ABCC7 p.Ser549Asn
[switch to full view]Comments [show]
PMID: 10376575
[PubMed]
Mak V et al: "Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia."
No.
Sentence
Comment
28
Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining.
X
ABCC7 p.Ser549Asn 10376575:28:168
status: NEW
PMID: 10439967
[PubMed]
Liechti-Gallati S et al: "Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease."
No.
Sentence
Comment
34
Intron 19, all 27 exons and their exon-intron boundaries, including the 24 most common mutations worldwide (G85E, R117H, 621 + 1G- > T, 711 + 1G- > T, 1078delT, R334W, R347P, A455E, I507, F508, 1717-1G- > A, G542X, S549N, G551D, R553X, R560T, 1898 + 1G- > A, 2184delA, 2789 + 5G- > A, R1162X, 3659delC, 3849 + 10kbC- > T, W1282X, N1303K) (Cystic Fibrosis Genetic Analysis Consortium 1994), and the 15 most common mutations in our population (I148T, 1078delT, R334W, R347P, F508, 1717-1G- > A, G542X, R553X, 2347delG, D1152H, R1162X, 3849 + 10kbC- > T, 3905insT, W1282X, N1303K), were considered in this study.
X
ABCC7 p.Ser549Asn 10439967:34:215
status: NEW61 The slots C present wild type (wt) sequences, 1-8 present amplification products from CF patients with the following genotypes: 1 = R553X/R553X; 2 = 1717-1G- > A/wt; 3 = R553X/wt; 4 = G542X/wt; 5 = G542X/1717-1G- > A; 6 = G551D/wt; 7 = R560T/wt; 8 = S549N/wt.
X
ABCC7 p.Ser549Asn 10439967:61:250
status: NEW
PMID: 10733236
[PubMed]
Zebrak J et al: "Partial CFTR genotyping and characterisation of cystic fibrosis patients with myocardial fibrosis and necrosis."
No.
Sentence
Comment
59
The latter was negative for 14 other mutations: DI507, 1717-1GA, G542X, G551D, R553X, R560T, 3849+10kbCT, N1303K, W1282X, S549I, S549N, 621+1GT, 2789+5GA, R117H.
X
ABCC7 p.Ser549Asn 10733236:59:141
status: NEW
PMID: 10798368
[PubMed]
Orozco L et al: "Spectrum of CFTR mutations in Mexican cystic fibrosis patients: identification of five novel mutations (W1098C, 846delT, P750L, 4160insGGGG and 297-1G-->A)."
No.
Sentence
Comment
28
R553X, G551D, S549N, R1162X, and 3120+1G→A were tested by PCR-based restriction analysis as previously described (Osborne et al. 1992; Jones et al. 1992; Picci et al. 1992; Shoshani et al. 1992).
X
ABCC7 p.Ser549Asn 10798368:28:14
status: NEW41 The second most common mutation was G542X, present in 6.1% of CF chromosomes, followed by ∆I507 and S549N (each 2.5%), N1303K (2.06%) and 2055del→A (1.03%).
X
ABCC7 p.Ser549Asn 10798368:41:107
status: NEW69 First, we tested these patients for 12 mutations selected for the following reasons: five are the most common mutations worldwide (∆F508, G542X, N1303K, G551D and R553X; CFGAC 1994); 362 Table 1 Frequency of the CFTR gene mutations in 97 (194 chromosomes) Mexican patients Mutation Number of Frequency affected alleles (%) ∆F508 79 40.72 G542X 12 6.18 ∆I507 5 2.57 S549N 5 2.57 N1303K 4 2.06 R75X 3 1.54 406-1G→A 3 1.54 I148T 3 1.54 2055del9→A 2 1.03 935delA 2 1.03 I506T 2 1.03 3199del6 2 1.03 2183AA→G 2 1.03 G551D 1 0.51 R553X 1 0.51 1924del7 1 0.51 G551S 1 0.51 1078delT 1 0.51 Y1092X 1 0.51 R117H 1 0.51 G85E 1 0.51 3849+10KbC→T 1 0.51 1716G→A 1 0.51 W1204X 1 0.51 W1098Ca 1 0.51 846delTa 1 0.51 P750La 1 0.51 V754M 1 0.51 R75Q 1 0.51 W1069X 1 0.51 L558S 1 0.51 4160insGGGGa 1 0.51 297-1G→Aa 1 0.51 H199Y 1 0.51 2869insG 0 0 R1162X 0 0 3120+1G→A 0 0 Total 34 145 74.58% aNovel mutations detected in this study Fig.1 Sequencing ladders showing the CFTR novel mutations.
X
ABCC7 p.Ser549Asn 10798368:69:386
status: NEW70 a W1098C (antisense), b P750L (antisense), c 846delT (antisense), d 4160insGGGG (antisense), e 297-1GA (antisense) three mutations were found in our population during a preliminary screening by SSCP (S549N, 2055del9→A and 1924del7; Orozco et al. 1997); ∆I507 was found during the screening for ∆F508 (Orozco et al. 1994); and three mutations described at least once in Hispanic populations (R1162X, 2869insG; Casals et al. 1997; 3120+ 1G→A; CFGAC 1994).
X
ABCC7 p.Ser549Asn 10798368:70:201
status: NEW77 It is noteworthy that the S549N mutation was relatively frequent in our patients (2.5%) whereas its worldwide frequency is below 0.1%, and it was absent in a sample of 640 Spanish CF families (Casals et al. 1997), and in 114 Argentinean families (Chertkoff et al. 1997).
X
ABCC7 p.Ser549Asn 10798368:77:26
status: NEW
PMID: 10825408
[PubMed]
Dawson KP et al: "A hypothesis regarding the origin and spread of the cystic fibrosis mutation deltaF508."
No.
Sentence
Comment
60
Indirect supporting large Asian population sample and occurrence of a evidence for this hypothesis may be found in the homozygous S549N mutation in an inbred Pakistani family.
X
ABCC7 p.Ser549Asn 10825408:60:130
status: NEW
PMID: 10952679
[PubMed]
Mall M et al: "Effect of genistein on native epithelial tissue from normal individuals and CF patients and on ion channels expressed in Xenopus oocytes."
No.
Sentence
Comment
30
In all CF patients from whom rectal biopsies were studied DNA analysis was carried out for the following CFTR mutations: DF508; R117H and S108F in exon 4; R347P, R347H, I336K and T338I in exon 7; S549N, G551D, R553X, G542X, Q552X, 1717-1 G?A in exon 11; W1282X and 3905insT in exon 20; N1303K in exon 21 and 3849+10kB C?T in intron 19.
X
ABCC7 p.Ser549Asn 10952679:30:196
status: NEW
PMID: 10973878
[PubMed]
Costes B et al: "Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19)."
No.
Sentence
Comment
51
The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E.
X
ABCC7 p.Ser549Asn 10973878:51:26
status: NEW
PMID: 11025834
[PubMed]
Wang X et al: "Mutation in the gene responsible for cystic fibrosis and predisposition to chronic rhinosinusitis in the general population."
No.
Sentence
Comment
30
Analysis of CFTR Genes Genomic DNA samples extracted from the blood of participants were screened for 16 mutations (R117H, 621+1G→T, R334W, R347P, A455E, ⌬I507, ⌬F508, 1717-1 G→A, G542X, S549N, G551D, R553X, R560T, 3849+10 Kb C→T, W1282X, and N1303K) that account for 85% of CF alleles in the white population using the multiplex reverse dot hybridization system (Roche Molecular Systems, Alameda, Calif).16,17 This test also identified the 5T, 7T, and 9T variants of the splice acceptor site in intron 8 and F508C, I507V, and I506V (exon 10) polymorphisms of the CFTR gene.
X
ABCC7 p.Ser549Asn 11025834:30:215
status: NEW
PMID: 11157821
[PubMed]
McCallum T et al: "Unilateral renal agenesis associated with congenital bilateral absence of the vas deferens: phenotypic findings and genetic considerations."
No.
Sentence
Comment
60
Therereflects the 26 mutation/5T allele polymorphism assessment at the was no history of maternal diabetes, obvious teratogen exposurepresent time at Boston University Center for Human Genetics: or evidence of known congenital syndromes in themselves, orR117H; 1717-1G→A; G542X; 621ϩ1; S549N; R560T; I507; G551D; their families, that the men in either group could recall.
X
ABCC7 p.Ser549Asn 11157821:60:299
status: NEW
No.
Sentence
Comment
27
Five other mutations were identified in the white population, G542X, R553X, S549N, 621+lGT and N1303K which together account for a further 3% of mutations (5).
X
ABCC7 p.Ser549Asn 11168023:27:76
status: NEW58 Frequency of CFTR mutations in white CF chromosomes Mutation Number of chromosomes Frequency (%) DF508 291 76 3272-26AG 16 4 394delTT 14 3.6 G542X 5 1.3 R553X 4 1 1W1282X 4 14N1303K G551D 3 0.8 3120+1GA 2 0.5 R117H 1 0.3 Q493X 1 0.3 S549N 1 0.3 621+1GT 1 0.3 1717-1GA 1 0.3 2789+5GA 1 0.3 91Total 349/384 Table 2.
X
ABCC7 p.Ser549Asn 11168023:58:245
status: NEW
PMID: 11484207
[PubMed]
Orozco L et al: "XV-2c/KM-19 haplotype analysis of cystic fibrosis mutations in Mexican patients."
No.
Sentence
Comment
46
Among those found in more than one chromosome, S549N was associated only with haplotype A, N1303K only with haplotype B, DI507 only with D, and 2055del9!A only with A.
X
ABCC7 p.Ser549Asn 11484207:46:47
status: NEW65 Distribution of XK Haplotype on Chromosomes Bearing Uncommon Cystic Fibrosis (CF) Mutations A B C D S549N 4/4 DI507 3/3 N1303K 3/3 2055 del9!A 2/2 I148T 1/1 406-1G!A 1/1 R75X 1/1 I506T 1/1 935delA 1/1 2183AA!G 1/1 1924del7 1/1 G551S 1/1 1078delT 1/1 R117H 1/1 384910KbC!T 1/1 1716G!A 1/1 W1204X 1/1 W1098C 1/1 846delT 1/1 R75Q 1/1 W1069X 1/1 L558S 1/1 4160insGGGG 1/1 297-1G!A 1/1 Fig.
X
ABCC7 p.Ser549Asn 11484207:65:100
status: NEW86 Mutation S549N is relatively frequent in Mexico (2.5%) and was associated with haplotype A in all informative chromosomes.
X
ABCC7 p.Ser549Asn 11484207:86:9
status: NEW87 As far as we know, there are no previous reports of XK haplotypes associated with S549N, which is very uncommon in other populations [CFGAC, 1994].
X
ABCC7 p.Ser549Asn 11484207:87:82
status: NEW
PMID: 11491164
[PubMed]
Massie RJ et al: "Intron-8 polythymidine sequence in Australasian individuals with CF mutations R117H and R117C."
No.
Sentence
Comment
41
Infants with a positive (w60 mmol?L-1 ) or borderline (40 - 60 mmol?L-1 ) sweat chloride and in whom there is an unidentified mutation are referred for an extended mutation analysis which includes: DF508, R117H, G551D, A455E, G542X, N1303K, W1282X, 1717-1, R560T, R347P, R334W, R1162X, S549N, 621z1, 3849z10CwT, and the IVS8 polythymidine sequence.
X
ABCC7 p.Ser549Asn 11491164:41:286
status: NEW
PMID: 11504857
[PubMed]
Chen JM et al: "A combined analysis of the cystic fibrosis transmembrane conductance regulator: implications for structure and disease models."
No.
Sentence
Comment
100
Moreover, all of the 11 most common missense mutations or single-amino-acid deletions (i.e., F508del, G551D, N1303K, R117H, R347P, I507del, G85E, R560T, A455E, R334W, and S549N) identified in classic and atypical CF patients worldwide (http://www.genet.sickkids.on.ca/cftr) occur in stringently conserved residues across the 15 CFTR sequences.
X
ABCC7 p.Ser549Asn 11504857:100:171
status: NEW
No.
Sentence
Comment
16
A study of 27 177 CF chromosomes from 29 European and three north African countries showed that of the 272 mutations examined, S549R occurred on 12 occasions (0.04 per cent) and the S549N on 16 occasions (0.059 per cent).
X
ABCC7 p.Ser549Asn 11523757:16:182
status: NEW
PMID: 11569691
[PubMed]
Truninger K et al: "Mutations of the cystic fibrosis gene in patients with chronic pancreatitis."
No.
Sentence
Comment
56
Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A.
X
ABCC7 p.Ser549Asn 11569691:56:184
status: NEW
PMID: 11574497
[PubMed]
Josserand RN et al: "Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens."
No.
Sentence
Comment
30
Leukocytes samples were analysed for a series of 22 CF mutations including the five most frequently encountered in our region (The CF Genotype Consortium, 1994): ∆F508, G542X, N1303K, 1717-G-A, 885E; and 17 others: R117H, R334W, R347H, R347P, 556delA, S549N, S549I, S549R, G551D, R553X, R560T, G1244E, S1255X, W1282X, R1283K, 3898ins C, D1270N.
X
ABCC7 p.Ser549Asn 11574497:30:259
status: NEW
PMID: 11589722
[PubMed]
Walkowiak J et al: "Analysis of exocrine pancreatic function in cystic fibrosis: one mild CFTR mutation does not exclude pancreatic insufficiency."
No.
Sentence
Comment
85
Previously, it has been shown that pancreatic insufficiency was related to mutation G551D and pancreatic sufficiency to R347W and S549N [11].
X
ABCC7 p.Ser549Asn 11589722:85:130
status: NEW
PMID: 11668613
[PubMed]
Wong LJ et al: "Improved detection of CFTR mutations in Southern California Hispanic CF patients."
No.
Sentence
Comment
96
Seven other mutations, I148T, S549N, R334W, 3120+1G to A, 406-1G>A, 935delA, and R1066C, occurred twice.
X
ABCC7 p.Ser549Asn 11668613:96:30
status: NEW210 It also differs from that reported for Argentine patients [Chertkoff et al., 1997], where W1282X accounts for 3.1% of mutant alleles, compared to 0.8% in this study, while S549N mutation was not found in a total of 228 Argentine CF chromosomes, compared to 2.4% in our study.
X
ABCC7 p.Ser549Asn 11668613:210:172
status: NEW
PMID: 11883825
[PubMed]
Padoan R et al: "Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis."
No.
Sentence
Comment
34
It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14).
X
ABCC7 p.Ser549Asn 11883825:34:475
status: NEW
No.
Sentence
Comment
42
The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X.
X
ABCC7 p.Ser549Asn 11933191:42:369
status: NEW
PMID: 12000363
[PubMed]
Visich A et al: "Complete screening of the CFTR gene in Argentine cystic fibrosis patients."
No.
Sentence
Comment
35
Screening for DF508 and 12 other known mutations DF508 and 11 other frequent mutations (i.e. DI507, G551D, R553X, S549N, S549I, R1162X, 1811π1.6KbA»T, G542X, 1717-1G»A, 208 W1282X and N1303K) were detected as previously described (5).
X
ABCC7 p.Ser549Asn 12000363:35:114
status: NEW
PMID: 12007216
[PubMed]
Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."
No.
Sentence
Comment
109
Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Ser549Asn 12007216:109:1017
status: NEW111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Ser549Asn 12007216:111:3174
status: NEW113 Mexico ∆F508 (41.6%) G551S (0.5%) 75.5 57.0 35 374/194 Orozco et al.[1993]; Villalobos- G542X (5.6%) 1078delT (0.5%) Torres et al. [1997]; Liang et al. ∆I507 (2.5%) Y1092X (0.5%) [1998]; Orozco et al. [2000] S549N (1.9%) R117H (0.5%) N1303K (1.7%) G85E (0.5%) R75X (1.5%) 1716G→A (0.5%) 406-1G→A (1.5%) W1204X (0.5%) I148T (1.5%) W1098C (0.5%) 3849+10KbC→T (1.5%) 846delT (0.5%) 621+1G→T (1.2%) P750L (0.5%) 2055del9→A (1.0%) V754M (0.5%) 935delA (1.0%) R75Q (0.5%) I506T (1.0) W1096X (0.5%) 3199del6 (1.0%) L558S (0.5%) 2183AA→G (1.0%) 4160insGGGG (0.5%) G551D (0.5%) 297-1G→A (0.5%) R553X (0.5%) H199Y (0.5%) 1924del7 (0.5%) United States ∆F508 (68.6%) R553X (0.9%) 79.7 63.5 10 25048 Cystic Fibrosis Foundation (total) G542X (2.4%) 621+1G→T (0.9%) [1998] G551D (2.1%) 1717-1G→A (0.7%) W1282X (1.4%) 3849+10KbC→T (0.7%) N1303K (1.3%) R117H (0.7%) United States ∆F508 (48.0%) S1255X (1.4%) 77.3 59.8 16 160/148 Carles et al. [1996]; Macek et al. (African 3120+1G→A (12.2%) 444delA (0.7%) [1997]; Dörk et al. [1998]; American) 2307insA (2.0%) R334W (0.7%) Friedman et al. [1998] A559T (2.0%) ∆I507 (0.7%) R553X (2.0%) 1717-1G→A (0.7%) ∆F311 (2.0%) G542X (0.7%) G480C (1.4%) S549N (0.7%) 405+3A→C (1.4%) G551D (0.7%) United States 1) L1093P - - 1 2 Yee et al. [2000] (Cherokee) United States Non-French: French: Non- Non- Non- Non- Bayleran et al. [1996] (Maine) ∆F508 (82.0%) ∆F508 (58%) French: French: French: French: G542X (2.6%) 711+1G→T (8.3%) 95.3 90.8 11 191 G551D (2.6%) I148T (4.2%) French: French: French: French: N1303K (2.1%) A455E (4.2%) 80.3 64.5 8 72 R560T (1.0%) 1717-1G→A (1.4%) Total: 621+1G→T (1.0%) G85E (1.4%) 263 711+1G→T (1.0%) 621+1G→T (1.4%) R117H (1.0%) Y1092X (1.4%) 1717-1G→A (1.0%) G85E (0.5%) W1282X (0.5%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS589 United States ∆F508 (46.0%) R334W (1.6%) 58.5 34.2 7 129 Grebe et al. [1994] (SW Hispanic) G542X (5.4%) W1282X (0.8%) 3849+10KbC→T (2.3%) R553X (0.8%) R1162X (1.6%) United States 1) R1162X - - 3 17 Mercier et al. [1992] (SW Native 2) D648V American) 3) G542X United States 1) R1162X 3) G542X - - 4 16 Mercier et al. [1994] (Zuni Pueblo) 2) 3849+10KbC®T 4) D648V Venezuela ∆F508 (29.6%) G542X (3.7%) 33.3 11.1 2 54 Restrepo et al. [2000] Other Regions Australia ∆F508 (76.9%) 621+1G→T (1.1%) 88.7 78.7 8 761/464 CFGAC [1994] G551D (4.5%) N1303K (0.9%) G542X (2.8%) W1282X (0.6%) R553X (1.3%) R117H (0.6%) East Asia 1) 1898+1G®T 2) 1898+5G®T - - 2 28 Suwanjutha et al. [1998] Hutterite 1) M1101K (69.0%) 2) DF508 (31.0%) - - 2 32 Zielenski et al. [1993] Brethren New Zealand ∆F508 (78.0%) N1303K (1.9%) 87.4 76.4 5 636 CFGAC [1994] G551D (4.4%) 621+1G→T (1.1%) G542X (2.0%) *This table presents the mutation panels for all regions investigated in this study.
X
ABCC7 p.Ser549Asn 12007216:113:222
status: NEWX
ABCC7 p.Ser549Asn 12007216:113:1305
status: NEW213 Ideal Recommended CFTR Mutation Screening Panel for 2001 Neonatal Screening in the USA* Location Estimated Mutation in CFTRa percentageb Reason for inclusion DF508 Exon 10 68.6% CFF registry, >1%, Pan-European G542X Exon 11 2.4% CFF registry, >1%, Mediterranean G551D Exon 11 2.1% CFF registry, >1%, Celtic W1282X Exon 20 1.4% CFF registry, >1%, Ashkenazi Jew N1303K Exon 21 1.3% CFF registry, >1%, Mediterranean R553X Exon 11 0.9% CFF registry, >0.5%, Hispanic 621+1G®T Intron 4 0.9% CFF registry, >0.5%, multi-ethnic 1717-1G®A Intron 10 0.7% CFF registry, >0.5%, Italian 3849+10KbC®T Intron 19 0.7% CFF registry, >0.5%, Hispanic R117Hc Exon 4 0.7% CFF registry, >0.5% 1898+1G→T Intron 12 0.4% CFF registry, >0.1%, East Asian DI507 Exon 10 0.3% CFF registry, >0.1%, Hispanic 2789+5G®A Intron 14b 0.3% CFF registry, >0.1% G85E Exon 3 0.3% CFF registry, >0.1% R347P Exon 7 0.2% CFF registry, >0.1% R334W Exon 7 0.2% CFF registry, >0.1%, multi-ethnic R1162X Exon 19 0.2% CFF registry, >0.1%, multi-ethnic R560T Exon 11 0.2% CFF registry, >0.1% 3659delC Exon 19 0.2% CFF registry, >0.1% A455E Exon 9 0.2% CFF registry, >0.1% 2184delA Exon 13 0.1% CFF registry, >0.1% S549N Exon 11 0.1% CFF registry, >0.1%, multi-ethnic 711+1G®T Intron 5 0.1% CFF registry, >0.1% R75X Exon 3 0.2% Hispanic 406-1G→A Intron 3 0.2% Hispanic I148T Exon 4 0.2% Hispanic, French 2055del9→A Exon 13 0.1% Hispanic 935delA Exon 6b 0.1% Hispanic I506T Exon 10 0.1% Hispanic 3199del6 Exon 17a 0.1% Hispanic 2183AA→G Exon 13 0.1% Hispanic 3120+1G®A Intron 16 1.5% African American, Arabian 2307insA Exon 13 0.2% African American A559T Exon 11 0.2% African American ∆F311 Exon 7 0.2% African American G480C Exon 10 0.2% African American 405+3A→C Intron 3 0.2% African American S1255X Exon 20 0.2% African American L1093P Exon 17b Undetermined Native American D648V Exon 13 Undetermined Native American I1234V Exon 19 Undetermined Arabian linkage S549R Exon 11 Undetermined Arabian linkage 1898+5G→T Intron 12 Undetermined East Asian linkage CFTRdele2,3 Exons 2,3 Undetermined Eastern European linkage (Slavic) Y1092X Exon 17b Undetermined French linkage 394delTT Exon 3 Undetermined Nordic linkage Y569D Exon 12 Undetermined Pakistani linkage 3905insT Exon 20 Undetermined Swiss linkage (also: Amish, Acadian, Mennonite) 1898+1G®A Intron 12 Undetermined Welsh linkage M1101k Exon 17b Undetermined Hutterite ancestry *This table presents the top 50 mutations in the USA based on the Cystic Fibrosis Foundation CF Registry data from 1997 [Cystic Fibrosis Foundation, 1998], and data generated during our investigation.
X
ABCC7 p.Ser549Asn 12007216:213:1191
status: NEW
PMID: 12089190
[PubMed]
Wang X et al: "Development and evaluation of a PCR-based, line probe assay for the detection of 58 alleles in the cystic fibrosis transmembrane conductance regulator (CFTR) gene."
No.
Sentence
Comment
82
During the evaluation phase, a sample that was previously genotyped as a compound heterozygote, S549N/ R553X, hybridized as expected with the R553X wild-type and mutant probes.
X
ABCC7 p.Ser549Asn 12089190:82:96
status: NEW83 However, the presence of the R553X and S549N mutations precluded hybridization to the G551D wild-type probe (data not shown).
X
ABCC7 p.Ser549Asn 12089190:83:39
status: NEW
PMID: 12116247
[PubMed]
Muller F et al: "Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases."
No.
Sentence
Comment
48
A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 þ 10kbC !
X
ABCC7 p.Ser549Asn 12116247:48:38
status: NEW
PMID: 12124743
[PubMed]
Salvatore F et al: "Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes."
No.
Sentence
Comment
46
A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994].
X
ABCC7 p.Ser549Asn 12124743:46:262
status: NEW
PMID: 12133923
[PubMed]
Corbetta C et al: "Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population."
No.
Sentence
Comment
266
Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K.
X
ABCC7 p.Ser549Asn 12133923:266:269
status: NEW
PMID: 12357328
[PubMed]
McCormick J et al: "Demographics of the UK cystic fibrosis population: implications for neonatal screening."
No.
Sentence
Comment
83
The additional eleven are S549N, 3849+4A?G, 3905insT, 2789+5G?A, Y122X, 711+1G?T, R347P, R347H, R334W, A455E and 3281AA?G.
X
ABCC7 p.Ser549Asn 12357328:83:26
status: NEW
No.
Sentence
Comment
57
Mutations not included in the 25 mutation core testing panel that have been reported in these populations include D1270N, W1089X, and S549N.13-15 CF 2.8.4 Insufficient information is available for the Asian American population.
X
ABCC7 p.Ser549Asn 12394352:57:134
status: NEW
No.
Sentence
Comment
36
F508C, I507V, I506V polymorphism exon 11 1717-1G → A, G542X, S549N, G551D, R553X, R560T exon 20 W1282X exon 21 N1303K intron 19 3849+10kb C → T Innogenetics assay: exon 3 394delTT, G85E, E60X exon/intron 4 621+1G-T, R117H exon 7 1078delT, R347P, R334W exon 13 2143delT, 2183AA-G, 2184delA exon 19 R1162X, 3659delC intron 5 711+5G-A intron8/exon 9 A455E,, 5T,7T,9T intron 14b 2789+5G-A intron 19 3849+10kb C-T Table 2: Genotypes of patients with mutations, final results Group 1) (patients with symptoms typical for/indicative of CF) No.
X
ABCC7 p.Ser549Asn 12437773:36:68
status: NEW
PMID: 12794695
[PubMed]
Timmreck LS et al: "Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina."
No.
Sentence
Comment
82
CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development.
X
ABCC7 p.Ser549Asn 12794695:82:292
status: NEW
No.
Sentence
Comment
32
The frequency of this mutation was about 0.5%, higher than some of the mutations, such as DI507, R334W, R347P, and S549N that were in the routine screening panels [Cystic Fibrosis Genetic Analysis Consortium, 1994; Friedman et al., 1995].
X
ABCC7 p.Ser549Asn 12833419:32:115
status: NEW
PMID: 12939655
[PubMed]
Perri F et al: "Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis."
No.
Sentence
Comment
33
Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation.
X
ABCC7 p.Ser549Asn 12939655:33:194
status: NEW
PMID: 14641997
[PubMed]
Raskin S et al: "High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing."
No.
Sentence
Comment
63
FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes.
X
ABCC7 p.Ser549Asn 14641997:63:1699
status: NEW
PMID: 14685259
[PubMed]
Lewis HA et al: "Structure of nucleotide-binding domain 1 of the cystic fibrosis transmembrane conductance regulator."
No.
Sentence
Comment
216
CF mutations in NBD1 The majority of sites of CF-causing missense mutations occur in NBD1, primarily in its a-subdomain, and the locations in the mNBD1 structure of the most common of these (A455E, G480C, I506T, DI507, DF508, S549N, S549R, G551D, A559T, R560T, Y569D, and D648V; Bobadilla et al, 2002) are shown in Figure 3D.
X
ABCC7 p.Ser549Asn 14685259:216:226
status: NEW
PMID: 14998948
[PubMed]
Danziger KL et al: "Improved detection of cystic fibrosis mutations in infertility patients with DNA sequence analysis."
No.
Sentence
Comment
59
Polyacrylamide gels were analysed for the presence of mutations following staining in ethidium bromide (EtBr) and image capture under UV using the Gel Doc 1000 system Table I. List of CFTR mutations included in common mutation panels American College of Medical Genetics CF panel (25 mutations) DF508 G542X G551D R117H W1282X N1303K R1162X 3849+10kbC®T DI507 R553X 1717-1G®A 621+1G®T R560T 3659delC 3120+1G®A I148T G85E R334W A455E 1898+1G®A 2148delA 711+1G®T 2789+5G®A R347P 1078delT Six additional mutations and one polymorphism in UCSF panel (31 mutations) Y1092X R347H 3849+4 Q493X 3905insT S549N F508C (polymorphism) (BioRad).
X
ABCC7 p.Ser549Asn 14998948:59:630
status: NEW
PMID: 15084222
[PubMed]
D'Apice MR et al: "Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy."
No.
Sentence
Comment
89
Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency.
X
ABCC7 p.Ser549Asn 15084222:89:1206
status: NEW
No.
Sentence
Comment
39
Two others (15 per cent) were homozygous for S549N, one (8 per cent) was homozygous for I19, and three (23 per cent) had unidentified mutations.
X
ABCC7 p.Ser549Asn 15088804:39:45
status: NEW
PMID: 15173476
[PubMed]
Comeau AM et al: "Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections."
No.
Sentence
Comment
79
The 16-mutation panel included ⌬F508, R117H, G551D, G542X, W1282X, N1303K, R334W, 621 ϩ 1GϾT, R553X, ⌬I507, 1717-1GϾA, R347P, R560T, 3849 ϩ 10kbCϾT, A455E, and S549N.
X
ABCC7 p.Ser549Asn 15173476:79:204
status: NEW80 The 27-mutation panel included all of the 16 except S549N and the following additional mutations: 3120 ϩ 1GϾA, 3659delC, A559T, R1162X, S1255X, 405 ϩ 3AϾC, 711 ϩ 1GϾT, 2789 ϩ 5GϾA, G480C, 2307insA, G85E, and 1078delT.
X
ABCC7 p.Ser549Asn 15173476:80:52
status: NEW
PMID: 15371903
[PubMed]
Sugarman EA et al: "CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations."
No.
Sentence
Comment
4
Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers.
X
ABCC7 p.Ser549Asn 15371903:4:96
status: NEW35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene.
X
ABCC7 p.Ser549Asn 15371903:35:414
status: NEW119 In the Hispanic population, our findings support the inclusion, minimally, of 3876delA, R1066C, S549N, and 1949del84 in a mutation panel.
X
ABCC7 p.Ser549Asn 15371903:119:96
status: NEW
PMID: 15371908
[PubMed]
Buyse IM et al: "Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation."
No.
Sentence
Comment
77
This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively.
X
ABCC7 p.Ser549Asn 15371908:77:366
status: NEW
PMID: 15507145
[PubMed]
Blaisdell CJ et al: "CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity."
No.
Sentence
Comment
57
We examined human CLC-2 protein expression using lysates from primary nasal cells obtained from elective Table 1: Primers used to amplify CLC-2 polymorphisms Primer oligomer expected size (bp) rat hpolE1 dTCC GGG TCA ATA TCC TTC ACA TCG 2128 hClC-2 promoter dCGC CCG TGG CTC CAT CCC TTC 15F dGTC CCA GGA GTA GAC TTC C 760 bp 16R dCAC TGC CCT CTG GCC TC 17F dTCC CCT CCG GCC TAC CCC TTC CGG T 147 + 300 bp 18R dGGA AGG ATT CGG AGA GGG TTG GGG C Intron 1F dCGC TGC AGC ACG AGC AGA C 2273 Intron 1R dCCC AAG GTC CTG AGT GTA CC Exon 20F dGCC TCT TCT GTG GCA GTC C 481 Exon 20R dCTT CAG GGC TCA TCT CGC C ClC-2 expression by Western blot of nasal polyp lysatesfrom CF adults with the following genotypesFigure 1 ClC-2 expression by Western blot of nasal polyp lysates from CF adults with the following genotypes: Lanes 1,3,6 dF508/dF508; Lane 2: dF508/d559T; Lane 4: unknown; Lane 5: S549N/R553X; Lane 7,9: dF508/unknown; Lane 8: F508/ W1282X.; Lane 10, IB3-1 cell line, genotype F508/W1282X.
