ABCMdb

PMID: 21079659

Maleki M, Sayyah M, Kamgarpour F, Karimipoor M, Arab A, Rajabi A, Gharagozli K, Shamshiri AR, Shahsavand Ananloo E
Association between ABCB1-T1236C polymorphism and drug-resistant epilepsy in Iranian female patients.
Iran Biomed J. 2010 Jul;14(3):89-96., [PubMed]

Sentences

No. Mutations Sentence Comment

3 ABCB1 p.Thr1236Cys We studied the association of T129C and T1236C single-nucleotide polymorphisms (SNP) of ABCB1 gene with drug-resistant epilepsy in Iranian epileptics. Login to comment 6 ABCB1 p.Thr1236Cys Results: No significant association was found between T129C and T1236C genotypes and drug-resistant epilepsy neither in adults nor in children. Login to comment 10 ABCB1 p.Thr1236Cys Conclusion: Our results indicate that T1236C polymorphism is associated with drug resistance in Iranian female epileptic patients. Login to comment 21 ABCB1 p.Thr1236Cys Association between single nucleotide polymorphisms (SNP) in the ABCB1 gene and refractory epilepsy has been studied by many researchers at different nucleotide positions such as T129C and T1236C in exon 12, G2677T in exon 21 and C3435T in exon 27 [9-15]. Login to comment 32 ABCB1 p.Thr1236Cys Therefore, this study proceeded to the association of two other most investigated SNP of the ABCB1 gene, T129C (rs2188524) and T1236C (rs1128503), with drug-resistant epilepsy in Iranian epileptic patients. Login to comment 53 ABCB1 p.Thr1236Cys ABCB1 p.Thr1236Cys SNP Primer sequences PCR product (bp) Restriction endonucleases Genotype determination on the gel T129C (rs2188524) Forward: 5'TTTCaCTACTTGCCCTTTCTAGAG3' Reverse: 5'CGGCCTCTGCTTCTTTGAG3' 258 MspA1I TT: 258 bp TC: 258 bp/226 bp/36 bp CC: 226 bp/32 bp T1236C (rs1128503) Forward: 5'GCCACaGTCTGCCCACTC3' Reverse: 5'CCCATaTCGAAAAGAAATTAAG3 240 HaeIII TT: 240 bp TC: 240 bp/204 bp/36 bp CC: 204 bp/36 bp 94&#b0;C for 40 s, annealing for 40 s at 58&#b0;C for T129C and 62&#b0;C for T1236C, an extension step at 72&#b0;C for 30 s, and a final extension step at 72&#b0;C for 5 min. Login to comment 58 ABCB1 p.Thr1236Cys Primer sequences and SNP at nucleotide positions T129C (A) and T1236C (B) in ABCB1 gene are demonstrated in Figure 1. Login to comment 68 ABCB1 p.Thr1236Cys (A) T129C (rs2188524) Forward Primer 5`TTTCACTACTTGCCCTTTCTAGAG3` Reverse Primer 5`CGGCCTCTGCTTCTTTAGG3` 5`TTTCACTACTTGCCCTTTCTAGAGAGGTGCAACGGAAGCCAGAACATTCCTCCTGGAAATTCAACCTGTTTCG CAGTTTCTCGAGGAATCAGCATTCAGTCAATCCGGGCCGGGAGCAGTCATCTGTGGTGAGGCTGATTGGCTGG GCAGGAACAGCGCCGGGGCGTGGGCTGAGCACAGCCGCTTCGCTCTCTTTGCCACAGGAAGCCTGAGCTCATT cgagCagcgGCTCTTCCAAGCTCAAAGAAGCAGAGGCCG3` (B) T1236C (rs1128503) Forward Primer 5`CCCATATCGAAAAGAAGTTAAG3` Reverse Primer 5`GCCACAGTCTGCCCACTC3` 5`CCCATCTCGAAAAGAAGTTAAGGTACAGTGATAAATGATTAATCAACAATTAATCTATTGAATGAAGAGTTT CTGATGTTTTCTTGTAGAGATTATAAAAAAGTGCATGTATATTTAAACCTAGTGAACAGTCAGTTCCTATATCC TGTGTCTGTGAATTGCCTTGAAGTTTTTTTCTCACTCGTCCTGGTAGATCTTGAagggCctgaACCTGAAGGTGCAG AGTGGGCAGACGGTGGC3` Fig. 1. Login to comment 69 ABCB1 p.Thr1236Cys Primer sequences and