ABCMdb

ABCB1 p.Thr1236Cys

Predicted by SNAP2:	A: D (75%), C: D (80%), D: D (91%), E: D (91%), F: D (91%), G: D (85%), H: D (85%), I: D (85%), K: D (91%), L: D (85%), M: D (85%), N: D (85%), P: D (91%), Q: D (85%), R: D (91%), S: D (59%), V: D (85%), W: D (91%), Y: D (91%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Polymorphism of the ABC transporter genes, MDR1, M... Pharmacogenetics. 2001 Mar;11(2):175-84. Ito S, Ieiri I, Tanabe M, Suzuki A, Higuchi S, Otsubo K
Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects.
Pharmacogenetics. 2001 Mar;11(2):175-84., [PMID:11266082]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 In the MDR1 gene, three mutations were detected; T to C transversion at position 1236 (T1236C) in exon 12 (for position numbering refer to Chen et al., 1990), A to G transversion 41 bases upstream from the initial position of exon 1a (A-41aG) and C to G transversion at ±145 in exon 1a (C-145G) (Fig. 1). Login to comment
29 The T1236C mutation was silent (Gly to Gly at codon 412). Login to comment
30 The allele frequencies of T1236C, A-41aG and C-145G were 0.385, 0.073 and 0.01, respectively (Table 4). Login to comment
43 Thus, information on Fig. 1. Single-strand conformational polymorphism (SSCP) analysis (a) and sequence analysis (b) on MDR1 polymerase chain reaction products. Sequencing was carried out using the forward (C-145G) and the reverse (A-41aG and T1236C) primer shown in Table 1. Login to comment
51 Three mutations were observed; one (T1236C) was in the coding region (exon 12) and two (A-41aG and C-145G) were in the promoter region. Login to comment
52 Of these, the T1236C mutation had previously been identi®ed by Kioka et al. (1989). Login to comment
53 The allele frequency of T1236C mutation among Japanese is relatively high (38.5%), however; it is unlikely to be of functional signi®cance because it is a silent mutation (Gly to Gly). Login to comment
56 In addition to T1236C, T to G transversion at position 2677, which is a missense mutation (Ser to Ala at codon 893), was reported as a natural mutation. Login to comment

[hide] Association between single nucleotide polymorphism... Anticancer Res. 2006 May-Jun;26(3B):2227-32. Obata H, Yahata T, Quan J, Sekine M, Tanaka K
Association between single nucleotide polymorphisms of drug resistance-associated genes and response to chemotherapy in advanced ovarian cancer.
Anticancer Res. 2006 May-Jun;26(3B):2227-32., [PMID:16821592]

Abstract [show]
BACKGROUND: Single nucleotide polymorphisms (SNPs) may show clinicopathological importance as prognostic markers. This study examined the association of SNPs and the expression of drug resistance-associated markers with response to chemotherapy in advanced ovarian cancer (stages III and IV) patients. MATERIALS AND METHODS: SNPs were analyzed for MDR1, MRP1, MRP2 and LRP in 60 advanced ovarian cancer patients. The protein expression of each factor was analyzed by immunohistochemistry in all patients. RESULTS: As a result of examining the relevance of SNP genotypes to the response to chemotherapy, a significant relevance (p=0.01) was observed regarding MRP1 exon-17 SNP (G2168A) involving amino acid substitution. No significant relationship was observed between protein expression and the response to chemotherapy or disease-free survival time. CONCLUSION: Analysis of drug resistance gene polymorphism appears to be an indicator of the response to chemotherapy in advanced ovarian cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 Gene Nucleic acid Amino acid Allele frequencies Allele frequencies location change substitution (major alleles) (major alleles) in this study in other subject* MDR1 Promotor 1 T/C - 0.908 - Promotor 2 A-41aG - 0.883 0.927 exon-12 T1236C Gly412Gly 0.633 0.615 exon-26 G/A IIe1144IIe 0.500 - exon-28 A/G - 0.742 - MRP1 exon-8 T825C Val275Val 0.600 0.625 exon-9 T1062C Asn354Asn 0.567 0.646 exon-13 T1684C Leu562Leu 0.750 0.802 exon-16 C2007T Pro669Pro 0.950 0.917 exon-17 G2168A Arg723Gln 0.917 0.927 exon-28 G4002A Ser1334Ser 0.883 0.844 MRP2 Promotor C-24T - 0.867 - exon-10 G1249A Val417IIe 0.925 0.875 exon-28 C3972T IIe1324IIe 0.758 0.781 *Ito S. et al. Login to comment

[hide] Distinct haplotype profiles and strong linkage dis... Pharmacogenetics. 2002 Aug;12(6):437-50. Tang K, Ngoi SM, Gwee PC, Chua JM, Lee EJ, Chong SS, Lee CG
Distinct haplotype profiles and strong linkage disequilibrium at the MDR1 multidrug transporter gene locus in three ethnic Asian populations.
Pharmacogenetics. 2002 Aug;12(6):437-50., [PMID:12172212]

Abstract [show]
The MDR1 multidrug transporter plays a key role in determining drug bioavailability, and differences in drug response exist amongst different ethnic groups. Numerous studies have identified an association between the MDR1 single nucleotide polymorphism (SNP) exon 26 3435C>T and differences in MDR1 function. We performed a haplotype analysis of the MDR1 gene in three major ethnic groups (Chinese, Malays and Indians) by examining 10 intragenic SNPs. Four were polymorphic in all three ethnic groups: one occurring in the non-coding region and three occurring in coding exons. All three coding SNPs (exon 12 1236C>T, exon 21 2677G>T/A and exon 26 3435C>T) were present in high frequency in each ethnic group, and the derived haplotype profiles exhibited distinct differences between the groups. Fewer haplotypes were observed in the Malays (n = 6) compared to the Chinese (n = 10) and Indians (n = 9). Three major haplotypes (> 10% frequency) were observed in the Malays and Chinese; of these, two were observed in the Indians. Strong linkage disequilibrium (LD) was detected between the three SNPs in all three ethnic groups. The strongest LD was present in the Chinese, followed by Indians and Malays, with the corresponding LD blocks estimated to be approximately 80 kb, 60 kb and 40 kb, respectively. These data strongly support the hypothesis that strong LD between the neutral SNP exon 26 3435C>T and a nearby unobserved causal SNP underlies the observed associations between the neutral SNP and MDR1 functional differences. Furthermore, strong LD between exon 26 3435T and different unobserved causal SNPs in different study populations may provide a plausible explanation for conflicting reports associating the same exon 26 3435T allele with different MDR1 functional changes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 To date, detailed linkage disequilibrium analysis of the different polymorphisms of the MDR1 gene has not been documented, although a recent publication by Kim et al. [19] reported co-segregation of exon 26 3435T with the T allele of the non-synonymous exon 21 SNP G2677T (exon 21 2677G.T), resulting in an A893S amino acid change, and the T allele of the synonymous exon 12 SNP T1236C (exon 12 1236C.T) in Caucasians. Login to comment

[hide] Neurotoxicity induced by tacrolimus after liver tr... Transplantation. 2002 Aug 27;74(4):571-2. Yamauchi A, Ieiri I, Kataoka Y, Tanabe M, Nishizaki T, Oishi R, Higuchi S, Otsubo K, Sugimachi K
Neurotoxicity induced by tacrolimus after liver transplantation: relation to genetic polymorphisms of the ABCB1 (MDR1) gene.
Transplantation. 2002 Aug 27;74(4):571-2., 2002-08-27 [PMID:12352921]

Abstract [show]
BACKGROUND: Tacrolimus is a substrate of P-glycoprotein (PGP) encoded by the multidrug resistant (MDR)1 gene (ABCB1). PGP, a multidrug efflux pump, restricts the distribution of tacrolimus in the brain. In this study, we investigate the correlation of ABCB1 gene polymorphism with tacrolimus-induced neurotoxicity in patients after liver transplantation. METHODS: The genotype of 6 patients with neurotoxic events and 11 patients without neurotoxic events was analyzed by polymerase chain reaction (PCR), and 8 mutations were detected. In addition to laboratory findings and patient characteristics, the contribution of mutations in the ABCB1 gene was evaluated with stepwise discriminant function analysis. RESULTS: High tacrolimus concentration, liver dysfunction, and mutation at position 2677 in exon 21 were demonstrated as positive predictors of tacrolimus-induced neurotoxicity. CONCLUSION: It is indicated that blood concentrations, liver function, graft weight, and polymorphism in the ABCB1 gene are important factors in tacrolimus-induced neurotoxicity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 The independent variables were as follows: the eight polymorphisms (A-41aG, C-145G, T-129C, T1236C, G2677[A,T], C3435T, and A4036G) and the number of mutations, age, graft weight, ratio of graft weight to recipient`s standard liver volume, tacrolimus trough concentration, hematocrit, aspartate aminotransferase (AST), alanine aminotransferase, and serum albumin concentration (thought to affect the tacrolimus distribution in the brain). Login to comment
61 Position, sequence, and frequencies of ABCB1 mutations in Japanese living-related donor liver transplantation patients ABCB1 exon/ position Region Nucleotide sequence Effect Genotype Allele frequency Wild type Mutation w/w w/m m/m w m A-41aG UTR cccaAtgat cccaGtgat 11 5 1 0.79 0.21 C-145G Exon 1a gaagCctag gaagGctag 15 2 0 0.94 0.06 T-129C Exon 1b cgagTagcg cgagCagcg 12 3 2 0.79 0.21 T1236C Exon 12 agggTctga agggCctga 7 7 3 0.62 0.38 G2677A Exon 21 aggtGctgg aggtActgg Ala893Thr 6 G/Aϭ2 A/Aϭ0 0.59 0.09 G2677T Exon 21 aggtGctgg aggtTctgg Ala893Ser G/Tϭ6 T/Tϭ2 0.32 A/Tϭ1 C3435T Exon 26 agatCgtga agatTgtga 4 10 3 0.53 0.47 A4036G Exon 28 aatcAtagt aatcGtagt 7 7 3 0.62 0.38 UTR, untranslated region; w, wild type; m, mutation. Login to comment

[hide] Genetic polymorphisms of the human MDR1 drug trans... Annu Rev Pharmacol Toxicol. 2003;43:285-307. Epub 2002 Jan 10. Schwab M, Eichelbaum M, Fromm MF
Genetic polymorphisms of the human MDR1 drug transporter.
Annu Rev Pharmacol Toxicol. 2003;43:285-307. Epub 2002 Jan 10., [PMID:12359865]

Abstract [show]
P-glycoprotein is an ATP-dependent efflux pump that contributes to the protection of the body from environmental toxins. It transports a huge variety of structurally diverse compounds. P-glycoprotein is involved in limiting absorption of xenobiotics from the gut lumen, in protection of sensitive tissues (brain, fetus, testis), and in biliary and urinary excretion of its substrates. P-glycoprotein can be inhibited or induced by xenobiotics, thereby contributing to variable drug disposition and drug interactions. Recently, several SNPs have been identified in the MDR1 gene, some of which can affect P-glycoprotein expression and function. Potential implications of MDR1 polymorphisms for drug disposition, drug effects, and disease risk are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Thus, a cosegregation of the silent mutation 3435T in 62% with the T allele of the nonsynonymous exon 21 SNP 2677T and the T allele of the synonymous exon 12 polymorphism T1236C was reported for European Americans (29). Login to comment

[hide] Pharmacogenetics of MDR1 and its impact on the pha... Pharmacogenomics. 2003 Jul;4(4):397-410. Sakaeda T, Nakamura T, Okumura K
Pharmacogenetics of MDR1 and its impact on the pharmacokinetics and pharmacodynamics of drugs.
Pharmacogenomics. 2003 Jul;4(4):397-410., [PMID:12831320]

Abstract [show]
The multi-drug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette (ABC) superfamily of membrane transporters. MDR1 was originally isolated from resistant tumor cells as part of the mechanism of multi-drug resistance, but over the last decade, it has been elucidated that human MDR1 is also expressed throughout the body to confer intrinsic resistance to the tissues by exporting unnecessary or toxic exogeneous substances or metabolites. A number of various types of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics and pharmacodynamics. In 2000, Hoffmeyer et al. performed a systemic screening for MDR1 polymorphisms and indicated that a single nucleotide polymorphism (SNP), C3435T in exon 26, which caused no amino acid change, was associated with the duodenal expression of MDR1 and thereby the plasma concentrations of digoxin after oral administration. Interethnic differences in genotype frequencies of C3435T have been clarified, and, at present, a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical studies on the effects of C3435T on MDR1 expression and function in the tissues, and also on the pharmacokinetics and pharmacodynamics have been performed around the world; however, there are still discrepancies in the results, suggesting that the haplotype analysis of the gene should be included instead of SNP detection, and the design of clinical trials must be carefully planned to avoid misinterpretations. A polymorphism of C3435T is also reported to be a risk factor for a certain class of diseases such as the inflammatory bowel diseases, Parkinson's disease and renal epithelial tumor, and this might also be explained by the effects on MDR1 expression and function. In this review, the latest reports are summarized for the future individualization of pharmacotherapy based on MDR1 genotyping.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 IN COO- A61G T307C G1199A T1236C G2677A,T A2956G G2995T A3320C C3396T C3435T OUT NH2 gure 1. Sakaeda et al. MSD1 MSD2NBD1 NBD2 region accounts for < 5% of the total. Login to comment

[hide] Amlodipine, but not MDR1 polymorphisms, alters the... Transplantation. 2003 Sep 15;76(5):865-8. Kuzuya T, Kobayashi T, Moriyama N, Nagasaka T, Yokoyama I, Uchida K, Nakao A, Nabeshima T
Amlodipine, but not MDR1 polymorphisms, alters the pharmacokinetics of cyclosporine A in Japanese kidney transplant recipients.
Transplantation. 2003 Sep 15;76(5):865-8., 2003-09-15 [PMID:14501869]