X
ABCC7 p.Ser549Asn 15507145:57:879
status: NEW
PMID: 15880796
[PubMed]
Kerem E et al: "Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy."
No.
Sentence
Comment
58
C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C !
X
ABCC7 p.Ser549Asn 15880796:58:35
status: NEW
PMID: 15970608
[PubMed]
Mei-Zahav M et al: "The prevalence and clinical characteristics of cystic fibrosis in South Asian Canadian immigrants."
No.
Sentence
Comment
303
Table 3 CFTR gene mutations among CF patients of South Asian origin and all patients living in the same geographic region in the CF population Mutation South Asian CF population Mutation General CF population (number, % of total alleles) (number, % of total alleles) No. identified % of alleles No. identified % of alleles DF508 13 50 DF508 375 65.1 L218X 2 7.7 W1282X 16 2.8 1525-1GRA 1 3.8 G551D 15 2.6 S549N 1 3.8 G542X 10 1.7 3849+10kbCRT 1 3.8 621+1GRT 10 1.7 V392G 1 3.8 R117H 7 1.2 N1303K 7 1.2 49 others (,1%) 89 16.4 Unidentified 7 26.9 Unidentified 47 8.2 What is already known on this topic N CF is rare in populations not of European Caucasian origin N More severe disease has been reported in South Asian CF patients N DF508, the most common mutation in Caucasians, is less prevalent in South Asians What this study adds N Prevalence and clinical course of CF in children of South Asian origin is similar to that in the general Toronto population N Previous reports reflect inadequate awareness of CF in this ethnic group N The prevalence of DF508 is confirmed to be lower in South Asians than other Caucasian groups Mei-Zahav, Durie, Zielenski, et al www.archdischild.com Authors` affiliations .
X
ABCC7 p.Ser549Asn 15970608:303:405
status: NEW
No.
Sentence
Comment
43
Mutations (missense, nonsense, frameshift, splice, small and large in-frame deletions or insertions) con- Table 1 Distribution of theWorldwide 24 Most Common Cystic Fibrosis Mutationsa Exon/ Northern Southern North South Austral- Relative Mutation Intron Europe Europe America America asia Africa Asia Frequency G85E E 03 30 14 16 n.a. n.a. 0 7 0.15 R117H E 04 62 3 61 n.a. 7 0 0 0.30 621+1G→T I 04 97 37 154 n.a. 27 0 0 0.72 711+1G→T I 05 15 13 21 n.a. n.a. n.a. 0 0.11 1078delT E 07 53 2 1 n.a. 1 n.a. 0 0.13 R334W E 07 18 21 12 n.a. 2 0 0 0.12 R347P E 07 55 24 26 n.a. 1 0 0 0.24 A455E E 09 35 0 27 n.a. n.a. n.a. 0 0.14 ⌬I507 E 10 57 5 20 2 9 0 0 0.21 ⌬F508 E 10 14,866 4007 6901 342 2309 351 173 66.02 1717-1G→A I 10 160 65 44 n.a. 12 0 3 0.65 G542X E 11 439 259 234 38 56 9 27 2.42 S549N E 11 18 2 5 1 3 1 0 0.07 G551D E 11 356 37 206 1 117 0 0 1.64 R553X E 11 165 44 96 5 11 1 0 0.73 R560T E 11 40 0 24 0 3 0 0 0.15 1898+1G→A I 12 41 10 2 n.a. n.a. n.a. 0 0.12 2184delA E 13 14 7 8 n.a. n.a. n.a. 0 0.07 2789+5G→A I 14b 27 10 17 n.a. n.a. n.a. 0 0.12 R1162X E 19 36 68 19 0 2 0 0 0.28 3659delC E 19 39 1 14 n.a. n.a. n.a. 0 0.12 3849+10kbC→T I 19 23 8 57 n.a. n.a. n.a. 16 0.24 W1282X E 20 120 43 245 n.a. 6 2 120 1.22 N1303K E 21 209 179 130 11 23 8 29 1.34 Chromosomes 21,154 7281 10438 758 3095 515 608 screened Detection rate 80.2 66.7 79.9 52.8 83.7 72.2 61.7 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/.
X
ABCC7 p.Ser549Asn 16088579:43:823
status: NEW67 SSCP analysis is one of the most popular methods for the detection of sequence variants in polymerase chain reaction (PCR) amplified DNA fragments.29 The princi- Table 3 Cystic Fibrosis Mutations Detected by Commercial Kits INNO-LiPA Mutations CF2 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K CFTR12 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K, S1251N, R560T, 3905insT, Q552X CFTR17+Tn 394delTT, G85E, 621+1G→T, R117H, 1078delT, R347P, R334W, E60X, 2183AA→G, 2184delA, 711+5G→A, 2789+5G→A, R1162X, 3659delC, 3849+10kbC→T, 2143delT, A455E, (5T/7T/9T) Elucigene CF4 ⌬F508, G542X, G551D, 621+1G→T CF12 ⌬F508, G542X, G551D, N1303K, W1282X, 1717-1G→A, R553X, 621+1G→T, R117H, R1162X, 3849+10kbC→T, R334W CF20 1717-1G→A, G542X, W1282X, N1303K, ⌬F508, 3849+10kbC→T, 621+1G→T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA→G, 3659delC, 1078delT, ⌬I507, R345P, S1251N, E60X CF Poly-T 5T/7T/9T OLA CF OLA assay ⌬F508, F508C, ⌬I507, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183AA→G, 2789+5G→A b Figure 2 Mutation screening of exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene using polymerase chain reaction (PCR) followed by single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis on a silver-stained polyacrylamide gel.
X
ABCC7 p.Ser549Asn 16088579:67:1203
status: NEW
PMID: 16126774
[PubMed]
Morea A et al: "Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility."
No.
Sentence
Comment
47
CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T.
X
ABCC7 p.Ser549Asn 16126774:47:366
status: NEW
PMID: 16243854
[PubMed]
Massie J et al: "Markedly elevated neonatal immunoreactive trypsinogen levels in the absence of cystic fibrosis gene mutations is not an indication for further testing."
No.
Sentence
Comment
222
*All patients underwent an extended CFTR mutation analysis for the following mutations in addition to DF508: G551D, R553X, G542X, R117H, N1303K, 621+1G-T, A455E, V520F, 1717-1G-A, W1282X, R1162X, 3849+10kbC-T, R347P, R334W, R560T, S549N.
X
ABCC7 p.Ser549Asn 16243854:222:231
status: NEW
PMID: 16435054
[PubMed]
Zilfalil BA et al: "Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays."
No.
Sentence
Comment
55
MUTATIONS R553X G551D 1507 del F508 del 1717-1 G>A G542X R560T R347P W1282X R334W 1078 Del T 3849 + 10KB C>T R1162X N1303K 3659 Del C A455E R117H 2183 AA>G 2789+5 G>A 1898 +1 G>A 621+1 G>T 711+1 G>T G85E S549N S549R V520F Q493X R347H 3849 +4 A>G 3905 INS T Y122X 4 software before running the gel electrophoresis in 1X TBE using ABI PRISM® 377 Genetic Analyzer (Applied Biosystems, USA) for 45 minutes.
X
ABCC7 p.Ser549Asn 16435054:55:204
status: NEW
PMID: 16690975
[PubMed]
McKone EF et al: "Variants in the glutamate-cysteine-ligase gene are associated with cystic fibrosis lung disease."
No.
Sentence
Comment
62
* Severe cystic fibrosis transmembrane conductance regulator (CFTR) mutations (Class I-III) ϭ G542X, R553X, W1282X, R1162X, 621-1G→T, 1717-1G→A, 1078⌬T, 3659⌬C, ⌬F508, ⌬I507, N1303K, S549N, G551D, R560T.
X
ABCC7 p.Ser549Asn 16690975:62:231
status: NEW
PMID: 16778595
[PubMed]
Sun W et al: "CFTR 5T variant has a low penetrance in females that is partially attributable to its haplotype."
No.
Sentence
Comment
55
These mutations include R347H, S549N, S549R, 3876delA, 394delT, 3905insT, and V520F, in addition to the 25-mutation core panel recommended by ACMG/ACOG for population-based CF screening.
X
ABCC7 p.Ser549Asn 16778595:55:31
status: NEW
PMID: 17099022
[PubMed]
McKone EF et al: "CFTR genotype as a predictor of prognosis in cystic fibrosis."
No.
Sentence
Comment
46
Alleles High-risk CFTR genotype Class I 2,131 G542X, R553X, W1282X, R1162X, 621-1G3T, 1717-1G3A, 1078⌬T, 3659⌬C Class II 11,231 ⌬F508, ⌬I507, N1303K, S549N, G85E Class III 783 G551D, R560T Low-risk CFTR genotype Class IV 391 R117H, R334W, R347P Class V 421 3849 ϩ 10KbC3T, 2789 ϩ 5G3A, A455E *Patients with both CFTR alleles in either class I, class II, or class III were grouped together as a high-risk genotype, while patients with at least one mutant allele in class IV and V were considered to have low-risk genotypes; 380 patients had both mutations in either class I, II, or III, while 314 patients had both mutations in either class IV or V (total, n ϭ 15,651).
X
ABCC7 p.Ser549Asn 17099022:46:178
status: NEW
No.
Sentence
Comment
229
The nine normal sequences detected at other tested mutation sites (3876delA; S1255X; 2307insA; 1898ϩ5G Ǟ T; S549R; S549N; V520F; Y122X; and 394delTT) reflected the correct sequence in this mixture of nine cloned sequences.
X
ABCC7 p.Ser549Asn 17949287:229:127
status: NEW
PMID: 18344710
[PubMed]
Madore AM et al: "Distribution of CFTR mutations in Saguenay- Lac-Saint-Jean: proposal of a panel of mutations for population screening."
No.
Sentence
Comment
48
Altogether, the six mutations represent 95.89% of the CFTR allele of CF patients in the SLSJ population, whereas the proportions are 86.85, 85.27, and Table 2 Cystic fibrosis mutations present in the four populations studied Mutationa Allelic frequency (number of alleles [%]) Populationb 1 2 3 4 „F508 106 (62.35) 55 (72.37) 398 (72.36) 67 (57.78) 621 ؉ 1G>T 42 (24.71) 6 (7.89) 30 (5.45) 1 (0.85) A455E 12 (7.06) 2 (2.63) 14 (2.55) 1 (0.85) 3199del6 1 (0.59) 1 (1.32) 7 (1.27) 1 (0.85) 711 ؉ 1G>T 1 (0.59) 1 (1.32) 15 (2.73) 1 (0.85) Y1092X 1 (0.59) 1 (1.32) 5 (0.91) 0 R117C 2 (1.18) 0 0 0 ‚I507 1 (0.59) 2 (2.63) 10 (1.82) 0 L206W 1 (0.59) 1 (1.32) 9 (1.64) 0 R1158X 1 (0.59) 0 0 0 S489X 1 (0.59) 0 1 (0.18) 0 R553X 0 2 (2.63) 2 (0.36) 0 R334W 0 1 (1.32) 2 (0.36) 0 G542X 0 0 10 (1.82) 0 G85E 0 0 6 (1.09) 5 (4.24) N1303K 0 0 5 (0.91) 1 (0.85) IVS8-5T 0 0 4 (0.73) 0 W1282X 0 0 3 (0.55) 7 (5.93) R347P 0 0 1 (0.18) 2 (1.69) V520F 0 0 1 (0.18) 0 I1027T 0 0 1 (0.18) 0 R1066C/IVS 0 0 1 (0.18) 0 Q1313X 0 0 1 (0.18) 0 1898ϩ3GϾA 0 0 1 (0.18) 0 2183AAϾG 0 0 1 (0.18) 0 2951insA 0 0 1 (0.18) 0 G551D 0 0 0 2 (1.69) 1525-iG-A 0 0 0 2 (1.69) Y109C 0 0 0 1 (0.85) S549N 0 0 0 1 (0.85) 3154del1G 0 0 0 1 (0.85) UNKNOWN 1 (0.59) 4 (5.26) 20 (3.82) 25 (21.19) Number of alleles genotypedc 170 (100) 76 (100) 550 (100) 118 (100) a The six mutations included in the panels proposed are in bold.
X
ABCC7 p.Ser549Asn 18344710:48:1203
status: NEW
PMID: 18373402
[PubMed]
Lakeman P et al: "CFTR mutations in Turkish and North African cystic fibrosis patients in Europe: implications for screening."
No.
Sentence
Comment
113
Identity and Frequency of CFTR Mutations on Unrelated Turkish (Tr) and North African (NA) CF alleles Total number of allelesa Number of CF patients with this mutationb Mutation Exon All Tr NA Homozygote Compound heterozygote: two mutations found Compound heterozygote: one mutation found F508delc 10 73 33 40 27 11 6 N1303K 21 22 12 10 10 5 2 711 þ 1G > T Intron 5 14 - 14 7 2 0 G542X 11 14 6 8 7 1 0 R1162X 19 11 - 11 1 5 2 2183AA > G 13 9 9 - 3 3 1 W1282X 20 7 3 4 2 3 1 2789 þ 5G > A Intron 14b 6 3 3 1 4 1 L227R 6a 4 - 4 3 1 0 1677delTA 10 4 4 - 2 1 1 2184insA 13 4 4 - 1 2 0 R334W 7 4 4 - 1 1 1 G85E 3 4 3 1 1 2 0 R709X 13 3 - 3 2 0 0 L732X 13 3 3 - 2 0 0 2184delA 13 3 3 - 0 3 0 del exon 1-4d 1-4 3 3 - 1 1 0 del exon 19 19 2 2 - 2 0 0 3849 þ 10kbC > T Intron 19 2 - 2 1 0 0 S549N 11 2 1 1 0 1 1 3120 þ G > A Intron 16 2 2 - 1 0 0 3601-2A > G Intron 18 2 2 - 1 0 0 D1152H 18 2 2 - 1 0 0 E1104X 17b 2 - 2 1 0 0 S1159F 19 2 2 - 1 0 0 S977F 16 2 - 2 0 1 0 2347delG 13 2 - 2 1 0 0 4096-3C > G Intron 21 1 1 - 1 0 0 E831X 14a 1 1 - 1 0 0 L619S 13 1 1 - 1 0 0 1525-1G > Ac Intron 9 1 1 - 1 0 0 F1052V 17b 1 1 - 1 0 0 3130delA 17a 1 1 - 1 0 0 R352Q 7 1 - 1 0 1 0 1812-1G > A Intron 11 1 - 1 0 1 0 R553X 11 1 - 1 0 0 1 IVS8-5T Intron 8 1 1 - 0 1 0 R1066C 17b 1 - 1 0 1 0 3129del4 17a 1 - 1 0 1 0 D110H 4 1 1 - 0 1 0 R117H 4 1 - 1 0 1 0 S945L 15 1 - 1 0 1 0 1716G=A 10 1 - 1 0 0 1 711 þ 3A > G Intron 5 1 1 - 0 1 0 R75X 3 1 1 - 0 1 0 R764X 13 1 - 1 0 1 0 S1196X 19 1 1 - 0 1 0 S492F 10 1 - 1 0 1 0 G551D 11 1 - 1 1 0 0 del exon 2 2 1 1 - 1 0 0 Subtotal 231 113 118 - No mutation 80 63 17 - Total 311 176 135 88 60 18 a n ¼ 311 alleles, based on 166 CF patients (332 alleles) with both parents and 22 CF patients (22 alleles) with one parent from Turkey or North Africa, minus 43 alleles of homozygous CF patients with consanguineous parents of whom only one allele was taken into account.
X
ABCC7 p.Ser549Asn 18373402:113:796
status: NEW
PMID: 18535191
[PubMed]
Adler AI et al: "Genetic determinants and epidemiology of cystic fibrosis-related diabetes: results from a British cohort of children and adults."
No.
Sentence
Comment
54
Genotypes associated with cystic fibrosis were coded into five established classes reflecting CFTR function of defective production, processing, regulation, conductance, and quantity of CFTR protein (12) as follows: I: G542X, R553X, W1282X, R1162X, 621-1G3T, 1717- 1G3 A, 1078⌬T, and 3659⌬C; II: ⌬F508, ⌬I507, N1303K, and S549N; III: G551Dand R560T; IV: R117H, R334W, G85E, and R347P; V: 3849ϩ5G3A, and A455E; and unknown: 711ϩIG3 T, 2184DA, and 1898ϩIG3 A.
X
ABCC7 p.Ser549Asn 18535191:54:350
status: NEW
PMID: 18782298
[PubMed]
Sharma N et al: "Identification and characterization of CFTR gene mutations in Indian CF patients."
No.
Sentence
Comment
67
They included nine missense mutations (L69H, S158N, Q493L, Y517C, V520F, I530L, S549N, E1329Q, and Y1381H), one insertion mutation (1792insA), three splice site mutations (876-6del4, 1525-1G-A, 3120+1G-A), two deletion mutations (1161delC, 3986delC), and 1 nonsense mutation (L218X).
X
ABCC7 p.Ser549Asn 18782298:67:80
status: NEW68 S549N and 1525-1G-A were the second most common mutations observed in our population (5% each).
X
ABCC7 p.Ser549Asn 18782298:68:0
status: NEW96 Table 2 Genotypes of CF subjects (n=50) Genotype Number of subjects Delta F508/Delta F508 5 Delta F508/3849+10kb C-T 1 Delta F508/S549N 2 Delta F508/S158N 1 Delta F508/Y1381H 1 Delta F508/1525-1 G-A 2 V520F/R117H 1 I530L/I530L 1 876-6del4/876-6del4 1 1792ins A/1792insA 1 3986-3987delC/3986-3987delC 1 Delta F508/U 10 1161 delC/U 2 L69H/U 1 R117H/U 1 Q493L/U 1 Y517C/U 1 S549N/U 3 G551D/U 1 E1329Q/U 1 N1303K/U 1 Y1381H/U 1 L218X/U 1 R553X/U 1 1525-1G-A/U 3 3120+1G-A/U 2 3849+10kb C-T/U 2 U/U 1 U-unidentified Table 3 Outcome prediction scores of novel substitution mutations identified in Indian CF patients Wild type Mutant Position Output Reliablity Prediction L H 69 0.5210 0 Pathological S N 158 0.3304 3 Neutral Q L 493 0.7784 5 Pathological I L 530 0.0591 8 Neutral E Q 1329 0.1018 7 Neutral Molecular Modelling and Bioinformatics (MMB) program (http://mmb.pcb.ub.es/PMut/) was used for pathological predictions of novel sequence variants.
X
ABCC7 p.Ser549Asn 18782298:96:130
status: NEWX
ABCC7 p.Ser549Asn 18782298:96:371
status: NEW113 We first identified five of the mutations by ARMS (Delta F508, R117H, R553X, N1303K & G551D) and one by restriction digestion (3849+10kbC-T) and later identified by SSCP eight known (Y517C, V520F, S549N, Y1381H, 1525-1G-A, 3120+1G-A, 1161delC and L218X) and eight previously unreported mutations (L69H, S158N, Q493L, I530L, E1329Q, 876-6del4, 1792insA and 3986-3987delC).
X
ABCC7 p.Ser549Asn 18782298:113:197
status: NEW119 S549N and 1525-1G-A were the second most common mutations, followed by 3849+10kbC-T.
X
ABCC7 p.Ser549Asn 18782298:119:0
status: NEW120 This corroborates the study of Shastri et al., (2008) which has recommended testing Indian CF patients for delta F508 followed by 1161delC, 3849+10kbC-T and S549N.
X
ABCC7 p.Ser549Asn 18782298:120:157
status: NEW
PMID: 18951463
[PubMed]
Krasnov KV et al: "Localization studies of rare missense mutations in cystic fibrosis transmembrane conductance regulator (CFTR) facilitate interpretation of genotype-phenotype relationships."
No.
Sentence
Comment
171
Of those with CBAVD, one patient carried a mutation known to cause pancreatic insufficient CF (S549N [c.1646G4A; p.Ser549Asn]), a second patient carried a mutation associated with CBAVD (D1152 H [c.3454G4C; p.Asp1152His]), and the third carried a mutation of unknown disease association (F1337 V [c.4009T4G; Phe1337Val]).
X
ABCC7 p.Ser549Asn 18951463:171:95
status: NEWX
ABCC7 p.Ser549Asn 18951463:171:115
status: NEW
PMID: 19372188
[PubMed]
Bickmann JK et al: "A novel approach to CFTR mutation testing by pyrosequencing-based assay panels adapted to ethnicities."
No.
Sentence
Comment
100
Diagnostic evaluation of the PSQ-based first-level testing of a predominantly German CF population.a Panethnic population Clinical diagnosis All patients Sweat test-confirmed CF Suspected atypical CF Carrier screening Chromosomes, n 310 184 96 30 PSQ screen 168 (54.2%) 158 (85.9%) 5 (5.2%) 5 (33.3%) Conventional sequencing 25 (8.1%) 25 (13.6%) 0 (0%) 0 (0%) Total detected alleles 193 (62.3%) 183 (99.5%) 5 (5.2%) 5 (33.3%) German ethnicity Other ethnicities Clinical diagnosis Sweat test-confirmed CF Sweat test-confirmed CF Chromosomes, n 146 38 PSQ screen F508del 106 (72.6%) 14 (36.8%) I507del 1 (0.7%) 1 (2.6%) 1677delTA 0 (0%) 2 (5.3%) G551D 6 (4.1%) 0 (0%) R553X 2 (1.4%) 0 (0%) Q552X 1 (0.7%) 0 (0%) G542X 2 (1.4%) 1 (2.6%) S549N 0 (0%) 2 (5.3%) W1282X 1 (0.7%) 3 (7.9%) R117H 1 (0.7%) 0 (0%) 1342-12 (TG)11-5T 0 (0%) 0 (0%) R347P 2 (1.4%) 1 (2.6%) 3849ϩ10kb CϾT 2 (1.4%) 0 (0%) N1303K 3 (2.1%) 3 (7.9%) 1717-1 GϾA 1 (0.7%) 0 (0%) CFTRdele2,3 (21 kb) 2 (1.4%) 1 (2.6%) Sum 130 (89.0%) 28 (73.7%) Conventional sequencing 16 (11.0%) 9 (23.7%) Total detected alleles 146 (100%) 37 (97.4%) a Data are presented as the number of chromosomes (percent).
X
ABCC7 p.Ser549Asn 19372188:100:734
status: NEW118 An example of the integration of a mutation that was not primarily targeted (S549N) into a PSQ assay for G542X.
X
ABCC7 p.Ser549Asn 19372188:118:77
status: NEW121 Conventional sequencing of exon 11 confirmed the homozygous state of S549N, and MLPA analysis excluded the combination of S549N with a gross deletion.
X
ABCC7 p.Ser549Asn 19372188:121:69
status: NEWX
ABCC7 p.Ser549Asn 19372188:121:122
status: NEW122 By changing the order of base injections, we obtained pyrograms optimized to detect S549N, facilitating automated genotype calling of this mutation in the future (extended assay, right panel).
X
ABCC7 p.Ser549Asn 19372188:122:84
status: NEW123 See Fig. 1 in the online Data Supplement for example pyrograms of a wild-type sample and heterozygous samples for G542X and S549N.
X
ABCC7 p.Ser549Asn 19372188:123:124
status: NEW153 The fact that simultaneously detecting some mutations (e.g.: F508del, 1677delTA, and I507del; G542X and S549N; or G551D, R553X, and Q552X) within a single assay improves the sensitivity of each PSQ run underlines even further the advantages that arise from detecting neighboring mutations as well as the target mutation within one assay (Table 2).
X
ABCC7 p.Ser549Asn 19372188:153:104
status: NEW
PMID: 19645745
[PubMed]
Shah U et al: "Cystic fibrosis: defining a disease under-diagnosed in Pakistan."
No.
Sentence
Comment
5
One patient was a F508 / S549N compound heterozygote.
X
ABCC7 p.Ser549Asn 19645745:5:25
status: NEW29 For example, S549N (G>A) homozygosity previously reported from a Pakistani family has also been associated with significant disease, while in contrast another patient with a compound heterozygote mutation, S549R / R1158X gene, presented with a mild form of CF (Frossard et al. 1999; Romey et al. 1999).
X
ABCC7 p.Ser549Asn 19645745:29:13
status: NEW51 Common mutations such as DF508, S549R, S549N, Y569D, 296 + 12(T>C), R553X, G551D and G551X were screened by allele-specific polymerase chain reaction using published oligonucleotide sequences as template primers (Kerem et al. 1989; Riordan et al. 1989; Rommens et al. 1989; : Collins 1992b).
X
ABCC7 p.Ser549Asn 19645745:51:39
status: NEW60 The remaining 150 samples were tested by PCR for DF508, S549N, S549R, Y569D, 296 + 12(T>C), R553X, G551D, G551X (Table 1).
X
ABCC7 p.Ser549Asn 19645745:60:56
status: NEW64 One patient was identified with a compound DF508 / S549N mutation.
X
ABCC7 p.Ser549Asn 19645745:64:51
status: NEW81 These mutations were S549N, S549R, Y569D, 296 + 12(T>C), R553X, G551D and G551X.
X
ABCC7 p.Ser549Asn 19645745:81:21
status: NEW84 Some of the common mutations detected on PCR in our study, such as the S549N and S549R, were not confirmed by sequencing. We did confirm the results of one patient who was a compound heterozygote for the DF508 / S549N Table 1 Frequencies of mutations identified by allele specific PCR Mutations Homozygous Heterozygous delF508 12 14 S549N 0 1 S549R 1 19 Y569D 0 0 296 + 12(T>C) 0 0 R553X 0 0 G551D 0 0 G551X 0 0 Table 2 Mutations identified by sequencing Exon Sequenced (n) Mutations identified (n) Exon 10 87 4 Exon 11 43 1 Exon 12 29 0 Tropical Medicine and International Health volume 14 no 5 pp 542-545 may 2009 U. Shah et al. Cystic fibrosis in Pakistan ª 2009 Blackwell Publishing Ltd mutation and had very aggressive disease.
X
ABCC7 p.Ser549Asn 19645745:84:71
status: NEWX
ABCC7 p.Ser549Asn 19645745:84:212
status: NEWX
ABCC7 p.Ser549Asn 19645745:84:333
status: NEW87 Previously identified regional mutations, except for S549N, were not found in our patients.
X
ABCC7 p.Ser549Asn 19645745:87:53
status: NEW
PMID: 19843100
[PubMed]
Burgel PR et al: "Non-classic cystic fibrosis associated with D1152H CFTR mutation."
No.
Sentence
Comment
42
The CF genetic analysis panel used in France seeks for 32 mutations: G85E, 394delTT, 621+1G>T, 711+1G>T, R334W, R347P, R347H, 1078delT, 5T/7T/9T, A455E, F508del, I507del, V520F, 1717-1G>A, G542X, G551D, R553X, R560T, S549R (T>G), S549N, 1898+1G>A, 2183AA>G, 2184delA, 2789+5G>A, 3120+1G>A, R1162X, 3659delC, 3849+10kbC>T, W1282X, 3905insT, 3876delA, N1303K.
X
ABCC7 p.Ser549Asn 19843100:42:230
status: NEW98 Diagnostic features in 42 D1152H subjects according to the other CFTR mutation class Subject Sex (M/F) Other CFTR mutation Sweat Cl- mean (mmol/l) Age at diagnosis (years) Presentation at diagnosis Class I mutations 1 F W1282X 58 4 Pneumonia recurrent bronchitis 2 F W1282X 25 74 Bronchiectasis 3 M W1282X 43 33 CBAVD 4 M G542X 48 39 CBAVD 5 M G542X 72 27 CBAVD 6 F S1206X 18 13 Recurrent bronchitis+ diarrhea 7 F 394delTT 19 41 Bronchiectasis 8 F 394delTT 25 18 Bronchiectasis 9 F Q552X 56 43 Bronchiectasis Class II mutations 10 F F508del 13 42 Bronchiectasis 11 F F508del 40 32 Bronchiectasis 12 F F508del 52 23 Bronchiectasis 13 M F508del 51 15 Bronchiectasis 14 F F508del 100 24 Bronchiectasis 15 M F508del 79 26 Bronchiectasis 16 F F508del - 43 Bronchiectasis 17 M F508del - 23 Bronchiectasis 18 F F508del 19 55 Bronchiectasis 19 F F508del 25 33 Bronchiectasis 20 F F508del 78 15 Bronchiectasis 21 M F508del 90 40 Bronchiectasis 22 F F508del 44 42 Bronchiectasis 23 M F508del 88 11 Bronchiectasis 24 F F508del 63 47 Bronchiectasis 25 F F508del 43 33 Bronchiectasis 26 M F508 del 62 49 Bronchiectasis 27 M F508del 20 - CBAVD 28 M F508del - 27 CBAVD 29 M F508del 42 36 CBAVD 30 M F508del 36 34 CBAVD 31 M F508del 40 36 CBAVD 32 M F508del 41 30 CBAVD 33 M F508del 82 9 Asymptomatic genetic counseling 34 M F508del - 0 Neonatal screening 35 F F508del 53 0 Neonatal screening 36 F F508del 35 0 Neonatal screening 37 M F508del 35 0 Neonatal screening Class III mutation 38 F S549N 75 31 Bronchiectasis Class IV mutations 39 M E116K 80 41 ABPA+ diarrhea 40 M D1152H 34 34 CBAVD 41 M R1070Q 56 38 CBAVD Class V mutation 42 M 3849+10kbC>T 31 40 Asymptomatic genetic counseling ABPA, allergic bronchopulmonary aspergillosis; CBAVD, congenital bilateral absence of the vas deferens.
X
ABCC7 p.Ser549Asn 19843100:98:1475
status: NEW
PMID: 19885835
[PubMed]
McWilliams RR et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations and risk for pancreatic adenocarcinoma."
No.
Sentence
Comment
85
* Mutations recommended for screening by the American College of Medical Genetics.16 Mutations not listed but included in the 39-site assay: 3120þ1G>A, R334W, 3569delC, 1078delT, S549N, 3876delA, 1898þ5G>T, 2307insA, Y1092X, M1101K, S1255X, Y122X, A559T; in the 33-site assay: 3120þ1G>A, R334W, 3569delC, S549N, 3876delA, F508C.
X
ABCC7 p.Ser549Asn 19885835:85:184
status: NEWX
ABCC7 p.Ser549Asn 19885835:85:320
status: NEW
PMID: 19897426
[PubMed]
Picci L et al: "A 10-year large-scale cystic fibrosis carrier screening in the Italian population."
No.
Sentence
Comment
48
Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT.
X
ABCC7 p.Ser549Asn 19897426:48:268
status: NEW
PMID: 20059485
[PubMed]
Dorfman R et al: "Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?"
No.
Sentence
Comment
64
Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure).
X
ABCC7 p.Ser549Asn 20059485:64:252
status: NEW
PMID: 20797923
[PubMed]
Farra C et al: "Mutational spectrum of cystic fibrosis in the Lebanese population."
No.
Sentence
Comment
6
Five mutations - not previously reported in the Lebanese population - were identified; these are: S549N, G542X, 2043delG, 4016insG, and R117H-7T.
