>G p.N965S DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 17 c.3064G>A p.E1022K DC c.6729&#fe;4_&#fe;18delAGTTGGCCCTGGGGC Splice site DC 2 18 c.3064G>A p.E1022K DC 1 19 c.3208_3209insGT p.S1071fs DC c.2942C>T p.P981L DC c.6529G>A p.D2177N B 2 20 c.3208_3209insGT p.S1071fs DC c.1519G>T p.D507Y DC 2 21 c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 2 22 c.3208_3209insGT p.S1071fs DC 1 23 c.3292C>T p.R1098C DC c.3299T>A p.I1100N DC 2 24 c.3322C>T p.R1108C DC c.4978delC p.L1661* DC 2 25 c.3386G>A p.R1129H DC c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 3 Allele 2 (p.S1071fs) was APEX false-negative and allele 1 (p.R1129H) was NGS false-negative 26 c.4139C>T p.P1380L DC c.3191-1G>T Splice site DC 2 27 c.4139C>T p.P1380L DC c.3398T>C p.I1133T PDC 2 28 c.4139C>T p.P1380L DC c.4070C>A p.A1357E DC 2 29 c.4139C>T p.P1380L DC c.4773G>C Splice site DC 2 30 c.4139C>T p.P1380L DC 1 31 c.4139C>T p.P1380L DC 1 32 c.4139C>T p.P1380L DC 1 33 c.4234C>T p.Q1412* DC 1 34 c.4319T>C p.F1440S DC 1 35 c.4328G>A p.R1443H DC c.180delG p.M61fs DC 2 36 c.4469G>A p.C1490Y DC c.1726G>C p.D576H DC 2 37 c.4469G>A p.C1490Y DC 1 38 c.4537_4538insC p.Q1513fs DC c.5578C>T p.R1860W DC 2 Allele 1 (p.Q1513fs) was NGS-false-negative 39 c.4577C>T p.T1526M DC 1 T ABLE 2. Continued Pt Allele 1 Detected by APEX Allele 2 Detected by NGS Allele 3 Detected by NGS Total N of DC Variants Comments DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. Login to comment
62 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 3 c.161G>A p.C54Y 1 1 [ [ Lewis RA, et al. 11 Tol. 0.11 PRD 0.994 No change 1/13006 db SNP (rs150774447) 3 c.223T>G p.C75G 1 2 [ [ Lewis RA, et al. 11 Del. NA POD 0.603 No change ND 5 c.466A>G p.I156V 2 77, 78 [ [ Papaioannou M, et al. 16 Tol. 0.46 B 0.003 No change 16/13006 db SNP (rs112467008) Benign 6 c.655A>T p.R219* 1 11 [ Xi Q, et al. 27 ND 6 c.740A>C p.N247T 1 3 [ [ APEX Del. NA B 0.135 No change ND 6 c.768G>T Splice site 1 4 [ [ Klevering BJ, et al. 22 Tol. 0.56 NA Don. 70.4 58 Site broken (17.51) ND 9 c.1222C>T p.R408* 1 5 [ [ Webster AR, et al. 7 ND 12 c.1726G>C p.D576H 1 36 [ Downs K, et al. 25 POD 0.688 Acc. 68.1 39.1 Site broken (42.54) 1/13006 13 c.1804C>T p.R602W 1 6 [ [ Lewis RA, et al. 11 Del. 0.00 B 0.129 No change ND db SNP (rs 6179409) 13 c.1805G>A p.R602Q 1 7 [ [ Webster AR, et al. 7 Del. 0.04 PRD 0.513 Acc. 48.9 77.9 New site (&#fe;59.14) 2/13006 db SNP (rs61749410) 13 c.1906C>T p.Q636* 3 12, 13, 60 [ Zernant J, et al. 5 No change 1/13006 db SNP (rs145961131) 13 c.1922G>C p.C641S 1 8 [ [ Stenirri S, et al. 24 Del. 0.00 No change ND db SNP (rs61749416) 14 c.1957C>T p.R653C 2 9, 10 [ [ Rivera A, et al. 17 Del. 0.00 PRD 0.999 No change ND db SNP (rs61749420) 17 c.2588G>C p.G863A/ p.DelG863 5 11, 12, 13, 14, 15 [ [ Lewis RA, et al. 11 / Maugeri A, et al. 29 Del. 0.00 PRD 0.996 No change 68/13006 db SNP (rs76157638) 18 c.2701A>G p.T901A 1 74 [ [ APEX Tol. 0.82 B 0.008 23/13006 db SNP (rs139655975) Benign 19 c.2894A>G p.N965S 1 16 [ [ Lewis RA, et al. 11 Del. 0.03 PRD 0.981 Acc. 53.4 82.3 New site (&#fe;54.26) ND db SNP (rs201471607) 20 c.2971G>C p.G991R 1 67 [ [ Yatsenko AN, et al. 13 Del. 0.02 PRD 0.999 No change 28/13006 db SNP (rs147484266) Benign 22 c.3064G>A p.E1022K 2 17, 18 [ [ Webster AR, et al. 7 Del. 0.00 PRD 1.000 No change ND db SNP (rs61749459) 22 c.3208_3209insGT p.S1071fs 5 19, 20, 21, 22, 25 [ [ APEX ND False-negative in APEX in patient 25 22 c.3292C>T p.R1098C 1 23 [ [ Rivera A, et al. 17 Del. NA PRD 0.999 No change ND 22 c.3322C>T p.R1108C 3 16, 24, 61 [ [ Rozet JM, et al. 10 Del. 0.00 PRD 0.986 No change 1/13006 db SNP (rs61750120) False-negative in APEX in patients 16 and 61 23 c.3386G>A p.R1129H 1 25 [ Zernant J, et al. 5 PRD 0.989 No change ND False-negative in NGS in patient 25 24 c.3602T>G p.L1201R 4 72, 73, 74, 79 [ [ Lewis RA, et al. 11 Tol. 0.37 B 0.052 Don. 61.3 73.7 New site (20.08) 416/13006 db SNP (rs61750126) Benign 28 c.4139C>T p.P1380L 7 30, 31, 32, 33, 34, 35, 36 [ [ Lewis RA, et al. 11 Del. 0.01 B 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4234C>T p.Q1412* 1 33 [ [ Rivera A, et al. 17 ND db SNP (rs61750137) 29 c.4283C>T p.T1428M 1 76 [ [ APEX Tol. 0.15 B 0.010 No change 2/13006 db SNP (rs1800549) Benign 29 c.4319T>C p.F1440S 1 34 [ [ Lewis RA, et al. 11 Del. 0.00 POD 0.744 No change ND dbSNP (rs61750141) 29 c.4326C>A p.N1442K 1 64 [ Zernant J, et al. 5 Tol. NA POD 0.374 No change ND 29 c.4328G>A p.R1443H 1 35 [ [ Rivera A, et al. 17 Del. 0.02 PRD 0.999 No change 1/13006 dbSNP (rs61750142) IVS29 c.4352&#fe;1G>A Splice site 1 73 [ Zernant J, et al. 5 Don. 82.3 55.4 WT site broken (32.62) ND 30 c.4469G>A p.C1490Y 2 36, 37 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.994 No change ND dbSNP (rs61751402) 30 c.4538A>G p.Q1513R 1 67 [ Webster AR, et al. 7 Tol. NA Benign 0.043 Acc. 91.7 62.8 Site broken (31.55) ND T ABLE 3. Continued Exon/ IVS Nucleotide Substitution Protein Change/ Effect N of Alleles Identified Pt Method Previous Report SIFT Polyphen 2 HSF Matrix Allele Freq. by EVS Reference Comment APEX NGS Pred. Tol. Index (0-1) Pred. Login to comment

[hide] Identification of three ABCA4 sequence variations ... Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4. Utz VM, Chappelow AV, Marino MJ, Beight CD, Sturgill-Short GM, Pauer GJ, Crowe S, Hagstrom SA, Traboulsi EI
Identification of three ABCA4 sequence variations exclusive to African American patients in a cohort of patients with Stargardt disease.
Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4., [PMID:24011517]

Abstract [show]
PURPOSE: To describe the clinical and molecular findings in ten unrelated African American patients with Stargardt disease. DESIGN: Retrospective, observational case series. METHODS: We reviewed the clinical histories, examinations, and genotypes of 85 patients with molecular diagnoses of Stargardt disease. Three ABCA4 sequence variations identified exclusively in African Americans were evaluated in 300 African American controls and by in silico analysis. RESULTS: ABCA4 sequence changes were identified in 85 patients from 80 families, of which 11 patients identified themselves as African American. Of these 11 patients, 10 unrelated patients shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). The minor allele frequencies in the African American control population for each variation were 7.5%, 6.3%, and 2%, respectively. This is comparable to the allele frequency in African Americans in the Exome Variant Server. In contrast, the allele frequency of all three of these variations was less than or equal to 0.05% in European Americans. Although both c.3602T>G and c.3899G>A have been reported as likely disease-causing variations, one of our control patients was homozygous for each variant, suggesting that these are nonpathogenic. In contrast, the absence of c.6320G>A in the control population in the homozygous state, combined with the results of bioinformatics analysis, support its pathogenicity. CONCLUSIONS: Three ABCA4 sequence variations were identified exclusively in 10 unrelated African American patients: p.L1201R and p.R1300Q likely represent nonpathogenic sequence variants, whereas the p.R2107H substitution appears to be pathogenic. Characterization of population-specific disease alleles may have important implications for the development of genetic screening algorithms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 Population-Specific ABCA4 Alleles in Patients with Stargardt Disease References Population Allele Protein Rivera et al.28 Hargitai et al.12 Hungaro-German c.1622T>C/c.3113C>T p.L541P/p.A1038V September et al.47 Afrikaner c.4469G>A p.C1490Y September et al.47 Afrikaner c.1804C>T p.R602W Rosenberg et al.48 Danish c.2894A>G p.N965S Maugeri et al.27 Western European c.2588G>C p.G863A Maia-Lopes et al.49 Portuguese c.32T>C p.L11P Valverde et al.29 Spanish c.5882G>A p.R1129L Fumagalli et al.50 Italian c.2099G>A p.W700X VOL. 156, NO. 6 ALL AUTHORS HAVE COMPLETED AND SUBMITTED THE ICMJE FORM FOR DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST, and the following were reported. Login to comment

[hide] Association between genotype and phenotype in fami... Mol Vis. 2014 Jan 7;20:89-104. eCollection 2014. Kjellstrom U
Association between genotype and phenotype in families with mutations in the ABCA4 gene.