Abstract [show]
BACKGROUND: Cyclosporine A (CsA) is a critical immunosuppressive drug with a narrow therapeutic range and wide interindividual variation in its pharmacokinetics. Many factors, including P-glycoprotein (PGP), influence the oral bioavailability and interpatient variability of CsA. A number of polymorphisms have been identified in the human MDR1 gene, and some of them have been found to be associated with an altered expression of PGP. We have investigated the role of these polymorphisms in CsA absorption from kidney transplant recipients. In addition, we also investigated the effect of amlodipine on CsA absorption. METHODS: The area under the time-concentration curve from 0 to 2 hr (AUC(0-2)) estimated by the trapezoidal rule was used for the evaluation of extent of CsA absorption. The genotypes were identified by a polymerase chain reaction, restriction fragment length polymorphism analysis. RESULTS: No association was found between polymorphisms in the MDR1 and CsA AUC(0-2)/dose/kg. In contrast, the combination of amlodipine significantly increased CsA AUC(0-2)/dose/kg (706.2 microg x hr/L to 819.2 microg x hr/L, P<0.05). Furthermore, we attempted to compare MDR1 polymorphisms and the absorption of CsA again without patients receiving amlodipine, but there was still no significant difference. CONCLUSIONS: There is no relationship between polymorphisms for MDR1 and CsA absorption, suggesting polymorphisms for MDR1 cannot account for the interpatient variability of CsA. Amlodipine, which is the substrate of PGP, significantly increased CsA absorption. These results indicate that PGP plays a significant role in CsA absorption, but its polymorphisms could not influence the CsA absorption.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 The genotypes of MDR1 (exon 1b, T-129C; exon 12, T1236C; exon 21, G2677[T/A]; and exon 26, C3435T) were identified by a polymerase chain reaction, restriction fragment length polymorphism analysis as described previously (11). Login to comment
65 T1236C, G2677T, G2677A, and C3435T mutations occurred with variant allele frequencies of 42.3%, 39.7%, 23.7%, and 41.2%, respectively. Login to comment
84 Therefore, we tried to compare the effects of MDR1 polymorphisms on CsA AUC0 -2/dose/kg again without amlodipine treatment, but there was still no significant difference (T-129C, Pϭ0.202; T1236C, Pϭ0.447; G2677T/A, Pϭ0.765; and C3435T, Pϭ0.877). Login to comment
97 MDR1 genetic variants in 97 kidney transplant recipients Position Region Genotype Allele frequency (%) W/W W/M M/M W M T-129C Exon 1b 88 9 95.4 4.6 T1236C Exon 12 30 52 15 57.7 42.3 G2677T Exon 21 12(G/G) 33 (G/T) 11 (T/T) 36.6 39.7(T) G2677A Exon 21 14 (G/A) 5 (A/A) 23.7(A) G2677A 22 (T/A) C3435T Exon 26 33 48 16 58.8 41.2 TABLE 3. Login to comment
98 P values between SNP and AUC0-2/dose/kg AUC0-2/dose/kg 752.8Ϯ194.1a T-129C 0.279 T1236C 0.868 G2677T/A 0.911 C3435T 0.973 a MeanϮSD. FIGURE 2. Login to comment

[hide] Hepatic technetium Tc 99m-labeled sestamibi elimin... Clin Pharmacol Ther. 2005 Jan;77(1):33-42. Wong M, Evans S, Rivory LP, Hoskins JM, Mann GJ, Farlow D, Clarke CL, Balleine RL, Gurney H
Hepatic technetium Tc 99m-labeled sestamibi elimination rate and ABCB1 (MDR1) genotype as indicators of ABCB1 (P-glycoprotein) activity in patients with cancer.
Clin Pharmacol Ther. 2005 Jan;77(1):33-42., [PMID:15637529]

Abstract [show]
BACKGROUND AND OBJECTIVE: The adenosine triphosphate-binding cassette transporter ABCB1 (P-glycoprotein) mediates terminal excretion of many chemotherapeutic agents, and variable ABCB1 activity may be an important contributor to interpatient variability in the clearance of chemotherapeutic agents. Our objective was to determine the elimination constant (kH) for hepatic elimination of technetium Tc 99m-labeled sestamibi (99mTc-MIBI) in patients with cancer and to compare this putative indicator of ABCB1 phenotype with clinical features and common ABCB1 genetic variants. METHODS: 99mTc-MIBI kH was determined from the time-dependent elimination profile of 99mTc-MIBI over a 90-minute hepatic scanning period in 66 patients with cancer. Single nucleotide polymorphisms (SNPs) in ABCB1 exons 12 (C1236T), 21 (G2677T/A), and 26 (C3435T) were documented by polymerase chain reaction-restriction fragment length polymorphism analysis. RESULTS: There was a 12-fold variation in 99mTc-MIBI kH across the cohort, which was not correlated with sex, age, conventional liver function test results, previous chemotherapy treatment, or history of liver metastasis. Mean 99mTc-MIBI kH was significantly reduced in patients with SNPs in exons 21 and 26 such that mean 99mTc-MIBI kH was 1.90 times (95% confidence interval, 1.14-2.66; P = .02) and 2.21 times (95% confidence interval, 1.47-2.97; P < .01) higher in subjects homozygous for the wild-type alleles than in those homozygous for these SNPs, respectively. CONCLUSION: Hepatic elimination of 99mTc-MIBI is a potential in vivo probe of hepatic ABCB1 activity that is significantly associated with the presence of common SNPs in ABCB1. 99mTc-MIBI hepatic scanning may provide a useful pretreatment indicator of ABCB1-mediated drug clearance in cancer patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 Frequency of ABCB1 variants ABCB1 locus Genotype Actual frequency (%) Predicted frequency (%) (Hardy-Weinberg equilibrium) ␹2 (P value) Exon 12 CC 17 17 0.021 (.885) CT 48 48 TT 35 35 Exon 21 GG 17 20 3.125 (.373) GT 52 48 GA 3 1 TT 28 28 Exon 26 CC 17 19 0.597 (.440) CT 53 49 TT 30 32 T1236C in exon 12, G2677T/A in exon 21, and C3435T polymorphisms in exon 26 of ABCB1 were detected by polymerase chain reaction-restriction fragment length polymorphism. Login to comment

[hide] Pharmacokinetics of paclitaxel in ovarian cancer p... J Clin Pharmacol. 2005 Jun;45(6):674-82. Nakajima M, Fujiki Y, Kyo S, Kanaya T, Nakamura M, Maida Y, Tanaka M, Inoue M, Yokoi T
Pharmacokinetics of paclitaxel in ovarian cancer patients and genetic polymorphisms of CYP2C8, CYP3A4, and MDR1.
J Clin Pharmacol. 2005 Jun;45(6):674-82., [PMID:15901749]

Abstract [show]
Interindividual differences in the pharmacokinetics of paclitaxel and its metabolites in Japanese ovarian cancer patients were investigated in relation to genetic polymorphisms of the CYP2C8, CYP3A4, and MDR1 genes. The area under the concentration-time curve (AUC) ratios of paclitaxel/6alpha-hydroxypaclitaxel and paclitaxel/3 -p-hydroxypaclitaxel calculated as the metabolic index of CYP2C8 and CYP3A4 showed 13- and 12-fold interindividual variations, respectively. No patient had any CYP2C8 variants, while 2 patients were heterozygotes of CYP3A4*16. For the MDR1 gene, the frequencies of -129C, 1236C, 2677T, 2677A, and 3435T alleles were 2.2%, 8.7%, 56.5%, 4.4%, and 52.2%, respectively. Subjects possessing the 3435T allele had a significantly (P < .05) higher AUC of 3'- p-hydroxypaclitaxel compared to those possessing the 3435C allele. Leukocytopenia was significantly (P < .05) related to the AUC of paclitaxel. Genotyping of the CYP2C8, CYP3A4, and MDR1 genes might not be essential to predict adverse effects of paclitaxel in Japanese patients, although an allelic variant of MDR1 may functionally affect the pharmacokinetics of its metabolite.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 Table II Genotype of CYP3A4 and MDR1 Genes in Each Patient MDR1 Patient CYP3A4*16 T-129C T1236C G2677T/A C3435T 1 C/G T/T T/T G/G C/C 2 C/G T/T T/T G/T C/C 3 C/C T/T T/T G/T C/C 4 C/C T/T T/T G/A C/C 5 C/C T/C C/C G/A C/C 6 C/C T/T T/T G/T C/T 7 C/C T/T T/T G/T C/T 8 C/C T/T T/T G/T C/T 9 C/C T/T T/T G/T C/T 10 C/C T/T T/T G/T C/T 11 C/C T/T T/T G/T C/T 12 C/C T/T T/T G/T C/T 13 C/C T/T T/T G/T C/T 14 C/C T/T T/T T/A C/T 15 C/C T/T T/T T/A C/T 16 C/C T/T T/C T/A C/T 17 C/C T/T T/T T/T C/T 18 C/C T/T T/T T/T T/T 19 C/C T/T T/T T/T T/T 20 C/C T/T T/T T/T T/T 21 C/C T/T T/T T/T T/T 22 C/C T/T T/T T/T T/T 23 C/C T/T T/C G/T T/T Shading indicates nucleotides in mutant type. Login to comment
141 A number of SNPs have been identified in the human MDR1 gene.19,21,33,34 Of these SNPs, T-129C (noncoding), T1236C (Gly412Gly, wobble), G2677T/A (Ala893Ser/Thr), and C3435T (Ile1145Ile, wobble) are associated with alterations in the expression of P-glycoprotein and pharmacokinetic profiles of certain clinically used drugs.19,21,34 The present study showed an apparent association between the presence of 3435T allele and increased AUC of 3'-p-hydroxypaclitaxel. Login to comment

[hide] Multidrug resistance polypeptide 1 (MDR1, ABCB1) v... Pharmacogenet Genomics. 2005 Oct;15(10):693-704. Wang D, Johnson AD, Papp AC, Kroetz DL, Sadee W
Multidrug resistance polypeptide 1 (MDR1, ABCB1) variant 3435C>T affects mRNA stability.
Pharmacogenet Genomics. 2005 Oct;15(10):693-704., [PMID:16141795]

Abstract [show]
OBJECTIVES: ABCB1 (multidrug resistance 1 polypeptide, MDR1, Pgp) is a multispecific efflux transporter of drugs and xenobiotics. Among numerous polymorphisms in human ABCB1, the synonymous SNP 3435C > T has been associated with decreased mRNA and protein levels, via unknown mechanisms. METHODS: To search for cis-acting polymorphism affecting transcription or mRNA processing, we used 3435C > T as a marker single nucleotide polymorphism (SNP), for measuring differences in allelic mRNA expression. Ratios of allelic abundance in genomic DNA and mRNA (after conversion to cDNA) were measured quantitatively with a primer extension assay, in human liver samples. RESULTS: mRNA expression of the 3435C allele was significantly higher than that of the 3435T allele (3435C/3435T ratios ranging from 1.06-1.61). Cotransfection of equal amounts of ABCB1 expression plasmids containing 3435C or 3435T also revealed higher 3435C mRNA expression. Increasing 3435C/3435T ratios after cessation of transcription indicated that the 3435C > T substitution decreases mRNA stability. 3435C > T is in strong linkage disequilibrium with two other coding SNPs (1236C > T and 2677G > T) forming two abundant haplotypes (ABCB1*1 and ABCB1*13). Transfection of all possible combinations of these three SNPs demonstrated that only 3435T is associated with lower mRNA levels. Calculations of mRNA folding, using Mfold, suggested an effect on mRNA secondary structure. CONCLUSIONS: the abundant 3435C > T SNP appears to be a main factor in allelic variation of ABCB1 mRNA expression in the liver, by changing mRNA stability.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
190 When Fig. 5 1.8 *** *** ### *** ### *** ### *** ### *** ### *** ### *** ### ## 3435C/3435T 1236C/1236T 1.6 1.6 1.4 1.4 1.2 1.2 DNA-48hRNA-8hDNA-8h RNA-48h 1.0 1.0 0.8 0.8 0.6 0.6 0.4 1.8 2677G/2677T 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.4 *13 3435C > T1236C > T/3435C > T2677G > T/3435C > T *13 1236C > T 1236C > T/2677G > T1236C > T/3435C > T *13 2677G > T 1236C > T/2677G > T 2677G > T/3435C > T (a) (b) (c) Differential mRNA expression between ABCB1*1 and different ABCB1 variants after co-transfection into CHO cells. Login to comment

[hide] Single nucleotide polymorphisms in human P-glycopr... Expert Opin Drug Deliv. 2006 Jan;3(1):23-35. Dey S
Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition.
Expert Opin Drug Deliv. 2006 Jan;3(1):23-35., [PMID:16370938]

Abstract [show]
Drug efflux pumps belong to a large family of ATP-binding cassette transporter proteins. These pumps bind their substrate and export it through the membrane using energy derived from ATP hydrolysis. P-glycoprotein, the main efflux pump in this family, is expressed not only in tumour cells but also in normal tissues with excretory function (liver, kidney and the intestine). It has a broad specificity of substrates and plays an important role in drug delivery and disposition. Recently, genetic screening of P-glycoprotein has yielded multiple single nucleotide polymorphisms, which seem to alter transporter function and expression. This review discusses the various polymorphisms of this gene and its impact on drug disposition and diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 1 2 3 4 5 6 7 8 9 10 11 12 NH2 COOH Out Membrane In T1236C G2677T/A C3435T A2956G NBD1 NBD2 A NBD1 NBD2 B the second ATP-binding domain. Login to comment

[hide] MDR1 genotype-related pharmacokinetics: fact or fi... Drug Metab Pharmacokinet. 2005 Dec;20(6):391-414. Sakaeda T
MDR1 genotype-related pharmacokinetics: fact or fiction?
Drug Metab Pharmacokinet. 2005 Dec;20(6):391-414., [PMID:16415525]