X
ABCC7 p.Ser549Asn 20797923:6:98
status: NEW27 Family Origin Community CM Sex CF mutations Age at diagnosis CP Sweat test 1 Bekaa Maronite No M W1282X Mount Lebanon Maronite F 4010del4 M W1282X/4010del4 1 year Pu Positive 2 North Sunnite Yes M N1303K North Sunnite F N1303K M N1303K/N1303K 7 months Pu, Gi, GR Positive 3 South Shiite Yes M F508del Shiite F F508del M F508del/F508del 2 years Pu, Gi, GR Positive 4 Mount Lebanon Greek-orthodox Yes M F508del Mount Lebanon Maronite F W1282X M F508del/W1282X 2 weeks Gi Positive 5 North Sunnite No M S549N North Sunnite F G542X M S549N/G542X 19 years Pu, Gi Positive 6 Bekaa Sunnite Yes M N1303K Bekaa Sunnite F N1303K M N1303K/N1303K 8 months Gi, GR Positive 7 Beirut Maronite No M 2789+5GNA Beirut Greek-Orthodox F F508del M F508del/2789+5GNA 6 months Pu, Gi, GR Positive 8 North Sunnite Yes M 2043delG North Sunnite F 2043delG M 2043delG/2043delG 6 weeks Gi No data 9 North Sunnite Yes M R117H-7T North Sunnite F R117H-7T M R117H-7T/R117H-7T 3 months Pu Positive 10 South Sunnite Yes M 4016insG South Sunnite F 4016insG M 4016insG/4016insG 3 months Pu Positive M 4016insG/4016insG 5 months Pu Positive 11 Mount Lebanon Maronite No M N1303K Mount Lebanon Greek-Catholic F N1303K M N1303K/N1303K 3 months Pu, Gi Positive 12 North Maronite No M S4X Mount Lebanon Maronite F N1303K M N1303K/S4X 1 month Pu, Gi, Gr Positive 13 Bekaa Greek-Catholic No M F508del No data Maronite F 4010del4 F F508del/4010del4 11 months Pu, Gi Positive 14 No data Greek-Catholic No M W1282X No data Maronite F F508del F W1282X/F508del 2 years No data Positive 15 Mount Lebanon Baptist No M F508del Mount Lebanon Maronite F N1303K F F508del/N1303K 3 years Pu, Gi, Gr Positive 16 North Sunnite Yes M F508del North Sunnite F F508del F F508del/F508del 9 months Pu, Gi, Gr Negative 17 North Sunnite Yes M N1303K Sunnite F N1303K F N1303K./N1303K 2 years Pu, Gr Positive 18 North Sunnite No M F508del North Sunnite F F508del F F508del/F508del 7 months Pu, Gi, Gr Positive 19 North Maronite No M F508del No data Maronite F F508del M F508del/F508del 7 years Pu, Gi, Gr Positive 20 Beirut Maronite No data M S4X No data Maronite F S4X M S4X/S4X 9 months Pu, Gi No data (continued on next page) diagnosis was based mainly on the clinical picture according to the consensus criteria [16] and was confirmed when possible by a positive sweat chloride test.
X
ABCC7 p.Ser549Asn 20797923:27:499
status: NEWX
ABCC7 p.Ser549Asn 20797923:27:529
status: NEW39 These mutations were W1282X, 4010del4, N1303K, F508del, S549N, G542X, 2043delG, R117H-7T, 2789 + 5G NA, 4016insG, and S4X.
X
ABCC7 p.Ser549Asn 20797923:39:56
status: NEW42 Five mutations that were not previously reported in the Lebanese population were identified, these are: S549N, G542X, 2043delG, 4016insG and R117H-7T.
X
ABCC7 p.Ser549Asn 20797923:42:104
status: NEW51 Common CFTR mutations in the Lebanese population Frequency of CF alleles (%) Lebanona Palestine [17] Jordan [24] Syria [29] Saudi Arabia, United Arab Emirates, Oman, Qatar, Kuwait, and Jordan [1] Saudi Arabia [3,25] Bahrain [27] F508 del 36.3 23.5 7.4 1 patient 12 15 7.7 W1282X 13.8 10.6 N1303K 20 21 1.5 3-14 4010del4 7.5 2.3 S4X 6.3 2789+5GNA 2.5 2043delG 2.5 7 30.8 4016insG 2.5 R117H-7T 2.5 G542X 1.3 1.2 4096-28G→A 1.3 E672del 1.3 M952I 1.3 S549N 1.3 a Mutations in a total of 80 identified CF alleles in the Lebanese population from this study combined with Desgeorges et al. (1997) [2].
X
ABCC7 p.Ser549Asn 20797923:51:454
status: NEW
PMID: 20932301
[PubMed]
Green DM et al: "Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients."
No.
Sentence
Comment
74
For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function.
X
ABCC7 p.Ser549Asn 20932301:74:661
status: NEW
PMID: 21228336
[PubMed]
Brown MB et al: "Low abundance of sweat duct Cl- channel CFTR in both healthy and cystic fibrosis athletes with exceptionally salty sweat during exercise."
No.
Sentence
Comment
114
Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X.
X
ABCC7 p.Ser549Asn 21228336:114:57
status: NEW119 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X.
X
ABCC7 p.Ser549Asn 21228336:119:57
status: NEW
PMID: 21514289
[PubMed]
Earley MC et al: "Implementation of the first worldwide quality assurance program for cystic fibrosis multiple mutation detection in population-based screening."
No.
Sentence
Comment
129
Allele Allele Allele Allele p.Gly85Glu G85E (0.26) p.Arg117His R117H (0.54) c.489+1 GNT 621+1 GNT (1.3) p.Phe508del F508del (66.31) p.Arg347Pro R347P (0.36) p.lle507del I507del (0.90) p.Gly551Asp G551D (1.93) c.2052delA 2184delA (0.15) c.1585-1 GNA 1717-1 GNA (0.44) p.Gly542X G542X (2.64) c.3528delC 3659delC (0.28) p.Asn1303Lys N1303K (1.27) p.Arg553X R553X (1.21) p.Arg560Thr R560T (0.30) p.Arg1162X R1162X (0.30) c.2657+5 GNA 2789+5 GNA (0.38) c.3717+12191 CNT 3849+10kbCNT (0.85) c.2988+1 GNA 3120+1 GNA (0.86) p.Trp1282X W1282X (2.20) p.Ala455Glu A455E (0.26) c.1766+1 GNA 1898+1 GNA (0.13) c.579+1 GNT 711+1 GNT (0.35) p.Arg334Trp R334W (0.37) c.54-5940 _273+10250del21kb CFTR dele2,3 p.Ser549Asn S549N (0.14) c.1584 GNA 1716 G→A c.2051_2052delAAinsG 2183AANG (0.1) c.3140-26ANG 3272-26ANG c.262_263delTT 394delTT p.Arg1066Cys R1066C (0.03) p.Arg1066His R1066H c.1022_1023insTC 1154insTC c.2989-1 GNA 3121-1 GNA c.(?_2989)_(3139_?
X
ABCC7 p.Ser549Asn 21514289:129:694
status: NEWX
ABCC7 p.Ser549Asn 21514289:129:704
status: NEW
PMID: 21538969
[PubMed]
Ren CL et al: "Clinical outcomes in infants with cystic fibrosis transmembrane conductance regulator (CFTR) related metabolic syndrome."
No.
Sentence
Comment
60
Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1-CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected.
X
ABCC7 p.Ser549Asn 21538969:60:479
status: NEW61 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1- CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected.
X
ABCC7 p.Ser549Asn 21538969:61:480
status: NEW
PMID: 9630075
[PubMed]
Arduino C et al: "Congenital bilateral absence of vas deferens with a new missense mutation (P499A) in the CFTR gene."
No.
Sentence
Comment
52
Other missense mutations in this domain (A455E, P574H, G576A, S549N) have been found associated with a mild CF phenotype and their functional analysis in transfected cells revealed a low transport efficiency of the chloride channel and a reduced protein expression at the apical cell surface, which can explain the mild clinical phenotype (6).
X
ABCC7 p.Ser549Asn 9630075:52:62
status: NEW
PMID: 9725921
[PubMed]
Sharer N et al: "Mutations of the cystic fibrosis gene in patients with chronic pancreatitis."
No.
Sentence
Comment
32
DNA Studies We extracted DNA from buccal cells obtained by having the patients rinse their mouths with 10 ml of 4 percent sucrose.19 The CFTR locus was examined for the 22 mutations that together account for 95 percent of all such mutations in patients with cystic fibrosis in the northwest of England.20 The amplification- refractory mutation system Elucigene CF(4)m kit (Zeneca Diagnostics, Macclesfield, United Kingdom) was used to detect the four most common mutations: ∆F508, G551D, G542X, and 621+1(G→T)21; the polymerase chain reaction, restriction-enzyme analysis, and allele-specific oligonucleotide hybridization facilitated the detection of R560T, R117H, 1898+1(G→A), R553X, S549N, 1717¡1(G→A), N1303K, W1282X, E60X, 1154insTC, R347P, 3659delC, Q493X, V520F, R334W, ∆I507, 3849+10Kb(C→T), and 1078delT.
X
ABCC7 p.Ser549Asn 9725921:32:707
status: NEW
PMID: 9725922
[PubMed]
Cohn JA et al: "Relation between mutations of the cystic fibrosis gene and idiopathic pancreatitis."
No.
Sentence
Comment
34
Pancreatograms were assessed for the severity of chronic pancreatitis according to published criteria by a reviewer who was unaware of the patients` histories (Table 1).19 DNA Studies We extracted DNA from blood samples20 and tested for 16 CFTR mutations - ∆F508, W1282X, R117H, 621+1(G→T), R334W, R347P, A455E, ∆I507, 1717¡1(G→A), G542X, S549N, G551D, R553X, R560T, N1303K, and 3849+10Kb(C→T) - using reverse dot blot strips (Roche Molecular Systems, Alameda, Calif.).
X
ABCC7 p.Ser549Asn 9725922:34:372
status: NEW
PMID: 15300780
[PubMed]
Wong LJ et al: "Detection of CFTR mutations using temporal temperature gradient gel electrophoresis."
No.
Sentence
Comment
89
For example, the p.Q98X and p.Q98R mutations in exon 4; and p.S466X and p.S492F mutations in exon 10, were detected in the temperature range of 52-607C and 51- 577C, respectively. The p.G542X, p.R553X, p.S549N, and p.A559T in exon 11; p.A561E, c.189811G.A, and c.189813A.G in exon 12; and p.W1204X in exon 19; were detected in the temperature range of 51 to 567C.
X
ABCC7 p.Ser549Asn 15300780:89:204
status: NEW96 Detection of known mutations and polymorphisms by TTGE Base substitution Mutation Exon or intron Homozygote or heterozygote Polymorphism or mutation # Alleles detected 1 c.386G.A p.G85E 3 Heterozygote Mutation 2 2 c.575T.C p.I148T 4 Heterozygote Mutation 2 3 c.406-1G.A Splice Int 4 Heterozygote Mutation 9 4 c.71111G.T Splice Int 5 Heterozygote Mutation 1 5 c.1059_1069del 3bp p.F311del 7 Heterozygote Mutation 2 6 c.1132C.T p.R334W 7 Heterozygote Mutation 2 7 c.1652_1655del 3bp p.F508del 10 Heterozygote Mutation 94 8 Homozygote Mutation 12 c.1540A/G p.M470V 10 Heterozygote Polymorphism 15 9 Homozygote Polymorphism 4 c.1756G.T p.G542X 11 Heterozygote Mutation 13 10 c.1784G.A p.G551D 11 Heterozygote Mutation 1 11 c.1778G.A p.S549N 11 Heterozygote Mutation 4 12 c.1789C.T p.R553X 11 Homozygote Mutation 2 13 c.1807G.A p.A559T 11 Heterozygote Mutation 2 14 c.189811G.A Splice Int 12 Heterozygote Mutation 1 15 c.1949del84bp Frameshift 13 Heterozygote Mutation 3 16 c.278915G.A Splice Int 14b Heterozygote Mutation 2 17 c.312011G.A Splice Int 16 Heterozygote Mutation 9 18 c.3171delC Frameshift 17a Heterozygote Mutation 1 19 c.3398G.A p.W1089X 17b Heterozygote Mutation 1 20 c.3425G.A p.W1098X 17b Heterozygote Mutation 1 21 c.3616C.T p.R1162X 19 Heterozygote Mutation 2 22 c.3791delC Frameshift 19 Heterozygote Mutation 1 23 c.3821delT Frameshift 19 Heterozygote Mutation 1 24 c.3876delA Frameshift 20 Heterozygote Mutation 4 25 c.3905insT Frameshift 20 Heterozygote Mutation 1 26 c.4041C.G p.N1303K 21 Heterozygote Mutation 2 Total 194 The translation starts at c.133 of CFTR CDNA sequence in GenBank Acc.
X
ABCC7 p.Ser549Asn 15300780:96:731
status: NEW
PMID: 17331079
[PubMed]
Alonso MJ et al: "Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry."
No.
Sentence
Comment
105
Our impression is that Table 3 Common CF mutations identified in this study and in several Latin American populations Mutation This study Hispanic1 Mexico2 Colombia3 Brazil4 Argentina5 Chile6 p.F508del 51.7 51.6 40.7 41.8 48.4 58.6 45.0 p.G542X 7.7 4.0 6.2 3.8 8.8 4.1 7.0 p.N1303K 2.9 0.8 2.0 0.5 2.5 2.7 - c.1811 + 1,6kbA > G 1.8 - - 6.5 - 0.9 - p.R334W 1.8 1.6 - 0.5 2.5 1.1 2.0 p.L206W 1.6 - - - 0.6 - - c.711 + 1G > T 1.6 - - - - - - p.Q890X 1.4 - - - - - - p.R1162X 1.3 0.8 - 1.1 2.5 0.4 2.0 c.2789 + 5G > A 1.2 - - 0.5 0.3 0.7 - p.R1066C 1.2 1.6 - 0.5 - 0.2 - p.I507del 1.0 - 2.6 - - 0.7 - c.2183AA > G 0.8 - 1.0 - 0.2 - p.G85E 0.7 0.8 0.5 - 1.3 0.7 - p.W1282X 0.7 0.8 - 1.1 1.3 2.7 5.0 c.3849 + 10kbC > T 0.4 4.0 0.5 - - 0.9 3.0 p.S549N - 2.4 2.6 - - - - c.3120 + 1G > A - 1.6 - 0.5 - - - c.3876delA - 5.6 - - - - - c.406-1G > A - 1.6 1.5 - - - - c.935delA - 1.6 1.0 - - - - p.R75X - 0.8 1.5 - - - - c.2055del9 - - 1.0 - - - - p.I506T - - 1.0 - - - - c.3199del6 - - 1.0 - - - - p.S549R 0.4 - - 2.2 - 0.2 - c.1717-1G > A 0.2 - - - 0.3 1.1 - p.G551D 0.2 0.8 0.5 - - - 1.0 p.R553X 0.4 - 0.5 - 0.6 0.2 1.0 No.
X
ABCC7 p.Ser549Asn 17331079:105:742
status: NEW
PMID: 20502448
[PubMed]
Joergensen MT et al: "Genetic, epidemiological, and clinical aspects of hereditary pancreatitis: a population-based cohort study in Denmark."
No.
Sentence
Comment
57
The samples were also tested for 33 CFTR mutations, and all 6 classeswererepresented:394delTT,p.R553X,621+1G>T,p.R1162X, 1717-1G>A,3659delC,p.G542X,2183AA>G,p.W1282X,1078delT, 711+1G>T, F508del, p.S549N, I507del, p.S549R, 2184delA, p.G551D, p.G85E, p.N1303K, p.R560T, p.R117H, p.R347H, p.R347P, p.R334W, 2789+5G>A, 3849+10kbC>T, p.A445E, 3120+1G>A, p.V520F,1898+1G>A,3876delA,3905insT,andIVS8-5T.DNAwas amplified by multiplex PCR (Hybaid 4 A62, Middlesex, UK).
X
ABCC7 p.Ser549Asn 20502448:57:197
status: NEW
PMID: 21036675
[PubMed]
Lay-Son G et al: "Cystic fibrosis in Chilean patients: Analysis of 36 common CFTR gene mutations."
No.
Sentence
Comment
81
Mutation This study Rios et al. [4] Molina et al. [5] Repetto et al. [6] Perez et al. [13] CFGAC [2] (n=578) (%) (n=72) (%) (n=36) (%) (n=100) (%) (n=4102) (%) (n=43,849) (%) Chile Chile Chile Chile Latin-Americaa Worldwide Unknown 58.0 66.6 61.1 34.0 36.7 22.7 p.F508del 30.6 29.2 30.6 45.0 47.1 66.0 p.R334W 3.1 - - 2.0 0.8 0.1 p.G542X 2.4 0 8.3 7.0 5.0 2.4 c.3849+10Kb CNT 1.7 - - 3.0 0.3 0.2 p.R553X 1.2 4.2 0 1.0 0.4 0.7 p.R1162X 0.9 - - 2.0 1.0 0.3 p.1078delT 0.5 - - 0 b0.1 0.1 p.G85E 0.5 - - - 0.8 0.2 p.W1282X 0.2 - - 5.0 1.0 1.2 c.3120+1 GNA 0.2 - - - 0.3 - c.711+1 GNT 0.2 - - - 0.1 0.1 p.R117H 0.2 - - 0 b0.1 0.3 p.A455E 0.2 - - 0 0 0.1 p.I148T 0.2 - - - - - p.G551D 0 0 0 1.0 0.1 1.6 p.N1303K 0 0 0 0 1.8 1.3 c.621+1 GNT 0 - - 0 0.2 0.7 c.1717-1 GNA 0 - - 0 0.3 0.6 p.I507del 0 - - 0 0.2 0.2 p.R347P 0 - - 0 0 0.2 c.2789+5 GNA 0 - - - 0.2 0.1 c.1898+1 GNA 0 - - - 0.1 0.1 c.2184delA 0 - - - b0.1 0.1 p.S549N 0 - 0 - 0.1 0.1 c.3659delC 0 - - 0 0.1 0.1 p.R560T 0 - - - 0 0.1 c.1811+1.6Kb ANG 0 - - - 0.4 - c.2183AANG 0 - - 0 0.1 - p.S549R 0 - - - 0.1 - c.3272-26 ANG 0 - - - 0.1 - c.3199del6 0 - - - b0.1 - p.E60X 0 - - 0 0 - c.3905insT 0 - - - 0 - p.S1251N 0 - - 0 - - CFTRdele2,3 0 - - - - - p.R347H 0 - - - - - p.V520F 0 - - - - - p.Q552X 0 - - - - - c.394delTT 0 - - - - - c.711+1 GNA 0 - - - - - c.2143delT 0 - - - - - c.3876delA 0 - - - - - a Data from Chilean patients published in Rios et al., Molina et al., and Repetto et al. [4-6] included in this publication were excluded in this table to avoid repetition.
X
ABCC7 p.Ser549Asn 21036675:81:915
status: NEW
PMID: 1718974
[PubMed]
Chastre E et al: "Functional insertion of the SV40 large T oncogene in cystic fibrosis intestinal epithelium. Characterization of CFI-3 cells."
No.
Sentence
Comment
143
This mutation changes a serine codon to asparagine within the first nucleotide binding fold and is referred to S549N.
X
ABCC7 p.Ser549Asn 1718974:143:111
status: NEW207 The S549N mutation observed here in intestinal CFI-3 cells causes a conservative substitution between uncharged polar amino acids.
X
ABCC7 p.Ser549Asn 1718974:207:4
status: NEW
PMID: 9180695
[PubMed]
Del Sorbo G et al: "Multidrug resistance in Aspergillus nidulans involves novel ATP-binding cassette transporters."
No.
Sentence
Comment
182
The substitution in this motif of the conserved serine (S) by N in the CFTR gene product (S549N) is associated with cystic ®brosis in man (Cutting et al. 1990).
X
ABCC7 p.Ser549Asn 9180695:182:90
status: NEW
No.
Sentence
Comment
437
CFTR mRNA levels were also reduced in a compound nonsense/missense heterozygote (R553X/ S549N).
X
ABCC7 p.Ser549Asn 1381146:437:88
status: NEW
PMID: 22678879
[PubMed]
El-Seedy A et al: "CFTR mutation combinations producing frequent complex alleles with different clinical and functional outcomes."
No.
Sentence
Comment
105
[2002C>T;3718-2477C>T] p.Gln689X 2 CSD Nasal polyposis 14 y,16 y NA, 29 p.[Gly576Ala;Arg668Cys] NI 3 IP 35-39 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 IP Bronchitis 49 y NA p.[Gly576Ala;Arg668Cys] p.PheF508del 1 IP 42 y NA p.[Gly576Ala;Arg668Cys] p.Arg668Cys 1 IP NA NA p.[Gly576Ala;Arg668Cys] c.1210_34TG[12]T[5] 4 IP 19-69 y NA p.[Gly576Ala;Arg668Cys] NI 1 Cholestasis 60 y NA p.[Gly576Ala;Arg668Cys] c.1584G>A 33 CBAVD 27-50 y 9-82 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 2 CBAVD 30 y,36 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.2051_2052delAAinsG 1 CBAVD 34 y 72 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Trp1282X 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 CBAVD 35 y 65-66 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Ser549Asn 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.3605delA 1 CBAVD 30 y 41-69 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gln1411X 1 CBAVD 31 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg347His 3 CBAVD 29 y, 34 y, NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gly542X 1 CBAVD 35 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.946delT 1 CBAVD 26 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.4242_4242+1delGGinsT 1 CBAVD 41 y 31 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg117His 1 CBAVD 32 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr338Ile 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Glu379Lys 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Met1137Val 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr1246Ile 2 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 CBAVD 34 NA p.[Gly576Ala;Arg668Cys] p.Asn1303Lys 8 CBAVD 30-42 y NA p.[Gly576Ala;Arg668Cys] NI 1 CBAVD 27 y NA p.Arg668Cys p.Phe508del 1 CBAVD 30 y NA p.Arg668Cys NI 1 CUAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 1 CUAVD NA NA p.[Gly576Ala;Arg668Cys] NI 1 CUAVD Renal agenesis NA NA p.[Gly576Ala;Arg668Cys] NI 1 Hypofertility (not CBAVD) CF carrier`s partner NA NA p.[Gly576Ala;Arg668Cys] p.Asp1152His 1 FBA Mild CF considered possible, 2 older brothers with the same genotype, one with a very mild phenotype, the other being asymptomatic 22 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 FBA TOP for de novo chromosomal translocation; not CF 21 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg31Cys 1 FBA Not CF at birth 28 wg <30 p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Unknown outcome 23 wg NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Not CF at birth 21 wg <30 p.[Gly576Ala;Arg668Cys] p.Trp846X (Continued) Table 1.
X
ABCC7 p.Ser549Asn 22678879:105:737
status: NEW
PMID: 22311127
[PubMed]
Watts KD et al: "Hispanic Infants with cystic fibrosis show low CFTR mutation detection rates in the Illinois newborn screening program."
No.
Sentence
Comment
39
Mutation Frequency Table 1 shows the mutations found in Illinois patients diagnosed with CF after a positive NBS and compares these to mutations documented in Hispanic Caucasian Table 1 CFTR mutation frequency detected by Illinois newborn screen Mutation IL Newborn Screen CFF Patient Registry Total alleles Non-Hispanic Caucasian Hispanic Caucasian African American Ethnicity/Race Missing Hispanic Caucasian ΔF508 63.9% 71.6% 36.7% 33.3% 58.3% 44.7% R117H 7.7% 10.1% 3.3% - - 0.3% G542X 1.9% 2.0% - - 4.2% 4.1% 3120+1G>A 1.9% 0.7% 3.3% 33.3% - 0.7% ΔI507 1.4% 0.7% - - 8.3% 1.3% G551D 1.4% 2.0% - - - 0.5% 3659delC 1.4% 1.3% 3.3% - - 0.1% 3849+10 kbC>T 1.4% - 6.7% 16.7% - 1.0% ΔF311 1.4% - 6.7% - 4.2% 0.03% 1288insT 0.5% - 3.3% - - 0% 621+1G>T 0.5% - 3.3% - - 0.4% G85E 1.0% - 3.3% - 4.2% 0.3% 2184delA 0.5% - 3.3% - - 0.2% S549N 0.5% - 3.3% - - 0.7% R334W 1.0% 0.7% - 16.7% - 1.0% N1303K 1.0% - - - 8.3% 1.6% Other 4.4% 6.2%a 0% 0% 0% 12.8%b Unknown 8.2% 4.7% 23.5% 0% 12.5% 15.7% a R347P, 1898+1G>A, 2789+5G>A, 3272-26A>G, 3876delA, CFTRdel2,3, W1282X occurred in non-Hispanic Caucasian patients only with an allele frequency of 0.5% of the entire IL NBS population b In the 2004 CFF Patient Registry 12.8% of alleles are not included in the above table because they occur in less than 1% of the population.
X
ABCC7 p.Ser549Asn 22311127:39:842
status: NEW
PMID: 22658665
[PubMed]
Ooi CY et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis."
No.
Sentence
Comment
855
CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray.
X
ABCC7 p.Ser549Asn 22658665:855:693
status: NEW
PMID: 22581207
[PubMed]
Krulisova V et al: "Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA."
No.
Sentence
Comment
81
According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations.
X
ABCC7 p.Ser549Asn 22581207:81:2662
status: NEWX
ABCC7 p.Ser549Asn 22581207:81:2673
status: NEW
PMID: 22293084
[PubMed]
Yu H et al: "Ivacaftor potentiation of multiple CFTR channels with gating mutations."
No.
Sentence
Comment
4
These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations.
X
ABCC7 p.Ser549Asn 22293084:4:33
status: NEW39 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11].
X
ABCC7 p.Ser549Asn 22293084:39:31
status: NEW67 The CF-associated CFTR mutations, S549N, S549R, and S1251N, are located in the ABC signature sequence (Fig. 4; LSGGQ; S549N,R in NBD1) and Walker A motif (Fig. 4; S1251N in NBD2), that form the ATP binding sites [14].
X
ABCC7 p.Ser549Asn 22293084:67:34
status: NEWX
ABCC7 p.Ser549Asn 22293084:67:118
status: NEW68 Immunoblot and Ussing chamber studies indicated that, although the maturation of S549N- and S1251N-CFTR was similar to normal, the baseline level of chloride transport was b10% of normal CFTR (Figs. 1 and 3; Table 2).
X
ABCC7 p.Ser549Asn 22293084:68:34
status: NEWX
ABCC7 p.Ser549Asn 22293084:68:81
status: NEWX
ABCC7 p.Ser549Asn 22293084:68:118
status: NEW69 S549R-CFTR showed maturation comparable to 26±2% (n=5) of normal CFTR (Fig. 1D), which did not account for the b1% of normal CFTR function (Fig. 3; Table 2).
X
ABCC7 p.Ser549Asn 22293084:69:81
status: NEW70 These results indicated that the function of S549N-, S549R-, and S1251N-CFTR at the cell surface was minimal.
X
ABCC7 p.Ser549Asn 22293084:70:45
status: NEW71 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTRmRNA (%NormalCFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTRMaturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations MatureCFTR (%NormalCFTR) A B D C Mature Immature Fig. 1.
X
ABCC7 p.Ser549Asn 22293084:71:45
status: NEWX
ABCC7 p.Ser549Asn 22293084:71:67
status: NEWX
ABCC7 p.Ser549Asn 22293084:71:195
status: NEWX
ABCC7 p.Ser549Asn 22293084:71:312
status: NEWX
ABCC7 p.Ser549Asn 22293084:71:448
status: NEW82 Taken together, these data suggested that defective channel gating was the predominant defect in S549N-, S549R- and S1251N-CFTR.
X
ABCC7 p.Ser549Asn 22293084:82:97
status: NEW83 In FRT cells expressing S549N-, S549R-, and S1251N-CFTR, acute addition of 10 μM ivacaftor increased the channel open probability and total chloride transport by N10-fold over baseline levels (Figs. 2 and 3; Tables 1 and 2).
X
ABCC7 p.Ser549Asn 22293084:83:97
status: NEW91 In addition, we showed that the 3 additional mutations, S549N, S549R, and S1251N also have characteristics consistent with gating defects.
X
ABCC7 p.Ser549Asn 22293084:91:56
status: NEW96 Taken together, these in vitro results provide a rationale for testing the potential benefit of ivacaftor in individuals with CF who have a CFTR gating mutation other than G551D, including the G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P, and G1349D CFTR gating mutations.
X
ABCC7 p.Ser549Asn 22293084:96:201
status: NEW97 Evaluation of CF-associated CFTR mutations that were expected to cause protein alterations in the ATP-binding sites formed by the NBDs indicated that S549N- and S1251N-CFTR also shared similar in vitro functional characteristics with G551D-CFTR and could be classified as CFTR gating mutations.
X
ABCC7 p.Ser549Asn 22293084:97:150
status: NEWX
ABCC7 p.Ser549Asn 22293084:97:201
status: NEW98 Unlike S549N-CFTR and S1251N-CFTR, S549R-CFTR exhibited a partial reduction in the level of CFTR maturation compared to normal CFTR (see also Ref. [16]).
X
ABCC7 p.Ser549Asn 22293084:98:7
status: NEWX
ABCC7 p.Ser549Asn 22293084:98:150
status: NEW99 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 µM Ivacaftor * * * * * * * * * * * CFTR Mutation ChannelOpenProbability ChannelOpenProbability (%NormalCFTR) B 1pA 3sec + 10 µM Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2.
X
ABCC7 p.Ser549Asn 22293084:99:7
status: NEWX
ABCC7 p.Ser549Asn 22293084:99:80
status: NEWX
ABCC7 p.Ser549Asn 22293084:99:410
status: NEW127 Like G551D, the G551S, G1244E, S1255P, and G1349D CFTR gating mutations, as well as the S549N, S549R, and S1251N CFTR gating mutations identified in the Table 1 Effect of ivacaftor on the channel gating activity of CFTR with gating mutations.
X
ABCC7 p.Ser549Asn 22293084:127:88
status: NEW128 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 bc;M ivacaftor Baseline With 10 μM ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57±0.03 100 0.63±0.02 111 0.400±0.04 100 0.800±0.04 a 200 G551D 0.46±0.06 81 0.46±0.03 81 0.019±0.01 b 5 0.121±0.035 a 30 G178R 0.59±0.11 103 0.66±0.08 116 0.005±0.001 b 1 0.228±0.022 a 57 S549N 0.55±0.02 97 0.61±0.02 108 0.003±0.010 b 1 0.396±0.119 a 99 S549R 0.45±0.01 b 79 0.55±0.02 a 96 0.004±0.010 b 1 0.143±0.031 a 36 G551S 0.57±0.13 100 0.64±0.02 113 0.010±0.001 b 3 0.337±0.110 a 84 G970R 0.55±0.03 96 0.55±0.03 97 0.001±0.001 b 0 0.245±0.042 a 61 G1244E 0.44±0.11 77 0.54±0.08 94 0.011±0.010 b 3 0.470±0.122 a 118 S1251N 0.54±0.07 95 0.63±0.04 111 0.003±0.010 b 1 0.350±0.03 a 88 S1255P 0.70±0.03 b 122 0.71±0.02 125 0.018±0.016 b 5 0.468±0.168 a 117 G1349D 0.49±0.08 85 0.63±0.06 111 0.019±0.015 b 5 0.315±0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation.
X
ABCC7 p.Ser549Asn 22293084:128:88
status: NEWX
ABCC7 p.Ser549Asn 22293084:128:459
status: NEW130 0 100 200 300 400 -9 -8 -7 -6 -5 -4 G178R G551D G551S 0 S549N S549R Ivacaftor [Log M] 0 100 200 300 400 0 50 100 150 200 -9 -8 -7 -6 -5 -4 G970R G1244E S1255P G1349D 0 S1251N Ivacaftor [Log M] ChlorideTransport (%NormalCFTR) Normal Forskolin G178R G551S G970R G1244E 50 2 1 min S1255P Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 0 50 100 150 200 * * * * * * * * * * * * * CFTR Mutation ChlorideTransport(µA/cm2)ChlorideTransport(µA/cm2) ChlorideTransport(A/cm2) ChlorideTransport (%NormalCFTR) B G1349D G551D A F508del C S549N S549R S1251N Baseline Baseline present study, cause protein alterations in the ATP binding pockets formed by the two NBDs required for normal CFTR channel gating (Fig. 4) [2].