single nucleotide polymorphisms at nucleotide positions T129C (A) and T1236C (B) in ABCB1 gene. Login to comment 89 ABCB1 p.Thr1236Cys The genotype frequency of both T129C and T1236C polymorphisms did not differ significantly between drug-responsive and drug-resistant patients for CC, CT or TT genotypes (Table 4). Login to comment 90 ABCB1 p.Thr1236Cys When patients were stratified by patient age, no significant association was observed between ABCB1-T129C and -T1236C polymorphisms and 1 2 3 4 M 5 C1 C2 258 bp 226 bp Fig. 3. Login to comment 91 ABCB1 p.Thr1236Cys Genotype determination of epileptic patients for ABCB1-T1236C polymorphism based on digestion of a 240 bp amplified DNA fragment with HaeIII, analyzed by 2.5% agarose gel electrophoresis. Lanes 1-4 and 7, digestion resulted in two DNA fragments of 204 bp and 36 bp (CC genotype); lanes 5 and 8, digestion resulted in three DNA fragments of 240 bp, 204 bp and 36 bp (TC genotype); lane 6, fragment with no digestion site (TT genotype); M, 100 bp DNA ladder; C1 and C2 sequenced fragments with site for digestion in one or both alleles, as positive controls. Login to comment 94 ABCB1 p.Thr1236Cys However, when patients were stratified by gender, significant association was observed between ABCB1-T1236C polymorphism and drug resistance in females (Table 5). Login to comment 100 ABCB1 p.Thr1236Cys Genotype and allele frequencies at nucleotide positions T129C and T1236C of ABCB1 gene in normal non-epileptic subjects. Login to comment 101 ABCB1 p.Thr1236Cys Nucleotide position Genotype frequency Allele frequency ABCB1-T129C (rs2188524) CC 0 (0%) CT 11 (5.5%) TT 189 (94.5%) C 11 (2.75%) T 289 (97.25%) ABCB1-T1236C (rs1128503) CC 43 (21.5%) CT 95 (47.5) TT 62 (31.00%) T 219 (54.7%) C 181 (45.25%) association was found between ABCB1-129T>C polymorphism and drug response in patients with idiopathic epilepsy but not in those with symptomatic epilepsy (Table 6). Login to comment 104 ABCB1 p.Thr1236Cys Genotype frequencies and drug-resistance odds ratio for ABCB1-T129C and -T1236C polymorphisms in Iranian epileptic patients. Login to comment 105 ABCB1 p.Thr1236Cys P OR (95% CI) Drug-resistant patients Drug-responsive patients Genotype Subgroups of age 0.75 1.21 (0.36-4.06) 1 0 5 (3.75%) 127 (96.25%) 0 7 (3.5%) 193 (96.5%) CC CT TT ABCB1-T129C (n = 332) 0.75 1.21 (0.36-4.06) 1 0 5 (3.84%) 125 (96.15%) 0 6 (3.19%) 182 (96.8%) CC CT TT Adults (n = 318) small sample size 0 0 4 (100%) 0 1 (10%) 9 (90%) CC CT TT Children (n = 14) 0.11 0.19 1.73 (0.88-3.41) 1.39 (0.85-3.41) 1 24 (18.18%) 65 (49.24%) 43 (32.57%) 28 (14%) 87 (43.5%) 85 (42.5%) CC CT TT ABCB1-T1236C (n = 332) 0.11 0.19 1.73 (0.88-3.41) 1.39 (0.85-3.41) 1 23 (17.96%) 62 (48.43%) 43 (33.59%) 25 (13.15%) 84 (44.21%) 81 (42.63%) CC CT TT Adults (n = 318) small sample size 1 (25%) 3 (75%) 0 3 (30%) 3 (30%) 4 (40%) CC CT TT Children (n = 14) OR, odds ratios; CI, confidence interval M 1 2 3 4 5 6 7 8 C1 C2 240 bp 204 bp M 1 2 3 4 5 6 7 8 C1 C2 Table 5. Login to comment 