ABCMdb

ABCB1 p.Thr1236Cys

None has been submitted yet.

Publications

PMID: 11266082 [PubMed] Ito S et al: "Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects."

No. Sentence Comment

27 In the MDR1 gene, three mutations were detected; T to C transversion at position 1236 (T1236C) in exon 12 (for position numbering refer to Chen et al., 1990), A to G transversion 41 bases upstream from the initial position of exon 1a (A-41aG) and C to G transversion at ±145 in exon 1a (C-145G) (Fig. 1). Login to comment
29 The T1236C mutation was silent (Gly to Gly at codon 412). Login to comment
30 The allele frequencies of T1236C, A-41aG and C-145G were 0.385, 0.073 and 0.01, respectively (Table 4). Login to comment
43 Thus, information on Fig. 1. Single-strand conformational polymorphism (SSCP) analysis (a) and sequence analysis (b) on MDR1 polymerase chain reaction products. Sequencing was carried out using the forward (C-145G) and the reverse (A-41aG and T1236C) primer shown in Table 1. Login to comment
51 Three mutations were observed; one (T1236C) was in the coding region (exon 12) and two (A-41aG and C-145G) were in the promoter region. Login to comment
52 Of these, the T1236C mutation had previously been identi®ed by Kioka et al. (1989). Login to comment
53 The allele frequency of T1236C mutation among Japanese is relatively high (38.5%), however; it is unlikely to be of functional signi®cance because it is a silent mutation (Gly to Gly). Login to comment
56 In addition to T1236C, T to G transversion at position 2677, which is a missense mutation (Ser to Ala at codon 893), was reported as a natural mutation. Login to comment

PMID: 16821592 [PubMed] Obata H et al: "Association between single nucleotide polymorphisms of drug resistance-associated genes and response to chemotherapy in advanced ovarian cancer."

No. Sentence Comment

84 Gene Nucleic acid Amino acid Allele frequencies Allele frequencies location change substitution (major alleles) (major alleles) in this study in other subject* MDR1 Promotor 1 T/C - 0.908 - Promotor 2 A-41aG - 0.883 0.927 exon-12 T1236C Gly412Gly 0.633 0.615 exon-26 G/A IIe1144IIe 0.500 - exon-28 A/G - 0.742 - MRP1 exon-8 T825C Val275Val 0.600 0.625 exon-9 T1062C Asn354Asn 0.567 0.646 exon-13 T1684C Leu562Leu 0.750 0.802 exon-16 C2007T Pro669Pro 0.950 0.917 exon-17 G2168A Arg723Gln 0.917 0.927 exon-28 G4002A Ser1334Ser 0.883 0.844 MRP2 Promotor C-24T - 0.867 - exon-10 G1249A Val417IIe 0.925 0.875 exon-28 C3972T IIe1324IIe 0.758 0.781 *Ito S. et al. Login to comment

PMID: 12172212 [PubMed] Tang K et al: "Distinct haplotype profiles and strong linkage disequilibrium at the MDR1 multidrug transporter gene locus in three ethnic Asian populations."

No. Sentence Comment

31 To date, detailed linkage disequilibrium analysis of the different polymorphisms of the MDR1 gene has not been documented, although a recent publication by Kim et al. [19] reported co-segregation of exon 26 3435T with the T allele of the non-synonymous exon 21 SNP G2677T (exon 21 2677G.T), resulting in an A893S amino acid change, and the T allele of the synonymous exon 12 SNP T1236C (exon 12 1236C.T) in Caucasians. Login to comment

PMID: 12352921 [PubMed] Yamauchi A et al: "Neurotoxicity induced by tacrolimus after liver transplantation: relation to genetic polymorphisms of the ABCB1 (MDR1) gene."

No. Sentence Comment

47 The independent variables were as follows: the eight polymorphisms (A-41aG, C-145G, T-129C, T1236C, G2677[A,T], C3435T, and A4036G) and the number of mutations, age, graft weight, ratio of graft weight to recipient`s standard liver volume, tacrolimus trough concentration, hematocrit, aspartate aminotransferase (AST), alanine aminotransferase, and serum albumin concentration (thought to affect the tacrolimus distribution in the brain). Login to comment
61 Position, sequence, and frequencies of ABCB1 mutations in Japanese living-related donor liver transplantation patients ABCB1 exon/ position Region Nucleotide sequence Effect Genotype Allele frequency Wild type Mutation w/w w/m m/m w m A-41aG UTR cccaAtgat cccaGtgat 11 5 1 0.79 0.21 C-145G Exon 1a gaagCctag gaagGctag 15 2 0 0.94 0.06 T-129C Exon 1b cgagTagcg cgagCagcg 12 3 2 0.79 0.21 T1236C Exon 12 agggTctga agggCctga 7 7 3 0.62 0.38 G2677A Exon 21 aggtGctgg aggtActgg Ala893Thr 6 G/Aϭ2 A/Aϭ0 0.59 0.09 G2677T Exon 21 aggtGctgg aggtTctgg Ala893Ser G/Tϭ6 T/Tϭ2 0.32 A/Tϭ1 C3435T Exon 26 agatCgtga agatTgtga 4 10 3 0.53 0.47 A4036G Exon 28 aatcAtagt aatcGtagt 7 7 3 0.62 0.38 UTR, untranslated region; w, wild type; m, mutation. Login to comment

PMID: 12359865 [PubMed] Schwab M et al: "Genetic polymorphisms of the human MDR1 drug transporter."

No. Sentence Comment

58 Thus, a cosegregation of the silent mutation 3435T in 62% with the T allele of the nonsynonymous exon 21 SNP 2677T and the T allele of the synonymous exon 12 polymorphism T1236C was reported for European Americans (29). Login to comment

PMID: 12831320 [PubMed] Sakaeda T et al: "Pharmacogenetics of MDR1 and its impact on the pharmacokinetics and pharmacodynamics of drugs."

No. Sentence Comment

35 IN COO- A61G T307C G1199A T1236C G2677A,T A2956G G2995T A3320C C3396T C3435T OUT NH2 gure 1. Sakaeda et al. MSD1 MSD2NBD1 NBD2 region accounts for < 5% of the total. Login to comment

PMID: 14501869 [PubMed] Kuzuya T et al: "Amlodipine, but not MDR1 polymorphisms, alters the pharmacokinetics of cyclosporine A in Japanese kidney transplant recipients."

No. Sentence Comment

56 The genotypes of MDR1 (exon 1b, T-129C; exon 12, T1236C; exon 21, G2677[T/A]; and exon 26, C3435T) were identified by a polymerase chain reaction, restriction fragment length polymorphism analysis as described previously (11). Login to comment
65 T1236C, G2677T, G2677A, and C3435T mutations occurred with variant allele frequencies of 42.3%, 39.7%, 23.7%, and 41.2%, respectively. Login to comment
84 Therefore, we tried to compare the effects of MDR1 polymorphisms on CsA AUC0 -2/dose/kg again without amlodipine treatment, but there was still no significant difference (T-129C, Pϭ0.202; T1236C, Pϭ0.447; G2677T/A, Pϭ0.765; and C3435T, Pϭ0.877). Login to comment
97 MDR1 genetic variants in 97 kidney transplant recipients Position Region Genotype Allele frequency (%) W/W W/M M/M W M T-129C Exon 1b 88 9 95.4 4.6 T1236C Exon 12 30 52 15 57.7 42.3 G2677T Exon 21 12(G/G) 33 (G/T) 11 (T/T) 36.6 39.7(T) G2677A Exon 21 14 (G/A) 5 (A/A) 23.7(A) G2677A 22 (T/A) C3435T Exon 26 33 48 16 58.8 41.2 TABLE 3. Login to comment
98 P values between SNP and AUC0-2/dose/kg AUC0-2/dose/kg 752.8Ϯ194.1a T-129C 0.279 T1236C 0.868 G2677T/A 0.911 C3435T 0.973 a MeanϮSD. FIGURE 2. Login to comment

PMID: 15637529 [PubMed] Wong M et al: "Hepatic technetium Tc 99m-labeled sestamibi elimination rate and ABCB1 (MDR1) genotype as indicators of ABCB1 (P-glycoprotein) activity in patients with cancer."

