ABCMdb

ABCC7 p.Lys1250Ala

Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]

Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 Two mutations, K464A (NBD1) and K1250A (NBD2) reduced ATP binding and hydrolysis [60-64]. Login to comment
99 K1250A abolished ATP hydrolysis by disrupting the catalytic activity because its position is in the P loop that forms the core of the ATP-binding pocket. Login to comment
103 Indeed, K1250A dramatically prolonged burst duration, suggesting that hydrolysis at NBD2 might be coupled to burst termination [52,65,67], whereas K464A slowed channel opening to a burst, suggesting that NBD1 might be a site of ATP interactions governing opening [68]. Login to comment

[hide] Gating of cystic fibrosis transmembrane conductanc... J Gen Physiol. 1999 Apr;113(4):541-54. Zeltwanger S, Wang F, Wang GT, Gillis KD, Hwang TC
Gating of cystic fibrosis transmembrane conductance regulator chloride channels by adenosine triphosphate hydrolysis. Quantitative analysis of a cyclic gating scheme.
J Gen Physiol. 1999 Apr;113(4):541-54., [PMID:10102935]

Abstract [show]
Gating of the cystic fibrosis transmembrane conductance regulator (CFTR) involves a coordinated action of ATP on two nucleotide binding domains (NBD1 and NBD2). Previous studies using nonhydrolyzable ATP analogues and NBD mutant CFTR have suggested that nucleotide hydrolysis at NBD1 is required for opening of the channel, while hydrolysis of nucleotides at NBD2 controls channel closing. We studied ATP-dependent gating of CFTR in excised inside-out patches from stably transfected NIH3T3 cells. Single channel kinetics of CFTR gating at different [ATP] were analyzed. The closed time constant (tauc) decreased with increasing [ATP] to a minimum value of approximately 0.43 s at [ATP] >1.00 mM. The open time constant (tauo) increased with increasing [ATP] with a minimal tauo of approximately 260 ms. Kinetic analysis of K1250A-CFTR, a mutant that abolishes ATP hydrolysis at NBD2, reveals the presence of two open states. A short open state with a time constant of approximately 250 ms is dominant at low ATP concentrations (10 microM) and a much longer open state with a time constant of approximately 3 min is present at millimolar ATP. These data suggest that nucleotide binding and hydrolysis at NBD1 is coupled to channel opening and that the channel can close without nucleotide interaction with NBD2. A quantitative cyclic gating scheme with microscopic irreversibility was constructed based on the kinetic parameters derived from single-channel analysis. The estimated values of the kinetic parameters suggest that NBD1 and NBD2 are neither functionally nor biochemically equivalent.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Kinetic analysis of K1250A-CFTR, a mutant that abolishes ATP hydrolysis at NBD2, reveals the presence of two open states. Login to comment
34 We studied gating of CFTR in excised inside-out patches from NIH3T3 cells stably transfected with wild-type (wt) or K1250A-CFTR. Login to comment
36 This concentration dependence of the mean open time is more prominent in K1250A-CFTR, a mutant CFTR of which the conserved lysine residue in the Walker A motif of NBD2 is converted to alanine. Login to comment
38 m a t e r i a l s a n d m e t h o d s Cell Culture and Electrophysiology Both wt (Berger et al., 1991) and K1250A (lysine to alanine mutation) CFTR channels were stably expressed in NIH3T3 cells (NIH3T3-CFTR and NIH3T3-K1250A, respectively). Login to comment
39 NIH3T3-K1250A cells stably expressing K1250A-CFTR were established using the retroviral vector pLJ (a generous gift from Dr. Mitchell Drumm, Case Western Reserve University, Cleveland, OH). Login to comment
58 Curve fits of the time courses for deactivation by washout of AMP-PNP and ATP from patches containing wt-CFTR or the time courses for deactivation by washout of ATP from patches containing K1250A-CFTR were obtained by using the Igor software. Login to comment
153 due to ATP binding to NBD2, we next examined [ATP]-dependent gating of K1250A-CFTR, a mutant in which the conserved lysine in the Walker A motif of NBD2 is converted to alanine. Login to comment
155 Gating of K1250A-CFTR channels was examined in the presence of either 10 ␮M or 2.75 mM ATP. Login to comment
156 Fig. 6 A shows that a K1250A-CFTR channel, preactivated with PKA and ATP (not shown), was "locked" in an open state with 2.75 mM ATP and the channel closed ‫2ف‬ min after ATP washout. Login to comment
159 The single channel amplitude, obtained from the all-point histograms (not shown), of K1250A-CFTR channels opened with millimolar ATP is about the same as that for brief openings in the presence of 10 ␮M ATP (Fig. 6 B). Login to comment
162 To quantify the brief openings of K1250A-CFTR in the presence of 10 ␮M ATP, dwell time analysis of the cumulative open time from three different patches was performed. Login to comment
164 Since the "locked open" time of K1250A-CFTR is apparently very long (Fig. 6 A), it will be very difficult to collect enough events for dwell time analysis. Login to comment
165 Even if we obtain patches containing a single K1250A-CFTR channel, the flickering closures in locked open state may interfere with the analysis. Login to comment
166 Although excluding closing intervals Ͻ80 ms is appropriate for eliminating flickers in analysis of wt-CFTR, this exclusion is not sufficient to eliminate flickers from analysis of K1250A-CFTR because the ratio of flickers to "true" closings (gating) of CFTR is much higher. Login to comment
168 At this concentration, most of K1250A-CFTR channels are locked open, as can be judged from the small magnitude of macroscopic current fluctuations (Fig. 6 D). Login to comment
172 These results suggest that, at low micromolar [ATP], K1250A-CFTR can assume brief openings with a time constant close to that of wt-CFTR at equivalent [ATP], but this mutant CFTR Figure 6. Login to comment
173 ATP concentration dependence of the channel open time for K1250A-CFTR. Login to comment
174 (A) A continuous current trace of K1250A-CFTR in the presence or absence of ATP. Login to comment
178 (B) Single channel amplitudes of K1250A-CFTR (obtained from all point histograms of 30 s recordings) at 10 ␮M or 2.75 mM ATP. Login to comment
179 (C) The open time histogram of K1250A-CFTR at 10 ␮M ATP. Login to comment
182 (D) Slow closing of PKA-phosphorylated K1250A-CFTR. Login to comment
185 Macroscopic relaxation of the K1250A-CFTR channel current was constructed from multiple washouts of ATP from the same patch. Login to comment
188 Assuming ATP is not hydrolyzed by the NBD2 of K1250A-CFTR, the slow closing rate reflects a slow dissociation of ATP from CFTR (presumably from NBD2). Login to comment
189 If the brief openings of K1250A-CFTR at 10 ␮M ATP represent open channel conformations without NBD2 being occupied, this observation suggests that CFTR can close even when ATP acts exclusively on NBD1 (see Carson et al., 1995; also see discussion). Login to comment
205 This stabilizing effect is greatly magnified when hydrolysis at NBD2 is eliminated, either through chemical modification of the binding molecule (AMP-PNP) or molecular alteration of the CFTR protein itself (i.e., K1250A mutation). Login to comment
243 We clearly resolve two open times with K1250A-CFTR and demonstrate a dramatic [ATP] dependence of the channel open time for this mutant CFTR. Login to comment
244 One interesting observation is that at 10 ␮M ATP, the mean open time for K1250A-CFTR is ‫052ف‬ ms, a value very close to that for wt-CFTR at the equivalent [ATP]. Login to comment
247 Based on this interpretation, the brief opening with K1250A-CFTR is coupled to hydrolysis of one ATP molecule at NBD1 and subsequently the channel can close without ATP hydrolysis at NBD2. Login to comment
249 This same observation that the open time of K1250A-CFTR depends on [ATP] is also inconsistent with the proposal that ATP binding at NBD2 opens the channel (Gunderson and Kopito, 1995). Login to comment
250 According to this latter model, every opening of K1250A-CFTR should last for minutes. Login to comment
262 The fact that this short open time constant is very close to the mean open time of K1250A-CFTR at 10 ␮M ATP further supports this assignment. Login to comment
309 Carson et al. (1995), using 20 ms as a cutoff, reported a mean burst time of ‫1ف‬ s for K1250A-CFTR. Login to comment
310 This number is evidently an underestimation of the true ATP-coupled open time for K1250A-CFTR as a continuous burst of opening that lasts for minutes is observed even when ATP is removed (Fig. 6 A). Login to comment
342 Assuming the opening rate of K1250A-CFTR is the same as that of wt-CFTR, our kinetic data suggest a maximal ATP hydrolysis rate of ‫500.0ف‬ s-1, which is 1/200 of that for wt-CFTR. Login to comment
343 Recent preliminary data that K1250A-CFTR has a drastically reduced rate of ATP hydrolysis support this coupled ATP turnover hypothesis (Ramjeesingh et al., 1998). Login to comment

[hide] CFTR channel gating: incremental progress in irrev... J Gen Physiol. 1999 Jul;114(1):49-53. Csanady L, Gadsby DC
CFTR channel gating: incremental progress in irreversible steps.
J Gen Physiol. 1999 Jul;114(1):49-53., [PMID:10398691]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 The CFTR mutants K464A and K1250A, for instance, lie at the heart of challenges to the simple answers to both key questions. Login to comment
14 Thus, K1250A channels not only close much more slowly than wild-type (WT) channels, they also open more slowly, drawing speculation that ATP binding at NBD2 (rather than hydrolysis at NBD1) might trigger channel opening (Gunderson and Kopito, 1995; compare Sheppard and Welsh, 1999). Login to comment
15 And recent direct measurements on purified, reconstituted CFTR have revealed virtual abolition of ATPase activity by K1250A, a more than sevenfold reduction of ATP hydrolysis (compared with WT) for K464A, but only an approximately twofold decrement in open probability (Po) for K1250A channels (because the effect of their markedly slower closing is more than offset by that of their slowed opening) and an even smaller drop in Po (due to slightly slower opening) for K464A relative to WT (Ramjeesingh et al., 1999), prompting the conclusion that ATP hydrolysis and channel gating are not tightly coupled. Login to comment
16 As pointed out by Zeltwanger et al. (1999) (compare Gadsby and Nairn, 1999), it is not difficult to explain the K1250A findings, since the very low ATPase activity correlates well with observations of very few openings (still conceivably associated with ATP hydrolysis at NBD1) and, after very long open times, an equal number of closings that are presumably associated with dissociation of the ATP, not its hydrolysis, at NBD2. Login to comment
44 Zeltwanger et al. (1999) examined K1250A CFTR channels and found, at millimolar ATP, the extremely long open times (mean ~3 min) reported by others, but, at 10 ␮M ATP, only the same brief openings (mean ~250 ms) observed for WT CFTR at low [ATP]. Login to comment
46 In other words, the brief openings of both WT and K1250A CFTR channels are interpreted as simply reflecting ATP binding and hydrolysis, and dissociation of the hydrolysis products, at NBD1. Login to comment

[hide] Dual effects of ADP and adenylylimidodiphosphate o... J Gen Physiol. 1999 Jul;114(1):55-70. Weinreich F, Riordan JR, Nagel G
Dual effects of ADP and adenylylimidodiphosphate on CFTR channel kinetics show binding to two different nucleotide binding sites.
J Gen Physiol. 1999 Jul;114(1):55-70., [PMID:10398692]

Abstract [show]
The CFTR chloride channel is regulated by phosphorylation by protein kinases, especially PKA, and by nucleotides interacting with the two nucleotide binding domains, NBD-A and NBD-B. Giant excised inside-out membrane patches from Xenopus oocytes expressing human epithelial cystic fibrosis transmembrane conductance regulator (CFTR) were tested for their chloride conductance in response to the application of PKA and nucleotides. Rapid changes in the concentration of ATP, its nonhydrolyzable analogue adenylylimidodiphosphate (AMP-PNP), its photolabile derivative ATP-P3-[1-(2-nitrophenyl)ethyl]ester, or ADP led to changes in chloride conductance with characteristic time constants, which reflected interaction of CFTR with these nucleotides. The conductance changes of strongly phosphorylated channels were slower than those of partially phosphorylated CFTR. AMP-PNP decelerated relaxations of conductance increase and decay, whereas ATP-P3-[1-(2-nitrophenyl)ethyl]ester only decelerated the conductance increase upon ATP addition. ADP decelerated the conductance increase upon ATP addition and accelerated the conductance decay upon ATP withdrawal. The results present the first direct evidence that AMP-PNP binds to two sites on the CFTR. The effects of ADP also suggest two different binding sites because of the two different modes of inhibition observed: it competes with ATP for binding (to NBD-A) on the closed channel, but it also binds to channels opened by ATP, which might either reflect binding to NBD-A (i.e., product inhibition in the hydrolysis cycle) or allosteric binding to NBD-B, which accelerates the hydrolysis cycle at NBD-A.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
324 Their conclusions were derived from studying the gating (temperature not specified) and the ATPase activity (at 30ЊC) of purified CFTR protein, either WT or the mutants K464A or K1250A. Login to comment
325 However, in contrast to their open burst duration for the mutant K1250A of 265 ms (temperature not specified) are dramatically increased open burst durations found by other groups (65 s for Gunderson and Kopito, 1995; 3 min for Zeltwanger et al., 1999; both at room temperature). Login to comment
326 Carson et al. (1995) found an open burst duration for K1250A at 34-36ЊC of ‫1ف‬ s. Login to comment

[hide] Regulation of CFTR Cl- channel gating by ATP bindi... Proc Natl Acad Sci U S A. 2000 Jul 18;97(15):8675-80. Ikuma M, Welsh MJ
Regulation of CFTR Cl- channel gating by ATP binding and hydrolysis.
Proc Natl Acad Sci U S A. 2000 Jul 18;97(15):8675-80., 2000-07-18 [PMID:10880569]

Abstract [show]
Opening and closing of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel is regulated by the interaction of ATP with its two cytoplasmic nucleotide-binding domains (NBD). Although ATP hydrolysis by the NBDs is required for normal gating, the influence of ATP binding versus hydrolysis on specific steps in the gating cycle remains uncertain. Earlier work showed that the absence of Mg(2+) prevents hydrolysis. We found that even in the absence of Mg(2+), ATP could support channel activity, albeit at a reduced level compared with the presence of Mg(2+). Application of ATP with a divalent cation, including the poorly hydrolyzed CaATP complex, increased the rate of opening. Moreover, in CFTR variants with mutations that disrupt hydrolysis, ATP alone opened the channel and Mg(2+) further enhanced ATP-dependent opening. These data suggest that ATP alone can open the channel and that divalent cations increase ATP binding. Consistent with this conclusion, when we mutated an aspartate thought to bind Mg(2+), divalent cations failed to increase activity compared with ATP alone. Two observations suggested that divalent cations also stabilize the open state. In wild-type CFTR, CaATP generated a long duration open state, whereas ATP alone did not. With a CFTR variant in which hydrolysis was disrupted, MgATP, but not ATP alone, produced long openings. These results suggest a gating cycle for CFTR in which ATP binding opens the channel and either hydrolysis or dissociation leads to channel closure. In addition, the data suggest that ATP binding and hydrolysis by either NBD can gate the channel.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 In CFTR, the NBD1 mutation K464A reduces ATPase activity to Ϸ15%, and the NBD2 mutation K1250A eliminates ATPase activity (24). Login to comment
39 Strikingly, a variant with both NBDs mutated (K464A͞K1250A) showed significant activity and gating not different from CFTR-K1250A (10). Login to comment
123 Prolongation of the burst duration is similar to the result of two other interventions that allow nucleotide binding but not hydrolysis: binding of the nonhydrolyzable AMP-PNP (9, 10, 16, 17, 38) and an NBD2 mutation that prevents hydrolysis, K1250A (10, 11, 14, 24). Login to comment
136 We tested variants with mutations in the Walker A lysine, CFTR-K464A and -K1250A. Login to comment
140 With MgATP, CFTR-K1250A showed prolonged bursts (Fig. 3 B and C), as previously reported (10, 11, 14, 24). Login to comment
144 There are two potential explanations for the difference between K464A and K1250A. Login to comment
155 Therefore, we studied CFTR-K1250A and CFTR-K464A at two different ATP concentrations. Login to comment
156 With 1 mM ATP and 4 mM Mg2ϩ , CFTR-K1250A showed prolonged bursts, but with a low MgATP concentration (5-20 ␮M ATP and 4 mM Mg2ϩ ), burst duration decreased (Fig. 4 A and C). Login to comment
159 This might prevent the channel from entering the prolonged bursts that result from NBD2 gating in K1250A. Login to comment
189 The K1250A variant has a similar effect, blocking the O1 3 O2 transition and thereby prolonging bursts with MgATP (Fig. 3). Login to comment
190 In contrast, with ATP alone, the O1 state of K1250A is unstable and ATP dissociates more quickly (Fig. 3). Login to comment
192 This result suggests that the K1250A mutation reduces ATP binding to NBD2. Login to comment
203 Effect of MgATP and ATP alone on CFTR-K1250A and -K464A. Login to comment
238 Effect of ATP concentration on gating of CFTR-K1250A (A and C) and K464A (B and D) channels. Login to comment

[hide] Severed molecules functionally define the boundari... J Gen Physiol. 2000 Aug;116(2):163-80. Chan KW, Csanady L, Seto-Young D, Nairn AC, Gadsby DC
Severed molecules functionally define the boundaries of the cystic fibrosis transmembrane conductance regulator's NH(2)-terminal nucleotide binding domain.
J Gen Physiol. 2000 Aug;116(2):163-80., [PMID:10919864]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator is a Cl(-) channel that belongs to the family of ATP-binding cassette proteins. The CFTR polypeptide comprises two transmembrane domains, two nucleotide binding domains (NBD1 and NBD2), and a regulatory (R) domain. Gating of the channel is controlled by kinase-mediated phosphorylation of the R domain and by ATP binding, and, likely, hydrolysis at the NBDs. Exon 13 of the CFTR gene encodes amino acids (aa's) 590-830, which were originally ascribed to the R domain. In this study, CFTR channels were severed near likely NH(2)- or COOH-terminal boundaries of NBD1. CFTR channel activity, assayed using two-microelectrode voltage clamp and excised patch recordings, provided a sensitive measure of successful assembly of each pair of channel segments as the sever point was systematically shifted along the primary sequence. Substantial channel activity was taken as an indication that NBD1 was functionally intact. This approach revealed that the COOH terminus of NBD1 extends beyond aa 590 and lies between aa's 622 and 634, while the NH(2) terminus of NBD1 lies between aa's 432 and 449. To facilitate biochemical studies of the expressed proteins, a Flag epitope was added to the NH(2) termini of full length CFTR, and of CFTR segments truncated before the normal COOH terminus (aa 1480). The functionally identified NBD1 boundaries are supported by Western blotting, coimmunoprecipitation, and deglycosylation studies, which showed that an NH(2)-terminal segment representing aa's 3-622 (Flag3-622) or 3-633 (Flag3-633) could physically associate with a COOH-terminal fragment representing aa's 634-1480 (634-1480); however, the latter fragment was glycosylated to the mature form only in the presence of Flag3-633. Similarly, 433-1480 could physically associate with Flag3-432 and was glycosylated to the mature form; however, 449-1480 protein seemed unstable and could hardly be detected even when expressed with Flag3-432. In excised-patch recordings, all functional severed CFTR channels displayed the hallmark characteristics of CFTR, including the requirement of phosphorylation and exposure to MgATP for gating, ability to be locked open by pyrophosphate or AMP-PNP, small single channel conductances, and high apparent affinity of channel opening by MgATP. Our definitions of the boundaries of the NBD1 domain in CFTR are supported by comparison with the solved NBD structures of HisP and RbsA.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
319 Moreover, mutant K1250A CFTR channels, in which ATP hydrolysis at NBD2 is severely impaired (Ramjeesingh et al., 1999), show brief WT-like openings at low micromolar [ATP], but extremely long openings at higher [ATP] that reflect binding at NBD2 of ATP that cannot be hydrolyzed (Zeltwanger et al., 1999); those results imply that the brief openings at low [ATP] involve only NBD1. Login to comment

[hide] Severed channels probe regulation of gating of cys... J Gen Physiol. 2000 Sep;116(3):477-500. Csanady L, Chan KW, Seto-Young D, Kopsco DC, Nairn AC, Gadsby DC
Severed channels probe regulation of gating of cystic fibrosis transmembrane conductance regulator by its cytoplasmic domains.
J Gen Physiol. 2000 Sep;116(3):477-500., [PMID:10962022]

Abstract [show]
Opening and closing of a CFTR Cl(-) channel is controlled by PKA-mediated phosphorylation of its cytoplasmic regulatory (R) domain and by ATP binding, and likely hydrolysis, at its two nucleotide binding domains. Functional interactions between the R domain and the two nucleotide binding domains were probed by characterizing the gating of severed CFTR channels expressed in Xenopus oocytes. Expression levels were assessed using measurements of oocyte conductance, and detailed functional characteristics of the channels were extracted from kinetic analyses of macroscopic current relaxations and of single-channel gating events in membrane patches excised from the oocytes. The kinetic behavior of wild-type (WT) CFTR channels was compared with that of split CFTR channels bearing a single cut (between residues 633 and 634) just before the R domain, of split channels with a single cut (between residues 835 and 837) just after the R domain, and of split channels from which the entire R domain (residues 634-836) between those two cut sites was omitted. The channels cut before the R domain had characteristics almost identical to those of WT channels, except for less than twofold shorter open burst durations in the presence of PKA. Channels cut just after the R domain were characterized by a low level of activity even without phosphorylation, strong stimulation by PKA, enhanced apparent affinity for ATP as assayed by open probability, and a somewhat destabilized binding site for the locking action of the nonhydrolyzable ATP analog AMPPNP. Split channels with no R domain (from coexpression of CFTR segments 1-633 and 837-1480) were highly active without phosphorylation, but otherwise displayed the characteristics of channels cut after the R domain, including higher apparent ATP affinity, and less tight binding of AMPPNP at the locking site, than for WT. Intriguingly, severed channels with no R domain were still noticeably stimulated by PKA, implying that activation of WT CFTR by PKA likely also includes some component unrelated to the R domain. As the maximal opening rates were the same for WT channels and split channels with no R domain, it seems that the phosphorylated R domain does not stimulate opening of CFTR channels; rather, the dephosphorylated R domain inhibits them.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 CFTR-K1250A was a gift from Dr. David Dawson (Oregon Health Sciences University, Portland, OR), and was subcloned into pGEMHE to give pGEMHE-K1250A. Login to comment
41 pGEMHE-837-1480(K1250A) was made using pGEMHE-K1250A as template, primers SK837FW (5Ј-TCCCCC- GGGCCGCCATGGAGAGCATACCAGCAGTGACT) and SP6 RV, followed by subcloning. Login to comment
79 [Typically, tc was 30-80 ms, 400-800 ms for cut-⌬R(K1250A).] Login to comment
252 Severed Channels with no R Domain, but with NBD2 Walker-A Mutation, Display Prolonged Bursts To probe the role of NBD2 function in cut-⌬R channels, we introduced the Walker-A lysine (Walker et al., 1982) mutation in NBD2, K1250A. Login to comment
253 In excised patches, cut- ⌬R(K1250A) channels had similar conductance to WT CFTR, required MgATP for activity but (like the other cut channels with no R domain) were active without exposure to PKA, and their activity was dominated by long open bursts, each interrupted by many (six to eight on average) flickery closures (Fig. 10 A; note time scale). Login to comment
256 Consistent with the interpretation that the prolonged bursts reflect nonhydrolytic binding of ATP at NBD2, these mean burst durations of cut-⌬R(K1250A) were comparable with the time constants of the slow components of current relaxation after exposure of cut-⌬R channels to AMPPNP at the corresponding temperatures (5.8 Ϯ 0.4 s and 13.5 Ϯ 2 s at 25Њ and 20ЊC, respectively; Figs. 6 D and 9; and Table II). Login to comment
257 To avoid the difficulties of steady state kinetic analysis, we examined the current relaxation after ATP removal in patches containing cut-⌬R(K1250A) channels. Login to comment
261 Analysis of the Ͻ100 isolated bursts recorded from cut-⌬R(K1250A) channels indicated a double-exponential distribution (Fig. 10 C), suggesting two distinct populations of bursts, although both components Figure 8. Login to comment
284 Walker-A mutant cut-⌬R(K1250A) [633ϩ837 (K1250A)] channels show prolonged open bursts. Login to comment
285 (A) Representative baseline-subtracted record of single cut-⌬R(K1250A) channel in 2 mM MgATP, no PKA, at 25ЊC. Login to comment
286 (B) Current relaxation of cut- ⌬R(K1250A) channels after removal of 2 mM MgATP (no PKA), constructed by summing synchronized decay currents from nine experiments, at 25ЊC; single-exponential fit (solid line) to quasi-macroscopic current decay gave ␶ ϭ 6.7 s. Login to comment
288 (C) Survivor function of burst durations, after exclusion of flickery closures, of cut-⌬R(K1250A) channels in 2 mM MgATP, constructed from events isolated from a total of 16 min of recordings suitable for such analysis, including 10 min from a single channel. Login to comment
306 (Strictly, if ADP leaves (SCHEME I) (SCHEME II) NBD2 during O1 → O2, that step is irreversible in the absence of ADP, and WT channels unlocking from AMPPNP, or K1250A channels closing from long bursts in ATP, must close through a state distinct from O1: the four-state schemes are clearly oversimplified.) Login to comment
401 ATP Binding to NBD2 of Severed Channels Lacking an R Domain Is Supported by Prolonged Bursts of Cut-⌬R(K1250A) Mutation of K1250 practically abolishes ATP hydrolysis in CFTR (Ramjeesingh et al., 1999), as does mutation of Walker-A lysines in other ABC transporters (e.g., Loo and Clarke, 1994; Müller et al., 1996). Login to comment
402 In intact CFTR, the K1250A mutation results in extremely long open bursts, comparable with those seen with AMPPNP, interpreted as nonhydrolytic tight binding of ATP to NBD2 (Carson et al., 1995; Gunderson and Kopito, 1995). Login to comment
403 If ATP can occupy NBD2 in severed CFTR channels with no R domain, then cut-⌬R(K1250A) channels ought to show prolonged bursts (like those induced by AMPPNP in cut-⌬R channels) whenever NBD2 binds ATP, since k3 ϭ 0. Login to comment
405 The large fraction of prolonged openings in cut-⌬R(K1250A) channels seems paradoxical, because only a small fraction of the bursts of cut-⌬R channels belonged to the slow component of the distribution (Fig. 8), implying that few bursts involved binding of ATP to the stabilizing site. Login to comment
406 Intriguingly, the same paradox seems to apply to intact K1250A CFTR channels, which also showed predominantly long openings under conditions where WT channels were only inefficiently locked by AMPPNP (see Carson and Welsh, 1993; Carson et al., 1995). Login to comment
407 Despite technical difficulties, such as excessive numbers of flickery closures coupled with the small overall number of bursts recorded, the distribution of cut- ⌬R(K1250A) burst durations indicated a mixture of two populations, both with lifetimes longer than the corresponding populations for cut-⌬R channels (Fig. 10 C). Login to comment
408 According to Scheme I, the slower components of those distributions reflect k3 for cut-⌬R channels, but k-2 for cut-⌬R(K1250A) channels. Login to comment
409 But the observation that the faster component was approximately fivefold prolonged for cut-⌬R(K1250A) channels, if correct, suggests that rate k-1 is also slowed in these channels, which would provide, during each burst, a longer time window for ATP to bind to NBD2. Login to comment
411 However, intact K1250A CFTR channels showed brief (‫-002ف‬ms) bursts at 10 ␮M ATP comparable with WT (Zeltwanger et al., 1999), and we occasionally saw comparably brief reopenings of cut- ⌬R(K1250A) channels in macropatches during ATP washout, when [ATP] was extremely low. Login to comment
412 In any event, an influence of the Walker-A mutation on more than one rate constant is not unexpected, since cut- ⌬R(K1250A) channels were also ‫-01ف‬fold slower in opening (␶ib ϭ 25 Ϯ 12 s in the absence of PKA, n ϭ 4) than cut-⌬R channels (␶ib ϭ 3.1 Ϯ 0.7 s in the absence of PKA, n ϭ 18; Table I), just like full-length K1250A CFTR channels, which reportedly open far more slowly than WT (Carson et al., 1995). Login to comment
465 For cut-⌬R(K1250A) channels, all parameters were measured in the absence of PKA. Login to comment
477 Parameters ash, al, ␶sh, and ␶l are fractional amplitudes and time constants of exponential components describing the distributions (Fig. 8) of burst durations (note al ϭ 1 - ash is not a free parameter); ␶b is mean burst duration, measured in the presence of PKA for WT and 633ϩ634, or pooled from all experiments for 835ϩ837, cut-⌬R (633ϩ837), and Flag-cut-⌬R (F633ϩ837); ␶AMPPNP and alocked are the time constant and fractional amplitude of the slowly relaxing macroscopic current component after removal of AMPPNP and ATP (see Table II); ␶relax and arelax, analogous, after just ATP, for cut-⌬R(K1250A) [633ϩ837(K1250A); Fig. 10 B]. Login to comment
480 The value of k1 KPo was obtained as the reciprocal of ␶ib in the presence of 2 mM MgATP and PKA (except for cut-⌬R(K1250A) channels, for which all data were obtained in the absence of PKA; apparent affinity was not measured for this construct). Login to comment
484 ***Rate k3, representing a compound step including ATP hydrolysis at NBD2, was set to zero for cut-⌬R(K1250A). Login to comment
486 Comparing cut-⌬R(K1250A) with cut-⌬R, the fit for the Walker-A mutant predicted nucleotide on and off rates at NBD2 (k2 and k-2) similar to those of cut-⌬R. However, to account for the observed distribution of bursts of the Walker mutant, k-1 had to be slowed by an order of magnitude compared with cut-⌬R channels, which, together with a similar decrease in opening rate (compare k1 with basal opening rate of cut-⌬R), calls into question either the assumed local nature of the effect on channel structure of the Walker-A point mutation, or all gating models in which the influence of ATP hydrolysis at NBD2 is limited to channel closure. Login to comment
496 Cut-⌬R channels seem capable of binding ATP at NBD2, evident from the locking effect of AMPPNP [and from the prolonged openings of cut- ⌬R(K1250A) channels], but the affinity of this binding site for nucleotide seems considerably lower than in phosphorylated WT channels (Figs. 6-8, and 10). Login to comment
500 We thank Dr. David Dawson for the CFTR K1250A clone, Atsuko Horiuchi and Peter Hoff for technical assistance, and Kate Hall for help with the preparation of the manuscript. Login to comment

[hide] A common mechanism for cystic fibrosis transmembra... J Pharmacol Exp Ther. 2001 Feb;296(2):464-72. Al-Nakkash L, Hu S, Li M, Hwang TC
A common mechanism for cystic fibrosis transmembrane conductance regulator protein activation by genistein and benzimidazolone analogs.
J Pharmacol Exp Ther. 2001 Feb;296(2):464-72., [PMID:11160632]