X
ABCC7 p.Ser549Asn 22293084:130:56
status: NEWX
ABCC7 p.Ser549Asn 22293084:130:312
status: NEWX
ABCC7 p.Ser549Asn 22293084:130:584
status: NEW131 The G178R and G970R CFTR gating mutations alter the intracellular cytoplasmic loops that are believed to link the ATP-driven conformational changes in the NBDs to the opening of the CFTR channel pore formed by the membrane spanning domains [27].
X
ABCC7 p.Ser549Asn 22293084:131:56
status: NEWX
ABCC7 p.Ser549Asn 22293084:131:315
status: NEWX
ABCC7 p.Ser549Asn 22293084:131:601
status: NEW144 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D.
X
ABCC7 p.Ser549Asn 22293084:144:240
status: NEW40 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11].
X
ABCC7 p.Ser549Asn 22293084:40:31
status: NEW72 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTR mRNA (% Normal CFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTR Maturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations Mature CFTR (% Normal CFTR) A B D C Mature Immature Fig. 1.
X
ABCC7 p.Ser549Asn 22293084:72:67
status: NEWX
ABCC7 p.Ser549Asn 22293084:72:195
status: NEWX
ABCC7 p.Ser549Asn 22293084:72:315
status: NEWX
ABCC7 p.Ser549Asn 22293084:72:452
status: NEW92 In addition, we showed that the 3 additional mutations, S549N, S549R, and S1251N also have characteristics consistent with gating defects.
X
ABCC7 p.Ser549Asn 22293084:92:56
status: NEW100 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 &#b5;M Ivacaftor * * * * * * * * * * * CFTR Mutation Channel Open Probability Channel Open Probability (% Normal CFTR) B 1pA 3sec + 10 &#b5;M Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2.
X
ABCC7 p.Ser549Asn 22293084:100:80
status: NEWX
ABCC7 p.Ser549Asn 22293084:100:414
status: NEW129 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 bc;M ivacaftor Baseline With 10 bc;M ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57&#b1;0.03 100 0.63&#b1;0.02 111 0.400&#b1;0.04 100 0.800&#b1;0.04 a 200 G551D 0.46&#b1;0.06 81 0.46&#b1;0.03 81 0.019&#b1;0.01 b 5 0.121&#b1;0.035 a 30 G178R 0.59&#b1;0.11 103 0.66&#b1;0.08 116 0.005&#b1;0.001 b 1 0.228&#b1;0.022 a 57 S549N 0.55&#b1;0.02 97 0.61&#b1;0.02 108 0.003&#b1;0.010 b 1 0.396&#b1;0.119 a 99 S549R 0.45&#b1;0.01 b 79 0.55&#b1;0.02 a 96 0.004&#b1;0.010 b 1 0.143&#b1;0.031 a 36 G551S 0.57&#b1;0.13 100 0.64&#b1;0.02 113 0.010&#b1;0.001 b 3 0.337&#b1;0.110 a 84 G970R 0.55&#b1;0.03 96 0.55&#b1;0.03 97 0.001&#b1;0.001 b 0 0.245&#b1;0.042 a 61 G1244E 0.44&#b1;0.11 77 0.54&#b1;0.08 94 0.011&#b1;0.010 b 3 0.470&#b1;0.122 a 118 S1251N 0.54&#b1;0.07 95 0.63&#b1;0.04 111 0.003&#b1;0.010 b 1 0.350&#b1;0.03 a 88 S1255P 0.70&#b1;0.03 b 122 0.71&#b1;0.02 125 0.018&#b1;0.016 b 5 0.468&#b1;0.168 a 117 G1349D 0.49&#b1;0.08 85 0.63&#b1;0.06 111 0.019&#b1;0.015 b 5 0.315&#b1;0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation.
X
ABCC7 p.Ser549Asn 22293084:129:445
status: NEW145 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D.
X
ABCC7 p.Ser549Asn 22293084:145:240
status: NEW
PMID: 22427236
[PubMed]
Rosendahl J et al: "CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?"
No.
Sentence
Comment
72
The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A.
X
ABCC7 p.Ser549Asn 22427236:72:291
status: NEW69 The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A.
X
ABCC7 p.Ser549Asn 22427236:69:291
status: NEW
PMID: 22137130
[PubMed]
Cordovado SK et al: "CFTR mutation analysis and haplotype associations in CF patients."
No.
Sentence
Comment
101
CFTR mutation 1 Gene location CFTR mutation 2 Gene location CFTR mutation 3 Gene location S549N Ex12 3120+1G→A Intron 18 -102T→A Promoter F508del Ex11 G542X Ex12 185+4A→T Intron1 F508del Ex11 F508del Ex11 I1027T Ex19 F508del Ex11 W1282X Ex23 I1027T Ex19 only by the number of repeats of the IVS8CA microsatellite; 32 chromosomes contained 17 repeats and 29 chromosomes contained 23 repeats.
X
ABCC7 p.Ser549Asn 22137130:101:90
status: NEW
PMID: 22256939
[PubMed]
Massie RJ et al: "Lessons learned from 20 years of newborn screening for cystic fibrosis."
No.
Sentence
Comment
30
Where possible, all patients with a diagnosis of CF had further CFTR mutation analysis performed in an attempt to clarify the genotype (p.A455E, p.S549N, p.R347H, p.R1162X, p.R347P, p.R334W, p.R117H).
X
ABCC7 p.Ser549Asn 22256939:30:147
status: NEW
PMID: 21843195
[PubMed]
Nathan AM et al: "First study of the F508del mutation in Malaysian children diagnosed with cystic fibrosis."
No.
Sentence
Comment
48
Letters to the Editor Journal of Paediatrics and Child Health 47 (2011) 572-575 (c) 2011 The Authors Journal of Paediatrics and Child Health (c) 2011 Paediatrics and Child Health Division (Royal Australasian College of Physicians) Table1Summaryoftheclinicalcharacteristics,sweattestresultsandcysticfibrosistransmembraneconductanceregulatormutationstudiesofthepatientsdiagnosedwithcysticfibrosisinUniversity MalayaMedicalCenterfrom2000to2009 PatientAgeat presentation PresentingsymptomsOtherfindingsConsanguinityRaceSweatconductivity (mmol/l) KS score Mutations Rin3monthsRecurrentpneumoniaandFTTPseudo-Bartter`ssyndromeYesIndian13440†Nonedetected Nes8yearsSeverepersistentasthmaFTTNoIndian12450F508del/unknown Abd4monthsSeverepneumoniaandventilator dependent FTTYesYemeni11730F508del/F508del Ben7yearsCirrhosisoftheliverwithportal hypertension FTTUnknown(adopted)Unknown14080†Nonedetected(7T polymorphism) Sak3monthsRecurrentpneumoniaandFTTNDYesIndian11350F508del/F508del Ngan3yearsPseudo-Bartter`ssyndromeNDNoChinese13790Notdone(parentsrefused) LJH5monthsPseudo-Bartter`ssyndromeRecurrentpneumoniaNoChinese/Indonesian9465F508delnegative Josh5monthsPseudo-Bartter`ssyndromeandFTTNDNoIndian8585†Nonedetected Nur3monthsChronicdiarrhoeaandFTTPseudo-Bartter`ssyndromeNoMalay/Chinese13085‡†R553X/nonedetected Vin4monthsRecurrentpneumoniaandFTTNDNoChinese12260F508delnegative Muh5yearsPoorlycontrolledasthmaNDNoMalay10765F508delnegative Naz3monthsFTTandsteatorrhoeaRecurrentlunginfectionsand pseudo-Bartter`s NoMalay14675F508delnegative Additionalmutationsscreenedinthefourpatients:†F508del,I506/7del,G551D,G542X,R553X,R117C,R117H,621+1G>T,V520F,A455E,N1303K,3849+10kbC>T.‡R334W,R347P,A455E,S549N,R560T, 3659delC,W1282X.FTT,failuretothrive;KS,Schwachman-Kulczycki(KS)score;ND,nodata.
X
ABCC7 p.Ser549Asn 21843195:48:1736
status: NEW
PMID: 21966101
[PubMed]
Prasad R et al: "Molecular basis of cystic fibrosis disease: an Indian perspective."
No.
Sentence
Comment
98
25 mutation Table 2 CFTR mutation identified in Indian population with classical CF [25] Genotype No. of subjects Delta F508/Delta F508 5 Delta F508/3849?10kb C-T 1 Delta F508/S549 2 Delta F508/Y138H 1 Delta F508/15251G-A 1 V520F/R117H 2 1530L/1530L 1 876-6del4/876-6del4 1 1792insA/1792insA 1 3986-3987delC/3986-3987delC 1 Delta F508/U 10 1161delC/U 2 L69H/U 1 R117H/U 1 Q493L/U 1 Y517C/U 1 S549N/U 3 G551D/U 1 E1329Q/U 1 N1303K/U 1 Y1381H/U 1 L218X/U 1 R553X/U 1 1525-1G-A/U 3 3120?1G-A/U 2 3849?10kbC-T/U 2 U/U 1 U unidentified panel were detected in our population at a combined frequency of (10%).
X
ABCC7 p.Ser549Asn 21966101:98:392
status: NEW99 The other seven known but rare mutations (1161delC, Y517C, V520F, S549N, Y1381H, L218X and 1525-1G-A) were identified at a combined frequency of (17%), and eight new mutations (3986delC, 1792InsA, L69H, S158N, Q493L, I530L, E1329Q and 876-8del4) identified in our CF population represented (15%) of the total CF alleles analyzed.
X
ABCC7 p.Ser549Asn 21966101:99:66
status: NEW100 Substitution mutation, S549N and splice site mutation, 1525-1G-A were the two most common mutations identified with a frequency of (4%) followed by another splice site mutation 3849?10kbC-T (3%).
X
ABCC7 p.Ser549Asn 21966101:100:23
status: NEW
PMID: 22439061
[PubMed]
Mesoraca A et al: "The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis."
No.
Sentence
Comment
100
48 Journal of Prenatal Medicine 2010; 4 (3): 45-50 Table III Mutations found with II level screening through DHPLC Mutations of mutated alleles DF508 29 W1282X 3 N1303K 8 1717-1G®A 2 3659delC 1 G85E 1 2789 +5G®A 2 R553X 2 R1162X 1 R117H 1 G542X 3 Total 53Table I Mutations found through I level screeningMutations analysed with I level screening through OLA CFTR Mutations Position on the CFTR gene DF508 Exon 10 3849+10KbC®T Intron 19 R334W Exon 7 W1282X Exon 10 V520F Exon 10 3905insT Exon 20 N1303K Exon 21 3876delA Exon 20 1717-1G®A Exon 11 3659delC Exon 19 DI507 Exon 10 A455E Exon 9 G85E Exon 3 2789 +5G®A Exon 14 / Intron 14 2183AA®G Exon 13 1898+1G®A Exon 12 / Intron 12 R347P Exon 7 R347H Exon 7 R560T Exon 11 1078delT Exon 7 R553X Exon 11 711+1G®T Exon 5 / Intron 5 G551D Exon 11 R1162X Exon 19 S549R Exon 11 R117H Exon 4 S549N Exon 11 621+1G®T Exon 4 G542X Exon 11 394delTT Exon 3 3120+1G®ðA Exon 16/ Intron 16 2184delA Exon 13 Table II Mutations found through I level screening Mutations Positions on CFTR gene R1066C Exon 17 b L1065P Exon 17 b A1006E Exon 19 R75Q Exon 3 D537E Exon 11 W1134X Exon 18 W1145X Exon 18 L1077P Exon 17b C524X Exon 11 Total 9 The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis Journal of Prenatal Medicine 2010; 4 (3): 45-50 49 tion was to provide the couple with adequate counselling in order to better understand the genotype-phenotype correlation in the various associations of mutations.
X
ABCC7 p.Ser549Asn 22439061:100:865
status: NEWX
ABCC7 p.Ser549Asn 22439061:100:872
status: NEW
PMID: 18243066
[PubMed]
Ratbi I et al: "Cystic fibrosis carrier frequency and estimated prevalence of the disease in Morocco."
No.
Sentence
Comment
27
We screened for 32 CFTR gene mutations (G85E, 394delTT, R117H, 621+1GNT, 711+1GNT, R334W, R347P, R347H, 1078delT, A455E, I507del, F508del, V520F, 1717-1GNA, G542X, G551D, R553X, R560T, S549R(TNG), S549N, 1898+1GNA, 2183AANG, 2184delA, 2789+5GNA, 3120 + 1G NA, R1162X, 3659delC, 3849 + 10kbC NT, W1282X, 3905insT, 3876delA, N1303K) and the (T)5 splicing variant of intron 8, using a commercial kit (CF v3 Genotyping Assay, Abbott, Rungis, France).
X
ABCC7 p.Ser549Asn 18243066:27:197
status: NEW
PMID: 18456578
[PubMed]
Castellani C et al: "Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice."
No.
Sentence
Comment
1236
Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations.
X
ABCC7 p.Ser549Asn 18456578:1236:86
status: NEW1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations.
X
ABCC7 p.Ser549Asn 18456578:1239:86
status: NEW
PMID: 17716958
[PubMed]
Shastri SS et al: "Characterisation of mutations and genotype-phenotype correlation in cystic fibrosis: experience from India."
No.
Sentence
Comment
6
In addition, c.3849+10 kb CNT, c.1161delC, and p.S549N were identified in two patients each and p. R352Q, p.R1158X and p.R75Q were identified in one patient each.
X
ABCC7 p.Ser549Asn 17716958:6:49
status: NEW11 Conclusions: A strategy for mutation screening for CF in India must involve testing for p.F508del followed by c.1161delC, c.3849+10 kb CNT and p.S549N.
X
ABCC7 p.Ser549Asn 17716958:11:145
status: NEW79 Three other mutations, c.3849+10 kb CNT, c.1161delC and p.S549N were seen in two patients each.
X
ABCC7 p.Ser549Asn 17716958:79:58
status: NEW82 SSCP/HA SSCP/HA identified at least one mutation in exons 3, 4, 7, 11 and 19 viz. p.R75Q in exon 3, p.G149X in exon 4, c.1161delC, p.R352Q and c.1002-7_1002-5delTTT in exon 7, p.S549N in exon 11 and p.R1158X in exon 19.
X
ABCC7 p.Ser549Asn 17716958:82:178
status: NEW124 1 p.[S549N]+[?]
X
ABCC7 p.Ser549Asn 17716958:124:5
status: NEW162 This should be followed by screening for the other three common mutations, p.S549N, c.3849+10 kb CNT and c.1161delC identified in this study.
X
ABCC7 p.Ser549Asn 17716958:162:77
status: NEW
PMID: 16049310
[PubMed]
Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."
No.
Sentence
Comment
51
Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS.
X
ABCC7 p.Ser549Asn 16049310:51:3000
status: NEW73 Genomic DNA Samples Used for Mutation Evaluation on the APEX Array Mutations validated with native DNA CFTRdel 2,3 (21 kb) 394delTT G85E R75X 574delA Y122X R117C R117H 621 ϩ 1GϾT 621 ϩ 3AϾG 711 ϩ 1GϾT I336K R334W R347P IVS8-5T IVS8-7T IVS8-9T A455E ⌬F508 ⌬I507 1677delTA 1717 - 1GϾA G542X G551D R553X R560T S549N 1898 ϩ 1GϾA 1898 ϩ 1GϾC 2183AAϾG 2043delG R668C 2143delT 2184delA 2184insA 2789 ϩ 5GϾA S945L 3120 ϩ 1GϾA I1005R 3272 - 26AϾG R1066C G1069R Y1092X (CϾA) 3500 - 2AϾT R1158X R1162X 3659delC S1235R 3849 ϩ 10 kb CϾT W1282X primer.
X
ABCC7 p.Ser549Asn 16049310:73:363
status: NEW85 Mutations include several prominent in non-Caucasian backgrounds, including N1303K, 3849 ϩ 10 kb, 2789 ϩ 5GϾA, 3876delA, 406-1GϾA, R75X, 2055delGϾA, and S549N, which are each prevalent in the Hispanic popu- Figure 1.
X
ABCC7 p.Ser549Asn 16049310:85:183
status: NEW
PMID: 15858154
[PubMed]
Schrijver I et al: "Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum."
No.
Sentence
Comment
103
Table 1. Continued Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) R1070W 1 0.55 0.19 R1158X 1 0.55 0.19 R1438W 1 0.55 0.19 R334W 2 1.09 0.39 R352W 1 0.55 0.19 R553X 2 1.09 0.39 R668C 2 1.09 0.39 R74W 3 1.64 0.58 R75X 3 1.64 0.58 S1235R 2 1.09 0.39 S492F 2 1.09 0.39 S549N 1 0.55 0.19 S573CS573C 1 0.55 0.19 S945L 1 0.55 0.19 T351S 1 0.55 0.19 T501A 2 1.09 0.39 T604ST604S 1 0.55 0.19 V11I 1 0.55 0.19 V201 mol/L 1 0.55 0.19 V232D 2 1.09 0.39 V754 mol/L 1 0.55 0.19 W1089X 2 1.09 0.39 W1098C 1 0.55 0.19 W1204X 4 2.19 0.78 Y563N 1 0.55 0.19 Y913XY913X 1 0.55 0.19 85 different mutations 183 100.00 35.60 Novel variants are in boldface, mutations on the ACMG/ACOG panel are italicized.
X
ABCC7 p.Ser549Asn 15858154:103:333
status: NEW171 Mutations R75X, 935delA, S549N, W1204X, and R334W were present at a relative frequency of 1.3%, and 12 additional mutations were each represented at a frequency of 1% of detected mutations (Table 3).
X
ABCC7 p.Ser549Asn 15858154:171:25
status: NEW187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent.
X
ABCC7 p.Ser549Asn 15858154:187:285
status: NEW199 The pooled data set demonstrates that the most frequently seen mutations are: ⌬F508, G542X, 406-1GϾA, W1204X, R75X, 2055del9ϾA, 3876delA, ⌬I507, S549N, I148T, N1303K, 935delA, and 3849 ϩ 10kbCϾT.
X
ABCC7 p.Ser549Asn 15858154:199:171
status: NEW201 Comparison of Relative Frequencies of CFTR Sequence Variants in Comprehensive CFTR Studies in US and Mexican Hispanics This study % Orozco 2000 % US/ Mexican % deltaF508 28.96 54.48 43.72 G542X 3.83 8.28 5.19 406 - 1GϾA 3.28 2.07 2.38 W1204X 2.19 Ͻ1 1.08 R74W 1.64 Ͻ1 R75X 1.64 2.07 1.51 H199Y 1.64 Ͻ1 Ͻ1 L206W 1.64 Ͻ1 L997F 1.64 Ͻ1 I1027T 1.64 Ͻ1 2055del9ϾA 1.64 1.38 1.27 D1270N 1.64 Ͻ1 E116K 1.09 Ͻ1 V232D 1.09 Ͻ1 R334W 1.09 Ͻ1 S492F 1.09 Ͻ1 T501A 1.09 Ͻ1 R553X 1.09 Ͻ1 Ͻ1 E588V 1.09 Ͻ1 R668C 1.09 Ͻ1 Q890X 1.09 Ͻ1 W1089X 1.09 Ͻ1 S1235R 1.09 Ͻ1 D1445N 1.09 Ͻ1 3876delA 1.09 3.24 1717 - 8GϾA 1.09 Ͻ1 3272 - 26AϾG 1.09 Ͻ1 A1009T 1.09 Ͻ1 deltaI507 Ͻ1 3.45 1.30 S549N Ͻ1 3.45 1.95 G567A Ͻ1 Ͻ1 I148T 2.07 1.08 I506T 1.38 Ͻ1 N1303K 2.76 1.08 935delA 1.38 1.30 2183AAϾG 1.38 Ͻ1 3199del6 1.38 Ͻ1 3849 ϩ 10kbCϾT Ͻ1 1.30 ACMG/ACOG italicized.
X
ABCC7 p.Ser549Asn 15858154:201:835
status: NEW204 Some of the disparity in mutation detection between Caucasians and Hispanics could be alleviated by adding at least seven additional mutations to the currently recommended ACOG/ACMG panel of 25 mutations: 406-1GϾA, W1204X, R75X, 2055del9ϾA, 3876delA, S549N, and 935delA (Table 4).
X
ABCC7 p.Ser549Asn 15858154:204:263
status: NEW221 For carrier screening of Hispanic patients, inclusion of additional mutations with significant frequency in the Hispanic CF population (especially 406-1GϾA, W1204X, R75X, 2055del9ϾA, 3876delA, S549N, and 935delA) may be helpful to supplement the ACMG/ACOG panel.
X
ABCC7 p.Ser549Asn 15858154:221:205
status: NEW
PMID: 16156102
[PubMed]
Dunbar SA et al: "Rapid screening for 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator gene by Lminex xMAP suspension array."
No.
Sentence
Comment
119
Coriell Cell Repositories, NA12960 ΔI507/R347P Patient sample G551D/R347P Coriell Cell Repositories, NA12785 621+1G→T/711+1G→T Coriell Cell Repositories, NA11280 621+1G→T/G85E Coriell Cell Repositories, NA11282 3849+10kbC→T/3849+10kbC→T Coriell Cell Repositories, NA11860 A455E/normal Patient sample 621+1G→T/A455E Coriell Cell Repositories, NA11290 R1162X/normal Coriell Cell Repositories, NA12585 ΔF508/3659delC Coriell Cell Repositories, NA11275 2789+5G→A/2789+5G→A Coriell Cell Repositories, NA11859 2184delA/normal Patient sample 1898+1G→A/normal Patient sample 621+1G→T/3120+1G→A Coriell Cell Repositories, NA07441 3120+1G→A/3120+1G→A Patient sample F508C/normal Coriell Cell Repositories, NA13033 I506V/normal Coriell Cell Repositories, NA13032 R347H/normal Patient sample ΔF508/3120G→A Patient sample S549N/normal Patient sample S549R/normal Patient sample CFTR, cystic fibrosis transmembrane conductance regulator gene.
X
ABCC7 p.Ser549Asn 16156102:119:925
status: NEW
No.
Sentence
Comment
118
of patients with IGT 2 10 2 0 0 1/1 16 No of patients with CFRD without FH 0 4 0 0 0 0 4 *Genotype class based on mutation with ∆F508: Class I, 621+1G→T, G542X, 441delA, R553X, W1282X, 3120+1G→A, 4016insT, 1154insTC, I1027T; Class II, ∆F508; Class III, G551D, G85E, S549N, L1077P, H199R; Class IV, Class V, 3849+10kbC→T, 5T; Unknown, G85E/-, ∆F508/-; Other, G551D/R506T, W1282X/W1282X.
X
ABCC7 p.Ser549Asn 12584532:118:290
status: NEW
No.
Sentence
Comment
34
The isolated DNA from each patient was amplified by polymerase chain reaction (PCR) using a kit for reverse dot blot detection of 16 common CF mutations: ⌬F508, R553X, G542X, G551D, N1303K, W1282X, R117H, R334W, R347P, A455E, ⌬I507, 1717-1 G>A, R560T, 3849+10kb C>T, 621+1 G>T, S549N [Villalobos-Torres et al., 1997].
X
ABCC7 p.Ser549Asn 10766983:34:292
status: NEW45 In addition to these alleles, only three other CF mutations were detected: 621+1 G>T, S549N, and W1282X.
X
ABCC7 p.Ser549Asn 10766983:45:86
status: NEW57 The three additional mutations found (W1282X, 621+1G>T, and S549N) represent only 1.5% of the CF allele occurrence in this analysis.
X
ABCC7 p.Ser549Asn 10766983:57:60
status: NEW62 Frequencies and (Chromosome Number) of CF Mutations Detected in Three Latin American Countries CF mutation Mexico % (90) Colombia % (48) Venezuela % (54) Total % (192) ⌬F508 47.8 (43) 35.4 (17) 29.6 (16) 39.6 (76) G542X 4.4 (4) 6.3 (3) 3.7 (2) 4.7 (9) N1303K 1.1 (1) 2.1 (1) 0.0 (0) 1.0 (2) 3849 + 10kb C > T 2.2 (2) 0.0 (0) 0.0 (0) 1.0 (2) W1282X 0.0 (0) 2.1 (1) 0.0 (0) 0.5 (1) 621 + 1 G > T 1.1 (1) 0.0 (0) 0.0 (0) 0.5 (1) S549N 1.1 (1) 0.0 (0) 0.0 (0) 0.5 (1) Non-⌬F508a 10.0 (9) 10.4 (5) 3.7 (2) 8.3 (16) Unknown 42.2 (38) 54.2 (26) 66.7 (36) 52.1 (100) a Detected with the 16 CF mutation panel in this study.
X
ABCC7 p.Ser549Asn 10766983:62:433
status: NEW
PMID: 10923036
[PubMed]
Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."
No.
Sentence
Comment
107
f 306insA, W79X, R117C, P205S, L227R, I336K, 1248+1G>A, 1609delCA, 1717-8G>A, S549R(T>G), S549N, 1812-1G>A, P574H, 2176insC, R709X, E827X, D836Y, 3007delG, L1065P, L1077P, H1085R, M1101K, 4021insT.
X
ABCC7 p.Ser549Asn 10923036:107:90
status: NEW
PMID: 10862085
[PubMed]
Ellis LA et al: "A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning."
No.
Sentence
Comment
97
Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE.
X
ABCC7 p.Ser549Asn 10862085:97:1274
status: NEW135 Effect of Amplicon Size on Mutation Detection Rate in ABCC7 Exon 11 SSCP slab gels SSCP 310 DHPLC 49:1, 20°C MDE, 20°C 35°C Exon 11 ABCC7 190bp 490bp 190bp 490bp 190bp 490bp 190bp 490bp 1717-1G>A - - + + + + + + G542X + + + + + - + + S549N + + + + + + - - S549R + + - + + + + - G551D - + + + - - + - R553X + + + + + + + - G551D/R553X + + + + + + + - R560T + - - + - - + + R560K + + + + - - + + 1811+1G>C + + + + + + + + Sensitivity 9/10 8/10 8/10 10/10 7/10 6/10 9/10 5/10 ammonium acetate as an ion-pairing agent has the unintended consequence of modifying the stability of GC and AT base pairs in a similar manner to the effects of tetra-alkyl ammonium salts, tetraethyl ammonium chloride and tetramenthyl ammonium chloride.
X
ABCC7 p.Ser549Asn 10862085:135:249
status: NEW158 This analysis was carried out for ABCC7 exon 11 (190 bp version) and the mutation which could not be detected (S549N) in our study was undetectable at the temperature predicted by Melt or at 2°C above this temperature.
X
ABCC7 p.Ser549Asn 10862085:158:111
status: NEW
PMID: 9674722
[PubMed]
Schwiebert EM et al: "Cystic fibrosis: a multiple exocrinopathy caused by dysfunctions in a multifunctional transport protein."
No.
Sentence
Comment
223
They include another deletion mutation at amino acid position 507 (⌬I507), several missense mutations (F508C, G551D, G551S, A455E, R553Q, P574H, S549N, A559T), and some nonsense mutations (G542X, R553X, Q493X).
X
ABCC7 p.Ser549Asn 9674722:223:152
status: NEW
PMID: 9499426
[PubMed]
Mickle JE et al: "A mutation in the cystic fibrosis transmembrane conductance regulator gene associated with elevated sweat chloride concentrations in the absence of cystic fibrosis."
No.
Sentence
Comment
151
Mutation analysis Total genomic DNA was assayed for 16 common CFTR mutations (R117H, 621+1G→T, R334W, R349P, A455E, 1717-1G→A, ∆I507, ∆F508, G542X, S549N, G551D, R553X, R560T, 3849+10 kb C→T, W1282X, N1303K) by reverse dot-blot hybridization (46).
X
ABCC7 p.Ser549Asn 9499426:151:176
status: NEW152 Mutation analysis Total genomic DNA was assayed for 16 common CFTR mutations (R117H, 621+1GT, R334W, R349P, A455E, 1717-1GA, ࢞I507, ࢞F508, G542X, S549N, G551D, R553X, R560T, 3849+10 kb CT, W1282X, N1303K) by reverse dot-blot hybridization (46).
X
ABCC7 p.Ser549Asn 9499426:152:172
status: NEW
PMID: 9521595
[PubMed]
Onay T et al: "Analysis of the CFTR gene in Turkish cystic fibrosis patients: identification of three novel mutations (3172delAC, P1013L and M1028I)."
No.
Sentence
Comment
26
Other frequent mutations, namely G542X, R560T, S549N or S549I and G551D or R553X, were analysed by the multiplex ARMS method combined with restriction enzyme analysis (Dean et al. 1990; Cutting et al. 1990; Ferrie et al. 1992).
X
ABCC7 p.Ser549Asn 9521595:26:47
status: NEW
PMID: 9376123
[PubMed]
Berguerand M et al: "Differential stimulation of cytosolic phospholipase A2 by bradykinin in human cystic fibrosis cell lines."
No.
Sentence
Comment
25
Abbreviations: arachidonic acid, AA; cystic fibrosis, CF; cystic fibrosis transmembrane conductance regulator, CFTR; cystic fibrosis cell line presenting two minor mutations S549N and N1303K, CFT-1; cystic fibrosis cell line presenting ⌬F508 mutation, CFT-2; enhanced chemiluminescence, ECL; (1,4,5)-inositol triphosphate, IP3; normal cell line, NT-1; phospholipase A2, PLA2; phospholipase C, PLC; phenylmethylsulfonyl fluoride, PMSF; tetradecanoyl phorbol acetate, TPA.
X
ABCC7 p.Ser549Asn 9376123:25:174
status: NEW43 We have examined the mechanism by which the ⌬F508 CFTR mutation affects AA release by comparing the coupling of bradykinin receptors to the activation of PLC and PLA2 in a ⌬F508 tracheal epithelial cell line, a double heterozygote cell line (S549N, N1303K), and in a control cell line.
X
ABCC7 p.Ser549Asn 9376123:43:242
status: NEWX
ABCC7 p.Ser549Asn 9376123:43:256
status: NEW68 Three cell lines were studied: a control cell line (NT-1), a CF cell line carrying the homozygous mutation ⌬F508 of CFTR (CFT-2) and a CF cell line carrying a double heterozygous mutation S549N and N1303K (CFT-1).
X
ABCC7 p.Ser549Asn 9376123:68:198
status: NEW117 Results Cytosolic PLA2 Activity Specific for AA in Epithelial Cystic Fibrosis Cell Lines We have shown that an epithelial ⌬F508 cell line (CFT-2) releases more AA in response to bradykinin than do the control epithelial cell line (NT-1), or a CF epithelial cell line bearing the double heterozygous mutation S549N and N1303K (CFT-1).
X
ABCC7 p.Ser549Asn 9376123:117:315
status: NEWX
ABCC7 p.Ser549Asn 9376123:117:479
status: NEW176 The maximal concentration in ⌬F508 epithelial cells was 3 times greater than in the control cells or in S549N-N1303K CF cells (Figure 5).
X
ABCC7 p.Ser549Asn 9376123:176:104
status: NEWX
ABCC7 p.Ser549Asn 9376123:176:111
status: NEW67 Three cell lines were studied: a control cell line (NT-1), a CF cell line carrying the homozygous mutation DF508 of CFTR (CFT-2) and a CF cell line carrying a double heterozygous mutation S549N and N1303K (CFT-1).
X
ABCC7 p.Ser549Asn 9376123:67:191
status: NEW
PMID: 9164776
[PubMed]
Gregg RG et al: "Newborn screening for cystic fibrosis in Wisconsin: comparison of biochemical and molecular methods."
No.
Sentence
Comment
52
Polyacrylamide gel electrophoresis of PCR-amplified DNA served to identify the ⌬F508 mutation.14 Mutations S549N, R553X, and G551D were screened by PCR amplification of exon 11, followed by restriction enzyme digests that are diagnostic of each mutation.