No. Sentence Comment

136 Frequency of ABCB1 variants ABCB1 locus Genotype Actual frequency (%) Predicted frequency (%) (Hardy-Weinberg equilibrium) ␹2 (P value) Exon 12 CC 17 17 0.021 (.885) CT 48 48 TT 35 35 Exon 21 GG 17 20 3.125 (.373) GT 52 48 GA 3 1 TT 28 28 Exon 26 CC 17 19 0.597 (.440) CT 53 49 TT 30 32 T1236C in exon 12, G2677T/A in exon 21, and C3435T polymorphisms in exon 26 of ABCB1 were detected by polymerase chain reaction-restriction fragment length polymorphism. Login to comment

PMID: 15901749 [PubMed] Nakajima M et al: "Pharmacokinetics of paclitaxel in ovarian cancer patients and genetic polymorphisms of CYP2C8, CYP3A4, and MDR1."

No. Sentence Comment

106 Table II Genotype of CYP3A4 and MDR1 Genes in Each Patient MDR1 Patient CYP3A4*16 T-129C T1236C G2677T/A C3435T 1 C/G T/T T/T G/G C/C 2 C/G T/T T/T G/T C/C 3 C/C T/T T/T G/T C/C 4 C/C T/T T/T G/A C/C 5 C/C T/C C/C G/A C/C 6 C/C T/T T/T G/T C/T 7 C/C T/T T/T G/T C/T 8 C/C T/T T/T G/T C/T 9 C/C T/T T/T G/T C/T 10 C/C T/T T/T G/T C/T 11 C/C T/T T/T G/T C/T 12 C/C T/T T/T G/T C/T 13 C/C T/T T/T G/T C/T 14 C/C T/T T/T T/A C/T 15 C/C T/T T/T T/A C/T 16 C/C T/T T/C T/A C/T 17 C/C T/T T/T T/T C/T 18 C/C T/T T/T T/T T/T 19 C/C T/T T/T T/T T/T 20 C/C T/T T/T T/T T/T 21 C/C T/T T/T T/T T/T 22 C/C T/T T/T T/T T/T 23 C/C T/T T/C G/T T/T Shading indicates nucleotides in mutant type. Login to comment
141 A number of SNPs have been identified in the human MDR1 gene.19,21,33,34 Of these SNPs, T-129C (noncoding), T1236C (Gly412Gly, wobble), G2677T/A (Ala893Ser/Thr), and C3435T (Ile1145Ile, wobble) are associated with alterations in the expression of P-glycoprotein and pharmacokinetic profiles of certain clinically used drugs.19,21,34 The present study showed an apparent association between the presence of 3435T allele and increased AUC of 3'-p-hydroxypaclitaxel. Login to comment

PMID: 16141795 [PubMed] Wang D et al: "Multidrug resistance polypeptide 1 (MDR1, ABCB1) variant 3435C>T affects mRNA stability."

No. Sentence Comment

190 When Fig. 5 1.8 *** *** ### *** ### *** ### *** ### *** ### *** ### *** ### ## 3435C/3435T 1236C/1236T 1.6 1.6 1.4 1.4 1.2 1.2 DNA-48hRNA-8hDNA-8h RNA-48h 1.0 1.0 0.8 0.8 0.6 0.6 0.4 1.8 2677G/2677T 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.4 *13 3435C > T1236C > T/3435C > T2677G > T/3435C > T *13 1236C > T 1236C > T/2677G > T1236C > T/3435C > T *13 2677G > T 1236C > T/2677G > T 2677G > T/3435C > T (a) (b) (c) Differential mRNA expression between ABCB1*1 and different ABCB1 variants after co-transfection into CHO cells. Login to comment

PMID: 16370938 [PubMed] Dey S et al: "Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition."

No. Sentence Comment

113 1 2 3 4 5 6 7 8 9 10 11 12 NH2 COOH Out Membrane In T1236C G2677T/A C3435T A2956G NBD1 NBD2 A NBD1 NBD2 B the second ATP-binding domain. Login to comment

PMID: 16415525 [PubMed] Sakaeda T et al: "MDR1 genotype-related pharmacokinetics: fact or fiction?"

No. Sentence Comment

104 The ˆrst preliminary report on the eŠects of their genotypes was presented by von Ahsen et al., who indicated that the maintenance dose or dose-adjusted Cmin,ss of CsA was independent either of MDR1 C3435T or CYP3A4 genotype, after an analysis of 124 Caucasian renal transplant recipients.146) Mai et al. indicated no eŠects of MDR1 G2677T or C3435T on the dose-adjusted AUC0-12,ss, Cmin,ss and C2,ss of CsA in 95 renal transplant recipients, and an analysis based on the G2677TW C3435T haplotype56) also failed to predict the pharmacokinetics of CsA.147) Kuzuya et al. also reported no eŠects of MDR1 T-129C, T1236C, G2677A,T and C3435T on the dose-adjusted AUC0-2,ss of CsA in 57 renal transplant recipients.148) In 2002, the Consensus on Neoral C2: Expert Review in Transplantation (CONCERT) conference was convened to undertake a multidisciplinary review of pharmacokinetic and clinical data on CsA microemulsions, and an international consensus on a patient management strategy with the oral administration of a CsA microemulsion has come to be presented based on the monitoring of C2,ss as a surrogate marker of AUC0-4,ss, AUCss up to 4 hr after oral administration, which was recently found to be predictive of immunosuppressive eŠects and toxicity, when compared with conventional C0,ss monitoring.175-178) One important issue to be resolved is the existence of ``slow absorbers'', who show a Cmax,ss at 4 hr or later, and are susceptible to over-dosing of CsA based on C2,ss monitoring. Login to comment

PMID: 16462814 [PubMed] Rodriguez-Novoa S et al: "Overview of the pharmacogenetics of HIV therapy."

No. Sentence Comment

87 The percentage of subjects with total bilirubin in the range of jaundice (42.5 mg/dl) was 13% for those with the TA6/TA6 NH COO A61G A3320C T307C T1236C G1199A G2677A,T C3435T G2995T C3396T A2956G •Polymorphism associated with Non-A • Lower EFV plasma levels in T/T genotype • Increased HDL-cholesterol levels in C/C genotype • Low risk of NVP hepatotoxicity in T/T genotype •Polymorphism associated with Protease Inhibitors •Lower NFV plasma levels in T/T genotype •Lower ATV plasma levels in T/T genotype NH2 COO A61G A3320C T307C T1236C G1199A G2677A,T C3435T G2995T C3396T A2956G NH COO- A61G A3320C T307C T1236C G G2677A,T C3435T G2995T C3396T A2956G •Polymorphism associated with Non-Analogues: wer EFV plasma levels in T/T genotype ncreased HDL-cholesterol levels in C/C genotype w risk of NVP hepatotoxicity in T/T genotype •Polymorphism associated with Protease Inhibitors •Lower NFV plasma levels in T/T genotype •Lower ATV plasma levels in T/T genotype Figure 5 Polymorphisms at the MDR1 gene and structure of the P-glycoprotein. Login to comment

PMID: 16651648 [PubMed] Wong M et al: "Predictors of vinorelbine pharmacokinetics and pharmacodynamics in patients with cancer."