Abstract [show]
Multidrug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily of membrane transporters. A number of various types of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics. The first investigation of the effects of MDR1 genotypes on pharmacotherapy was reported in 2000; a silent single nucleotide polymorphism (SNP), C3435T in exon 26, was found to be associated with the duodenal expression of MDR1, and thereby the plasma concentration of digoxin after oral administration. In the last 5 years, clinical studies have been conducted around the world on the association of MDR1 genotype with MDR1 expression and function in tissues, and with the pharmacokinetics and pharmacodynamics of drugs; however, there are still discrepancies in the results on C3435T. In 1995, a novel concept to predict in vivo oral pharmacokinetic performance from data on in vivo permeability and in vitro solubility has been proposed, and this Biopharmaceutical Classification System strongly suggested that the effects of intestinal MDR1 on the intestinal absorption of substrates is minimal in the case of commercially available oral drugs, and therefore MDR1 genotypes are little associated with the pharmacokinetics after oral administration. This review summarizes the latest reports for the future individualization of pharmacotherapy based on MDR1 genotyping, and attempts to explain discrepancies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
104 The ˆrst preliminary report on the eŠects of their genotypes was presented by von Ahsen et al., who indicated that the maintenance dose or dose-adjusted Cmin,ss of CsA was independent either of MDR1 C3435T or CYP3A4 genotype, after an analysis of 124 Caucasian renal transplant recipients.146) Mai et al. indicated no eŠects of MDR1 G2677T or C3435T on the dose-adjusted AUC0-12,ss, Cmin,ss and C2,ss of CsA in 95 renal transplant recipients, and an analysis based on the G2677TW C3435T haplotype56) also failed to predict the pharmacokinetics of CsA.147) Kuzuya et al. also reported no eŠects of MDR1 T-129C, T1236C, G2677A,T and C3435T on the dose-adjusted AUC0-2,ss of CsA in 57 renal transplant recipients.148) In 2002, the Consensus on Neoral C2: Expert Review in Transplantation (CONCERT) conference was convened to undertake a multidisciplinary review of pharmacokinetic and clinical data on CsA microemulsions, and an international consensus on a patient management strategy with the oral administration of a CsA microemulsion has come to be presented based on the monitoring of C2,ss as a surrogate marker of AUC0-4,ss, AUCss up to 4 hr after oral administration, which was recently found to be predictive of immunosuppressive eŠects and toxicity, when compared with conventional C0,ss monitoring.175-178) One important issue to be resolved is the existence of ``slow absorbers'', who show a Cmax,ss at 4 hr or later, and are susceptible to over-dosing of CsA based on C2,ss monitoring. Login to comment

[hide] Overview of the pharmacogenetics of HIV therapy. Pharmacogenomics J. 2006 Jul-Aug;6(4):234-45. Epub 2006 Feb 7. Rodriguez-Novoa S, Barreiro P, Jimenez-Nacher I, Soriano V
Overview of the pharmacogenetics of HIV therapy.
Pharmacogenomics J. 2006 Jul-Aug;6(4):234-45. Epub 2006 Feb 7., [PMID:16462814]

Abstract [show]
The administration of standard doses of most antiretroviral drugs results in significant variations in plasma drug concentrations among different individuals, influencing antiviral activity as well as incidence of drug-related toxicities. The reasons for this large inter-individual variability in drug levels are multifactorial, and involve differences in metabolism related to gender, concomitant medications, drug compliance, underlying diseases and genetic factors. Pharmacogenetics is the discipline that analyses the genetic basis for the inter-individual variation in the body disposition of drugs. One of its main goals is to give grounds to individualized treatment. The majority of pharmacogenetic traits so far have involved drug metabolism. This is the case for the inherited variation in the pharmacokinetics and pharmacodynamics of drugs such as hydralazine or isoniazid, which is due to polymorphisms in the N-acetyltransferase-2 (NAT2) gene, which allows splitting the population into three categories: slow, intermediate, and fast metabolizers. Pharmacogenetic studies conducted so far with antiretroviral drugs have focussed on metabolizer enzymes at the liver and on transporter proteins on cell membranes. Herein, we review the most relevant metabolizer enzymes and protein transporters, along with the genetic polymorphisms, which seem to influence the pharmacokinetics of antiretroviral drugs, ultimately determining its efficacy and toxicity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 The percentage of subjects with total bilirubin in the range of jaundice (42.5 mg/dl) was 13% for those with the TA6/TA6 NH COO A61G A3320C T307C T1236C G1199A G2677A,T C3435T G2995T C3396T A2956G •Polymorphism associated with Non-A • Lower EFV plasma levels in T/T genotype • Increased HDL-cholesterol levels in C/C genotype • Low risk of NVP hepatotoxicity in T/T genotype •Polymorphism associated with Protease Inhibitors •Lower NFV plasma levels in T/T genotype •Lower ATV plasma levels in T/T genotype NH2 COO A61G A3320C T307C T1236C G1199A G2677A,T C3435T G2995T C3396T A2956G NH COO- A61G A3320C T307C T1236C G G2677A,T C3435T G2995T C3396T A2956G •Polymorphism associated with Non-Analogues: wer EFV plasma levels in T/T genotype ncreased HDL-cholesterol levels in C/C genotype w risk of NVP hepatotoxicity in T/T genotype •Polymorphism associated with Protease Inhibitors •Lower NFV plasma levels in T/T genotype •Lower ATV plasma levels in T/T genotype Figure 5 Polymorphisms at the MDR1 gene and structure of the P-glycoprotein. Login to comment

[hide] Predictors of vinorelbine pharmacokinetics and pha... J Clin Oncol. 2006 Jun 1;24(16):2448-55. Epub 2006 May 1. Wong M, Balleine RL, Blair EY, McLachlan AJ, Ackland SP, Garg MB, Evans S, Farlow D, Collins M, Rivory LP, Hoskins JM, Mann GJ, Clarke CL, Gurney H
Predictors of vinorelbine pharmacokinetics and pharmacodynamics in patients with cancer.
J Clin Oncol. 2006 Jun 1;24(16):2448-55. Epub 2006 May 1., 2006-06-01 [PMID:16651648]

Abstract [show]
PURPOSE: Marked interindividual variation in drug disposition and toxicity pose an ongoing challenge to chemotherapy dosage individualization. The aim of this study was to evaluate pretreatment clinical features, genotype and functional indicators of drug clearance as predictors of vinorelbine clearance, and myelotoxicity that could inform dosage optimization. PATIENTS AND METHODS: Forty-one patients with cancer received a 60 mg intravenous dose of vinorelbine. Pretreatment routine body size measurements and blood tests were performed. Midazolam clearance and hepatic technetium labeled sestamibi (99mTc-MIBI) clearance were used to investigate CYP3A and ABCB1 (MDR1, P-glycoprotein) phenotype respectively and selected single nucleotide polymorphisms in CYP3A and ABCB1 were documented. A limited blood sampling strategy was employed and vinorelbine concentrations were determined by high-performance liquid chromatography. Posterior Bayesian estimates of vinorelbine clearance were obtained for each patient using population pharmacokinetic modeling. Myelotoxicity was estimated from the fractional survival of neutrophils post-treatment. RESULTS: There was 4.3-fold variation in vinorelbine clearance across the cohort. In a multivariable analysis, pretreatment estimated creatinine clearance (P < .01) and hepatic (99m)Tc-MIBI clearance (P = .01) were independent predictors of vinorelbine clearance. Fractional survival of neutrophils ranged from 1.3% to 100% and was significantly correlated with vinorelbine clearance (P < .01). Body-surface area was the only pretreatment predictor of fractional survival of neutrophils independent of vinorelbine clearance (P = .02). CONCLUSION: Specific indicators of drug clearance provide predictive information about vinorelbine pharmacokinetics, and body-surface area, probably reflecting normal bone marrow reserve, provides an additional pharmacodynamic indicator. Use of a fixed dose of vinorelbine with modifications guided by pretreatment measures is worthy of prospective evaluation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 of patients 41 Male 25 Female 16 Age Mean, years 63 Range 43-81 Body-surface area, m2 Mean 1.84 Range 1.41-2.46 Ethnicity White 39 Nonwhite 2 Cancer type Prostate 16 Breast 10 Lung 8 Bladder 3 Others 4 ECOG performance status 0 25 1 15 2 1 Liver metastasis Yes 14 No 25 Unknown 2 Prior chemotherapy Yes 26 No 15 Pretreatment neutrophil count, ϫ10 9 /L (mean Ϯ SD) 5.9 Ϯ 2.8 ABCB1 SNPs Exon 12 T1236C CC 6 CT 23 TT 12 Exon 21 G2677T, A GG 5 GT 24 GA 2 TT 10 Exon 26 C3435T CC 7 CT 23 TT 11 CYP3A5 SNP *1/*3 3 *3/*3 38 Abbreviations: ECOG, Eastern Cooperative Oncology Group; SNP, single nucleotide polymorphism; SD, standard deviation; C, cytosine; T, thymine; G, guanine; A, adenine. Login to comment
80 Association Between Potential Predictors, Vinorelbine Clearance, and Fractional Survival of Neutrophil Postvinorelbine Variable Correlation With Vinorelbine Clearance Correlation With Fractional Survival of Neutrophils Postvinorelbine No. Spearman`s Rho P No. Spearman`s Rho P Age 34 -0.28 .11 38 -0.05 .78 Sex (male/female) 34 .06 38 .02 ECOG (0 to 3) 34 .56 38 .29 Prior chemotherapy (Y/N) 34 .42 38 .64 Liver metastasis (Y/N) 32 .11 36 .28 Body habitus‫ء‬ Body-surface area† 34 0.17 .33 38 0.48 Ͻ .01 Height 34 0.25 .16 38 0.41 .01 Pretreatment platelet count 32 -0.16 .39 N/A‡ Genotype CYP3A5*1/*3 34 .25 38 .50 ABCB1 exon 12 T1236C 34 .78 38 .44 exon 21 G2677T, A 34 .82 38 .54 exon 26 C3435T 34 .25 38 .69 Liver function tests Aspartate transaminase 33 -0.23 .20 37 -0.19 .26 Alanine transaminase 34 -0.16 .38 38 -0.03 .87 Alkaline phosphatase 34 0.05 .78 38 -0.09 .60 Serum albumin 34 -0.12 .51 38 0.07 .67 INR 28 -0.21 .27 30 0.06 .74 Bile acids 18 0.06 .81 18 -0.10 .68 Clearance indicators Creatinine clearance§ 34 0.34 .05 38 0.39 .02 Hepatic 99m Tc-MIBI clearance (kH ϫ liver volume) 33 0.32 .07 37 0.28 .09 Midazolam clearance 34 -0.06 .73 37 0.12 .47 Abbreviations: ECOG, Eastern Cooperative Oncology Group; Y, yes; N, no; INR, international normalized ratio; 99m Tc-MIBI, technetium labeled sestamibi; kH, elimination rate constant. Login to comment

[hide] Genetic variation in ABCB1 influences paclitaxel p... Int J Gynecol Cancer. 2006 May-Jun;16(3):979-85. Yamaguchi H, Hishinuma T, Endo N, Tsukamoto H, Kishikawa Y, Sato M, Murai Y, Hiratsuka M, Ito K, Okamura C, Yaegashi N, Suzuki N, Tomioka Y, Goto J
Genetic variation in ABCB1 influences paclitaxel pharmacokinetics in Japanese patients with ovarian cancer.
Int J Gynecol Cancer. 2006 May-Jun;16(3):979-85., [PMID:16803472]

Abstract [show]
Paclitaxel, an antineoplastic agent used for the treatment of ovarian cancer, is metabolized by cytochrome P450 (CYP)3A4 and CYP2C8 and is excreted from cells by ATP-binding cassette (ABCB1) (multi-drug resistance [MDR1], P-glycoprotein). Expression of these proteins is regulated by pregnane X receptor (PXR). Although there are common genetic polymorphisms in the genes encoding these proteins, their effect on the clinical efficacy of paclitaxel is unclear. We therefore examined the relationship of the paclitaxel pharmacokinetics in 13 patients with ovarian cancer to polymorphisms in CYP2C8, CYP3A5, ABCB1, and PXR. We found high interindividual variability in the plasma concentrations of two metabolites, 6alpha-hydroxypaclitaxel and p-3'-hydroxypaclitaxel. All the patients were genotyped as CYP2C8*1/*1. Neither the CYP3A5 A6986G (CYP3A5*3) nor the PXR C-25385T alleles were associated with altered plasma concentrations of paclitaxel and its metabolites. ABCB1 T-129C, T1236C, and G2677(A,T), however, was associated with lower area under the plasma concentration-time curve (AUC) of paclitaxel. We also observed a significant correlation between the AUC (r=-0.721) or the total clearance of paclitaxel (CL(tot)) (r= 0.673) and the ABCB1 mutant allele dosage in each patient. Taken together, our findings suggest that interindividual variability in paclitaxel pharmacokinetics could be predicted by ABCB1 genotyping.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 ABCB1 T-129C, T1236C, and G2677(A,T), however, was associated with lower area under the plasma concentration-time curve (AUC) of paclitaxel. Login to comment
41 CYP2C8 A805T (CYP2C8*2), G416A/A1196G (CYP2C8*3), and C792G (CYP2C8*4), and ABCB1 T-129C, T1236C, G2677(A,T), and C3435T were genotyped by polymerase chain reaction (PCR)-restriction enzyme fragment length polymorphism as previously described with minor modification(15-17) . Login to comment
68 CYP2C8, CYP3A5, ABCB1, and PXR genotypes in 13 patientsa Patient number CYP2C8 CYP3A5 ABCB1 PXR A6986G T-129C T1236C G2677 (A,T) C3435T C-25385T 1 *1/*1 A/G T/T T/T G/T C/T C/C 2 *1/*1 A/G T/T T/C A/T C/C C/C 3 *1/*1 G/G T/T T/C G/G C/T C/C 4 *1/*1 A/G T/T T/T T/T T/T C/T 5 *1/*1 A/A T/T T/T G/T C/T T/T 6 *1/*1 A/G T/T T/T G/G C/C C/C 7 *1/*1 G/G T/T T/C G/G C/C C/C 8 *1/*1 G/G T/T T/T G/T C/T C/T 9 *1/*1 A/G T/T T/T G/T C/T C/C 10 *1/*1 G/G T/T T/T G/T C/T C/C 11 *1/*1 A/G T/T T/C G/T C/C C/T 12 *1/*1 G/G T/C C/C A/A C/C C/T 13 *1/*1 G/G T/T T/C G/T C/T C/C a The most common (wild-type) CYP2C8 allele was CYP2C8*1. than the frequencies of 0.39 and 0.32 observed for Caucasian and African American populations, respectively(21) . Login to comment
80 Although the differences were not statistically significant, ABCB1 T1236C tended to be associated with lower paclitaxel AUC (11.4 Æ 2.32, 9.62 Æ 1.48, and 5.73 lgÁh/mL for 1236T/T, T/C, and C/C genotypes [n ¼ 7, 5, and 1], respectively). Login to comment
87 As ABCB1 T-129C, T1236C, and G2677(A,T) were associated with lower paclitaxel AUC (Fig. 2), we examined the relationships between total ABCB1 mutant allele numbers and either paclitaxel AUC or CLtot in 13 patients. Login to comment
110 ABCB1 T1236C is associated with significantly increased exposure to irinotecan and the active metabolite SN-38(26) . Login to comment