Abstract [show]
We have investigated the mechanism of action of two benzimidazolone analogs (NS004 and NS1619) on DeltaF508-CFTR using both whole-cell and cell-attached patch-clamp techniques and compared their effects with those of genistein. We conclude that benzimidazolone analogs and genistein act through a common mechanism, based on the following evidence: 1) both act only on phosphorylated CFTR, 2) the maximal DeltaF508-CFTR current activated by benzimidazolone analogs is identical to that induced by genistein, 3) benzimidazolone analogs increase the open probability of the forskolin-dependent DeltaF508-CFTR channel activity through an increase of the channel open time and a decrease of the channel closed time (effects indistinct from those reported for genistein), and 4) the prolonged K1250A-CFTR channel open time (in the presence of 10 microM forskolin) is unaffected by benzimidazolone analogs or genistein, supporting the hypothesis that these compounds stabilize the open state by inhibiting ATP hydrolysis at nucleotide binding domain 2 (NBD2). In addition, we demonstrate that NS004 and NS1619 are more potent CFTR activators than genistein (EC(50) values are 87 +/- 14 nM, 472 +/- 88 nM, and 4.4 +/- 0.5 microM, respectively). From our studies with the double mutant DeltaF508/K1250A-CFTR, we conclude that benzimidazolone analogs and genistein rectify the DeltaF508-CFTR prolonged closed time independent of their effects on channel open time, since these agonists enhance DeltaF508/K1250A-CFTR activity by shortening the channel closed time. These studies should pave the way toward understanding the agonist binding sites at a molecular level.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 We conclude that benzimidazolone analogs and genistein act through a common mechanism, based on the following evidence: 1) both act only on phosphorylated CFTR, 2) the maximal ⌬F508-CFTR current activated by benzimidazolone analogs is identical to that induced by genistein, 3) benzimidazolone analogs increase the open probability of the forskolin-dependent ⌬F508-CFTR channel activity through an increase of the channel open time and a decrease of the channel closed time (effects indistinct from those reported for genistein), and 4) the prolonged K1250A-CFTR channel open time (in the presence of 10 ␮M forskolin) is unaffected by benzimidazolone analogs or genistein, supporting the hypothesis that these compounds stabilize the open state by inhibiting ATP hydrolysis at nucleotide binding domain 2 (NBD2). Login to comment
3 From our studies with the double mutant ⌬F508/K1250A-CFTR, we conclude that benzimidazolone analogs and genistein rectify the ⌬F508-CFTR prolonged closed time independent of their effects on channel open time, since these agonists enhance ⌬F508/K1250A-CFTR activity by shortening the channel closed time. Login to comment
34 Neither benzimidazolone analogs nor genistein potentiate cAMP-dependent K1250A-CFTR activity, a nucleotide binding domain 2 mutant with a prolonged open time due to diminished ATP hydrolysis activity. Login to comment
35 Although the ⌬F508-CFTR channel open time is increased by introducing the K1250A mutation into the ⌬F508 background, the prolonged closed time is unaffected, suggesting that the prolonged closed time associated with the ⌬F508 mutation is independent of channel open time. Login to comment
36 Since benzimidazolone analogs and genistein enhance ⌬F508/K1250A-CFTR activity by shortening the channel closed time, we conclude that their rectification of the ⌬F508-CFTR prolonged closed time is independent of their effects on the channel open time. Login to comment
38 Materials and Methods Cell Culture NIH3T3 mouse fibroblast cells stably expressing either ⌬F508-CFTR or K1250A-CFTR were prepared as described previously (Berger et al., 1991; Zeltwanger et al., 1999). Login to comment
39 The ⌬F508/K1250A-CFTR double mutation was generated as follows. Login to comment
40 Plasmids containing ⌬F508-CFTR (⌬F508pRBG4) or K1250A-CFTR (K1250ApRBG4) were generously provided by Dr. R. R. Kopito (Stanford University, Stanford, CA). Login to comment
44 Using Superfect reagent (Qiagen, Valencia, CA), the ⌬F508/K1250A-CFTR double mutant was transiently transfected into NIH3T3 mouse fibroblast cells, according to the manufacturer`s protocol. Login to comment
188 Effects of NS004 and NS1619 on K1250A-CFTR. Login to comment
189 To further corroborate our evidence that NS004 and NS1619 act to stabilize the channel open state, we examined the effect of these drugs upon the K1250A-CFTR mutant channel. Login to comment
191 Figure 7 shows a representative recording of K1250A-CFTR in a cell-attached patch. Login to comment
193 Fold increases in mean K1250A-CFTR current amplitude were 1.09 Ϯ 0.11 (n ϭ 3) and 1.15 Ϯ 0.18 (n ϭ 3), respectively. Login to comment
195 In the same patch forskolin alone can reactivate the K1250A-CFTR current, and subsequent addition of 20 ␮M genistein had minimal effect on the current (fold increase ϭ 1.03 Ϯ 0.02, n ϭ 5). Login to comment
197 Thus, neither benzimidazolone analogs nor genistein altered the Po of K1250A-CFTR in the presence of a maximal concentration of forskolin. Login to comment
198 We further examined the effect of benzimidazolone analogs and genistein upon the open time of K1250A-CFTR. Login to comment
199 In cell-attached patches, steady-state macroscopic K1250A-CFTR current was generated by forskolin alone or forskolin plus either genistein or NS004 (each 20 ␮M); the patch was then excised into an ATP-free bath. Login to comment
203 These data demonstrate that the open time of the K1250A-CFTR channels activated with a maximally effective concentration of forskolin (10 ␮M) is not affected by either genistein or benzimidazolone analogs. Since neither the Po nor the open time of K1250A-CFTR is affected by genistein or benzimidazolone analogs, we conclude that the closed time of K1250A-CFTR is not affected when the cAMP pathway is maximally activated. Login to comment
204 The fact that these drugs do not change the open time of K1250A-CFTR is consistent with the idea that genistein acts by inhibiting ATP hydrolysis at NBD2 (Wang et al., 1998; Randak et al., 1999). Login to comment
205 However, a lack of effect on the K1250A-CFTR mutant could be caused by an obliteration of the binding site for these compounds by the mutation. Login to comment
206 This is perhaps not the case, since these reagents increase K1250A-CFTR channel activity when the cAMP stimulation is submaximal. Login to comment
207 Like wt-CFTR, the activity of K1250A-CFTR can be manipulated using different concentrations of forskolin (Al-Nakkash and Hwang, 1999). Login to comment
208 For example, sequential addition of 100 nM and then 10 ␮M forskolin to the bath solution generates an incremental increase in the steady-state macroscopic K1250A-CFTR current (data not shown). Login to comment
209 Under conditions that produce submaximal stimulation of the cAMP-dependent K1250A-CFTR channel activation (i.e., 100 nM forskolin), benzimidazolone analogs enhanced mean K1250A-CFTR current. Login to comment
210 In the presence of 100 nM forskolin, 50 nM and 20 ␮M NS004 increased the K1250A-CFTR current by 6.22 Ϯ 2.55-fold (n ϭ 6) and 19.09 Ϯ 9.71-fold (n ϭ 6), respectively. Login to comment
212 These data suggest, for those K1250A-CFTR channels that are not maximally stimulated (i.e., have not attained a maximum Po), that benzimidazolone analogs can potentiate the cAMP-dependent channel current. Login to comment
213 Effect of NS004 and NS1619 upon the ⌬F508/K1250A Double Mutation. Login to comment
217 To address this, we examined the effects of benzimidazolone analogs and genistein on the double mutant ⌬F508/K1250A-CFTR. Login to comment
218 Figure 8A shows a 30-min cell-attached recording from an NIH3T3 cell expressing ⌬F508/K1250A-CFTR. Login to comment
224 Effect of NS1619 and genistein upon forskolin-dependent K1250A-CFTR channel current. Login to comment
225 In this continuous cell-attached recording (lasting 50 min), the application of 10 ␮M forskolin elicits a macroscopic K1250A-CFTR current. Login to comment
227 Similarly, there is no effect of 20 ␮M genistein upon the steady-state macroscopic K1250A-CFTR current generated by 10 ␮M forskolin. Login to comment
228 The expanded section shows the closure of all K1250A channels upon removal of agonists and a return to basal activity (expanded trace lasts for 200 s). Login to comment
230 K1250A mutation into the ⌬F508-CFTR background does not rectify the functional defect associated with ⌬F508-CFTR and that NS004 greatly potentiates the Po of ⌬F508/K1250A-CFTR. Login to comment
232 In this cell-attached patch recording of ⌬F508/K1250A-CFTR, one single channel opens for 20 s in the presence of forskolin alone (a phenotype for the K1250A-CFTR mutation), but the channel is predominantly closed (a phenotype for the ⌬F508-CFTR mutation). Login to comment
263 Effect of NS004 and NS1619 on ⌬F508/K1250A current. Login to comment
264 A, 30-min continuous recording showing the effect of NS004 on forskolin-dependent macroscopic ⌬F508/K1250A-CFTR current. Login to comment
267 B, effect of NS1619 on forskolin-dependent ⌬F508/ K1250A-CFTR channel current in a patch containing one single channel. Login to comment
273 Last, neither benzimidazolone analogs nor genistein can potentiate K1250A-CFTR channel current activated by a maximally effective concentration of forskolin. Login to comment
275 We show, from macroscopic relaxation analysis, that the open time for K1250A-CFTR is not changed by benzimidazolone analogs or genistein, supporting the hypothesis that these compounds stabilize the open state by inhibiting ATP hydrolysis at NBD2. Login to comment
285 First, when K1250A-CFTR is submaximally stimulated with nanomolar forskolin, the closed time can still be decreased by benzimidazolone analogs. Login to comment
286 Second, when the double mutant ⌬F508/ K1250A-CFTR is stimulated with a maximally effective concentration of forskolin, the prolonged open time caused by the K1250A mutation does not automatically correct the abnormally long closed time associated with the ⌬F508 mutation. Login to comment

[hide] Differential interactions of nucleotides at the tw... J Biol Chem. 2001 Apr 20;276(16):12918-23. Epub 2001 Jan 29. Aleksandrov L, Mengos A, Chang X, Aleksandrov A, Riordan JR
Differential interactions of nucleotides at the two nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator.
J Biol Chem. 2001 Apr 20;276(16):12918-23. Epub 2001 Jan 29., 2001-04-20 [PMID:11279083]

Abstract [show]
After phosphorylation by protein kinase A, gating of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is regulated by the interaction of ATP with its nucleotide binding domains (NBDs). Models of this gating regulation have proposed that ATP hydrolysis at NBD1 and NBD2 may drive channel opening and closing, respectively (reviewed in Nagel, G. (1999) Biochim. Biophys. Acta 1461, 263-274). However, as yet there has been little biochemical confirmation of the predictions of these models. We have employed photoaffinity labeling with 8-azido-ATP, which supports channel gating as effectively as ATP to evaluate interactions with each NBD in intact membrane-bound CFTR. Mutagenesis of Walker A lysine residues crucial for azido-ATP hydrolysis to generate the azido-ADP that is trapped by vanadate indicated a greater role of NBD1 than NBD2. Separation of the domains by limited trypsin digestion and enrichment by immunoprecipitation confirmed greater and more stable nucleotide trapping at NBD1. This asymmetry of the two domains in interactions with nucleotides was reflected most emphatically in the response to the nonhydrolyzable ATP analogue, 5'-adenylyl-beta,gamma-imidodiphosphate (AMP-PNP), which in the gating models was proposed to bind with high affinity to NBD2 causing inhibition of ATP hydrolysis there postulated to drive channel closing. Instead we found a strong competitive inhibition of nucleotide hydrolysis and trapping at NBD1 and a simultaneous enhancement at NBD2. This argues strongly that AMP-PNP does not inhibit ATP hydrolysis at NBD2 and thereby questions the relevance of hydrolysis at that domain to channel closing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 EXPERIMENTAL PROCEDURES Materials- BHK-21 cells stably expressing wild-type human CFTR were prepared and maintained as described previously (20) as were cells expressing the K464A and K1250A mutants. Login to comment
63 A, membranes from BHK cells expressing wild-type and the K1250A (15 ␮g of protein) and K464A variants (60 ␮g of protein) were incubated with 20 ␮M 8-azido-[␣-32 P]ATP in the presence of 0.5 mM orthovanadate and processed as under "Experimental Procedures." Login to comment
69 (K1250A) is reduced only a small amount compared with wild type indicating that normally there may be little hydrolysis and trapping at NBD2. Login to comment

[hide] Voltage-dependent flickery block of an open cystic... J Physiol. 2001 Apr 15;532(Pt 2):435-48. Zhou Z, Hu S, Hwang TC
Voltage-dependent flickery block of an open cystic fibrosis transmembrane conductance regulator (CFTR) channel pore.
J Physiol. 2001 Apr 15;532(Pt 2):435-48., 2001-04-15 [PMID:11306662]

Abstract [show]
1. Fast flickery block of the cystic fibrosis transmembrane conductance regulator (CFTR) was studied with cell-attached and whole-cell patch-clamp recordings from mouse NIH3T3 cells stably expressing a mutant CFTR channel, K1250A-CFTR. This mutant CFTR channel, once open, can stay open for minutes. Within a prolonged opening, the kinetics of fast flickery closures can be readily quantified. 2. Flickering block of K1250A-CFTR channels was voltage dependent since the open probability within an opening burst decreased as the membrane was hyperpolarized. 3. Mean open time (tau(o)) and mean closed time (tau(c)), obtained from single-channel kinetic analysis, were corrected for missed events. Our data show that corrected tau(c) was voltage dependent while corrected tau(o) exhibited little voltage dependence. Results from whole-cell current relaxation upon voltage jump further indicate that tau(c) at a membrane potential of -100 mV was at least 10-fold longer than that at +100 mV. 4. tau(c), but not tau(o), was sensitive to external permeant anions. After complete replacement of external Cl(-) with impermeant anions, tau(c) showed little voltage dependence and approximated a value observed under strong hyperpolarization in the presence of high external permeant anions. These results suggest that the resident time of the blocker is prolonged by conditions (i.e. hyperpolarization or the absence of external permeant anions) that deplete Cl(-) in the CFTR pore. 5. Results from macroscopic current noise analysis of both wild-type CFTR and K1250A-CFTR channels further confirm the voltage dependence and Cl(-) sensitivity of the fast flickery block observed with single-channel analysis. 6. We conclude that the voltage dependence of the flickery block in CFTR is mainly due to the voltage-dependent occupancy of an anion-binding site in the channel pore by trans-anions. The blocker acquires a voltage-dependent off rate through an electrostatic interaction with Cl(-) in the pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Fast flickery block of the cystic fibrosis transmembrane conductance regulator (CFTR) was studied with cell-attached and whole-cell patch-clamp recordings from mouse NIH3T3 cells stably expressing a mutant CFTR channel, K1250A-CFTR. Login to comment
12 Flickering block of K1250A-CFTR channels was voltage dependent since the open probability within an opening burst decreased as the membrane was hyperpolarized. Login to comment
22 Results from macroscopic current noise analysis of both wild-type CFTR and K1250A-CFTR channels further confirm the voltage dependence and Cl_ sensitivity of the fast flickery block observed with single-channel analysis. Login to comment
38 To overcome these technical difficulties, we characterized the kinetics of the flickery blockade using the CFTR mutant K1250A in which the conserved Walker A lysine (K) at amino acid position 1250 located in NBD2 is replaced by the neutral amino acid alanine (A). Login to comment
40 Within a long opening of K1250A-CFTR, fast flickers are clearly discernible (Zeltwanger et al. 1999). Login to comment
42 In the present paper, fast flickery block of CFTR was studied with cell-attached and whole-cell patch-clamp techniques in NIH3T3 cells stably expressing wild-type or K1250A-CFTR. Login to comment
46 Using spectrum analysis of macroscopic K1250A-CFTR and wild-type CFTR currents, we obtained corner frequencies (fc) at different membrane potentials. Login to comment
47 The measured fc agreed well with the fc calculated from the single-channel kinetic parameters obtained for K1250A-CFTR channels. Login to comment
50 METHODS Cell culture NIH3T3 cell lines stably expressing wild-type CFTR (Anderson et al. 1991) or K1250A-CFTR (Zeltwanger et al. 1999) were grown at 37°C and 5 % CO2 in Dulbecco`s Modified Eagle`s Medium (DMEM) supplemented with 10% fetal bovine serum. Login to comment
62 To obtain single-channel recordings, we activated multiple K1250A-CFTR channels with 10 µM forskolin, then washed out the forskolin and observed current decay. Login to comment
64 Under this condition, once the K1250A-CFTR channel closes from the activated state, it remains closed unless forskolin is re-applied. Login to comment
97 Noise analysis Macroscopic K1250A-CFTR or wild-type CFTR currents in cell-attached patches were elicited with 10 µM forskolin. Login to comment
99 At least 60 s of K1250A-CFTR current recordings or 180 s of wild-type CFTR current recordings were fast Fourier transformed to generate noise spectra that were further analysed in a bandwidth of 9.7-600 Hz for K1250A-CFTR or 3.9-800 Hz for wild-type CFTR with Igor software. Login to comment
100 Data from K1250A-CFTR were fitted with a single Lorentzian function to estimate the Lorentzian parameters: S(f) = S0/(1 + (f/fc)2 ) + S1, where fc is the corner frequency, S0 is the zero-frequency asymptote, S1 is non-specific basal noise and S(f) is the spectral density at the frequency f. Data from wild-type CFTR were fitted with the sum of two Lorentzian components: S(f) = S0/(1 + (f/fc1)2 ) + S1/(1 + (f/fc2)2 ) + S2, where S0 and S1 are the zero-frequency asymptotes corresponding to fc1 and fc2, respectively, and S2 is the basal noise. Login to comment
101 RESULTS Voltage-dependent fast flickery block of the K1250A-CFTR channels It has been shown previously that in cell-attached patches, the inward CFTR current shows more flickering events than the outward current, and that the number of these fast flickers is dramatically reduced upon patch excision (Haws et al. 1992; Fischer & Machen, 1994, 1996). Login to comment
102 The flickering block of K1250A-CFTR channels shares these two characteristic features with wild-type channels. Login to comment
103 Figure 1A shows that the fast flickery events present in a cell-attached patch from NIH3T3 cells stably expressing K1250A-CFTR channels were reduced in frequency upon patch excision. Login to comment
109 The fast flickery block of K1250A-CFTR channels also showed clear voltage dependence when recorded in the cell-attached configuration. Login to comment
112 Fast flickery block of K1250A-CFTR channels A, the fast flickery events diminished dramatically after patch excision. Login to comment
113 A cell-attached patch from an NIH3T3 cell stably expressing the K1250A-CFTR channel was held at _70 mV (_Vp). Login to comment
121 Voltage dependence of the fast flickery block of K1250A-CFTR channels A, representative single-channel current traces at different potentials (_Vp) recorded in the cell-attached configuration with 154 mM Cl_ pipette solution. Dotted lines indicate the baseline current level. Login to comment
132 In the present study, similar observations were made with the K1250A-CFTR channel. Login to comment
168 Voltage-dependent block of the whole-cell K1250A-CFTR current Our single-channel recordings were filtered at 100 Hz (dead time = 3 ms) in order to obtain a reasonable signal-to-noise ratio for dwell time analysis. Login to comment
172 Under symmetrical Cl_ conditions with 125 mM Cl_ in both the external and the internal solutions, the whole-cell instantaneous I-V relationship of K1250A-CFTR was linear whereas the steady-state I-V relationship was somewhat outwardly rectifying (data not shown). Login to comment
180 Flickery block of K1250A-CFTR in the absence of external Cl_ Representative single-channel current traces at different potentials (_Vp) recorded from a cell-attached patch with 0 mM Cl_ pipette solution. Dotted lines indicate the baseline current level. Login to comment
185 Voltage-dependent block of the whole-cell K1250A-CFTR current A, net CFTR currents were determined by subtracting the current response of the cell in the absence of forskolin from that in the presence of 10 µM forskolin with 125 mM internal Cl_ and 11 mM external Cl_ . Login to comment
186 The cAMP-activated K1250A-CFTR current density was 55 ± 12 pA pF_1 at 0 mV holding potential (n = 4). Login to comment
209 Noise analysis of macroscopic K1250A-CFTR and wild-type CFTR currents Ideally, one should analyse single-channel kinetics on data that are lightly filtered in order to obtain more reliable kinetic parameters. Login to comment
212 Macroscopic K1250A-CFTR currents were evoked by 10 µM forskolin in cell-attached patches from NIH3T3 cells stably expressing K1250A-CFTR. Login to comment
214 Figure 6 shows representative noise spectra of K1250A-CFTR macroscopic currents recorded at _50 mV in a cell-attached patch. Login to comment
226 K1250A-CFTR current noise spectra of recordings filtered at two different frequencies Macroscopic K1250A-CFTR currents, activated with 10 µM forskolin in a cell-attached patch held at _50 mV, were filtered at 1 kHz (A) or 5 kHz (B). Login to comment
238 On the other hand, fc2 was in the frequency range of the fast flickery events seen in K1250A-CFTR channels. Login to comment
239 Furthermore, fc2 showed a similar voltage dependence to that observed in K1250A-CFTR channels (Fig. 9B). Login to comment
241 Effects of voltage and external Cl_ on K1250A-CFTR current noise spectra Comparison of normalized K1250A-CFTR current noise spectra at _100 mV (0) and +50 mV (1) with 154 mM external Cl_ (A) and with 0 mM external Cl_ (B). Login to comment
248 Comparison of fc estimated from noise analysis and fc calculated from kinetic parameters from single-channel analysis Filled circles represent mean fc at _100, _50, _20 and +50 mV estimated from noise analysis of K1250A-CFTR macroscopic currents in the presence of 154 mM external Cl_ . Login to comment
250 fast flickery block of K1250A-CFTR channels is probably applicable to wild-type CFTR channels. Login to comment
275 Results from noise analysis of macroscopic K1250A-CFTR current further verify our conclusions Z. Zhou, S. Hu and T.-C. Hwang444 J. Physiol. 532.2 Figure 9. Login to comment
285 One concern of using the CFTR mutant K1250A-CFTR to study the mechanism of fast flickery block is whether K1250A-CFTR and wild-type CFTR share the same mechanism of voltage-dependent flickery block. Login to comment
288 Since fc2 of wild-type CFTR channels shows a similar voltage dependence to that of K1250A-CFTR (Fig. 9B), we believe that the voltage-dependent mechanism proposed for the fast flickery block of K1250A-CFTR channels is probably also applicable to wild-type CFTR channels. Login to comment
289 It is worth noting, however, that fc2 of wild-type CFTR channels is slightly higher than the fc of the fast flickers seen in K1250A-CFTR channels. Login to comment
328 In this study, we took the advantage of the CFTR mutant K1250A-CFTR, which can be 'locked` open for minutes to allow more accurate kinetic analysis of the flickery block of CFTR channels. Login to comment
331 We believe future studies of channel blockade in K1250A-CFTR channels by exogenously applied blockers could provide useful information on the mechanism of CFTR blockade as well as on the structure of the CFTR pore. Login to comment

[hide] ATP hydrolysis-coupled gating of CFTR chloride cha... Biochemistry. 2001 May 15;40(19):5579-86. Zou X, Hwang TC
ATP hydrolysis-coupled gating of CFTR chloride channels: structure and function.
Biochemistry. 2001 May 15;40(19):5579-86., 2001-05-15 [PMID:11341822]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
154 Converting lysine 1250 to alanine (K1250A) almost completely abolishes the ATPase activity (46). Login to comment
155 A critical role of this NBD2 lysine in CFTR gating was demonstrated by the result that the open time of the K1250A CFTR mutant is significantly prolonged from hundreds of milliseconds to minutes (38), an effect similar to the effect of AMP-PNP on wild-type channels (see the previous section). Login to comment
165 Kinetic studies of the K1250A CFTR channels have refined the function of NBD2. Login to comment
166 It was first suggested that hydrolysis of ATP at NBD2 plays an obligatory role in closing of the channel since the K1250A mutant CFTR exhibits a much longer open time (31, 32). Login to comment
167 This model predicts that the open time of the K1250A mutant CFTR will be independent of the concentration of ATP. Login to comment
170 However, while the K1250A CFTR channel, once opened by a millimolar level of ATP, can remain open for minutes, the mean open time is only ~250 ms when the channel is opened by a low micromolar ATP concentration. Login to comment
172 Assuming that lowering the concentration of ATP only affects the probability of the occupancy of NBDs, Zeltwanger et al. (38) hypothesize that at low micromolar ATP concentrations, the K1250A CFTR channels close before ATP binds at NBD2. Login to comment
236 Their model is based mainly on the studies of the K464A and K1250A mutants, assuming mutations of the Walker A lysines diminish the level of ATP hydrolysis at respective NBDs. Login to comment
240 This model explains the results showing that the K464A mutant shows a longer open time at micromolar ATP concentrations than that at millimolar ATP concentrations, whereas the K1250A mutant shows an opposite pattern of gating in response to changes in the ATP concentration (cf. ref 38). Login to comment
245 The demonstration that the K1250A mutant CFTR shows a drastically reduced ATP hydrolysis rate (48) is consistent with this idea of tight coupling since the duration of the gating cycle of this mutant is in the range of minutes (38). Login to comment

[hide] A cluster of negative charges at the amino termina... J Physiol. 2001 Oct 15;536(Pt 2):459-70. Fu J, Ji HL, Naren AP, Kirk KL
A cluster of negative charges at the amino terminal tail of CFTR regulates ATP-dependent channel gating.
J Physiol. 2001 Oct 15;536(Pt 2):459-70., 2001-10-15 [PMID:11600681]

Abstract [show]
1. The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is activated by protein kinase A (PKA) phosphorylation of its R domain and by ATP binding at its nucleotide-binding domains (NBDs). Here we investigated the functional role of a cluster of acidic residues in the amino terminal tail (N-tail) that also modulate CFTR channel gating by an unknown mechanism. 2. A disease-associated mutant that lacks one of these acidic residues (D58N CFTR) exhibited lower macroscopic currents in Xenopus oocytes and faster deactivation following washout of a cAMP -activating cocktail than wild-type CFTR. 3. In excised membrane patches D58N CFTR exhibited a two-fold reduction in single channel open probability due primarily to shortened open channel bursts. 4. Replacing this and two nearby acidic residues with alanines (D47A, E54A, D58A) also reduced channel activity, but had negligible effects on bulk PKA phosphorylation or on the ATP dependence of channel activation. 5. Conversely, the N-tail triple mutant exhibited a markedly inhibited response to AMP-PNP, a poorly hydrolysable ATP analogue that can nearly lock open the wild-type channel. The N-tail mutant had both a slower response to AMP-PNP (activation half-time of 140 +/- 20 s vs. 21 +/- 4 s for wild type) and a lower steady-state open probability following AMP-PNP addition (0.68 +/- 0.08 vs. 0.92 +/- 0.03 for wild type). 6. Introducing the N-tail mutations into K1250A CFTR, an NBD2 hydrolysis mutant that normally exhibits very long open channel bursts, destabilized the activity of this mutant as evidenced by decreased macroscopic currents and shortened open channel bursts. 7. We propose that this cluster of acidic residues modulates the stability of CFTR channel openings at a step that is downstream of ATP binding and upstream of ATP hydrolysis, probably at NBD2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 Introducing the N-tail mutations into K1250A CFTR, an NBD2 hydrolysis mutant that normally exhibits very long open channel bursts, destabilized the activity of this mutant as evidenced by decreased macroscopic currents and shortened open channel bursts. Login to comment
53 However, the N-tail mutations prevented the prolonged channel openings that are normally induced by AMP-PNP or by an NBD2 mutation that inhibits ATP hydrolysis (K1250A). Login to comment
194 If the N-tail mutations destabilize the long channel openings that predominate under conditions of reduced hydrolysis by NBD2, then they should also inhibit the very long bursts that are characteristic of K1250A. Login to comment
195 K1250A CFTR is a NBD2 mutant that lacks a lysine at the Walker A motif that is critical for ATPase activity. Login to comment
197 We introduced the N-tail triple mutations into K1250A CFTR as another test of whether the N-tail regulates gating by affecting a step prior to ATP hydrolysis (i.e. at NBD2). Login to comment
198 The triple/K1250A mutant exhibited lower macroscopic currents (Fig. 6A) and faster deactivation (Fig. 6B) compared with K1250A in voltage clamp studies of intact oocytes. Login to comment
199 In single channel studies we observed that the very long bursts of K1250A CFTR were disrupted by the N-tail mutations (Fig. 7). Login to comment
200 The triple/K1250A mutant exhibited a lower single channel open probability due to a marked reduction in open channel burst duration (Fig. 7D). Login to comment
203 The N-tail mutations inhibit the macroscopic currents and accelerate the deactivation kinetics of the hydrolysis mutant, K1250A CFTR A, macroscopic currents mediated by K1250A CFTR and triple/K1250A CFTR were measured in intact oocytes as described in Fig. 1 legend. Login to comment
204 Equal amounts of K1250A and triple/K1250A cRNAs (1 ng) were injected into oocytes (n = 6 oocytes for K1250A, n = 8 for triple/K1250A). Login to comment
205 B, deactivation of K1250A (n = 3) and triple/K1250A (n = 4) currents were monitored following washout of cAMP cocktail as described. Login to comment
208 The N-tail mutations disrupt the long open channel bursts of K1250A CFTR A and B, representative records from excised inside-out patches for K1250 and triple/K1250A, respectively (1.5 mM MgATP for each). Login to comment
209 C and D, mean single channel Po and burst duration for K1250A (n = 4 patches) and triple/K1250A (n = 5 patches). Login to comment
220 However, there does appear to be a rough correlation between macroscopic deactivation kinetics and single channel burst duration for a number of CFTR mutants that have been assayed for both parameters (e.g. K1250A CFTR, which exhibits both prolonged channel bursts and slower macroscopic deactivation; Carson et al. 1995; Gunderson & Kopito, 1995; Wilkinson et al. 1996). Login to comment
222 If so, perhaps mutations that destabilize (e.g. N-tail mutations) or stabilize (e.g. K1250A) channel openings also influence the stability of channel phosphorylation. Login to comment
231 In addition, the N-tail mutations destabilized the long bursts that are a feature of an NBD2 mutant (K1250A) that is defective at ATP hydrolysis (Ramjeesingh et al. 1999). Login to comment
241 We place this transition upstream of ATP hydrolysis because these mutants do inhibit the long bursts that are otherwise activated by manoeuvres that inhibit ATP hydrolysis (AMP-PNP and K1250A mutation). Login to comment
243 It appears from our data that the N-tail both facilitates the entry of the channel into the longer open state (as evidenced by a decreased rate of activation of N-tail mutants by AMP-PNP) and inhibits exit from this longer open state (as evidenced by destabilization of the long bursts of K1250A CFTR by introducing the N-tail mutations). Login to comment
244 The results of our K1250A and AMP-PNP experiments appear to link functionally NBD2 and the N-tail in the regulation of CFTR channel gating. Login to comment
270 AMP-PNP and the K1250A mutation normally prolong CFTR openings by blocking ATP hydrolysis, presumably at NBD2. Login to comment
384 They also thank Drs Dale Benos and Michael Quick for their support and guidance, and Dr David Dawson for the K1250A mutant. Login to comment