No. Sentence Comment

45 of patients 41 Male 25 Female 16 Age Mean, years 63 Range 43-81 Body-surface area, m2 Mean 1.84 Range 1.41-2.46 Ethnicity White 39 Nonwhite 2 Cancer type Prostate 16 Breast 10 Lung 8 Bladder 3 Others 4 ECOG performance status 0 25 1 15 2 1 Liver metastasis Yes 14 No 25 Unknown 2 Prior chemotherapy Yes 26 No 15 Pretreatment neutrophil count, ϫ10 9 /L (mean Ϯ SD) 5.9 Ϯ 2.8 ABCB1 SNPs Exon 12 T1236C CC 6 CT 23 TT 12 Exon 21 G2677T, A GG 5 GT 24 GA 2 TT 10 Exon 26 C3435T CC 7 CT 23 TT 11 CYP3A5 SNP *1/*3 3 *3/*3 38 Abbreviations: ECOG, Eastern Cooperative Oncology Group; SNP, single nucleotide polymorphism; SD, standard deviation; C, cytosine; T, thymine; G, guanine; A, adenine. Login to comment
80 Association Between Potential Predictors, Vinorelbine Clearance, and Fractional Survival of Neutrophil Postvinorelbine Variable Correlation With Vinorelbine Clearance Correlation With Fractional Survival of Neutrophils Postvinorelbine No. Spearman`s Rho P No. Spearman`s Rho P Age 34 -0.28 .11 38 -0.05 .78 Sex (male/female) 34 .06 38 .02 ECOG (0 to 3) 34 .56 38 .29 Prior chemotherapy (Y/N) 34 .42 38 .64 Liver metastasis (Y/N) 32 .11 36 .28 Body habitus‫ء‬ Body-surface area† 34 0.17 .33 38 0.48 Ͻ .01 Height 34 0.25 .16 38 0.41 .01 Pretreatment platelet count 32 -0.16 .39 N/A‡ Genotype CYP3A5*1/*3 34 .25 38 .50 ABCB1 exon 12 T1236C 34 .78 38 .44 exon 21 G2677T, A 34 .82 38 .54 exon 26 C3435T 34 .25 38 .69 Liver function tests Aspartate transaminase 33 -0.23 .20 37 -0.19 .26 Alanine transaminase 34 -0.16 .38 38 -0.03 .87 Alkaline phosphatase 34 0.05 .78 38 -0.09 .60 Serum albumin 34 -0.12 .51 38 0.07 .67 INR 28 -0.21 .27 30 0.06 .74 Bile acids 18 0.06 .81 18 -0.10 .68 Clearance indicators Creatinine clearance§ 34 0.34 .05 38 0.39 .02 Hepatic 99m Tc-MIBI clearance (kH ϫ liver volume) 33 0.32 .07 37 0.28 .09 Midazolam clearance 34 -0.06 .73 37 0.12 .47 Abbreviations: ECOG, Eastern Cooperative Oncology Group; Y, yes; N, no; INR, international normalized ratio; 99m Tc-MIBI, technetium labeled sestamibi; kH, elimination rate constant. Login to comment

PMID: 16803472 [PubMed] Yamaguchi H et al: "Genetic variation in ABCB1 influences paclitaxel pharmacokinetics in Japanese patients with ovarian cancer."

No. Sentence Comment

11 ABCB1 T-129C, T1236C, and G2677(A,T), however, was associated with lower area under the plasma concentration-time curve (AUC) of paclitaxel. Login to comment
41 CYP2C8 A805T (CYP2C8*2), G416A/A1196G (CYP2C8*3), and C792G (CYP2C8*4), and ABCB1 T-129C, T1236C, G2677(A,T), and C3435T were genotyped by polymerase chain reaction (PCR)-restriction enzyme fragment length polymorphism as previously described with minor modification(15-17) . Login to comment
68 CYP2C8, CYP3A5, ABCB1, and PXR genotypes in 13 patientsa Patient number CYP2C8 CYP3A5 ABCB1 PXR A6986G T-129C T1236C G2677 (A,T) C3435T C-25385T 1 *1/*1 A/G T/T T/T G/T C/T C/C 2 *1/*1 A/G T/T T/C A/T C/C C/C 3 *1/*1 G/G T/T T/C G/G C/T C/C 4 *1/*1 A/G T/T T/T T/T T/T C/T 5 *1/*1 A/A T/T T/T G/T C/T T/T 6 *1/*1 A/G T/T T/T G/G C/C C/C 7 *1/*1 G/G T/T T/C G/G C/C C/C 8 *1/*1 G/G T/T T/T G/T C/T C/T 9 *1/*1 A/G T/T T/T G/T C/T C/C 10 *1/*1 G/G T/T T/T G/T C/T C/C 11 *1/*1 A/G T/T T/C G/T C/C C/T 12 *1/*1 G/G T/C C/C A/A C/C C/T 13 *1/*1 G/G T/T T/C G/T C/T C/C a The most common (wild-type) CYP2C8 allele was CYP2C8*1. than the frequencies of 0.39 and 0.32 observed for Caucasian and African American populations, respectively(21) . Login to comment
80 Although the differences were not statistically significant, ABCB1 T1236C tended to be associated with lower paclitaxel AUC (11.4 Æ 2.32, 9.62 Æ 1.48, and 5.73 lgÁh/mL for 1236T/T, T/C, and C/C genotypes [n ¼ 7, 5, and 1], respectively). Login to comment
87 As ABCB1 T-129C, T1236C, and G2677(A,T) were associated with lower paclitaxel AUC (Fig. 2), we examined the relationships between total ABCB1 mutant allele numbers and either paclitaxel AUC or CLtot in 13 patients. Login to comment
110 ABCB1 T1236C is associated with significantly increased exposure to irinotecan and the active metabolite SN-38(26) . Login to comment

PMID: 17225463 [PubMed] Ryu HC et al: "Analyses of single nucleotide polymorphisms and haplotype linkage of the human ABCB1 (MDR1) gene in Korean."

No. Sentence Comment

4 The frequcies of the SNPs were C3435T (47.7%), G2677T (37.6%), G2677A (4.4%), T1236C (21.7%), T129C (8%), A2956G (2.5%), T307C (1.5%), A41aG (92%), C145G (0%), and G4030C (0 %). Login to comment
44 Eleven haplotypes were detected in pairwise of 3 SNPs (T1236C, G2677T/A, C3435T) using Haplotype analyses. Login to comment
53 The allele frequencies of the 9 MDR1 SNPs and the sample numbers were C3435T 47.7% (n=500), G2677T 37.6% (n=500), G2677A 4.4% (n=500), T1236C 21.7% (n=500), A41aG 9.2% (n=388), T129C 8% (n=lO0), A2956G 2.5% (n=lO0), and T307C 1.5% (n=lO0). Login to comment
55 There were 4 point mutations (T307C, G2677T/A, and A2956G) among the 9 SNPs that caused an amino acid exchange in MDR1, but not the others (C3435T, T1236C, A41aG, T129C, C-145G, and G4030C) (Table II). Login to comment
65 Haplotype and LD analysis The most frequent 3 SNPs (T1236C, G2677T/A, C3435T) were further analyzed for their haplotype. Login to comment
66 The frequency of the 11 haplotypes in T1236C-G2677T/A-C3435T loci were T-G-C (28.1%), T-T-T (25.1%), C-G-C (14.2%), T-GT (14.1%), T-T-C (7.6%), C-T-T (4.3%), C-A-C (2.1%), TA-C (1.9%), C-G-T (1.6%), C-T-C (0.6%), and T-A-T (0.4%). Login to comment
71 C3435T SNP was shown to have relationship with the T1236C (D' value of 0.64), T129C (D' value of 0.58), A41aG (D' value of 0.32), and G2677T (D' value of 0.37) SNPs. Login to comment
73 This suggests that C3435T SNP has some relationship with the other 4 SNPs, whereas the G2677T SNP has a relationship with A41aG T129C T1236C G2677T C3435T A41aG T129C 0.19 T1236C 0.17 G2677T 0.14 C3435T 0.32* 0.05 0.58* 0.06 0.58* 0.64* 0.37* T129C T1236C G2677T C3435T A41aG T129C T1236C G2677T Fig. 2. Login to comment
79 DISCUSSION In this study, the frequencies of 3 SNPs from 500 samples showed that C3435T (47.7%) was the most frequent followed by G2677T (37.6%), and T1236C (21.7%). Login to comment
80 In contrast, Yi et aL (2004) reported that T1236C was the most frequent (38.1%) followed by G2677T Table t|i. Login to comment
97 The 3rd most frequent SNP, T1236C SNP, detected at the exon 12, which affected the expression and function of P-gp (Marzolini et al., 2004; Kim et al., 2001; Goto et al., 2002; IIImer et al., 2002), was similar to those reported in other Asian populations (Japanese, Chinese, Indian, Malay) but much higher than those reported in Caucasians (34-41%) and Africans (15%) (Table III). Login to comment
98 When the LD for all pairs of exons 12, 21, and 26 (3 SNPs T1236C, G2677T/A, and C3435T) were examined, of the 12 possible haplotypes, 11 and 12 were observed in the Korean and Chinese subjects, respectively (Zhang et al., 2005), and these haplotype numbers were much larger than those in western black Africans (6 haplotypes; Allabi et al., 2005), Benineses (8 haplotypes), African-Americans (8 haplotypes), Caucasians (10 haplotypes) (Kroetz et al., 2003; Allabi et al., 2005), Malays (6 haplotypes), Chinese (10 haplotypes), and Indians (9 haplotypes; Tang et al., 2002). Login to comment
115 Two synonymous SNPs (T1236C and C3435T) and a non-synonymous SNP (G2677T, Ala893Ser) were found to be linked in 62% of European Americans and 13% of African Americans (Kim et al., 2001; Goto et al., 2002; IIImer et al., 2002). Login to comment
116 This study also confirmed this similar linkage in Koreans, and the T1236C was linked to an exon 26 (C3435T) and exon 21 (G2677T) SNPs in 64% and 37% of cases, relatively. Login to comment
120 A LD was also found in the C3435T SNP with T129C, and T1236C. Login to comment

PMID: 19745014 [PubMed] Kim HJ et al: "Association between Genetic Polymorphism of Multidrug Resistance 1 Gene and Sasang Constitutions."