Mol Vis. 2014 Jan 7;20:89-104. eCollection 2014., [PMID:24453473]

Abstract [show]
PURPOSE: To investigate the genotype and phenotype in families with adenosine triphosphate-binding cassette, sub-family A, member 4 (ABCA4)-associated retinal degeneration. METHODS: Three families with at least one family member with known homozygous or compound heterozygote mutations in the ABCA4 gene were studied. The investigations included full field electroretinography (ff-ERG), multifocal ERG (mERG), Goldmann visual fields, optical coherence tomography (OCT), and standard ophthalmological examination. Microarray (Asper) was used for ABCA4 genotyping. RESULTS: In family 1, the proband (age 23) was homozygote for the c768 G>T mutation. She was diagnosed with cone rod dystrophy (CRD) while her aunt (age 69) was compound heterozygote for the c768 G>T and c2894 A>G mutations and had autosomal recessive retinitis pigmentosa (arRP). The father (age 61) and the mother (age 60) of the proband were asymptomatic carriers of the c768 G>T mutation. In family 2, the proband (age 25) was homozygote for the c5917del. She was diagnosed with CRD. Her father and two sisters were compound heterozygote for the c5917del and c5882 G>A mutations. The eldest sister (age 23) suffered from Stargardt disease (STGD) while the youngest sister (age 12) and their father (age 48) had no visual complaints. Anyhow, their ERG measurements indicated changes corresponding to STGD. The mother (age 42), (heterozygote for the c5917 delG mutation) and the youngest child (age 9; heterozygote for the c5882 G>A mutation) had a normal phenotype. In family 3, the proband (age 43) was compound heterozygote for c768 G>T and c3113 C>T and had been diagnosed with STGD. Her son (age 12), who was homozygote for the c768 G>T mutation, had wider scotomas with earlier onset (age 6), ff-ERG cone responses in the lower range of normality, and reduced mERG. At the moment, he is classified as having STGD but may progress to CRD. The father (age 45) was asymptomatic and heterozygote for the c768 G>T mutation. The patients with progressive disorders (CRD or arRP) had prolonged implicit times for the 30 Hz flicker ff-ERG and the mERG. All patients with two mutations in the ABCA4 gene demonstrated attenuation of retinal thickness on the OCT macular map. CONCLUSIONS: This study confirms that ABCA4 mutations lead to a spectrum of retinal degenerations ranging from STGD to CRD or arRP. At the time of diagnosis, it is not possible to predict the severity of the condition only from genotyping. Our results suggest that prolongation of implicit times for the ff-ERG and/or mERG seem to be associated with progressive conditions such as CRD and arRP. Since ABCA4 mutations are common in the general population, different family members can harbor various combinations of mutations resulting in diverse phenotype and prognosis in the same family, further emphasizing the importance of a combination of genetic and electrophysiological tests at the first visit and follow-up.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
96 Subject ABCA4 allele 1 ABCA4 allele 2 Phenotype* Nucleotide change Effect Nucleotide change Effect 1 Ia c768 G>T V256V/splice c2894 A>G N965S/missense arRP 1 Ib c768 G>T V256V/splice ৄ ৄ NVP 1 Ic c768 G>T V256V/splice ৄ ৄ NVP 1 IIa c768 G>T V256V/splice c768 G>T V256V/splice CRD 2 Ia c5917 delG V1973X/frameshift ৄ ৄ NVP 2 Ib c5917 delG V1973X/frameshift c5882 G>A G1961E/missense STGD 2 IIa c5917 delG V1973X/frameshift c5917 delG V1973X/frameshift CRD 2 IIb c5917 delG V1973X/frameshift c5882 G>A G1961E/missense STGD 2 IIc c5917 delG V1973X/frameshift c5882 G>A G1961E/missense STGD 2 II d c5882 G>A G1961E/missense ৄ ৄ NVP 3 Ia c768 G>T V256V/splice c3113 C>T A1038V/missense STGD 3 Ib c768 G>T V256V/splice ৄ ৄ NVP 3 IIa c768 G>T V256V/splice c768 G>T V256V/splice STGD Abbreviations: arRP; autosomal recessive retinitis pigmentosa, CRD; cone rod dystrophy, STGD; Stargardt disease, NVP; no visual problems *clinical presentation at last visit T able 3. Login to comment

[hide] Inner and outer retinal changes in retinal degener... Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768. Huang WC, Cideciyan AV, Roman AJ, Sumaroka A, Sheplock R, Schwartz SB, Stone EM, Jacobson SG
Inner and outer retinal changes in retinal degenerations associated with ABCA4 mutations.
Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768., [PMID:24550365]

Abstract [show]
PURPOSE: To investigate in vivo inner and outer retinal microstructure and effects of structural abnormalities on visual function in patients with retinal degeneration caused by ABCA4 mutations (ABCA4-RD). METHODS: Patients with ABCA4-RD (n = 45; age range, 9-71 years) were studied by spectral-domain optical coherence tomography (OCT) scans extending from the fovea to 30 degrees eccentricity along horizontal and vertical meridians. Thicknesses of outer and inner retinal laminae were analyzed. Serial OCT measurements available over a mean period of 4 years (range, 2-8 years) allowed examination of the progression of outer and inner retinal changes. A subset of patients had dark-adapted chromatic static threshold perimetry. RESULTS: There was a spectrum of photoreceptor layer thickness changes from localized central retinal abnormalities to extensive thinning across central and near midperipheral retina. The inner retina also showed changes. There was thickening of the inner nuclear layer (INL) that was mainly associated with regions of photoreceptor loss. Serial data documented only limited change in some patients while others showed an increase in outer nuclear layer (ONL) thinning accompanied by increased INL thickening in some regions imaged. Visual function in regions both with and without INL thickening was describable with a previously defined model based on photoreceptor quantum catch. CONCLUSIONS: Inner retinal laminar abnormalities, as in other human photoreceptor diseases, can be a feature of ABCA4-RD. These changes are likely due to the retinal remodeling that accompanies photoreceptor loss. Rod photoreceptor-mediated visual loss in retinal regionswith inner laminopathy at the stages studied did not exceed the prediction from photoreceptor loss alone.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Characteristics of the ABCA4-Related Retinal Disease Patients Patient Age at Visits, y Sex Allele 1 Allele 2 Previous Report*ߤ P1 9, 12 M E341G F608I P2 9, 15 M R681X C2150Y P28* P3ߥ 12 M N965S W821R P1ߤ P4 13, 16 M V256V T1526M P21*, P15ߤ P5 14, 20 F W1408R IVS40&#fe;5 G>A P49* P6ߥ 16 F V989A IVS28&#fe;5 G>T P17ߤ P7ߥ 16 M N965S W821R P18ߤ P8 18, 20 F Y362X IVS38-10 T>C P9ߥ 18 F V989A IVS28&#fe;5 G>T P10 18, 22 M G1961E R1129L P3ߤ P11 20 M R1640Q c.5174_5175insG P12ߥ 20 M G1961E G1961E/P68L P13 22, 25 M G863A IVS35&#fe;2 T>C P20ߤ P14 22, 24 F G1961E R152X P12*, P21ߤ P15ߥ 23 M G1961E G1961E/P68L P16 25, 27 M G1961E R152X P11* P17 26, 32 F L1940P R1129L P64* P18 27, 34 F R1925G A1038V/L541P P19 27, 29 M c.4530_4531insC R1705Q P52*, P5ߤ P20 28, 30 F G1961E A1038V/L541P P23ߤ P21 31, 35 M T1019M G1961E P34* P22ߥ 32, 37 M P1486L Deletion of exon 7 P25ߤ P23 33, 35 M G863A R1108C P29*, P6ߤ P24 34, 37 F IVS40&#fe;5 G>A V935A P32*, P7ߤ P25 34 M G1961E &#a7; P8ߤ P26 37, 43 F C54Y G863A P4* P27 39, 44 F G863A C1490Y P30*, P26ߤ P28 40 M G1961E C54Y P7*, P10ߤ P29 41 F IVS38-10 T>C E1087D P59* P30ߥ 43, 47 F G1961E V256V P23*, P11ߤ P31ߥ 47, 51 F P1486L Deletion of exon 7 P32 47 M Y245X Y245X P20* P33ߥ 48, 51 F G1961E V256V P22*, P12ߤ P34 48, 50 F c.3208_3209insTG IVS40&#fe;5 G>A P35 50, 54 M V1433I L2027F P50* P36ߥ 52, 55 F T1526M R2030Q P55*, P28ߤ P37 53, 59 F G1961E P1380L P47*, P13ߤ P38ߥ 53, 61 M L1940P IVS40&#fe;5 G>A P61* P39 58 M D600E R18W P2*, P14ߤ P40 59, 62 M E1122K G1961E P44* P41 59, 62 F R1640Q G1961E P58* P42ߥ 62 F T1526M R2030Q P54* P43ߥ 64, 68 M L1940P IVS40&#fe;5 G>A P62* P44 68 F R1108C IVS40&#fe;5 G>A P42* P45 71 F IVS38-10 T>C &#a7; Novel variants are bold and italicized. Login to comment

[hide] Generalized choriocapillaris dystrophy, a distinct... Invest Ophthalmol Vis Sci. 2014 Apr 29;55(4):2766-76. doi: 10.1167/iovs.13-13391. Bertelsen M, Zernant J, Larsen M, Duno M, Allikmets R, Rosenberg T
Generalized choriocapillaris dystrophy, a distinct phenotype in the spectrum of ABCA4-associated retinopathies.