[hide] Analyses of single nucleotide polymorphisms and ha... Arch Pharm Res. 2006 Dec;29(12):1132-9. Ryu HC, Kwon HY, Choi IK, Rhee DK
Analyses of single nucleotide polymorphisms and haplotype linkage of the human ABCB1 (MDR1) gene in Korean.
Arch Pharm Res. 2006 Dec;29(12):1132-9., [PMID:17225463]

Abstract [show]
Single nucleotide polymorphisms (SNPs) in the MDR1 gene that are responsible for drug efflux can cause toxicity. Therefore, this study determined the SNPs of the Korean MDR1 gene, and analyzed the haplotypes and a linkage disequilibrium (LD) of the SNPs determined. The frequency of 9 SNPs from the MDR1 gene was determined by PCR-RFLP analyses of 100 to 500 healthy individuals. The frequcies of the SNPs were C3435T (47.7%), G2677T (37.6%), G2677A (4.4%), T1236C (21.7%), T129C (8%), A2956G (2.5%), T307C (1.5%), A41aG (9.2%), C145G (0%), and G4030C (0 %). Analyses of the haplotype structure and an estimation of the LD of the combined polymorphisms demonstrated that the frequency of the 1236T-2677G-3435T haplotype is much higher in Koreans (14.1%) than in Chinese and western black Africans and the C3435T SNP in Koreans appears to have LD with T129C in Koreans for the first time. These results provide insight into the genetic variation of MDR1 in Koreans, and demonstrated the possibility of a new LD in this gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 The frequcies of the SNPs were C3435T (47.7%), G2677T (37.6%), G2677A (4.4%), T1236C (21.7%), T129C (8%), A2956G (2.5%), T307C (1.5%), A41aG (92%), C145G (0%), and G4030C (0 %). Login to comment
44 Eleven haplotypes were detected in pairwise of 3 SNPs (T1236C, G2677T/A, C3435T) using Haplotype analyses. Login to comment
53 The allele frequencies of the 9 MDR1 SNPs and the sample numbers were C3435T 47.7% (n=500), G2677T 37.6% (n=500), G2677A 4.4% (n=500), T1236C 21.7% (n=500), A41aG 9.2% (n=388), T129C 8% (n=lO0), A2956G 2.5% (n=lO0), and T307C 1.5% (n=lO0). Login to comment
55 There were 4 point mutations (T307C, G2677T/A, and A2956G) among the 9 SNPs that caused an amino acid exchange in MDR1, but not the others (C3435T, T1236C, A41aG, T129C, C-145G, and G4030C) (Table II). Login to comment
65 Haplotype and LD analysis The most frequent 3 SNPs (T1236C, G2677T/A, C3435T) were further analyzed for their haplotype. Login to comment
66 The frequency of the 11 haplotypes in T1236C-G2677T/A-C3435T loci were T-G-C (28.1%), T-T-T (25.1%), C-G-C (14.2%), T-GT (14.1%), T-T-C (7.6%), C-T-T (4.3%), C-A-C (2.1%), TA-C (1.9%), C-G-T (1.6%), C-T-C (0.6%), and T-A-T (0.4%). Login to comment
71 C3435T SNP was shown to have relationship with the T1236C (D' value of 0.64), T129C (D' value of 0.58), A41aG (D' value of 0.32), and G2677T (D' value of 0.37) SNPs. Login to comment
73 This suggests that C3435T SNP has some relationship with the other 4 SNPs, whereas the G2677T SNP has a relationship with A41aG T129C T1236C G2677T C3435T A41aG T129C 0.19 T1236C 0.17 G2677T 0.14 C3435T 0.32* 0.05 0.58* 0.06 0.58* 0.64* 0.37* T129C T1236C G2677T C3435T A41aG T129C T1236C G2677T Fig. 2. Login to comment
79 DISCUSSION In this study, the frequencies of 3 SNPs from 500 samples showed that C3435T (47.7%) was the most frequent followed by G2677T (37.6%), and T1236C (21.7%). Login to comment
80 In contrast, Yi et aL (2004) reported that T1236C was the most frequent (38.1%) followed by G2677T Table t|i. Login to comment
97 The 3rd most frequent SNP, T1236C SNP, detected at the exon 12, which affected the expression and function of P-gp (Marzolini et al., 2004; Kim et al., 2001; Goto et al., 2002; IIImer et al., 2002), was similar to those reported in other Asian populations (Japanese, Chinese, Indian, Malay) but much higher than those reported in Caucasians (34-41%) and Africans (15%) (Table III). Login to comment
98 When the LD for all pairs of exons 12, 21, and 26 (3 SNPs T1236C, G2677T/A, and C3435T) were examined, of the 12 possible haplotypes, 11 and 12 were observed in the Korean and Chinese subjects, respectively (Zhang et al., 2005), and these haplotype numbers were much larger than those in western black Africans (6 haplotypes; Allabi et al., 2005), Benineses (8 haplotypes), African-Americans (8 haplotypes), Caucasians (10 haplotypes) (Kroetz et al., 2003; Allabi et al., 2005), Malays (6 haplotypes), Chinese (10 haplotypes), and Indians (9 haplotypes; Tang et al., 2002). Login to comment
115 Two synonymous SNPs (T1236C and C3435T) and a non-synonymous SNP (G2677T, Ala893Ser) were found to be linked in 62% of European Americans and 13% of African Americans (Kim et al., 2001; Goto et al., 2002; IIImer et al., 2002). Login to comment
116 This study also confirmed this similar linkage in Koreans, and the T1236C was linked to an exon 26 (C3435T) and exon 21 (G2677T) SNPs in 64% and 37% of cases, relatively. Login to comment
120 A LD was also found in the C3435T SNP with T129C, and T1236C. Login to comment

[hide] Association between Genetic Polymorphism of Multid... Evid Based Complement Alternat Med. 2009 Sep;6 Suppl 1:73-80. Kim HJ, Hwang SY, Kim JH, Park HJ, Lee SG, Lee SW, Joo JC, Kim YK
Association between Genetic Polymorphism of Multidrug Resistance 1 Gene and Sasang Constitutions.
Evid Based Complement Alternat Med. 2009 Sep;6 Suppl 1:73-80., [PMID:19745014]

Abstract [show]
Multidrug resistance 1 (MDR1) is a gene that expresses P-glycoprotein (P-gp), a drug transporter protein. Genetic polymorphisms of MDR1 can be associated with Sasang constitutions because Sasang constitutional medicine (SCM) prescribes different drugs according to different constitutions. A Questionnaire for Sasang Constitution Classification II (QSCC II) was used to diagnose Sasang constitutions. Two hundred and seven healthy people whose Sasang constitutions had been identified were tested. Genotype analyses, restriction fragment length polymorphism (RFLP) and pyrosequencing were used in MDR1 C1236T, and in MDR1 G2677T/A and C3435T, respectively. Significant differences in MDR1 C1236T genotypes were found between So-yangin and So-eumin. MDR1 G2677T/A genotype also showed significant differences in allele distribution between So-yangin and Tae-eumin. So-yangin and So-eumin showed significant differences in the distribution of both 1236C-2677G-3435C and 1236T-2677G-3435T, haplotypes of MDR1. The genetic polymorphism of the MDR1 gene was thus shown to be an indicator that could distinguish So-yangin from other constitutions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 Haplotype frequencies of MDR1 SNPs in Sasang constitutions Haplotypes of MDR1 gene Haplotype frequency in each group P* T1236C G2677T/A C3435T Tae-eumin (n ¼ 51) (%) So-yangin (n ¼ 56) (%) So-eumin (n ¼ 100) (%) Pa /Pb /Pc T T T 24.08 26.47 28.58 0.68/0.68/0.40 C G C 22.44 13.70 23.18 0.09/0.04/0.88 T G C 24.22 15.83 17.14 0.12/0.76/0.14 C A C 13.44 14.46 14.98 0.82/0.90/0.71 T T C 5.24 5.26 4.53 0.99/0.77/0.78 T G T 5.00 6.19 1.72 0.70/0.03/0.10 C T C 2.05 5.39 3.39 0.20/0.39/0.51 T A C 1.25 7.86 1.28 0.02/0.002/0.98 C T T - 4.85 - 0.02/0.001/- T A T - - 2.74 -/0.07/0.32 C G T 1.29 - 2.45 0.22/0.09/0.50 Dash indicates values below 0.01%; a Tae-eumin versus So-yangin; b So-yangin versus So-eumin; c Tae-eumin versus So-eumin; *Values calculated by 2 -test. Table 3. Frequencies of MDR1 C1236T genotype and Sasang constitutions Tae-eumin (n ¼ 51) (%) So-yangin (n ¼ 56) (%) So-eumin (n ¼ 100) (%) P* T/T 17 (33.3) 23 (41.1) 25 (25.0) C/T 28 (54.9) 23 (41.1) 62 (62.0) 0.33a /0.03b /0.55c C/C 6 (11.8) 10 (17.9) 13 (13.0) a Tae-eumin versus So-yangin; b So-yangin versus So-eumin; c Tae-eumin versus So-eumin; *Values calculated by 2 -test. Table 4. Frequencies of MDR1 G2677T/A allele in Sasang constitutions Tae-eumin (n ¼ 102) (%) So-yangin (n ¼ 112) (%) So-eumin (n ¼ 200) (%) P* G 54 (52.9) 40 (35.7) 89 (44.5) 0.04a /0.31b /0.37c T 32 (31.4) 47 (42.0) 73 (36.5) A 16 (15.7) 25 (22.3) 38 (19.0) a Tae-eumin versus So-yangin; b So-yangin versus So-eumin; c Tae-eumin versus So-eumin; *Values calculated by 2 -test. Table 2. Login to comment
129 Table 6. Frequencies of MDR1 haplotypes in Korean compared with other populations Haplotypes of MDR1 gene German Caucasian % Chinese Han % Korean % T1236C G2677T/A C3435T (n ¼ 461) (n ¼ 165) (n ¼ 207) T T T 41.0 33.3 26.5 C G C 37.0 20.1 20.4 T G C 1.0 22.2 18.6 C A C 2.5 11.3 14.5 T T C 2.5 5.6 5.2 T G T 0.5 1.0 3.9 C T C 1.5 1.7 3.4 T A C 0.0 1.2 2.9 C T T 1.0 1.6 1.7 T A T 0.0 0.4 1.6 C G T 12.0 1.2 1.3 C A T 1.0 0.4 0.0 Reference 19 24 This study Particularly as in Sai et al., haplotype 1236T-2677T-3435T showed the highest frequency in Japanese and Koreans. Login to comment

[hide] Multidrug resistance gene (MDR1) polymorphisms cor... Med Oncol. 2011 Mar;28(1):265-9. Epub 2010 Mar 4. Ni LN, Li JY, Miao KR, Qiao C, Zhang SJ, Qiu HR, Qian SX
Multidrug resistance gene (MDR1) polymorphisms correlate with imatinib response in chronic myeloid leukemia.
Med Oncol. 2011 Mar;28(1):265-9. Epub 2010 Mar 4., [PMID:20204543]

Abstract [show]
The human multidrug resistance gene (MDR1, ABCB1) codes for P-glycoprotein (P-gp) that affects the pharmacokinetics of many drugs. MDR1 single nucleotide polymorphisms (SNPs) are associated with drug clearance. Imatinib is a substrate of P-gp-mediated efflux. We investigated the MDR1 T1236C, G 2677T/A, and C3435T polymorphism in 52 patients with chronic myeloid leukemia treated with imatinib. The distribution of MDR1 1236, 2677, or 3435 genotypes was significantly different between the resistance patients and sensitivity patients. The resistance incidence correlated with the number of T alleles at locus 1236 and 3435. Resistance was higher for patients homozygous for the 1236T allele when compared to patients with CT/CC genotype groups (75% vs. 31.3%, P = 0.004). For the G2677T/A polymorphism, a better complete cytogenetic remission was observed for patients with genotype AG/AT/AA, when compared to other genotype groups (TT/GT/GG, P = 0.02). Patients with 3435 TT/CT genotypes showed a higher resistance when compared with patients with CC genotype (59.4% vs. 25%, P = 0.023). In conclusion, determination of 1236T, C3435T, and G2677T MDR1 polymorphisms might be useful in response prediction to therapy with imatinib in patients with CML.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 We investigated the MDR1 T1236C, G 2677T/A, and C3435T polymorphism in 52 patients with chronic myeloid leukemia treated with imatinib. Login to comment
17 The SNPs T1236C, G 2677T/A, and C3435T are the most common variants in the coding region of ABCB1 [3]. Login to comment
21 Therefore, it is important that we analyze the T1236C, G2677T/A, and C3435T most relevant SNPs to identify genetic variants underlying susceptibility to imatinib efficacy in Chinese. Login to comment

[hide] Multidrug resistance 1 (MDR1) gene polymorphisms i... J Child Neurol. 2010 Dec;25(12):1485-90. Epub 2010 May 6. Alpman A, Ozkinay F, Tekgul H, Gokben S, Pehlivan S, Schalling M, Ozkinay C
Multidrug resistance 1 (MDR1) gene polymorphisms in childhood drug-resistant epilepsy.
J Child Neurol. 2010 Dec;25(12):1485-90. Epub 2010 May 6., [PMID:20448249]

Abstract [show]
Despite considerable progress in the pharmacotherapy of epilepsy, more than 30% of patients are reported to be resistant to antiepileptic drugs. Multidrug resistance 1 (MDR1) gene could play a role in drug resistance in epilepsy. In this study, the authors investigated the association between the MDR1 gene polymorphisms, C3435T and G2677AT, and drug resistance epilepsy by using polymerase chain reaction/restriction fragment length polymorphism and pyrosequencing methods in a group of 39 patients with drug-resistant epilepsy and 92 controls. No associations were found between the polymorphisms of the MDR1 gene and drug-resistant epilepsy. Haplotype analysis showed no significant association. Compound genotype analysis showed that CC3435/GG2677 was significantly higher in the control group compared to the patient group. In conclusion, MDR1 polymorphisms investigated in this study are not associated with antiepileptic drug resistance, but the CC3435/GG2677 compound genotype might have an effect on antiepileptic drug response.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 To date, more than 50 polymorphisms have been identified within the MDR1 gene.7 C3435T, G2677AT, and T1236C are the most commonly investigated polymorphisms. Login to comment

[hide] Associations between variants in the ABCB1 (MDR1) ... Inflamm Bowel Dis. 2011 Jan 6. Krupoves A, Mack D, Seidman E, Deslandres C, Amre D
Associations between variants in the ABCB1 (MDR1) gene and corticosteroid dependence in children with crohn's disease.
Inflamm Bowel Dis. 2011 Jan 6., 2011-01-06 [PMID:21213280]