No. Sentence Comment

95 Haplotype frequencies of MDR1 SNPs in Sasang constitutions Haplotypes of MDR1 gene Haplotype frequency in each group P* T1236C G2677T/A C3435T Tae-eumin (n ¼ 51) (%) So-yangin (n ¼ 56) (%) So-eumin (n ¼ 100) (%) Pa /Pb /Pc T T T 24.08 26.47 28.58 0.68/0.68/0.40 C G C 22.44 13.70 23.18 0.09/0.04/0.88 T G C 24.22 15.83 17.14 0.12/0.76/0.14 C A C 13.44 14.46 14.98 0.82/0.90/0.71 T T C 5.24 5.26 4.53 0.99/0.77/0.78 T G T 5.00 6.19 1.72 0.70/0.03/0.10 C T C 2.05 5.39 3.39 0.20/0.39/0.51 T A C 1.25 7.86 1.28 0.02/0.002/0.98 C T T - 4.85 - 0.02/0.001/- T A T - - 2.74 -/0.07/0.32 C G T 1.29 - 2.45 0.22/0.09/0.50 Dash indicates values below 0.01%; a Tae-eumin versus So-yangin; b So-yangin versus So-eumin; c Tae-eumin versus So-eumin; *Values calculated by 2 -test. Table 3. Frequencies of MDR1 C1236T genotype and Sasang constitutions Tae-eumin (n ¼ 51) (%) So-yangin (n ¼ 56) (%) So-eumin (n ¼ 100) (%) P* T/T 17 (33.3) 23 (41.1) 25 (25.0) C/T 28 (54.9) 23 (41.1) 62 (62.0) 0.33a /0.03b /0.55c C/C 6 (11.8) 10 (17.9) 13 (13.0) a Tae-eumin versus So-yangin; b So-yangin versus So-eumin; c Tae-eumin versus So-eumin; *Values calculated by 2 -test. Table 4. Frequencies of MDR1 G2677T/A allele in Sasang constitutions Tae-eumin (n ¼ 102) (%) So-yangin (n ¼ 112) (%) So-eumin (n ¼ 200) (%) P* G 54 (52.9) 40 (35.7) 89 (44.5) 0.04a /0.31b /0.37c T 32 (31.4) 47 (42.0) 73 (36.5) A 16 (15.7) 25 (22.3) 38 (19.0) a Tae-eumin versus So-yangin; b So-yangin versus So-eumin; c Tae-eumin versus So-eumin; *Values calculated by 2 -test. Table 2. Login to comment
129 Table 6. Frequencies of MDR1 haplotypes in Korean compared with other populations Haplotypes of MDR1 gene German Caucasian % Chinese Han % Korean % T1236C G2677T/A C3435T (n ¼ 461) (n ¼ 165) (n ¼ 207) T T T 41.0 33.3 26.5 C G C 37.0 20.1 20.4 T G C 1.0 22.2 18.6 C A C 2.5 11.3 14.5 T T C 2.5 5.6 5.2 T G T 0.5 1.0 3.9 C T C 1.5 1.7 3.4 T A C 0.0 1.2 2.9 C T T 1.0 1.6 1.7 T A T 0.0 0.4 1.6 C G T 12.0 1.2 1.3 C A T 1.0 0.4 0.0 Reference 19 24 This study Particularly as in Sai et al., haplotype 1236T-2677T-3435T showed the highest frequency in Japanese and Koreans. Login to comment

PMID: 20204543 [PubMed] Ni LN et al: "Multidrug resistance gene (MDR1) polymorphisms correlate with imatinib response in chronic myeloid leukemia."

No. Sentence Comment

3 We investigated the MDR1 T1236C, G 2677T/A, and C3435T polymorphism in 52 patients with chronic myeloid leukemia treated with imatinib. Login to comment
17 The SNPs T1236C, G 2677T/A, and C3435T are the most common variants in the coding region of ABCB1 [3]. Login to comment
21 Therefore, it is important that we analyze the T1236C, G2677T/A, and C3435T most relevant SNPs to identify genetic variants underlying susceptibility to imatinib efficacy in Chinese. Login to comment

PMID: 20448249 [PubMed] Alpman A et al: "Multidrug resistance 1 (MDR1) gene polymorphisms in childhood drug-resistant epilepsy."

No. Sentence Comment

13 To date, more than 50 polymorphisms have been identified within the MDR1 gene.7 C3435T, G2677AT, and T1236C are the most commonly investigated polymorphisms. Login to comment

PMID: 21213280 [PubMed] Krupoves A et al: "Associations between variants in the ABCB1 (MDR1) gene and corticosteroid dependence in children with crohn's disease."

No. Sentence Comment

92 Indeed, three polymorphisms in the gene, C3435T (rs1045642), T1236C (rs1128503), and triallelic SNP G2677T/A, have been shown to affect the expression of the Pg.47 FIGURE 1. Login to comment

PMID: 21857092 [PubMed] Milojkovic M et al: "Frequency of the C1236T, G2677T/A and C3435T MDR1 gene polymorphisms in the Serbian population."

No. Sentence Comment

43 Genotype frequencies of MDR1 variants observed in this study compared with those found in other populations Position C3435T G2677T/A T1236C Reference Population N CC CT TT GG GT GA TT TA AA CC CT TT Serbian 158 0.19 0.54 0.27 0.26 0.52 0.03 0.15 0.04 0.00 0.23 0.61 0.16 This study German 461 0.21 0.50 0.29 0.31 0.49 0.02 0.16 0.02 0.00 0.35** 0.49* 0.16 [4] Russian 290;59 0.21 0.49 0.30 0.30 0.45 0.04 0.18 0.03 0.00 0.24 0.56 0.20 [10, 11] Portuguese 100 0.12 0.47 0.41* 0.31 0.43 N. a. Login to comment

PMID: 21987299 [PubMed] Krupoves A et al: "Associations between variants in the ABCB1 (MDR1) gene and corticosteroid dependence in children with Crohn's disease."

No. Sentence Comment

91 Indeed, three polymorphisms in the gene, C3435T (rs1045642), T1236C (rs1128503), and triallelic SNP G2677T/A, have been shown to affect the expression of the Pg.47 FIGURE 1. Login to comment

PMID: 20627697 [PubMed] Sia AT et al: "The influence of ATP-binding cassette sub-family B member -1 (ABCB1) genetic polymorphisms on acute and chronic pain after intrathecal morphine for caesarean section: a prospective cohort study."