Invest Ophthalmol Vis Sci. 2014 Apr 29;55(4):2766-76. doi: 10.1167/iovs.13-13391., [PMID:24713488]

Abstract [show]
PURPOSE: We describe a particular form of autosomal recessive generalized choriocapillaris dystrophy phenotype associated with ABCA4 mutations. METHODS: A cohort of 30 patients with identified ABCA4 mutations and a distinct phenotype was studied. A retrospective review of history, fundus photographs, electroretinography, visual field testing, dark adaptometry, and optical coherence tomography was performed. Genetic analyses were performed by ABCA4 microarray analysis, high resolution melting, and/or next generation sequencing of all protein-coding sequences of the ABCA4 gene. RESULTS: The earliest recorded manifestation of ABCA4-associated disease was a central bull's eye type of macular dystrophy that progressed to chorioretinal atrophy of the macula with coarse rounded hyperpigmentations and expanding involvement of the periphery. The mean age at first presentation was 10.3 years, the longest follow-up was 61 years. All patients had two ABCA4 mutations identified, confirming the molecular genetic diagnosis of an ABCA4-associated disease. Most patients harbored at least one mutation classified as "severe," the most common of which was the p.N965S variant that had been found previously at a high frequency among patients with ABCA4-associated retinal dystrophies in Denmark. CONCLUSIONS: Generalized choriocapillaris dystrophy is a progressive ABCA4-associated phenotype characterized by early-onset macular dystrophy that disperses and expands to widespread end-stage chorioretinal atrophy with profound visual loss. All cases in this study were confirmed as harboring two ABCA4 mutations. Most of the ABCA4 mutations were classified as "severe" explaining the early onset, panretinal degeneration, and fast progression of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 Most patients harbored at least one mutation classified as ''severe,`` the most common of which was the p.N965S variant that had been found previously at a high frequency among patients with ABCA4-associated retinal dystrophies in Denmark. Login to comment
82 The most frequent mutations in the cohort were the p.N965S Danish founder TABLE 1. Login to comment
114 Two ABCA4 mutations were detected in patient D109 from generation III; a common Danish missense mutation p.N965S and a nonsense mutation p.Q1412*. Login to comment
123 Summary of Detected Potential Pathogenic Variants (Known and Novel [in Bold Face]) Found in the ABCA4 Gene of Patients With Generalized Choriocapillaris Dystrophy Patient Method Mutation 1 Mutation 2 Nucleotide Protein Nucleotide Protein D513 NGS c.203C>T p.P68L c.2894A>G p.N965S D514 Microarray, NGS c.2894A>G p.N965S c.5461-10T>C - D516 NGS c.4926C>G p.S1642R c.5041_5055del p.V1681_C1685del D517 NGS c.5169C>G p.Y1723* c.6079C>T p.L2027F D137 Microarray, NGS c.2894A>G p.N965S c.2894A>G p.N965S D801 Microarray, NGS c.6386&#fe;1G>A Aberrant splicing c.4234C>T p.Q1412* D109 Microarray c.2894A>G p.N965S c.4234C>T p.Q1412* D040 Microarray c.6229C>T p.R2077W c.6229C>T p.R2077W D159 Microarray c.3113C>T p.L541P/A1038V c.3113C>T p.L541P/A1038V D129 Microarray c.2894A>G p.N965S c.3322C>T p.R1108C D115 Microarray c.2894A>G p.N965S c.3113C>T p.L541P/A1038V D033 Microarray c.2894A>G p.N965S c.2041C>T p.R681* D023 Microarray c.203C>T p.P68L c.3329-2A>G Aberrant splicing D001 Microarray c.666_678del p.K223_R226delfs c.4667&#fe;2T>C Aberrant splicing D147 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D162 Microarray c.3329-2A>G Aberrant splicing c.6089G>A p.R2030Q D022 