106 ABCB1 p.Thr1236Cys Genotype frequencies of ABCB1-T129C and -T1236C polymorphisms and odds ratios in male and female epileptic patients. Login to comment 107 ABCB1 p.Thr1236Cys ABCB1 p.Thr1236Cys P OR (95% CI) Drug-resistant patients Drug-responsive patients Genotype Subgroups of gender ABCB1-T129C (n = 332) 0.78 1.23 (0.30-5.07) 1 0 4 (5.06%) 75 (94.93%) 0 4 (4.16%) 92(95.83%) CC CT TT Male (n = 175) 0.65 0.71 (0.07-6.38) 1 0 1 (1.88%) 52 (98.11%) 0 3 (2.9%) 101 (97.1%) CC CT TT Female (n =157) ABCB1-T1236C (n = 332) 0.53 0.41 0.76 (0.33-1.77) 0.75 (0.38-1.49) 1 16(20.25%) 36(45.56%) 27 (34.17%) 21 (21.87%) 48 (50%) 27 (28.12%) CC CT TT Male (n = 175) 0.02 0.008 4.14 (1.31-13.16) 2.70 (1.30-5.61) 1 8 (15.09%) 29 (54.71%) 16 (30.18%) 7 (6.73%) 39 (37.50%) 58 (55.76%) CC CT TT Female (n =157) OR, odds ratios; CI, confidence interval DISCUSSION Results of the present study demonstrate that by analyzing all patients as a whole, T129C and T1236C polymorphisms of ABCB1 gene are not associated with drug resistance in Iranian epileptics. Login to comment 108 ABCB1 p.Thr1236Cys The effect of T129C (rs2188524) and T1236C (rs1128503) polymorphisms of ABCB1 gene on AED resistance has been studied by many researchers. Login to comment 109 ABCB1 p.Thr1236Cys In some of these studies, an association was found between T1236C polymorphism and drug-resistant epilepsy [9-11]. Login to comment 110 ABCB1 p.Thr1236Cys However, in other studies such association was not observed for T1236C [12, 14] or for T129C [11]. Login to comment 114 ABCB1 p.Thr1236Cys Genotype frequencies of ABCB1-T129C and -T1236C polymorphisms and odds ratios in patients with idiopathic or symptomatic epilepsy. Login to comment 115 ABCB1 p.Thr1236Cys P OR (95% CI) Drug-resistant patients Drug-responsive patients Genotype Etiology of epilepsy ABCB1-T129C (n = 332) 0.001 25.00 (3.48-179.80) 1 0 3 (50%) 3 (50%) 0 3 (3.8%) 75 (96.2%) CC CT TT Idiopathic (n = 84) 0.77 1.22 (0.32-4.65) 1 0 5 (4.0%) 121 (96.0%) 0 4 (3.3%) 118 (96.7%) CC CT TT Symptomatic (n=248) ABCB1-T1236C (n = 332) Small sample size 0 0 6 (100%) 12 (15.4%) 41 (52.6%) 25 (32.0%) CC CT TT Idiopathic (n= 84) 0.02 0.004 2.43 (1.15-5.17) 2.29 (1.31-4.00) 1 24 (19.0 %) 65 (51.6%) 37 (29.4%) 16 (13.1%) 46 (37.7%) 60 (49.2%) CC CT TT Symptomatic (n =248) OR, odds ratios; CI, confidence interval similar to criteria of drug resistance used by Hung et al. [10]. Login to comment 116 ABCB1 p.Thr1236Cys However, in contrast to that study, we did not find any association between T1236C polymorphism and drug resistance in epileptic patients. Login to comment 122 ABCB1 p.Thr1236Cys When patients were stratified by age, no significant association was observed between ABCB1-T129C and T1236C polymorphisms and drug resistance neither in adults nor in children. Login to comment 132 ABCB1 p.Thr1236Cys Exclusion of the patients treated with carbamazepine and valproate did not affect the final result of T129C and T1236C polymorphisms and drug resistance. Login to comment