No. Sentence Comment

87 Table 1 Personal characteristics Age (yr) Weight (kg) Height (cm) Previous caesarean section Duration of surgery (min) Pain scores in recovery (0-10 VAS) SNP C3435T CC (n = 190, 31%) 32.2 (4.6) 69.2 (10) 158 (5.5) 70 (37) 51.9 (16) 0 [0-3] CT (n = 319, 51%) 32.5 (4.8) 69.3 (11) 158 (5.5) 112 (35) 52.2 (16) 0 [0-2] TT (n = 111, 18%) 32.5 (4.6) 68.9 (10) 159 (5.6) 43 (39) 54.8 (15) 0 [0-4] SNP T1236C TT (n = 288, 47%) 32.6 (4.6) 69.1 (10) 158 (5.9) 108 (37) 52.6 (17) 0 [0-4] TC (n = 263, 42%) 32.3 (4.6) 69.2 (9.2) 159 (5.3) 96 (37) 53.2 (16) 0 [0-3] CC (n = 61, 11%) 32.9 (5.0) 70.0 (14) 158 (5.8) 21 (34) 51.5 (11) 0 [0-3] SNP 2677 Homozygous T (n = 100, 16%) 32.0 (4.7) 70.0 (11) 159 (5.2) 38 (38) 53.2 (15) 0 [0-3] Heterozygous T (n = 308, 50%) 32.6 (4.5) 69.0 (11) 158 (5.6) 111 (36) 52.5 (17) 0 [0-4] No allele T (n = 205, 34%) 32.4 (4.7) 68.5 (9.1) 160 (3.8) 76 (37) 53.2 (16) 0 [0-3] SNP 2677 Homozygous G (n = 130, 21%) 32.3 (4.7) 68.8 (9.0) 159 (5.4) 51 (39) 54.6 (16) 0 [0-2] Heterozygous G (n = 327, 53%) 32.5 (4.5) 70.0 (11) 158 (5.6) 113 (35) 51.7 (16) 0 [0-2] No allele G (n = 156, 26%) 32.4 (4.7) 67.6 (10) 159 (5.3) 61 (40) 53.1 (15) 0 [0-3] SNP 2677 Homozygous A (n = 7, 1%) 32.5 (4.7) 67.8 (10) 158 (5.5) 3 (43) 54.0 (9) 0 [0-0] Heterozygous A (n = 117, 19%) 32.8 (4.6) 70.0 (11) 159 (5.6) 42 (36) 52.4 (15) 0 [0-3] No allele A (n = 489, 80%) 32.4 (5.2) 68.8 (9.8) 158 (5.3) 180 (37) 52.7 (16) 0 [0-4] The frequency of each SNP is expressed as absolute numbers (n), percentage of total (%); Data are mean (SD) except parturients with previous cesarean section, which are n (%) and pain scores which are median [range]; No statistically significant differences were found among the genotypes. Login to comment
88 Table 2 Data in the first 24 h after caesarean section Total morphine consumption (mg) Total pain scores (0-10 VAS) Total pruritus (0-3 severity score) Total nausea (0-3 severity score) Total episodes of vomiting SNP C3435T CC (n = 190) 6.9 (7.3) 2 [0-24] 0 [0-10] 0 [0-6] 0 [0-4] CT (n = 319) 7.3 (8.4) 2 [0-17] 0 [0-12] 0 [0-2] 0 [0-8] TT (n = 111) 7.6 (8.0) 2 [0-14] 0 [0-11] 0 [0-3] 0 [0-3] SNP T1236C TT (n = 288) 7.3 (8.5) 2 [0-24] 0 [0-12] 0 [0-3] 0 [0-3] TC (n = 263) 6.9 (7.7) 2 [0-17] 0 [0-12] 0 [0-6] 0 [0-8] CC (n = 61) 8.4 (8.7) 2 [0-13] 0 [0-12] 0 [0-6] 0 [0-3] SNP 2677 Homozygous T (n = 100) 8.0 (9.3) 2 [0-24] 2 [0-11] 0 [0-3] 0 [0-3] Heterozygous T (n = 308) 6.8 (7.6) 2 [0-14] 0 [0-12] 0 [0-3] 0 [0-8] No allele T (n = 205) 7.7 (8.5) 2 [0-14] 0 [0-11] 0 [0-6] 0 [0-4] SNP 2677 Homozygous G (n = 130) 7.2 (7.8) 2 [0-14] 0.5 [0-11] 0 [0-6] 0 [0-8] Heterozygous G (n = 327) 7.2 (8.1) 2 [0-14] 0 [0-12] 0 [0-3] 0 [0-4] No allele G (n = 156) 7.5 (8.6) 2 [0-24] 1 [0-1]) 0 [0-3] 0 [0-3] SNP 2677 Homozygous A (n = 7) 3.0 (2.4) 0 [0-8] 0 [0-9] 0 [0-0] 0 [0-0] Heterozygous A (n = 117) 8.2 (8.9) 4 [0-14] 0 [0-12] 0 [0-3] 0 [0-8] No allele A (n = 489) 7.1 (8.0) 2 [0-24] 0 [0-12] 0 [0-6] 0 [0-3] Data are median [range] except nausea and morphine consumption which are actual number of episodes and mean (SD), respectively; No statistically significant differences were found among the genotypes. Login to comment
113 0.18 for CC, CT and TT, respectively (with an allelic frequency of 0.56 for C); our results were not dissimilar to the Chinese population in a previous study.10 Also, the presence of the T allele at position 2677, which was found to be closely linked to C3435T SNP in a previous study, has been shown to result in a reduced expression of Table 3 Data on persistent pain after caesarean section Incidence of persistent pain for 3 months or longer [n (%)] Survival time of post operative pain (months) SNP C3435T CC (n = 164) 9 (5.5) 1.43 (0.06) CT (n = 248) 17 (6.9) 1.42 (0.05) TT (n = 89) 12 (13.5)a 1.72 (0.11)b SNP T1236C TT (n = 233) 24 (10.3) 1.50 (0.06) TC (n = 209) 8 (3.8) 1.33 (0.05) CC (n = 54) 6 (11) 1.40 (0.13) SNP 2677 Homozygous T (n = 100) 8. Login to comment
116 P-glycoprotein in the placenta.11 SNP T1236C has also been found to have an impact on methadone dose requirements in chronic opioid users even though its impact on the effectiveness of morphine is undetermined.12 However, while the blood brain barrier could be an important site for modulation of morphine in mice,2 there is to date, no evidence of an association between the SNP which we investigated in this study, and any clinically relevant differences in the quality of analgesia rendered by morphine in postoperative patients. Login to comment
89 Table 2 Data in the first 24 h after caesarean section Total morphine consumption (mg) Total pain scores (0-10 VAS) Total pruritus (0-3 severity score) Total nausea (0-3 severity score) Total episodes of vomiting SNP C3435T CC (n = 190) 6.9 (7.3) 2 [0-24] 0 [0-10] 0 [0-6] 0 [0-4] CT (n = 319) 7.3 (8.4) 2 [0-17] 0 [0-12] 0 [0-2] 0 [0-8] TT (n = 111) 7.6 (8.0) 2 [0-14] 0 [0-11] 0 [0-3] 0 [0-3] SNP T1236C TT (n = 288) 7.3 (8.5) 2 [0-24] 0 [0-12] 0 [0-3] 0 [0-3] TC (n = 263) 6.9 (7.7) 2 [0-17] 0 [0-12] 0 [0-6] 0 [0-8] CC (n = 61) 8.4 (8.7) 2 [0-13] 0 [0-12] 0 [0-6] 0 [0-3] SNP 2677 Homozygous T (n = 100) 8.0 (9.3) 2 [0-24] 2 [0-11] 0 [0-3] 0 [0-3] Heterozygous T (n = 308) 6.8 (7.6) 2 [0-14] 0 [0-12] 0 [0-3] 0 [0-8] No allele T (n = 205) 7.7 (8.5) 2 [0-14] 0 [0-11] 0 [0-6] 0 [0-4] SNP 2677 Homozygous G (n = 130) 7.2 (7.8) 2 [0-14] 0.5 [0-11] 0 [0-6] 0 [0-8] Heterozygous G (n = 327) 7.2 (8.1) 2 [0-14] 0 [0-12] 0 [0-3] 0 [0-4] No allele G (n = 156) 7.5 (8.6) 2 [0-24] 1 [0-1]) 0 [0-3] 0 [0-3] SNP 2677 Homozygous A (n = 7) 3.0 (2.4) 0 [0-8] 0 [0-9] 0 [0-0] 0 [0-0] Heterozygous A (n = 117) 8.2 (8.9) 4 [0-14] 0 [0-12] 0 [0-3] 0 [0-8] No allele A (n = 489) 7.1 (8.0) 2 [0-24] 0 [0-12] 0 [0-6] 0 [0-3] Data are median [range] except nausea and morphine consumption which are actual number of episodes and mean (SD), respectively; No statistically significant differences were found among the genotypes. Login to comment
114 0.18 for CC, CT and TT, respectively (with an allelic frequency of 0.56 for C); our results were not dissimilar to the Chinese population in a previous study.10 Also, the presence of the T allele at position 2677, which was found to be closely linked to C3435T SNP in a previous study, has been shown to result in a reduced expression of Table 3 Data on persistent pain after caesarean section Incidence of persistent pain for 3 months or longer [n (%)] Survival time of post operative pain (months) SNP C3435T CC (n = 164) 9 (5.5) 1.43 (0.06) CT (n = 248) 17 (6.9) 1.42 (0.05) TT (n = 89) 12 (13.5)a 1.72 (0.11)b SNP T1236C TT (n = 233) 24 (10.3) 1.50 (0.06) TC (n = 209) 8 (3.8) 1.33 (0.05) CC (n = 54) 6 (11) 1.40 (0.13) SNP 2677 Homozygous T (n = 100) 8. Login to comment
117 P-glycoprotein in the placenta.11 SNP T1236C has also been found to have an impact on methadone dose requirements in chronic opioid users even though its impact on the effectiveness of morphine is undetermined.12 However, while the blood brain barrier could be an important site for modulation of morphine in mice,2 there is to date, no evidence of an association between the SNP which we investigated in this study, and any clinically relevant differences in the quality of analgesia rendered by morphine in postoperative patients. Login to comment