Microarray, HRM c.4462T>C p.C1488R c.4102C>T p.R1368C D112 Microarray, HRM c.2894A>G p.N965S c.1529T>G p.L510R D108 Microarray, HRM c.1648G>A p.G550R c.4102C>T p.R1368C D107 Microarray c.666_678del p.K223_R226delfs c.2588G>C p.G863A D070 Microarray c.2588G>C p.G863A c.2588G>C p.G863A D116 Microarray c.2300T>A p.V767D c.5461-10T>C - D135 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D117 Microarray, HRM c.3191-2A>G Aberrant splicing c.2408delG p.G803fs D186 Microarray, HRM c.3322C>T p.R1108C c.6386&#fe;1G>A Aberrant splicing D173 Microarray, HRM c.4469G>A p.C1490Y c.2915C>A p.T972N TABLE 3. Login to comment
124 In Silico Analysis of ABCA4 Variants Detected in This Study Using Alamut 2.2 Software cDNA Variant Protein Variant Effect on Protein Function AGVGD Class SIFT Prediction Effect on Protein PPH2 Prediction Effect on Protein TASTER Prediction Effect on Splicing Missense variants c.203C>T p.P68L C65 Deleterious Probably damaging Disease causing c.1529T>G p.L510R C65 Deleterious Benign Polymorphism c.1622T>C p.L541P Reduced ATP binding mislocali- zation26,27 C65 Deleterious Probably damaging Disease causing c.1648G>A p.G550R C65 Deleterious Possibly damaging Disease causing New acceptor site c.2300T>A p.V767D Reduced protein28 C65 Deleterious Benign Disease causing c.2588G>C p.G863A Reduced protein level, reduced ATP binding, reduced ATPase activity26 C55 Deleterious Possibly damaging Disease causing Predicted change at acceptor site 1 bp upstream: 11.1%, creating a new stronger acceptor 3 bp downstream c.2894A>G p.N965S Reduced ATP binding26 C45 Deleterious Probably damaging Disease causing New acceptor site c.2915C>A p.T972N C55 Deleterious Probably damaging Disease causing c.3113C>T p.A1038V Reduced ATP binding, reduced ATP hydrolysis26 C65 Deleterious Benign Disease causing c.3322C>T p.R1108C Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing c.4102C>T p.R1368C C65 Deleterious Probably damaging Disease causing c.4462T>C p.C1488R C65 Deleterious Possibly damaging Disease causing c.4469G>A p.C1490Y Misfolding, mislocali- zation27 C65 Deleterious Probably damaging Disease causing Cryptic donor strongly activated c.4926C>G p.S1642R C25 Deleterious Benign Disease causing c.6079C>T p.L2027F Reduced ATP binding26,29 C15 Deleterious Probably damaging Disease causing c.6089G>A p.R2030Q C35 Deleterious Probably damaging Disease causing c.6229C>T p.R2077W Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing Deletion/frame-shift/stop variants c.666_678del p.K223_ R226delfs c.2041C>T p.R681* c.2408delG p.G803fs c.4234C>T p.Q1412* c.5041_5055del p.V1681_ C1685del c.5169C>G p.Y1723* Splicing affecting variants c.3191-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.3329-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.4667&#fe;2T>C Predicted change at donor site 2 bps upstream: 100% generalized choriocapillaris dystrophy have the occasional hallmarks of early Stargardt disease, such as vermillion fundus, fundus hyperautofluorescence, and a dark choroid on fluorescein angiograms. Login to comment
127 The Danish p.N965S founder mutation was among the most frequent mutations found in our patients, and this mutation is believed to lead to moderate-to-severe retinal phenotypes, because ABCA4 protein dysfunction results in impaired ATP hydrolysis. Login to comment

[hide] Foveal sparing in Stargardt disease. Invest Ophthalmol Vis Sci. 2014 Oct 16;55(11):7467-78. doi: 10.1167/iovs.13-13825. van Huet RA, Bax NM, Westeneng-Van Haaften SC, Muhamad M, Zonneveld-Vrieling MN, Hoefsloot LH, Cremers FP, Boon CJ, Klevering BJ, Hoyng CB
Foveal sparing in Stargardt disease.