X
ABCC7 p.Ser549Asn 9164776:52:114
status: NEW123 Tested) Frequency (%) Theoretical Cumulative Detection† (%) Patients Missed in One Year‡ ⌬F508§ 513/720 71.25 91.74 1.32 G542X 17/162 3.02 93.38 1.05 W1282X 7/102 1.97 94.36 0.90 R117H 6/101 1.71 95.14 0.77 R553X 11/197 1.61 95.82 0.66 G551D 9/195 1.33 96.35 0.58 N1303K 3/100 0.86 96.67 0.53 1717 - 1G 3 A 2/99 0.58 96.88 0.49 R560T 2/106 0.54 97.06 0.47 621 ϩ 1G 3 T 3/163 0.53 97.25 0.44 S549N 0/196 0.0 97.25 0.44 * Chromosomes were analyzed on blood or cheek cell specimens obtained from 360 patients (80% of the total Wisconsin CF population), all of whom had a positive sweat test.
X
ABCC7 p.Ser549Asn 9164776:123:423
status: NEW152 DNA Analysis of Genotyped CF Patients in the US* n Percent ⌬F508 12701 67.7 G542X 403 2.2 G551D 357 1.9 W1282X 240 1.3 N1303K 223 1.2 R553X 157 0.8 3849 ϩ 10kbC 3 T 102 0.5 621 ϩ 1G 3 T 147 0.8 1717 - 1G 3 A 101 0.5 R117H 101 0.5 R334W 36 0.2 ⌬I507 42 0.2 R347P 37 0.2 R560T 23 0.1 R1162X 44 0.2 2789 ϩ 5G 3 A 25 0.1 A455E 16 0.1 3120 ϩ IG 3 A 14 0.0 S549N 12 0.0 711 ϩ IG 3 T 9 0.0 Other 178 0.9 Unidentified 3814 20.3 Total 18782 99.7† Patient Genotypes Allele 1/Allele 2 n % of Genotype ⌬F508/⌬F508 4573 48.7 ⌬F508/Known 1511 16.1 ⌬F508/Unknown 2044 21.8 Known/unknown 310 3.3 Known/known 223 2.4 Unknown/unknown 730 7.8 Total 9391 100.0 *Data from Cystic Fibrosis Registry, 1995; Annual Report.
X
ABCC7 p.Ser549Asn 9164776:152:389
status: NEW47 Polyacrylamide gel electrophoresis of PCR-amplified DNA served to identify the DF508 mutation.14 Mutations S549N, R553X, and G551D were screened by PCR amplification of exon 11, followed by restriction enzyme digests that are diagnostic of each mutation.
X
ABCC7 p.Ser549Asn 9164776:47:107
status: NEW118 Tested) Frequency (%) Theoretical Cumulative Detectionߤ (%) Patients Missed in One Yearߥ DF508&#a7; 513/720 71.25 91.74 1.32 G542X 17/162 3.02 93.38 1.05 W1282X 7/102 1.97 94.36 0.90 R117H 6/101 1.71 95.14 0.77 R553X 11/197 1.61 95.82 0.66 G551D 9/195 1.33 96.35 0.58 N1303K 3/100 0.86 96.67 0.53 1717 2 1G 3 A 2/99 0.58 96.88 0.49 R560T 2/106 0.54 97.06 0.47 621 1 1G 3 T 3/163 0.53 97.25 0.44 S549N 0/196 0.0 97.25 0.44 * Chromosomes were analyzed on blood or cheek cell specimens obtained from 360 patients (80% of the total Wisconsin CF population), all of whom had a positive sweat test.
X
ABCC7 p.Ser549Asn 9164776:118:407
status: NEW147 DNA Analysis of Genotyped CF Patients in the US* n Percent DF508 12701 67.7 G542X 403 2.2 G551D 357 1.9 W1282X 240 1.3 N1303K 223 1.2 R553X 157 0.8 3849 1 10kbC 3 T 102 0.5 621 1 1G 3 T 147 0.8 1717 2 1G 3 A 101 0.5 R117H 101 0.5 R334W 36 0.2 DI507 42 0.2 R347P 37 0.2 R560T 23 0.1 R1162X 44 0.2 2789 1 5G 3 A 25 0.1 A455E 16 0.1 3120 1 IG 3 A 14 0.0 S549N 12 0.0 711 1 IG 3 T 9 0.0 Other 178 0.9 Unidentified 3814 20.3 Total 18782 99.7ߤ Patient Genotypes Allele 1/Allele 2 n % of Genotype DF508/DF508 4573 48.7 DF508/Known 1511 16.1 DF508/Unknown 2044 21.8 Known/unknown 310 3.3 Known/known 223 2.4 Unknown/unknown 730 7.8 Total 9391 100.0 *Data from Cystic Fibrosis Registry, 1995; Annual Report.
X
ABCC7 p.Ser549Asn 9164776:147:351
status: NEW
PMID: 9150159
[PubMed]
Macek M Jr et al: "Identification of common cystic fibrosis mutations in African-Americans with cystic fibrosis increases the detection rate to 75%."
No.
Sentence
Comment
39
Mutation Analysis All patients were screened for the AF508 mutation and 15 common Caucasian CF mutations using a reverse dot strip hybridization system (Kawasaki et al. 1993) (R117H, 621+1G--T, R334W, R347P, A455E, A1507, 1717-1G-+A, G542X, S549N, GSS1D, R553X, R560T, 3849+10kbC-+T, W1282X, and N1303K) (Welsh et al. 1995) and a deep intron 11 splice-site mutation, 1811+1.6kbA-+G (Chillon et al. 1995).
X
ABCC7 p.Ser549Asn 9150159:39:241
status: NEW70 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al.
X
ABCC7 p.Ser549Asn 9150159:70:139
status: NEW86 The most common muta- Table 2 Distribution of CF Mutations in African-American and U.S.-Caucasian CF Patients African-American U.S. Caucasiana Mutation (n= 148) % (n = 8,714) % Caucasian mutations: AF508 71 48 5,769 66.2 R117H 0 0 47 .5 621+1 G--T 0 0 68 .8 R334W 1 .7 7 .1 R347P 0 0 24 .3 A455E 0 0 5 .1 AI507 1 .7 10 .1 1717-1 G-IA 1 .7 39 .5 G542X 1 .7 204 2.3 S549N 1 .7 4 .1 GS51D 1 .7 173 2.0 R553X (Caucasian)b 0 0 87 1.0 R560T 0 0 16 .2 3849+10kb C-T 0 0 51 .6 W1282X 0 0 235 2.7 N1303K 0 0 116 1.3 Subtotal 77 52 6,855 78.7 African-American mutations: 405+3 A-C 2 1.4 ... ... 444delA 1 .7 ... ... G480C 2 1.4 ... ... R553X (African)b 3 2.0 ... ... A559T 3 2.0 ... ... 2307insA 3 2.0 ... ... 3120+1 GC-A 18 12.2 ... ... S1255X 2 1.4 ... ... Subtotal 34 23 ... ... Total 111 75.0 6,855 78.7 NOTE.-Percentages are rounded.
X
ABCC7 p.Ser549Asn 9150159:86:367
status: NEW40 Mutation Analysis All patients were screened for the AF508 mutation and 15 common Caucasian CF mutations using a reverse dot strip hybridization system (Kawasaki et al. 1993) (R117H, 621+1G--T, R334W, R347P, A455E, A1507, 1717-1G-+A, G542X, S549N, GSS1D, R553X, R560T, 3849+10kbC-+T, W1282X, and N1303K) (Welsh et al. 1995) and a deep intron 11 splice-site mutation, 1811+1.6kbA-+G (Chillon et al. 1995).
X
ABCC7 p.Ser549Asn 9150159:40:241
status: NEW71 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al.
X
ABCC7 p.Ser549Asn 9150159:71:139
status: NEW87 The most common muta- Table 2 Distribution of CF Mutations in African-American and U.S.-Caucasian CF Patients African-American U.S. Caucasiana Mutation (n= 148) % (n = 8,714) % Caucasian mutations: AF508 71 48 5,769 66.2 R117H 0 0 47 .5 621+1 G--T 0 0 68 .8 R334W 1 .7 7 .1 R347P 0 0 24 .3 A455E 0 0 5 .1 AI507 1 .7 10 .1 1717-1 G-IA 1 .7 39 .5 G542X 1 .7 204 2.3 S549N 1 .7 4 .1 GS51D 1 .7 173 2.0 R553X (Caucasian)b 0 0 87 1.0 R560T 0 0 16 .2 3849+10kb C-T 0 0 51 .6 W1282X 0 0 235 2.7 N1303K 0 0 116 1.3 Subtotal 77 52 6,855 78.7 African-American mutations: 405+3 A-C 2 1.4 ... ... 444delA 1 .7 ... ... G480C 2 1.4 ... ... R553X (African)b 3 2.0 ... ... A559T 3 2.0 ... ... 2307insA 3 2.0 ... ... 3120+1 GC-A 18 12.2 ... ... S1255X 2 1.4 ... ... Subtotal 34 23 ... ... Total 111 75.0 6,855 78.7 NOTE.-Percentages are rounded.
X
ABCC7 p.Ser549Asn 9150159:87:367
status: NEW
PMID: 9098486
[PubMed]
Villalobos-Torres C et al: "Analysis of 16 cystic fibrosis mutations in Mexican patients."
No.
Sentence
Comment
58
Mutations N1303K, S549N and 621 + 1 G→T had same frequency (1.25%) which was the lowest detected in our sample.
X
ABCC7 p.Ser549Asn 9098486:58:18
status: NEW60 Mutation Frequency Data and Geographic Distribution of the Mutations Found in 80 Chromosomes From Mexican CF Patients Mutation Northeast n ס 54 Central n ס 16 Western n ס 10 Total n ס 80 CFGAC [1994] (%)n (%) n (%) n (%) n (%) ⌬F508 27 (50) 2 (12.5) 7 (70) 36 (45) 66 G542X 2 (3.7) 2 (12.5) 0 4 (5) 2.4 3849 + 10 kb C→T 1 (1.9) 0 1 (10) 2 (2.5) 0.2 N1303K 0 1 (6.25) 0 1 (1.25) 1.3 S549N 0 1 (6.25) 0 1 (1.25) 0.1 621 + 1 G→T 0 0 1 (10) 1 (1.25) 0.7 Othera 24 (44.4) 10 (62.5) 1 (10) 35 (43.7) Detected 30 (55.6) 6 (37.5) 9 (90) 45 (56.3) a Different from W1282X, R117H, R334W, R347P, A455E, ⌬I507, 1717 - 1 G→T, G551D, R553X, and R560T.
X
ABCC7 p.Ser549Asn 9098486:60:484
status: NEW62 It is interesting that we found one S549N mutant chromosome, which has a frequency of 0.1% worldwide.
X
ABCC7 p.Ser549Asn 9098486:62:36
status: NEW
PMID: 9375855
[PubMed]
Casals T et al: "Missense mutation R1066C in the second transmembrane domain of CFTR causes a severe cystic fibrosis phenotype: study of 19 heterozygous and 2 homozygous patients."
No.
Sentence
Comment
60
(Strong et al., 1991), E92K (Nunes et al., 1993), S549N (Curtis et al., 1993), I175V (Romey et al., 1994), A559T (McDowell et al., 1995), and G85E (Vázquez et al., 1996).
X
ABCC7 p.Ser549Asn 9375855:60:50
status: NEW
No.
Sentence
Comment
22
List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories.
X
ABCC7 p.Ser549Asn 9222762:22:1305
status: NEW57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1.
X
ABCC7 p.Ser549Asn 9222762:57:808
status: NEW
PMID: 9067754
[PubMed]
Macek M Jr et al: "Sensitivity of the denaturing gradient gel electrophoresis technique in detection of known mutations and novel Asian mutations in the CFTR gene."
No.
Sentence
Comment
42
621 + 1 GÃT, R334W, R347P, A455E, aI507, aF508, 1717-1 GÃA, G542X, S549N, G551D, R553X, R560T, 3849 + 10kb CÃT, W1282X, and N1303K) was performed using the rapid multiplex reverse dot hybridization system, under conditions provided by Roche Molecular Systems (Alameda, CA) (Kawasaki et al., 1993; Welsh et al., 1995).
X
ABCC7 p.Ser549Asn 9067754:42:77
status: NEW
PMID: 8863168
[PubMed]
Parad RB et al: "Heterogeneity of phenotype in two cystic fibrosis patients homozygous for the CFTR exon 11 mutation G551D."
No.
Sentence
Comment
12
DNA from patient 1 was also assessed for 12 mutations by allele specific oligonucleotide analysis (ASO),4 but S549N was screened in addition, and 3849 + 1Okb was excluded.
X
ABCC7 p.Ser549Asn 8863168:12:110
status: NEW
PMID: 8644747
[PubMed]
Witt DR et al: "Cystic fibrosis heterozygote screening in 5,161 pregnant women."
No.
Sentence
Comment
69
Lab group A was screened for the 6 most common mutations (F508, G542X, G551D, R553X, W1282X, and N1303K); lab group B was screened for 12 mutations, including the 6 most common and an additional 6 less common alleles (R117H, 621+1, I507, 1717G-A, R560T, and S549N).
X
ABCC7 p.Ser549Asn 8644747:69:258
status: NEW142 Table 7 CFTR Mutations in Screened Women NUMBER (%) wITH MUTATIONa GROUP ETHNiciTY F508 G542X GS5lD R553X W1282X N1303K R117H 621+1 1507 1717G-A R560T S549N TOTAL A Caucasian 26 (81) 5 (16) 1 (3) NA NA NA NA NA NA 32 Hispanic 2 (100) NA NA NA NA NA NA 2 B Caucasian 63b (65) 4 (4) 2 (3) 1 (1) 2 (2) 4 (4) 16b (16) 4 (4) 1 (1) 97b Hispanic 7 (88) 1 (12) 8 Caucasian/ Hispanic 2 (50) 1 (25) 1 (25) 4 'NA = not applicable.
X
ABCC7 p.Ser549Asn 8644747:142:151
status: NEW
No.
Sentence
Comment
42
Screening in Cystic Fibrosis 107 Table 5 CF Mutations Detectable by Restriction Endonuclease (RE) Digestion of PCR Products Mutation PCR primers0 RE RE digestion product sizes, bpbJ Normal Mutant G85E 621+ 1 (G`V 1154insTC R334W R347P G551D R553X R560T S549N 3849+ IOkb CC ` T) W1282X 3i5 and 313 4i5 and 4i3 Hinff MseI 105 + 204 33,35,71, 118, 181 7i5 and 7i3 MspI, RsaI 50,68,74 + 21V 715 and 7i3 MspI 192 + 218 7i5 and 7i3 CfoI 151+ 259 1li5 and 1113 Mb01 425 1115 and lli3 HzncII 186 + 239 lli5 and lli3 Mae11 425 lli5 and lli3 DdeI 13, 174 + 238 i19F and i19R HphI 88 + 349 2Oi5 and 2Oi3 Mnfl 185 + 288 309 33,35,54,71, 118, 127 50,68,76 + 21gc 410 410 182+243 425 215 + 210 13 + 412 88,127 + 222 473 'See Table 2 bThe expected digestion product sizes for both normal and mutant sequences are shown CTheseproducts may be d1stmgmshedby PAGE 1.2.3.
X
ABCC7 p.Ser549Asn 21374513:42:253
status: NEW
PMID: 8572248
[PubMed]
Mergey M et al: "CFTR gene transfer corrects defective glycoconjugate secretion in human CF epithelial tracheal cells."
No.
Sentence
Comment
34
One was a compound heterozygote with S549N and N1303K mutations (CFT-1); the other was homozygous for the AF508 mutation (CFT-2).
X
ABCC7 p.Ser549Asn 8572248:34:37
status: NEW51 The CF cell lines used in this study are tracheal epithelial cells from two CF fetuses with different mutations in the CFTR gene: CFT-1 cells are compound heterozygote for S549N and Nl303K mutations; CFT-2 cells are homozygous for the AF508 mutation (23).
X
ABCC7 p.Ser549Asn 8572248:51:172
status: NEW251 Correction was consistently more marked in the homozygous AF508 cell line CFT-2 than in the compound heterozygote S549N/N1303K cell line CFT-1.
X
ABCC7 p.Ser549Asn 8572248:251:114
status: NEW291 The recovery was greater for the cells carrying the AF508 deletion than for those with the S549N/Nl303K mutation.
X
ABCC7 p.Ser549Asn 8572248:291:91
status: NEW
PMID: 8553305
[PubMed]
Gan KH et al: "Genetic and clinical features of patients with cystic fibrosis diagnosed after the age of 16 years."
No.
Sentence
Comment
41
DNA was analysed for the following mutations: E60X, R117H, A455E, AI507, AF508, G542X, S549N, G550X, G551D, R553X, R560T, R1162X, S1251N, W1282X, N1303K, 621 + 1G-+T, 1717-1G--+A. These mutations represent 80% ofthe expected cystic fibrosis mutations in The Netherlands.
X
ABCC7 p.Ser549Asn 8553305:41:87
status: NEW65 Table 3 CFTR mutations in 278 chromosomes of adult cystic fibrosis patients Early diagnosis Late diagnosis (n= 118) (n=25) n % n % AF508s 175 74-2 18 36-0 A455Em 12 5-1 14 28-0 1717-15 6 2-5 1 2-0 G542X' 4 1-7 - W1282X1 3 1-3 - R553X' 1 04 1 2-0 S1251N 2 0-8 - N1303K' 1 0 4 - E60X 1 0-4 3 6-0 Not identified 31 13-2 13 26-0 Total 236 50 Mutations not found: RI 17H, AI507, S549N, G550X, G551D, R560T, R1162X, 621+1G-+T.
X
ABCC7 p.Ser549Asn 8553305:65:374
status: NEW
PMID: 7573058
[PubMed]
Zielenski J et al: "CFTR gene variant for patients with congenital absence of vas deferens."
No.
Sentence
Comment
22
W1282X Unknown 2 R553X Unknown ............ 20.0 4173delC Unknown1 1 D614G Unknown 1 1716+12T- C Unknown 1 J Unknown Unknown ............ .15 21.4 NOTE.-The known CFTR mutations screened included AF508, G542X, GSS1D, N1303K, R553X, W1282X, AI507, 1717-1G-A, R560T, S549N, 621+1G--T, and R117H.
X
ABCC7 p.Ser549Asn 7573058:22:265
status: NEW
No.
Sentence
Comment
78
Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No.
X
ABCC7 p.Ser549Asn 7551394:78:561
status: NEW
PMID: 7544319
[PubMed]
Brancolini V et al: "Search for mutations in pancreatic sufficient cystic fibrosis Italian patients: detection of 90% of molecular defects and identification of three novel mutations."
No.
Sentence
Comment
70
(UN yet unidentified mutation) Patient Genotype after Genotype at the end number preliminary screening of the analysis UN/UN M1V/4382delA 1717-1G---~A/UN 1717-1G---~A/R1066H AF508/UN AF508/D579G UN/UN M1V/UN AF508/UN AF508/UN UN/UN T338I/R1158X UN/UN G85E/71 I+5G---~A UN/UN D1152H/UN AF508/UN AF508/UN AF508/UN AF508/3849+ 10kbC---~T UN/UN 711+3A---~G/UN AF508/UN AF508/F1052V UN/UN R352Q/W57G UN/UN 1898+3A----~G/UN AF508/UN AF508/711+5G--~A G542X/UN G542X/DI 152H AF508/UN AF508/E193K 1717-1G---~A/UN 1717-1G---~A/2789+5A---)G AF508/UN AF508/G1349D AF508/UN AF508/G85E AF508/UN AF508/R347P AF508/UN AF508/R352Q AF508/UN AF508/R352Q AF508/UN AF508/S549N G542X/UN G542X/R1066H AF508/UN AF508/T338I AF508/UN AF508/R334W AF508/UN AF508/R334W AF508/UN AF508/S1251N AF508/UN AF508/R1066C AF508/UN AF508/D579G results) while the remaining three haplotypes had been found in association with other rare mutations, which were excluded by DGGE analysis in these patients (Table 3).
X
ABCC7 p.Ser549Asn 7544319:70:650
status: NEW
PMID: 7539080
[PubMed]
Cheadle JP et al: "Two CF patients, one homozygous for the 621 + 1G > T splice mutation, the other homozygous for the 1898 + 1G > A splice mutation."
No.
Sentence
Comment
5
To date, investigators have described homozygotes for G542X,2 R553X,3 G85E,4 S549N,5 Rl17H,6 2184delA,7 R1162X,8 and W128X.9 We report here two patients, one homozygous for 621 + 1G>T, the other homozygous for 1898 + 1G>A.
X
ABCC7 p.Ser549Asn 7539080:5:77
status: NEW
No.
Sentence
Comment
552
T 2183AA --.0 3905insT S549N 2184deiA Q359K1T360K MllOlK YI22X 1898 + 50 --.
X
ABCC7 p.Ser549Asn 8825494:552:23
status: NEW593 Not surprisingly, Rl17H is associated with CF only when the allele also contains Table 2 Examples of complex alleles in the CfTR gene Principal Second site mutationa Location alteration Location Reference R75X exon 3 125G --.. C promoter 57 405 + IG --.. A intron 3 3030G --.. A exon 15 57 R1l7H exon 4 129G --.. C promoter 203 RI17H exon 4 IVS8 : 5T or 7T intron 8 101 R297Q exon 7 IVS8 : 5T or 7T intron 8 60 aF508 exon 10 R553Q exon II 59 aF508 exon 10 1I027T exon I7a 57 8F508 exon 10 deletion of D7S8 500 kb 3' of 186 CfTR S549N exon II R75Q exon 3 205a L619S exon 13 1716G � A exon 10 57 G628R (G � C) exon 13 SI235R exon 19 47 2184insA exon 13 IVS:5T exon 9 J Zielenski, J Bal, 0 Markiewicz, L-C Tsui, unpublished data A800G exon 13 IVS8 : 5T or 7T intran 8 31 S912L exon 15 GI244V exon 20 149 GlO69R exon 17b L88X exon 3 149 3732deiA exon 19 Kl200E exon 19 70 3849 + IOkbC � intron 19 R668C exon 13 57 T SI251N exon 20 F508C exon 10 94 The status of principal mutation may not be clear in every case; e.g. G628R(G --> C) vs S1235R.
X
ABCC7 p.Ser549Asn 8825494:593:530
status: NEW605 The one patient who showed severe CF disease was found to harbor a known CF mutation (S549N) in the allele carrying R75Q.
X
ABCC7 p.Ser549Asn 8825494:605:86
status: NEW
PMID: 7526685
[PubMed]
Morral N et al: "Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene."
No.
Sentence
Comment
112
CT................... 3863: G--oA .................. G-.T ................... 3980: G-jA .................. G--)T.................... 4374+1: G-A .................. G--oT.................... L88S L88X L88X G. Malone, personal communication Savov et al. 1994b Macek et al. 1992 406-1G--.C Bonizzato et al. 1992 406-1G- T T. Bienvenu, personal communication E92K Nunes et al. 1993 E92X Will et al. 1994 S549N Cutting et al. 1990 S5491 Kerem et al. 1990 R560K Ferec et al. 1992 R560T Kerem et al. 1990 Y563D A. Hamosh, personal communication Y563N Kerem et al. 1990 1898+1CG-.A Strong et al. 1992 1898+1GC-.C Cuppens et al. 1993 1898+3A-)C W. Lissens, personal communication 1898+3A--4G Cremonesi et al. 1992 G628R G628R 2183AA- G 2184delA 2184insA M1101K M1101R 3667del4 3667ins4 3791delC T12201 G1244E G1244V R1283K R1283M Fanen et al. 1992 Cuppens et al. 1993 Bozon et al. 1994 Dork et al., in press N. Kilin, personal communication Zielenski et al. 1993 Mercier et al. 1993 Chillon et al. 1994a Sangiuolo et al. 1993 M. Macek, Jr., personal communication Ghanem et al. 1994 Devoto et al. 1991 Savov et al. 1994a Chevalier et al., in press Cheadle et al. 1992 4374+1G-*A Fanen et al. 1992 4374+1G--iT Dork et al. 1993 of the most common allele.
X
ABCC7 p.Ser549Asn 7526685:112:400
status: NEW
PMID: 7526344
[PubMed]
Grossman PD et al: "High-density multiplex detection of nucleic acid sequences: oligonucleotide ligation assay and sequence-coded separation."
No.
Sentence
Comment
55
Probes for multiplex CF OLA assay CF Locus S549R2-WT S549R2-MUT S549R2-COM S549N WT S549N-MUT S549N-COM G542-WT G542-MUT G542X-COM R553-WT R553X-MUT R553-COM G551-WT G55ID-MUT G55ICOM W1282-WT W1282X-MUT W1282-COM R560T-WT R560T-MUT R560-COM 1717-WT 1717-MUT 1717-COM 3905-WT 39O51NST-MUT 3905-COM Sequence (5'-3') (HEO)2-TTGCTCGTTGACCTCCA (HEO)3-TTGCTCGTTGACCTCCC PO4-CTCAGTGTGATTCCACCT-FAM (HEO)4-TGCTCGTTGACCTCCAC (HEO)5-TGCTCGTTGACCTCCAT PO4-TCAGTGTGATTCCACCTTC-FAM (HEO)6-GTGATTCCACCTTCTCC (HEO)7-GTGATTCCACCTTCTCA PO4-AAGAACTATATTGTCTTTCTCT-FAM (HEO)8-TGCTAAAGAAATTCTTGCTCG (HEO)9-TTGCTAAAGAAATTCTTGCTCA PO4-TTGACCTCCACTCAGTGTGA-FAM (HEO)IO-TAAAGAAATTCTTGCTCGTTGAC (HEO)11-TAAAGAAATTCTTGCTCGTTGAT PO4-CTCCACTCAGTGTGATTCCA-FAM (HEO) 12-TATCACTCCAA AGGCTTTCCTC (HEO) 13-TATCACTCCAAAGGCTTTCCTT PO4-CACTGTTGCAAAGTTATTGAATCC-FAM (HEO)14-TAGACCAATAATTAGTTATTCACC (HEO)15-TAGACCAATAATTAGTTATTCACG PO4-TTGCTAAAGAAATTCTTGCTCG-FAM (HEO) 16-TCTGCAAACTTGG AGATGTCC (HEO) 17-TCTGCAAACTTGGAGATGTCT PO4-TATTACCAAAAATAGAAAATTAGAGA-FAM (HEO) 18-A AGAGTACTTTGTTATCAGCTTTTTT (HEO)19-AAGAGTACTnUTIATCAGCTnTnT PO4-GAGACTACTGAACACTGAAGGAG-FAM Oligonucleotide ligation assay kinetics study For the study of ligation reaction kinetics, probe concentrations were 5 nM, and oligonucleotide target concentration was 0.5 nM.
X
ABCC7 p.Ser549Asn 7526344:55:75
status: NEWX
ABCC7 p.Ser549Asn 7526344:55:84
status: NEWX
ABCC7 p.Ser549Asn 7526344:55:94
status: NEW157 Variations in OLA product yield seen in Figure 4 can more likely be attributed to the high degree of overlap of the probes used in the exon 11 mutational hotspot (G542X, S549N, S549R2, G551D, R553X, R560T).
X
ABCC7 p.Ser549Asn 7526344:157:170
status: NEW
PMID: 7518920
[PubMed]
Ellis LA et al: "MutS binding protects heteroduplex DNA from exonuclease digestion in vitro: a simple method for detecting mutations."
No.
Sentence
Comment
23
Figures 1-4 illustrate the detection of four different mutations in CFTR exon 11 (1717-1 G-A, R553X, G551D, S549N) by this method.
X
ABCC7 p.Ser549Asn 7518920:23:108
status: NEW27 Mutation wild type 1717-1 (G-A) R553X (C-T) G551D (G-A) S549N (G-A) Observed fragment size (blue) none 189 269 259 253 Distance from primer to mutation (blue) NA 184 256 250 245 Observed fragment size (green) none 326 246 256 263 Distance from primer to mutation (green) NA 308 236 242 247 *To whom correspondence should be addressed at: DNA Laboratory, Regional Genetics Service, Ashley Wing, St James's University Hospital, Leeds LS9 7TF, UK atUniversityofNorthCarolinaatChapelHillonOctober25,2012http://nar.oxfordjournals.org/Downloadedfrom Nucleic Acids Research, 1994, Vol. 22, No. 13 / 189 326 1. .
X
ABCC7 p.Ser549Asn 7518920:27:56
status: NEW
PMID: 7525963
[PubMed]
Chevalier-Porst F et al: "Mutation analysis in 600 French cystic fibrosis patients."
No.
Sentence
Comment
21
Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population.
X
ABCC7 p.Ser549Asn 7525963:21:284
status: NEW
PMID: 7521710
[PubMed]
Ravnik-Glavac M et al: "Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene."
No.
Sentence
Comment
121
1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.).
X
ABCC7 p.Ser549Asn 7521710:121:343
status: NEW
PMID: 7505692
[PubMed]
Osborne LR et al: "Nasal epithelial ion transport and genetic analysis of infertile men with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
25
Nasal potential difference, sweat sodium concentration and CF genotype in subjects with CBAVD, CF patients and controls CF genotype Control cohort CBAVD cohort CF cohort N/N« AF5O8/R347H SM9N/R1070Q AF508/Other R553X/N*> Unknown/Unknowtf AF 5«/AF5O8 AFjQj/Other AF508/R347P AF50e/G542X AFjQg/RllTH AF5O8/G85E AF5Q8/R553X AFJO8/G551D AF5O8A^520F AFJO8/S549N AF^/DIjQ, N1303K/Other G542X/R117H AFJ08/R334W Other/Other Subjects 50 1 1 1 6 1 16 25 18 3 2 1 1 1 2 1 1 1 3 1 1 3 Mean (range) sweat Na+ concentration (mmol/1) 50 (27-78) 88 N/A 94 57 (47-70) 36 49 (32-76) 126(80-162) 99 (80-128) 108 (99-115) 128 (118-137) 95 107 130 122 (116-128) 90 80 118 96 (92-99) 84 123 108(83-130) Mean (range) nasal potential difference (-mV) 21 (8-30) 31 N/A 34 23 (13-29) -15 20 (-13-28) 45 (32-58) 41 (33-61) 50 (36-77) 43 (33-52) 51 42 39 60 (50-71) 32 37 41 38 (36-40) 32 34 44(31-57) N = non-CF chromosome Other = uncharacterised CF chromosome N/A not available • with CF carrier frequency of 1/20-1/25, it is likely that 2 or 3 of these individuals will be carriers.
X
ABCC7 p.Ser549Asn 7505692:25:361
status: NEW34 One of these was a British Caucasian whose genotype was AFJ08/R347H and the second, a Pakistani Asian, was heterozygous for the S549N and R1070Q mutations (Table 1).
X
ABCC7 p.Ser549Asn 7505692:34:128
status: NEW
PMID: 7505689
[PubMed]
Cheadle JP et al: "Direct sequencing of the complete CFTR gene: the molecular characterisation of 99.5% of CF chromosomes in Wales."
No.
Sentence
Comment
55
In the three CF chromosomes in which we excluded the site of the mutation from the complete coding regions, the intron splice sites, and part of the promoter region (see above) of the CFTR gene, we screened S549N heterozygote G A T C 1078 delT heterozygote G A T C G T .
X
ABCC7 p.Ser549Asn 7505689:55:210
status: NEW62 S549N (G-A a: 1778) and S549R (T-G at 1779) were sequenced from 1115', 1078 delT from 7i5\ 3659 deIC from 19e3'b, and 3272-26A-G from 17Bi5'.
X
ABCC7 p.Ser549Asn 7505689:62:0
status: NEW
PMID: 7691344
[PubMed]
Claustres M et al: "Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France."
No.
Sentence
Comment
26
Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation?
X
ABCC7 p.Ser549Asn 7691344:26:209
status: NEW
PMID: 7691870
[PubMed]
Patrizio P et al: "Cystic fibrosis mutations impair the fertilization rate of epididymal sperm from men with congenital absence of the vas deferens."
