ABCMdb

PMID: 24440239

Muthuswamy S, Agarwal S, Awasthi S, Singh S, Dixit P, Maurya N, Choudhuri G
Spectrum and distribution of CFTR gene mutations in asthma and chronic pancreatitis cases of North Indian population.
Gene. 2014 Apr 10;539(1):125-31. doi: 10.1016/j.gene.2014.01.022. Epub 2014 Jan 14., [PubMed]

Sentences

No. Mutations Sentence Comment

3 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Trp1282* ABCC7 p.Gly542* ABCC7 p.Ser549Asn Methods: A total of 800 subjects including 400 controls, 250 asthma cases and150 chronic pancreatitis cases were analyzed for 6 mutations (F508del, G542X, G551D, R117H, W1282X, and S549N) and IVS8 Tn polymorphism. Login to comment 4 ABCC7 p.Trp1282* Results: Out of 800 subjects, 18% [asthma - 24% (n = 250), CP - 29.33% (n = 150) cases and controls - 9.3% (n = 400)] were positive for heterozygous mutation, 0.8% of the (n = 250) asthmatic cases (n = 250) were homozygous for IVS8 T5 polymorphism while no subjects were found positive for W1282X mutation. Login to comment 6 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Gly542* ABCC7 p.Ser549Asn The carrier frequency of F508del, G542X, G551D, R117H, S549N and T5 was 0.015, 0.025, 0.02, 0.005, 0.005, and 0.022 respectively. Login to comment 44 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Trp1282* ABCC7 p.Gly542* ARMS PCR Identification of F508del, G551D, G542X, R117H and W1282X mutations were carried out by ARMS PCR (Ferrie et al., 1992). Login to comment 50 ABCC7 p.Ser549Asn PCR RFLP S549N mutation was analyzed by PCR RFLP (Kerem et al., 1990). Login to comment 63 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Gly542* ABCC7 p.Ser549Asn Mutation Primer Method Amplicon (size in bp) Reference DF508 C GACTTCACTTCTAATGATGATTATGGGAG ARMS Ferrie et al. (1992) N GTATCTATATTCATCATAGGAAACACCAC 160 M GTATCTATATTCATCATAGGAAACACCAT 157 G551D C TAAAATTTCAGCAATGTTGTTTTTGACC N GCTAAAGAAATTCTTGCTCGTTGCC 285 M AGCTAAAGAAATTCTTGCTCGTTGCT 286 G542X C TAAAATTTCAGCAATGTTGTTTTTGACC N ACTCAGTGTGATTCCACCTTCTAC 256 M CACTCAGTGTGATTCCACCTTCTCA 257 R117H C CACATATGGTATGACCCTCTATATAAACT N CCTATGCCTAGATAAATCGCGATAGAAC 237 M CCTATGCCTAGATAAATCGCGATAGAAT 237 S549N For TTCAGCAATGTTGTTTTGACCAAC RFLP (DdeI) N: 13 + 238 + 174 H: 13 + 238 + 174 + 412 M: 13 + 412 Kerem et al. (1990) Rev CACAGATTCTGAGTAACCATAATC IVS8 Tn For1 TAATGGATCATGGGCCATGT Nested PCR (Xmn1) 5T - 84 7T - 86 9T - 88 Chillon et al. (1995) Rev1 ACAGTGTTGAATGTGGTGCA For2 CCGCCGCTGTGTGTGTGTGTGTGTTTTT Rev2 GGATCCAGCAACCGCCAACA 3. Login to comment 66 ABCC7 p.Trp1282* W1282X mutations, known to be the second most common among North Americans (http://www.genet.sickkids.on.ca), were not detected in the present study. Login to comment 71 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Gly542* ABCC7 p.Ser549Asn Controls (n = 400) Minor allele frequency of F508del, G542X, G551D, R117H and S549N observed to be 0.0075, 0.0125, 0.01, 0.0025 and 0.0025 respectively (Table 2). Login to comment 73 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Gly542* ABCC7 p.Ser549Asn We further stratified data as per their prevalence and found G542X to be the most common mutation with the frequency of 2.49%, followed by G551D, F508del, R117H and S549N with 2.00%, 1.50%, 0.50% and 0.50% respectively and 2.24% for 5T allele (Fig. 1A). Login to comment 75 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Ser549Asn Asthma cases (n = 250) We observed a minor allele frequency of 0.008, 0.022, 0.028, 0.002, 0.01 and 0.058 for F508del, G452X, G551D, R117H, S549N and IVS8 T5 respectively (Table 2). Login to comment 76 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Gly542* ABCC7 p.Ser549Asn The frequency of individuals falling in different mutations were 10%, 5.6%, 4.4%, 2.0%, 1.6% and 0.4% with respect to IVS8 T5, G551D, G542X, S549N, F508del and R117H (Fig. 1B). Login to comment 78 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Ser549Asn CP cases (n = 150) 300 chromosomes belonging to this subgroup found to have the minor allele frequency of 0.04, 0.03, 0.03, 0.006, 0.013 and 0.02 for F508del, G452X, G551D, R117H, S549N and IVS8 T5 respectively (Table 2). Login to comment 79 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Ser549Asn The frequency of heterozygous individuals were 8.67%, 6.67%, 6.00%, 2.67%, 1.33% and 4.00% for F508del, G452X, G551D, R117H, S549N and IVS8 T5 respectively (Fig. 1C). Login to comment 87 ABCC7 p.Gly542* ABCC7 p.Gly542* G542X mutation The