PMID: 16386926 [PubMed] Kim YO et al: "Single nucleotide polymorphisms in the multidrug resistance 1 gene in Korean epileptics."

No. Sentence Comment

16 Among these proteins, P-glycoprotein 170, which is the product of the ATP-binding cassette subfamily b member 1 (ABCB1), also known as the multidrug resistance 1 (MDR1) gene, is the most extensively studied.4 P-glycoprotein 170 is an energy-dependent efflux pump that exports several antiepileptic drugs,4,6 including carbamazepine,7 phenytoin,8 phenobarbital, lamotrigine, and felbamate.9 Single nucleotide polymorphisms (SNPs) in the MDR1 gene have been described, including T1236C in exon 12, G2677T/A in exon 21, and C3435T in exon 26. Login to comment
62 But the BBB represents a serous obstacle in achieving appropriate drug concentrations in the CNS.19 The P-glycoprotein of an efflux transporter in the BBB is a 170-kDa transmembrane phosphoglycoprotein that is encoded by the MDR1 gene, which is located on chromosome 7 and consists of 28 exons.6,20 The P-glycoprotein expression levels in different tissues are not constant, but rather change in response to various agents and environmental factors.20 In epileptics, P-glycoprotein is overexpressed in endothelial cells of the BBB and is expressed at sites at which P-glycoprotein is not expressed in normal subjects, e.g., in astrocytes and neurons.21-23 Mutations in MDR1 influence the expression or function of P-glycoprotein in normal tissues.24 Approximately 28 SNPs have been identified in MDR1, among which the SNPs of T1236C in exon 12, G2677A/T in exon 21, and C3425T in exon 26 are the most commonly reported in normal subjects 70 Y.O. Kim et al. Table 3 Genotype frequencies at nucleotide site 2677 in exon 21 of MDR1 Genotype Genotype frequency, N (%) P value Odds ratio 95% C.I. RS [N, 99] RP [N, 107] GG 19 (19.2) 17 (15.9) 0.66 1.26 0.61-2.58 GT 33 (33.3) 40 (37.4) 0.64 0.84 0.47-1.48 GA 22 (22.2) 21 (19.6) 0.77 1.17 0.60-2.29 TA 12 (12.1) 15 (14.0) 0.84 0.85 0.37-1.91 TT 11 (11.1) 9 (8.4) 0.68 1.36 0.54-3.44 AA 2 (2.0) 5 (4.7) 0.49 0.42 0.08-2.22 N, total number; RS, patients with drug-resistant epilepsy; RP, patients with drug-responsive epilepsy. Login to comment
65 from different ethnic groups.15-17 The G2677A/T SNP in exon 21 is usually associated with an amino acid conversion from Ala to Thr and to Ser, respectively.15 On the other hand, the T1236C SNP in exon 12 is located in non-coding regions and the C3435T SNP in exon 26 does not lead to a change in the amino acid sequence.15 Nevertheless, silent SNPs may play important roles in drug resistance, since they may be in linkage disequilibrium with non-silent SNPs.3,15,25 The mutation at nucleotide position 3435 in exon 26 of MDR1 is the most frequently studied polymorphism in relation to multidrug resistance.3,10-12 Siddiqui et al.3 have reported an association between multidrug resistance in epileptics and the C3435T polymorphism in the drug transporter gene ABCB1. Login to comment
74 Moreover, MDR1 mutations may reveal the characteristics of specific MDR1 variants, which could lead to the development of inhibitors that are specific for individual variants.12 Single nucleotide polymorphisms 71 Table 5 Haplotype frequencies of three single nucleotide polymorphisms in the MDR1 gene Haplotype Haplotype frequency (%) P value Odds ratio 95% C.I. T1236C G2677T/A C3435T RS [N, 97] RP [N, 99] T G C 20.78 19.49 0.96 1.09 0.54-2.21 T G T 1.07 4.68 0.28 0.20 0.02-1.71 T T C 10.40 9.13 0.95 1.15 0.45-2.96 T T T 17.12 15.74 0.95 1.10 0.52-2.33 T A C 1.06 0.59 0.67 1.02 0.06-16.56 T A T 10.40 8.95 0.92 1.15 0.45-2.96 C G C 19.91 17.24 0.77 1.18 0.57-2.42 C G T 0.00 0.00 C T C 16.54 16.12 0.91 1.02 0.48-2.19 C T T 0.79 1.44 0.80 1.02 0.06-16.56 C A C 1.94 6.62 0.21 0.28 0.06-1.37 C A T 0.00 0.00 N, total number; RS, patients with drug-resistant epilepsy; RP, patients with drug-responsive epilepsy. Login to comment

PMID: 12189368 [PubMed] Kurata Y et al: "Role of human MDR1 gene polymorphism in bioavailability and interaction of digoxin, a substrate of P-glycoprotein."

No. Sentence Comment

57 1 5 14 15 16 2 7 9 11 12 3 4 6 10 13 5Ј-Flanking region A-41aG Noncoding A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A G/G Exon 1a C-145G Noncoding C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C Exon 1b T-129C Noncoding T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/C Exon 12 T1236C Gly412Gly C/C C/C T/T T/T T/C T/T C/C T/T T/T T/C T/T T/T T/T T/T T/T Exon 21 G2677T Ala893Ser G/G G/G G/G G/G G/G G/T G/T G/T G/T G/T T/T T/T T/T T/T T/T Exon 24 A2956G Met986Val A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A Exon 26 C3435T Ile1145I1e C/C C/C C/C C/C C/C C/T C/T C/T C/T C/T T/T T/T T/T T/T T/T Exon 28 G4030C Noncoding G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G Exon 28 A4036G Noncoding A/G A/A A/G A/A A/A A/G A/A G/G A/A A/A A/G A/G A/A A/G A/G Genotypic classification G/G2677C/C3435 G/T2677C/T3435 T/T2677T/T3435 Fig 1. Login to comment

PMID: 15217301 [PubMed] Ieiri I et al: "The MDR1 (ABCB1) gene polymorphism and its clinical implications."