[hide] Mutations that change the position of the putative... J Biol Chem. 2002 Jan 18;277(3):2125-31. Berger AL, Ikuma M, Hunt JF, Thomas PJ, Welsh MJ
Mutations that change the position of the putative gamma-phosphate linker in the nucleotide binding domains of CFTR alter channel gating.
J Biol Chem. 2002 Jan 18;277(3):2125-31., 2002-01-18 [PMID:11788611]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel is an ATP-binding cassette transporter that contains conserved nucleotide-binding domains (NBDs). In CFTR, the NBDs bind and hydrolyze ATP to open and close the channel. Crystal structures of related NBDs suggest a structural model with an important signaling role for a gamma-phosphate linker peptide that couples bound nucleotide to movement of an alpha-helical subdomain. We mutated two residues in CFTR that the structural model predicts will uncouple effects of nucleotide binding from movement of the alpha-helical subdomain. These residues are Gln-493 and Gln-1291, which may directly connect the ATP gamma-phosphate to the gamma-phosphate linker, and residues Asn-505 and Asn-1303, which may form hydrogen bonds that stabilize the linker. In NBD1, Q493A reduced the frequency of channel opening, suggesting a role for this residue in coupling ATP binding to channel opening. In contrast, N505C increased the frequency of channel opening, consistent with a role for Asn-505 in stabilizing the inactive state of the NBD. In NBD2, Q1291A decreased the effects of pyrophosphate without altering other functions. Mutations of Asn-1303 decreased the rate of channel opening and closing, suggesting an important role for NBD2 in controlling channel burst duration. These findings are consistent with both the bacterial NBD structural model and gating models for CFTR. Our results extend models of nucleotide-induced structural changes from bacterial NBDs to a functional mammalian ATP-binding cassette transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 However, the effects of mutations in the two NBDs are not symmetrical; the K1250A mutation dramatically prolongs the burst duration, whereas the K464A mutation reduces the frequency of channel opening but does not change burst duration. Login to comment
145 For example, the CFTR-K1250A mutant markedly prolongs burst duration (9, 10, 13, 22). Login to comment
168 between CFTR-N1303K and CFTR-K1250A, we examined the effect of PPi and ADP. Login to comment

[hide] The First Nucleotide Binding Domain of Cystic Fibr... J Biol Chem. 2002 May 3;277(18):15419-25. Epub 2002 Feb 22. Aleksandrov L, Aleksandrov AA, Chang XB, Riordan JR
The First Nucleotide Binding Domain of Cystic Fibrosis Transmembrane Conductance Regulator Is a Site of Stable Nucleotide Interaction, whereas the Second Is a Site of Rapid Turnover.
J Biol Chem. 2002 May 3;277(18):15419-25. Epub 2002 Feb 22., 2002-05-03 [PMID:11861646]

Abstract [show]
As in other adenine nucleotide binding cassette (ABC) proteins the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator (CFTR) bind and hydrolyze ATP and in some manner regulate CFTR ion channel gating. Unlike some other ABC proteins, however, there are preliminary indications that the two domains of CFTR are nonequivalent in their nucleotide interactions (Szabo, K., Szakacs, G., Hegeds, T., and Sarkadi, B. (1999) J. Biol. Chem. 274, 12209-12212; Aleksandrov, L., Mengos, A., Chang, X., Aleksandrov, A., and Riordan, J. R. (2001) J. Biol. Chem. 276, 12918-12923). We have now characterized the interactions of the 8-azido-photoactive analogues of ATP, ADP, and 5'-adenyl-beta,gamma-imidodiphosphate (AMP-PNP) with the two domains of functional membrane-bound CFTR. The results show that the two domains appear to act independently in the binding and hydrolysis of 8-azido-ATP. At NBD1 binding does not require a divalent cation. This binding is followed by minimal Mg(2+)-dependent hydrolysis and retention of the hydrolysis product, 8-azido-ADP, but not as a vanadate stabilized post-hydrolysis transition state complex. In contrast, at NBD2, MgN(3)ATP is hydrolyzed as rapidly as it is bound and the nucleoside diphosphate hydrolysis product dissociates immediately. Confirming this characterization of NBD1 as a site of more stable nucleotide interaction and NBD2 as a site of fast turnover, the non-hydrolyzable N(3)AMP-PNP bound preferentially to NBD1. This demonstration of NBD2 as the rapid nucleotide turnover site is consistent with the strong effect on channel gating kinetics of inactivation of this domain by mutagenesis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 To distinguish between these possibilities, the Walker A lysine mutants K464A and K1250A were used; K464A ablated labeling of NBD1 without influencing that at NBD2, and hence the N3ADP that labeled * This work was supported by Grant DK51619 from the NIDDK, National Institutes of Health and by the Cystic Fibrosis Foundation. Login to comment
43 Stable BHK-21 cell lines expressing wild-type and K464A and K1250A variants of CFTR were established and cultured as described previously (16, 17). Login to comment
130 As expected, the mutations K464A and K1250A prevented photolabeling with either 8-azido-ATP or 8-azido-ADP of NBD1 and NBD2, respectively. Login to comment
131 However, there was no indication that the mutation in one domain had any influence on the labeling of the other, i.e. in K464A, NBD2 was labeled as in wild-type and in K1250A, NBD1 was not different from wild type. Login to comment
191 Membranes from BHK cells expressing wild-type and K464A and K1250A variants of CFTR were incubated as in Figs. Login to comment

[hide] Mutation of Walker-A lysine 464 in cystic fibrosis... J Physiol. 2002 Mar 1;539(Pt 2):333-46. Powe AC Jr, Al-Nakkash L, Li M, Hwang TC
Mutation of Walker-A lysine 464 in cystic fibrosis transmembrane conductance regulator reveals functional interaction between its nucleotide-binding domains.
J Physiol. 2002 Mar 1;539(Pt 2):333-46., 2002-03-01 [PMID:11882668]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel bears two nucleotide-binding domains (NBD1 and NBD2) that control its ATP-dependent gating. Exactly how these NBDs control gating is controversial. To address this issue, we examined channels with a Walker-A lysine mutation in NBD1 (K464A) using the patch clamp technique. K464A mutants have an ATP dependence (EC(50) approximate 60 microM) and opening rate at 2.75 mM ATP (approximately 2.1 s(-1)) similar to wild type (EC(50) approximate 97 microM; approximately 2.0 s(-1)). However, K464A's closing rate at 2.75 mM ATP (approximately 3.6 s(-1)) is faster than that of wild type (approximately 2.1 s(-1)), suggesting involvement of NBD1 in nucleotide-dependent closing. Delay of closing in wild type by adenylyl imidodiphosphate (AMP-PNP), a non-hydrolysable ATP analogue, is markedly diminished in K464A mutants due to reduction in AMP-PNP's apparent on-rate and acceleration of its apparent off-rate (approximately 2- and approximately 10-fold, respectively). Since the delay of closing by AMP-PNP is thought to occur via NBD2, K464A's effect on the NBD2 mutant K1250A was examined. In sharp contrast to K464A, K1250A single mutants exhibit reduced opening (approximately 0.055 s(-1)) and closing (approximately 0.006 s(-1)) rates at millimolar [ATP], suggesting a role for K1250 in both opening and closing. At millimolar [ATP], K464A-K1250A double mutants close approximately 5-fold faster (approximately 0.029 s(-1)) than K1250A but open with a similar rate (approximately 0.059 s(-1)), indicating an effect of K464A on NBD2 function. In summary, our results reveal that both of CFTR's functionally asymmetric NBDs participate in nucleotide-dependent closing, which provides important constraints for NBD-mediated gating models.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Since the delay of closing by AMP-PNP is thought to occur via NBD2, K464A`s effect on the NBD2 mutant K1250A was examined. Login to comment
17 In sharp contrast to K464A, K1250A single mutants exhibit reduced opening (~0.055 s_1 ) and closing (~0.006 s_1 ) rates at millimolar [ATP], suggesting a role for K1250 in both opening and closing. Login to comment
18 At millimolar [ATP], K464A-K1250A double mutants close ~5-fold faster (~0.029s_1 )thanK1250Abutopenwithasimilarrate(~0.059s_1 ),indicatinganeffectofK464Aon NBD2 function. Login to comment
22 The idea that this second functional site corresponds to NBD2 became prominent because millimolar [ATP] can prolong the opening of a Walker-A lysine mutant at NBD2 (i.e. K1250A), mimicking AMP-PNP`s effect on wild type CFTR (Carson et al. 1995; Gunderson & Kopito, 1995; Zeltwanger et al. 1999). Login to comment
31 The plasmids K464A-pRBG4 and K1250A-pRBG4 were gifts from Dr R. R. Kopito (Stanford University, CA, USA), and the plasmid CFTRwt-pBQ4.7 and the retroviral vector pLJ were gifts from Dr M. Drumm (Case Western Reserve University, Cleveland, OH, USA). Login to comment
32 To construct K464A-pBQ and K1250A-pBQ, the 0.7 kb BspEI-BstZ171 fragment from K464A-pRBG4 and the 3.0 kb BspEI-NcoI fragment from K1250A-pRBG4, respectively, replaced the corresponding ones in CFTRwt-pBQ4.7. Login to comment
33 To create WT-pLJ and K1250A-pLJ, the 4.7 kb EcoICRI fragments from CFTRwt-pBQ4.7 and K1250A-pBQ, respectively, were ligated to Bcl I linkers, cut with BclI, then ligated into the BamHI site of the pLJ vector. Login to comment
35 To generate WT-pCDNA, K464A-pCDNA and K1250A-pCDNA,the4.7 kbPstIfragmentsfromthecorresponding pBQ constructs were subcloned into the PstI site of pCDNA. Login to comment
36 For the creation of K464A-K1250A-pCDNA, the 2.7 kb BspEI-PflMI fragment from K464A-pCDNA was used to substitute the corresponding region in K1250A-pCDNA. Login to comment
40 To obtain recordings with few channels per patch, we used NIH3T3 cells stably transfected with wild type CFTR (Berger et al. 1991), CFTR-K1250A and CFTR-K464A (Zeltwanger et al. 1999; present study). Login to comment
75 EstimationofkineticparametersforK1250Aand K464A-K1250A For recordings of quasi-macroscopic K1250A and K464A-K1250A channel currents, open probability was estimated by means of variance analysis (Sigworth, 1980): Po = (1 _ (s2 /Ii)), where Po represents open probability, s2 the variance of steady-state current, I the mean steady-state current and i the single channel amplitude. Login to comment
80 RESULTS As a step towards understanding how CFTR`s NBDs participate in gating, we examined the kinetic behaviour of the NBD1 mutant K464A, the NBD2 mutant K1250A and double mutant K464A-K1250A. Login to comment
197 Thus, channels bearing K1250A, the lysine-to-alanine mutation in the Walker-A motif of NBD2, exhibit a prolonged open state, similar to the AMP-PNP-dependent locked open state (Carson et al. 1995; Gunderson & Kopito, 1995; Ramjeesingh et al. 1999; Zeltwanger et al. 1999). Login to comment
198 We wondered whether K464A reduces channel open time in K1250A mutants as it does with AMP-PNP. Login to comment
199 To test this idea, we determined the mean open time for both K1250A single mutant and K464A-K1250A double mutant channels using relaxation time courses upon ATP withdrawal (Fig. 7A). Login to comment
200 In the examples shown, the double mutant relaxes more rapidly than the single mutant. On average, K464A-K1250A channel currents decay fivefold morequicklythanK1250A(34 ± 7 s,n = 5versus167 ± 37 s, n = 6, respectively; Fig. 7C; cf. Zeltwanger et al.1999). Login to comment
202 We also examined the open probability of K1250A and K464A-K1250A. Login to comment
210 In this example, all four K1250A channels remain open for most of the sweep, whereas only two of the three double mutants channels are open most of the time, suggesting a lower Po for K464A-K1250A. Login to comment
211 As expected, K1250A channels exhibit a steady-state Po of 0.89 ± 0.02 (n = 6; Fig. 7C) and double mutants 0.67 ± 0.05 (n = 5; P < 0.005). Login to comment
212 Our estimates of Po for both mutants are much higher than previously reported (~ 0.2_0.34 for K1250A and ~ 0.25 for K464A-K1250A; Carson et al. 1995; Ramjeesingh et al. 1999; but cf. ~0.9 for K1250A; Gunderson & Kopito, 1995). Login to comment
213 The differences probably arise from measurements of presteady-state phosphorylated K1250A channels which exhibit a lower Po than those at the steady state (A.C.Powe & T.-C.Hwang, unpublished observations). Login to comment
214 To see whether the reduced Po of K464A-K1250A mutants arises only from shorter open times, we calculated mean closed times from steady-state Po and relaxation time constants (see Methods). Login to comment
215 The calculated mean closed time for K1250A at 2.75 m ATP was 18 ± 4 s (n = 6; Fig. 7C). Login to comment
216 Thus, K1250A prolongs closed time >30-fold compared either to wild type or to the K464A single mutant (Fig. 3B). Login to comment
218 The mean closed time for K464A-K1250A (17 ± 4 s, n = 5; Fig. 7B) is similar to that for K1250A (P ∆ 0.42). Login to comment
220 Although K1250A exhibits long open times at millimolar [ATP], the mutant channel opens only briefly at micromolar [ATP] (Zeltwanger et al. 1999). Login to comment
221 We tested whether K464A-K1250A behaved in a similar manner. Login to comment
226 This result is qualitatively similar to that shown for K1250A (Zeltwanger et al. 1999). Login to comment
227 We then examined the open time distribution of K464A-K1250A channels in the presence Functional interaction between nucleotide binding domains of CFTRJ. Physiol. 539.2 341 Figure 7. Login to comment
228 K464A shortens K1250A relaxation A, representative trace of macroscopic current relaxations from CFTR-K1250A (top trace) and CFTR-K464A-K1250A double mutant channels upon withdrawal of PKA (40 U ml_1 ) and ATP (1 m). Login to comment
229 Mean relaxation time constant for the CFTR-K1250A trace shown is 110 ± 1 s and for CFTR-K464A-K1250A is 30 ± 1 s. B, few-channel traces of CFTR-K1250A and CFTR-K464A-K1250A at the steady state in 2.75 m ATP. Login to comment
230 Dashed lines indicate baseline (all channels closed); marks at the left indicate open channel current levels (a total of 4 channels for K1250A and 3 for K464A-K1250A). Login to comment
231 C, comparison of steady-state Po, mean open (relaxation) times and mean closed times for CFTR-K1250A and CFTR-K464A-K1250A. Login to comment
232 Asterisks indicate significant differences between CFTR-K1250A and CFTR-K464A-K1250A (**P < 0.01; ***P < 0.005). Login to comment
234 A single exponential fit to the distribution provides an estimated open time of 241 ± 3 ms, similar to the open time of wild type, K464A and K1250A at 10 µ ATP (~250 ms; Zeltwanger et al. 1999; present study, Fig. 3A). Login to comment
235 Thus, K464A had little effect on brief openings seen in K1250A at micromolar [ATP]. Login to comment
241 We demonstrate that K1250A, but not K464A, affects the opening rate. Login to comment
242 We also show that both K464A and K1250A affect closing at millimolar [ATP] but in opposite ways. Login to comment
243 K464A accelerates closing whereas K1250A delays it. Login to comment
249 Ramjeesingh et al. (1999) showed that K464A only partly reduced CFTR`s ATPase activity while K1250A eliminates it altogether. Login to comment
250 Aleksandrov et al. (2001) showed that K1250A had no effect on 8-azido- [a-32 P]-ATP labelling of CFTR whereas K464A drastically reduced it. Login to comment
255 It was further hypothesized that hydrolysis is the main pathway for closing under normal conditions and that blocking hydrolysis with K464A or K1250A permits closing only through the slow unbinding pathway, resulting in prolonged openings. Login to comment
256 Based on that model, one would predict that the double mutant K464A-K1250A should exhibit long openings at all ATP concentrations, since the hydrolysis pathway at both A. C. Powe, Jr, L. Al-Nakkash, M. Li and T.-C. Hwang342 J. Physiol. 539.2 Figure 8. Login to comment
257 K464A-K1250A gating at millimolar and micromolar [ATP] A, representative sweep from experiments with CFTR-K464A-K1250A channels exposed first to 1 m and then to 10 µ MgATP. Login to comment
258 Arrow indicates the baseline, downward deflections channel openings. B, survivor plot of open dwell times for CFTR-K464A-K1250A at 10 µ MgATP. Login to comment
262 We find, however, that the mean open time for K464A-K1250A is ~250 ms at 10 µ ATP and ~30 s at 2.75 m ATP (Figs 7 and 8B). Login to comment
263 The double mutant open time at 10 µ ATP is similar to that of wild type, K464A and K1250A at the same [ATP] (Zeltwanger et al. 1999; present study). Login to comment
264 This finding, together with the dramatic differences between K464A and K1250A mutants, casts considerable doubt on the idea that the NBDs function identically. Login to comment
278 Furthermore, the NBD2 mutation K1250A greatly prolongs CFTR open time ~300-fold; that prolongation is then reduced ~5-fold by addition of the NBD1 mutation K464A (Fig. 7). Login to comment
288 Furthermore, Ramjeesingh et al. (1999) showed that K464A reduces ATPase activity by ~80% and K1250A virtually eliminates it, suggesting that mutating one NBD affects the biochemical activity of the other. Login to comment
299 Channel open times at 10 µ ATP for wild type, K464A, K1250A and K464A-K1250A are all ~250 ms (Zeltwanger et al. 1999; present study, Figs 3 and 8), indicating that the NBD mutations have no effect on brief openings. Login to comment
305 The NBD2 mutation K1250A prolongs opening (Fig. 7), which suggests that blocking ATP hydrolysis at NBD2 slows exit from an open state. Login to comment
311 While our results provide no evidence for involvement of NBD1 in channel opening, NBD2 seems to play a role, since the NBD2 mutation K1250A increases closed time > 30-fold (Fig. 7). Login to comment
333 If it turns out that NBD1 is truly involved in channel opening, then the delay of opening by NBD2 mutant K1250A would suggest that NBD1 and NBD2 interact to control opening as well as closing. Login to comment
338 Finally, K464A reduces the prolongation of open time seen in the NBD2 mutant K1250A at millimolar [ATP], strongly suggesting an interaction between NBD1 and NBD2 during CFTR`s open state. Login to comment
339 Although the NBD1 mutant K464A did not affect opening, the NBD2 mutant K1250A delays opening >30-fold compared to wild type. Login to comment

[hide] Multiple inhibitory effects of Au(CN)(2-) ions on ... J Physiol. 2002 Apr 1;540(Pt 1):29-38. Linsdell P, Gong X
Multiple inhibitory effects of Au(CN)(2-) ions on cystic fibrosis transmembrane conductance regulator Cl(-) channel currents.
J Physiol. 2002 Apr 1;540(Pt 1):29-38., 2002-04-01 [PMID:11927666]

Abstract [show]
Lyotropic pseudohalide anions are potentially useful as high affinity probes of Cl(-) channel pores. However, the interaction between these pseudohalides and the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel have not been described in detail. Here we show that Au(CN)(2-) ions applied to the intracellular face of membrane patches from stably transfected baby hamster kidney cells inhibit CFTR channel currents by at least two mechanisms, which can be distinguished at the single channel level or by inhibiting channel closure using 2 mM pyrophosphate. Low concentrations (< 10 microM) of Au(CN)(2-) significantly reduced CFTR channel open probability. This effect was apparently voltage insensitive, independent of extracellular Cl(-) concentration, and lost following exposure to pyrophosphate. Higher concentrations of intracellular Au(CN)(2-) caused an apparent reduction in unitary current amplitude, presumably due to a kinetically fast blocking reaction. This effect, isolated following exposure to pyrophosphate, was strongly voltage dependent (apparent K(d) 61.6 microM at -100 mV and 913 microM at +60 mV). Both the affinity and voltage dependence of block were highly sensitive to extracellular Cl(-) concentration. We propose that Au(CN)(2-) has at least two inhibitory effects on CFTR currents: a high affinity effect on channel gating due to action on a cytoplasmically accessible aspect of the channel and a lower affinity block within the open channel pore. These results offer important caveats for the use of lyotropic pseudohalide anions such as Au(CN)(2-) as specific high affinity probes of Cl(-) channel pores.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
141 A similar strategy using the CFTR mutant K1250A, which shows prolonged openings similar to that of wild type CFTR after locking the channels open with PPi (Gunderson & Kopito, 1995), has been used to dissociate open channel blocking from gating events at the single channel level (Zhou et al. 2001). Login to comment

[hide] Distinct Mg(2+)-dependent steps rate limit opening... J Gen Physiol. 2002 Jun;119(6):545-59. Dousmanis AG, Nairn AC, Gadsby DC
Distinct Mg(2+)-dependent steps rate limit opening and closing of a single CFTR Cl(-) channel.
J Gen Physiol. 2002 Jun;119(6):545-59., [PMID:12034762]

Abstract [show]
The roles played by ATP binding and hydrolysis in the complex mechanisms that open and close cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channels remain controversial. In this work, the contributions made by ATP and Mg(2+) ions to the gating of phosphorylated cardiac CFTR channels were evaluated separately by measuring the rates of opening and closing of single channels in excised patches exposed to solutions in which [ATP] and [Mg(2+)] were varied independently. Channel opening was found to be rate-limited not by the binding of ATP alone, but by a Mg(2+)-dependent step that followed binding of both ATP and Mg(2+). Once a channel had opened, sudden withdrawal of all Mg(2+) and ATP could prevent it from closing for tens of seconds. But subsequent exposure of such an open channel to Mg(2+) ions alone could close it, and the closing rate increased with [Mg(2+)] over the micromolar range (half maximal at approximately 50 microM [Mg(2+)]). A simple interpretation is that channel closing is stoichiometrically coupled to hydrolysis of an ATP molecule that remains tightly associated with the open CFTR channel despite continuous washing. If correct, that ATP molecule appears able to reside for over a minute in the catalytic site that controls channel closing, implying that the site must entrap, or have an intrinsically high apparent affinity for, ATP, even without a Mg(2+) ion. Such stabilization of the open-channel conformation of CFTR by tight binding, or occlusion, of an ATP molecule echoes the stabilization of the active conformation of a G protein by GTP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 Thus, although ATPase activity is diminished 10-20-fold in mutant K464A CFTR, and practically abolished in K1250A CFTR (Ramjeesingh et al., 1999), channel opening rate at millimolar [MgATP] has been reported to be reduced only 2-4-fold in K464A and somewhat more severely (5-10-fold) in K1250A CFTR (Carson et al., 1995; Gunderson and Kopito, 1995; Ramjeesingh et al., 1999); and gating persists even in double mutant K464A/K1250A CFTR channels (Carson et al., 1995). Login to comment
29 The finding that K1250A CFTR channels, mutated within the NBD2 catalytic site, when exposed to millimolar MgATP alone displayed prolonged open bursts comparable to those elicited by MgAMPPNP in wild-type channels, suggested that NBD2 comprises the active site that controls normal termination of open bursts (Carson et al., 1995; Gunderson and Kopito, 1995). Login to comment
31 A possibly related finding is that the open burst duration of K1250A CFTR channels, though prolonged at millimolar MgATP, has been reported to be brief at micromolar MgATP (Zeltwanger et al., 1999; Ikuma and Welsh, 2000). Login to comment
136 This is consonant with earlier conclusions that ATP hydrolysis prompts channel closure, based on extreme stabilization of the open state of WT CFTR channels exposed to MgATP plus a poorly hydrolyzable analogue (like MgAMPPNP; see below), or of K1250A mutant channels exposed to just MgATP (Hwang et al., 1994; compare with Gunderson and Kopito, 1994, 1995; Carson et al., 1995). Login to comment
195 The observation that mutant K1250A CFTR channels show similarly prolonged bursts during exposure to MgATP alone suggested that NBD2 contains the catalytic site where hydrolysis leads to channel closure (Gunderson and Kopito, 1994, 1995; Carson et al., 1995; Zeltwanger et al., 1999). Login to comment
196 Analysis of the temporal asymmetry of changes in character of rapid current blocking events during open bursts of CFTR channels, and their modification by nucleotide analogues and by mutation of NBD2 (K1250A) but not NBD1 (K464A), provided additional evidence that hydrolysis of ATP tightly bound at NBD2 causes the channel to close (Gunderson and Kopito, 1995). Login to comment
202 Presumably, when hydrolysis is prevented, either by lack of Mg2ϩ ions (Li et al., 1996) or by NBD mutation (e.g., K1250A; Ramjeesingh et al., 1999), dissociation of nonhydrolyzed nucleotide from NBD2 becomes the rate-limiting step for the delayed channel closure. Login to comment
246 Nucleotide binding assays (at 0ЊC to prevent hydrolysis) using 8-azidoATP photolabeling show that binding occurs with the same micromolar apparent affinity in wild-type, mutant K1250M, and double mutant K464A/ K1250A, CFTR (Carson et al., 1995). Login to comment
247 These findings, together with the fact that even double mutant K464A/ K1250A CFTR channels open and close at measurable rates (Carson et al., 1995), make it seem unlikely that ATP hydrolysis at either NBD1 or NBD2 is a prerequisite for channel opening. Login to comment

[hide] Probing an open CFTR pore with organic anion block... J Gen Physiol. 2002 Nov;120(5):647-62. Zhou Z, Hu S, Hwang TC
Probing an open CFTR pore with organic anion blockers.
J Gen Physiol. 2002 Nov;120(5):647-62., [PMID:12407077]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is an ion channel that conducts Cl- current. We explored the CFTR pore by studying voltage-dependent blockade of the channel by two organic anions: glibenclamide and isethionate. To simplify the kinetic analysis, a CFTR mutant, K1250A-CFTR, was used because this mutant channel, once opened, can remain open for minutes. Dose-response relationships of both blockers follow a simple Michaelis-Menten function with K(d) values that differ by three orders of magnitude. Glibenclamide blocks CFTR from the intracellular side of the membrane with slow kinetics. Both the on and off rates of glibenclamide block are voltage dependent. Removing external Cl- increases affinity of glibenclamide due to a decrease of the off rate and an increase of the on rate, suggesting the presence of a Cl- binding site external to the glibenclamide binding site. Isethionate blocks the channel from the cytoplasmic side with fast kinetics, but has no measurable effect when applied extracellularly. Increasing the internal Cl- concentration reduces isethionate block without affecting its voltage dependence, suggesting that Cl- and isethionate compete for a binding site in the pore. The voltage dependence and external Cl- concentration dependence of isethionate block are nearly identical to those of glibenclamide block, suggesting that these two blockers may bind to a common binding site, an idea further supported by kinetic studies of blocking with glibenclamide/isethionate mixtures. By comparing the physical and chemical natures of these two blockers, we propose that CFTR channel has an asymmetric pore with a wide internal entrance and a deeply embedded blocker binding site where local charges as well as hydrophobic components determine the affinity of the blockers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 To simplify the kinetic analysis, a CFTR mutant, K1250A-CFTR, was used because this mutant channel, once opened, can remain open for minutes. Login to comment
51 M A T E R I A L S A N D M E T H O D S Cell Preparation NIH3T3 cells stably expressing K1250A-CFTR channels (Zeltwanger et al., 1999) were maintained at 37ЊC and 5% CO2 in Dulbecco`s Modified Eagle`s Medium (DMEM) supplemented with 10% fetal bovine serum. Login to comment
81 For quantitative analysis of isethionate blockade, net K1250A-CFTR single-channel I-V relationships were obtained by subtracting the I-V relationship of the leak (i.e., basal conductance before the channel is opened) from that of a single locked-open K1250A-CFTR channel. Login to comment
83 The average of these I-V relationships were then calculated to represent the single-channel I-V curve of K1250A-CFTR. Login to comment
93 R E S U L T S Glibenclamide Block of K1250A-CFTR Channels Previous studies show that glibenclamide blocks CFTR channels with a time constant in the range of tens of milliseconds that is slow enough to be resolved in single-channel recordings (Schultz et al., 1996; Sheppard and Robinson, 1997). Login to comment
97 To extract the kinetic parameters of glibenclamide-induced blocking events with minimal contamination of ATP-dependent gating events, we studied glibenclamide block with a CFTR mutant, K1250A-CFTR, instead of wt-CFTR. Login to comment
98 The advantage of using K1250A-CFTR is that this channel, once opened by ATP, can stay open for minutes even after a complete removal of ATP. Login to comment
100 Kd 1 Fb-( )Poc Glibenclamide[ ] Fb,/= kon V( ) kon V( )' X[ ] kon 0( )' X[ ] zδonFV RT/( )exp= = koff V( ) koff V( ) z- δoffFV RT/( ),exp= Kd V( ) koff V( ) kon V( )'/ koff 0( ) kon 0( )'/ z- δon δoff+[ ]FV RT/( )exp Kd 0( ) z- δKd FV RT/( ),exp = = = We first tested whether glibenclamide block of K1250A-CFTR channels is similar to that of wt-CFTR channels. Login to comment
101 Fig. 1 A shows an example of glibenclamide-induced block recorded from an inside-out patch excised from an NIH3T3 cell stably expressing K1250A-CFTR. Login to comment
102 K1250A-CFTR currents were first activated by PKA and 1mM ATP (not depicted). Login to comment
113 Therefore, glibenclamide-induced block in K1250A-CFTR channels is completely reversible as seen in wt-CFTR (Schultz et al., 1996; Sheppard and Robinson, 1997; Gupta and Linsdell, 2002; cf. Sheppard and Welsh, 1992). Login to comment
114 Next, we examined the sensitivity of K1250A-CFTR to glibenclamide block. Login to comment
119 The resulting dose-response relationship can be fitted with a Michaelis-Menten function with a K1/2 of 49.4 Ϯ 9.5 ␮M at -50 mV, which is similar to that reported for wt-CFTR (Schultz et al., 1996; Sheppard and Robinson, 1997), indicating that the K1250A mutation does not affect the sensitivity of the channel to glibenclamide. Login to comment
120 We then tested whether glibenclamide blocks K1250A-CFTR channels in a voltage-dependent manner as shown for wt-CFTR channels (Sheppard and Robinson, 1997; Gupta and Linsdell, 2002). Login to comment
126 We therefore conclude that the mechanisms of voltage dependence of glibenclamide block for K1250A-CFTR channels can also be applied to wt-CFTR channels. Login to comment
128 Glibenclamide block of K1250A-CFTR is reversible. Login to comment
129 K1250A-CFTR channel currents were activated by PKA and 1 mM ATP in an excised inside-out patch held at -50 mV with symmetric Cl- (154 mM [Cl-]o/154 mM [Cl-]i). Login to comment
130 (A) Continuous recording of K1250A-CFTR after the channels were locked open with PKA and ATP. Login to comment
137 Whole-cell Recordings of Glibenclamide Block of K1250A-CFTR With single-channel recordings in excised inside-out patches, we were only able to investigate glibenclamide block at negative membrane potentials since patches became unstable when held at positive potentials for a long period of time (essential for kinetic analysis). Login to comment
164 Net K1250A-CFTR current traces were obtained by subtracting the leak from the forskolin-activated current (Fig. 4 A). Login to comment
168 Net steady-state I-V relationships in the presence or absence of glibenclamide are shown in Fig. 4 C. Clearly, glibenclamide blocks whole-cell K1250A-CFTR currents in a voltage-dependent manner with more block at negative voltages. Login to comment
172 Glibenclamide block of whole-cell K1250A-CFTR currents. Login to comment
178 (D) Voltage dependence of glibenclamide block of K1250A-CFTR. Login to comment
182 Kinetic Analysis of Voltage-dependent Block of Glibenclamide on K1250A-CFTR For glibenclamide block of K1250A-CFTR, we were able to apply a simple scheme for kinetic analysis (Scheme I). Login to comment
196 The agreement between this Kd value, obtained from kinetic parameters based on Scheme I, and the model-independent K1/2 further demonstrates that Scheme I is adequate for describing glibenclamide block of K1250A-CFTR channels. Login to comment
236 Voltage-dependent Block of K1250A-CFTR Channels by Isethionate Glibenclamide is a powerful tool to probe the CFTR pore because it affords direct measurements of both the on and off rate constants. Login to comment
245 To compare their ability to block K1250A-CFTR channels, we applied voltage ramps on inside-out patches in the presence or absence of various blockers in the perfusion solution. Login to comment
247 All three anions block K1250A-CFTR channels in a voltage-dependent manner. Login to comment
258 Voltage-dependent block of K1250A-CFTR by hydrophilic organic anions. Login to comment
280 Effect of extracellular isethionate on K1250A-CFTR whole-cell current. Login to comment
282 K1250A-CFTR currents were activated by 10 ␮M Fsk. Login to comment
293 Block of K1250A-CFTR by Mixture of Glibenclamide and Isethionate If indeed these two blockers share a common binding site, then the kinetics of channel blockade by these two blockers can be described as: SCHEME II where X, XG, and XI represent the binding site, glibenclamide-occupied state and isethionate-occupied state, respectively. Login to comment
322 With the K1250A-CFTR mutant, we were able to quantify detailed kinetic parameters of glibenclamide block not provided by previous studies (Schultz et al., 1996; Sheppard and Robinson, 1997; Gupta and Linsdell, 2002). Login to comment
332 Block of K1250A-CFTR current in the presence of both glibenclamide and isethionate. Login to comment
338 reported that the voltage dependence of the intrinsic flickery blocking events seen in a locked-open K1250A-CFTR channel is mostly determined by the trans-ion effects (Zhou et al., 2001b). Login to comment