Invest Ophthalmol Vis Sci. 2014 Oct 16;55(11):7467-78. doi: 10.1167/iovs.13-13825., [PMID:25324290]

Abstract [show]
PURPOSE: To provide a clinical and genetic description of a patient cohort with Stargardt disease (STGD1) with identifiable foveal sparing. METHODS: Patients with retinal atrophy (defined as an absence of autofluorescence) that surrounded the fovea by at least 180 degrees and did not include the fovea were defined as having foveal sparing; eyes with visual acuity (VA) worse than 20/200 were excluded. We reviewed the medical files and extracted data regarding medical history, VA, ophthalmoscopy, static perimetry, fundus photography, spectral-domain optical coherence tomography (SD-OCT), fluorescein angiography (FA), fundus autofluorescence (FAF), and electroretinography (ERG). We screened each patient's ABCA4 gene for mutations. RESULTS: Seventeen eyes with foveal sparing were identified in 13 unrelated patients. In 4 eyes, the fovea gradually became atrophic after the initial foveal sparing. The mean age at onset was 51 years (range, 32-67 years). Visual acuity was 20/40 or better in all foveal sparing eyes and was 20/25 or better in 41%. Fundus autofluorescence imaging revealed hyperautofluorescent flecks and parafoveal retinal atrophy; SD-OCT revealed sharply delineated atrophy; and perimetry revealed parafoveal scotomas with intact foveal sensitivity. Finally, genetic screening identified mutations in 19 of the 26 ABCA4 gene alleles. CONCLUSIONS: Foveal sparing occurs mainly in patients with late-onset STGD1 and represents the milder end of the clinical spectrum in STGD1. The anatomy, metabolism, and biochemistry of the retina, as well as genetic variations in genes other than ABCA4, can influence the etiology of foveal sparing. Identifying these fovea-protecting factors will facilitate the future development of strategies designed to treat STGD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
302 Rosenberg T, Klie F, Garred P, Schwartz M. N965S is a common ABCA4 variant in Stargardt-related retinopathies in the Danish population. Login to comment

[hide] Identification of Genetic Defects in 33 Probands w... PLoS One. 2015 Jul 10;10(7):e0132635. doi: 10.1371/journal.pone.0132635. eCollection 2015. Xin W, Xiao X, Li S, Jia X, Guo X, Zhang Q
Identification of Genetic Defects in 33 Probands with Stargardt Disease by WES-Based Bioinformatics Gene Panel Analysis.
PLoS One. 2015 Jul 10;10(7):e0132635. doi: 10.1371/journal.pone.0132635. eCollection 2015., [PMID:26161775]

Abstract [show]
Stargardt disease (STGD) is the most common hereditary macular degeneration in juveniles, with loss of central vision occurring in the first or second decade of life. The aim of this study is to identify the genetic defects in 33 probands with Stargardt disease. Clinical data and genomic DNA were collected from 33 probands from unrelated families with STGD. Variants in coding genes were initially screened by whole exome sequencing. Candidate variants were selected from all known genes associated with hereditary retinal dystrophy and then confirmed by Sanger sequencing. Putative pathogenic variants were further validated in available family members and controls. Potential pathogenic mutations were identified in 19 of the 33 probands (57.6%). These mutations were all present in ABCA4, but not in the other four STGD-associated genes or in genes responsible for other retinal dystrophies. Of the 19 probands, ABCA4 mutations were homozygous in one proband and compound heterozygous in 18 probands, involving 28 variants (13 novel and 15 known). Analysis of normal controls and available family members in 12 of the 19 families further support the pathogenicity of these variants. Clinical manifestation of all probands met the diagnostic criteria of STGD. This study provides an overview of a genetic basis for STGD in Chinese patients. Mutations in ABCA4 are the most common cause of STGD in this cohort. Genetic defects in approximately 42.4% of STGD patients await identification in future studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Patient Nucleotide Amino Acid State Computational Prediction Allele Frequency in Reported ID Change Change P/SS Proven SIFT 1000G EVS ExAC NC RC QT058 c.6173T>G p.L2058R Het PrD D D NA NA NA 0/192 0/456 Novel c.4773 +1G>T Splicing defect Het SSA NA NA NA NA NA - 0/456 Pang et al. 2002; Riveiro-Alvarez et al. 2013 QT085 c.6173T>G p.L2058R Het PrD D D NA NA NA 0/192 0/456 Novel c.5932delA p. K1978Qfs*13 Het NA NA NA NA NA NA 0/192 0/456 Novel QT292 c.6389T>A p.M2130K Het PoD D D NA NA NA - 0/456 