Abstract [show]
BACKGROUND:: Corticosteroids (CS) effectively induce remission in patients with moderate to severe Crohn's disease (CD). However, CS dependence in children is a significant clinical problem associated with numerous side effects. Identification of molecular markers of CS dependence is of paramount importance. The ABCB1 gene codes for P-glycoprotein, a transporter involved in the metabolism of CS. We examined whether DNA variation in the ABCB1 gene was associated with CS dependency in children with CD. METHODS:: A retrospective study was carried out in two Canadian tertiary pediatric gastroenterology centers. Clinical information was abstracted from medical charts of CD patients (N = 260) diagnosed with CD prior to age 18 and administered a first course of CS during the 1 year since diagnosis. Patients were classified as CS-dependent if they relapsed during drug tapering or after the end of therapy. DNA was extracted from blood or saliva. Thirteen tagging single nucleotide polymorphisms (tag-SNPs) and a synonymous variation (C3435T) in the ABCB1 gene were genotyped. Allelic, genotype, and haplotype associations were examined using logistic regression and Haploview. RESULTS:: Tag-SNP rs2032583 was statistically significantly associated with CS dependency. The rare C allele of this SNP (odds ratio [OR] = 0.56, 95% confidence interval [CI]: 0.34-0.95, P = 0.029) and heterozygous genotype TC (OR = 0.52, 95% CI: 0.28-0.95, P = 0.035) conferred protection from CS dependency. A three-marker haplotype was significantly associated with CS dependence (multiple comparison corrected P-value = 0.004). CONCLUSIONS:: Our results suggest that the ABCB1 gene may be associated with CS dependence in pediatric CD patients. (Inflamm Bowel Dis 2011;).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 Indeed, three polymorphisms in the gene, C3435T (rs1045642), T1236C (rs1128503), and triallelic SNP G2677T/A, have been shown to affect the expression of the Pg.47 FIGURE 1. Login to comment

[hide] Frequency of the C1236T, G2677T/A and C3435T MDR1 ... Pharmacol Rep. 2011 May-Jun;63(3):808-14. Milojkovic M, Stojnev S, Jovanovic I, Ljubisavljevic S, Stefanovic V, Sunder-Plassman R
Frequency of the C1236T, G2677T/A and C3435T MDR1 gene polymorphisms in the Serbian population.
Pharmacol Rep. 2011 May-Jun;63(3):808-14., [PMID:21857092]

Abstract [show]
The multi-drug resistance 1 (MDR1) gene encodes for a P-glycoprotein (PGP), which acts as a gate-keeper against various kinds of xenobiotics. Several single nucleotide polymorphisms (SNPs) in the MDR1 gene that may influence PGP level and function have been identified. The aim of this study was to simultaneously analyze the three most important MDR1 SNPs, C3435T, G2677T/A and C1236T, in the Serbian population and to compare the results with those published for other ethnic groups. A group of 158 unrelated, healthy subjects was included in the present study. For determination of MDR1 SNPs, a multiplexed mutagenically separated PCR was performed. The genotype frequency of the analyzed MDR1 SNPs was as follows: 3435 nt - 0.19 (CC), 0.54 (CT) and 0.27 (TT); 2677 nt - 0.26 (GG), 0.52 (GT), 0.15 (TT), 0.03 (GA) and 0.064 (TA), and 1236 nt - 0.23 (CC), 0.61 (CT) and 0.16 (TT). Our results for the Serbian population could be relevant for further investigation of drugs that are substrates of PGPand for studies of interethnic diversity in MDR1 polymorphism frequency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Genotype frequencies of MDR1 variants observed in this study compared with those found in other populations Position C3435T G2677T/A T1236C Reference Population N CC CT TT GG GT GA TT TA AA CC CT TT Serbian 158 0.19 0.54 0.27 0.26 0.52 0.03 0.15 0.04 0.00 0.23 0.61 0.16 This study German 461 0.21 0.50 0.29 0.31 0.49 0.02 0.16 0.02 0.00 0.35** 0.49* 0.16 [4] Russian 290;59 0.21 0.49 0.30 0.30 0.45 0.04 0.18 0.03 0.00 0.24 0.56 0.20 [10, 11] Portuguese 100 0.12 0.47 0.41* 0.31 0.43 N. a. Login to comment

[hide] Associations between variants in the ABCB1 (MDR1) ... Inflamm Bowel Dis. 2011 Nov;17(11):2308-17. doi: 10.1002/ibd.21608. Epub 2011 Jan 6. Krupoves A, Mack D, Seidman E, Deslandres C, Amre D
Associations between variants in the ABCB1 (MDR1) gene and corticosteroid dependence in children with Crohn's disease.
Inflamm Bowel Dis. 2011 Nov;17(11):2308-17. doi: 10.1002/ibd.21608. Epub 2011 Jan 6., [PMID:21987299]

Abstract [show]
BACKGROUND: Corticosteroids (CS) effectively induce remission in patients with moderate to severe Crohn's disease (CD). However, CS dependence in children is a significant clinical problem associated with numerous side effects. Identification of molecular markers of CS dependence is of paramount importance. The ABCB1 gene codes for P-glycoprotein, a transporter involved in the metabolism of CS. We examined whether DNA variation in the ABCB1 gene was associated with CS dependency in children with CD. METHODS: A retrospective study was carried out in two Canadian tertiary pediatric gastroenterology centers. Clinical information was abstracted from medical charts of CD patients (N = 260) diagnosed with CD prior to age 18 and administered a first course of CS during the 1 year since diagnosis. Patients were classified as CS-dependent if they relapsed during drug tapering or after the end of therapy. DNA was extracted from blood or saliva. Thirteen tagging single nucleotide polymorphisms (tag-SNPs) and a synonymous variation (C3435T) in the ABCB1 gene were genotyped. Allelic, genotype, and haplotype associations were examined using logistic regression and Haploview. RESULTS: Tag-SNP rs2032583 was statistically significantly associated with CS dependency. The rare C allele of this SNP (odds ratio [OR] = 0.56, 95% confidence interval [CI]: 0.34-0.95, P = 0.029) and heterozygous genotype TC (OR = 0.52, 95% CI: 0.28-0.95, P = 0.035) conferred protection from CS dependency. A three-marker haplotype was significantly associated with CS dependence (multiple comparison corrected P-value = 0.004). CONCLUSIONS: Our results suggest that the ABCB1 gene may be associated with CS dependence in pediatric CD patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
91 Indeed, three polymorphisms in the gene, C3435T (rs1045642), T1236C (rs1128503), and triallelic SNP G2677T/A, have been shown to affect the expression of the Pg.47 FIGURE 1. Login to comment

[hide] The influence of ATP-binding cassette sub-family B... Int J Obstet Anesth. 2010 Jul;19(3):254-60. Epub 2010 Jun 2. Sia AT, Sng BL, Lim EC, Law H, Tan EC
The influence of ATP-binding cassette sub-family B member -1 (ABCB1) genetic polymorphisms on acute and chronic pain after intrathecal morphine for caesarean section: a prospective cohort study.
Int J Obstet Anesth. 2010 Jul;19(3):254-60. Epub 2010 Jun 2., [PMID:20627697]

Abstract [show]
BACKGROUND: Polymorphisms of the ATP-binding cassette sub-family B member -1 (ABCB1) gene that codes for P-glycoprotein could influence the efflux of morphine from the central nervous system affecting its analgesic action. We investigated the effect of ABCB1 gene polymorphisms on analgesia and the development of persistent pain in post caesarean patients. METHODS: Women of Chinese descent who received spinal anaesthesia with intrathecal morphine for elective caesarean section were recruited. They were given intravenous morphine via a patient-controlled analgesia pump for postoperative analgesia. Blood samples were collected and analysed for the presence of C1236T, G2677T/A and C3435T single nucleotide polymorphisms of the ABCB1 gene. We primarily investigated the association between ABCB1 polymorphisms and the effect of morphine. In a postpartum phone survey of the subjects six months after surgery, the occurrence of persistent abdominal wound scar pain was established. RESULTS: We found no significant statistical difference in total morphine consumption, pain scores and side effects among the various genotypes. For C3435T polymorphism, there was a trend towards the association of the T allele and persistent pain for three months after surgery but this did not reach statistical significance (P=0.07). The TT genotype had the longest mean survival time of wound pain in comparison with CT and CC genotypes (P=0.004 and P=0.014, respectively). CONCLUSION: Polymorphisms of ABCB1 were not associated with differences in morphine use in the first 24h after surgery. Women with the T allele of C3435T polymorphism showed a trend towards a higher risk of developing persistent postoperative pain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Table 1 Personal characteristics Age (yr) Weight (kg) Height (cm) Previous caesarean section Duration of surgery (min) Pain scores in recovery (0-10 VAS) SNP C3435T CC (n = 190, 31%) 32.2 (4.6) 69.2 (10) 158 (5.5) 70 (37) 51.9 (16) 0 [0-3] CT (n = 319, 51%) 32.5 (4.8) 69.3 (11) 158 (5.5) 112 (35) 52.2 (16) 0 [0-2] TT (n = 111, 18%) 32.5 (4.6) 68.9 (10) 159 (5.6) 43 (39) 54.8 (15) 0 [0-4] SNP T1236C TT (n = 288, 47%) 32.6 (4.6) 69.1 (10) 158 (5.9) 108 (37) 52.6 (17) 0 [0-4] TC (n = 263, 42%) 32.3 (4.6) 69.2 (9.2) 159 (5.3) 96 (37) 53.2 (16) 0 [0-3] CC (n = 61, 11%) 32.9 (5.0) 70.0 (14) 158 (5.8) 21 (34) 51.5 (11) 0 [0-3] SNP 2677 Homozygous T (n = 100, 16%) 32.0 (4.7) 70.0 (11) 159 (5.2) 38 (38) 53.2 (15) 0 [0-3] Heterozygous T (n = 308, 50%) 32.6 (4.5) 69.0 (11) 158 (5.6) 111 (36) 52.5 (17) 0 [0-4] No allele T (n = 205, 34%) 32.4 (4.7) 68.5 (9.1) 160 (3.8) 76 (37) 53.2 (16) 0 [0-3] SNP 2677 Homozygous G (n = 130, 21%) 32.3 (4.7) 68.8 (9.0) 159 (5.4) 51 (39) 54.6 (16) 0 [0-2] Heterozygous G (n = 327, 53%) 32.5 (4.5) 70.0 (11) 158 (5.6) 113 (35) 51.7 (16) 0 [0-2] No allele G (n = 156, 26%) 32.4 (4.7) 67.6 (10) 159 (5.3) 61 (40) 53.1 (15) 0 [0-3] SNP 2677 Homozygous A (n = 7, 1%) 32.5 (4.7) 67.8 (10) 158 (5.5) 3 (43) 54.0 (9) 0 [0-0] Heterozygous A (n = 117, 19%) 32.8 (4.6) 70.0 (11) 159 (5.6) 42 (36) 52.4 (15) 0 [0-3] No allele A (n = 489, 80%) 32.4 (5.2) 68.8 (9.8) 158 (5.3) 180 (37) 52.7 (16) 0 [0-4] The frequency of each SNP is expressed as absolute numbers (n), percentage of total (%); Data are mean (SD) except parturients with previous cesarean section, which are n (%) and pain scores which are median [range]; No statistically significant differences were found among the genotypes. Login to comment
88 Table 2 Data in the first 24 h after caesarean section Total morphine consumption (mg) Total pain scores (0-10 VAS) Total pruritus (0-3 severity score) Total nausea (0-3 severity score) Total episodes of vomiting SNP C3435T CC (n = 190) 6.9 (7.3) 2 [0-24] 0 [0-10] 0 [0-6] 0 [0-4] CT (n = 319) 7.3 (8.4) 2 [0-17] 0 [0-12] 0 [0-2] 0 [0-8] TT (n = 111) 7.6 (8.0) 2 [0-14] 0 [0-11] 0 [0-3] 0 [0-3] SNP T1236C TT (n = 288) 7.3 (8.5) 2 [0-24] 0 [0-12] 0 [0-3] 0 [0-3] TC (n = 263) 6.9 (7.7) 2 [0-17] 0 [0-12] 0 [0-6] 0 [0-8] CC (n = 61) 8.4 (8.7) 2 [0-13] 0 [0-12] 0 [0-6] 0 [0-3] SNP 2677 Homozygous T (n = 100) 8.0 (9.3) 2 [0-24] 2 [0-11] 0 [0-3] 0 [0-3] Heterozygous T (n = 308) 6.8 (7.6) 2 [0-14] 0 [0-12] 0 [0-3] 0 [0-8] No allele T (n = 205) 7.7 (8.5) 2 [0-14] 0 [0-11] 0 [0-6] 0 [0-4] SNP 2677 Homozygous G (n = 130) 7.2 (7.8) 2 [0-14] 0.5 [0-11] 0 [0-6] 0 [0-8] Heterozygous G (n = 327) 7.2 (8.1) 2 [0-14] 0 [0-12] 0 [0-3] 0 [0-4] No allele G (n = 156) 7.5 (8.6) 2 [0-24] 1 [0-1]) 0 [0-3] 0 [0-3] SNP 2677 Homozygous A (n = 7) 3.0 (2.4) 0 [0-8] 0 [0-9] 0 [0-0] 0 [0-0] Heterozygous A (n = 117) 8.2 (8.9) 4 [0-14] 0 [0-12] 0 [0-3] 0 [0-8] No allele A (n = 489) 7.1 (8.0) 2 [0-24] 0 [0-12] 0 [0-6] 0 [0-3] Data are median [range] except nausea and morphine consumption which are actual number of episodes and mean (SD), respectively; No statistically significant differences were found among the genotypes. Login to comment
113 0.18 for CC, CT and TT, respectively (with an allelic frequency of 0.56 for C); our results were not dissimilar to the Chinese population in a previous study.10 Also, the presence of the T allele at position 2677, which was found to be closely linked to C3435T SNP in a previous study, has been shown to result in a reduced expression of Table 3 Data on persistent pain after caesarean section Incidence of persistent pain for 3 months or longer [n (%)] Survival time of post operative pain (months) SNP C3435T CC (n = 164) 9 (5.5) 1.43 (0.06) CT (n = 248) 17 (6.9) 1.42 (0.05) TT (n = 89) 12 (13.5)a 1.72 (0.11)b SNP T1236C TT (n = 233) 24 (10.3) 1.50 (0.06) TC (n = 209) 8 (3.8) 1.33 (0.05) CC (n = 54) 6 (11) 1.40 (0.13) SNP 2677 Homozygous T (n = 100) 8. Login to comment
116 P-glycoprotein in the placenta.11 SNP T1236C has also been found to have an impact on methadone dose requirements in chronic opioid users even though its impact on the effectiveness of morphine is undetermined.12 However, while the blood brain barrier could be an important site for modulation of morphine in mice,2 there is to date, no evidence of an association between the SNP which we investigated in this study, and any clinically relevant differences in the quality of analgesia rendered by morphine in postoperative patients. Login to comment
89 Table 2 Data in the first 24 h after caesarean section Total morphine consumption (mg) Total pain scores (0-10 VAS) Total pruritus (0-3 severity score) Total nausea (0-3 severity score) Total episodes of vomiting SNP C3435T CC (n = 190) 6.9 (7.3) 2 [0-24] 0 [0-10] 0 [0-6] 0 [0-4] CT (n = 319) 7.3 (8.4) 2 [0-17] 0 [0-12] 0 [0-2] 0 [0-8] TT (n = 111) 7.6 (8.0) 2 [0-14] 0 [0-11] 0 [0-3] 0 [0-3] SNP T1236C TT (n = 288) 7.3 (8.5) 2 [0-24] 0 [0-12] 0 [0-3] 0 [0-3] TC (n = 263) 6.9 (7.7) 2 [0-17] 0 [0-12] 0 [0-6] 0 [0-8] CC (n = 61) 8.4 (8.7) 2 [0-13] 0 [0-12] 0 [0-6] 0 [0-3] SNP 2677 Homozygous T (n = 100) 8.0 (9.3) 2 [0-24] 2 [0-11] 0 [0-3] 0 [0-3] Heterozygous T (n = 308) 6.8 (7.6) 2 [0-14] 0 [0-12] 0 [0-3] 0 [0-8] No allele T (n = 205) 7.7 (8.5) 2 [0-14] 0 [0-11] 0 [0-6] 0 [0-4] SNP 2677 Homozygous G (n = 130) 7.2 (7.8) 2 [0-14] 0.5 [0-11] 0 [0-6] 0 [0-8] Heterozygous G (n = 327) 7.2 (8.1) 2 [0-14] 0 [0-12] 0 [0-3] 0 [0-4] No allele G (n = 156) 7.5 (8.6) 2 [0-24] 1 [0-1]) 0 [0-3] 0 [0-3] SNP 2677 Homozygous A (n = 7) 3.0 (2.4) 0 [0-8] 0 [0-9] 0 [0-0] 0 [0-0] Heterozygous A (n = 117) 8.2 (8.9) 4 [0-14] 0 [0-12] 0 [0-3] 0 [0-8] No allele A (n = 489) 7.1 (8.0) 2 [0-24] 0 [0-12] 0 [0-6] 0 [0-3] Data are median [range] except nausea and morphine consumption which are actual number of episodes and mean (SD), respectively; No statistically significant differences were found among the genotypes. Login to comment
114 0.18 for CC, CT and TT, respectively (with an allelic frequency of 0.56 for C); our results were not dissimilar to the Chinese population in a previous study.10 Also, the presence of the T allele at position 2677, which was found to be closely linked to C3435T SNP in a previous study, has been shown to result in a reduced expression of Table 3 Data on persistent pain after caesarean section Incidence of persistent pain for 3 months or longer [n (%)] Survival time of post operative pain (months) SNP C3435T CC (n = 164) 9 (5.5) 1.43 (0.06) CT (n = 248) 17 (6.9) 1.42 (0.05) TT (n = 89) 12 (13.5)a 1.72 (0.11)b SNP T1236C TT (n = 233) 24 (10.3) 1.50 (0.06) TC (n = 209) 8 (3.8) 1.33 (0.05) CC (n = 54) 6 (11) 1.40 (0.13) SNP 2677 Homozygous T (n = 100) 8. Login to comment
117 P-glycoprotein in the placenta.11 SNP T1236C has also been found to have an impact on methadone dose requirements in chronic opioid users even though its impact on the effectiveness of morphine is undetermined.12 However, while the blood brain barrier could be an important site for modulation of morphine in mice,2 there is to date, no evidence of an association between the SNP which we investigated in this study, and any clinically relevant differences in the quality of analgesia rendered by morphine in postoperative patients. Login to comment