[hide] On the mechanism of MgATP-dependent gating of CFTR... J Gen Physiol. 2003 Jan;121(1):17-36. Vergani P, Nairn AC, Gadsby DC
On the mechanism of MgATP-dependent gating of CFTR Cl- channels.
J Gen Physiol. 2003 Jan;121(1):17-36., [PMID:12508051]

Abstract [show]
CFTR, the product of the gene mutated in cystic fibrosis, is an ATPase that functions as a Cl(-) channel in which bursts of openings separate relatively long interburst closed times (tauib). Channel gating is controlled by phosphorylation and MgATP, but the underlying molecular mechanisms remain controversial. To investigate them, we expressed CFTR channels in Xenopus oocytes and examined, in excised patches, how gating kinetics of phosphorylated channels were affected by changes in [MgATP], by alterations in the chemical structure of the activating nucleotide, and by mutations expected to impair nucleotide hydrolysis and/or diminish nucleotide binding affinity. The rate of opening to a burst (1/tauib) was a saturable function of [MgATP], but apparent affinity was reduced by mutations in either of CFTR's nucleotide binding domains (NBDs): K464A in NBD1, and K1250A or D1370N in NBD2. Burst duration of neither wild-type nor mutant channels was much influenced by [MgATP]. Poorly hydrolyzable nucleotide analogs, MgAMPPNP, MgAMPPCP, and MgATPgammaS, could open CFTR channels, but only to a maximal rate of opening approximately 20-fold lower than attained by MgATP acting on the same channels. NBD2 catalytic site mutations K1250A, D1370N, and E1371S were found to prolong open bursts. Corresponding NBD1 mutations did not affect timing of burst termination in normal, hydrolytic conditions. However, when hydrolysis at NBD2 was impaired, the NBD1 mutation K464A shortened the prolonged open bursts. In light of recent biochemical and structural data, the results suggest that: nucleotide binding to both NBDs precedes channel opening; at saturating nucleotide concentrations the rate of opening to a burst is influenced by the structure of the phosphate chain of the activating nucleotide; normal, rapid exit from bursts occurs after hydrolysis of the nucleotide at NBD2, without requiring a further nucleotide binding step; if hydrolysis at NBD2 is prevented, exit from bursts occurs through a slower pathway, the rate of which is modulated by the structure of the NBD1 catalytic site and its bound nucleotide. Based on these and other results, we propose a mechanism linking hydrolytic and gating cycles via ATP-driven dimerization of CFTR's NBDs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 The rate of opening to a burst (1/␶ib) was a saturable function of [MgATP], but apparent affinity was reduced by mutations in either of CFTR`s nucleotide binding domains (NBDs): K464A in NBD1, and K1250A or D1370N in NBD2. Login to comment
7 NBD2 catalytic site mutations K1250A, D1370N, and E1371S were found to prolong open bursts. Login to comment
32 However, in CFTR the Walker A NBD2 mutation K1250A abolished ATP hydrolysis, whereas the NBD1 mutation K464A simply reduced overall hydrolytic activity (Ramjeesingh et al., 1999); and biochemical studies of Walker B aspartate mutations in CFTR (D572N in NBD1, D1370N in NBD2) have not yet been performed. Login to comment
34 Thus, the K1250A mutation dramatically prolonged burst duration, suggesting that hydrolysis at NBD2 might be coupled to burst termination (Carson et al., 1995; Gunderson and Kopito, 1995), whereas the NBD1 mutations K464A, Q552A, and Q552H somewhat slowed channel opening to a burst, suggesting that NBD1 might be a site of ATP interactions governing opening (Carson et al., 1995; Carson and Welsh 1995). Login to comment
41 We studied in detail the dependence of channel gating on [MgATP], gating in the presence of poorly hydrolyzable nucleotide analogs, as well as the effects of mutating residues in the Walker A (K464A and K1250A) and Walker B motifs (in particular, D1370N in NBD2). Login to comment
52 Amounts of cRNA injected were adjusted to vary the level of expression: up to 40 ng/oocyte was required for high expression of K1250A or K464A/K1250A mutant channels, whereas 0.1-0.25 ng/oocyte sufficed for single channel recordings of WT, K464A, or D1370N channels. Login to comment
85 We do not report absolute values for ␶ib and rCO in these cases, but only values relative to some other experimental condition applied to the same patch, and these should be relatively insensitive to N. Thus, for MgATP dose-response curves (Fig. 2), rates were normalized to those in bracketing segments at 5 mM MgATP; for the poorly hydrolyzable nucleotides, rates were normalized to those obtained in the same patches at 10 ␮M (Figs. 7 and 11) or 50 ␮M MgATP (Fig. 8); for K1250A mutant openings in 10 ␮M MgATP, rates were normalized to those in nominally MgATP-free bath solution. Login to comment
126 Similar kinetic analysis of patches containing few channels proved technically difficult for K1250A CFTR (NBD2 Walker A lysine mutant) due to the extremely prolonged bursts (see Fig. 6 C, below), which precluded collection of enough events to reliably estimate absolute values of rCO or Po. Login to comment
127 So we recorded macroscopic current in patches with hundreds or thousands of WT or K1250A channels (Fig. 3, A and B), and determined relative Po as a function of [MgATP] (Fig. 3 C) by normalizing current amplitude at each test [MgATP] to that during bracketing exposures at 5 mM MgATP (Fig. 3, A and B). Login to comment
128 The curve for K1250A was strongly shifted to higher [MgATP] and was still not saturated at 10 mM MgATP. Login to comment
132 Therefore, in K1250A, as in WT CFTR, it is only the dependence of channel opening rate on [MgATP] that underlies the [MgATP] dependence of Po. Login to comment
134 In fact, this relationship implies that the effective dissociation constant for MgATP activation of opening of K1250A channels is likely even larger than is apparent in Fig. 3 C because the other effect of the K1250A mutation, marked slowing of channel closure from bursts, would by itself shift the Po versus [MgATP] curve to lower [MgATP], opposite to our experimental observation. Login to comment
137 The K1250A mutation strongly shifts the [MgATP] dependence of Po to higher [MgATP]. Login to comment
140 (B) Macroscopic current of K1250A channels was reduced Ն2-fold on lowering [MgATP] from 5 to 1 mM. Login to comment
144 Michaelis fit parameters for WT: Po max ϭ 1.04 Ϯ 0.01, K0.5 ϭ 57 Ϯ 2 ␮M; for K1250A: Po max ϭ 2.45 Ϯ 0.88, K0.5 ϭ 6.5 Ϯ 4.8 mM; for display, WT (circles) and K1250A (inverted triangles) data (mean Ϯ SD, 3 Յ n Յ9) were renormalized to these Po max values. Login to comment
145 Because 10 mM, the highest [MgATP] used, was still far from saturating for K1250A channels, the fit for this mutant is less accurate, evident from large errors on fit parameters. Login to comment
169 The K1250A mutation more dramatically slowed channel closing from bursts, resulting in prolonged bursts lasting tens of seconds (Fig. 6 C; cf. Carson et al., 1995; Gunderson and Kopito, 1995; Ramjeesingh et al., 1999; Zeltwanger et al., 1999). Login to comment
170 Analysis of the macroscopic current relaxation upon nucleotide withdrawal in patches containing many K1250A channels indicates that their average burst duration was ‫08ف‬ s in the presence of PKA (see below, Fig. 10, E and G) but ‫04ف‬ s after PKA had been removed (Fig. 3 B), at least two orders of magnitude longer than bursts of WT channels under the same conditions (Fig. 3, A vs. B; Fig. 6, A vs. C). Login to comment
171 Moreover, for both K1250A and D1370N mutants, this macroscopic current decay followed a single exponential time course, implying the presence of a single population of open bursts (for K1250A, see Figs. 3 B and 10 E; for D1370N, decay time constants were: ␶[after 5 mM MgATP ϩ PKA] ϭ 6.4 Ϯ 1.6 s, n ϭ 6; ␶[after 5 mM MgATP] ϭ 2.2 Ϯ 0.5 s, n ϭ 7; ␶[after 300 ␮M MgATP] ϭ 1.9 Ϯ 0.3 s, n ϭ 8; cf. Table I). Login to comment
179 WT (A), D1370N (B), K1250A (C), and E1371S (D) CFTR channels were activated by 5 mM MgATP plus PKA as indicated: burst termination (‫-4.0ف‬pA downward steps) after nucleotide washout was slowed for NBD2 mutants, relative to WT. Login to comment
180 Note persistence of brief (intraburst) closures during K1250A and E1371S bursts, long after nucleotide withdrawal. Login to comment
234 The K464A mutation also shortened (Fig. 10, E-G) the similarly prolonged bursts of NBD2 mutant K1250A channels exposed to MgATP alone (Fig. 6 C). Login to comment
235 The control record (Fig. 10 E) illustrates the slow decay of macroscopic current after washout of MgATP and PKA from a patch containing hundreds of K1250A CFTR Figure 9. Login to comment
248 (E) Macroscopic K1250A currents, activated by 5 mM MgATP ϩ PKA, decay slowly on nucleotide withdrawal. Login to comment
249 (F) The additional K464A mutation accelerates channel closure from bursts: for the traces shown, ␶ ϭ 71.7s (K1250A) and ␶ ϭ 29.7s (K464A/K1250A). Login to comment
250 (G) Mean time constants of all 9 K1250A and 9 K464A/K1250A relaxations, each well fit by a single exponential. Login to comment
253 However, in double mutant K464A/K1250A CFTR channels (Fig. 10 F) the current relaxation time constant (␶ ϭ 36 Ϯ 4 s, n ϭ 9), and hence the mean open-burst dwell time, was less than half that of channels bearing the K1250A mutation alone (Fig. 10 G). Login to comment
270 K1250A) reduce the apparent affinity of the MgATP binding site(s) involved in channel opening (Figs. 2 and 3), but (at least for K464A and D1370N) affect the maximal opening rate little (Table I). Login to comment
275 Accordingly, although no major difference in [␣32P]8-azidoATP photolabeling at 0ЊC was detected between WT and K464A/K1250A (Carson et al., 1995) or K464A CFTR (Vergani et al., 2002), the K464A mutation alone greatly reduced photolabeling of NBD1 by ␮M [␣32P]8-azidoATP at 37ЊC (Aleksandrov et al., 2002) and virtually abolished stable (i.e., surviving extensive post-incubation washing) photolabeling at 30ЊC (unpublished data). Login to comment
280 Therefore, the simplest interpretation of the reduced apparent affinity with which MgATP elicits opening of K464A and D1370N (and K1250A) mutants compared with WT is that the mutations impair nucleotide binding at two different sites, such that at subsaturating [MgATP] channel opening is limited by MgATP binding at NBD1 in K464A, but at NBD2 in D1370N (and K1250A). Login to comment
286 Allosteric interactions between CFTR`s two NBDs (compare Powe et al., 2002) could, therefore, permit the K464A, D1370N, and K1250A mutations to all affect the same binding site. Login to comment
291 Moreover, covalent modification of the NBD2 Walker A sequence (Cotten and Welsh, 1998), and the K1250A (Fig. 3 C) and the D1370N (Fig. 2 D) mutations (‫9-8ف‬ Å apart; e.g., Hung et al., 1998), all reduce apparent affinity for MgATP activation of opening. Login to comment
293 Most likely, therefore, the rightward shift in [MgATP] dependence of D1370N (and K1250A) open- ing rate reflects the lower affinity of a binding step, required for channel opening, at NBD2 itself. Login to comment
300 Therefore, present evidence suggests that nucleotide normally binds to both of WT CFTR`s NBDs before the channel opens, and that opening is limited by nucleotide binding at NBD2 in WT, D1370N, and K1250A CFTR channels, but probably by nucleotide binding at NBD1 in K464A CFTR channels. Login to comment
318 On the other hand, ATPase measurements on purified CFTR have shown that the K1250A mutation abolished ATP hydrolysis (Ramjeesingh et al., 1999), whereas opening of K1250A channels was impaired, but not abolished, at normal [MgATP] (Carson et al., 1995; Gunderson and Kopito, 1995; Ramjeesingh et al., 1999; Powe et al., 2002); indeed, the greatly reduced apparent affinity for MgATP we observed (Fig. 3 C) implies that the maximal opening rate of K1250A may be several-fold greater than that measured at 1-2 mM MgATP. Login to comment
324 We found no clear dependence of burst duration on [MgATP] (10 ␮M to 5 mM) in WT CFTR (Figs. 2 E, 3 A, and 4, B and C) or in K464A, D1370N, or K1250A mutant channels (Figs. 2 E, 3 B, and 4, E-H), indicating that all ATP binding events precede channel opening and no further binding to the open channel is needed to complete the gating cycle. Login to comment
326 This [MgATP] dependence of burst duration was reported to be exaggerated in K1250A mutant channels, in which brief bursts were observed at 10 ␮M MgATP and only at higher concentrations did the characteristic (e.g., Fig. 6 C, above) prolonged bursts appear (Zeltwanger et al., 1999; Ikuma and Welsh, 2000; Powe et al., 2002). Login to comment
327 Though we occasionally observed brief bursts in K1250A channels at 10 ␮M MgATP (not illustrated), these were very rare, with a frequency of occurrence not demonstrably different from that in nominally MgATP-free bath solution (rCO10 ␮M/rCObath soln ϭ 0.72 Ϯ 0.12, n ϭ 6). Login to comment
328 Thus, brief bursts of K1250A channels might reflect infrequent nucleotide-independent events, unrelated to the physiological gating cycle of WT channels, an interpretation consistent with those brief bursts surviving mutation of the Walker A lysine in either, or both, NBDs (Zeltwanger et al., 1999; Ikuma and Welsh, 2000; Powe et al., 2002). Login to comment
369 But when hydrolysis (at NBD2) was prevented, by supplying nucleotide resistant to hydrolysis (Figs. 9, and 10, A-D; Fig. 7 vs. Fig. 11), by adding VO4 (Vergani et al., 2002), or by mutating the NBD2 Walker A lysine (K1250A; Fig. 10, E-G), the K464A mutation resulted in less prolonged bursts. Login to comment

[hide] CFTR directly mediates nucleotide-regulated glutat... EMBO J. 2003 May 1;22(9):1981-9. Kogan I, Ramjeesingh M, Li C, Kidd JF, Wang Y, Leslie EM, Cole SP, Bear CE
CFTR directly mediates nucleotide-regulated glutathione flux.
EMBO J. 2003 May 1;22(9):1981-9., 2003-05-01 [PMID:12727866]

Abstract [show]
Studies have shown that expression of cystic fibrosis transmembrane conductance regulator (CFTR) is associated with enhanced glutathione (GSH) efflux from airway epithelial cells, implicating a role for CFTR in the control of oxidative stress in the airways. To define the mechanism underlying CFTR-associated GSH flux, we studied wild-type and mutant CFTR proteins expressed in Sf9 membranes, as well as purified and reconstituted CFTR. We show that CFTR-expressing membrane vesicles mediate nucleotide-activated GSH flux, which is disrupted in the R347D pore mutant, and in the Walker A K464A and K1250A mutants. Further, we reveal that purified CFTR protein alone directly mediates nucleotide-dependent GSH flux. Interestingly, although ATP supports GSH flux through CFTR, this activity is enhanced in the presence of the non-hydrolyzable ATP analog AMP-PNP. These findings corroborate previous suggestions that CFTR pore properties can vary with the nature of the nucleotide interaction. In conclusion, our data demonstrate that GSH flux is an intrinsic function of CFTR and prompt future examination of the role of this function in airway biology in health and disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 We show that CFTR-expressing membrane vesicles mediate nucleotide-activated GSH ¯ux, which is disrupted in the R347D pore mutant, and in the Walker A K464A and K1250A mutants. Login to comment
94 To assess the nucleotide dependence of GSH permeation through CFTR, we determined the consequences of lysine mutations in the conserved Walker A consensus motifs for ATP binding in NBD1 and NBD2: K464A and K1250A, respectively. Login to comment
96 In Figure 4, we show that both the K464A and K1250A mutants exhibit similar signi®cant reductions in GSH ¯ux. Login to comment
97 We observed that GSH uptake in both the K464A and K1250A membrane vesicles was 3to 4-fold lower than in vesicles expressing wild-type CFTR protein, yielding permeability values of 132 and 120 pmol/mg CFTR/h, respectively (P < 0.001). Login to comment
102 Membrane vesicles expressing phosphorylated wild-type, K464A or K1250A CFTR were incubated with 20 nM [35S]GSH and 1 mM cold GSH in CFTR transport buffer, in the presence of MgAMPPNP. Login to comment
104 Values shown represent the mean activity (T SEM; for K464A and K1250A, n = 4; for wild-type CFTR, n = 5). Login to comment
105 Inset: expression of CFTR in membranes from Sf9 cells transfected with wild-type, K464A or K1250A CFTR constructs. Login to comment
194 An Sf9 cell pellet (0.5 l) expressing either recombinant CFTR-His proteins (wild type or mutant: R347D, K464A, K1250A) or no CFTR was solubilized in 30 ml of homogenization buffer containing 250 mM sucrose, 50 mM Tris±HCl, 0.25 mM CaCl2 pH 7.5 and protease inhibitors (Roche Diagnostics GmbH, Mannheim, Germany). Login to comment

[hide] Prolonged nonhydrolytic interaction of nucleotide ... J Gen Physiol. 2003 Sep;122(3):333-48. Basso C, Vergani P, Nairn AC, Gadsby DC
Prolonged nonhydrolytic interaction of nucleotide with CFTR's NH2-terminal nucleotide binding domain and its role in channel gating.
J Gen Physiol. 2003 Sep;122(3):333-48., [PMID:12939393]

Abstract [show]
CFTR, the protein defective in cystic fibrosis, functions as a Cl- channel regulated by cAMP-dependent protein kinase (PKA). CFTR is also an ATPase, comprising two nucleotide-binding domains (NBDs) thought to bind and hydrolyze ATP. In hydrolyzable nucleoside triphosphates, PKA-phosphorylated CFTR channels open into bursts, lasting on the order of a second, from closed (interburst) intervals of a second or more. To investigate nucleotide interactions underlying channel gating, we examined photolabeling by [alpha32P]8-N3ATP or [gamma32P]8-N3ATP of intact CFTR channels expressed in HEK293T cells or Xenopus oocytes. We also exploited split CFTR channels to distinguish photolabeling at NBD1 from that at NBD2. To examine simple binding of nucleotide in the absence of hydrolysis and gating reactions, we photolabeled after incubation at 0 degrees C with no washing. Nucleotide interactions under gating conditions were probed by photolabeling after incubation at 30 degrees C, with extensive washing, also at 30 degrees C. Phosphorylation of CFTR by PKA only slightly influenced photolabeling after either protocol. Strikingly, at 30 degrees C nucleotide remained tightly bound at NBD1 for many minutes, in the form of nonhydrolyzed nucleoside triphosphate. As nucleotide-dependent gating of CFTR channels occurred on the time scale of seconds under comparable conditions, this suggests that the nucleotide interactions, including hydrolysis, that time CFTR channel opening and closing occur predominantly at NBD2. Vanadate also appeared to act at NBD2, presumably interrupting its hydrolytic cycle, and markedly delayed termination of channel open bursts. Vanadate somewhat increased the magnitude, but did not alter the rate, of the slow loss of nucleotide tightly bound at NBD1. Kinetic analysis of channel gating in Mg8-N3ATP or MgATP reveals that the rate-limiting step for CFTR channel opening at saturating [nucleotide] follows nucleotide binding to both NBDs. We propose that ATP remains tightly bound or occluded at CFTR's NBD1 for long periods, that binding of ATP at NBD2 leads to channel opening wherupon its hydrolysis prompts channel closing, and that phosphorylation acts like an automobile clutch that engages the NBD events to drive gating of the transmembrane ion pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
299 Second, purified NBD1 mutant, K464A, CFTR was reported to hydrolyze MgATP at a maximal rate 10-20-fold lower than that of wild-type CFTR, whereas the equivalent mutation in NBD2, K1250A, essentially abolished hydrolysis (Ramjeesingh et al., 1999). Login to comment
302 However, the mutation does substantially shorten prolonged (locked) open bursts ascribed to NBD2 catalytic-site occupancy by the equivalent of nonhydrolyzed nucleotide, due to the K1250A mutation or to exposure of wild-type CFTR to MgATP plus nonhydrolyzable ATP analogs (Powe et al., 2002; Vergani et al., 2003) or to MgATP plus Vi (Fig. 4 vs. Fig. 8, C and D). Login to comment
314 In accord with this interpretation, NBD2 does appear to hydrolyze ATP (Aleksandrov et al., 2002; cf. Ramjeesingh et al., 1999) and is where the hydrolysis- abolishing mutation, K1250A, similarly (like Vi) prolongs bursts (Carson et al., 1995; Gunderson and Kopito, 1995; Ramjeesingh et al., 1999; Zeltwanger et al., 1999; Vergani et al., 2003). Login to comment

[hide] Comparative pharmacology of the activity of wild-t... J Membr Biol. 2003 Jul 15;194(2):109-17. Derand R, Bulteau-Pignoux L, Becq F
Comparative pharmacology of the activity of wild-type and G551D mutated CFTR chloride channel: effect of the benzimidazolone derivative NS004.
J Membr Biol. 2003 Jul 15;194(2):109-17., 2003-07-15 [PMID:14502435]

Abstract [show]
The pharmacological activation of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel mutated at glycine 551 (G551D-CFTR) was studied in the presence of the benzimidazolone derivative NS004 and compared to that of wild-type (wt) CFTR. Using iodide ((125)I) efflux and whole-cell patch-clamp techniques we found dose-dependent stimulation of phosphorylated wt-CFTR channels by NS004 with an EC(50) approximately 11 microM. With non-phosphorylated CFTR, the effect of NS004 was apparent only at concentration >100 microM. In G551D-CFTR-expressing CHO cells, neither forskolin (from 0.1 to 10 microM) nor NS004 (from 0.1 to 200 microM) added separately were able to stimulate channel activity. However, in the presence of 10 microM forskolin, NS004 stimulated G551D-CFTR activity in a dose-dependent manner with an EC(50) approximately 1.5 microM. We also determined the half-maximal effective concentration of forskolin ( EC(50) approximately 3.2 microM) required to stimulate G551D channel activity in presence of 1.5 micro M NS004. No inhibitory effect was observed at high concentration of NS004 with both wt- and G551D-CFTR. Whole-cell recordings of CFTR chloride currents from cells expressing wild-type or G551D-CFTR in the presence of NS004 were linear, time- and voltage-independent. The inhibitory profile of G551D-CFTR channel activity was similar to that of wild type, i.e., inhibition by glibenclamide (100 microM) and DPC (250 microM) but not by DIDS (200 microM) nor calixarene (100 nM). These results show that NS004 activates wt-CFTR channel and restores G551D-CFTR channel activity, the potency of which depends on both the concentration of NS004 and the phosphorylation status of CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
204 Further studies have also demonstrated that NS004 is a modulator of P574H (Champigny et al., 1995), K1250A (Al-Nakkash et al., 2001) and delF508 (Gribkoff et al., 1994; He et al., 1998; Al-Nakkash et al., 2001). Login to comment

[hide] Voltage-dependent gating of the cystic fibrosis tr... J Gen Physiol. 2003 Nov;122(5):605-20. Cai Z, Scott-Ward TS, Sheppard DN
Voltage-dependent gating of the cystic fibrosis transmembrane conductance regulator Cl- channel.
J Gen Physiol. 2003 Nov;122(5):605-20., [PMID:14581585]

Abstract [show]
When excised inside-out membrane patches are bathed in symmetrical Cl--rich solutions, the current-voltage (I-V) relationship of macroscopic cystic fibrosis transmembrane conductance regulator (CFTR) Cl- currents inwardly rectifies at large positive voltages. To investigate the mechanism of inward rectification, we studied CFTR Cl- channels in excised inside-out membrane patches from cells expressing wild-type human and murine CFTR using voltage-ramp and -step protocols. Using a voltage-ramp protocol, the magnitude of human CFTR Cl- current at +100 mV was 74 +/- 2% (n = 10) of that at -100 mV. This rectification of macroscopic CFTR Cl- current was reproduced in full by ensemble currents generated by averaging single-channel currents elicited by an identical voltage-ramp protocol. However, using a voltage-step protocol the single-channel current amplitude (i) of human CFTR at +100 mV was 88 +/- 2% (n = 10) of that at -100 mV. Based on these data, we hypothesized that voltage might alter the gating behavior of human CFTR. Using linear three-state kinetic schemes, we demonstrated that voltage has marked effects on channel gating. Membrane depolarization decreased both the duration of bursts and the interburst interval, but increased the duration of gaps within bursts. However, because the voltage dependencies of the different rate constants were in opposite directions, voltage was without large effect on the open probability (Po) of human CFTR. In contrast, the Po of murine CFTR was decreased markedly at positive voltages, suggesting that the rectification of murine CFTR is stronger than that of human CFTR. We conclude that inward rectification of CFTR is caused by a reduction in i and changes in gating kinetics. We suggest that inward rectification is an intrinsic property of the CFTR Cl- channel and not the result of pore block.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
385 Third, to investigate the flickery closures that interrupt bursts of channel openings, Zhou et al. (2001) analyzed the gating kinetics of the CFTR variant K1250A whose prolonged openings facilitate the discrimination of fast and slow gating events. Login to comment

[hide] Nucleotide-binding domains of human cystic fibrosi... Cell Mol Life Sci. 2004 Jan;61(2):230-42. Callebaut I, Eudes R, Mornon JP, Lehn P
Nucleotide-binding domains of human cystic fibrosis transmembrane conductance regulator: detailed sequence analysis and three-dimensional modeling of the heterodimer.
Cell Mol Life Sci. 2004 Jan;61(2):230-42., [PMID:14745501]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) protein is encoded by the gene that is defective in cystic fibrosis, the most common lethal inherited disease among the Caucasian population. CFTR belongs to the ABC transporter superfamily, whose members form macromolecular architectures composed of two membrane-spanning domains and two nucleotide-binding domains (NBDs). The experimental structures of NBDs from several ABC transporters have recently been solved, opening new avenues for understanding the structure/function relationships and the consequences of some disease-causing mutations of CFTR. Based on a detailed sequence/structure analysis, we propose here a three-dimensional model of the human CFTR NBD heterodimer. This model, which is in agreement with recent experimental data, highlights the specific features of the CFTR asymmetric active sites located at the interface between the two NBDs. Moreover, additional CFTR-specific features can be identified at the subunit interface, which may play critical roles in active site interdependence and are uncommon in other NBD dimers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
235 These results are in agreement with the recent work of Aleksandrov et al. [54] with the Walker A lysine mutants K464A and K1250A, with the finding that NBD2 is a site of rapid nucleotide turnover, while NBD1 is a site of stable nucleotide interaction. Login to comment

[hide] A heteromeric complex of the two nucleotide bindin... J Biol Chem. 2004 Oct 1;279(40):41664-9. Epub 2004 Jul 28. Kidd JF, Ramjeesingh M, Stratford F, Huan LJ, Bear CE
A heteromeric complex of the two nucleotide binding domains of cystic fibrosis transmembrane conductance regulator (CFTR) mediates ATPase activity.
J Biol Chem. 2004 Oct 1;279(40):41664-9. Epub 2004 Jul 28., 2004-10-01 [PMID:15284228]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) protein is a member of the ABC superfamily of transporter proteins. Recently, crystal structures of intact, prokaryotic members of this family have been described. These structures suggested that ATP binding and hydrolysis occurs at two sites formed at the interface between their nucleotide binding domains (NBDs). In contrast to the prokaryotic family members, the NBDs of CFTR are asymmetric (both structurally and functionally), and previous to the present studies, it was not clear whether both NBDs are required for ATP hydrolysis. In order to assess the relative roles of the two NBDs of human CFTR, we purified and reconstituted NBD1 and NBD2, separately and together. We found that NBD1 and NBD2 by themselves exhibited relatively low ATPase activity. Co-assembly of NBD1 and NBD2 exhibited a 2-3-fold enhancement in catalytic activity relative to the isolated domains and this increase reflected enhanced ATP turnover (V(max)). These data provide the first direct evidence that heterodimerization of the NBD1 and NBD2 domains of CFTR is required to generate optimal catalytic activity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
188 Mutation of the canonical Walker A lysine in either NBD1 (K464A, targeting Site A) or NBD2 (K1250A, targeting Site B) decreased ATPase activity of the whole protein by greater than 50% (39). Login to comment
189 Interestingly, the most severe effects on ATPase activity and channel gating were observed in the K1250A mutant, wherein ATPase activity was virtually abolished, consistent with this conventional site playing a more important role in generating the overall catalytic function of CFTR. Login to comment
191 However, an electrophysiological study found that these mutations caused a marked slowing of channel closing from bursts as did K1250A, which is known to reduce the ATPase activity of CFTR to around 1% of wild type (40). Login to comment

[hide] Direct effects of 9-anthracene compounds on cystic... Pflugers Arch. 2004 Oct;449(1):88-95. Ai T, Bompadre SG, Sohma Y, Wang X, Li M, Hwang TC
Direct effects of 9-anthracene compounds on cystic fibrosis transmembrane conductance regulator gating.
Pflugers Arch. 2004 Oct;449(1):88-95., [PMID:15290302]

Abstract [show]
Anthracene-9-carboxylic acid (9-AC) has been reported to show both potentiation and inhibitory effects on guinea-pig cardiac cAMP-activated chloride channels via two different binding sites, and inhibition of Mg(2+)-sensitive protein phosphatases has been proposed for the mechanism of 9-AC potentiation effect. In this study, we examined the effects of 9-AC on wild-type and mutant human cystic fibrosis transmembrane conductance regulator (CFTR) chloride channels expressed in NIH3T3 or CHO cells. 9-AC inhibits whole-cell CFTR current in a voltage-dependent manner, whereas the potentiation effect is not affected by membrane potentials. Anthracene-9-methanol, an electro-neutral 9-AC analog, fails to block CFTR, but shows a nearly identical potentiation effect, corroborating the idea that two chemically distinct sites are responsible, respectively, for potentiation and inhibitory actions of 9-AC. 9-AC also enhances the activity of deltaR-CFTR, a constitutively active CFTR mutant whose R-domain is removed. In excised inside-out patches, 9-AC increases Po by prolonging the mean burst durations and shortening the interburst durations. We therefore conclude that two different 9-AC binding sites for potentiation and inhibitory effects on CFTR channels are located outside of the R-domain. We also speculate that 9-AC potentiates CFTR activity by directly affecting CFTR gating.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Materials and methods Cell culture NIH3T3 cells stably expressing wild-type CFTR (NIH3T3/CFTR) or K1250A-CFTR mutant channels were grown as previously described [32] at 37°C and 5% CO2 in DMEM supplemented with 10% FBS. Login to comment
78 Since K1250A-CFTR channels Fig. 1A-D Effects of anthracene-9-carboxylic acid (9-AC) on whole-cell cystic fibrosis transmembrane conductance regulator (CFTR) currents. Login to comment
82 Net potentiation effects in wild-type CFTR were calculated by correcting for the inhibitory effects obtained from recordings of 9-AC on K1250A-CFTR currents. Login to comment
83 ycomp=yraw/(1-x/100), where ycomp, is the compensated value; yraw, the measured fold increase; x, the percentage inhibition of whole-cell K1250A-CFTR currents with 1 mM 9-AC at a pipette potential (Vp) of +100 mV or -100 mV. Login to comment
85 C A whole-cell K1250A-CFTR current trace. Login to comment
86 I-V relationships show net K1250A-CFTR currents in the presence or absence of 9-AC. Login to comment
87 D Dose-response relationships of the inhibitory effect on K1250A-CFTR currents at three different voltages. Login to comment
91 Figure 1C shows the whole-cell current trace from an NIH3T3 cell stably expressing K1250A-CFTR. Login to comment
93 Figure 1D shows the dose-response relationships of this inhibitory effect of 9-AC on K1250A-CFTR at three different membrane potentials (-60, -80, and -100 mV). Login to comment