No. Sentence Comment

41 [47] Membrane-spanning domain 1 Nucleotide binding domain 1 Membrane-spanning domain 2 Nucleotide binding domain 2 1 1280 Asn21࢐Asp Glu108࢐Lys Ser400࢐Asn Ala893࢐Thr/Ser Met986࢐Val Gln1107࢐Pro ATP site ATP site Phe103࢐Leu Asn183࢐Ser Arg492࢐Cys Ser1141࢐Thr T1236C C3396T C3435T Fig. 1. Login to comment
80 [Note: Tables II and III are a continuation of table I] Ethnic background Subject C+139T C+145T A548G G1199A T1236C C+44T C1474T T-76A A+137G (183N࢐S) (400S࢐N) (492R࢐C) C/T C/T A/G G/A T/C C/T C/T T/A A/G Asian/Oceanian Japanese (n = 100) [10] Placental cDNA 1.00/0 1.00/0 0.65/0.35 1.00/0 Japanese (n = 114) [55] Volunteers Chinese (n = 92-104) [54] Neonates (umbilical cords) 0.69/0.31 Chinese (n = 96-132) [56,57] Volunteers/blood donors 0.72/0.28 Filipino (n = 60) [56] Volunteers/blood donors Indian (n = 61-68) [54] Neonates (umbilical cords) 0.61/0.39 Indian (n = 87) [57] Volunteers 0.67/0.33 Malay (n = 80-93) [54] Neonates (umbilical cords) 0.69/0.31 Malay (n = 92) [57] Volunteers 0.66/0.34 Southwest (n = 89) [56] Volunteers/blood donors Middle East Saudi (n = 96) [56] Volunteers/blood donors African Ghanaian Volunteers/blood donors (n = 172-206) [56,58] Kenyan (n = 80) [56] Volunteers/blood donors Sudanese (n = 51) [56] Volunteers/blood donors African American African American Volunteers/blood donors 1.00/0 1.00/0 1.00/0 (n = 23-88) [52,56] Caucasian Caucasian German Volunteers 0.63/0.37 0.94/0.06 0.41/0.59 0.95/0.05 0.54/0.46 (n = 461) [51] Caucasian UK (n = 190) [56] Volunteers/blood donors Portuguese (n = 100) [56] Volunteers/blood donors Italian (n = 106) [59] Control for Parkinson`s disease Caucasian (n = 537) [3] Control for renal tumours Caucasian (n = 37-188) [9,52] Volunteers 0.59/0.41 0.99/0.01 0.99/0.01 (0.94-0.95)/ 0.62/0.38 0.94/0.06 0.99/0.01 0.55/0.45 0.99/0.01 (0.05-0.06) Continued next page or the volume of distribution at steady state. Login to comment
91 Contd Ethnic background Subject C+139T C+145T A548G G1199A T1236C C+44T C1474T T-76A A+137G (183N࢐S) (400S࢐N) (492R࢐C) C/T C/T A/G G/A T/C C/T C/T T/A A/G Specific patient groups Japanese (n = 17) [6] LDLT recipients 1.00/0 1.00/0 0.62/0.38 1.00/0 1.00/0 Japanese (n = 68-69) [7] LDLT recipients 0.37/0.63 1.00/0 0.65/0.35 1.00/0 0.68/0.32 Italian (n = 25) [59] Early onset Parkinson`s disease Italian (n = 70) [59] Late onset Parkinson`s disease Caucasian New Zealand Depressed patients (n = 160) [1] Caucasian (n = 124) [60] Renal transplant recipients Caucasian (n = 212) [3] Renal epithelial tumours LDLT = living donor liver transplantation. Login to comment

PMID: 21079659 [PubMed] Maleki M et al: "Association between ABCB1-T1236C polymorphism and drug-resistant epilepsy in Iranian female patients."

No. Sentence Comment

3 We studied the association of T129C and T1236C single-nucleotide polymorphisms (SNP) of ABCB1 gene with drug-resistant epilepsy in Iranian epileptics. Login to comment
6 Results: No significant association was found between T129C and T1236C genotypes and drug-resistant epilepsy neither in adults nor in children. Login to comment
10 Conclusion: Our results indicate that T1236C polymorphism is associated with drug resistance in Iranian female epileptic patients. Login to comment
21 Association between single nucleotide polymorphisms (SNP) in the ABCB1 gene and refractory epilepsy has been studied by many researchers at different nucleotide positions such as T129C and T1236C in exon 12, G2677T in exon 21 and C3435T in exon 27 [9-15]. Login to comment
32 Therefore, this study proceeded to the association of two other most investigated SNP of the ABCB1 gene, T129C (rs2188524) and T1236C (rs1128503), with drug-resistant epilepsy in Iranian epileptic patients. Login to comment
53 SNP Primer sequences PCR product (bp) Restriction endonucleases Genotype determination on the gel T129C (rs2188524) Forward: 5'TTTCaCTACTTGCCCTTTCTAGAG3' Reverse: 5'CGGCCTCTGCTTCTTTGAG3' 258 MspA1I TT: 258 bp TC: 258 bp/226 bp/36 bp CC: 226 bp/32 bp T1236C (rs1128503) Forward: 5'GCCACaGTCTGCCCACTC3' Reverse: 5'CCCATaTCGAAAAGAAATTAAG3 240 HaeIII TT: 240 bp TC: 240 bp/204 bp/36 bp CC: 204 bp/36 bp 94&#b0;C for 40 s, annealing for 40 s at 58&#b0;C for T129C and 62&#b0;C for T1236C, an extension step at 72&#b0;C for 30 s, and a final extension step at 72&#b0;C for 5 min. Login to comment
58 Primer sequences and SNP at nucleotide positions T129C (A) and T1236C (B) in ABCB1 gene are demonstrated in Figure 1. Login to comment
68 (A) T129C (rs2188524) Forward Primer 5`TTTCACTACTTGCCCTTTCTAGAG3` Reverse Primer 5`CGGCCTCTGCTTCTTTAGG3` 5`TTTCACTACTTGCCCTTTCTAGAGAGGTGCAACGGAAGCCAGAACATTCCTCCTGGAAATTCAACCTGTTTCG CAGTTTCTCGAGGAATCAGCATTCAGTCAATCCGGGCCGGGAGCAGTCATCTGTGGTGAGGCTGATTGGCTGG GCAGGAACAGCGCCGGGGCGTGGGCTGAGCACAGCCGCTTCGCTCTCTTTGCCACAGGAAGCCTGAGCTCATT cgagCagcgGCTCTTCCAAGCTCAAAGAAGCAGAGGCCG3` (B) T1236C (rs1128503) Forward Primer 5`CCCATATCGAAAAGAAGTTAAG3` Reverse Primer 5`GCCACAGTCTGCCCACTC3` 5`CCCATCTCGAAAAGAAGTTAAGGTACAGTGATAAATGATTAATCAACAATTAATCTATTGAATGAAGAGTTT CTGATGTTTTCTTGTAGAGATTATAAAAAAGTGCATGTATATTTAAACCTAGTGAACAGTCAGTTCCTATATCC TGTGTCTGTGAATTGCCTTGAAGTTTTTTTCTCACTCGTCCTGGTAGATCTTGAagggCctgaACCTGAAGGTGCAG AGTGGGCAGACGGTGGC3` Fig. 1. Login to comment
69 Primer sequences and single nucleotide polymorphisms at nucleotide positions T129C (A) and T1236C (B) in ABCB1 gene. Login to comment
89 The genotype frequency of both T129C and T1236C polymorphisms did not differ significantly between drug-responsive and drug-resistant patients for CC, CT or TT genotypes (Table 4). Login to comment
90 When patients were stratified by patient age, no significant association was observed between ABCB1-T129C and -T1236C polymorphisms and 1 2 3 4 M 5 C1 C2 258 bp 226 bp Fig. 3. Login to comment
91 Genotype determination of epileptic patients for ABCB1-T1236C polymorphism based on digestion of a 240 bp amplified DNA fragment with HaeIII, analyzed by 2.5% agarose gel electrophoresis. Lanes 1-4 and 7, digestion resulted in two DNA fragments of 204 bp and 36 bp (CC genotype); lanes 5 and 8, digestion resulted in three DNA fragments of 240 bp, 204 bp and 36 bp (TC genotype); lane 6, fragment with no digestion site (TT genotype); M, 100 bp DNA ladder; C1 and C2 sequenced fragments with site for digestion in one or both alleles, as positive controls. Login to comment
94 However, when patients were stratified by gender, significant association was observed between ABCB1-T1236C polymorphism and drug resistance in females (Table 5). Login to comment
100 Genotype and allele frequencies at nucleotide positions T129C and T1236C of ABCB1 gene in normal non-epileptic subjects. Login to comment
101 Nucleotide position Genotype frequency Allele frequency ABCB1-T129C (rs2188524) CC 0 (0%) CT 11 (5.5%) TT 189 (94.5%) C 11 (2.75%) T 289 (97.25%) ABCB1-T1236C (rs1128503) CC 43 (21.5%) CT 95 (47.5) TT 62 (31.00%) T 219 (54.7%) C 181 (45.25%) association was found between ABCB1-129T>C polymorphism and drug response in patients with idiopathic epilepsy but not in those with symptomatic epilepsy (Table 6). Login to comment
104 Genotype frequencies and drug-resistance odds ratio for ABCB1-T129C and -T1236C polymorphisms in Iranian epileptic patients. Login to comment
105 P OR (95% CI) Drug-resistant patients Drug-responsive patients Genotype Subgroups of age 0.75 1.21 (0.36-4.06) 1 0 5 (3.75%) 127 (96.25%) 0 7 (3.5%) 193 (96.5%) CC CT TT ABCB1-T129C (n = 332) 0.75 1.21 (0.36-4.06) 1 0 5 (3.84%) 125 (96.15%) 0 6 (3.19%) 182 (96.8%) CC CT TT Adults (n = 318) small sample size 0 0 4 (100%) 0 1 (10%) 9 (90%) CC CT TT Children (n = 14) 0.11 0.19 1.73 (0.88-3.41) 1.39 (0.85-3.41) 1 24 (18.18%) 65 (49.24%) 43 (32.57%) 28 (14%) 87 (43.5%) 85 (42.5%) CC CT TT ABCB1-T1236C (n = 332) 0.11 0.19 1.73 (0.88-3.41) 1.39 (0.85-3.41) 1 23 (17.96%) 62 (48.43%) 43 (33.59%) 25 (13.15%) 84 (44.21%) 81 (42.63%) CC CT TT Adults (n = 318) small sample size 1 (25%) 3 (75%) 0 3 (30%) 3 (30%) 4 (40%) CC CT TT Children (n = 14) OR, odds ratios; CI, confidence interval M 1 2 3 4 5 6 7 8 C1 C2 240 bp 204 bp M 1 2 3 4 5 6 7 8 C1 C2 Table 5. Login to comment
106 Genotype frequencies of ABCB1-T129C and -T1236C polymorphisms and odds ratios in male and female epileptic patients. Login to comment
107 P OR (95% CI) Drug-resistant patients Drug-responsive patients Genotype Subgroups of gender ABCB1-T129C (n = 332) 0.78 1.23 (0.30-5.07) 1 0 4 (5.06%) 75 (94.93%) 0 4 (4.16%) 92(95.83%) CC CT TT Male (n = 175) 0.65 0.71 (0.07-6.38) 1 0 1 (1.88%) 52 (98.11%) 0 3 (2.9%) 101 (97.1%) CC CT TT Female (n =157) ABCB1-T1236C (n = 332) 0.53 0.41 0.76 (0.33-1.77) 0.75 (0.38-1.49) 1 16(20.25%) 36(45.56%) 27 (34.17%) 21 (21.87%) 48 (50%) 27 (28.12%) CC CT TT Male (n = 175) 0.02 0.008 4.14 (1.31-13.16) 2.70 (1.30-5.61) 1 8 (15.09%) 29 (54.71%) 16 (30.18%) 7 (6.73%) 39 (37.50%) 58 (55.76%) CC CT TT Female (n =157) OR, odds ratios; CI, confidence interval DISCUSSION Results of the present study demonstrate that by analyzing all patients as a whole, T129C and T1236C polymorphisms of ABCB1 gene are not associated with drug resistance in Iranian epileptics. Login to comment
108 The effect of T129C (rs2188524) and T1236C (rs1128503) polymorphisms of ABCB1 gene on AED resistance has been studied by many researchers. Login to comment
109 In some of these studies, an association was found between T1236C polymorphism and drug-resistant epilepsy [9-11]. Login to comment
110 However, in other studies such association was not observed for T1236C [12, 14] or for T129C [11]. Login to comment
114 Genotype frequencies of ABCB1-T129C and -T1236C polymorphisms and odds ratios in patients with idiopathic or symptomatic epilepsy. Login to comment
115 P OR (95% CI) Drug-resistant patients Drug-responsive patients Genotype Etiology of epilepsy ABCB1-T129C (n = 332) 0.001 25.00 (3.48-179.80) 1 0 3 (50%) 3 (50%) 0 3 (3.8%) 75 (96.2%) CC CT TT Idiopathic (n = 84) 0.77 1.22 (0.32-4.65) 1 0 5 (4.0%) 121 (96.0%) 0 4 (3.3%) 118 (96.7%) CC CT TT Symptomatic (n=248) ABCB1-T1236C (n = 332) Small sample size 0 0 6 (100%) 12 (15.4%) 41 (52.6%) 25 (32.0%) CC CT TT Idiopathic (n= 84) 0.02 0.004 2.43 (1.15-5.17) 2.29 (1.31-4.00) 1 24 (19.0 %) 65 (51.6%) 37 (29.4%) 16 (13.1%) 46 (37.7%) 60 (49.2%) CC CT TT Symptomatic (n =248) OR, odds ratios; CI, confidence interval similar to criteria of drug resistance used by Hung et al. [10]. Login to comment
116 However, in contrast to that study, we did not find any association between T1236C polymorphism and drug resistance in epileptic patients. Login to comment
122 When patients were stratified by age, no significant association was observed between ABCB1-T129C and T1236C polymorphisms and drug resistance neither in adults nor in children. Login to comment
132 Exclusion of the patients treated with carbamazepine and valproate did not affect the final result of T129C and T1236C polymorphisms and drug resistance. Login to comment