Yi et al. 2012 c.6118C>T p.R2040* Het NA NA NA NA NA 2/121394 0/192 0/456 Baum et al. 2003 QT302 c.6816 +1G>A Splicing defect Het SSA NA NA NA NA NA - 0/456 Robert et al. 2014 c.4555delA p.T1519Rfs*7 Het NA NA NA NA NA NA 0/192 0/456 Novel QT398 c.4352 +1G>A Splicing defect Het SSA NA NA NA NA 1/121268 - 0/456 Ernest et al. 2009 c.1804C>T p.R602W Het PoD D D NA NA 6/119038 - 2/456 Lewis et al. 1999; Wiszniewski et al. 2005; Heathfield et al. 2013 QT431 c.5646G>A p.M1882I Het PoD D D NA NA 3/121340 - 0/456 Zernant et al. 2011 c.1804C>T p.R602W Het B D D NA NA 6/119038 - 2/456 Lewis et al. 1999; Wiszniewski et al. 2005; Heathfield et al. 2013 QT458 c.4555delA p.T1519Rfs*7 Het NA NA NA NA NA NA 0/192 0/456 Novel c.164A>G p.H55R Het PoD D D NA NA NA - 0/456 Thiadens et al. 2012 QT727 c.161-2A>G Splicing defect Het SSA NA NA NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT833 c.2424C>G p.Y808* Het NA NA NA NA NA NA - 0/456 Zhou et al. 2014 c.1560delG p.V521Sfs*47 Het NA NA NA NA NA NA 0/192 0/456 Novel QT1137 c.6284A>T p.D2095V Het PrD D D NA NA NA 0/192 0/456 Novel c.22C>T p.Q8* Het NA NA NA NA 0.0001 NA 0/192 0/456 Novel QT1160 c.240_241del p.C81Ffs*17 Het NA NA NA NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT1175 c.4195G>T p.E1399* Het NA NA NA NA NA 2/120596 0/192 0/456 Novel c.2894A>G p.N965S Het PrD D D NA 0.0001 21/ 121302 - 0/456 Allikmets et al. 1997; Shanks et al. 2013; Bertelsen et al. 2014 QT1182 c.4773 +1G>T Splicing defect Hom SSA NA NA NA NA NA - 0/456 Pang et al. 2002; Riveiro-Alvarez et al. 2013 QT1198 c.5646G>A p.M1882I Het B D D NA NA 3/121340 - 0/456 Zernant et al. 2011 c.2894A>G p.N965S Het PrD D D NA 0.0001 21/ 121302 - 0/456 Allikmets et al. 1997;Shanks et al. 2013; Bertelsen et al. 2014 QT1200 c.6563T>C p.F2188S Het B D D NA 0.0005 2/121380 - 1/456 Fukui et al. 2002 c.858+2T>A Splicing defect Het SSA NA NA NA NA NA - 0/456 Zhang et al. 2014 QT1230 c.6317G>C p.R2106P Het PrD D D NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT1277 c.6479 +2T>C Splicing defect Het SSA NA NA NA NA NA 0/192 0/456 Novel (Continued) Table 1. Login to comment

[hide] Next-generation sequencing of ABCA4: High frequenc... Exp Eye Res. 2015 Nov 22;145:93-99. doi: 10.1016/j.exer.2015.11.011. Sciezynska A, Ozieblo D, Ambroziak AM, Korwin M, Szulborski K, Krawczynski M, Stawinski P, Szaflik J, Szaflik JP, Ploski R, Oldak M
Next-generation sequencing of ABCA4: High frequency of complex alleles and novel mutations in patients with retinal dystrophies from Central Europe.
Exp Eye Res. 2015 Nov 22;145:93-99. doi: 10.1016/j.exer.2015.11.011., [PMID:26593885]

Abstract [show]
Variation in the ABCA4 locus has emerged as the most prevalent cause of monogenic retinal diseases. The study aimed to discover causative ABCA4 mutations in a large but not previously investigated cohort with ABCA4-related diseases originating from Central Europe and to refine the genetic relevance of all identified variants based on population evidence. Comprehensive clinical studies were performed to identify patients with Stargardt disease (STGD, n = 76) and cone-rod dystrophy (CRD, n = 16). Next-generation sequencing targeting ABCA4 was applied for a widespread screening of the gene. The results were analyzed in the context of exome data from a corresponding population (n = 594) and other large genomic databases. Our data disprove the pathogenic status of p.V552I and provide more evidence against a causal role of four further ABCA4 variants as drivers of the phenotype under a recessive paradigm. The study identifies 12 novel potentially pathogenic mutations (four of them recurrent) and a novel complex allele p.[(R152*; V2050L)]. In one third (31/92) of our cohort we detected the p.[(L541P; A1038V)] complex allele, which represents an unusually high level of genetic homogeneity for ABCA4-related diseases. Causative ABCA4 mutations account for 79% of STGD and 31% of CRD cases. A combination of p.[(L541P; A1038V)] and/or a truncating ABCA4 mutation always resulted in an early disease onset. Identification of ABCA4 retinopathies provides a specific molecular diagnosis and justifies a prompt introduction of simple precautions that may slow disease progression. The comprehensive, population-specific study expands our knowledge on the genetic landscape of retinal diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
201 of patients Early 13 (50%) 27 (60%) 21 (100%) 61 Late 13 (50%) 18 (40%) 0 (0%) 31 Early &#fe; late 26 45 21 92 or p.N965S in Danish patients (Rosenberg et al., 2007) have not been detected in any of our patients. Login to comment