[hide] Steady-state interactions of glibenclamide with CF... J Membr Biol. 2004 May 1;199(1):15-28. Zhang ZR, Zeltwanger S, McCarty NA
Steady-state interactions of glibenclamide with CFTR: evidence for multiple sites in the pore.
J Membr Biol. 2004 May 1;199(1):15-28., 2004-05-01 [PMID:15366420]

Abstract [show]
The objective of the present study was to clarify the mechanism by which the sulfonylurea drug, glibenclamide, inhibits single CFTR channels in excised patches from Xenopus oocytes. Glibenclamide blocks the open pore of the channel via binding at multiple sites with varying kinetics. In the absence of glibenclamide, open-channel bursts exhibited a flickery intraburst closed state (C1); this is due to block of the pore by the pH buffer, TES. Application of 25 microM glibenclamide to the cytoplasmic solution resulted in the appearance of two drug-induced intraburst closed states (C2, C3) of widely different duration, which differed in pH-dependence. The kinetics of interaction with the C3 state, but not the C2 state, were strongly voltage-dependent. The durations of both the C2 and C3 states were concentration-dependent, indicating a non-linear reaction scheme. Application of drug also increased the burst duration, which is consistent with an open-channel blocking mechanism. A kinetic model is proposed. These results indicate that glibenclamide interacts with open CFTR channels in a complex manner, involving interactions with multiple binding sites in the channel pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
265 A recent study by Hwang and coworkers (Zhou et al., 2002) used the opposite approach in relying upon the K1250A-CFTR mutant that exhibits greatly diminished (but not completely abolished) ATP-dependent gating. Login to comment
313 In that study, the behavior of mutant K1250A-CFTR was assayed with significant filtering of the single-channel records (100 Hz), resulting in loss of brief events. Login to comment
314 It is unclear whether this mutation, outside of the pore domain, might have any effect on block of the pore by glibenclamide; certainly, if glibenclamide binding is state-dependent, one would expect the results in K1250A-CFTR to differ substantially from those in wt-CFTR. Login to comment

[hide] Determination of the functional unit of the cystic... J Biol Chem. 2005 Jan 7;280(1):458-68. Epub 2004 Oct 25. Zhang ZR, Cui G, Liu X, Song B, Dawson DC, McCarty NA
Determination of the functional unit of the cystic fibrosis transmembrane conductance regulator chloride channel. One polypeptide forms one pore.
J Biol Chem. 2005 Jan 7;280(1):458-68. Epub 2004 Oct 25., 2005-01-07 [PMID:15504728]

Abstract [show]
The magnitudes and distributions of subconductance states were studied in chloride channels formed by the wild-type cystic fibrosis transmembrane conductance regulator (CFTR) and in CFTRs bearing amino acid substitutions in transmembrane segment 6. Within an open burst, it was possible to distinguish three distinct conductance states referred to as the full conductance, subconductance 1, and subconductance 2 states. Amino acid substitutions in transmembrane segment 6 altered the duration and probability of occurrence of these subconductance states but did not greatly alter their relative amplitudes. Results from real time measurements indicated that covalent modification of single R334C-CFTR channels by [2-(trimethylammonium)ethyl]methanethiosulfonate resulted in the simultaneous modification of all three conductance levels in what appeared to be a single step, without changing the proportion of time spent in each state. This behavior suggests that at least a portion of the conduction path is common to all three conducting states. The time course for the modification of R334C-CFTR, measured in outside-out macropatches using a rapid perfusion system, was also consistent with a single modification step as if each pore contained only a single copy of the cysteine at position 334. These results are consistent with a model for the CFTR conduction pathway in which a single anion-conducting pore is formed by a single CFTR polypeptide.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
156 A similar result was obtained using a double mutant, R334C/K1250A, that exhibits a prolonged open state duration (data not shown). Login to comment

[hide] Normal gating of CFTR requires ATP binding to both... Proc Natl Acad Sci U S A. 2005 Jan 11;102(2):455-60. Epub 2004 Dec 27. Berger AL, Ikuma M, Welsh MJ
Normal gating of CFTR requires ATP binding to both nucleotide-binding domains and hydrolysis at the second nucleotide-binding domain.
Proc Natl Acad Sci U S A. 2005 Jan 11;102(2):455-60. Epub 2004 Dec 27., 2005-01-11 [PMID:15623556]

Abstract [show]
ATP interacts with the two nucleotide-binding domains (NBDs) of CFTR to control gating. However, it is unclear whether gating involves ATP binding alone, or also involves hydrolysis at each NBD. We introduced phenylalanine residues into nonconserved positions of each NBD Walker A motif to sterically prevent ATP binding. These mutations blocked [alpha-(32)P]8-N(3)-ATP labeling of the mutated NBD and reduced channel opening rate without changing burst duration. Introducing cysteine residues at these positions and modifying with N-ethylmaleimide produced the same gating behavior. These results indicate that normal gating requires ATP binding to both NBDs, but ATP interaction with one NBD is sufficient to support some activity. We also studied mutations of the conserved Walker A lysine residues (K464A and K1250A) that prevent hydrolysis. By combining substitutions that block ATP binding with Walker A lysine mutations, we could differentiate the role of ATP binding vs. hydrolysis at each NBD. The K1250A mutation prolonged burst duration; however, blocking ATP binding prevented the long bursts. These data indicate that ATP binding to NBD2 allowed channel opening and that closing was delayed in the absence of hydrolysis. The corresponding NBD1 mutations showed relatively little effect of preventing ATP hydrolysis but a large inhibition of blocking ATP binding. These data suggest that ATP binding to NBD1 is required for normal activity but that hydrolysis has little effect. Our results suggest that both NBDs contribute to channel gating, NBD1 binds ATP but supports little hydrolysis, and ATP binding and hydrolysis at NBD2 are key for normal gating.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 We also studied mutations of the conserved Walker A lysine residues (K464A and K1250A) that prevent hydrolysis. Login to comment
8 The K1250A mutation prolonged burst duration; however, blocking ATP binding prevented the long bursts. Login to comment
122 The possibility that the K1250A mutation might reduce ATP binding is based on the observation that Walker A Lys mutations can reduce the interaction with ATP in some ABC transporters (35-37). Login to comment
123 In CFTR, it has been reported that the K1250A and K464A mutations prevented [␣-32 P]8-N3-ATP photolabeling of the respective NBD (14, 15), whereas another study found that K464A did not prevent [␣-32 P]8-N3-ATP NBD1 photolabeling (36). Login to comment
124 We found that neither the K1250A nor K464A mutations prevented [␣-32 P]8-N3-ATP photolabeling of the NBDs (Fig. 3A). Login to comment
132 (A) Autoradiogram of [␣-32P]8-N3-ATP labeling of CFTR-K464A and K1250A; labeling of both NBDs was observed for each mutant. Login to comment
134 (C) Effect of NEM modification of CFTR-S1248C͞ K1250A on relative current and burst duration. Login to comment
135 Because we were not able to accurately assess the number of channels in a patch before adding NEM (K1250A has a long interburst interval), Po and the interburst interval were not determined. Login to comment
139 Thus, our data, considered together with that in the literature, suggest that K1250A does not abolish nucleotide binding at NBD2, although it might reduce binding affinity. Login to comment
140 The finding that channels unable to bind nucleotide at NBD2 (S1248F and NEM-modified S1248C) had a normal burst duration suggested that the prolonged burst duration of K1250A (16-18, 20, 21) arose when ATP bound NBD2 but then did not undergo hydrolysis. Login to comment
141 To test this hypothesis, we combined the K1250A mutation with S1248C. Login to comment
142 CFTR-S1248C͞ K1250A showed the prolonged burst duration typical of CFTR-K1250A (Fig. 3 B and C). Login to comment
150 Third, ATP binds the K1250A variant, and while bound it generated a long burst duration. Login to comment
212 As we argued above, although these labeling studies do not assess equilibrium binding, taken together they suggest that K1250A probably reduced binding affinity. Login to comment
213 The functional consequences of the K1250A mutation have also been reported; the mutation reduced the rate of channel opening, and once the channel opened, it delayed its closure (16-18, 20, 21). Login to comment
218 What causes the long burst duration of K1250A? Login to comment
222 Second, ATP could bind the K1250A mutant (perhaps with reduced affinity), but impaired hydrolysis could slow channel closing. Login to comment
131 Fig. 3. Effect of blocking ATP binding to NBD2 on the gating of CFTR-K1250A. Login to comment
217 They also suggest that the reduced opening rate of CFTR-K1250A might result from reduced binding affinity. Login to comment

[hide] ADP inhibits function of the ABC transporter cysti... Proc Natl Acad Sci U S A. 2005 Feb 8;102(6):2216-20. Epub 2005 Jan 31. Randak CO, Welsh MJ
ADP inhibits function of the ABC transporter cystic fibrosis transmembrane conductance regulator via its adenylate kinase activity.
Proc Natl Acad Sci U S A. 2005 Feb 8;102(6):2216-20. Epub 2005 Jan 31., 2005-02-08 [PMID:15684079]

Abstract [show]
ADP interacts with the nucleotide-binding domains (NBDs) of the cystic fibrosis transmembrane conductance regulator (CFTR) to inhibit its Cl- channel activity. Because CFTR NBD2 has reversible adenylate kinase activity (ATP + AMP<==> ADP + ADP) that gates the channel, we asked whether ADP might inhibit current through this enzymatic activity. In adenylate kinases, binding of the two ADP molecules is cooperative. Consistent with this hypothesis, CFTR current inhibition showed positive cooperativity for ADP. We also found that ADP inhibition of current was attenuated when we prevented adenylate kinase activity with P1,P5-di(adenosine-5') pentaphosphate. Additional studies suggested that adenylate kinase-dependent inhibition involved phosphotransfer between two nucleotide diphosphates. These data indicate that the adenylate kinase reaction at NBD2 contributed to the inhibitory effect of ADP. Finding that ADP inhibits function via an adenylate kinase activity also helps explain the earlier observation that mutations that disrupt adenylate kinase activity also disrupt ADP inhibition. Thus, the results reveal a previously unrecognized mechanism by which ADP inhibits an ABC transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 For example, structural studies predict that the K1250A and D1370N mutations alter the ATP-binding sites, and these mutations disrupted both ATPase activity and adenylate kinase activities, as well as ADP-dependent inhibition. Login to comment

[hide] CFTR gating II: Effects of nucleotide binding on t... J Gen Physiol. 2005 Apr;125(4):377-94. Epub 2005 Mar 14. Bompadre SG, Cho JH, Wang X, Zou X, Sohma Y, Li M, Hwang TC
CFTR gating II: Effects of nucleotide binding on the stability of open states.
J Gen Physiol. 2005 Apr;125(4):377-94. Epub 2005 Mar 14., [PMID:15767296]

Abstract [show]
Previously, we demonstrated that ADP inhibits cystic fibrosis transmembrane conductance regulator (CFTR) opening by competing with ATP for a binding site presumably in the COOH-terminal nucleotide binding domain (NBD2). We also found that the open time of the channel is shortened in the presence of ADP. To further study this effect of ADP on the open state, we have used two CFTR mutants (D1370N and E1371S); both have longer open times because of impaired ATP hydrolysis at NBD2. Single-channel kinetic analysis of DeltaR/D1370N-CFTR shows unequivocally that the open time of this mutant channel is decreased by ADP. DeltaR/E1371S-CFTR channels can be locked open by millimolar ATP with a time constant of approximately 100 s, estimated from current relaxation upon nucleotide removal. ADP induces a shorter locked-open state, suggesting that binding of ADP at a second site decreases the locked-open time. To test the functional consequence of the occupancy of this second nucleotide binding site, we changed the [ATP] and performed similar relaxation analysis for E1371S-CFTR channels. Two locked-open time constants can be discerned and the relative distribution of each component is altered by changing [ATP] so that increasing [ATP] shifts the relative distribution to the longer locked-open state. Single-channel kinetic analysis for DeltaR/E1371S-CFTR confirms an [ATP]-dependent shift of the distribution of two locked-open time constants. These results support the idea that occupancy of a second ATP binding site stabilizes the locked-open state. This binding site likely resides in the NH2-terminal nucleotide binding domain (NBD1) because introducing the K464A mutation, which decreases ATP binding affinity at NBD1, into E1371S-CFTR shortens the relaxation time constant. These results suggest that the binding energy of nucleotide at NBD1 contributes to the overall energetics of the open channel conformation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
354 A similar short-lived open state was reported previously for K1250A-CFTR (␶o ϭ ‫052ف‬ ms), another hydrolysis-deficient mutant (Zeltwanger et al., 1999). Login to comment
364 Furthermore, mutations that abolish ATP hydrolysis (e.g., K1250A and E1371S) dramatically prolong the open state (Gunderson and Kopito, 1995; Zeltwanger et al., 1999; Powe et al., 2002; Vergani et al., 2003). Login to comment
367 Interestingly, introducing the K464A mutations into the K1250A construct significantly decreases the locked-open time (Powe et al., 2002; Vergani et al., 2003). Login to comment
380 This hypothesis is based on the observation that mutations that affect ATP binding at NBD1 (e.g., K464A) alter the stability of the open state of K1250A, suggesting an interaction between two ATP-binding sites. Login to comment
406 While we did observe a decrease of the opening rate by the K1250A mutation (Powe et al., 2002; cf. Login to comment

[hide] High affinity ATP/ADP analogues as new tools for s... J Physiol. 2005 Dec 1;569(Pt 2):447-57. Epub 2005 Oct 13. Zhou Z, Wang X, Li M, Sohma Y, Zou X, Hwang TC
High affinity ATP/ADP analogues as new tools for studying CFTR gating.
J Physiol. 2005 Dec 1;569(Pt 2):447-57. Epub 2005 Oct 13., 2005-12-01 [PMID:16223764]

Abstract [show]
Previous studies using non-hydrolysable ATP analogues and hydrolysis-deficient cystic fibrosis transmembrane conductance regulator (CFTR) mutants have indicated that ATP hydrolysis precedes channel closing. Our recent data suggest that ATP binding is also important in modulating the closing rate. This latter hypothesis predicts that ATP analogues with higher binding affinities should stabilize the open state more than ATP. Here we explore the possibility of using N6-modified ATP/ADP analogues as high-affinity ligands for CFTR gating, since these analogues have been shown to be more potent than native ATP/ADP in other ATP-binding proteins. Among the three N6-modified ATP analogues tested, N6-(2-phenylethyl)-ATP (P-ATP) was the most potent, with a K(1/2) of 1.6 +/- 0.4 microm (>50-fold more potent than ATP). The maximal open probability (P(o)) in the presence of P-ATP was approximately 30% higher than that of ATP, indicating that P-ATP also has a higher efficacy than ATP. Single-channel kinetic analysis showed that as [P-ATP] was increased, the opening rate increased, whereas the closing rate decreased. The fact that these two kinetic parameters have different sensitivities to changes of [P-ATP] suggests an involvement of two different ATP-binding sites, a high-affinity site modulating channel closing and a low affinity site controlling channel opening. The effect of P-ATP on the stability of open states was more evident when ATP hydrolysis was abolished, either by mutating the nucleotide-binding domain 2 (NBD2) Walker B glutamate (i.e. E1371) or by using the non-hydrolysable ATP analogue AMP-PNP. Similar strategies to develop nucleotide analogues with a modified adenine ring could be valuable for future studies of CFTR gating.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
224 In addition, K464A mutation decreases the locked open time of hydrolysis-deficient mutants K464A/K1250A and K464A/E1371S (Powe et al. 2002; Vergani et al. 2003; Bompadre et al. 2005b), supporting the idea that the strength of ligand binding at the NBD1 site affects the stability of the open state. Login to comment

[hide] State-dependent chemical reactivity of an engineer... J Biol Chem. 2005 Dec 23;280(51):41997-2003. Epub 2005 Oct 14. Zhang ZR, Song B, McCarty NA
State-dependent chemical reactivity of an engineered cysteine reveals conformational changes in the outer vestibule of the cystic fibrosis transmembrane conductance regulator.
J Biol Chem. 2005 Dec 23;280(51):41997-2003. Epub 2005 Oct 14., 2005-12-23 [PMID:16227620]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) chloride channels are gated by binding and hydrolysis of ATP at the nucleotide-binding domains (NBDs). We used covalent modification of CFTR channels bearing a cysteine engineered at position 334 to investigate changes in pore conformation that might accompany channel gating. In single R334C-CFTR channels studied in excised patches, modification by [2-(trimethylammonium)ethyl] methanethiosulfonate (MTSET+), which increases conductance, occurred only during channel closed states. This suggests that the rate of reaction of the cysteine was greater in closed channels than in open channels. R334C-CFTR channels in outside-out macropatches activated by ATP alone were modified with first order kinetics upon rapid exposure to MTSET+. Modification was much slower when channels were locked open by the addition of nonhydrolyzable nucleotide or when the R334C mutation was coupled to a second mutation, K1250A, which greatly decreases channel closing rate. In contrast, modification was faster in R334C/K464A-CFTR channels, which exhibit prolonged interburst closed states. These data indicate that the reactivity of the engineered cysteine in R334C-CFTR is state-dependent, providing evidence of changes in pore conformation coupled to ATP binding and hydrolysis at the NBDs. The data also show that maneuvers that lock open R334C-CFTR do so by locking channels into the prominent s2 subconductance state, suggesting that the most stable conducting state of the pore reflects the fully occupied, prehydrolytic state of the NBDs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Modification was much slower when channels were locked open by the addition of nonhydrolyzable nucleotide or when the R334C mutation was coupled to a second mutation, K1250A, which greatly decreases channel closing rate. Login to comment
40 All single channel recordings for R334C- and R34C/K1250A-CFTR used asymmetrical [Cl- ] in order to increase the single channel amplitude at VM ϭ -100 mV, where the pipettes were filled with a low [Cl- ]-containing solution (see below). Login to comment
45 R334C-, R334C/ K464A-, and R334C/K1250A-CFTR channels were activated by excision into intracellular solution containing 300 mM NMDG-Cl, 1.1 mM MgCl2, 2 mM Tris-EGTA, 1 mM MgATP, 10 mM TES (pH 7.4), 50 units/ml PKA. Login to comment
60 The bin widths for R334C-CFTR recordings in the absence of AMP-PNP were 100 ms, and for R334C-CFTR in the presence of additional AMP-PNP or for a dual mutant R334C/K1250A, bin widths were 500 and 1000 ms, respectively. Login to comment
77 To test this hypothesis, we coupled the R334C mutation with a mutation at the Walker lysine of NBD2, K1250A, which prolongs the open burst duration of CFTR channels (21-23). Login to comment
78 Fig. 1B shows a recording of a single R334C/ K1250A-CFTR channel, where the electrode was backfilled with 200 ␮M MTSETϩ . Login to comment
81 Hence, even when Po was increased by the K1250A mutation, modification at R334C did not take place in the open state. Login to comment
84 In contrast, all of the open bursts of R334C/K1250A-CFTR before modification lacked transitions between conductance states and were "locked" in the s2 state (Fig. 1B). Login to comment
85 Following MTSETϩ -induced modification, R334C/K1250A-CFTR channels opened to, and remained locked in, the s2 state. Login to comment
86 Amplitudes for the s2 state in R334C/K1250A-CFTR were not significantly different from the amplitudes of the s2 state of R334C-CFTR before and after modification (p ϭ 0.85) (17). Login to comment
107 Furthermore, the prolonged unmodified FIGURE1.RealtimemodificationofR334C-CFTRandR334C/K1250A-CFTRchannels by MTSET؉ . Login to comment
112 B, representative trace for R334C/K1250A-CFTR under identical conditions. Login to comment
122 Movement in the Outer Vestibule of the CFTR Pore DECEMBER 23, 2005•VOLUME 280•NUMBER 51 JOURNAL OF BIOLOGICAL CHEMISTRY 41999 openings and prolonged modified openings induced by AMP-PNP were "locked" in the s state, as was found for R334C/K1250A-CFTR with ATP alone, and the s2 state amplitudes were virtually identical to those for the s2 state of R334C-CFTR in the presence of ATP alone (p Ͼ 0.5). Login to comment
130 TABLEONE KineticsofmodificationofR334Cunderavarietyofconditions ValuesshownaremeanϮS.E. Condition1mMATP0.2mMATP1mMATP 1mMATP؉2.75mM AMP-PNP 1mMATP1mMATP1mMATP1mMATP MutantR334CR334CR334C/K464AR334CR334C/K1250AR334CR334CR334C/K1250A ͓MTSETϩ ͔(␮M)101010101050 ͓MTSES- ͔(␮M)5050 ␶(s)(n)5.93Ϯ1.37(4)5.88Ϯ0.49(5)2.44Ϯ0.27(3)a 4.35Ϯ0.9and 157Ϯ14.9(5) 12.5Ϯ0.94and 225Ϯ29(5)a 2.73Ϯ0.24(5)4.23Ϯ0.18(3)b 11.3Ϯ0.7and 132Ϯ30.1(5) a SignificantdifferencefromvalueforR334C-CFTRwith1mMATP,exposedto10␮MMTSETϩ . Login to comment
144 Mutation K1250A reduces the channel closing rate (Fig. 1B). Login to comment
146 We studied outside-out macropatches from oocytes expressing R334C/K1250A- or R334C/K464A-CFTR to determine the effects of these gating domain mutations on the kinetics of modification, using experimental procedures similar to those described above. Login to comment
147 Upon exposure to MTSETϩ , the macroscopic current for R334C/K1250A-CFTR increased rapidly at first, followed by a slower increase in current, reflecting a complicated modification process (Fig. 5A); the kinetics of modification were described best by the sum of two exponential functions. Login to comment
148 Hence, the consequences of introducing the K1250A mutation were similar to the consequences of the addition of nonhydrolyzable nucleotide; the time-course of macroscopic modification was biphasic, with a component that is much slower than that seen in the single mutant with ATP alone. Login to comment
151 The modification rate coefficients for MTSETϩ in R334C/K1250A-CFTR were 9,840 Ϯ 626 M -1 s-1 and 482 Ϯ 65 M -1 s-1 , respectively. Login to comment
152 The biphasic nature of the macroscopic kinetics of modification in these experiments probably reflects the fact that the K1250A mutation reduces the closing rate in some channels but not all (23). Login to comment
153 In other words, while R334C/K1250A-CFTR channels are closed, they stay closed approximately as long as R334C-CFTR channels do, which provides an opportunity for rapid modification. Login to comment
154 When R334C/K1250A-CFTR channels are open, they typically stay open much longer than R334C-CFTR channels do, which reduces the macroscopic modification rate coefficient. Login to comment
155 These interpretations are supported, at least in part, by the single channel behavior of R334C/K1250A-CFTR. Login to comment
157 The top, middle, and bottom traces are from near the beginning, middle, and end of the experiment, respectively. One can see that R334C/K1250A-CFTR channel openings lack prominent transitions between conductance states, no matter how long the burst duration. Login to comment
161 However, we were able to estimate mean burst duration of R334C/K1250A-CFTR channels. Login to comment
163 The fractional amplitudes contributed by ␶B1 and ␶B2 were 77 and 23%, respectively, which are very compatible with the fractional amplitudes for ␶1 (75%) and ␶2 (25%) for the kinetics of macroscopic modification of R334C/K1250A-CFTR. Login to comment
164 This suggests that the faster phase of macroscopic modification of R334C/K1250A-CFTR by MTSETϩ could be attributed to modification of channels with burst duration of ϳ4 s, FIGURE 5. Login to comment
165 MTSET؉ -induced modification of R334C/K1250A-CFTR and R334C/ K464A-CFTR. Login to comment
166 Shown are outside-out macropatches from oocytes expressing either R334C/K1250A-CFTR (A and C) or R334C/K464A-CFTR (B). Login to comment
169 The process of modification of R334C/K1250A-CFTR by MTSETϩ at Vm ϭ ϩ80 mVwasfitbestwiththesumoftwoexponentialfunctions,with␶1 ϭ14.8sand␶2 ϭ158s in this experiment. Login to comment
170 The kinetics of modification of R334C/K1250A-CFTR by MTSETϩ at Vm ϭ -80 mV also were described best by the sum of two exponential functions, having values of ␶1 ϭ 12.9 s and ␶2 ϭ 126 s in this experiment. Login to comment
183 This behavior also is characteristic of the K1250A single mutant, which under identical conditions exhibits PO of only ϳ0.77 (27). Login to comment
197 Fig. 7 shows outside-out macropatch recordings from oocytes expressing either R334C-CFTR or R334C/K1250A-CFTR, with rapid exposure to 50 ␮M MTSES- . Login to comment
198 Macroscopic currents from R334C- and R334C/K1250A-CFTR were decreased upon exposure to MTSES- (due to deposition of negative charge) by 75 Ϯ 6 and 77 Ϯ 5%, respectively. Login to comment
200 The macroscopic kinetics of modification of R334C/K1250A-CFTR were fit best with the sum of two exponential functions (TABLE ONE; the fractional amplitudes were 84 Ϯ 2.7% for ␶1 and 16 Ϯ 2.7% for ␶2), as was found for MTSETϩ . Login to comment
201 The modification rate coefficients for MTSES- in both R334C-CFTR and R334C/K1250A-CFTR were Ͼ3-fold lower than those measured for MTSETϩ in the same mutants (p Ͻ 0.001). Login to comment
206 Upon rapid exposure to MTSETϩ , macroscopic inward current was increased, reflecting modification of R334C/ K1250A-CFTR channels. Login to comment
208 Kinetics of modification of single R334C/K1250A-CFTR channels. Login to comment
217 All openings of R334C/K1250A-CFTR channels exhibited conductance equivalent to the s2 conductance state of R334C-CFTR. Login to comment
220 MTSES- -induced modification of R334C-CFTR and R334C/K1250A-CFTR. Login to comment
221 Outside-out macropatches were pulled from oocytes expressing either R334C-CFTR or R334C/K1250A-CFTR. Login to comment
225 The dashed line indicates a fit of the data to a first-order exponentialfunction,having␶ϭ4.5sinthisexperiment.B,arepresentativerecordingof macroscopic current of R334C/K1250A-CFTR under identical conditions. Login to comment
231 Single R334C-CFTR channels studied using real time modification only showed a reaction to MTSETϩ during a closed state, even when channel Po was increased dramatically by exposure to mixtures of ATP and AMP-PNP or by the addition of the Walker A mutation K1250A. Login to comment
233 Under conditions that increase channel activity (i.e. R334C-CFTR with ATP ϩ AMP-PNP, or R334C/K1250A-CFTR with ATP alone), the kinetics of modification were slowed. Login to comment
249 Results from the present study show that when R334C-CFTR channels are locked open by either AMP-PNP or the addition of the K1250A mutation, they are locked into the s2 state. Login to comment
252 Consistent with this notion, we recently reported that WT-CFTR channels locked open by either AMP-PNP or vanadate (and K1250A-CFTR channels with ATP alone) exhibit a reduced frequency of flickery closures compared with WT-CFTR channels in the presence of ATP alone (27). Login to comment

[hide] Nucleotide-binding domains of cystic fibrosis tran... J Biol Chem. 2006 Feb 17;281(7):4058-68. Epub 2005 Dec 16. Gross CH, Abdul-Manan N, Fulghum J, Lippke J, Liu X, Prabhakar P, Brennan D, Willis MS, Faerman C, Connelly P, Raybuck S, Moore J
Nucleotide-binding domains of cystic fibrosis transmembrane conductance regulator, an ABC transporter, catalyze adenylate kinase activity but not ATP hydrolysis.
J Biol Chem. 2006 Feb 17;281(7):4058-68. Epub 2005 Dec 16., 2006-02-17 [PMID:16361259]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter family. CFTR consists of two transmembrane domains, two nucleotide-binding domains (NBD1 and NBD2), and a regulatory domain. Previous biochemical reports suggest NBD1 is a site of stable nucleotide interaction with low ATPase activity, whereas NBD2 is the site of active ATP hydrolysis. It has also been reported that NBD2 additionally possessed adenylate kinase (AK) activity. Knowledge about the intrinsic biochemical activities of the NBDs is essential to understanding the Cl(-) ion gating mechanism. We find that purified mouse NBD1, human NBD1, and human NBD2 function as adenylate kinases but not as ATPases. AK activity is strictly dependent on the addition of the adenosine monophosphate (AMP) substrate. No liberation of [(33)P]phosphate is observed from the gamma-(33)P-labeled ATP substrate in the presence or absence of AMP. AK activity is intrinsic to both human NBDs, as the Walker A box lysine mutations abolish this activity. At low protein concentration, the NBDs display an initial slower nonlinear phase in AK activity, suggesting that the activity results from homodimerization. Interestingly, the G551D gating mutation has an exaggerated nonlinear phase compared with the wild type and may indicate this mutation affects the ability of NBD1 to dimerize. hNBD1 and hNBD2 mixing experiments resulted in an 8-57-fold synergistic enhancement in AK activity suggesting heterodimer formation, which supports a common theme in ABC transporter models. A CFTR gating mechanism model based on adenylate kinase activity is proposed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
191 B, thin layer chromatography plateshowingtheAKactivityofthewild-typehNBD2 protein and the K1250A mutant protein. Login to comment
205 The hNBD2 (K1250A) mutant result is in agreement with the results reported by Randak and Welsh (16). Login to comment

[hide] On the discovery and development of CFTR chloride ... Curr Pharm Des. 2006;12(4):471-84. Becq F
On the discovery and development of CFTR chloride channel activators.
Curr Pharm Des. 2006;12(4):471-84., [PMID:16472140]

Abstract [show]
Chloride channels play important roles in vital cellular signalling processes contributing to homeostasis in both excitable and non-excitable cells. Since 1987, more than ten ion channel genes have been identified as causing human hereditary diseases among them the genes for the voltage-dependent chloride channel ClC-1 (myotonia) and the cystic fibrosis transmembrane conductance regulator (CFTR) protein (cystic fibrosis). The CFTR gene was cloned in 1989 and its protein product identified as an ATP-gated and phosphorylation-regulated chloride channel during the following two years. Since then, searching for potent and specific small molecules able to modulate normal and mutated CFTR has become a crucial endpoint in the field for both our understanding of the physiological role that CFTR plays in epithelial cells and more importantly for the development of therapeutic agents to cure cystic fibrosis (CF). It is predicted that a pharmacological approach would help not only to restore the defective transport activity of mutant CFTR but also to correct the regulatory function of CFTR. This review describes the evolution of CFTR pharmacology and how during the last five years, high throughput screening assays have been developed to identify novel molecules, some of them probably constituting a reservoir of future therapeutic agents for CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
175 Importantly, NS004 is a modulator of several mutated forms of CFTR; P574H [60], K1250A [61], delF508 [31, 35, 61] and G551D [59]. Login to comment