No.
Sentence
Comment
38
Briefly, genomic DNA extracted from peripheral lymphocytes was amplified by the polymerase chain reaction (PCR) and analysed for 12 mutations in the CFTR gene: Delta F508, G542X, G551D, R553X, W1282X, N1303K, Delta 1507, 1717G-A, R560T, S549N, R117H and 621 + 1.
X
ABCC7 p.Ser549Asn 7691870:38:237
status: NEW
PMID: 7684637
[PubMed]
Richards B et al: "Multiplex PCR amplification from the CFTR gene using DNA prepared from buccal brushes/swabs."
No.
Sentence
Comment
82
All of the mutations except S549N were present in the population tested in this study, and all mutations were efficiently detected by uie assay.
X
ABCC7 p.Ser549Asn 7684637:82:28
status: NEW108 observed AF5O8 G542X G551D W1282X R553X R560T 1717-1 N1303K 621 + 1 R117H S549N 1507 280 7 16 2 4 2 2 5 6 11 1 •Includes affected individuals and known carriers.
X
ABCC7 p.Ser549Asn 7684637:108:74
status: NEW
PMID: 7684636
[PubMed]
Shuber AP et al: "Efficient 12-mutation testing in the CFTR gene: a general model for complex mutation analysis."
No.
Sentence
Comment
50
Percent GC content of allele-speciik oligonucleotides GC Content/ASO Mutation G542X G551D R553X W1282X N1303K DI507 1717-1 G - A R560T S549N R117H 621 + 1 G - T 40 53 53 47 41 30 41 53 53 47 30 HS«3X W12»2X N1J0JK £507 H117M • 21 SS4tN RSOOT Table 2.
X
ABCC7 p.Ser549Asn 7684636:50:135
status: NEW53 1) Number of ASOs (N = 12) 2) Mutation Frequencies # ofCF Mutation Chromosomes Frequency A508 G551D G542X W1282X N1303K R553X 621 + 1 G - T R117H 1717-1 G - A R560T AI507 S549N unknown Total 548 15 13 13 12.
X
ABCC7 p.Ser549Asn 7684636:53:171
status: NEW54 9 9 '3 3 2 1 1 133 764 • Minimal Number of Independent Conclusion (4 hybridizations) Filter # 1 N(A5O8) 2 A5O8 72.0% 2.0% 1.7% 2.0% 1.5% 1.1% 1.1% 0.4% 0.4% 0.3% 0.1% 0.1% 17.0% Hybridizations 3 4 G551D 621 + 1 G - T G542X R117H W1282X 1717-1 G - A N13O3K R560T R553X A507 S549N with the remaining six mutations: 621 + 1 G^T, R117H, 1717-1 G - A , R560T, AI507, and S549N.
X
ABCC7 p.Ser549Asn 7684636:54:280
status: NEWX
ABCC7 p.Ser549Asn 7684636:54:376
status: NEW72 Example of results obtained from hybridizing four identical filters with ASOs specific for N (the normal sequence at position 508), AF508 (a 3 bp deletion at position 508), pool 1 (G542X, G551D, R553X, W1282X, and N13O3K), and pool 2 (AI507, R117H, 621 + 1 G - T , S549N, R560T, 1717-1 G-A).
X
ABCC7 p.Ser549Asn 7684636:72:265
status: NEW73 Row A contains positive control samples with the following genotypes: 1A (AF508/AF508); 2A (AF508/G542X); 3A (AF5O8/G551D); 4A (N/R553X); 5A (NAV1282X); 6A (AF5O8/N13O3K); 7A (N/AI5O7); 8A (N/R117H); 9A (N/621 + 1 G-T); 10A (AF508/S549N); HA (AF508/R560T); and 12A (N/1717-1 G-A).
X
ABCC7 p.Ser549Asn 7684636:73:231
status: NEW80 Pool 2: lane 1 (AI507); lane 2 (Rl 17H); lane 3 (621 +1 G-T); lane 4 (S549N); lane 5 (R560T); lane 6 (1717-1 G - A ) .
X
ABCC7 p.Ser549Asn 7684636:80:70
status: NEW86 Row A contains positive control samples: lane 2 (G542X); lane 3 (G551D); lane 4 (R553X); lane 5 (W1282X); lane 6 (N13O3K); lane 7 (AI507); lane 8 (R117H); lane 9 (621 +1 G-T)); lane 10 (S549N); lane 11 (R560T); lane 12 (1717-1 G-A)).
X
ABCC7 p.Ser549Asn 7684636:86:186
status: NEW122 For example, no cross-hybridization is seen here between ASOs for S549N, G55 ID, and R553X, which have identical target locations and differ in sequence by only one base pair.
X
ABCC7 p.Ser549Asn 7684636:122:66
status: NEW
PMID: 8473422
[PubMed]
Patrizio P et al: "Aetiology of congenital absence of vas deferens: genetic study of three generations."
No.
Sentence
Comment
51
Exon 4,10,11,20 and 21 were amplified in a multiplex reaction followed by allele specific oligonucleotide (ASO) probe analysis for the mutations Delta F508, G542X, G551D, R553X, W1282X, N13O3K, Delta 1507, 1717G-A, R560T, S549N, R117H and 621 + 1.
X
ABCC7 p.Ser549Asn 8473422:51:222
status: NEW
PMID: 7680378
[PubMed]
Curtis A et al: "Absence of cystic fibrosis mutations in a large Asian population sample and occurrence of a homozygous S549N mutation in an inbred Pakistani family."
No.
Sentence
Comment
3
Molecular and clinical data are presented which may improve our understanding of the phenotypic effects of the S549N mutation in the CFTR gene.
X
ABCC7 p.Ser549Asn 7680378:3:111
status: NEW19 Such homozygotes are likely to be extremely rare, but some useful cases have been identified, such as aG85E homozygotel' and an R553X" homozygote, in addition to the S549N case described here.
X
ABCC7 p.Ser549Asn 7680378:19:166
status: NEW28 Her lungs have been infected by mucoid strains of Pseudomonas 164 group.bmj.comon October 25, 2012 - Published byjmg.bmj.comDownloaded from Absence of cysticfibrosis mutations in a large Asian population sample and occurrence of a homozygous S549N mutation in an inbred Pakistanifamily aeruginosa since the age of 5 years.
X
ABCC7 p.Ser549Asn 7680378:28:243
status: NEW48 These show a G to A substitution at cDNA nucleotide position 1778 which creates the S549N (Ser-+Asn) mutation in the CFTR protein previously described by Cutting et al.4 Discussion Cystic fibrosis has rarely been described in subjects from the Asian population.
X
ABCC7 p.Ser549Asn 7680378:48:84
status: NEW49 No carriers of the commonest Caucasian CF mutation (AF508) or of the less common G551D, R553X, and S549N mutations were detected in an Asian population of 443 unrelated subjects, even though the frequency of 5-8% in our population was slightly greater than expected.
X
ABCC7 p.Ser549Asn 7680378:49:84
status: NEWX
ABCC7 p.Ser549Asn 7680378:49:99
status: NEW52 The affected Pakistani child studied here is homozygous for a rare CF mutation, S549N.
X
ABCC7 p.Ser549Asn 7680378:52:80
status: NEW54 The detection of this mutation allowed carrier testing for her two unaffected brothers, neither of whom were shown to carry the S549N mutation (figs 1 and 2).
X
ABCC7 p.Ser549Asn 7680378:54:128
status: NEW29 Her lungs have been infected by mucoid strains of Pseudomonas 164 group.bmj.com on December 5, 2015 - Published by http://jmg.bmj.com/ Downloaded from Absence of cysticfibrosis mutations in a large Asian population sample and occurrence of a homozygous S549N mutation in an inbred Pakistanifamily aeruginosa since the age of 5 years.
X
ABCC7 p.Ser549Asn 7680378:29:254
status: NEW50 No carriers of the commonest Caucasian CF mutation (AF508) or of the less common G551D, R553X, and S549N mutations were detected in an Asian population of 443 unrelated subjects, even though the frequency of 5-8% in our population was slightly greater than expected.
X
ABCC7 p.Ser549Asn 7680378:50:99
status: NEW53 The affected Pakistani child studied here is homozygous for a rare CF mutation, S549N.
X
ABCC7 p.Ser549Asn 7680378:53:80
status: NEW55 The detection of this mutation allowed carrier testing for her two unaffected brothers, neither of whom were shown to carry the S549N mutation (figs 1 and 2).
X
ABCC7 p.Ser549Asn 7680378:55:128
status: NEW
PMID: 1281385
[PubMed]
Ober C et al: "Ethnic heterogeneity and cystic fibrosis transmembrane regulator (CFTR) mutation frequencies in Chicago-area CF families."
No.
Sentence
Comment
7
When a panel of 10 mutations (AF508, AI507, G542X, G551D, R553X, S549N, R1162X, W1282X, N1303K, and 1717-1G--A) was used, detection rates ranged from 75% in non-Ashkenazi Caucasians to 40% in African-Americans.
X
ABCC7 p.Ser549Asn 1281385:7:65
status: NEW36 Mutation Analysis DNA from each subject was screened for the following mutations: AF508 (Kerem et al. 1989a), G542X (Kerem et al. 1990), GS51D (Cutting et al. 1990), R553X (Cutting et al. 1990), S549N (Cutting et al. 1990), R1162X (Gasparini et al. 1991), W1282X (Vidaud et al. 1990), N1303K (Osborne et al. 1991), and 1717-1G- A (Guillermit et al. 1990; Kerem et al. 1990).
X
ABCC7 p.Ser549Asn 1281385:36:195
status: NEW47 GSS ID, RSS3X, and S549N.-DNA (0.5-1 ig) was subjected to amplification by PCR using primers 11i-5 and 1 i-3, according to published protocol (Kerem et al. 1990).
X
ABCC7 p.Ser549Asn 1281385:47:19
status: NEW
PMID: 1384328
[PubMed]
Abeliovich D et al: "Screening for five mutations detects 97% of cystic fibrosis (CF) chromosomes and predicts a carrier frequency of 1:29 in the Jewish Ashkenazi population."
No.
Sentence
Comment
50
The mutations G551D, S549N, S5491, S549R, and 1717-1 G-OA were analyzed according to the method of Kerem et al.
X
ABCC7 p.Ser549Asn 1384328:50:21
status: NEW56 The mutations 621 + 1 G-oT, 1717-1 G-oA, S549N, S549I, S549R, G551D, and R553Xwere not foundin our patients.
X
ABCC7 p.Ser549Asn 1384328:56:41
status: NEW
No.
Sentence
Comment
64
Frequent cystic fibrosis mutations Name Relative freqeenc~ Mutation Con~,~'~luence Ref. Z~508 67.2 G542X 3.4 G551D 2.4 W1282X 2.1 3905insT 2.1 N1303K 1.8 3849+10kbC-+T 1.4 1717-1G-+A 1078delT 2789+5G--+A Deletion of 3 bp between nt 1652 and t655 in exon 10 G-+T at nt 1756 in exon 11 G-+A at nt 1784 in exon 1I G-+A at nt 3978 in exon 20 Insertion of T after nt 3905 in exon 20 C-+G at nt 4041 in exon 21 C-->T in a 6.2 kb EcoRI fragment 10 kb from 5' junction of intron 19 3849+4A-+G 1.0 7tt÷IG--+T 0.9 Rl162X 0.9 1898+lG-+A 0.9 Rll7H 0.8 3659delc 0.8 G85E 0.7 2184delA 0.7 AI5W 0.5 R347P 0.5 R~ 0.4 1,3 C-+T at nt 1"789in exon 11 1.3 G-+T at nt 1 from 5' junction of intron 4 1.1 G--+A at nt 1 from 3' junction of intron 10 1.1 Deletion of T at nt 1078 in exon 7 1.1 G-cA at 5 nt from 5' end of intron 14b A-->G at 4 nt from 5' end of intron 19 G-+T at nt 1 from 5' junction of intron 5 C-+T at nt 3616 in exon 19 G-+A at nt 1 from 5' junction of intron 12 G--)A at nt 482 in exon Deletion of C at nt 3659 in exon 19 G-+A at nt 386 in exon 3 A-->G at nt 2183 and deletion of A at nt 2184 in exon 13 Deletion of 3 bp between nt 1648 and 1653 in exon 10 G-+C at nt 1172 in exon 7 G-~C at nt 1811 in exon 11 A455E 0.4 R334W 0.4 Y122X 0.3 S549R(T-+G) 0.3 Q493X 0.3 V520F 0.2 S549N 0.2 C-+A at nt 1496 in exon 9 C-+T at nt 1132 in exon 7 T-cA at nt ~i98 in exon 4 T--+G at nt 1779 in exon 11 C-+T at nt 1609 in exon 10 G-+T at nt 1690 in exon 10 G-->A at nt I778 in exon !1 Deletion of Phe at codon 508 Gly-+Stop at codon 542 12 Gly-~Asp at codon 551 10 l"rp-->Stop at codon t282 35 Frameshift -~ Asn-+Lys at codon 1303 36 Aberrant splicing -~ Arg~Stop ~ codon 553 Splice mutation 10 37 Splice mutation 12 Frameshift 38 Splice mutation _c Splice mutation?
X
ABCC7 p.Ser549Asn 1279852:64:1278
status: NEW
No.
Sentence
Comment
164
Mutations encountered elsewhere in UK but not yet m N-W 1154insTC R347P A455E G458V Q493X C524X S549N R1283M Q1291H 199 (in the north-west group) 199 199 0 0 0 199 199 0 icant alteration in function appears to be worse than no CFTR being formed at all.
X
ABCC7 p.Ser549Asn 1281032:164:96
status: NEW
PMID: 1376017
[PubMed]
Cutting GR et al: "Analysis of four diverse population groups indicates that a subset of cystic fibrosis mutations occur in common among Caucasians."
No.
Sentence
Comment
96
Two other mutations (S549N and R553X) in African-Americans have been reported to occur in Caucasian CF patients, although R553X is probably a recurrent mutation (Reiss et al. 1991).
X
ABCC7 p.Ser549Asn 1376017:96:21
status: NEW
PMID: 1377454
[PubMed]
Fiedler MA et al: "Cloning and sequence analysis of rat cystic fibrosis transmembrane conductance regulator."
No.
Sentence
Comment
487
Cutting et al. (7) identified a cluster of mutations in NBFl (R533stop, S549N, G551D, and A559T), which are associated with the CF phenotype.
X
ABCC7 p.Ser549Asn 1377454:487:72
status: NEW
PMID: 1709778
[PubMed]
Devoto M et al: "Screening for non-delta F508 mutations in five exons of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in Italy."
No.
Sentence
Comment
34
Table 2 Results of Screening for Known Mutations Total No. of No. of Chromosomes Chromosomes Overall Mutation Exon Method With the Mutationa Screenedb Frequencyc Reference R334W......... 7 MspI 2 198 1.01 X. Estivill, personal communication R347P......... 7 HhaI or NcoI 4 183 2.19 Dean et al. 1990 G542X ......... 11 ASO (DGGE) 15 (4) 176 (18) 9.79 Kerem et al. 1990 S549N......... 11 DdeI 1 159 .63 Cutting et al. 1990b G5S1D ......... 11 HincII or MboI 0 186 Cutting et al. 1990b R553X ......... 11 HincIl (DGGE) 5 (1) 186 (13) 3.02 Cutting et al. 1990b 1717-1G-A .... 11 (DGGE) (12) (109) 11.01 Guillermit et al. 1990 S1255X ......... 20 HindIII 0 130 Cutting et al. 1990a W1282X......... 20 MnlI (DGGE) 7 (3) 124 (53) 5.65 Vidaud et al. 1990 a Numbers in parentheses are number of mutations found through DGGE.
X
ABCC7 p.Ser549Asn 1709778:34:368
status: NEW
PMID: 10762539
[PubMed]
Mickle JE et al: "Effects of cystic fibrosis and congenital bilateral absence of the vas deferens-associated mutations on cystic fibrosis transmembrane conductance regulator-mediated regulation of separate channels."
No.
Sentence
Comment
47
DNA was assayed for 16 common CFTR mutations (R117H, 62111GrT, R334W, R349P, A455E, DI507, DF508, 1717-1GrA, G542X, S549N, G551D, R553X, R560T, 3849110 Kb CrT, W1282X, and N1303K), by reverse dot-blot hybridization (Mickle et al. 1998).
X
ABCC7 p.Ser549Asn 10762539:47:116
status: NEW
PMID: 10931414
[PubMed]
Massie RJ et al: "Pancreatic function and extended mutation analysis in DeltaF508 heterozygous infants with an elevated immunoreactive trypsinogen but normal sweat electrolyte levels."
No.
Sentence
Comment
26
Measurement of Cl levels was done by colorimetry, and measurement of sodium levels was done by flame cytometry.16 Gene Mutation Analysis Blood was taken and DNA extract- ed17 for an extended cystic fibrosis transmembrane conductance regulator protein gene mutation analysis as described previously.18 The following mutations were included: ࢞F508, ࢞I507, R117H, G551D, A455E, G542X, N1303K, W1282X, 1717-1GA, R560T, R347P, R334W, R553X, R1162X, S549N, 3849+10CT, and 621+1GT.
X
ABCC7 p.Ser549Asn 10931414:26:463
status: NEW
PMID: 11755047
[PubMed]
Gomez-Llorente MA et al: "Analysis of 31 CFTR mutations in 55 families from the South of Spain."
No.
Sentence
Comment
30
T I.5 R553X E.11 1078delT E.7 R560T E.11 R347P E.7 S549R E.11 R347H E.7 S549N E.11 R334W E.7 3849 + 10kbC !
X
ABCC7 p.Ser549Asn 11755047:30:72
status: NEW
PMID: 12706377
[PubMed]
Streit C et al: "CFTR gene: molecular analysis in patients from South Brazil."
No.
Sentence
Comment
2
The present work aimed (1) to detect sequence alterations in the nucleotide binding regions and at the membrane spanning domain of the CFTR gene and (2) to detect the following frequent mutations R347P, R347H, R334W, and Q359K (located in exon 7), DF508 (located in exon 10), G542X, G551D, R553X, and S549N (located in exon 11), W1282X (located in exon 20), and N1303K (located in exon 21).
X
ABCC7 p.Ser549Asn 12706377:2:301
status: NEW8 No alleles were found to carry mutations G551D, R334W, R347P, R347H, Q359K, S549N, and N1303K, which were included in the screening protocol.
X
ABCC7 p.Ser549Asn 12706377:8:76
status: NEW59 Restriction fragment length polymorphism Mutations R347P, R347H, R334W, Q359K (located in exon 7), G542X, S549N, G551D, R553X mutations (exon 11), W1282X (exon 20), and N1303K (exon 21) were identified by restriction fragment length polymorphism (RFLP) protocol, using specific restriction endonucleases.
X
ABCC7 p.Ser549Asn 12706377:59:106
status: NEW76 Screening of four additional mutations (G542X, R553X, R334W, and W1282X) together with DF508 Table 2 Mutations detected in 77 CF patients from south region of Brazil Mutation Location Number of alleles Frequency (%) R334W Exon 7 2 1.3 R347P Exon 7 0 0 R347H Exon 7 0 0 Q359K Exon 7 0 0 DF508 Exon 10 75 48.7 S549N Exon 11 0 0 G542X Exon 11 5 3.2 G551D Exon 11 0 0 R553X Exon 11 1 0.7 W1282X Exon 20 1 0.7 N1303K Exon 21 0 0 ?
X
ABCC7 p.Ser549Asn 12706377:76:308
status: NEW
PMID: 12767731
[PubMed]
McKone EF et al: "Effect of genotype on phenotype and mortality in cystic fibrosis: a retrospective cohort study."
No.
Sentence
Comment
47
ARTICLES 1672 THE LANCET ߦ Vol 361 ߦ May 17, 2003 ߦ www.thelancet.com Panel 1: Frequencies of CFTR mutations* CFTR Allele CFTR Allele mutation frequency (%) mutation frequency èc;F508 69&#b7;4% 2789+5GA 0&#b7;3% Unknown 15&#b7;7% R1162X 0&#b7;3% G542X 2&#b7;3% G85E 0&#b7;3% G551D 2&#b7;2% R560T 0&#b7;2% èc;I507 1&#b7;6% R334W 0&#b7;2% W1282X 1&#b7;4% 3659èc;C 0&#b7;2% N1303K 1&#b7;2% A455E 0&#b7;1% R553X 0&#b7;9% 711+1GT 0&#b7;1% 621+1GT 0&#b7;8% 1898+1GA 0&#b7;1% R117H 0&#b7;7% 2184èc;A 0&#b7;1% 3849+10 kbCT 0&#b7;7% S549N 0&#b7;1% 1717-IGA 0&#b7;5% 1078èc;T 0&#b7;03% R347P 0&#b7;3% *n=17 853.
X
ABCC7 p.Ser549Asn 12767731:47:593
status: NEW48 Panel 2: Functional classification of CFTR alleles Class Functional effect of Allele mutation I Defective protein G542X, R553X, W1282X, production R1162X, 621-1GT, 1717-1GA, 1078èc;T, 3659èc;C II Defective protein èc;F508, èc;I507, N1303K, processing S549N III Defective protein G551D, R560T regulation IV Defective protein R117H, R334W, G85E, conductance R347P V Reduced amounts of 3849+10KbCT, functioning CFTR protein 2789+5GA, A455E Unknown 711+1GT, 2184DA, 1898+1GA Total cohort Genotyped cohort (n=28 455) (n=17 853) Person-years at risk 152 011 96 870 Sex (% male) 53% 52% Race (% white) 96% 96% Age (years) 11&#b7;9 (11&#b7;1) 10&#b7;9 (11&#b7;2) Age at diagnosis (years) 3&#b7;5 (7&#b7;1) 3&#b7;6 (7&#b7;5) Sweat test (mmol/L) 101 (19) 100 (20) FEV1 (L) 1&#b7;72 (0&#b7;91) 1&#b7;80 (0&#b7;92) FEV1 (% predicted) 69 (29) 72 (28) FVC (L) 2&#b7;41 (1&#b7;18) 2&#b7;50 (1&#b7;21) FVC (% predicted) 81% (28) 84% (24) Height (cm) 121% (41) 117% (41) Weight (kg) 30&#b7;0 (21&#b7;3) 28&#b7;6 (21&#b7;8) Pancreatic insufficiency (%) 90% 87% P aeruginosa colonisation (%) 49% 46% Number of deaths (%) 3548 (12%) 1547 (9%) Data are mean (SD) unless otherwise stated.
X
ABCC7 p.Ser549Asn 12767731:48:281
status: NEW67 Table 2: Standardised and crude mortality rates (including organ transplantation) by genotype Genotype No of Age at Sweat FEV1 FVC Height Weight Pancreatic P&#b7; aeruginosa Subjects Diagnosis Chloride (% predicted)* (% predicted)* (cms)* (kg)* Insufficiency Colonization (yrs) (mmol) (%)ߤ (%)ߤ èc;F508/èc;F508 6 213 2&#b7;5 &#b1; 0&#b7;1 104 &#b1; 0&#b7;2 77 &#b1; 0&#b7;3 89 &#b1; 0&#b7;3 141 &#b1; 0&#b7;2 37&#b7;0 &#b1; 0&#b7;1 92 (91-92) 60 (59-61) èc;F508/G551D 411 3&#b7;7 &#b1; 0&#b7;3ߥ 108 &#b1; 0&#b7;9ߥ 76 &#b1; 1&#b7;2 89 &#b1; 1&#b7;2 142 &#b1; 0&#b7;7&#a7; 38&#b7;2 &#b1; 0&#b7;6&#a7; 92 (89-94) 59 (54-64) èc;F508/G542X 389 1&#b7;9 &#b1; 0&#b7;2 104 &#b1; 0&#b7;8 79 &#b1; 1&#b7;2 91 &#b1; 1&#b7;2 141 &#b1; 0&#b7;7 37&#b7;3 &#b1; 0&#b7;5 93 (89-95) 57 (52-62) èc;F508/N1303K 213 2&#b7;1 &#b1; 0&#b7;3 106 &#b1; 1&#b7;2 80 &#b1; 1&#b7;8 91 &#b1; 1&#b7;7 141 &#b1; 1&#b7;0 37&#b7;1 &#b1; 0&#b7;6 92 (87-95) 61 (55--68) èc;F508/W1282X 205 1&#b7;6 &#b1; 0&#b7;2 103 &#b1; 1&#b7;2 80 &#b1; 1&#b7;7 92 &#b1; 1&#b7;6 141 &#b1; 0&#b7;9 37&#b7;4 &#b1; 0&#b7;7 94 (90-97) 59 (52-65) èc;F508/R553X 164 2&#b7;5 &#b1; 0&#b7;4 106 &#b1; 1&#b7;4 76 &#b1; 1&#b7;8 89 &#b1; 1&#b7;6 139 &#b1; 0&#b7;9 35&#b7;4 &#b1; 0&#b7;7&#a7; 90 (85-94) 60 (53-67) èc;F508/621-1G 162 2&#b7;5 &#b1; 0&#b7;4 107 &#b1; 1&#b7;3 78 &#b1; 1&#b7;8 89 &#b1; 1&#b7;5 143 &#b1; 1&#b7;0&#a7; 38&#b7;8 &#b1; 0&#b7;8&#a7; 87 (80-91)&#a7; 57 (49-64) èc;F508/èc;I507 149 8&#b7;5 &#b1; 1&#b7;1ߥ 95 &#b1; 1&#b7;9ߥ 86 &#b1; 2&#b7;1ߥ 93 &#b1; 1&#b7;8&#a7; 137 &#b1; 1&#b7;4&#a7; 37&#b7;4 &#b1; 1&#b7;25 84 (78-89)ߥ 39 (31-48)ߥ èc;F508/R117H 123 13&#b7;7 &#b1; 1&#b7;2ߥ 80 &#b1; 1&#b7;9ߥ 91 &#b1; 2&#b7;1ߥ 97 &#b1; 1&#b7;7ߥ 143 &#b1; 1&#b7;8 42&#b7;9 &#b1; 1&#b7;7ߥ 65 (55-73)ߥ 22 (16-29)ߥ èc;F508/3849+10 kB 114 11&#b7;3 &#b1; 0&#b7;9ߥ 72 &#b1; 2&#b7;5ߥ 77 &#b1; 2&#b7;1 87 &#b1; 1&#b7;9 144 &#b1; 1&#b7;4&#a7; 41&#b7;2 &#b1; 1&#b7;2ߥ 66 (57-74)ߥ 69 (59-77) èc;F508/2789+5G 63 13&#b7;4 &#b1; 1&#b7;6ߥ 102 &#b1; 2&#b7;1 88 &#b1; 2&#b7;8ߥ 97 &#b1; 2&#b7;3ߥ 140 &#b1; 2&#b7;5 41&#b7;8 &#b1; 2&#b7;2&#a7; 71 (59-81)ߥ 32 (22-44)ߥ èc;F508/1717-1G 74 1&#b7;3 &#b1; 0&#b7;3 103 &#b1; 2&#b7;0 75 &#b1; 2&#b7;7 86 &#b1; 2&#b7;4 139 &#b1; 1&#b7;5 35&#b7;7 &#b1; 0&#b7;9 96 (88-99) 59 (48-69) èc;F508/R560T 46 1&#b7;7 &#b1; 0&#b7;5 104 &#b1; 2&#b7;0 84 &#b1; 3&#b7;3ߥ 96&#b1; 2&#b7;8&#a7; 142 &#b1; 1&#b7;9 38&#b7;4 &#b1; 1&#b7;4 91 (79-97) 63 (48-75) èc;F508/R347P 44 5&#b7;9 &#b1; 1&#b7;1&#a7; 105 &#b1; 2&#b7;6 76 &#b1; 3&#b7;0 90 &#b1; 2&#b7;9 142 &#b1; 2&#b7;4 38&#b7;7 &#b1; 1&#b7;8 67 (52-79)ߥ 53 (38-68) èc;F508/G85E 43 9&#b7;2 &#b1; 1&#b7;8ߥ 99 &#b1; 2&#b7;3&#a7; 76 &#b1; 2&#b7;5 90 &#b1; 2&#b7;5 142 &#b1; 2&#b7;9 38&#b7;3 &#b1; 2&#b7;2 88 (75-95) 52 (35-68) èc;F508/3659DC 40 1&#b7;1 &#b1; 0&#b7;4 105 &#b1; 2&#b7;1 76 &#b1; 3&#b7;9 88 &#b1; 4&#b7;1 139 &#b1; 1&#b7;9 36&#b7;6 &#b1; 1&#b7;2 92 (77-97) 55 (39-69) èc;F508/A455E 29 14&#b7;3 &#b1; 2&#b7;0ߥ 89 &#b1; 3&#b7;1ߥ 98 &#b1; 4&#b7;0ߥ 104 &#b1; 3&#b7;4ߥ 138 &#b1; 3&#b7;4 42&#b7;1 &#b1; 2&#b7;5&#a7; 60 (41--76)ߥ 17 (8-32)ߥ èc;F508/R334W 28 13&#b7;2 &#b1; 3&#b7;0ߥ 104 &#b1; 3&#b7;2 86 &#b1; 3&#b7;4&#a7; 94 &#b1; 3&#b7;3 138 &#b1; 3&#b7;2 42&#b7;3 &#b1; 3&#b7;5 67 (46-82)ߥ 51 (32--70) èc;F508/R1162X 26 1&#b7;9 &#b1; 1&#b7;1 101 &#b1; 2&#b7;3 77 &#b1; 4&#b7;2 92 &#b1; 4&#b7;6 138 &#b1; 1&#b7;8 36&#b7;5 &#b1; 1&#b7;4 92 (75-98) 65 (47-80) èc;F508/1898+1G 20 1&#b7;2 &#b1; 0&#b7;3 99 &#b1; 2&#b7;8 83 &#b1; 4&#b7;1 94 &#b1; 4&#b7;4 138 &#b1; 3&#b7;3 35&#b7;1 &#b1; 2&#b7;1 85 (61--95) 63 (39-82) èc;F508/2184DA 20 2&#b7;3 &#b1; 0&#b7;9 106 &#b1; 5&#b7;3 82 &#b1; 4&#b7;3 92 &#b1; 4&#b7;4 141 &#b1; 3&#b7;0 36&#b7;5 &#b1; 1&#b7;5 94 (69-99) 60 (38-79) èc;F508/711+1G 17 1&#b7;3 &#b1; 0&#b7;5 108 &#b1; 4&#b7;6 83 &#b1; 4&#b7;2 94 &#b1; 4&#b7;4 137 &#b1; 3&#b7;4 36&#b7;7 &#b1; 2&#b7;9 100 73 (50-88) èc;F508/S549N 11 6&#b7;4 &#b1; 1&#b7;9&#a7; 109 &#b1; 5&#b7;7 67 &#b1; 6&#b7;1 77 &#b1; 7&#b7;2 140 &#b1; 3&#b7;2 36&#b7;7 &#b1; 2&#b7;6 92 (62-99) 71 (40--90) èc;F508/Other 2 262 5&#b7;8 &#b1; 0&#b7;2ߥ 99 &#b1; 0&#b7;4ߥ 80 &#b1; 0&#b7;5ߥ 91 &#b1; 0&#b7;5ߥ 141 &#b1; 0&#b7;3 38&#b7;1 &#b1; 0&#b7;3ߥ 86 (84-87)ߥ 50 (48-52)ߥ Other/Other 1 551 7&#b7;5 &#b1; 0&#b7;3ߥ 93 &#b1; 0&#b7;6ߥ 82 &#b1; 0&#b7;6ߥ 90 &#b1; 0&#b7;6&#a7; 141 &#b1; 0&#b7;4 38&#b7;3 &#b1; 0&#b7;3ߥ 81 (80-84)ߥ 40 (38-43)ߥ Data are mean (SE) unless otherwise indicated.