PMID: 23546964 [PubMed] Khabour OF et al: "Frequency of MDR1 single nucleotide polymorphisms in a Jordanian population, including a novel variant."

No. Sentence Comment

88 Variable C3435T G2677T T1236C Allele C Allele T Allele G Allele T Allele A Allele C Allele T Jordan (the current study) 42 58 62 36 2 43.5 56.5 Serbian (Milojkovic et al., 2011) 47 53 53 43 4 54 46 German (Cascorbi et al., 2001) 46 54 56.5 41.5 3 59.5 40.5 Russian (Gaikovitch et al., 2003) 45.5 54.5 54.5 42 3.5 52 48 Turkish (Turgut et al., 2006; Gumus-Akay et al., 2008) 46.5 53.5 47.5 52.5 Japanese (Komoto et al., 2006) 59.5 40.5 42.5 40.5 17 34.5 65.5 Chinese (Zhang et al., 2008) 56.5 43.5 42 44.5 14.5 34.5 65.5 Table 3. Login to comment

PMID: 24093937 [PubMed] Konecny GE et al: "Are ABCB1 (P-glycoprotein) polymorphisms clinically relevant in ovarian cancer? - Finally an Answer!"

No. Sentence Comment

20 In four of these studies no associations were found between clinical outcome and the polymorphisms tagging either T1236C [11,12] or G2677T/A and C3435T [12,14,15]. Login to comment

PMID: 24505408 [PubMed] Noack A et al: "Drug-induced trafficking of p-glycoprotein in human brain capillary endothelial cells as demonstrated by exposure to mitomycin C."

No. Sentence Comment

126 In the MDR1 sequence of this construct we identified three of the most common single nucleotide polymorphisms, T1236C (Gly412Gly), T2677G (Ser893Ala) and T3435C (Ile1145Ile), which have been described in MDR1 of humans [24]. Login to comment

PMID: 24581936 [PubMed] Au A et al: "Association of genotypes and haplotypes of multi-drug transporter genes ABCB1 and ABCG2 with clinical response to imatinib mesylate in chronic myeloid leukemia patients."

No. Sentence Comment

10 In the current study, the contribution of three common single nucleotide polymorphisms (SNPs) of ABCB1 (T1236C, G2677T/A and C3435T) and two SNPs of ABCG2 (G34A and C421A) genes in mediating resistance and/or good response among 215 CML patients on IM therapy were investigated. Login to comment
31 Three polymorphisms (T1236C, G2677T/A and C3435T) of ABCB1 have significant effect on P-gp expression, functionality and substrate distribution [3]. Login to comment
160 Conclusion Our results demonstrated a significant association of the SNPs ABCB1 T1236C, G2677T/A and ABCG2 C421A with IM efficacy. Login to comment

PMID: 25012726 [PubMed] He H et al: "Association of ABCB1 polymorphisms with the efficacy of ondansetron in chemotherapy-induced nausea and vomiting."

No. Sentence Comment

65 However, the ABCB1 T1236C polymorphism was not in Hardy Weinberg equilibrium and its allelic frequency was not consistent with previous studies reports in Chinese Han Beijing populations and National Center for Biotechnology Information databases (P &#bc; 0.034) (Supplemental Table I; supplemental tables accompanying this article can be found in the online version at http://dx.doi.org/10.1016/j.clinthera.2014. Login to comment