[hide] The ABC protein turned chloride channel whose fail... Nature. 2006 Mar 23;440(7083):477-83. Gadsby DC, Vergani P, Csanady L
The ABC protein turned chloride channel whose failure causes cystic fibrosis.
Nature. 2006 Mar 23;440(7083):477-83., 2006-03-23 [PMID:16554808]

Abstract [show]
CFTR chloride channels are encoded by the gene mutated in patients with cystic fibrosis. These channels belong to the superfamily of ABC transporter ATPases. ATP-driven conformational changes, which in other ABC proteins fuel uphill substrate transport across cellular membranes, in CFTR open and close a gate to allow transmembrane flow of anions down their electrochemical gradient. New structural and biochemical information from prokaryotic ABC proteins and functional information from CFTR channels has led to a unifying mechanism explaining those ATP-driven conformational changes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 But they are 11 22 11 2 a b ATP ATP ATP ATP C2 Open Concentration of MgATP in µM Relativeopeningrate K1250A K464A C1C0 101 1.0 WT K464A K1250A 0.5 0 102 103 104 Figure 3 | The conserved Walker A lysine is critical for ATP binding in each NBD. Login to comment
144 ATP first binds to the non-mutant site, that is to the NBD2 site (blue) in K464A channels (upper row), but to the NDB1 site (green) in K1250A channels (lower row). Login to comment

[hide] The two ATP binding sites of cystic fibrosis trans... J Gen Physiol. 2006 Oct;128(4):413-22. Epub 2006 Sep 11. Zhou Z, Wang X, Liu HY, Zou X, Li M, Hwang TC
The two ATP binding sites of cystic fibrosis transmembrane conductance regulator (CFTR) play distinct roles in gating kinetics and energetics.
J Gen Physiol. 2006 Oct;128(4):413-22. Epub 2006 Sep 11., [PMID:16966475]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR), a member of the ABC (ATP binding cassette) transporter family, is a chloride channel whose activity is controlled by protein kinase-dependent phosphorylation. Opening and closing (gating) of the phosphorylated CFTR is coupled to ATP binding and hydrolysis at CFTR's two nucleotide binding domains (NBD1 and NBD2). Recent studies present evidence that the open channel conformation reflects a head-to-tail dimerization of CFTR's two NBDs as seen in the NBDs of other ABC transporters (Vergani et al., 2005). Whether these two ATP binding sites play an equivalent role in the dynamics of NBD dimerization, and thus in gating CFTR channels, remains unsettled. Based on the crystal structures of NBDs, sequence alignment, and homology modeling, we have identified two critical aromatic amino acids (W401 in NBD1 and Y1219 in NBD2) that coordinate the adenine ring of the bound ATP. Conversion of the W401 residue to glycine (W401G) has little effect on the sensitivity of the opening rate to [ATP], but the same mutation at the Y1219 residue dramatically lowers the apparent affinity for ATP by >50-fold, suggesting distinct roles of these two ATP binding sites in channel opening. The W401G mutation, however, shortens the open time constant. Energetic analysis of our data suggests that the free energy of ATP binding at NBD1, but not at NBD2, contributes significantly to the energetics of the open state. This kinetic and energetic asymmetry of CFTR's two NBDs suggests an asymmetric motion of the NBDs during channel gating. Opening of the channel is initiated by ATP binding at the NBD2 site, whereas separation of the NBD dimer at the NBD1 site constitutes the rate-limiting step in channel closing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 It is generally agreed that ATP hydrolysis at NBD2 precedes channel closing since mutations (e.g., K1250A and E1371S) that abolish ATP hydrolysis at the NBD2 site drastically prolong the open time (Carson et al., 1995; Gunderson and Kopito, 1995; Zeltwanger et al., 1999; Vergani et al., 2003; Bompadre et al., 2005b). Login to comment
194 Studies using different mutations that perturb ATP hydrolysis (e.g., K1250A, E1371S) indicate that ATP hydrolysis drives channel closure. Login to comment
198 Although these studies have provided significant insight into the role of ATP hydrolysis in CFTR gating, this kind of approach does not provide a distinct advantage in understanding the role of ATP binding since altering the ligand binding affinity with these mutations is often complicated by the mutational effect on ATP hydrolysis (e.g., K1250A in Vergani et al., 2003). Login to comment

[hide] The Walker B motif of the second nucleotide-bindin... Biochem J. 2007 Jan 15;401(2):581-6. Stratford FL, Ramjeesingh M, Cheung JC, Huan LJ, Bear CE
The Walker B motif of the second nucleotide-binding domain (NBD2) of CFTR plays a key role in ATPase activity by the NBD1-NBD2 heterodimer.
Biochem J. 2007 Jan 15;401(2):581-6., 2007-01-15 [PMID:16989640]

Abstract [show]
CFTR (cystic fibrosis transmembrane conductance regulator), a member of the ABC (ATP-binding cassette) superfamily of membrane proteins, possesses two NBDs (nucleotide-binding domains) in addition to two MSDs (membrane spanning domains) and the regulatory 'R' domain. The two NBDs of CFTR have been modelled as a heterodimer, stabilized by ATP binding at two sites in the NBD interface. It has been suggested that ATP hydrolysis occurs at only one of these sites as the putative catalytic base is only conserved in NBD2 of CFTR (Glu1371), but not in NBD1 where the corresponding residue is a serine, Ser573. Previously, we showed that fragments of CFTR corresponding to NBD1 and NBD2 can be purified and co-reconstituted to form a heterodimer capable of ATPase activity. In the present study, we show that the two NBD fragments form a complex in vivo, supporting the utility of this model system to evaluate the role of Glu1371 in ATP binding and hydrolysis. The present studies revealed that a mutant NBD2 (E1371Q) retains wild-type nucleotide binding affinity of NBD2. On the other hand, this substitution abolished the ATPase activity formed by the co-purified complex. Interestingly, introduction of a glutamate residue in place of the non-conserved Ser573 in NBD1 did not confer additional ATPase activity by the heterodimer, implicating a vital role for multiple residues in formation of the catalytic site. These findings provide the first biochemical evidence suggesting that the Walker B residue: Glu1371, plays a primary role in the ATPase activity conferred by the NBD1-NBD2 heterodimer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 In support of this model, mutation of the Walker A lysine (K1250A) or the Walker B glutamate (E1371A/Q) in the conventional catalytic site leads to defective channel closure, resulting in prolonged channel open Abbreviations used: ABC, ATP-binding cassette; CF, cystic fibrosis; CFTR, CF transmembrane conductance regulator; HA, haemagglutinin; NBD, nucleotide-binding domain; MSD, membrane spanning domain; PFO, pentadecafluorooctanoic acid; TNP-ATP, 2 (3)-O-(2,4,6-trinitrophenyl)adenosine 5-triphosphate. Login to comment
34 Although the consequences of mutating the Walker A lysine of NBD2 (K1250A) on nucleotide binding and hydrolysis have been measured [19], to date there have been no direct measurements of the consequences of mutating the putative catalytic base, Glu1371 , on nucleotide binding and hydrolysis. Login to comment

[hide] Thermodynamics of CFTR channel gating: a spreading... J Gen Physiol. 2006 Nov;128(5):523-33. Epub 2006 Oct 16. Csanady L, Nairn AC, Gadsby DC
Thermodynamics of CFTR channel gating: a spreading conformational change initiates an irreversible gating cycle.
J Gen Physiol. 2006 Nov;128(5):523-33. Epub 2006 Oct 16., [PMID:17043148]

Abstract [show]
CFTR is the only ABC (ATP-binding cassette) ATPase known to be an ion channel. Studies of CFTR channel function, feasible with single-molecule resolution, therefore provide a unique glimpse of ABC transporter mechanism. CFTR channel opening and closing (after regulatory-domain phosphorylation) follows an irreversible cycle, driven by ATP binding/hydrolysis at the nucleotide-binding domains (NBD1, NBD2). Recent work suggests that formation of an NBD1/NBD2 dimer drives channel opening, and disruption of the dimer after ATP hydrolysis drives closure, but how NBD events are translated into gate movements is unclear. To elucidate conformational properties of channels on their way to opening or closing, we performed non-equilibrium thermodynamic analysis. Human CFTR channel currents were recorded at temperatures from 15 to 35 degrees C in inside-out patches excised from Xenopus oocytes. Activation enthalpies(DeltaH(double dagger)) were determined from Eyring plots. DeltaH(double dagger) was 117 +/- 6 and 69 +/- 4 kJ/mol, respectively, for opening and closure of partially phosphorylated, and 96 +/- 6 and 73 +/- 5 kJ/mol for opening and closure of highly phosphorylated wild-type (WT) channels. DeltaH(double dagger) for reversal of the channel opening step, estimated from closure of ATP hydrolysis-deficient NBD2 mutant K1250R and K1250A channels, and from unlocking of WT channels locked open with ATP+AMPPNP, was 43 +/- 2, 39 +/- 4, and 37 +/- 6 kJ/mol, respectively. Calculated upper estimates of activation free energies yielded minimum estimates of activation entropies (DeltaS(double dagger)), allowing reconstruction of the thermodynamic profile of gating, which was qualitatively similar for partially and highly phosphorylated CFTR. DeltaS(double dagger) appears large for opening but small for normal closure. The large DeltaH(double dagger) and DeltaS(double dagger) (TDeltaS(double dagger) >/= 41 kJ/mol) for opening suggest that the transition state is a strained channel molecule in which the NBDs have already dimerized, while the pore is still closed. The small DeltaS(double dagger) for normal closure is appropriate for cleavage of a single bond (ATP's beta-gamma phosphate bond), and suggests that this transition state does not require large-scale protein motion and hence precedes rehydration (disruption) of the dimer interface.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
9 ∆H‡ for reversal of the channel opening step, estimated from closure of ATP hydrolysis-deficient NBD2 mutant K1250R and K1250A channels, and from unlocking of WT channels locked open with ATP+AMPPNP, was 43 ± 2, 39 ± 4, and 37 ± 6 kJ/mol, respectively. Login to comment
41 M AT E R I A L S A N D M E T H O D S Molecular Biology pGEMHE-WT was constructed as previously described (Chan et al., 2000), and the K1250R and K1250A mutations introduced using QuikChange (Stratagene) as previously described (Vergani et al., 2003, 2005). Login to comment
88 S2-S4 show parallel macroscopic current and temperature records illustrating temperature dependence of closure of partially phosphorylated K1250R and K1250A, and of AMPPNP-locked WT, CFTR, respectively, recorded at -80 to -20 mV between 25°C and 31°C. Fig. S5 demonstrates that exposure to millimolar levels of the hydrolysis products ADP+Pi does not cause opening of prephosphorylated WT CFTR channels. Login to comment
89 Fig. S6 shows the predicted energetic profile of CFTR gating obtained using K1250A, not K1250R (as in Fig. 6), as a model for nonhydrolytic channel closure. Login to comment
105 Temperature Dependence of Closing Rate of Hydrolysis-deficient Mutant K1250R and K1250A CFTR Channels To estimate ∆H‡ for channel closing when the normal route for channel closure via ATP hydrolysis was unavailable, we studied the temperature dependence of the closing rate of two channel constructs in which the composite NBD2 site was made catalytically inactive by mutation of the conserved NBD2 Walker A lysine, K1250. Login to comment
106 The mutation K1250A has been shown to abolish ATPase activity of purified CFTR (Ramjeesingh et al., 1999). Login to comment
108 Closure of K1250R or of K1250A mutant CFTR channels is too slow to allow kinetic analysis of individual gating events and so it was assayed as current decay after sudden removal of ATP. Login to comment
113 Because the K1250A mutation greatly diminishes the affinity for ATP binding (Vergani et al., 2003), 10 mM MgATP was used to repeatedly activate macroscopic K1250A currents at temperatures alternating between 25°C and either ‫°51ف‬C (Fig. 4 A) or ‫°13ف‬C (Fig. S3). Login to comment
117 For K1250A channels, the closing time constant after simultaneous removal of ATP and PKA was rarely assessed (τ = 38 ± 4 s, n = 3), and is not easily compared with that after removal of just ATP (τ = 25 ± 2 s, n = 29), as the latter usually progressively shortened during an experiment (τ = 29 ± 3 s, n = 18, for the first decay from each Figure 1. Login to comment
136 Temperature dependence of gating of partially phosphorylated K1250A CFTR. Login to comment
137 (A) Macroscopic current recording (top) from K1250A CFTR channels with simultaneously recorded temperature (bottom). Login to comment
140 (B) Eyring plot of normalized closing rates ( ˆk ) of K1250A CFTR channels upon ATP removal, fitted by a straight line to obtain ∆H‡; closing rates, obtained as 1/τ from single-exponential fits, as in A, were normalized to their average values in bracketing control segments at 25°C. Login to comment
145 From an Eyring plot of normalized unlocking rates (Fig. 5 B), the rough estimate of ∆H‡ for unlocking from AMPPNP of partially phosphorylated WT CFTR was 37 ± 6 kJ/ mol, similar to the value obtained above for closure of partially phosphorylated K1250R and K1250A channels opened by just ATP (Fig. 3 B and Fig. 4 B). Login to comment
167 We selected the mutant K1250A as a second model for nonhydrolytic closure because it displays much slower closure than K1250R (e.g., Vergani et al., 2003, 2005) and because the K1250A mutation abolishes ATP hydrolysis by CFTR (Ramjeesingh et al., 1999). Login to comment
188 The charge-neutralizing mutation K1250A, on the other hand,doesabrogateATPhydrolysisinCFTR(Ramjeesingh et al., 1999) and yields an open burst state more stable than that of K1250R (Vergani et al., 2003, 2005). Login to comment
189 But using the closing rate of K1250A (instead of K1250R) channels as a model for nonhydrolytic closure, and hence for reversal of channel opening, yields barrier values for this step (∆H‡ = 39 kJ/mol and Δ maxG‡ = 81 kJ/mol) that are onlyslightlydifferentfromthoseestimatedusingK1250R. Login to comment

[hide] G551D and G1349D, two CF-associated mutations in t... J Gen Physiol. 2007 Apr;129(4):285-98. Epub 2007 Mar 12. Bompadre SG, Sohma Y, Li M, Hwang TC
G551D and G1349D, two CF-associated mutations in the signature sequences of CFTR, exhibit distinct gating defects.
J Gen Physiol. 2007 Apr;129(4):285-98. Epub 2007 Mar 12., [PMID:17353351]

Abstract [show]
Mutations in the gene encoding cystic fibrosis transmembrane conductance regulator (CFTR) result in cystic fibrosis (CF). CFTR is a chloride channel that is regulated by phosphorylation and gated by ATP binding and hydrolysis at its nucleotide binding domains (NBDs). G551D-CFTR, the third most common CF-associated mutation, has been characterized as having a lower open probability (Po) than wild-type (WT) channels. Patients carrying the G551D mutation present a severe clinical phenotype. On the other hand, G1349D, also a mutant with gating dysfunction, is associated with a milder clinical phenotype. Residues G551 and G1349 are located at equivalent positions in the highly conserved signature sequence of each NBD. The physiological importance of these residues lies in the fact that the signature sequence of one NBD and the Walker A and B motifs from the other NBD form the ATP-binding pocket (ABP1 and ABP2, named after the location of the Walker A motif) once the two NBDs dimerize. Our studies show distinct gating characteristics for these mutants. The G551D mutation completely eliminates the ability of ATP to increase the channel activity, and the observed activity is approximately 100-fold smaller than WT-CFTR. G551D-CFTR does not respond to ADP, AMP-PNP, or changes in [Mg(2+)]. The low activity of G551D-CFTR likely represents the rare ATP-independent gating events seen with WT channels long after the removal of ATP. G1349D-CFTR maintains ATP dependence, albeit with a Po approximately 10-fold lower than WT. Interestingly, compared to WT results, the ATP dose-response relationship of G1349D-CFTR is less steep and shows a higher apparent affinity for ATP. G1349D data could be well described by a gating model that predicts that binding of ATP at ABP1 hinders channel opening. Thus, our data provide a quantitative explanation at the single-channel level for different phenotypes presented by patients carrying these two mutations. In addition, these results support the idea that CFTR's two ABPs play distinct functional roles in gating.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
200 It remains possible that this mutation lowers ATP binding affinity as other mutations in ABP2 (e.g., Y1219G in Zhou et al., 2006; K1250A in Vergani et al., 2003). Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Sheng Li Xue Bao. 2007 Aug 25;59(4):431-42. Bompadre SG, Hwang TC
Cystic fibrosis transmembrane conductance regulator: a chloride channel gated by ATP binding and hydrolysis.
Sheng Li Xue Bao. 2007 Aug 25;59(4):431-42., 2007-08-25 [PMID:17700963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel that belongs to the ATP-binding cassette (ABC) transporter superfamily. Defective function of CFTR is responsible for cystic fibrosis (CF), the most common lethal autosomal recessive disorder in Caucasian populations. The disease is manifested in defective chloride transport across the epithelial cells in various tissues. To date, more than 1400 different mutations have been identified as CF-associated. CFTR is regulated by phosphorylation in its regulatory (R) domain, and gated by ATP binding and hydrolysis at its two nucleotide-binding domains (NBD1 and NBD2). Recent studies reveal that the NBDs of CFTR may dimerize as observed in other ABC proteins. Upon dimerization of CFTR's two NBDs, in a head-to-tail configuration, the two ATP-binding pockets (ABP1 and ABP2) are formed by the canonical Walker A and B motifs from one NBD and the signature sequence from the partner NBD. Mutations of the amino acids that interact with ATP reveal that the two ABPs play distinct roles in controlling ATP-dependent gating of CFTR. It was proposed that binding of ATP to the ABP2, which is formed by the Walker A and B in NBD2 and the signature sequence in NBD1, is critical for catalyzing channel opening. While binding of ATP to the ABP1 alone may not increase the opening rate, it does contribute to the stabilization of the open channel conformation. Several disease-associated mutations of the CFTR channel are characterized by gating defects. Understanding how CFTR's two NBDs work together to gate the channel could provide considerable mechanistic information for future pharmacological studies, which could pave the way for tailored drug design for therapeutical interventions in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
135 In addition, introducing the K464A mutation into the K1250A mutant whose ATP hydrolysis at NBD2 is diminished[25,27] dramatically shortens the stable open state seen in the K1250A mutation (Fig.3). Login to comment
160 This conclusion was reached after finding that the ATP dose-response relationships of the Walker A mutants K464A and K1250A and the Walker B mutant D1370N were shifted towards higher [ATP] com- paredto theATPdose-response curvefor wild-typechannels. Login to comment
164 The K464A mutation shortens current relaxation of K1250A-CFTR. Login to comment
165 A: Representative traces for the current relaxation of K1250A-CFTR and K464A/K1250A-CFTR upon withdrawal of ATP and PKA. Login to comment
168 ** P<0.01, *** P<0.005 vs K1250A. Login to comment
181 Single channel analysis indicates that theY1219G mutation reduces the opening rate of the channel while not affecting the open time (i.e. this mutation probably does not affect ATP hydrolysis in ABP2 like K1250A or D1370N). Login to comment

[hide] Conformational changes in a pore-lining helix coup... J Biol Chem. 2008 Feb 22;283(8):4957-66. Epub 2007 Dec 3. Beck EJ, Yang Y, Yaemsiri S, Raghuram V
Conformational changes in a pore-lining helix coupled to cystic fibrosis transmembrane conductance regulator channel gating.
J Biol Chem. 2008 Feb 22;283(8):4957-66. Epub 2007 Dec 3., 2008-02-22 [PMID:18056267]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR), the protein dysfunctional in cystic fibrosis, is unique among ATP-binding cassette transporters in that it functions as an ion channel. In CFTR, ATP binding opens the channel, and its subsequent hydrolysis causes channel closure. We studied the conformational changes in the pore-lining sixth transmembrane segment upon ATP binding by measuring state-dependent changes in accessibility of substituted cysteines to methanethiosulfonate reagents. Modification rates of three residues (resides 331, 333, and 335) near the extracellular side were 10-1000-fold slower in the open state than in the closed state. Introduction of a charged residue by chemical modification at two of these positions (resides 331 and 333) affected CFTR single-channel gating. In contrast, modifications of pore-lining residues 334 and 338 were not state-dependent. Our results suggest that ATP binding induces a modest conformational change in the sixth transmembrane segment, and this conformational change is coupled to the gating mechanism that regulates ion conduction. These results may establish a structural basis of gating involving the dynamic rearrangement of transmembrane domains necessary for vectorial transport of substrates in ATP-binding cassette transporters.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
245 Zhang et al. (26) reported that the rate of MTSET modification of R334C-CFTR expressed in oocytes was monotonic in the WT background but followed a bi-exponential decay because of an additional slower (nearly 20 times slower) component in the K1250A background. Login to comment
246 The authors suggested that the slower reactivity in the open state that is stabilized in the K1250A mutant channel was due to changes in the local electrostatic environment (see above). Login to comment
249 A notable difference between the two mutations is that the Walker A mutation K1250A, unlike E1371Q, decreases the ATP binding affinity of NBD2 (27), which profoundly reduces the channel opening rate (28, 29) in addition to decreasing the closing rate (30) of CFTR. Login to comment
250 Hence, the slower modification rate observed in the earlier study (26) may be specific to K1250A and not a general characteristic of the open state. Login to comment

[hide] CLC-0 and CFTR: chloride channels evolved from tra... Physiol Rev. 2008 Apr;88(2):351-87. Chen TY, Hwang TC
CLC-0 and CFTR: chloride channels evolved from transporters.
Physiol Rev. 2008 Apr;88(2):351-87., [PMID:18391167]

Abstract [show]
CLC-0 and cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channels play important roles in Cl(-) transport across cell membranes. These two proteins belong to, respectively, the CLC and ABC transport protein families whose members encompass both ion channels and transporters. Defective function of members in these two protein families causes various hereditary human diseases. Ion channels and transporters were traditionally viewed as distinct entities in membrane transport physiology, but recent discoveries have blurred the line between these two classes of membrane transport proteins. CLC-0 and CFTR can be considered operationally as ligand-gated channels, though binding of the activating ligands appears to be coupled to an irreversible gating cycle driven by an input of free energy. High-resolution crystallographic structures of bacterial CLC proteins and ABC transporters have led us to a better understanding of the gating properties for CLC and CFTR Cl(-) channels. Furthermore, the joined force between structural and functional studies of these two protein families has offered a unique opportunity to peek into the evolutionary link between ion channels and transporters. A promising byproduct of this exercise is a deeper mechanistic insight into how different transport proteins work at a fundamental level.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
684 However, since CFTR mutants whose ATP hydrolysis is abolished (e.g., K1250A, E1371S) (251, 302), once opened by ATP, can remain open for minutes (34, 112, 323, 324, 350; cf. Refs. 42, 251), it is now generally accepted that hydrolysis of ATP at ABP2 closes the channel (97, 358). Login to comment
715 For hydrolysis-deficient mutants such as K1250A, the bursting time estimated with different methods in different reports can differ by ϳ100-fold. Login to comment
718 (237) reported a locked open-time constant of ϳ2-3 min for K1250A-CFTR. Login to comment
777 For example, the hydrolysis-deficient mutant K1250A-CFTR, once opened by ATP, stays open for minutes (but cf. Refs. 42, 251). Login to comment

[hide] State-dependent modulation of CFTR gating by pyrop... J Gen Physiol. 2009 Apr;133(4):405-19. Tsai MF, Shimizu H, Sohma Y, Li M, Hwang TC
State-dependent modulation of CFTR gating by pyrophosphate.
J Gen Physiol. 2009 Apr;133(4):405-19., [PMID:19332621]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is an adenosine triphosphate (ATP)-gated chloride channel. ATP-induced dimerization of CFTR's two nucleotide-binding domains (NBDs) has been shown to reflect the channel open state, whereas hydrolysis of ATP is associated with channel closure. Pyrophosphate (PPi), like nonhydrolytic ATP analogues, is known to lock open the CFTR channel for tens of seconds when applied with ATP. Here, we demonstrate that PPi by itself opens the CFTR channel in a Mg(2+)-dependent manner long after ATP is removed from the cytoplasmic side of excised membrane patches. However, the short-lived open state (tau approximately 1.5 s) induced by MgPPi suggests that MgPPi alone does not support a stable NBD dimer configuration. Surprisingly, MgPPi elicits long-lasting opening events (tau approximately 30 s) when administrated shortly after the closure of ATP-opened channels. These results indicate the presence of two different closed states (C(1) and C(2)) upon channel closure and a state-dependent effect of MgPPi on CFTR gating. The relative amount of channels entering MgPPi-induced long-open bursts during the ATP washout phase decreases over time, indicating a time-dependent dissipation of the closed state (C(2)) that can be locked open by MgPPi. The stability of the C(2) state is enhanced when the channel is initially opened by N(6)-phenylethyl-ATP, a high affinity ATP analogue, but attenuated by W401G mutation, which likely weakens ATP binding to NBD1, suggesting that an ATP molecule remains bound to the NBD1 site in the C(2) state. Taking advantage of the slow opening rate of Y1219G-CFTR, we are able to identify a C(2)-equivalent state (C(2)*), which exists before the channel in the C(1) state is opened by ATP. This closed state responds to MgPPi much more inefficiently than the C(2) state. Finally, we show that MgAMP-PNP exerts its effects on CFTR gating via a similar mechanism as MgPPi. The structural and functional significance of our findings is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 The idea that ATP hydrolysis precedes channel closing is further supported by the observations that CFTR mutations whose ATPase activity is abrogated (e.g., K1250A and E1371S) (Ramjeesingh et al., 1999) can remain open for minutes (Gunderson and Kopito, 1995; Zeltwanger et al., 1999; Vergani et al., 2003; Bompadre et al., 2005b), and that channel closure is markedly delayed in the presence of nonhydrolyzable ATP analogue AMP-PNP (Hwang et al., 1994), or of inorganic phosphate analogue orthovanadate, which presumably forms a stable complex with the hydrolytic product ADP (Baukrowitz et al., 1994). Login to comment

[hide] Direct sensing of intracellular pH by the cystic f... J Biol Chem. 2009 Dec 18;284(51):35495-506. Epub . Chen JH, Cai Z, Sheppard DN
Direct sensing of intracellular pH by the cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel.
J Biol Chem. 2009 Dec 18;284(51):35495-506. Epub ., 2009-12-18 [PMID:19837660]

Abstract [show]
In cystic fibrosis (CF), dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel disrupts epithelial ion transport and perturbs the regulation of intracellular pH (pH(i)). CFTR modulates pH(i) through its role as an ion channel and by regulating transport proteins. However, it is unknown how CFTR senses pH(i). Here, we investigate the direct effects of pH(i) on recombinant CFTR using excised membrane patches. By altering channel gating, acidic pH(i) increased the open probability (P(o)) of wild-type CFTR, whereas alkaline pH(i) decreased P(o) and inhibited Cl(-) flow through the channel. Acidic pH(i) potentiated the MgATP dependence of wild-type CFTR by increasing MgATP affinity and enhancing channel activity, whereas alkaline pH(i) inhibited the MgATP dependence of wild-type CFTR by decreasing channel activity. Because these data suggest that pH(i) modulates the interaction of MgATP with the nucleotide-binding domains (NBDs) of CFTR, we examined the pH(i) dependence of site-directed mutations in the two ATP-binding sites of CFTR that are located at the NBD1:NBD2 dimer interface (site 1: K464A-, D572N-, and G1349D-CFTR; site 2: G551D-, K1250M-, and D1370N-CFTR). Site 2 mutants, but not site 1 mutants, perturbed both potentiation by acidic pH(i) and inhibition by alkaline pH(i), suggesting that site 2 is a critical determinant of the pH(i) sensitivity of CFTR. The effects of pH(i) also suggest that site 2 might employ substrate-assisted catalysis to ensure that ATP hydrolysis follows NBD dimerization. We conclude that the CFTR Cl(-) channel senses directly pH(i). The direct regulation of CFTR by pH(i) has important implications for the regulation of epithelial ion transport.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
300 Accordingly, the Walker A lysine mutant K1250A-CFTR is an ATP-dependent channel with moderate Po (16), whereas the LSGGQ motif mutant G551D-CFTR is an ATP-independent channel with extremely low Po (14, 33). Login to comment

[hide] Strict coupling between CFTR's catalytic cycle and... Proc Natl Acad Sci U S A. 2010 Jan 19;107(3):1241-6. Epub 2009 Dec 4. Csanady L, Vergani P, Gadsby DC
Strict coupling between CFTR's catalytic cycle and gating of its Cl- ion pore revealed by distributions of open channel burst durations.
Proc Natl Acad Sci U S A. 2010 Jan 19;107(3):1241-6. Epub 2009 Dec 4., 2010-01-19 [PMID:19966305]

Abstract [show]
CFTR, the ABC protein defective in cystic fibrosis, functions as an anion channel. Once phosphorylated by protein kinase A, a CFTR channel is opened and closed by events at its two cytosolic nucleotide binding domains (NBDs). Formation of a head-to-tail NBD1/NBD2 heterodimer, by ATP binding in two interfacial composite sites between conserved Walker A and B motifs of one NBD and the ABC-specific signature sequence of the other, has been proposed to trigger channel opening. ATP hydrolysis at the only catalytically competent interfacial site is suggested to then destabilize the NBD dimer and prompt channel closure. But this gating mechanism, and how tightly CFTR channel opening and closing are coupled to its catalytic cycle, remains controversial. Here we determine the distributions of open burst durations of individual CFTR channels, and use maximum likelihood to evaluate fits to equilibrium and nonequilibrium mechanisms and estimate the rate constants that govern channel closure. We examine partially and fully phosphorylated wild-type CFTR channels, and two mutant CFTR channels, each bearing a deleterious mutation in one or other composite ATP binding site. We show that the wild-type CFTR channel gating cycle is essentially irreversible and tightly coupled to the ATPase cycle, and that this coupling is completely destroyed by the NBD2 Walker B mutation D1370N but only partially disrupted by the NBD1 Walker A mutation K464A.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 As a three-parameter fit of scheme 2 to the data in Fig. 1B (and also Fig. 3) did not provide a reliable estimate of this small rate (SI Text), to estimate k-1 we measured the macroscopic closing rates of prephosphorylated K1250A, K1250R, and E1371S mutant channels (e.g., Fig. 2A) upon sudden removal of ATP. Login to comment
79 These rates, obtained as the reciprocals of the time constants of fitted single exponentials (e.g., Fig. 2A, blue line), were 0.044 ± 0.004 s-1 (n = 9) for K1250A (Fig. 2C, blue bar), 0.22 ± 0.01 s-1 (n = 17) for K1250R, and 0.036 ± 0.002 s-1 (n = 16) for E1371S. Login to comment
87 For instance, closure of the catalytically incompetent NBD2 Walker A mutant K1250A is accelerated ~10-fold in the double-mutant K464A/K1250A, as reported by the rate of macroscopic current decay upon ATP removal (Fig. 2B; red line is a single-exponential fit; Fig. 2C, red bar). Login to comment
98 (A and B) Macroscopic currents of prephosphorylated K1250A (A) and K464A/K1250A (B) CFTR channels were activated by application of 10 mM ATP. Login to comment
100 (C) Mean (±SEM) closing rates estimated as the inverses of the current relaxation time constants (τrelax), for K1250A (blue) and K464A/K1250A (red). Login to comment