[hide] Single nucleotide polymorphisms in the multidrug r... Seizure. 2006 Jan;15(1):67-72. Kim YO, Kim MK, Woo YJ, Lee MC, Kim JH, Park KW, Kim EY, Roh YI, Kim CJ
Single nucleotide polymorphisms in the multidrug resistance 1 gene in Korean epileptics.
Seizure. 2006 Jan;15(1):67-72., [PMID:16386926]

Abstract [show]
PURPOSE: P-glycoprotein 170 encoded by the multidrug resistance 1 (MDR1) gene exports various antiepileptic drugs out of the CNS, which leads to multidrug resistance. This study was performed to elucidate the relationship between single nucleotide polymorphisms (SNPs) in the MDR1 gene and drug resistance in Koreans with epilepsy. SUBJECTS AND METHODS: Three SNPs at nucleotide position 1236 in exon 12, 2677 in exon 21 and 3435 in exon 26 of the MDR1 gene were genotyped in 207 Korean epileptics. Subjects were classified according to whether they had drug-resistant (RS group; N=99) or drug-responsive epilepsy (RP group; N=108). The frequencies of genotype and haplotype were compared between the RS and RP groups. RESULTS: The frequencies of genotype and haplotype in the RS group were not statistically different from those in the RP group. CONCLUSIONS: In Korean epileptics, there was no significant relationship between three known SNPs in MDR1 and drug resistance. And there was no association of MDR1 haplotype based on above three sites with pharmacoresistance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Among these proteins, P-glycoprotein 170, which is the product of the ATP-binding cassette subfamily b member 1 (ABCB1), also known as the multidrug resistance 1 (MDR1) gene, is the most extensively studied.4 P-glycoprotein 170 is an energy-dependent efflux pump that exports several antiepileptic drugs,4,6 including carbamazepine,7 phenytoin,8 phenobarbital, lamotrigine, and felbamate.9 Single nucleotide polymorphisms (SNPs) in the MDR1 gene have been described, including T1236C in exon 12, G2677T/A in exon 21, and C3435T in exon 26. Login to comment
62 But the BBB represents a serous obstacle in achieving appropriate drug concentrations in the CNS.19 The P-glycoprotein of an efflux transporter in the BBB is a 170-kDa transmembrane phosphoglycoprotein that is encoded by the MDR1 gene, which is located on chromosome 7 and consists of 28 exons.6,20 The P-glycoprotein expression levels in different tissues are not constant, but rather change in response to various agents and environmental factors.20 In epileptics, P-glycoprotein is overexpressed in endothelial cells of the BBB and is expressed at sites at which P-glycoprotein is not expressed in normal subjects, e.g., in astrocytes and neurons.21-23 Mutations in MDR1 influence the expression or function of P-glycoprotein in normal tissues.24 Approximately 28 SNPs have been identified in MDR1, among which the SNPs of T1236C in exon 12, G2677A/T in exon 21, and C3425T in exon 26 are the most commonly reported in normal subjects 70 Y.O. Kim et al. Table 3 Genotype frequencies at nucleotide site 2677 in exon 21 of MDR1 Genotype Genotype frequency, N (%) P value Odds ratio 95% C.I. RS [N, 99] RP [N, 107] GG 19 (19.2) 17 (15.9) 0.66 1.26 0.61-2.58 GT 33 (33.3) 40 (37.4) 0.64 0.84 0.47-1.48 GA 22 (22.2) 21 (19.6) 0.77 1.17 0.60-2.29 TA 12 (12.1) 15 (14.0) 0.84 0.85 0.37-1.91 TT 11 (11.1) 9 (8.4) 0.68 1.36 0.54-3.44 AA 2 (2.0) 5 (4.7) 0.49 0.42 0.08-2.22 N, total number; RS, patients with drug-resistant epilepsy; RP, patients with drug-responsive epilepsy. Login to comment
65 from different ethnic groups.15-17 The G2677A/T SNP in exon 21 is usually associated with an amino acid conversion from Ala to Thr and to Ser, respectively.15 On the other hand, the T1236C SNP in exon 12 is located in non-coding regions and the C3435T SNP in exon 26 does not lead to a change in the amino acid sequence.15 Nevertheless, silent SNPs may play important roles in drug resistance, since they may be in linkage disequilibrium with non-silent SNPs.3,15,25 The mutation at nucleotide position 3435 in exon 26 of MDR1 is the most frequently studied polymorphism in relation to multidrug resistance.3,10-12 Siddiqui et al.3 have reported an association between multidrug resistance in epileptics and the C3435T polymorphism in the drug transporter gene ABCB1. Login to comment
74 Moreover, MDR1 mutations may reveal the characteristics of specific MDR1 variants, which could lead to the development of inhibitors that are specific for individual variants.12 Single nucleotide polymorphisms 71 Table 5 Haplotype frequencies of three single nucleotide polymorphisms in the MDR1 gene Haplotype Haplotype frequency (%) P value Odds ratio 95% C.I. T1236C G2677T/A C3435T RS [N, 97] RP [N, 99] T G C 20.78 19.49 0.96 1.09 0.54-2.21 T G T 1.07 4.68 0.28 0.20 0.02-1.71 T T C 10.40 9.13 0.95 1.15 0.45-2.96 T T T 17.12 15.74 0.95 1.10 0.52-2.33 T A C 1.06 0.59 0.67 1.02 0.06-16.56 T A T 10.40 8.95 0.92 1.15 0.45-2.96 C G C 19.91 17.24 0.77 1.18 0.57-2.42 C G T 0.00 0.00 C T C 16.54 16.12 0.91 1.02 0.48-2.19 C T T 0.79 1.44 0.80 1.02 0.06-16.56 C A C 1.94 6.62 0.21 0.28 0.06-1.37 C A T 0.00 0.00 N, total number; RS, patients with drug-resistant epilepsy; RP, patients with drug-responsive epilepsy. Login to comment

[hide] Role of human MDR1 gene polymorphism in bioavailab... Clin Pharmacol Ther. 2002 Aug;72(2):209-19. Kurata Y, Ieiri I, Kimura M, Morita T, Irie S, Urae A, Ohdo S, Ohtani H, Sawada Y, Higuchi S, Otsubo K
Role of human MDR1 gene polymorphism in bioavailability and interaction of digoxin, a substrate of P-glycoprotein.
Clin Pharmacol Ther. 2002 Aug;72(2):209-19., [PMID:12189368]

Abstract [show]
OBJECTIVE: Our objective was to quantitate the contribution of the genetic polymorphism of the human MDR1 gene to the bioavailability and interaction profiles of digoxin, a substrate of P-glycoprotein. METHODS: The pharmacokinetics of digoxin was studied in 15 healthy volunteers, who were divided into 3 groups (n = 5 each) on the basis of genotyping for the MDR1 gene, in a 4-dose study after single doses of digoxin alone (0.5 mg orally and intravenously) and coadministered with clarithromycin (400 mg orally for 8 days). The dose of digoxin was reduced during the clarithromycin phase (0.25 mg orally and intravenously). RESULTS: The bioavailability of digoxin in G/G2677C/C3435, G/T2677C/T3435, and T/T2677T/T3435 subjects were 67.6% +/- 4.3%, 80.9% +/- 8.9%, and 87.1% +/- 8.4%, respectively, and the difference between G/G2677C/C3435 and T/T2677T/T3435 subjects was statistically significant (P <.05). The MDR1 variants were also associated with differences in disposition kinetics of digoxin, with the renal clearance being almost 32% lower in T/T2677T/T3435 subjects (1.9 +/- 0.1 mL/min per kilogram) than G/G2677C/C3435 subjects (2.8 +/- 0.3 mL/min per kilogram), and G/T2677C/T3435 subjects having an intermediate value (2.1 +/- 0.6 mL/min per kilogram). Coadministration of clarithromycin did not consistently affect digoxin clearance or renal clearance. However, a significant increase in digoxin bioavailability was observed in G/G2677C/C3435 subjects (67.6% +/- 4.3% versus 85.4% +/- 6.1%; P <.05) but not in the other 2 genotype groups. CONCLUSION: The allelic variants in the human MDR1 gene are likely to be associated with altered absorption and/or disposition profiles of digoxin and P-glycoprotein-mediated drug interaction

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 1 5 14 15 16 2 7 9 11 12 3 4 6 10 13 5Ј-Flanking region A-41aG Noncoding A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A G/G Exon 1a C-145G Noncoding C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C Exon 1b T-129C Noncoding T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/C Exon 12 T1236C Gly412Gly C/C C/C T/T T/T T/C T/T C/C T/T T/T T/C T/T T/T T/T T/T T/T Exon 21 G2677T Ala893Ser G/G G/G G/G G/G G/G G/T G/T G/T G/T G/T T/T T/T T/T T/T T/T Exon 24 A2956G Met986Val A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A Exon 26 C3435T Ile1145I1e C/C C/C C/C C/C C/C C/T C/T C/T C/T C/T T/T T/T T/T T/T T/T Exon 28 G4030C Noncoding G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G Exon 28 A4036G Noncoding A/G A/A A/G A/A A/A A/G A/A G/G A/A A/A A/G A/G A/A A/G A/G Genotypic classification G/G2677C/C3435 G/T2677C/T3435 T/T2677T/T3435 Fig 1. Login to comment

[hide] The MDR1 (ABCB1) gene polymorphism and its clinica... Clin Pharmacokinet. 2004;43(9):553-76. Ieiri I, Takane H, Otsubo K
The MDR1 (ABCB1) gene polymorphism and its clinical implications.
Clin Pharmacokinet. 2004;43(9):553-76., [PMID:15217301]