X
ABCC7 p.Ser549Asn 12767731:67:4145
status: NEW
PMID: 1372093
[PubMed]
Cuppens H et al: "Simultaneous screening for 11 mutations in the cystic fibrosis transmembrane conductance regulator gene by multiplex amplification and reverse dot-blot."
No.
Sentence
Comment
19
Frequency of 31 mutations in the CFTR gene in 194 Belgian CF chromosomes The 51255X, W1316X ;5 S549N, G551D, R553X, A559T;6 D110H, R117H, R347P;' Q493X, S5491, S549R(T-+G), R560T, Y563N, P574H ;9 W846X, Y913C;10 2556insAT;" R334W;" S549R(A-+C);'6 444delA, 3821deIT;" 621 +1G-*T18 mutations were not present in this random sample of the Belgian CF population .
X
ABCC7 p.Ser549Asn 1372093:19:95
status: NEW
PMID: 1377276
[PubMed]
Lerer I et al: "Cystic fibrosis mutations delta F508 and G542X in Jewish patients."
No.
Sentence
Comment
8
The majority of these are rare mutations observed in single families but some mutations are relatively frequent.3 We have screened CF patients for the AF508 mutation and for G542X, G551D, R553X, and S549N or I, all within exon 11, and for the splice mutation 1717-1G-.A.
X
ABCC7 p.Ser549Asn 1377276:8:199
status: NEW21 S549N or I eliminates a DdeI site.4 RFLPs were analysed by either Southern blot hybridisation or by PCR.
X
ABCC7 p.Ser549Asn 1377276:21:0
status: NEW
PMID: 16635477
[PubMed]
Lucarelli M et al: "A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene."
No.
Sentence
Comment
26
None of these subjects showed any clinical manifestations of CF, nor were any positive for CFTR mutations when analyzed by means of the PCR/OLA/SCS method (Celera Diagnostics) [21], which searches for the most common worldwide 31 CFTR mutations (G85E, R117H, Y122X, 621+1G->T, 711+1G->T, 1078delT, R347P, R347H, R334W, A455E, DF508, DI507, Q493X, V520F, 1717-1G->A, G542X, G551D, R553X, R560T, S549R(T->G), S549N, 1898+1G->A, 2183AA->G, 2789+5G->A, R1162X, 3659delC, 3849+10kbC->T, 3849+4A->G, W1282X, 3905insT, N1303K), including the 12 most common in Italy [1,22].
X
ABCC7 p.Ser549Asn 16635477:26:407
status: NEW
PMID: 16963320
[PubMed]
Perez MM et al: "CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent."
No.
Sentence
Comment
42
Some have concentrated in the search of specific mutations that are Table 1 Mutations found in the Latin American CF patients Exon 1 p.L6VÌe; Exon 3 p.W57X, p.R75X, p.G85E Exon 4 p.R117H Exon 6a p.H199Y, p.V201M, p.L206W, p.Q220X, p.V232D, c.846delTÌe; Exon 6b p.Y275XÌe;, c.935delA Exon 7 p.R334W, p.R347P, p.Y362XÌe;, c.1078delT, c.1215delG Exon 8 c.1323_1324insAÌe; Exon 9 c.1460_1461delATÌe;, c.1353_1354insTÌe;,# Exon 10 p.I506T, p.I507del, p.F508del Exon 11 p.G542X, p.S549N, p.S549R, p.G551D, p.G551S, p.R553X, p.L558S, p.A559T, c.1782delA Exon 12 p.S589I Exon 13 p.H609RÌe;, p.P750L, p.V754M, c.1924_1930del, c.2055_2063del, c.2183AA NG;c.2184delA, c.2184delA, c.2185_2186insC, c.2347delG, c.2566_2567insTÌe;, c.2594_2595delGTÌe; Exon 14a p.R851L, c.2686_2687insTÌe; Exon 15 c.2869_2870insG Exon 16 c.3120+1GNA Exon 17a p.I1027T, c.3171delC, c.3199_3204del Exon 17b p.G1061R, p.R1066C, p.W1069X#, p.W1089X, p.Y1092X, p.W1098CÌe; Exon 19 p.R1162X, p.W1204X, p.Q1238X, c.3617_3618delGAÌe;#, c.3659delC Exon 20 p.W1282X, p.R1283M Exon 21 p.N1303K, c.4016_4017insT Exon 22 c.4160_4161insGGGGÌe; 5' flanking c.-834GNT Intron 2 c.297-1GNAÌe;, c.297-2ANG Intron 3 c.406-1GNA Intron 4 c.621+1GNT Intron 5 c.711+1GNT Intron 8 c.IVS8-5T Intron 10 c.1716GNA, c.1717-1GNA Intron 11 c.1811+1.6KbANG, c.1812-1GNA Intron 12 c.1898+1GNA, c.1898+3ANG Intron 14 c.2789+2_2789+3insA, c.2789+5GNA Intron 17a c.3272-26ANG Intron 17b c.3500-2ANGÌe; Intron 19 c.3849+1GNA, c.3849+10KbCNT Intron 20 c.4005+1GNA, c.4005-1GNA# Mutations are listed according to their position in the gene.
X
ABCC7 p.Ser549Asn 16963320:42:503
status: NEW51 Table 2 p.I507del p.S549N p.S549R p.G551D p.G551S p.R553X p.L558S p.A559T p.S589I p.H609RÌe; p.P750L p.V754M p.R851L p.I1027T p.G1061R p.R1066C p.W1069X# p.W1089X p.Y1092X p.W1098CÌe; p.W1204X 3 0 1 0 1 1 1 1 1 0 4 1 2 3 1 3 0.24 1 0.08 1 0.08 6 0.48 2 0.16 1 0.08 1 0.08 4 0.32 1 0.08 1 4 1 2 1 1 0 0 0 1 0 0 0 1 1 0 1 0 2 0 1 3 0 0 0 0 0 0 1 0.05 1 0.05 1 0.05 10 0.54 1 0.05 2 0.11 3 0.16 3 0 0 0 1 0 1 1 2 0.79 4 1.58 4 1 1 1 1 4 1.83 1 0.46 1 0.46 1 0.46 1 0.46 0 0 0 0 0 0 0 5 5 1 1 1 1 1 1 1 1 1 1 1 5 1.82 6 2.19 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 1.31 1 1.31 1 1.31 10 6 6 6 1 22 1 1 2 1 1 1 1 1 1 6 1 3 5 1 1 0.23 0.14 0.14 0.14 0.02 0.51 0.02 0.02 0.05 0.02 0.02 0.02 0.02 0.02 0.02 0.14 0.02 0.07 0.11 0.02 0.02 (continued on next page) Table 2 Mutation frequencies in Latin American CF patients Country p.Q1238X p.R1283M c.-834GNT c.297-1GNA* c.297-2ANG c.406-1GNA c.621+1GNT c.711+1GNT c.846delT* c.935delA c.1078delT c.1215delG c.1323_1324insA* c.1353_1354insT*# c.1460_1461delAT* Argentina 1 3 1 1 1 1 1 Subtotal and frequency (%) 1 0.08 1 0.08 4 0.32 1 0.08 1 0.08 1 0.08 Brazil 1 1 1 1 0 0 Subtotal and frequency (%) 1 0.05 2 0.11 1 0.05 Chile 0 0 Subtotal and frequency (%) Colombia 1 1 Subtotal and frequency (%) 1 0.46 1 0.46 Costa Rica Frequency (%) 0 Cuba Frequency (%) Ecuador Subtotal and frequency (%) Mexico 1 3 1 2 1 1 Subtotal and frequency (%) 1 0.36 3 1.09 1 0.36 1 0.36 2 0.73 1 0.36 Uruguay Frequency (%) 1 1.31 Venezuela Subtotal and frequency (%) Total 1 1 1 1 1 3 7 2 1 2 1 1 1 1 1 Frequency (%) 0.02 0.02 0.02 0.02 0.02 0.07 0.16 0.05 0.02 0.05 0.02 0.02 0.02 0.02 0.02 (continued ) Table 2 c.1716GNA c.1717-1GNA c.1782delA c.1811+1,6KbANG c.1812-1GNA c.1898+1GNA c.1898+3ANG c.1924_1930del c.2055_2063del c.2183AANG;c.2184delA c.2184delA c.2185_2186insC 5 1 4 1 1 1 0 1 2 2 6 0.48 1 0.08 6 0.48 2 0.16 1 0.08 1 0.08 1 0.08 1 0 6 5 1 3 0 0 0 0 7 0.37 5 0.27 1 0.05 3 0.16 0 0 12 1 12 5.50 1 0.46 0 0 1 1 2 2 1 0.36 1 0.36 2 0.73 2 0.73 1 1.31 1 14 1 18 5 3 1 1 2 6 1 1 0.02 0.32 0.02 0.41 0.11 0.07 0.02 0.02 0.05 0.14 0.02 0.02 (continued on next page) Table 2 Mutation frequencies in Latin American CF patients Country c.2347delG c.2566_2567insT* c.2594_2595delGT* c.2686_2687insT* c.2789+2_2789+3insA c.2789+5GNA c.2869_2870insG c.3120+1GNA c.3171delC c.3199_3204del c.3272-26ANG c.3500-2ANG* Argentina 2 1 2 2 3 3 1 1 2 Subtotal and frequency (%) 2 0.16 1 0.08 2 0.16 2 0.16 6 0.48 1 0.08 1 0.08 2 0.16 Brazil 2 1 1 1 6 0 0 4 0 Subtotal and frequency (%) 2 0.11 1 0.05 1 0.05 10 0.54 1 0.05 Chile Subtotal and frequency (%) Colombia 1 1 1 Subtotal and frequency (%) 1 0.46 1 0.46 1 0.46 Costa Rica Frequency (%) Cuba Frequency (%) Ecuador Subtotal and frequency (%) Mexico 2 Subtotal and frequency (%) 2 0.73 Uruguay Frequency (%) 1 1.31 Venezuela Subtotal and frequency (%) Total 2 2 1 3 2 9 1 12 1 2 2 1 Frequency (%) 0.05 0.05 0.02 0.07 0.05 0.21 0.02 0.28 0.02 0.05 0.05 0.02 (continued ) Table 2 c.3617_3618delGA*,# c.3659delC c.3849+1GNA c.3849+10kbCNT c.4005+1GNA c.4005-1GNA# c.4016_4017insT c.4160_4161insGGGG* c.IVS8-5T Unknown Authors 37 Aulehla-Scholz [17] 2 4 1 2 4 76 Visich [12] 1 78 Iba&#f1;ez [18] 54 Varela 2004 8 Prieto [19] 2 1 1 1 18 Oller-Ramirez 2004 4 0.32 6 0.48 1 0.08 1 0.08 2 0.16 5 0.40 271 21.75 205 Raskin [20] 32 Chiba [21] 1 89 Bernardino [22] 60 Marostica [23] 69 Parizotto [24] 99 Cabello [25,26] 33 Martins [27] 70 Streit [28] 0 5 120 Raskin [15] 0 0 12 Goloni-Bertollo [29] 1 0.05 5 0.27 789 42.46 48 Rios [30] 22 Molina [31] 1 11 Navarro [32] 0 3 34 Repetto [33] 4 1.58 115 45.63 1 67 Keyeux [14] 17 Restrepo [34] 1 0.46 84 38.53 0 25 52.08 Venegas [35] 95 65.97 Collazo [36] 20 Merino [37] 30 Cassiman 2004 15 Paz-y-Mino [38] 65 63.72 1 1 53 Orozco [13] 2 35 Villalobos [39] 3 1.09 1 0.36 88 32.11 11 14.47 Luzardo [40,41] 36 Restrepo [34] 41 Alvarado [42] 77 56.62 1 4 1 18 1 1 2 1 5 1620 0.02 0.09 0.02 0.41 0.02 0.02 0.05 0.02 0.11 37.21 Mutation frequencies in Latin American CF patients most frequently found in Caucasians, by allele specific polymerase chain reaction (AS-PCR), enzymatic digestion, allele specific oligonucleotide hybridization (ASO), or using mainly commercial kits, whereas other studies used a systematic approach to analyse the promoter, coding and exon/ intron boundaries of the CFTR region in the search for any possible mutation.
X
ABCC7 p.Ser549Asn 16963320:51:20
status: NEW69 As shown in Table 4, 19 of them have overall frequencies of 0.1% to 1% in Latin America and could be considered as rare, but some of them have local elevated frequencies, like c.1811+1.6KbANG in Colombia (from 4.2% to 10.5% in the different geographical regions studied) [14, 46], p.G85E in Ecuador (8.9%) (Ruiz et al., personal communication), Uruguay (3.95%) [41], Brazil (2.33%) [15] and Argentina (2.26%) [18], p.R334W in Brazil (2.6%) [15, 22] and p.I507del (2.58%) and p.S549N (2.5%) in Mexico [13] (Table 2).
X
ABCC7 p.Ser549Asn 16963320:69:477
status: NEW90 Table 4 Mutations with frequencies between 0.1% and 1% Mutation Frequency Country Number of chromosomes % p.R334W 39 0.90 Argentina, Brazil, Chile, Colombia, Uruguay p.G85E 32 0.73 Argentina, Brazil, Ecuador, Mexico, Uruguay p.R553X 22 0.51 Argentina, Brazil, Chile, Mexico, Uruguay c.1811+1.6KbANG 18 0.41 Argentina, Colombia c.3849+10KbCNT 18 0.41 Argentina, Mexico c.1717-1GNA 14 0.32 Argentina, Brazil, Uruguay c.3120+1GNA 12 0.28 Argentina, Brazil Colombia p.I507del 10 0.23 Brazil, Mexico, Uruguay c.2789+5GNA 9 0.21 Argentina, Brazil, Colombia, Uruguay c.621+1GNT 7 0.16 Argentina, Brazil, Mexico p.S549N 6 0.14 Mexico p.S549R 6 0.14 Argentina, Brazil, Colombia p.G551D 6 0.14 Argentina, Mexico p.R1066C 6 0.14 Argentina, Colombia, Mexico c.2183ANG;c.2184delA 6 0.14 Argentina, Mexico p.Y1092X 5 0.11 Colombia, Mexico c.1812-1GNA 5 0.11 Brazil c.IVS8-5T 5 0.11 Argentina c.3659delC 4 0.09 Argentina Unfortunately, at present not all Latin-American countries have started molecular studies in their patients with a probable Cystic Fibrosis diagnosis.
X
ABCC7 p.Ser549Asn 16963320:90:606
status: NEW111 As discussed, another way to disclose similarities or differences in the distribution of mutations in the CF patients from Latin Table 6 Screening panel of CFTR mutations Country Total number of mutations Minimum panel Detection power Uruguay 12 6 mutations: p.F508del, p.G542X, p.R1162X, p.N1303K (p.R334W, p.G85E) 78% Argentina 52 7 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.R334W, p.G85E) 71% M&#e9;xico 35 8 mutations: p.F508del, p.G542X, p.N1303K (p.R75X, p.I507del, p.S549N,c.406-1GNA, c.3849+10kbGNA) 58% Colombia 19 7 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.S549R, c.1811+1.6kbANG) 56% Brazil 41 6 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.R334W) 53% The total number of mutations found in each country is indicated in the second column from left.
X
ABCC7 p.Ser549Asn 16963320:111:495
status: NEW
No.
Sentence
Comment
63
TABEL 1 Classificatie van mutaties in het 'cystic fibrosis transmembrane conductance regulator`(CFTR)-gen op chromosoom 7 klasse mechanisme enkele bekende mutaties I geen synthese van het CFTR-eiwit G542X R553X W1282X R1162X 621-1GT 1717-1GA 1078࢞T 3659࢞C II defect in eiwitrijping met voortijdig afbraak ࢞F508 ࢞I507 N1303K S549N III verstoorde regulatie van de CFTR-functie G551D R56OT IV verstoorde conductie van chloride of verstoorde kanaalopening R117H R334W G85E R347P V minder synthese van het CFTR-eiwit 3849+10KbCT 2789+5GA A455E TABEL 2 Diagnostiek van cystische fibrose test testuitslag klassieke CF* niet-klassieke CFߤ zweettest chlorideconcentratie > 60 mmol/l chlorideconcentratie ࣘ 60 mmol/l neuspotentiaalmeting afwijkend niet-afwijkend CFTR-mutatie-analyse 2 mutaties 2 mutaties CF = cystische fibrose; CFTR = 'cystic fibrosis transporter regulator`-gen.
X
ABCC7 p.Ser549Asn 20619026:63:362
status: NEW
PMID: 22043142
[PubMed]
Lilley M et al: "Newborn screening for cystic fibrosis in Alberta: Two years of experience."
No.
Sentence
Comment
46
These include the following mutations: delF508, I507del, G542X, G85E, R117H, 621+1GT, 711+1GT, G551D, R334W, R347P, A455E, 1717-1GA, R560T, R553X, N1303K, 1898+1GA, 2184delA, 2789+5GA, 3120+1GA, R1162X, 3659delC, 3849+10kbCT, W1282X, 1078delT, 394delTT, Y122X, R347H, V520F, A559T, S549N, S549R, 1898+5GT, 2183AAG, 2307insA, Y1092X, M1101K, S1255X, 3876delA and 3905insT.
X
ABCC7 p.Ser549Asn 22043142:46:331
status: NEW84 TAbLe 1 Mutation frequency Mutation name Number of times detected (247 total mutations) Frequency, % expected, % (reference) delF508* 156 63.2 68.6 (1) R117H* 36 14.6 0.7 (1) G551D* 11 4.5 2.1 (1) 3849+10kbCT* 6 2.4 0.7 (1) M1101K 5 2.0 Undetermined (1) G542X* 4 1.6 2.4 (1) 1717-1GA* 4 1.6 0.7 (1) 621+1GT* 3 1.2 0.9 (1) 3120+1GA* 3 1.2 1.5 (1) G85E* 2 0.8 0.3 (1) A455E* 2 0.8 0.2 (1) R553X* 2 0.8 0.9 (1) 2789+5GA* 2 0.8 0.3 (1) ƊI507* 1 0.4 0.3 (1) 711+1GT* 1 0.4 0.1 (1) R334W* 1 0.4 0.2 (1) N1303K* 1 0.4 1.3 (1) 1898+1GA* 1 0.4 Undetermined (1) 2184delA* 1 0.4 0.1 (1) 394delTT 1 0.4 Undetermined (1) R347H 1 0.4 0.2 (4) V520F 1 0.4 0.2 (4) S549N 1 0.4 0.1 (1) 2307insA 1 0.4 0.2 (1) R347P* 0 0 0.2 (1) R560T* 0 0 0.2 (1) R1162X* 0 0 0.2 (1) 3659delC* 0 0 0.2 (1) W1282X* 0 0 1.4 (1) 1078delT 0 0 0.03 (2) Y122X 0 0 Undetermined (3) A559T 0 0 0.2 (1) S549R 0 0 Undetermined (1) 1898+5GT 0 0 Undetermined (1) 2183AAG 0 0 0.1 (1) Y1092X 0 0 Undetermined (1) S1255X 0 0 0.2 (1) 3876delA 0 0 Undetermined (4) 3905insT 0 0 0.12 (1) *American College of Medical Genetics-recommended mutations TAbLe 2 Positive cystic fibrosis newborn screen summary Screen result Unaffected Affected Further follow-up required Lost to follow-up Total Probable screen 0 23 0 0 23 Inconclusive screen One mutation 179 8 2 2 191 Markedly elevated IRT 2 0 0 0 2 R117H/F508del 0 0 5 0 5 Total 181 31 7 2 221 Data presented as n. IRT Immunoreactive trypsinogen TAbLe 3 F508del/R117H cases ID number Mutation status Sweat test result(s), &#b5;mol/L Other clinical information 24827 F508del/R117H 28 None 23726 F508del/R117H 36/insufficient/20 Fecal elastase normal 22578 F508del/R117H 10 None 24500 F508del/R117H 34/insufficient None 18527 F508del/R117H 29 None 23317 F508del/R117H+5T 47/62 Affected sibling 5T 5 thymine There were 23 newborns with probable screens.
X
ABCC7 p.Ser549Asn 22043142:84:702
status: NEW
PMID: 23199563
[PubMed]
Leonard A et al: "[Mucoviscidosis: CFTR mutation-specific therapy: a ray of sunshine in a cloudy sky]."
No.
Sentence
Comment
178
De re &#b4;centes donne &#b4;es in vitro sugge `rent que cette me &#b4;dication soit e &#b4;galement efficace sur 9 autres mutations de la me c6;me classe (G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, G1349D) [50,51].
X
ABCC7 p.Ser549Asn 23199563:178:166
status: NEW
PMID: 23810505
[PubMed]
Prach L et al: "Novel CFTR variants identified during the first 3 years of cystic fibrosis newborn screening in California."
No.
Sentence
Comment
26
Newborns were screened using the California method, which includes i) analysis of serum immunoreactive trypsinogen (IRT) levels using the AutoDELFIA neonatal IRT L kit (PerkinElmer, Waltham, MA) in all newborn blood spot specimens, ii) CFTR mutation panel [29-40 mutations (the mutations on the California panel were selected for the most part according to allelic frequencies found in a comprehensively genotyped group of California CF cases to achieve a 95% race/ethnicity-specific rate of CF case detection in black, white, and Hispanic individuals in California and include c.1585-1G>A, c.1680-1G>A, c.1973-1985del13insAGAAA, c.2175_2176insA, c.164 &#fe; 2T>A (removed on August 12, 2008), c.2988 &#fe; 1G>A, c.3717 &#fe; 12191C>T, c.3744delA, c.274-1G>A, c.489 &#fe; 1G>T, c.579 &#fe; 1G>T, p.A559T, p.F311del, p.F508del, p.I507del, p.G542X, p.G551D, p.G85E, p.H199Y, p.N1303K, p.R1066C, p.R1162X, p.R334W, p.R553X, p.S549N, p.W1089X, p.W1204X (c.3611G>A), p.W1282X, c.1153_1154insAT [added October 4, 2007], c.1923_1931del9insA, c.3140-26A>G, c.531delT, c.803delA, c.54-5940_273 &#fe; 10250del21kb, p.P205S, p.Q98R, p.R75X, p.S492F [added December 12, 2007], c.3659delC, p.G330X, p.W1204X [c.3612G>A] [added August 12, 2008] [Signature CF 2.0 ASR; Asuragen Inc., Austin, TX])] testing of specimens with IRT 62 ng/mL (highest 1.5%), iii) CFTR gene scanning and sequence analysis (Ambry Test: CF; Ambry Genetics, Aliso Viejo, CA) for specimens found to have only one mutation after CFTR mutation panel testing, and iv) referral to 1 of 15 pediatric CF care centers (CFCs) for sweat chloride (SC) testing and follow-up of all newborns with either two CFTR mutations detected during panel testing or one CFTR mutation detected during panel testing and one (or more) additional CFTR mutation and/or variant detected during sequencing.
X
ABCC7 p.Ser549Asn 23810505:26:924
status: NEW
PMID: 23866907
[PubMed]
Landaburu I et al: "Genetic testing of sperm donors for cystic fibrosis and spinal muscular atrophy: evaluation of clinical utility."
No.
Sentence
Comment
51
The panel of mutations studied was: S549N, S549R, R553X, G551D, V520F, I507del, F508del, 3876delA, 1717-1G->A, G542X, R560T, 3120+1G->A, A455E, R117H, 394delTT, 2183AA- >G, 2184delA, 2789+5G->A, 1898+1G->A, 621+1G->T, 711+1G- >T, G85E, R347P, R347H, W1282X, R334W, 1078delT, 3849+10kbC->T, R1162X, N1303K, 3659delC, 3905insT.
X
ABCC7 p.Ser549Asn 23866907:51:36
status: NEW
PMID: 23891399
[PubMed]
Van Goor F et al: "Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function."
No.
Sentence
Comment
28
These include the most common CFTR gating mutation, G551D, as well as the G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D mutations [12].
X
ABCC7 p.Ser549Asn 23891399:28:81
status: NEW
PMID: 24030637
[PubMed]
Deeks ED et al: "Ivacaftor: a review of its use in patients with cystic fibrosis."
No.
Sentence
Comment
35
For example, in rodent cells expressing G551D/S, G178R, S549N/R, G970R, G1244E, S1251N, S1255P or G1349D CFTR, ivacaftor increased channel open probability from B5 % of normal at baseline to 30-118 % of normal and increased chloride transport C16- fold (EC50 124-594 nmol/L).
X
ABCC7 p.Ser549Asn 24030637:35:56
status: NEW
PMID: 24357848
[PubMed]
Zvereff VV et al: "Cystic fibrosis carrier screening in a North American population."
No.
Sentence
Comment
44
RESULTS The 32-mutation panel is composed of the 23 variants from the ACMG/ACOG screening panel combined with 9 additional mutations, namely, 3876delA, R347H, S549N, 3905insT, 1078delT, V520F, 394delTT, S549R, and 2183AA>G.
X
ABCC7 p.Ser549Asn 24357848:44:159
status: NEW63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population.
X
ABCC7 p.Ser549Asn 24357848:63:937
status: NEWX
ABCC7 p.Ser549Asn 24357848:63:2358
status: NEW99 Several alleles not found on the ACMG/ACOG panel were found at relatively high frequency (Table 2), including D1152H (4.0%), L206W (2.4%), c.3744delA (0.9%), F311del (0.8%), R117C (0.7%), and S549N (0.6%).
X
ABCC7 p.Ser549Asn 24357848:99:192
status: NEW107 These variants are 3876delA, S549N, 406-1G>A, 3199del6, W1089X, R1158X, R352Q, and 2183AA>G, and they account for 8.1% of the mutations detected in the Hispanic population.
X
ABCC7 p.Ser549Asn 24357848:107:29
status: NEW
PMID: 24440181
[PubMed]
De Boeck K et al: "The relative frequency of CFTR mutation classes in European patients with cystic fibrosis."
No.
Sentence
Comment
56
Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations Large deletions and insertions 1078delT; 1717-1GA; 3659delC; 621+1GT Class II Defective protein processing G85E, F508del, I507del, R560T, N1303K Class III Defective protein regulation ('gating`) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R117H, R334W, R347P Class V Reduced amount of functioning protein 2789+5GA, 3849+10KbCT, A455E Unclassified All other mutations, including those unknown.
X
ABCC7 p.Ser549Asn 24440181:56:336
status: NEW
PMID: 24440239
[PubMed]
Muthuswamy S et al: "Spectrum and distribution of CFTR gene mutations in asthma and chronic pancreatitis cases of North Indian population."
No.
Sentence
Comment
3
Methods: A total of 800 subjects including 400 controls, 250 asthma cases and150 chronic pancreatitis cases were analyzed for 6 mutations (F508del, G542X, G551D, R117H, W1282X, and S549N) and IVS8 Tn polymorphism.
X
ABCC7 p.Ser549Asn 24440239:3:181
status: NEW6 The carrier frequency of F508del, G542X, G551D, R117H, S549N and T5 was 0.015, 0.025, 0.02, 0.005, 0.005, and 0.022 respectively.
X
ABCC7 p.Ser549Asn 24440239:6:55
status: NEW50 PCR RFLP S549N mutation was analyzed by PCR RFLP (Kerem et al., 1990).
X
ABCC7 p.Ser549Asn 24440239:50:9
status: NEW63 Mutation Primer Method Amplicon (size in bp) Reference DF508 C GACTTCACTTCTAATGATGATTATGGGAG ARMS Ferrie et al. (1992) N GTATCTATATTCATCATAGGAAACACCAC 160 M GTATCTATATTCATCATAGGAAACACCAT 157 G551D C TAAAATTTCAGCAATGTTGTTTTTGACC N GCTAAAGAAATTCTTGCTCGTTGCC 285 M AGCTAAAGAAATTCTTGCTCGTTGCT 286 G542X C TAAAATTTCAGCAATGTTGTTTTTGACC N ACTCAGTGTGATTCCACCTTCTAC 256 M CACTCAGTGTGATTCCACCTTCTCA 257 R117H C CACATATGGTATGACCCTCTATATAAACT N CCTATGCCTAGATAAATCGCGATAGAAC 237 M CCTATGCCTAGATAAATCGCGATAGAAT 237 S549N For TTCAGCAATGTTGTTTTGACCAAC RFLP (DdeI) N: 13 + 238 + 174 H: 13 + 238 + 174 + 412 M: 13 + 412 Kerem et al. (1990) Rev CACAGATTCTGAGTAACCATAATC IVS8 Tn For1 TAATGGATCATGGGCCATGT Nested PCR (Xmn1) 5T - 84 7T - 86 9T - 88 Chillon et al. (1995) Rev1 ACAGTGTTGAATGTGGTGCA For2 CCGCCGCTGTGTGTGTGTGTGTGTTTTT Rev2 GGATCCAGCAACCGCCAACA 3.
X
ABCC7 p.Ser549Asn 24440239:63:501
status: NEW71 Controls (n = 400) Minor allele frequency of F508del, G542X, G551D, R117H and S549N observed to be 0.0075, 0.0125, 0.01, 0.0025 and 0.0025 respectively (Table 2).
X
ABCC7 p.Ser549Asn 24440239:71:78
status: NEW73 We further stratified data as per their prevalence and found G542X to be the most common mutation with the frequency of 2.49%, followed by G551D, F508del, R117H and S549N with 2.00%, 1.50%, 0.50% and 0.50% respectively and 2.24% for 5T allele (Fig. 1A).
X
ABCC7 p.Ser549Asn 24440239:73:165
status: NEW75 Asthma cases (n = 250) We observed a minor allele frequency of 0.008, 0.022, 0.028, 0.002, 0.01 and 0.058 for F508del, G452X, G551D, R117H, S549N and IVS8 T5 respectively (Table 2).
X
ABCC7 p.Ser549Asn 24440239:75:140
status: NEW76 The frequency of individuals falling in different mutations were 10%, 5.6%, 4.4%, 2.0%, 1.6% and 0.4% with respect to IVS8 T5, G551D, G542X, S549N, F508del and R117H (Fig. 1B).
X
ABCC7 p.Ser549Asn 24440239:76:141
status: NEW78 CP cases (n = 150) 300 chromosomes belonging to this subgroup found to have the minor allele frequency of 0.04, 0.03, 0.03, 0.006, 0.013 and 0.02 for F508del, G452X, G551D, R117H, S549N and IVS8 T5 respectively (Table 2).
X
ABCC7 p.Ser549Asn 24440239:78:180
status: NEW79 The frequency of heterozygous individuals were 8.67%, 6.67%, 6.00%, 2.67%, 1.33% and 4.00% for F508del, G452X, G551D, R117H, S549N and IVS8 T5 respectively (Fig. 1C).
X
ABCC7 p.Ser549Asn 24440239:79:125
status: NEW98 R117H and S549N mutations The mutation falls in class IV and class III categories respectively.
X
ABCC7 p.Ser549Asn 24440239:98:10
status: NEW101 Similarly, the genotype frequency of S549N mutation of CP (2.7%/150), asthma (2%/250) and controls (0.5%/400) showed no significance.
X
ABCC7 p.Ser549Asn 24440239:101:37
status: NEW112 Serial no. Mutation General population (400) Asthma (250) Chronic pancreatitis (150) 1 DF508 0.0075 0.0080 0.0433 2 G542X 0.0125 0.0220 0.0333 3 G551D 0.01 0.0280 0.03 4 R117H 0.0025 0.0020 0.0066 5 S549N 0.0025 0.0100 0.0133 6 IVS8-5T 0.01125 0.0580 0.02 thrive, pancreatic insufficiency, elevated sweat electrolytes, late-stage diabetes and cardiac failure, besides male infertility due to congenital bilateral absence of the vas deferens (CBAVD) (Schrijver et al., 2005).
X
ABCC7 p.Ser549Asn 24440239:112:199
status: NEW118 A) Among the studied 5 mutation and 1 polymorphism, G542X mutation accounts for 27% (10 out of 37) in controls and the least one is S549N of 5% (2 out of 37).