[hide] The cystic fibrosis-causing mutation deltaF508 aff... J Biol Chem. 2010 Nov 12;285(46):35825-35. Epub 2010 Jul 28. Thibodeau PH, Richardson JM 3rd, Wang W, Millen L, Watson J, Mendoza JL, Du K, Fischman S, Senderowitz H, Lukacs GL, Kirk K, Thomas PJ
The cystic fibrosis-causing mutation deltaF508 affects multiple steps in cystic fibrosis transmembrane conductance regulator biogenesis.
J Biol Chem. 2010 Nov 12;285(46):35825-35. Epub 2010 Jul 28., 2010-11-12 [PMID:20667826]

Abstract [show]
The deletion of phenylalanine 508 in the first nucleotide binding domain of the cystic fibrosis transmembrane conductance regulator is directly associated with >90% of cystic fibrosis cases. This mutant protein fails to traffic out of the endoplasmic reticulum and is subsequently degraded by the proteasome. The effects of this mutation may be partially reversed by the application of exogenous osmolytes, expression at low temperature, and the introduction of second site suppressor mutations. However, the specific steps of folding and assembly of full-length cystic fibrosis transmembrane conductance regulator (CFTR) directly altered by the disease-causing mutation are unclear. To elucidate the effects of the DeltaF508 mutation, on various steps in CFTR folding, a series of misfolding and suppressor mutations in the nucleotide binding and transmembrane domains were evaluated for effects on the folding and maturation of the protein. The results indicate that the isolated NBD1 responds to both the DeltaF508 mutation and intradomain suppressors of this mutation. In addition, identification of a novel second site suppressor of the defect within the second transmembrane domain suggests that DeltaF508 also effects interdomain interactions critical for later steps in the biosynthesis of CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
200 Mutations of the Walker A lysine (K464A and K1250A in NBD1 and NBD2, respectively) have been shown to dramatically decrease ATP affinity (40). Login to comment
205 Similarly, the introduction of the K1250A mutation had minimal effects on the maturation of wild type CFTR and failed to rescue the ⌬F508 CFTR protein. Login to comment
281 Mutation of the equivalent position in NBD2, K1250A, has minimal effect on CFTR maturation. Login to comment
329 As well, disruption of the composite ATP-binding site in NBD2 by the K1250A mutant had no discernible effect on CFTR maturation. Login to comment

[hide] Involvement of F1296 and N1303 of CFTR in induced-... J Gen Physiol. 2010 Oct;136(4):407-23. Szollosi A, Vergani P, Csanady L
Involvement of F1296 and N1303 of CFTR in induced-fit conformational change in response to ATP binding at NBD2.
J Gen Physiol. 2010 Oct;136(4):407-23., [PMID:20876359]

Abstract [show]
The chloride ion channel cystic fibrosis transmembrane conductance regulator (CFTR) displays a typical adenosine trisphosphate (ATP)-binding cassette (ABC) protein architecture comprising two transmembrane domains, two intracellular nucleotide-binding domains (NBDs), and a unique intracellular regulatory domain. Once phosphorylated in the regulatory domain, CFTR channels can open and close when supplied with cytosolic ATP. Despite the general agreement that formation of a head-to-tail NBD dimer drives the opening of the chloride ion pore, little is known about how ATP binding to individual NBDs promotes subsequent formation of this stable dimer. Structural studies on isolated NBDs suggest that ATP binding induces an intra-domain conformational change termed "induced fit," which is required for subsequent dimerization. We investigated the allosteric interaction between three residues within NBD2 of CFTR, F1296, N1303, and R1358, because statistical coupling analysis suggests coevolution of these positions, and because in crystal structures of ABC domains, interactions between these positions appear to be modulated by ATP binding. We expressed wild-type as well as F1296S, N1303Q, and R1358A mutant CFTR in Xenopus oocytes and studied these channels using macroscopic inside-out patch recordings. Thermodynamic mutant cycles were built on several kinetic parameters that characterize individual steps in the gating cycle, such as apparent affinities for ATP, open probabilities in the absence of ATP, open probabilities in saturating ATP in a mutant background (K1250R), which precludes ATP hydrolysis, as well as the rates of nonhydrolytic closure. Our results suggest state-dependent changes in coupling between two of the three positions (1296 and 1303) and are consistent with a model that assumes a toggle switch-like interaction pattern during the intra-NBD2 induced fit in response to ATP binding. Stabilizing interactions of F1296 and N1303 present before ATP binding are replaced by a single F1296-N1303 contact in ATP-bound states, with similar interaction partner toggling occurring during the much rarer ATP-independent spontaneous openings.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
242 Although for WT CFTR and for the nonhydrolytic mutant D1370N these two parameters are in rough agreement (Csanády et al., 2010), such comparisons have not yet been done for several other NBD2mutantsdefectiveinATPhydrolysis(e.g.,K1250R, K1250A, E1371S, and E1371Q). Login to comment

[hide] Electrophysiological, biochemical, and bioinformat... Methods Mol Biol. 2011;741:443-69. Csanady L, Vergani P, Gulyas-Kovacs A, Gadsby DC
Electrophysiological, biochemical, and bioinformatic methods for studying CFTR channel gating and its regulation.
Methods Mol Biol. 2011;741:443-69., [PMID:21594801]

Abstract [show]
CFTR is the only member of the ABC (ATP-binding cassette) protein superfamily known to function as an ion channel. Most other ABC proteins are ATP-driven transporters, in which a cycle of ATP binding and hydrolysis, at intracellular nucleotide binding domains (NBDs), powers uphill substrate translocation across the membrane. In CFTR, this same ATP-driven cycle opens and closes a transmembrane pore through which chloride ions flow rapidly down their electrochemical gradient. Detailed analysis of the pattern of gating of CFTR channels thus offers the opportunity to learn about mechanisms of function not only of CFTR channels but also of their ABC transporter ancestors. In addition, CFTR channel gating is subject to complex regulation by kinase-mediated phosphorylation at multiple consensus sites in a cytoplasmic regulatory domain that is unique to CFTR. Here we offer a practical guide to extract useful information about the mechanisms that control opening and closing of CFTR channels: on how to plan (including information obtained from analysis of multiple sequence alignments), carry out, and analyze electrophysiological and biochemical experiments, as well as on how to circumvent potential pitfalls.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
187 This technique for estimating mean burst duration has been preferentially used for catalytic site mutants which abolish ATP hydrolysis at the composite NBD2 site (e.g., K1250A), or when non-hydrolyzable ATP analogs (e.g., AMP-PNP and pyrophosphate) are applied, because in either case burst durations are prolonged to several seconds or tens of seconds. Login to comment

[hide] Pharmacological therapy for cystic fibrosis: from ... J Cyst Fibros. 2011 Jun;10 Suppl 2:S129-45. Becq F, Mall MA, Sheppard DN, Conese M, Zegarra-Moran O
Pharmacological therapy for cystic fibrosis: from bench to bedside.
J Cyst Fibros. 2011 Jun;10 Suppl 2:S129-45., [PMID:21658632]

Abstract [show]
With knowledge of the molecular behaviour of the cystic fibrosis transmembrane conductance regulator (CFTR), its physiological role and dysfunction in cystic fibrosis (CF), therapeutic strategies are now being developed that target the root cause of CF rather than disease symptoms. Here, we review progress towards the development of rational new therapies for CF. We highlight the discovery of small molecules that rescue the cell surface expression and defective channel gating of CF mutants, termed CFTR correctors and CFTR potentiators, respectively. We draw attention to alternative approaches to restore epithelial ion transport to CF epithelia, including inhibitors of the epithelial Na(+) channel (ENaC) and activators of the Ca(2+)-activated Cl(-) channel TMEM16A. The expertise required to translate small molecules identified in the laboratory to drugs for CF patients depends on our ability to coordinate drug development at an international level and our ability to provide pertinent biological information using suitable disease models.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
216 [121] NIH3T3 cells F508del, K1250A Electrophysiology Genistein and benzimidazolones shared the same mechanism of action. Login to comment

[hide] Control of CFTR channel gating by phosphorylation ... Physiol Rev. 1999 Jan;79(1 Suppl):S77-S107. Gadsby DC, Nairn AC
Control of CFTR channel gating by phosphorylation and nucleotide hydrolysis.
Physiol Rev. 1999 Jan;79(1 Suppl):S77-S107., [PMID:9922377]

Abstract [show]
Control of CTFR Channel Gating by Phosphorylation and Nucleotide Hydrolysis. Physiol. Rev. 79, Suppl.: S77-S107, 1999. - The cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel is the protein product of the gene defective in cystic fibrosis, the most common lethal genetic disease among Caucasians. Unlike any other known ion channel, CFTR belongs to the ATP-binding cassette superfamily of transporters and, like all other family members, CFTR includes two cytoplasmic nucleotide-binding domains (NBDs), both of which bind and hydrolyze ATP. It appears that in a single open-close gating cycle, an individual CFTR channel hydrolyzes one ATP molecule at the NH2-terminal NBD to open the channel, and then binds and hydrolyzes a second ATP molecule at the COOH-terminal NBD to close the channel. This complex coordinated behavior of the two NBDs is orchestrated by multiple protein kinase A-dependent phosphorylation events, at least some of which occur within the third large cytoplasmic domain, called the regulatory domain. Two or more kinds of protein phosphatases selectively dephosphorylate distinct sites. Under appropriately controlled conditions of progressive phosphorylation or dephosphorylation, three functionally different phosphoforms of a single CFTR channel can be distinguished on the basis of channel opening and closing kinetics. Recording single CFTR channel currents affords an unprecedented opportunity to reproducibly examine, and manipulate, individual ATP hydrolysis cycles in a single molecule, in its natural environment, in real time.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
567 K1250A CFTR channels bearing a mutation at the the functional analogy between CFTR`s NBDs and G proteins (discussed in sect. IVD2) could be resurrected andWalker A Lys of NBD2, expected to impair ATP hydrolysis there, have been reported to display slowed opening as reconciled with the new structural evidence. Login to comment
569 The overall result the information presently available, so they must await new experimental reults.is that Po of K1250A CFTR is reduced to about one-half that of wild-type CFTR channels (25, 159) and that the ATPase rate is even more markedly diminished (159). Login to comment
570 Sub- VI. CONCLUDING REMARKSstantially reduced ATPase activity of K1250A CFTR would be expected from the loss of ATP hydrolysis associated with wild-type CFTR channel closing, a loss inferred from The correlation between genotype and phenotype in terms of CF disease remains perplexingly elusive. Login to comment
571 But,detailed electrophysiological analysis of single K1250A channel records (75). Login to comment
572 If K1250A channels eventually close although in two-thirds of CF patients the disease stems from the same mutation in one chromosome 7 copy (caus-following dissociation, rather than hydrolysis, of the ATP at NBD2, the latter might reasonably be expected to tem- ing deletion of Phe-508), other influences of nature and nurture probably make it unrealistic to expect the sameporarily adopt a conformation different from that attained after hydrolysis. Login to comment

[hide] Walker mutations reveal loose relationship between... Biochemistry. 1999 Feb 2;38(5):1463-8. Ramjeesingh M, Li C, Garami E, Huan LJ, Galley K, Wang Y, Bear CE
Walker mutations reveal loose relationship between catalytic and channel-gating activities of purified CFTR (cystic fibrosis transmembrane conductance regulator).
Biochemistry. 1999 Feb 2;38(5):1463-8., 1999-02-02 [PMID:9931011]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) functions as an ATPase and as a chloride channel. It has been hypothesized, on the basis of electrophysiological findings, that the catalytic activity of CFTR is tightly coupled to the opening and closing of the channel gate. In the present study, to determine the structural basis for the ATPase activity of CFTR, we assessed the effect of mutations within the "Walker A" consensus motifs on ATP hydrolysis by the purified, intact protein. Mutation of the lysine residue in the "Walker A" motif of either the first nucleotide binding fold (CFTRK464A) or the second nucleotide binding fold (CFTRK1250A) inhibited the ATPase activity of the purified intact CFTR protein significantly, by greater than 50%. This finding suggests that the two nucleotide binding folds of CFTR are functioning cooperatively in catalysis. However, the rate of channel gating was only significantly inhibited in one of these purified mutants, CFTRK1250A, suggesting that ATPase activity may not be tightly coupled to channel gating as previously hypothesized.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 While it was determined that the K464A mutation abrogated ATPase activity of the CFTR-NBF1 fusion protein (15), the effect of the K1250A mutation in the context of the CFTR-NBF2 fusion protein is not known. Login to comment
32 A small cassette containing the specific mutation, i.e., a BspE1/SphI fragment for the K464A mutation or a Pm1I/Tth111I fragment for the K1250A mutation was subcloned into a new pBQ6.2 and then sequenced to confirm the introduction of the mutations. Login to comment
33 Ultimately, K464A (as an XbaI/SphI fragment) or K1250A (as a Pm1I/Tth111I fragment) was subcloned into pBlueBac4 (Invitrogen, Carlsbad, CA) for baculovirus expression. Login to comment
123 Disruption of the Chloride Channel ActiVity of the Intact Purified CFTR Protein by Mutation of the Walker A Lysine in either NBF1 or NBF2. We assessed the consequences of each of the Walker lysine mutations, K464A and K1250A, on the chloride channel activity of CFTR using two assays. Login to comment
166 The double mutant, CFTRK464A/K1250A, also exhibits negligible catalytic activity, comparable to that of CFTRK1250A (data not shown), supporting our suggestion that the two Walker sites are not symmetrical. Login to comment

[hide] Mutations in either nucleotide-binding site of P-g... Biochemistry. 1998 Mar 31;37(13):4592-602. Urbatsch IL, Beaudet L, Carrier I, Gros P
Mutations in either nucleotide-binding site of P-glycoprotein (Mdr3) prevent vanadate trapping of nucleotide at both sites.
Biochemistry. 1998 Mar 31;37(13):4592-602., 1998-03-31 [PMID:9521779]

Abstract [show]
Vanadate trapping of nucleotide and site-directed mutagenesis were used to investigate the role of the two nucleotide-binding (NB) sites in the regulation of ATP hydrolysis by P-glycoprotein (mouse Mdr3). Mdr3, tagged with a hexahistidine tail, was overexpressed in the yeast Pichia pastoris and purified to about 90% homogeneity by Ni-affinity chromatography. This protocol yielded purified, reconstituted Mdr3 which exhibited high verapamil stimulation of ATPase activity with a Vmax of 4.2 micromol min-1 mg-1 and a KM of 0.7 mM, suggesting that Mdr3 purified from P. pastoris is highly functional. Point mutations were introduced into the core consensus sequence of the Walker A or B motifs in each of the two NB sites. The mutants K429R, K1072R (Walker A) and D551N, D1196N (Walker B) were functionally impaired and unable to confer cellular resistance to the fungicide FK506 in the yeast Saccharomyces cerevisiae. Single and double mutants (K429R/K1072R, D551N/D1196N) were expressed in P. pastoris, and the effect of these mutations on the ATPase activity of Mdr3 was characterized. Purified reconstituted Mdr3 mutants showed no detectable ATPase activity compared to proteoliposomes purified from negative controls (<5% of wild-type Mdr3). Vanadate readily induced trapping of 8-azido-nucleotide in the wild-type enzyme after a short 10 s incubation, and specific photolabeling of Mdr3 after UV irradiation. No such vanadate-induced trapping/photolabeling was observed in any of the mutants, even after a 60 min trapping period at 37 degrees C. Since vanadate trapping with 8-azido-ATP requires hydrolysis of the nucleotide, the data suggest that 8-azido-ATP hydrolysis is dramatically impaired in all of the mutant proteins (<0.3% activity). These results show that mutations in either NB site prevent single turnover and vanadate trapping of nucleotide in the nonmutant site. These results further suggest that the two NB sites cannot function independently as catalytic sites in the intact molecule. In addition, the N- or C-terminal NB sites appear functionally indistinguishable, and cooperative interactions absolutely required for ATP hydrolysis may originate from both sites.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
254 In the cystic fibrosis transmembrane conductance regulator (CFTR), mutations of the conserved Walker A lysine altered the conductive properties of the Cl- channel: the K464A mutation in NB1 decreased the frequency of channel openings, whereas K1250A or K1250M in NB2 prolonged the open state of the channel (59). Login to comment

[hide] Nonintegral stoichiometry in CFTR gating revealed ... J Gen Physiol. 2012 Oct;140(4):347-59. Epub 2012 Sep 10. Jih KY, Sohma Y, Hwang TC
Nonintegral stoichiometry in CFTR gating revealed by a pore-lining mutation.
J Gen Physiol. 2012 Oct;140(4):347-59. Epub 2012 Sep 10., [PMID:22966014]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is a unique member of the ATP-binding cassette (ABC) protein superfamily. Unlike most other ABC proteins that function as active transporters, CFTR is an ATP-gated chloride channel. The opening of CFTR's gate is associated with ATP-induced dimerization of its two nucleotide-binding domains (NBD1 and NBD2), whereas gate closure is facilitated by ATP hydrolysis-triggered partial separation of the NBDs. This generally held theme of CFTR gating-a strict coupling between the ATP hydrolysis cycle and the gating cycle-is put to the test by our recent finding of a short-lived, post-hydrolytic state that can bind ATP and reenter the ATP-induced original open state. We accidentally found a mutant CFTR channel that exhibits two distinct open conductance states, the smaller O1 state and the larger O2 state. In the presence of ATP, the transition between the two states follows a preferred O1-->O2 order, a telltale sign of a violation of microscopic reversibility, hence demanding an external energy input likely from ATP hydrolysis, as such preferred gating transition was abolished in a hydrolysis-deficient mutant. Interestingly, we also observed a considerable amount of opening events that contain more than one O1-->O2 transition, indicating that more than one ATP molecule may be hydrolyzed within an opening burst. We thus conclude a nonintegral stoichiometry between the gating cycle and ATP consumption. Our results lead to a six-state gating model conforming to the classical allosteric mechanism: both NBDs and transmembrane domains hold a certain degree of autonomy, whereas the conformational change in one domain will facilitate the conformational change in the other domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 For example, the drastic effect of nonhydrolyzable ATP analogues or mutations (e.g., E1371S or K1250A) that abolish ATP hydrolysis on the open time supports the notion that ATP hydrolysis is coupled to channel Figure 1. An updated model illustrating the relationship between an opening/closing cycle of the gate and ATP consumption in CFTR` s NBDs. Login to comment
43 For example, the drastic effect of nonhydrolyzable ATP analogues or mutations (e.g., E1371S or K1250A) that abolish ATP hydrolysis on the open time supports the notion that ATP hydrolysis is coupled to channel Figure 1.ߓ An updated model illustrating the relationship between an opening/closing cycle of the gate and ATP consumption in CFTR` s NBDs. Login to comment

[hide] CFTR: An ion channel with a transporter-type energ... J Gen Physiol. 2012 Oct;140(4):343-5. Epub 2012 Sep 10. Tsai MF
CFTR: An ion channel with a transporter-type energy-coupling mechanism.
J Gen Physiol. 2012 Oct;140(4):343-5. Epub 2012 Sep 10., [PMID:22966013]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Indeed, unlike ABC transporters, which absolutely require ATPase activity to move substrates, CFTR mutants incapable of catalyzing ATP hydrolysis (e.g., K1250A, D13710N, and E1371Q) exhibit gating transitions with open probabilities comparable to WT (Powe et al., 2002; Vergani et al., 2003). Login to comment
51 Indeed, unlike ABC transporters, which absolutely require ATPase activity to move substrates, CFTR mutants incapable of catalyzing ATP hydrolysis (e.g., K1250A, D13710N, and E1371Q) exhibit gating transitions with open probabilities comparable to WT (Powe et al., 2002; Vergani et al., 2003). Login to comment

[hide] Demonstration of Phosphoryl Group Transfer Indicat... J Biol Chem. 2012 Oct 19;287(43):36105-10. doi: 10.1074/jbc.M112.408450. Epub 2012 Sep 4. Randak CO, Ver Heul AR, Welsh MJ
Demonstration of Phosphoryl Group Transfer Indicates That the ATP-binding Cassette (ABC) Transporter Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Exhibits Adenylate Kinase Activity.
J Biol Chem. 2012 Oct 19;287(43):36105-10. doi: 10.1074/jbc.M112.408450. Epub 2012 Sep 4., [PMID:22948143]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is a membrane-spanning adenosine 5'-triphosphate (ATP)-binding cassette (ABC) transporter. ABC transporters and other nuclear and cytoplasmic ABC proteins have ATPase activity that is coupled to their biological function. Recent studies with CFTR and two nonmembrane-bound ABC proteins, the DNA repair enzyme Rad50 and a structural maintenance of chromosome (SMC) protein, challenge the model that the function of all ABC proteins depends solely on their associated ATPase activity. Patch clamp studies indicated that in the presence of physiologically relevant concentrations of adenosine 5'-monophosphate (AMP), CFTR Cl(-) channel function is coupled to adenylate kinase activity (ATP+AMP &lrarr2; 2 ADP). Work with Rad50 and SMC showed that these enzymes catalyze both ATPase and adenylate kinase reactions. However, despite the supportive electrophysiological results with CFTR, there are no biochemical data demonstrating intrinsic adenylate kinase activity of a membrane-bound ABC transporter. We developed a biochemical assay for adenylate kinase activity, in which the radioactive gamma-phosphate of a nucleotide triphosphate could transfer to a photoactivatable AMP analog. UV irradiation could then trap the (32)P on the adenylate kinase. With this assay, we discovered phosphoryl group transfer that labeled CFTR, thereby demonstrating its adenylate kinase activity. Our results also suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for adenylate kinase activity. These biochemical data complement earlier biophysical studies of CFTR and indicate that the ABC transporter CFTR can function as an adenylate kinase.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
183 2) Patch clamp studies showed that mutations K1250A and D1370N, located within conserved motifs of ATP-binding site 2, abolished the effects of Ap5A and AMP on CFTR current. Login to comment

[hide] Thermal instability of DeltaF508 cystic fibrosis t... Biochemistry. 2012 Jun 26;51(25):5113-24. Epub 2012 Jun 15. Liu X, O'Donnell N, Landstrom A, Skach WR, Dawson DC
Thermal instability of DeltaF508 cystic fibrosis transmembrane conductance regulator (CFTR) channel function: protection by single suppressor mutations and inhibiting channel activity.
Biochemistry. 2012 Jun 26;51(25):5113-24. Epub 2012 Jun 15., [PMID:22680785]

Abstract [show]
Deletion of Phe508 from cystic fibrosis transmembrane conductance regulator (CFTR) results in a temperature-sensitive folding defect that impairs protein maturation and chloride channel function. Both of these adverse effects, however, can be mitigated to varying extents by second-site suppressor mutations. To better understand the impact of second-site mutations on channel function, we compared the thermal sensitivity of CFTR channels in Xenopus oocytes. CFTR-mediated conductance of oocytes expressing wt or DeltaF508 CFTR was stable at 22 degrees C and increased at 28 degrees C, a temperature permissive for DeltaF508 CFTR expression in mammalian cells. At 37 degrees C, however, CFTR-mediated conductance was further enhanced, whereas that due to DeltaF508 CFTR channels decreased rapidly toward background, a phenomenon referred to here as "thermal inactivation." Thermal inactivation of DeltaF508 was mitigated by each of five suppressor mutations, I539T, R553M, G550E, R555K, and R1070W, but each exerted unique effects on the severity of, and recovery from, thermal inactivation. Another mutation, K1250A, known to increase open probability (P(o)) of DeltaF508 CFTR channels, exacerbated thermal inactivation. Application of potentiators known to increase P(o) of DeltaF508 CFTR channels at room temperature failed to protect channels from inactivation at 37 degrees C and one, PG-01, actually exacerbated thermal inactivation. Unstimulated DeltaF508CFTR channels or those inhibited by CFTR(inh)-172 were partially protected from thermal inactivation, suggesting a possible inverse relationship between thermal stability and gating transitions. Thermal stability of channel function and temperature-sensitive maturation of the mutant protein appear to reflect related, but distinct facets of the DeltaF508 CFTR conformational defect, both of which must be addressed by effective therapeutic modalities.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Another mutation, K1250A, known to increase open probability (Po) of ΔF508 CFTR channels, exacerbated thermal inactivation. Login to comment
179 K1250A/ΔF508/CFTR Channels Inactivate More Rapidly at 37 °C. Login to comment
180 The Po of ΔF508 CFTR channels can be enhanced by substitutions for the "Walker lysine" in NBD2 (K1250) which slow the hydrolysis of ATP at composite site 2 of the NBD1/NBD2 dimer47 such that channels exhibit prolonged open times at room temperature.47 The results depicted in Figure 9 show that channel function of the double mutant (K1250A/ΔF508 CFTR) is even less stable than ΔF508 CFTR as judged by the increased rate of thermal inactivation. Login to comment
202 K1250A accelerated thermal inactivation of ΔF508 CFTR. Login to comment
203 (A) After stimulation, an oocyte expressing ΔF508 CFTR (gray bar and circles) or K1250A/ΔF508 CFTR (gray bar and downward triangles) was warmed to 37 °C for 10 min and then the bath was cooled to 22 °C. Login to comment
204 (B) Summary of the half-time of thermal inactivation of K1250A/ΔF508 and ΔF508 CFTR. Login to comment
274 Likewise, two experimental maneuvers that increased channel open probability, a second site mutation in NBD2 (K1250A) and a CFTR potentiator (P2), actually exacerbated thermal inactivation, although two other potentiators (P1 and Genistein) did not. Login to comment

[hide] Identification of a novel post-hydrolytic state in... J Gen Physiol. 2012 May;139(5):359-70. doi: 10.1085/jgp.201210789. Epub 2012 Apr 16. Jih KY, Sohma Y, Li M, Hwang TC
Identification of a novel post-hydrolytic state in CFTR gating.
J Gen Physiol. 2012 May;139(5):359-70. doi: 10.1085/jgp.201210789. Epub 2012 Apr 16., [PMID:22508846]

Abstract [show]
Adenosine triphosphate (ATP)-binding cassette (ABC) transporters, ubiquitous proteins found in all kingdoms of life, catalyze substrates translocation across biological membranes using the free energy of ATP hydrolysis. Cystic fibrosis transmembrane conductance regulator (CFTR) is a unique member of this superfamily in that it functions as an ATP-gated chloride channel. Despite difference in function, recent studies suggest that the CFTR chloride channel and the exporter members of the ABC protein family may share an evolutionary origin. Although ABC exporters harness the free energy of ATP hydrolysis to fuel a transport cycle, for CFTR, ATP-induced dimerization of its nucleotide-binding domains (NBDs) and subsequent hydrolysis-triggered dimer separation are proposed to be coupled, respectively, to the opening and closing of the gate in its transmembrane domains. In this study, by using nonhydrolyzable ATP analogues, such as pyrophosphate or adenylyl-imidodiphosphate as baits, we captured a short-lived state (state X), which distinguishes itself from the previously identified long-lived C2 closed state by its fast response to these nonhydrolyzable ligands. As state X is caught during the decay phase of channel closing upon washout of the ligand ATP but before the channel sojourns to the C2 closed state, it likely emerges after the bound ATP in the catalysis-competent site has been hydrolyzed and the hydrolytic products have been released. Thus, this newly identified post-hydrolytic state may share a similar conformation of NBDs as the C2 closed state (i.e., a partially separated NBD and a vacated ATP-binding pocket). The significance of this novel state in understanding the structural basis of CFTR gating is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
217 These flickering closings have been long thought to be ATP independent, as they can be easily discerned in a complete absence of ATP within an opening burst of hydrolysis-deficient mutants, such as E1371S or K1250A (Carson et al., 1995; Powe et al., 2002; Bompadre et al., 2005b; Vergani et al., 2005). Login to comment

[hide] ATP hydrolysis-dependent asymmetry of the conforma... J Physiol Sci. 2011 Jul;61(4):267-78. doi: 10.1007/s12576-011-0144-0. Epub 2011 Apr 3. Krasilnikov OV, Sabirov RZ, Okada Y
ATP hydrolysis-dependent asymmetry of the conformation of CFTR channel pore.
J Physiol Sci. 2011 Jul;61(4):267-78. doi: 10.1007/s12576-011-0144-0. Epub 2011 Apr 3., [PMID:21461971]

Abstract [show]
Despite substantial efforts, the entire cystic fibrosis transmembrane conductance regulator (CFTR) protein proved to be difficult for structural analysis at high resolution, and little is still known about the actual dimensions of the anion-transporting pathway of CFTR channel. In the present study, we therefore gauged geometrical features of the CFTR Cl(-) channel pore by a nonelectrolyte exclusion technique. Polyethylene glycols with a hydrodynamic radius (R (h)) smaller than 0.95 nm (PEG 300-1,000) added from the intracellular side greatly suppressed the inward unitary anionic conductance, whereas only molecules with R (h) </= 0.62 nm (PEG 200-400) applied extracellularly were able to affect the outward unitary anionic currents. Larger molecules with R (h) = 1.16-1.84 nm (PEG 1,540-3,400) added from either side were completely excluded from the pore and had no significant effect on the single-channel conductance. The cut-off radius of the inner entrance of CFTR channel pore was assessed to be 1.19 +/- 0.02 nm. The outer entrance was narrower with its cut-off radius of 0.70 +/- 0.16 nm and was dilated to 0.93 +/- 0.23 nm when a non-hydrolyzable ATP analog, 5'-adenylylimidodiphosphate (AMP-PNP), was added to the intracellular solution. Thus, it is concluded that the structure of CFTR channel pore is highly asymmetric with a narrower extracellular entrance and that a dilating conformational change of the extracellular entrance is associated with the channel transition to a non-hydrolytic, locked-open state.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 This locked-open phenotype is also observed when the ATPase activity of NBD2 is abolished by the mutation of K1250A or E1371S [10, 23, 39]. Login to comment
225 An intriguing question as to whether the mutation at the site essential for ATP hydrolysis in NBD2 (such as K1250A and E1371S) causes a similar conformational change remains for future studies. Login to comment

[hide] A mutation in CFTR modifies the effects of the ade... Biophys J. 2008 Dec;95(11):5178-85. Epub 2008 Sep 19. Dong Q, Randak CO, Welsh MJ
A mutation in CFTR modifies the effects of the adenylate kinase inhibitor Ap5A on channel gating.
Biophys J. 2008 Dec;95(11):5178-85. Epub 2008 Sep 19., [PMID:18805924]

Abstract [show]
Mutations in the gene that encodes the cystic fibrosis transmembrane conductance regulator (CFTR) cause cystic fibrosis. The CFTR anion channel is controlled by ATP binding and enzymatic activity at the two nucleotide-binding domains. CFTR exhibits two types of enzymatic activity: 1), ATPase activity in the presence of ATP and 2), adenylate kinase activity in the presence of ATP plus physiologic concentrations of AMP or ADP. Previous work showed that P(1),P(5)-di(adenosine-5')pentaphosphate (Ap(5)A), a specific adenylate kinases inhibitor, inhibited wild-type CFTR. In this study, we report that Ap(5)A increased activity of CFTR with an L1254A mutation. This mutation increased the EC50 for ATP by >10-fold and reduced channel activity by prolonging the closed state. Ap(5)A did not elicit current on its own nor did it alter ATP EC50 or maximal current. However, it changed the relationship between ATP concentration and current. At submaximal ATP concentrations, Ap(5)A stimulated current by stabilizing the channel open state. Whereas previous work indicated that adenylate kinase activity regulated channel opening, our data suggest that Ap(5)A binding may also influence channel closing. These results also suggest that a better understanding of the adenylate kinase activity of CFTR may be of value in developing new therapeutic strategies for cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
171 For example, the K1250A and D1370N mutations also have a reduced opening rate, prolonged burst duration, and increased ATP EC50 (11,12,14,15,29,32,39,43). Login to comment