Abstract [show]
There has been an increasing appreciation of the role of drug transporters in the pharmacokinetic and pharmacodynamic profiles of certain drugs. Among various drug transporters, P-glycoprotein, the MDR1 gene product, is one of the best studied and characterised. P-glycoprotein is expressed in normal human tissues such as liver, kidney, intestine and the endothelial cells of the blood-brain barrier. Apical (or luminal) expression of P-glycoprotein in these tissues results in reduced drug absorption from the gastrointestinal tract, enhanced drug elimination into bile and urine, and impeded entry of certain drugs into the central nervous system. The clinical relevance of P-glycoprotein depends on the localisation in human tissues (i.e. vectorial or directional movement), the therapeutic index of the substrate drug and the inherent inter- and intra-individual variability. With regard to the variability, polymorphisms of the MDR1 gene have recently been reported to be associated with alterations in disposition kinetics and interaction profiles of clinically useful drugs, including digoxin, fexofenadine, ciclosporin and talinolol. In addition, polymorphism may play a role in patients who do not respond to drug treatment. Moreover, P-glycoprotein is an important prognostic factor in malignant diseases, such as tumours of the gastrointestinal tract.A growing number of preclinical and clinical studies have demonstrated that polymorphism of the MDR1 gene may be a factor in the overall outcome of pharmacotherapy for numerous diseases. We believe that further understanding the physiology and biochemistry of P-glycoprotein with respect to its genetic variations will be important to establish individualised pharmacotherapy with various clinically used drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 [47] Membrane-spanning domain 1 Nucleotide binding domain 1 Membrane-spanning domain 2 Nucleotide binding domain 2 1 1280 Asn21࢐Asp Glu108࢐Lys Ser400࢐Asn Ala893࢐Thr/Ser Met986࢐Val Gln1107࢐Pro ATP site ATP site Phe103࢐Leu Asn183࢐Ser Arg492࢐Cys Ser1141࢐Thr T1236C C3396T C3435T Fig. 1. Login to comment
80 [Note: Tables II and III are a continuation of table I] Ethnic background Subject C+139T C+145T A548G G1199A T1236C C+44T C1474T T-76A A+137G (183N࢐S) (400S࢐N) (492R࢐C) C/T C/T A/G G/A T/C C/T C/T T/A A/G Asian/Oceanian Japanese (n = 100) [10] Placental cDNA 1.00/0 1.00/0 0.65/0.35 1.00/0 Japanese (n = 114) [55] Volunteers Chinese (n = 92-104) [54] Neonates (umbilical cords) 0.69/0.31 Chinese (n = 96-132) [56,57] Volunteers/blood donors 0.72/0.28 Filipino (n = 60) [56] Volunteers/blood donors Indian (n = 61-68) [54] Neonates (umbilical cords) 0.61/0.39 Indian (n = 87) [57] Volunteers 0.67/0.33 Malay (n = 80-93) [54] Neonates (umbilical cords) 0.69/0.31 Malay (n = 92) [57] Volunteers 0.66/0.34 Southwest (n = 89) [56] Volunteers/blood donors Middle East Saudi (n = 96) [56] Volunteers/blood donors African Ghanaian Volunteers/blood donors (n = 172-206) [56,58] Kenyan (n = 80) [56] Volunteers/blood donors Sudanese (n = 51) [56] Volunteers/blood donors African American African American Volunteers/blood donors 1.00/0 1.00/0 1.00/0 (n = 23-88) [52,56] Caucasian Caucasian German Volunteers 0.63/0.37 0.94/0.06 0.41/0.59 0.95/0.05 0.54/0.46 (n = 461) [51] Caucasian UK (n = 190) [56] Volunteers/blood donors Portuguese (n = 100) [56] Volunteers/blood donors Italian (n = 106) [59] Control for Parkinson`s disease Caucasian (n = 537) [3] Control for renal tumours Caucasian (n = 37-188) [9,52] Volunteers 0.59/0.41 0.99/0.01 0.99/0.01 (0.94-0.95)/ 0.62/0.38 0.94/0.06 0.99/0.01 0.55/0.45 0.99/0.01 (0.05-0.06) Continued next page or the volume of distribution at steady state. Login to comment
91 Contd Ethnic background Subject C+139T C+145T A548G G1199A T1236C C+44T C1474T T-76A A+137G (183N࢐S) (400S࢐N) (492R࢐C) C/T C/T A/G G/A T/C C/T C/T T/A A/G Specific patient groups Japanese (n = 17) [6] LDLT recipients 1.00/0 1.00/0 0.62/0.38 1.00/0 1.00/0 Japanese (n = 68-69) [7] LDLT recipients 0.37/0.63 1.00/0 0.65/0.35 1.00/0 0.68/0.32 Italian (n = 25) [59] Early onset Parkinson`s disease Italian (n = 70) [59] Late onset Parkinson`s disease Caucasian New Zealand Depressed patients (n = 160) [1] Caucasian (n = 124) [60] Renal transplant recipients Caucasian (n = 212) [3] Renal epithelial tumours LDLT = living donor liver transplantation. Login to comment

[hide] Association between ABCB1-T1236C polymorphism and ... Iran Biomed J. 2010 Jul;14(3):89-96. Maleki M, Sayyah M, Kamgarpour F, Karimipoor M, Arab A, Rajabi A, Gharagozli K, Shamshiri AR, Shahsavand Ananloo E
Association between ABCB1-T1236C polymorphism and drug-resistant epilepsy in Iranian female patients.
Iran Biomed J. 2010 Jul;14(3):89-96., [PMID:21079659]

Abstract [show]
BACKGROUND: One third of epileptic patients are resistant to several anti-epileptic drugs (AED). P-glycoprotein (P-gp) is an efflux transporter encoded by ATP-binding cassette subfamily B member 1 (ABCB1) gene that excludes drugs from the cells and plays a significant role in AEDs resistance. Over-expression of P-gp could be a result of polymorphisms in ABCB1 gene. We studied the association of T129C and T1236C single-nucleotide polymorphisms (SNP) of ABCB1 gene with drug-resistant epilepsy in Iranian epileptics. METHODS: DNA samples were obtained from 200 healthy controls and 332 epileptic patients, of whom 200 were drug responsive and 132 drug resistant. The frequencies of the genotypes of the two SNP were determined by polymerase chain reaction followed by restriction fragment length polymorphism. RESULTS: No significant association was found between T129C and T1236C genotypes and drug-resistant epilepsy neither in adults nor in children. However, the risk of drug resistance was higher in female patients with 1236CC (P = 0.02) or CT (P = 0.008) genotype than in those with TT genotype. The risk of drug resistance was also higher in patients with symptomatic epilepsies with 1236CC (P = 0.02) or CT (P = 0.004) genotype than in those with TT genotype. The risk of drug resistance was lower in patients with idiopathic epilepsies with 129TT genotype (P = 0.001) than in those with CT genotype. CONCLUSION: Our results indicate that T1236C polymorphism is associated with drug resistance in Iranian female epileptic patients. Replication studies with large sample sizes are needed to confirm our results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 We studied the association of T129C and T1236C single-nucleotide polymorphisms (SNP) of ABCB1 gene with drug-resistant epilepsy in Iranian epileptics. Login to comment
6 Results: No significant association was found between T129C and T1236C genotypes and drug-resistant epilepsy neither in adults nor in children. Login to comment
10 Conclusion: Our results indicate that T1236C polymorphism is associated with drug resistance in Iranian female epileptic patients. Login to comment
21 Association between single nucleotide polymorphisms (SNP) in the ABCB1 gene and refractory epilepsy has been studied by many researchers at different nucleotide positions such as T129C and T1236C in exon 12, G2677T in exon 21 and C3435T in exon 27 [9-15]. Login to comment
32 Therefore, this study proceeded to the association of two other most investigated SNP of the ABCB1 gene, T129C (rs2188524) and T1236C (rs1128503), with drug-resistant epilepsy in Iranian epileptic patients. Login to comment
53 SNP Primer sequences PCR product (bp) Restriction endonucleases Genotype determination on the gel T129C (rs2188524) Forward: 5'TTTCaCTACTTGCCCTTTCTAGAG3' Reverse: 5'CGGCCTCTGCTTCTTTGAG3' 258 MspA1I TT: 258 bp TC: 258 bp/226 bp/36 bp CC: 226 bp/32 bp T1236C (rs1128503) Forward: 5'GCCACaGTCTGCCCACTC3' Reverse: 5'CCCATaTCGAAAAGAAATTAAG3 240 HaeIII TT: 240 bp TC: 240 bp/204 bp/36 bp CC: 204 bp/36 bp 94&#b0;C for 40 s, annealing for 40 s at 58&#b0;C for T129C and 62&#b0;C for T1236C, an extension step at 72&#b0;C for 30 s, and a final extension step at 72&#b0;C for 5 min. Login to comment
58 Primer sequences and SNP at nucleotide positions T129C (A) and T1236C (B) in ABCB1 gene are demonstrated in Figure 1. Login to comment
68 (A) T129C (rs2188524) Forward Primer 5`TTTCACTACTTGCCCTTTCTAGAG3` Reverse Primer 5`CGGCCTCTGCTTCTTTAGG3` 5`TTTCACTACTTGCCCTTTCTAGAGAGGTGCAACGGAAGCCAGAACATTCCTCCTGGAAATTCAACCTGTTTCG CAGTTTCTCGAGGAATCAGCATTCAGTCAATCCGGGCCGGGAGCAGTCATCTGTGGTGAGGCTGATTGGCTGG GCAGGAACAGCGCCGGGGCGTGGGCTGAGCACAGCCGCTTCGCTCTCTTTGCCACAGGAAGCCTGAGCTCATT cgagCagcgGCTCTTCCAAGCTCAAAGAAGCAGAGGCCG3` (B) T1236C (rs1128503) Forward Primer 5`CCCATATCGAAAAGAAGTTAAG3` Reverse Primer 5`GCCACAGTCTGCCCACTC3` 5`CCCATCTCGAAAAGAAGTTAAGGTACAGTGATAAATGATTAATCAACAATTAATCTATTGAATGAAGAGTTT CTGATGTTTTCTTGTAGAGATTATAAAAAAGTGCATGTATATTTAAACCTAGTGAACAGTCAGTTCCTATATCC TGTGTCTGTGAATTGCCTTGAAGTTTTTTTCTCACTCGTCCTGGTAGATCTTGAagggCctgaACCTGAAGGTGCAG AGTGGGCAGACGGTGGC3` Fig. 1. Login to comment
69 Primer sequences and single nucleotide polymorphisms at nucleotide positions T129C (A) and T1236C (B) in ABCB1 gene. Login to comment
89 The genotype frequency of both T129C and T1236C polymorphisms did not differ significantly between drug-responsive and drug-resistant patients for CC, CT or TT genotypes (Table 4). Login to comment
90 When patients were stratified by patient age, no significant association was observed between ABCB1-T129C and -T1236C polymorphisms and 1 2 3 4 M 5 C1 C2 258 bp 226 bp Fig. 3. Login to comment
91 Genotype determination of epileptic patients for ABCB1-T1236C polymorphism based on digestion of a 240 bp amplified DNA fragment with HaeIII, analyzed by 2.5% agarose gel electrophoresis. Lanes 1-4 and 7, digestion resulted in two DNA fragments of 204 bp and 36 bp (CC genotype); lanes 5 and 8, digestion resulted in three DNA fragments of 240 bp, 204 bp and 36 bp (TC genotype); lane 6, fragment with no digestion site (TT genotype); M, 100 bp DNA ladder; C1 and C2 sequenced fragments with site for digestion in one or both alleles, as positive controls. Login to comment
94 However, when patients were stratified by gender, significant association was observed between ABCB1-T1236C polymorphism and drug resistance in females (Table 5). Login to comment
100 Genotype and allele frequencies at nucleotide positions T129C and T1236C of ABCB1 gene in normal non-epileptic subjects. Login to comment
101 Nucleotide position Genotype frequency Allele frequency ABCB1-T129C (rs2188524) CC 0 (0%) CT 11 (5.5%) TT 189 (94.5%) C 11 (2.75%) T 289 (97.25%) ABCB1-T1236C (rs1128503) CC 43 (21.5%) CT 95 (47.5) TT 62 (31.00%) T 219 (54.7%) C 181 (45.25%) association was found between ABCB1-129T>C polymorphism and drug response in patients with idiopathic epilepsy but not in those with symptomatic epilepsy (Table 6). Login to comment
104 Genotype frequencies and drug-resistance odds ratio for ABCB1-T129C and -T1236C polymorphisms in Iranian epileptic patients. Login to comment
105 P OR (95% CI) Drug-resistant patients Drug-responsive patients Genotype Subgroups of age 0.75 1.21 (0.36-4.06) 1 0 5 (3.75%) 127 (96.25%) 0 7 (3.5%) 193 (96.5%) CC CT TT ABCB1-T129C (n = 332) 0.75 1.21 (0.36-4.06) 1 0 5 (3.84%) 125 (96.15%) 0 6 (3.19%) 182 (96.8%) CC CT TT Adults (n = 318) small sample size 0 0 4 (100%) 0 1 (10%) 9 (90%) CC CT TT Children (n = 14) 0.11 0.19 1.73 (0.88-3.41) 1.39 (0.85-3.41) 1 24 (18.18%) 65 (49.24%) 43 (32.57%) 28 (14%) 87 (43.5%) 85 (42.5%) CC CT TT ABCB1-T1236C (n = 332) 0.11 0.19 1.73 (0.88-3.41) 1.39 (0.85-3.41) 1 23 (17.96%) 62 (48.43%) 43 (33.59%) 25 (13.15%) 84 (44.21%) 81 (42.63%) CC CT TT Adults (n = 318) small sample size 1 (25%) 3 (75%) 0 3 (30%) 3 (30%) 4 (40%) CC CT TT Children (n = 14) OR, odds ratios; CI, confidence interval M 1 2 3 4 5 6 7 8 C1 C2 240 bp 204 bp M 1 2 3 4 5 6 7 8 C1 C2 Table 5. Login to comment
106 Genotype frequencies of ABCB1-T129C and -T1236C polymorphisms and odds ratios in male and female epileptic patients. Login to comment
107 P OR (95% CI) Drug-resistant patients Drug-responsive patients Genotype Subgroups of gender ABCB1-T129C (n = 332) 0.78 1.23 (0.30-5.07) 1 0 4 (5.06%) 75 (94.93%) 0 4 (4.16%) 92(95.83%) CC CT TT Male (n = 175) 0.65 0.71 (0.07-6.38) 1 0 1 (1.88%) 52 (98.11%) 0 3 (2.9%) 101 (97.1%) CC CT TT Female (n =157) ABCB1-T1236C (n = 332) 0.53 0.41 0.76 (0.33-1.77) 0.75 (0.38-1.49) 1 16(20.25%) 36(45.56%) 27 (34.17%) 21 (21.87%) 48 (50%) 27 (28.12%) CC CT TT Male (n = 175) 0.02 0.008 4.14 (1.31-13.16) 2.70 (1.30-5.61) 1 8 (15.09%) 29 (54.71%) 16 (30.18%) 7 (6.73%) 39 (37.50%) 58 (55.76%) CC CT TT Female (n =157) OR, odds ratios; CI, confidence interval DISCUSSION Results of the present study demonstrate that by analyzing all patients as a whole, T129C and T1236C polymorphisms of ABCB1 gene are not associated with drug resistance in Iranian epileptics. Login to comment
108 The effect of T129C (rs2188524) and T1236C (rs1128503) polymorphisms of ABCB1 gene on AED resistance has been studied by many researchers. Login to comment
109 In some of these studies, an association was found between T1236C polymorphism and drug-resistant epilepsy [9-11]. Login to comment
110 However, in other studies such association was not observed for T1236C [12, 14] or for T129C [11]. Login to comment
114 Genotype frequencies of ABCB1-T129C and -T1236C polymorphisms and odds ratios in patients with idiopathic or symptomatic epilepsy. Login to comment
115 P OR (95% CI) Drug-resistant patients Drug-responsive patients Genotype Etiology of epilepsy ABCB1-T129C (n = 332) 0.001 25.00 (3.48-179.80) 1 0 3 (50%) 3 (50%) 0 3 (3.8%) 75 (96.2%) CC CT TT Idiopathic (n = 84) 0.77 1.22 (0.32-4.65) 1 0 5 (4.0%) 121 (96.0%) 0 4 (3.3%) 118 (96.7%) CC CT TT Symptomatic (n=248) ABCB1-T1236C (n = 332) Small sample size 0 0 6 (100%) 12 (15.4%) 41 (52.6%) 25 (32.0%) CC CT TT Idiopathic (n= 84) 0.02 0.004 2.43 (1.15-5.17) 2.29 (1.31-4.00) 1 24 (19.0 %) 65 (51.6%) 37 (29.4%) 16 (13.1%) 46 (37.7%) 60 (49.2%) CC CT TT Symptomatic (n =248) OR, odds ratios; CI, confidence interval similar to criteria of drug resistance used by Hung et al. [10]. Login to comment
116 However, in contrast to that study, we did not find any association between T1236C polymorphism and drug resistance in epileptic patients. Login to comment
122 When patients were stratified by age, no significant association was observed between ABCB1-T129C and T1236C polymorphisms and drug resistance neither in adults nor in children. Login to comment
132 Exclusion of the patients treated with carbamazepine and valproate did not affect the final result of T129C and T1236C polymorphisms and drug resistance. Login to comment