conversion of glycine residue at 542 position to termination codon (G542X) interrupts mRNA processing. Login to comment 89 ABCC7 p.Gly542* Among CP patients, G542X mutation prevalence was 6.7% (10/150), followed by asthma patients and controls with 4.4% (11/250) and 2.5% (10/400) respectively. Login to comment 91 ABCC7 p.Gly542* However, in asthma patients G542X heterozygosity was slightly higher in relative to controls but statistically insignificant. Login to comment 93 ABCC7 p.Gly551Asp G551D mutation A missense mutation arises by replacing glycine amino acid at 551st position to aspartic acid, and belongs to class III mutation. Login to comment 95 ABCC7 p.Gly551Asp The prevalence of G551D mutation is more or less similar between CP and asthma patients with the frequency of 6.0% (9/150) and 5.6% (14/250) respectively, followed by controls with 2.0% (8/400). Login to comment 98 ABCC7 p.Arg117His ABCC7 p.Ser549Asn R117H and S549N mutations The mutation falls in class IV and class III categories respectively. Login to comment 100 ABCC7 p.Arg117His The frequency for R117H mutation among the CP patients was 1.3%/150, which was statically different compared to neither the group of asthma patients (0.4%/250) nor the controls (0.5%/400). Login to comment 101 ABCC7 p.Ser549Asn Similarly, the genotype frequency of S549N mutation of CP (2.7%/150), asthma (2%/250) and controls (0.5%/400) showed no significance. Login to comment 112 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Gly542* ABCC7 p.Ser549Asn Serial no. Mutation General population (400) Asthma (250) Chronic pancreatitis (150) 1 DF508 0.0075 0.0080 0.0433 2 G542X 0.0125 0.0220 0.0333 3 G551D 0.01 0.0280 0.03 4 R117H 0.0025 0.0020 0.0066 5 S549N 0.0025 0.0100 0.0133 6 IVS8-5T 0.01125 0.0580 0.02 thrive, pancreatic insufficiency, elevated sweat electrolytes, late-stage diabetes and cardiac failure, besides male infertility due to congenital bilateral absence of the vas deferens (CBAVD) (Schrijver et al., 2005). Login to comment 118 ABCC7 p.Gly542* ABCC7 p.Ser549Asn A) Among the studied 5 mutation and 1 polymorphism, G542X mutation accounts for 27% (10 out of 37) in controls and the least one is S549N of 5% (2 out of 37). Login to comment 119 ABCC7 p.Arg117His B) In asthma patients IVS8-T5 polymorphism is the common one accounting for 42% (25 out of 60) and the least one is R117H mutation of 2%(1 out of 60). Login to comment 120 ABCC7 p.Arg117His C) In chronic pancreatitis cases the most common mutation is F508del account for 30% (13 out of 44) and the least one is R117H mutation of 4% (2 out of 44). Login to comment 134 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Gly542* ABCC7 p.Ser549Asn Serial No. Mutation General population (n = 400)% Asthma (n = 250)% Chronic pancreatitis (n = 150)% Chi square-testÌe; P value Asth vs ctrl Cp vs ctrl Asth vs CP 1 DF508 1.5 1.6 8.7 NS 0.0002 0.0013 2 G542X 2.5 4.4 6.7 NS 0.03 NS 3 G551D 2.0 5.6 6.0 0.02 0.02 NS 4 R117H 0.5 0.4 1.3 NS NS NS 5 S549N 0.5 2 2.7 NS NS NS 6 IVS8-5T 2.2 10 4.0 b0.0001 NS 0.03 7 Total 9.3 24 29.3 b0.0001 b0.0001 NS Ìe; P b 0.05 is considered significant (Bold values). Login to comment 142 ABCC7 p.Trp1282* ABCC7 p.Gly542* ABCC7 p.Gly542* ABCC7 p.Ser549Asn Recently, Shastri and Kabra reported 1161delC, 3849 + 10kbC-T and S549N as other most common mutations in India (Shastri and Kabra 2008), which is in agreement with other reports (Sharma et al., 2009b); however in the control group of the present study 1161delC and 3849+ 10kbC-T mutations were not found (unpublished data) whereas G542X, W1282X, 621 + 1G N T that occur in lesser percentage among Hispanic and non-Hispanic Caucasians (Watson et al., 2004) were not found in earlier studies from India while the present study recorded that G542X mutation is quite common among our controls (2.5%), asthmatic (4.4%) and CP (6.7%) cases in heterozygous nature. Login to comment 145 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Gly542* ABCC7 p.Ser549Asn Based on our data G551D, G542X, F508del, T5, R117H and S549N mutations may be considered for Indian subjects. Login to comment 146 ABCC7 p.Gly551Asp ABCC7 p.Gly542* In conclusion, our study indicates that CFTR mutations had been overlooked in our population while the carrier frequency of mutations F508del, G542X, and G551D are 3/200, 1/50 and 1/40, respectively, that is more common with reference to 1/238 of F508del in an earlier report by Kapoor et al. (2006). Login to comment