X
ABCC7 p.Ser549Asn 24440239:118:132
status: NEW134 Serial No. Mutation General population (n = 400)% Asthma (n = 250)% Chronic pancreatitis (n = 150)% Chi square-testÌe; P value Asth vs ctrl Cp vs ctrl Asth vs CP 1 DF508 1.5 1.6 8.7 NS 0.0002 0.0013 2 G542X 2.5 4.4 6.7 NS 0.03 NS 3 G551D 2.0 5.6 6.0 0.02 0.02 NS 4 R117H 0.5 0.4 1.3 NS NS NS 5 S549N 0.5 2 2.7 NS NS NS 6 IVS8-5T 2.2 10 4.0 b0.0001 NS 0.03 7 Total 9.3 24 29.3 b0.0001 b0.0001 NS Ìe; P b 0.05 is considered significant (Bold values).
X
ABCC7 p.Ser549Asn 24440239:134:298
status: NEW142 Recently, Shastri and Kabra reported 1161delC, 3849 + 10kbC-T and S549N as other most common mutations in India (Shastri and Kabra 2008), which is in agreement with other reports (Sharma et al., 2009b); however in the control group of the present study 1161delC and 3849+ 10kbC-T mutations were not found (unpublished data) whereas G542X, W1282X, 621 + 1G N T that occur in lesser percentage among Hispanic and non-Hispanic Caucasians (Watson et al., 2004) were not found in earlier studies from India while the present study recorded that G542X mutation is quite common among our controls (2.5%), asthmatic (4.4%) and CP (6.7%) cases in heterozygous nature.
X
ABCC7 p.Ser549Asn 24440239:142:66
status: NEW145 Based on our data G551D, G542X, F508del, T5, R117H and S549N mutations may be considered for Indian subjects.
X
ABCC7 p.Ser549Asn 24440239:145:55
status: NEW
PMID: 24517344
[PubMed]
Raju SV et al: "Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis."
No.
Sentence
Comment
81
As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B).
X
ABCC7 p.Ser549Asn 24517344:81:729
status: NEW
PMID: 24932877
[PubMed]
Bell SC et al: "New pharmacological approaches for cystic fibrosis: promises, progress, pitfalls."
No.
Sentence
Comment
547
Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations: G542X, R1162X, RW1282X Deletions and insertions: CFTRdele2,3; 1078delT; 1717-1G A; 3659delC; 621+1G N T Class II Defective protein processing G85E, F508del, I507del, R560T, A561E, R1066C, N1303K Class III Defective protein regulation (gating) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R334W, R347P, R117H Class V Reduced amount of functioning protein 2789+5G A, 3272-26ANG, 3849+10KbC T, A455E Class VI Reduced cell surface stability Rescued F508del, c.120del23 Unclassified All other mutations, including those unknown a F508del-CFTR pocket (at NBD1:ICL4 interface) (Farinha et al., 2013).
X
ABCC7 p.Ser549Asn 24932877:547:379
status: NEW
PMID: 24958810
[PubMed]
Sharma H et al: "Heterogeneous spectrum of mutations in CFTR gene from Indian patients with congenital absence of the vas deferens and their association with cystic fibrosis genetic modifiers."
No.
Sentence
Comment
82
SSCP analysis and subsequent DNA sequencing further revealed eleven mutations, viz., p.Gly480Ser, p.Ser549Asn, p.Arg518Lys, p.Gly126Cys, p.Ala141Gly, p.His139Gln, p.Ser118Pro, p.Arg170Cys, p.Glu585Gln, p.Met281Arg, p.Arg933Thr and two intronic variants c.1679+24G.T, c.1766+48G.C.
X
ABCC7 p.Ser549Asn 24958810:82:100
status: NEW95 1679+24G.T 1 ND p.Meth281Arg/U 1 ND p.Arg170Cys/U 1 ND p.Gly126Cys/U 1 ND p.Gly480Ser/U 1 ND p.Ser549Asn/5T 1 ND p.Arg518Lys/U 1 ND p.Ala141Gly/U 1 ND c.1766+48G.C/U 1 ND p.Glu585Gln/5T 1 ND In 11 CAVD patients, no mutation could be detected in either CFTR allele U-unidentified; ND, not detected.
X
ABCC7 p.Ser549Asn 24958810:95:95
status: NEW100 Mutations Nucleotide change Consequences Exon/Intron Number of alleles T5 Reduction of oligo T tract to 5T, c.1210-12T[5] Aberrant splicing Intron 8 34 p.Phe508del c.1521_1523delCTT or c.1522_1524delTTT Deletion of phenylalanine at amino acid 508 Exon 11 16 p.Gly480Ser c.1438G.A Glycine to Serine at 480 Exon 11 1 p.Arg518Lysa c.1553G.A Arginine to Lysine at 518 Exon 11 1 p.Arg117His c.350G.A Arginine to Histidine at 117 Exon 4 4 p.Gly126Cysa c.376G.T Glycine to Cystine at 126 Exon 4 1 p.Ala141Glya c.422C.G Alanine to Glycine at 141 Exon 4 1 p.His139Glna c.417C.G Histadine to Glutamine at 139 Exon 4 1 p.Ser118Proa c.352T.C Serine to Proline at 118 Exon 4 1 p.Arg170Cys c.508C.T Arginine to Cystine at 170 Exon 5 1 p.Glu585Glna c.1753G.C Glutamate to Glutamine at 585 Exon 13 1 p.Met281Arga c.842T.G Methionine to Arginine at 281 Exon 7 1 p.Arg933Thra c.2798G.C Arginine to Threonine at 933 Exon 17 1 p.Ser549Asn c.1646G.A Serine to Asparagine at 549 Exon 12 1 CTFR, cystic fibrosis transmembrane conductance regulator.
X
ABCC7 p.Ser549Asn 24958810:100:909
status: NEWX
ABCC7 p.Ser549Asn 24958810:100:929
status: NEW121 One patient with a T5/ p.Ser549Asn genotype presented with the symptoms of repeated respiratory infection since childhood.
X
ABCC7 p.Ser549Asn 24958810:121:25
status: NEW141 Intriguingly, extensive screening of 27 exons of CFTR in Indian CAVD males leads to the identification of eight novel substitutions which are reported only in the Indian population and three mutations, viz., p.Gly480Ser, p.Ser549Asn and p.Arg170Cys, which havebeen reported previously (Curtis et al., 1993; Fere et al., 1994; Kawose et al., 2001).
X
ABCC7 p.Ser549Asn 24958810:141:223
status: NEW
PMID: 25042876
[PubMed]
Sharma H et al: "Function, pharmacological correction and maturation of new Indian CFTR gene mutations."
No.
Sentence
Comment
4
Methods: We used Western blot, pharmacology and iodide efflux to study CFTR maturation and chloride transport in BHK cells expressing pEGFP-CFTR constructs for L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F and D1270E.
X
ABCC7 p.Ser549Asn 25042876:4:214
status: NEW6 However, the functions of L69H and S549N and the maturation of L69H are corrected at 27 &#b0;C and by the investigational drug VX809.
X
ABCC7 p.Ser549Asn 25042876:6:35
status: NEW10 Keywords: Missense CF mutations; India; L69H-CFTR; S549N-CFTR; Low temperature; VX809 1.
X
ABCC7 p.Ser549Asn 25042876:10:51
status: NEW33 Because the cellular and functional data on these mutations can improve CF genetic counseling, we examined here the functional and cellular consequences of eleven rare missense mutations, L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F and D1270E present in CFTR gene from both classical CF patients and CBAVD patients, which have been detected during molecular diagnosis of Indian CF patients (Fig. 1).
X
ABCC7 p.Ser549Asn 25042876:33:242
status: NEW45 The response to agonists of S549N-CFTR mutant was reduced (Fig. 3A) compared to WT-CFTR (Fig. 3B).
X
ABCC7 p.Ser549Asn 25042876:45:28
status: NEW49 Mutation Nucleotide change Location in CFTR Patient phenotype CFTR dysfunction L69H T to A at 338 N-terminal Patient 1: Pancreatic insufficient, sweat chloride N 60 mEq/L, S. aureus positive; Patient 2: CBAVD Defective CFTR maturation and channel activity, class-II CF mutation F87I T to A at 391 MSD1 CBAVD No dysfunction S118P T to C at 484 MSD1 CBAVD No dysfunction G126S G to A at 508 MSD1 CBAVD No dysfunction H139Q C to G at 549 MSD1 CBAVD No dysfunction F157C T to G at 602 MSD1 CBAVD No dysfunction F494L T to C at 1612 NBD1 CBAVD No dysfunction E543A A to C at 1760 NBD1 CBAVD No dysfunction S549N G to A at 1778 NBD1 Patient 1: Frequent respiratory infection.
X
ABCC7 p.Ser549Asn 25042876:49:601
status: NEW57 Rescue by low temperature of L69H, F508del and S549N-CFTR mutants F508del protein is temperature sensitive, that is the mutant can be rescued from its abnormal ER location to the plasma membrane by lowering the temperature of the cells from 37 &#b0;C to 27 &#b0;C [10].
X
ABCC7 p.Ser549Asn 25042876:57:47
status: NEW58 We studied the effect of low-temperature with cells expressing L69H and S549N compared to F508del-CFTR.
X
ABCC7 p.Ser549Asn 25042876:58:72
status: NEW66 We also performed Western blot with L69H and F508del in the presence of VX809 but not with S549N because it is already mature (Fig. 2A).
X
ABCC7 p.Ser549Asn 25042876:66:91
status: NEW70 Discussion The present study investigated the potential deleterious functional consequence of novel rare missense mutations 0 2 4 6 8 0.0 0.1 0.2 0.3 WT F87I S118P H139Q F157C NT Time (min) k (min -1 ) 0 2 4 6 8 0.0 0.1 0.2 0.3 G126S S549N Y852F WT F508del L69H Time (min) k (min -1 ) 0 2 4 6 8 0.0 0.1 0.2 0.3 WT F508del F494L D1270E NT E543A Time (min) k (min -1 ) W T F 8 7 I S 1 1 8 P G 1 2 6 S H 1 3 9 Q F 1 5 7 C F 4 9 4 L E 5 4 3 A Y 8 5 2 F D 1 2 7 0 E S 5 4 9 N L 6 9 H F 5 0 8 d e l 0.0 0.5 1.0 1.5 2.0 ns *** *** *** *** ns (k peak - k basal) mutant / (k peak - k basal) WT A B Fig. 3.
X
ABCC7 p.Ser549Asn 25042876:70:234
status: NEW72 Iodide efflux experiments in transfected BHK-21 cells, WT-CFTR, L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F and D1270E.
X
ABCC7 p.Ser549Asn 25042876:72:118
status: NEW80 Functional rescue of L69H, F508del and S549N by low temperature and VX809.
X
ABCC7 p.Ser549Asn 25042876:80:39
status: NEW82 Iodide efflux experiments with BHK-21 cells transfected with L69H, S549N and F508del-CFTR as indicated.
X
ABCC7 p.Ser549Asn 25042876:82:67
status: NEW100 In our study, the eleven CFTR mutants i.e. L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F and D1270E produced different results.
X
ABCC7 p.Ser549Asn 25042876:100:97
status: NEW118 S549N causes reduction in Cl-channel activity classifying it as a class III CF mutation [17].
X
ABCC7 p.Ser549Asn 25042876:118:0
status: NEW119 Normal maturation of S549N-CFTR protein was observed in our Western blot analysis as reported by others [17].
X
ABCC7 p.Ser549Asn 25042876:119:21
status: NEW120 It is noteworthy here that S549N defective channel activity was nevertheless potentiated after incubating cells at 27 &#b0;C or VX809, a result which on the contrary was not anticipated.
X
ABCC7 p.Ser549Asn 25042876:120:27
status: NEW129 Patients profile Eleven rare missense mutations i.e. L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F, and D1270E were characterized by using single stranded conformation polymorphism and subsequently by DNA sequencing in Indian infertile CBAVD male patients [7,8].
X
ABCC7 p.Ser549Asn 25042876:129:107
status: NEW131 All the detected mutations except S549N are novel, rare mutations identified only from the Indian population, however, the exact frequency is still not known [7,8].
X
ABCC7 p.Ser549Asn 25042876:131:34
status: NEW132 Additionally L69H and S549N mutations were also observed in Indian patients diagnosed with classical CF [7].
X
ABCC7 p.Ser549Asn 25042876:132:22
status: NEW135 Moreover S549N missense mutation was also observed in two patients.
X
ABCC7 p.Ser549Asn 25042876:135:9
status: NEW
No.
Sentence
Comment
36
At 48 weeks, 67% of patients in the ivacaftor group had not had a pulmonary exacerbation compared with 41% in the Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Ramsey(2011)30 STRIVE: Randomized, double-blind, placebo-controlled G551D Age 12-53 years N = 161 FEV1 40-90% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Percent change in FEV1 from baseline to 24 wks (P < 0.001): IVA, 10.4%; PBO, -0.2% ߦ Percent change in FEV1 from baseline to 48 wks compared with PBO (P < 0.001): IVA, 10.5% ߦ Percent of patients pulmonary exacerbation-free at 48 wks: IVA, 67%; PBO, 41% ߦ Change in body weight from baseline to 48 wks: IVA, 3.1 kg; PBO, 0.4 kg ߦ Sweat chloride change from baseline to 48 wks compared with PBO (P < 0.001): IVA, -48.1 mmol/L ߦ Change in CFQ-R respiratory domain from baseline to 48 wks (P < 0.001): IVA, 5.9 pts; PBO, -2.7 pts Davies (2013)29 ENVISION: Randomized, double-blind, placebo-controlled G551D Age 6-11 years N = 52 FEV1 40-105% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Absolute change in FEV1 percentage from baseline at 48 wks compared with PBO (P < 0.001): IVA, 10% ߦ Absolute change in FEV1 percentage from baseline at 24 wks (P < 0.001): IVA, 12.6%; PBO, 0.1% ߦ Mean change in sweat chloride from baseline to 48 wks compared with PBO (P < 0.001): IVA, -54.3 mmol/L ߦ Body weight change from baseline to 48 wks compared with PBO (P < 0.001): IVA, 2.8 kg ߦ Absolute CFQ-R change from baseline to 24 wks compared with PBO (P = 0.109): IVA, 6.1 pts McKone (2013)31 PERSIST: Open-label extension G551D Age ࣙ 6 years Patients had completed 48 wks of either ENVISION or STRIVE IVA 150 mg b.i.d. 96 wks (patients received 96 wks or 144 wks of IVA depending on ENVISION or STRIVE randomization) ߦ Absolute change in percent predicted FEV1: &#b0; &#b0; STRIVE (IVA IVA) Study start (48 wks of prior treatment): 9.4 &#b1; 8.3 &#b0; &#b0; STRIVE (IVA IVA) 144 wks: 9.4 &#b1; 10.8 &#b0; &#b0; STRIVE (PBO IVA) Study start: -1.2 &#b1; 7.8 &#b0; &#b0; STRIVE (PBO IVA) 96 wks: 9.5 &#b1; 11.2 &#b0; &#b0; ENVISION (IVA IVA) Study start (48 wks of prior treatment): 10.2 &#b1; 15.7 &#b0; &#b0; ENVISION (IVA IVA) 144 wks: 10.3 &#b1; 12.4 &#b0; &#b0; ENVISION (PBO IVA) Study start: -0.6 &#b1; 10.1 &#b0; &#b0; ENVISION (PBO IVA) 96 wks: 10.5 &#b1; 11.5 ߦ Absolute change in weight (kg): &#b0; &#b0; STRIVE (IVA IVA) Study start (48 wks of prior treatment): 3.4 &#b1; 4.9 &#b0; &#b0; STRIVE (IVA IVA) 144 wks: 4.1 &#b1; 7.1 &#b0; &#b0; STRIVE (PBO IVA) Study start: 0.3 &#b1; 2.2 &#b0; &#b0; STRIVE (PBO IVA) 96 wks: 3 &#b1; 4.2 &#b0; &#b0; ENVISION (IVA IVA) Study start (48 wks of prior treatment): 6.1 &#b1; 2.9 &#b0; &#b0; ENVISION (IVA IVA) 144 wks: 14.8 &#b1; 5.7 &#b0; &#b0; ENVISION (PBO IVA) Study start: 2.9 &#b1; 1.8 &#b0; &#b0; ENVISION (PBO IVA) 96 wks: 10.1 &#b1; 4.1 ߦ Absolute change in CFQ-R respiratory domain: &#b0; &#b0; STRIVE (IVA IVA) Study start (48 wks of prior treatment): 6.4 &#b1; 16.8 &#b0; &#b0; STRIVE (IVA IVA) 144 wks: 6.8 &#b1; 19.6 &#b0; &#b0; STRIVE (PBO IVA) Study start: -3.6 &#b1; 14.1 &#b0; &#b0; STRIVE (PBO IVA) 96 wks: 9.8 &#b1; 16.2 &#b0; &#b0; ENVISION (IVA IVA) Study start (48 wks of prior treatment): 7.4 &#b1; 17.4 &#b0; &#b0; ENVISION (IVA IVA) 144 wks: 10.6 &#b1; 18.9 &#b0; &#b0; ENVISION (PBO IVA) Study start: 0.8 &#b1; 18.4 &#b0; &#b0; ENVISION (PBO IVA) 96 wks: 10.8 &#b1; 12.8 CFTR Modulators for the Treatment of Cystic Fibrosis Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Davies (2013)32 Placebo-controlled, double-blind, crossover study G551D Age > 6 years N = 17 FEV1 > 90% LCI > 7.4 Sequence 1: PBO WO IVA 150 mg b.i.d. Sequence 2: IVA 150 mg b.i.d. WO PBO 28-day treatment and WO periods ߦ Average change in LCI from baseline compared with PBO (P < 0.0001): IVA, -2.16 (95% CI, -2.88 to -1.44) ߦ Average change in FEV1 from baseline compared with PBO (P = 0.0103): IVA, 8.67 (95% CI, 2.36 to 14.97) ߦ Average change in FEF25-75 from baseline compared with PBO (P = 0.0237): IVA, 16.56 (95% CI, 2.30 to 27.71) Barry (2013)34 Retrospective review G551D Age 20-31 in IVA group N = 21 FEV1 < 40% IVA 150 mg b.i.d. (n = 21); matched controls (n = 35) Median duration, 237 days ߦ Absolute FEV1 change from baseline (P = 0.0075): IVA, 0.125 L; CON, 0.01 L ߦ Percent predicted FEV1 change from baseline (P = 0.0092): IVA, 12.7%, CON, 2.2% ߦ Median weight increase from baseline: IVA, 1.8 kg; CON, 0.1 kg ߦ Median inpatient days per year decreased from 23 days to 0 days in the IVA group (P = 0.001) ߦ Median total intravenous antibiotic days per year decreased from 74 days to 38 days in the IVA group (P = 0.002) De Boeck (2013)37 KONNECTION: Randomized, double-blind, crossover, placebo-controlled Non-G551D gating mutations G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, G1349D Age ࣙ 6 years N = 39 FEV1 ࣙ 40% Treatment sequence 1: IVA 150 mg b.i.d. WO PBO open-label Treatment sequence 2: PBO WO IVA 150 mg b.i.d. open-label 8 wks of IVA or PBO; 4-8 wks WO period; 16 wks open label ߦ Absolute change from baseline percent predicted FEV1 (P < 0.0001): IVA, 7.49%; PBO, -3.19% ߦ Absolute change from baseline BMI (P < 0.0001): IVA, 0.68; PBO, 0.02 ߦ Absolute change from baseline in CFQ-R respiratory domain (P = 0.0004): IVA, 8.94 pts; PBO, -0.67 pts ߦ Absolute change from baseline in sweat chloride (mmol/L): IVA, -52.28; PBO, -3.11 Flume (2011)35 Randomized, double-blind, placebo-controlled, parallel group with open-label extension Homozygous F508del Age ࣙ 12 years Part 1: N = 140 Part 2: N = 33 42 patients were eligible for part 2 if change in FEV1 ࣙ 10% or sweat chloride decreased by at least 15 mmol/L at day 15 and week 8 Part 1: IVA 150 mg b.i.d. or PBO 16 wks Part 2: Open label IVA 150 mg b.i.d.
X
ABCC7 p.Ser549Asn 25083129:36:5190
status: NEW56 These promising results led to an FDA label expansion to include CF patients with the following eight mutations in addition to G551D: G178R, S549R, S549N, G551S, G1244E, S1251N, S1255P, and G1349D.38 Clinical Considerations Ivacaftor was well tolerated in clinical trials.
X
ABCC7 p.Ser549Asn 25083129:56:148
status: NEW
No.
Sentence
Comment
6
More recently, VX-770 has been approved by the FDA (NDA 203188, www.fda.gov) and recommended by the EMA (EMA/CHMP/365663/2014) for use with an additional eight CF gating (class III) mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D), although, including G551D, these mutations still just occur in ~5% of CF patients worldwide.
X
ABCC7 p.Ser549Asn 25088968:6:200
status: NEW
PMID: 25287046
[PubMed]
Mornon JP et al: "Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics."
No.
Sentence
Comment
359
Third, at the level of the NBD1:NBD2 heterodimer, CF-causing mutations are concentrated within the canonical ATP-binding site (S549N, S549R, G551D/G551S, G1244E, S1251N, and S1255P) (Fig. 7d).
X
ABCC7 p.Ser549Asn 25287046:359:127
status: NEW
PMID: 25481366
[PubMed]
Oueslati S et al: "Preliminary study of haplotypes linked to the rare cystic fibrosis E1104X mutation."
No.
Sentence
Comment
78
The 16-31-13 haplotype found in 50% of E1104X chromosomes was also described linked to 2 rare mutations, the E60X mutation in UK (12) and S549N mutation in the "Grande bri&#e9;re" population (3).
X
ABCC7 p.Ser549Asn 25481366:78:138
status: NEW
PMID: 25867140
[PubMed]
Eckford PD et al: "Functional reconstitution and channel activity measurements of purified wildtype and mutant CFTR protein."
No.
Sentence
Comment
30
While the correctors VX-809 and VX-661 (are not yet approved for use in patients, the potentiator Kalydeco (ivacaftor; VX-770) is being used at 150 mg every 12 hr in CF patients >6 years with at least one G551D-CFTR mutation, and more recently for patients with one of G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D.
X
ABCC7 p.Ser549Asn 25867140:30:276
status: NEW
PMID: 25910067
[PubMed]
Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."
No.
Sentence
Comment
381
[Glu479*;Val754Met] F508del c.1521_1523delCTT CF-PI CF-causing p.Phe508del 1717-8G>A c.1585-8G>A CF-PI CF-causing 1717-1G>A c.1585-1G>A CF-PI CF-causing D529N c.1585G>A CF-PI nd p.Asp529Asn G542X c.1624G>T CF-PI CF-causing p.Gly542* S549R(A>C) c.1645A>C CF-PI CF-causing p.Ser549Arg S549N c.1646G>A CF-PI CF-causing p.Ser549Asn S549R(T>G) c.1647T>G CF-PI CF-causing p.Ser549Arg G551D c.1652G>A CF-PI CF-causing p.Gly551Asp Q552X c.1654C>T CF-PI CF-causing p.Gln552* R553X c.1657C>T CF-PI CF-causing p.Arg553* L558S c.1673T>C CF-PI unknown significance p.Leu558Ser Y569D c.1705T>G CFTR-RD,CBAVD unknown significance p.Tyr569Asp Continued on next page 2 0 | L U C A R E L L I E T A L .
X
ABCC7 p.Ser549Asn 25910067:381:283
status: NEWX
ABCC7 p.Ser549Asn 25910067:381:318
status: NEW
PMID: 25940043
[PubMed]
Corvol H et al: "Translating the genetics of cystic fibrosis to personalized medicine."
No.
Sentence
Comment
155
Furthermore, Kalydeco has been tested in patients carrying other class III mutations, or targeted class IVand V mutations (sharing functional similarities with the class III).58 The new trials led to an extension of the FDA and European Medical Agency approval to 8 additional gating mutations: p.Gly178Arg (p.G178R), p.Ser549Asn (p.S549N), p.Ser549Arg (p.S549R), p.Gly551Ser (p.G551S), p.Gly1244Glu (p.G1244E), p.Ser1251Asn (p.S1251N), p.Ser1255Pro (pS1255P), and p.Gly1349Asp (p.G1349D).59 Recently, ivacaftor has also been shown to benefit patients carrying the c.350G .
X
ABCC7 p.Ser549Asn 25940043:155:320
status: NEWX
ABCC7 p.Ser549Asn 25940043:155:333
status: NEW
PMID: 26014425
[PubMed]
Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."
No.
Sentence
Comment
79
(unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance.
X
ABCC7 p.Ser549Asn 26014425:79:1514
status: NEWX
ABCC7 p.Ser549Asn 26014425:79:1532
status: NEW
PMID: 26021452
[PubMed]
Corvol H et al: "[Challenges of personalized medicine for cystic fibrosis]."
No.
Sentence
Comment
135
Compte tenu de l`efficacite &#b4; de KalydecoW chez ces patients, le laboratoire VertexW a ensuite teste &#b4;, puis de &#b4;montre &#b4; son efficacite &#b4; chez des patients porteurs d`autres mutations de classe III, ce qui a permis cette anne &#b4;e une extension d`autorisation de mise sur le marche &#b4; (AMM) pour 8 mutations supple &#b4;mentaires : G1244E, G1349D, G178R, G551S, S1251N, S1255P, S549N et S549R [37].
X
ABCC7 p.Ser549Asn 26021452:135:404
status: NEW
PMID: 26087176
[PubMed]
Dupuis A et al: "Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene."
No.
Sentence
Comment
76
Using the US and Italian data, we calculated equally low MIP scores for G178R (0.09, n = 22), S549N (0.12, n = 39), S1251N (0.07, n = 14), and G1244E (0.0, n = 3), but not for S549R (0.21, n = 14) (Supplementary Table S1 online).
X
ABCC7 p.Ser549Asn 26087176:76:94
status: NEW105 MIP scores were significantly different between the mutations F508del and G551D, which is in agreement with early studies of smaller numbers of patients with CF that reported a lower MI incidence in patients carrying F508del/G551D when compared with patients with CF with F508del/ F508del.28,29 We demonstrated equally low MIP scores for other class III CFTR mutations (G178R, S549N, G1244E, S1251N), further supporting the idea that class III CFTR mutations are not as severe as F508del, at least with respect to gastrointestinal development.
X
ABCC7 p.Ser549Asn 26087176:105:377
status: NEW
No.
Sentence
Comment
604
When tested in clinical trials, the potentiator ivacaftor (also known as VX-770) showed a marked clinical benefit, with substantial improvement of lung function, reduction of pulmonary exacerbations, and increase in body weight in CF patients with G551D and 8 additional Class III mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D) [32-35].
X
ABCC7 p.Ser549Asn 26115565:604:299
status: NEW
PMID: 26210165
[PubMed]
Kotha K et al: "Concentration of fractional excretion of nitric oxide (FENO): A potential airway biomarker of restored CFTR function."
No.
Sentence
Comment
53
Patients enrolled in Cohort 2 (Fig. 1B) included five CF patients with rare CFTR gating mutations (S549N/S549N in three subjects, G178R/F508del in one subject, and S549R/ F508del in one subject) who were candidates for ivacaftor therapy.
X
ABCC7 p.Ser549Asn 26210165:53:99
status: NEWX
ABCC7 p.Ser549Asn 26210165:53:105
status: NEW154 Genotypes of the five individual subjects were S549N/S549N (CF01-03), S549R/F508del (CF04), and G178R/F508del (CF05).
X
ABCC7 p.Ser549Asn 26210165:154:47
status: NEWX
ABCC7 p.Ser549Asn 26210165:154:53
status: NEW
PMID: 26526359
[PubMed]
Amaral MD et al: "Hallmarks of therapeutic management of the cystic fibrosis functional landscape."
No.
Sentence
Comment
656
The FDA approval of Ivacaftor for multiple G551D like phenotypic variants including G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D [159,160] found at the cell surface with gating defects [161,162], and the FDA-approval of a combination of Lumacaftor and Ivacaftor for treatment of F508del [156] are examples of successful application of these technologies.
X
ABCC7 p.Ser549Asn 26526359:656:91
status: NEW
No.
Sentence
Comment
77
July 16, 2007 c.164+2T.A (296+2T.A) 28 c.254G.A (G85E) c.274-1G.A (406-1G.A) c.489+1G.T (621+1G.T) c.579+1G.T (711+1G.T) c.595C.T (H199Y) c.933_935delCTT (F311del) c.1000C.T (R334W) c.1519_1521delATC (I507del) c.1521_1523delCTT (F508del) c.1585-1G.A (1717-1G.A) c.1624G.T (G5423) c.1646G.A (S549N) c.1652G.A (G551D) c.1657C.T (R5533) c.1675G.A (A559T) c.1680-1G.A (1812-1G.A) c.1973-1985del13insAGAAA (2105-2117del13insAGAAA) c.2175_2176insA (2307insA) c.2988+1G.A (3120+1G.A) c.3196C.T (R1066C) c.3266G.A (W10893) c.3485G.T (R11623) c.3611G.A (W12043 [3743G.A]) c.3717+12191C.T (3849+10kbC.T) c.3744delA (3876delA) c.3846G.A (W12823) c.3909C.G (N1303K) October 4, 2007 c.1153_1154insAT (1288insTA) 29 December 12, 2007 c.54-5940_273+10250del21kb (CFTRdele2,3(21kb)) 38 c.531delT (663delT) c.613C.T (P205S) c.803delA (935delA) c.1475C.T (S492F) c.1923_1931del9insA (2055del9.A) c.223C.T (R753) c.293A.G (Q98R) c.3140-26A.G (3272-26A.G) August 12, 2008 c.988G.T (G3303) 40 c.3612G.A (W12043 [3744G.A]) c.3659delC (3791delC) c.164+2T.A (296+2T.A), removed cDNA, complementary DNA.
X
ABCC7 p.Ser549Asn 26574590:77:291
status: NEW
PMID: 7505422
[PubMed]
Lester LA et al: "Delta F508 genotype does not predict disease severity in an ethnically diverse cystic fibrosis population."
No.
Sentence
Comment
41
CFTR Mutation Analysis All persons were tested for the following mutations: SF508, G542X, G551D, G553X, W1282X, N1303K, 621 +IG-*T, R117H, S549N, 3849+lOkbC-T, l6O9delCA, and R1162X.
X
ABCC7 p.Ser549Asn 7505422:41:139
status: NEW59 Frequencies of 12 CF With Cystic Fibrosis TR Mutations in 119 Patients Mutation Frequency SF508 0.559 G542X 0.092 G5SID 0.029 R553X 0.004 W1282X 0.012 N1303K 0.021 621 + IG -p 0.012 RII7H 0.004 R1162.X 0.008 3849 + lOkbC T 0.008 S549N 0 l6O9delCA 0 Unidentified 0.248 groups were not significantly different with respect to current age, presence of pancreatic insufficiency, clinical presentation, or associated complications common in CF patients.
X
ABCC7 p.Ser549Asn 7505422:59:229
status: NEW
PMID: 9092029
[PubMed]
Durieu I et al: "[Male infertility caused by bilateral agenesis of the vas deferens: a new clinical form of cystic fibrosis?]."
No.
Sentence
Comment
46
Vingt-deux mutations du gene CFTR ont Cte recher- chtes : les cinq plus frequentes (AF508, G542X, N1303K, 1717-G--A, G85E) et les 17 suivantes : R117H, 556delA, R334W, R347H, R347P, S549N, S5491, S549R, G551D, R553X,R560T,G1244E3,S1255X,W1282X,R1283K,3898 ins C, D1270N.
X
ABCC7 p.Ser549Asn 9092029:46:182
status: NEW
admin on 2016-08-19 15:16:22