[hide] Frequency of MDR1 single nucleotide polymorphisms ... Genet Mol Res. 2013 Mar 13;12(1):801-8. doi: 10.4238/2013.March.13.9. Khabour OF, Alzoubi KH, Al-Azzam SI, Mhaidat NM
Frequency of MDR1 single nucleotide polymorphisms in a Jordanian population, including a novel variant.
Genet Mol Res. 2013 Mar 13;12(1):801-8. doi: 10.4238/2013.March.13.9., [PMID:23546964]

Abstract [show]
The multidrug resistance gene (MDR1 or ABCB1) codes for P-glycoprotein, which plays an important role in regulating absorption, distribution, and elimination of drugs. We examined MDR1 gene variants in 100 unrelated subjects from various regions of Jordan. The MDR1 gene was scanned using direct sequencing. Six rare variants in MDR1 were detected, including a new variant, T3075A. This variant did not affect the protein sequence (synonym for threonine). Among the common SNPs, the frequencies of rs1128503 (C1236T) genotypes were: 0.23 (CC), 0.41 (CT) and 0.36 (TT). For the rs2032582 (G2677T) SNP, genotype frequencies were 0.38 for GG, 0.45 for GT, 0.13 for TT, 0.03 for GA, and 0.01 for TA, whereas for rs1045642 (C3435T), genotype frequencies were 0.17 for CC, 0.5 for CT and 0.33 for TT. The observed distribution of the common variants in the Jordanian population was within the range detected in other populations. These data on MDR1 gene variants in the Jordanian population will be useful for investigations on response to P-glycoprotein substrate drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 Variable C3435T G2677T T1236C Allele C Allele T Allele G Allele T Allele A Allele C Allele T Jordan (the current study) 42 58 62 36 2 43.5 56.5 Serbian (Milojkovic et al., 2011) 47 53 53 43 4 54 46 German (Cascorbi et al., 2001) 46 54 56.5 41.5 3 59.5 40.5 Russian (Gaikovitch et al., 2003) 45.5 54.5 54.5 42 3.5 52 48 Turkish (Turgut et al., 2006; Gumus-Akay et al., 2008) 46.5 53.5 47.5 52.5 Japanese (Komoto et al., 2006) 59.5 40.5 42.5 40.5 17 34.5 65.5 Chinese (Zhang et al., 2008) 56.5 43.5 42 44.5 14.5 34.5 65.5 Table 3. Login to comment

[hide] Are ABCB1 (P-glycoprotein) polymorphisms clinicall... Gynecol Oncol. 2013 Oct;131(1):1-2. doi: 10.1016/j.ygyno.2013.09.001. Konecny GE
Are ABCB1 (P-glycoprotein) polymorphisms clinically relevant in ovarian cancer? - Finally an Answer!
Gynecol Oncol. 2013 Oct;131(1):1-2. doi: 10.1016/j.ygyno.2013.09.001., [PMID:24093937]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 In four of these studies no associations were found between clinical outcome and the polymorphisms tagging either T1236C [11,12] or G2677T/A and C3435T [12,14,15]. Login to comment

[hide] Drug-induced trafficking of p-glycoprotein in huma... PLoS One. 2014 Feb 4;9(2):e88154. doi: 10.1371/journal.pone.0088154. eCollection 2014. Noack A, Noack S, Hoffmann A, Maalouf K, Buettner M, Couraud PO, Romero IA, Weksler B, Alms D, Romermann K, Naim HY, Loscher W
Drug-induced trafficking of p-glycoprotein in human brain capillary endothelial cells as demonstrated by exposure to mitomycin C.
PLoS One. 2014 Feb 4;9(2):e88154. doi: 10.1371/journal.pone.0088154. eCollection 2014., [PMID:24505408]

Abstract [show]
P-glycoprotein (Pgp; ABCB1/MDR1) is a major efflux transporter at the blood-brain barrier (BBB), restricting the penetration of various compounds. In other tissues, trafficking of Pgp from subcellular stores to the cell surface has been demonstrated and may constitute a rapid way of the cell to respond to toxic compounds by functional membrane insertion of the transporter. It is not known whether drug-induced Pgp trafficking also occurs in brain capillary endothelial cells that form the BBB. In this study, trafficking of Pgp was investigated in human brain capillary endothelial cells (hCMEC/D3) that were stably transfected with a doxycycline-inducible MDR1-EGFP fusion plasmid. In the presence of doxycycline, these cells exhibited a 15-fold increase in Pgp-EGFP fusion protein expression, which was associated with an increased efflux of the Pgp substrate rhodamine 123 (Rho123). The chemotherapeutic agent mitomycin C (MMC) was used to study drug-induced trafficking of Pgp. Confocal fluorescence microscopy of single hCMEC/D3-MDR1-EGFP cells revealed that Pgp redistribution from intracellular pools to the cell surface occurred within 2 h of MMC exposure. Pgp-EGFP exhibited a punctuate pattern at the cell surface compatible with concentrated regions of the fusion protein in membrane microdomains, i.e., lipid rafts, which was confirmed by Western blot analysis of biotinylated cell surface proteins in Lubrol-resistant membranes. MMC exposure also increased the functionality of Pgp as assessed in three functional assays with Pgp substrates (Rho123, eFluxx-ID Gold, calcein-AM). However, this increase occurred with some delay after the increased Pgp expression and coincided with the release of Pgp from the Lubrol-resistant membrane complexes. Disrupting rafts by depleting the membrane of cholesterol increased the functionality of Pgp. Our data present the first direct evidence of drug-induced Pgp trafficking at the human BBB and indicate that Pgp has to be released from lipid rafts to gain its full functionality.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
126 In the MDR1 sequence of this construct we identified three of the most common single nucleotide polymorphisms, T1236C (Gly412Gly), T2677G (Ser893Ala) and T3435C (Ile1145Ile), which have been described in MDR1 of humans [24]. Login to comment

[hide] Association of genotypes and haplotypes of multi-d... Biomed Pharmacother. 2014 Apr;68(3):343-9. doi: 10.1016/j.biopha.2014.01.009. Epub 2014 Feb 7. Au A, Aziz Baba A, Goh AS, Wahid Fadilah SA, Teh A, Rosline H, Ankathil R
Association of genotypes and haplotypes of multi-drug transporter genes ABCB1 and ABCG2 with clinical response to imatinib mesylate in chronic myeloid leukemia patients.
Biomed Pharmacother. 2014 Apr;68(3):343-9. doi: 10.1016/j.biopha.2014.01.009. Epub 2014 Feb 7., [PMID:24581936]

Abstract [show]
The introduction and success of imatinib mesylate (IM) has become a paradigm shift in chronic myeloid leukemia (CML) treatment. However, the high efficacy of IM has been hampered by the issue of clinical resistance that might due to pharmacogenetic variability. In the current study, the contribution of three common single nucleotide polymorphisms (SNPs) of ABCB1 (T1236C, G2677T/A and C3435T) and two SNPs of ABCG2 (G34A and C421A) genes in mediating resistance and/or good response among 215 CML patients on IM therapy were investigated. Among these patients, the frequency distribution of ABCG2 421 CC, CA and AA genotypes were significantly different between IM good response and resistant groups (P=0.01). Resistance was significantly associated with patients who had homozygous ABCB1 1236 CC genotype with OR 2.79 (95%CI: 1.217-6.374, P=0.01). For ABCB1 G2677T/A polymorphism, a better complete cytogenetic remission was observed for patients with variant TT/AT/AA genotype, compared to other genotype groups (OR=0.48, 95%CI: 0.239-0.957, P=0.03). Haplotype analysis revealed that ABCB1 haplotypes (C1236G2677C3435) was statistically linked to higher risk to IM resistance (25.8% vs. 17.4%, P=0.04), while ABCG2 diplotype A34A421 was significantly correlated with IM good response (9.1% vs. 3.9%, P=0.03). In addition, genotypic variant in ABCG2 421C>A was associated with a major molecular response (MMR) (OR=2.20, 95%CI: 1.273-3.811, P=0.004), whereas ABCB1 2677G>T/A variant was associated with a significantly lower molecular response (OR=0.49, 95%CI: 0.248-0.974, P=0.04). However, there was no significant correlation of these SNPs with IM intolerance and IM induced hepatotoxicity. Our results suggest the usefulness of genotyping of these single nucleotide polymorphisms in predicting IM response among CML patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 In the current study, the contribution of three common single nucleotide polymorphisms (SNPs) of ABCB1 (T1236C, G2677T/A and C3435T) and two SNPs of ABCG2 (G34A and C421A) genes in mediating resistance and/or good response among 215 CML patients on IM therapy were investigated. Login to comment
31 Three polymorphisms (T1236C, G2677T/A and C3435T) of ABCB1 have significant effect on P-gp expression, functionality and substrate distribution [3]. Login to comment
160 Conclusion Our results demonstrated a significant association of the SNPs ABCB1 T1236C, G2677T/A and ABCG2 C421A with IM efficacy. Login to comment

[hide] Association of ABCB1 polymorphisms with the effica... Clin Ther. 2014 Aug 1;36(8):1242-1252.e2. doi: 10.1016/j.clinthera.2014.06.016. Epub 2014 Jul 8. He H, Yin JY, Xu YJ, Li X, Zhang Y, Liu ZG, Zhou F, Zhai M, Li Y, Li XP, Wang Y, Zhou HH, Liu ZQ
Association of ABCB1 polymorphisms with the efficacy of ondansetron in chemotherapy-induced nausea and vomiting.
Clin Ther. 2014 Aug 1;36(8):1242-1252.e2. doi: 10.1016/j.clinthera.2014.06.016. Epub 2014 Jul 8., [PMID:25012726]

Abstract [show]
PURPOSE: Resistance to the antiemetic ondansetron is still a major problem resulting in discomfort and poor compliance with chemotherapy in acute myeloid leukemia (AML) patients. Based on our hypothesis that this clinical resistance to ondansetron is associated with ABCB1 genetic polymorphisms, we investigated whether ABCB1 gene variations affect the efficacy of ondansetron in chemotherapy-induced nausea and vomiting. METHODS: AML patients (n = 215) treated for 3 days with high-dose cytarabine were enrolled in this study. Thirty minutes before the beginning of chemotherapy, 8 mg ondansetron was administered intravenously, followed by 24 mg by continuous infusion and 8 mg intravenously, once per day, until 2 days after chemotherapy. Chemotherapy-induced nausea and vomiting occurrence in the acute and delayed phases was calculated. ABCB1 and CYP2D6 polymorphisms were analyzed by allele-specific matrix-assisted laser desorption. Basic clinical characteristics of the AML patients were collected from medical records. FINDINGS: No differences in genotype distribution frequencies of ABCB1 polymorphisms and haplotypes were observed in patients with different CYP2D6-predicted phenotypes. During the acute phase, patients with the CG haplotype (C3435T and G2677T) were associated with a high risk of grade 3/4 nausea and vomiting (P = 0.003 and P = 0.026, respectively). After adjustment for age, sex, smoking status, alcohol drinking status, body surface area, body mass index, and Eastern Cooperative Oncology Group-Performance Status, multivariate survival analysis implicated the CG haplotype as a predictive marker of the risk of grade 3/4 chemotherapy-induced nausea and vomiting in AML patients (P = 0.003 and P = 0.039, respectively). In addition, a significant association between the 3435CC genotype and grade 3/4 vomiting in AML patients was observed (P = 0.016). However, no association between these ABCB1 gene polymorphisms and ondansetron efficacy was found in the delayed phase. IMPLICATIONS: These findings suggest that ABCB1 gene polymorphisms are associated with antiemetic efficacy of ondansetron in the acute phase after high-dose cytarabine chemotherapy in AML patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 However, the ABCB1 T1236C polymorphism was not in Hardy Weinberg equilibrium and its allelic frequency was not consistent with previous studies reports in Chinese Han Beijing populations and National Center for Biotechnology Information databases (P &#bc; 0.034) (Supplemental Table I; supplemental tables accompanying this article can be found in the online version at http://dx.doi.org/10.1016/j.clinthera.2014. Login to comment