[hide] Molecular basis for the ATPase activity of CFTR. Arch Biochem Biophys. 2008 Aug 1;476(1):95-100. Epub 2008 Apr 8. Cheung JC, Kim Chiaw P, Pasyk S, Bear CE
Molecular basis for the ATPase activity of CFTR.
Arch Biochem Biophys. 2008 Aug 1;476(1):95-100. Epub 2008 Apr 8., [PMID:18417076]

Abstract [show]
CFTR is a member of the ABC (ATP binding cassette) superfamily of transporters. It is a multidomain membrane protein, which utilizes ATP to regulate the flux of its substrate through the membrane. CFTR is distinct in that it functions as a channel and it possesses a unique regulatory R domain. There has been significant progress in understanding the molecular basis for CFTR activity as an ATPase. The dimeric complex of NBD structures seen in prokaryotic ABC transporters, together with the structure of an isolated CF-NBD1, provide a unifying molecular template to model the structural basis for the ATPase activity of CFTR. The dynamic nature of the interaction between the NBDs and the R domain has been revealed in NMR studies. On the other hand, understanding the mechanisms mediating the transmission of information from the cytosolic domains to the membrane and the channel gate of CFTR remains a central challenge.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
124 For example, mutations of residues in the catalytic site (Site A, Fig. 1) that decrease ATPase activity, such as mutation of the Walker A lysine residue in NBD2 (K1250A) [29] and mutation of the putative catalytic base: E1371Q leads to a decrease in the rate of channel closing [51,52,55]. Login to comment

[hide] Activation of CFTR by UCCF-029 and genistein. Bioorg Med Chem Lett. 2008 Jul 15;18(14):3874-7. Epub 2008 Jun 19. Al-Nakkash L, Springsteel MF, Kurth MJ, Nantz MH
Activation of CFTR by UCCF-029 and genistein.
Bioorg Med Chem Lett. 2008 Jul 15;18(14):3874-7. Epub 2008 Jun 19., [PMID:18595696]

Abstract [show]
The mechanism of action of a novel CFTR activator UC(CF)-029 on NIH3T3 cells stably expressing DeltaF508-CFTR was investigated and its effects compared to those of genistein, a known CFTR activator. This study shows that UC(CF)-029 and genistein have differing efficacies. The efficacy of UC(CF)-029 in the presence of forskolin (10microM) is approximately 50% that of genistein; however, the EC(50)'s for both drugs are comparable; 3.5microM for UC(CF)-029 and 4.4muM for genistein. Using NIH3T3 cells stably transfected with K1250A-CFTR we find that CFTR channel open time is unaffected by UC(CF)-029 or genistein, supporting the hypothesis that these compounds stabilize the open state by inhibiting ATP hydrolysis at NBD2. Our data suggest that the ability of UC(CF)-029 to augment DeltaF508-CFTR channel activity necessitates further interest.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Using NIH3T3 cells stably transfected with K1250A-CFTR we find that CFTR channel open time is unaffected by UCCF-029 or genistein, supporting the hypothesis that these compounds stabilize the open state by inhibiting ATP hydrolysis at NBD2. Login to comment
56 To examine whether UCCF-029 acts to stabilize the channel open state, we determined its effect upon the K1250A-CFTR channel (a CFTR channel mutation that can stay open for minutes once opened).16 A representative recording of K1250A-CFTR in cell-attached patch is shown (Fig. Login to comment
63 In addition, we demonstrate that UCCF-029 is unable to further stimulate the K1250A-CFTR chloride current activated by a maximally effective concentration of forskolin. Login to comment
64 We have previously shown similar results with genistein and benzimidazolone analogs.6 Our earlier data using relaxation analysis demonstrated that these compounds stabilize open state by inhibiting ATP hydrolysis at NBD2.6 K1250A-CFTR, a mutation of the Walker A lysine at NBD2 prolongs channel opening by eliminating ATP hydrolysis at NBD2.19,16 The original work describing UCCF-029 compared its effects to several other novel compounds generated using combinatorial libraries and with genistein,11 using the halide-sensitive yellow fluorescent protein on Wt-CFTR transfected Fischer rat thyroid (FRT) cells. Login to comment
62 In addition, we demonstrate that UCCF-029 is unable to further stimulate the K1250A-CFTR chloride current activated by a maximally effective concentration of forskolin. Login to comment

[hide] The block of CFTR by scorpion venom is state-depen... Biophys J. 2005 Dec;89(6):3960-75. Epub 2005 Sep 23. Fuller MD, Zhang ZR, Cui G, McCarty NA
The block of CFTR by scorpion venom is state-dependent.
Biophys J. 2005 Dec;89(6):3960-75. Epub 2005 Sep 23., [PMID:16183882]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) adenosine triphosphate-dependent chloride channels are expressed in epithelial cells and are associated with a number of genetic disorders, including cystic fibrosis. Venom of the scorpion Leirus quinquestriatus hebraeus reversibly inhibits CFTR when applied to its cytoplasmic surface. To examine the state-dependence of inhibition we recorded wild-type and mutant CFTR channel currents using inside-out membrane patches from Xenopus oocytes. Application of either venom or diphenylamine-2-carboxylate to channels that were either activated (open) or resting (closed) indicate primarily closed state-dependent inhibition of CFTR by venom, whereas diphenylamine-2-carboxylate showed no state-dependence of block. Efficacy of venom-mediated macroscopic current inhibition was inversely related to channel activity. Analysis of single-channel and macropatch data indicated that venom could either inhibit channel opening, if it binds during an interburst closed state or in the absence of cytosolic adenosine triphosphate, or introduce new intraburst closed states, if it binds during an open event. The on-rate of venom binding for intraburst block could be modulated by changing CFTR activity with vanadate or adenylyl-imidodiphosphate, or by introducing the Walker A mutation K1250A. These findings represent the first description of state-dependent inhibition of CFTR and suggest that the active toxin could be used as a tool to study the conformational changes that occur during CFTR gating.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 The on-rate of venom binding for intraburst block could be modulated by changing CFTR activity with vanadate or adenylyl-imidodiphosphate, or by introducing the Walker A mutation K1250A. Login to comment
33 We also found that the potency of venom for intraburst inhibition was reduced in single-channel recordings of WT-CFTR channels with very high open probability or when the venom was applied to K1250A-CFTR channels. Login to comment
41 The mutant K1250A-CFTR construct was prepared with the QuikChange protocol (Stratagene, La Jolla, CA) using oligonucleotide-mediated mutagenesis. Login to comment
163 Mutations in NBD-B, such as K1250A, result in channels that follow the initial WT-CFTR gating steps; however, rates of ATP binding at NBD-B and hydrolysis of that ATP are greatly reduced (boxes). Login to comment
216 K1250A-CFTR channels exhibit a greatly reduced rate of ATP hydrolysis, resulting in channels that are open for tens of seconds; however, K1250A-CFTR channels also exhibit a reduced opening rate such that they remain in the C2 closed state longer than WT-CFTR channels (18). Login to comment
217 Studies were performed with K1250A-CFTR in multichannel patches with 50 U/mL PKA and 1 mM MgATP continuously present. Login to comment
227 However, results from studies with WT-CFTR in macropatch recordings (Fig. 1 C), as well as K1250A-CFTR in recordings of only a few channels (Fig. 4 B), suggested that the venom does not interact with the open state. Login to comment
239 (C) Representative single-channel recording of K1250A-CFTR before and during treatment with 0.1 mg/mL Lqh-pf venom. Login to comment
293 TABLE 1 Lqh-pf venom becomes a more effective blocker at lower CFTR channel activity Condition Venom dose (mg/mL) Control Po With venom Po Fractional inhibition n Wild-type (low Po)* 0.1 0.181 6 0.031 0.118 6 0.018y 31.4 6 6.96y 6 Wild-type (high Po)z 0.1 0.584 6 0.091 0.554 6 0.087 5.08 6 0.19 2 Wild-type (high Po)z 0.2 0.419 6 0.020 0.226 6 0.080 46.7 6 16.4 2 Wild-type 1 VO4 § 0.2 0.569 6 0.158§ 0.391 6 0.121y§ 31.9 6 6.32y§ 3 Wild-type 1 AMP-PNP§ 0.2 0.618 6 0.107§ 0.442 6 0.095y§ 29.5 6 5.22y§ 3 K1250A 0.1 0.772 6 0.079 0.751 6 0.074 2.66 6 0.59 3 Inhibition of CFTR by Lqh-pf venom was determined under several experimental conditions used to control channel-open probability. Login to comment
301 In addition, we also employed the Walker A mutant K1250A-CFTR, which gates open much like WT-CFTR, although the rate of ATP binding to NBD-B is somewhat reduced, whereas hydrolysis of ATP is greatly reduced, resulting in open bursts that are many tens of seconds in duration (Fig. 2, boxes). Login to comment
310 In control conditions, K1250A-CFTR channels remained almost entirely in the open state (Fig. 7 C, top), with few brief closures. Login to comment
312 Treatment of single K1250A-CFTR channels with 0.1 mg/mL Lqh-pf venom resulted in only 2.66 6 0.59% inhibition of channel activity (Po ¼ 0.772 6 0.079 vs. 0.751 6 0.074, n ¼ 3). Login to comment
313 Notably, the durations of the venom-induced intraburst blocked states in K1250A-CFTR and WT-CFTR with ATP 1 AMP-PNP, or WT-CFTR with ATP 1 vanadate, were similar to those observed in WT-CFTR with ATP alone (400-700 ms). Login to comment
315 The results described above suggested that Lqh-pf venom might be less effective at inhibiting K1250A-CFTR channels or WT-CFTR channels locked open by AMP-PNP or vanadate because those channels occupy the FC state less frequently. Login to comment
320 Similar results were seen when WT-CFTR channels were locked open with vanadate (Fig. 8 B) or when K1250A-CFTR channels were activated with MgATP (Fig. 8 C). Login to comment
323 All K1250A-CFTR openings were used. Login to comment
330 (C) Representative trace of K1250A-CFTR with 1 mM MgATP and 50 U/mL PKA continuously present before and during application of 0.1 mg/mL Lqh-pf venom. Login to comment
334 The largest increase in mean open time between intraburst closings was seen in K1250A-CFTR where the channels remained open for an average of 1580.9 6 106.8 ms (n ¼ 3 recordings, n ¼ 3 bursts, n ¼ 177 open duration events; p # 0.001 compared to WT-CFTR) between intraburst closings. Login to comment
340 Additionally, WT-CFTR channels that were locked in the open conformation by vanadate or AMP-PNP, and CFTR channels bearing the K1250A mutation, were inhibited by venom only at higher concentrations. Login to comment
356 (C) Representative trace of K1250A-CFTR from an excised inside-out patch with 1 mM MgATP and 50 U/mL PKA continuously present. Login to comment
357 All recordings at Vm ¼ ÿ100 mV. Note that brief closings, $5 ms in duration, occur less frequently when CFTR channel activity is manipulated by drug (vanadate or AMP-PNP) or mutation (K1250A), compared to WT-CFTR channels that are activated by MgATP and PKA only. Login to comment
358 (D) Effect of vanadate, AMP-PNP or K1250A mutation on the frequency of intraburst closings in records filtered at 500 Hz. Login to comment
379 Furthermore, K1250A-CFTR channels and WT-CFTR channels locked open by AMP-PNP basically never reach the C4 state, and yet do show the lengthening of interburst durations (Fig. 4). Login to comment
391 The effect oninterburst kinetics cannot fully explain the reduced efficacy of inhibition of single K1250A-CFTR channels or single WT-CFTR channels in the presence of AMP-PNP or vanadate. Login to comment
400 This was most apparent in experiments with channels locked open by vanadate, AMP-PNP, or mutation K1250A. Login to comment
424 The previous results could also explain why Lqh-pf venom is significantly less effective when applied to K1250A-CFTR, since the frequency of short intraburst closings in this mutant is much less than that seen with WT-CFTR (Fig. 8 D). Login to comment
439 The K1250A-CFTR results are also consistent with this notion. Login to comment
441 As a result, the NBD-ICD interaction would be stabilized, resulting in a decrease in the frequency of FC intraburst closings during open bursts in K1250A-CFTR, which is what we see in Fig. 8 C. The structural differences that are dependent on the nucleotide species bound at NBD-B could also have a large effect on the on-rate of venom binding during the FC intraburst closings. Login to comment
442 This would explain the decrease in intraburst inhibition of K1250A-CFTR channels and of WT-CFTR channels that are locked open with AMP-PNP or vanadate when a low concentration of the venom was applied (Fig. 7). Login to comment
446 K1250A-CFTR with ATP) (Table 1) is similar to the predicted order shown in Fig. 8 D. Small conformational changes in the NBD dimer are needed to signal for channel opening (9). Login to comment

[hide] The patch-clamp and planar lipid bilayer technique... J Cyst Fibros. 2004 Aug;3 Suppl 2:101-8. Sheppard DN, Gray MA, Gong X, Sohma Y, Kogan I, Benos DJ, Scott-Ward TS, Chen JH, Li H, Cai Z, Gupta J, Li C, Ramjeesingh M, Berdiev BK, Ismailov II, Bear CE, Hwang TC, Linsdell P, Hug MJ
The patch-clamp and planar lipid bilayer techniques: powerful and versatile tools to investigate the CFTR Cl- channel.
J Cyst Fibros. 2004 Aug;3 Suppl 2:101-8., [PMID:15463939]

Abstract [show]
Using the patch-clamp (PC) and planar lipid bilayer (PLB) techniques the molecular behaviour of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel can be visualised in real-time. The PC technique is a highly powerful and versatile method to investigate CFTR's mechanism of action, interaction with other proteins and physiological role. Using the PLB technique, the structure and function of CFTR can be investigated free from the influence of other proteins. Here we discuss how these techniques are employed to investigate the CFTR Cl- channel with special emphasis on its permeation, conduction and gating properties.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
153 To investigate the gating kinetics of the brief flickery closures interrupting channel openings, Zhou et al. [22] used K1250A, a CFTR construct with an elevated Po ( Po f 0.9), and a simple model of channel block: Open X a b Blocked; ð6Þ where a is the apparent on-rate of the blocker and b the off-rate. Login to comment
148 To investigate the gating kinetics of the brief flickery closures interrupting channel openings, Zhou et al. [22] used K1250A, a CFTR construct with an elevated Po ( Po f 0.9), and a simple model of channel block: Open X a b Blocked; &#f0;6&#de; where a is the apparent on-rate of the blocker and b the off-rate. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Biophys J. 1998 Mar;74(3):1320-32. Mansoura MK, Smith SS, Choi AD, Richards NW, Strong TV, Drumm ML, Collins FS, Dawson DC
Cystic fibrosis transmembrane conductance regulator (CFTR) anion binding as a probe of the pore.
Biophys J. 1998 Mar;74(3):1320-32., [PMID:9512029]

Abstract [show]
We compared the effects of mutations in transmembrane segments (TMs) TM1, TM5, and TM6 on the conduction and activation properties of the cystic fibrosis transmembrane conductance regulator (CFTR) to determine which functional property was most sensitive to mutations and, thereby, to develop a criterion for measuring the importance of a particular residue or TM for anion conduction or activation. Anion substitution studies provided strong evidence for the binding of permeant anions in the pore. Anion binding was highly sensitive to point mutations in TM5 and TM6. Permeability ratios, in contrast, were relatively unaffected by the same mutations, so that anion binding emerged as the conduction property most sensitive to structural changes in CFTR. The relative insensitivity of permeability ratios to CFTR mutations was in accord with the notion that anion-water interactions are important determinants of permeability selectivity. By the criterion of anion binding, TM5 and TM6 were judged to be likely to contribute to the structure of the anion-selective pore, whereas TM1 was judged to be less important. Mutations in TM5 and TM6 also dramatically reduced the sensitivity of CFTR to activation by 3-isobutyl 1-methyl xanthine (IBMX), as expected if these TMs are intimately involved in the physical process that opens and closes the channel.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Finally, dose-dependent inhibition of CFTR conductance by [SCN]o (see below) was identical in wtCFTR and a CFTR mutant exhibiting highly altered gating, K1250A (Wilkinson et al., 1996). Login to comment
146 Sensitivity to [SCN]o was identical to wtCFTR in a construct bearing a mutation in NBF2, K1250A (data not shown), which exhibits severely altered activation in the form of a highly stabilized active state (Wilkinson et al., 1996). Login to comment
147 The data in Table 3 show that for wtCFTR and G314Q and G314E, two of the most severely affected constructs, PSCN/PCl calculated from the shift in Vr was independent of the fractional abundance of [SCN]o. Login to comment
98 Finally, dose-dependent inhibition of CFTR conductance by [SCN]o (see below) was identical in wtCFTR and a CFTR mutant exhibiting highly altered gating, K1250A (Wilkinson et al., 1996). Login to comment

[hide] CFTR Cl- channel and CFTR-associated ATP channel: ... EMBO J. 1998 Feb 16;17(4):898-908. Sugita M, Yue Y, Foskett JK
CFTR Cl- channel and CFTR-associated ATP channel: distinct pores regulated by common gates.
EMBO J. 1998 Feb 16;17(4):898-908., [PMID:9463368]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel that is regulated by phosphorylation of the R domain and ATP hydrolysis at two nucleotide-binding domains (NBDs). It is controversial whether CFTR conducts ATP or whether CFTR might be closely associated with a separate ATP conductance. To characterize ATP channels associated with CFTR, we analyzed Cl- and ATP single channel-currents in excised inside-out membrane patches from MDCK epithelial cells transiently expressing CFTR. With 100 mM ATP in the pipette and 140 mM Cl- in the bath, ATP channels were associated with CFTR Cl- channels in two-thirds of patches that included CFTR. CFTR Cl- channels and CFTR-associated ATP channels had slope conductances of 7.4 pS and 5.2 pS, respectively, and had distinct reversal potentials and sensitivities to channel blockers. CFTR-associated ATP channels exhibited slow gating kinetics that depended on the presence of protein kinase A and cytoplasmic ATP, similar to CFTR Cl- channels. Gating kinetics of the ATP channels as well as the CFTR Cl- channels were similarly affected by non-hydrolyzable ATP analogues and mutations in the CFTR R domain and NBDs. Our results indicate that phosphorylation- and nucleotide-hydrolysis-dependent gating of CFTR is directly involved in gating of an associated ATP channel. However, the permeation pathways for Cl- and ATP are distinct and the ATP conduction pathway is not obligatorily associated with the expression of CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
131 The residues altered in CFTR∆R-S660A, CFTR S-oct-D, K464A and K1250A mutants are shown. Login to comment
155 These NBD1 and NBD2 mutants, containing the individual mutations K464A and K1250A, respectively, were expressed in MDCK cells and single-channel currents of CFTR Cl- channels and CFTR-associated ATP channels were analyzed. Login to comment
163 The K464A mutation similarly had no significant effects on the gating of the CFTR-associated ATP channels (Figure 10B, C, D and E). Login to comment
164 In contrast, mutation of the corresponding lysine in NBD2 (K1250A) resulted in CFTR-associated ATP channels (p Ͻ0.01) as well as CFTR Cl- channels (p Ͻ0.02) that exhibited significantly prolonged to (Figure 10A and D). Login to comment
165 The K1250A mutation resulted in gating behaviors of wild-type CFTR Cl- channels and CFTR-associated ATP channels which mimicked those induced by non-hydrolyzable nucleotide analogues (Figure 10A). Login to comment
166 In addition, we noted that the K1250A mutation also decreased tc of both CFTR Cl- channels (p Ͻ0.01) as well as CFTR-associated ATP channels (p Ͻ0.01) (Figure 10E). Login to comment
167 As a result, the K1250A mutation caused a substantial increase in the Po of both channels (p Ͻ0.01) (Figure 10C). Login to comment
171 (A) Current traces from a MDCK cell expressing K1250A in an inside-out patch with 100 mM ATP in the pipette and 140 mM Clin the bath at various membrane potentials (representative of six independently observed channels). Login to comment
173 (B) Current traces from a MDCK cell expressing K464A at various membrane potentials (representative of nine independently observed channels). Login to comment
205 Mutations in the conserved Walker A motif lysines of NBD1 (K464A) and NBD2 (K1250A) are thought to attenuate ATP hydrolysis with minimal effect on ATP binding (Sung et al., 1988; Schneider et al., 1994; Carson et al., 1995). Login to comment
209 The K1250A mutation had more pronounced effects. Login to comment
211 The prolonged channel open time in the K1250A mutant suggests that ATP hydrolysis at NBD2 closes the channel, consistent with previous observations (Carson et al., 1995; Gunderson and Kopito, 1995). Login to comment
272 Acknowledgements We thank M.Welsh for providing the CFTR∆R-S660A and CFTR S-oct-D mutants, R.Kopito for providing the K1250A and K464A mutants, J.Engelhardt for providing the R347E mutant, U.Patel for her precious technical help and D.Mak for helpful discussions. Login to comment
138 The residues altered in CFTRƊR-S660A, CFTR S-oct-D, K464A and K1250A mutants are shown. Login to comment
174 The K1250A mutation resulted in gating behaviors of wild-type CFTR Cl-channels and CFTR-associated ATP channels which mimicked those induced by non-hydrolyzable nucleotide analogues (Figure 10A). Login to comment
175 In addition, we noted that the K1250A mutation also decreased tc of both CFTR Cl-channels (p b0d;0.01) as well as CFTR-associated ATP channels (p b0d;0.01) (Figure 10E). Login to comment
176 As a result, the K1250A mutation caused a substantial increase in the Po of both channels (p b0d;0.01) (Figure 10C). Login to comment
180 (A) Current traces from a MDCK cell expressing K1250A in an inside-out patch with 100 mM ATP in the pipette and 140 mM Clin the bath at various membrane potentials (representative of six independently observed channels). Login to comment
215 Mutations in the conserved Walker A motif lysines of NBD1 (K464A) and NBD2 (K1250A) are thought to attenuate ATP hydrolysis with minimal effect on ATP binding (Sung et al., 1988; Schneider et al., 1994; Carson et al., 1995). Login to comment
219 The K1250A mutation had more pronounced effects. Login to comment
221 The prolonged channel open time in the K1250A mutant suggests that ATP hydrolysis at NBD2 closes the channel, consistent with previous observations (Carson et al., 1995; Gunderson and Kopito, 1995). Login to comment
282 Acknowledgements We thank M.Welsh for providing the CFTRƊR-S660A and CFTR S-oct-D mutants, R.Kopito for providing the K1250A and K464A mutants, J.Engelhardt for providing the R347E mutant, U.Patel for her precious technical help and D.Mak for helpful discussions. Login to comment

[hide] ClC and CFTR chloride channel gating. Annu Rev Physiol. 1998;60:689-717. Foskett JK
ClC and CFTR chloride channel gating.
Annu Rev Physiol. 1998;60:689-717., [PMID:9558482]

Abstract [show]
Chloride channels are widely expressed and play important roles in cell volume regulation, transepithelial transport, intracellular pH regulation, and membrane excitability. Most chloride channels have yet to be identified at a molecular level. The ClC gene family and the cystic fibrosis transmembrane conductance regulator (CFTR) are distinct chloride channels expressed in many cell types, and mutations in their genes are the cause of several diseases including myotonias, cystic fibrosis, and kidney stones. Because of their molecular definition and roles in disease, these channels have been studied intensively over the past several years. The focus of this review is on recent studies that have provided new insights into the mechanisms governing the opening and closing, i.e. gating, of the ClC and CFTR chloride channels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
321 The prolonged openings observed in the K1250A mutant are distinguished from those induced by nonhydrolyzable ATP analogues because they are independent of the degree of channel phosphorylation (145), whereas nonhydrolyzable analogues may only affect fully phosphorylated channels (127). Login to comment
324 An interesting contrast to the effects of the K1250A mutation in the Walker A motif was revealed in a D1370N mutant in the Walker B motif. Login to comment
325 In the latter, openings as well as closings were prolonged, but the prolonged openings (≈1.5 s) were considerably shorter than those seen in the K1250A mutant (tens of seconds) (150). Login to comment
329 Furthermore, they suggest that the prolonged openings induced by polyphosphates and the K1250A mutation require Mg2+ and nucleotide binding at NBD2. Login to comment

[hide] Function of the R domain in the cystic fibrosis tr... J Biol Chem. 1997 Oct 31;272(44):28133-41. Ma J, Zhao J, Drumm ML, Xie J, Davis PB
Function of the R domain in the cystic fibrosis transmembrane conductance regulator chloride channel.
J Biol Chem. 1997 Oct 31;272(44):28133-41., [PMID:9346969]

Abstract [show]
For a cystic fibrosis transmembrane conductance regulator (CFTR) channel to enter its open state, serine residues in the R domain must be phosphorylated by cAMP-dependent protein kinase, and intracellular ATP must bind to the nucleotide-binding folds and subsequently be hydrolyzed. CFTR with its R domain partially removed, DeltaR(708-835)-CFTR, forms a chloride channel that opens independently of protein kinase A phosphorylation, with open probability approximately one-third that of the wild type CFTR channel. Deletion of this portion of the R domain from CFTR alters the response of the channel to 5'-adenylylimidodiphosphate, pyrophosphate, and vanadate, compounds that prolong burst duration of the wild type CFTR channel but fail to do so in the DeltaR-CFTR. In addition, the addition of exogenous unphosphorylated R domain protein, which blocks the wild type CFTR channel, has no effect on the DeltaR-CFTR channel. However, when the exogenous R domain is phosphorylated, significant stimulation of the DeltaR-CFTR channel results; Po increases from 0.10 to 0.22. These data are consistent with a model for CFTR function in which the R domain in the unphosphorylated state interacts with the first nucleotide binding fold to inhibit either binding or hydrolysis of ATP or transduction of the effect to open the pore, but when the R domain is phosphorylated, it undergoes conformational change and interacts at a separate site in the first nucleotide binding fold to stimulate either binding or hydrolysis of ATP or transduction of the effect to open the pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
258 Point mutations within the conserved Walker A motif of NBF1 decreased the opening rate of the CFTR channel, while the corresponding mutations in NBF2 (K1250A, K1250M) prolong the open lifetime of CFTR (14, 15). Login to comment
259 The functional effects of K1250A and K1250M on the CFTR channel are similar to the effects of AMP-PNP and PPi (19, 24), suggesting that a decrease in the ATP hydrolysis rate at NBF2 leads to prolonged opening of the CFTR channel. Login to comment
260 The functional effects of K1250A and K1250M on the CFTR channel are similar to the effects of AMP-PNP and PPi (19, 24), suggesting that a decrease in the ATP hydrolysis rate at NBF2 leads to prolonged opening of the CFTR channel. Login to comment

[hide] CFTR: domains, structure, and function. J Bioenerg Biomembr. 1997 Oct;29(5):443-51. Devidas S, Guggino WB
CFTR: domains, structure, and function.
J Bioenerg Biomembr. 1997 Oct;29(5):443-51., [PMID:9511929]

Abstract [show]
Mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) cause cystic fibrosis (CF) (Collins, 1992). Over 500 naturally occurring mutations have been identified in CF gene which are located in all of the domains of the protein (Kerem et al., 1990; Mercier et al., 1993; Ghanem et al., 1994; Fanen et al., 1992; Ferec et al., 1992; Cutting et al., 1990). Early studies by several investigators characterized CFTR as a chloride channel (Anderson et al.; 1991b,c; Bear et al., 1991). The complex secondary structure of the protein suggested that CFTR might possess other functions in addition to being a chloride channel. Studies have established that the CFTR functions not only as a chloride channel but is indeed a regulator of sodium channels (Stutts et al., 1995), outwardly rectifying chloride channels (ORCC) (Gray et al., 1989; Garber et al., 1992; Egan et al., 1992; Hwang et al., 1989; Schwiebert et al., 1995) and also the transport of ATP (Schwiebert et al., 1995; Reisin et al., 1994). This mini-review deals with the studies which elucidate the functions of the various domains of CFTR, namely the transmembrane domains, TMD1 and TMD2, the two cytoplasmic nucleotide binding domains, NBD1 and NBD2, and the regulatory, R, domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 (1995) demonstrated that CFTR variants which contained mutations in the conserved Walker A motif of either NBD1 (K464A) or NBD2 (K1250M and K1250A) decreased the open probability of the channel compared to wt-CFTR. Login to comment
114 Mutations in NBD1 alone decreased the open probability whereas mutations at NBD2 or simultaneously at both the NBDs (K464A/ K1250A) prolonged the frequency of bursts of activity. These data point out convincingly that the two NBD's cooperate to control channel gating. Login to comment

[hide] CFTR activation: additive effects of stimulatory a... Am J Physiol. 1997 Jul;273(1 Pt 1):L127-33. Wilkinson DJ, Strong TV, Mansoura MK, Wood DL, Smith SS, Collins FS, Dawson DC
CFTR activation: additive effects of stimulatory and inhibitory phosphorylation sites in the R domain.
Am J Physiol. 1997 Jul;273(1 Pt 1):L127-33., [PMID:9252549]

Abstract [show]
To investigate the functional significance of individual consensus phosphorylation sites within the R domain of cystic fibrosis transmembrane conductance regulator (CFTR), serines were eliminated by substituting them with alanine. Included in this analysis were serine-660, -670, -686, -700, -712, -737, -768, -795, and -813, which lie within protein kinase A consensus sequences, and serine-641, which does not. Elimination of single potential phosphorylation sites altered the sensitivity of CFTR (expressed in Xenopus oocytes) to activating conditions in a manner that was highly site dependent. Substitution at serine-660, -670, -700, -795, or -813 significantly increased the half-maximal activation constant (KA) for activation by 3-isobutyl-1-methylxanthine, which is consistent with the hypothesis that phosphorylation at any of these sites promotes CFTR activation. The effect of substitution at serine-813 was significantly greater than at the other sites. In contrast, alanine substitution at serine-737 or -768 actually decreased the KA for activation, suggesting that phosphorylation at either of these sites is inhibitory. Substitution at serine-641, -686, and -712 had no significant effect on activation sensitivity. The effects of multiple serine to alanine substitutions were consistent with the notion that phosphorylation at individual sites produced roughly additive effects, suggesting that the effect produced by phosphorylation of any one serine was not dependent on the phosphorylation state of other serines. These results are consistent with the notion that, although none of the phosphorylation sites studied here are absolutely necessary for activation of CFTR, individual sites contribute differently to the gating of the channel.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Interpretation of Dose Response and Rate Analyses In a previous study (20), we used a CFTR (K1250A) mutant that is hypersensitive to activation by IBMX [half-maximal activation constant (&) = 0.07 mM] to obtain evidence that IBMX blocks CFTR channels with a half-maximal inhibition constant (&) of -9.5 mM. Login to comment

[hide] CFTR: the nucleotide binding folds regulate the ac... J Gen Physiol. 1996 Jan;107(1):103-19. Wilkinson DJ, Mansoura MK, Watson PY, Smit LS, Collins FS, Dawson DC
CFTR: the nucleotide binding folds regulate the accessibility and stability of the activated state.
J Gen Physiol. 1996 Jan;107(1):103-19., [PMID:8741733]

Abstract [show]
The functional roles of the two nucleotide binding folds, NBF1 and NBF2, in the activation of the cystic fibrosis transmembrane conductance regulator (CFTR) were investigated by measuring the rates of activation and deactivation of CFTR Cl- conductance in Xenopus oocytes. Activation of wild-type CFTR in response to application of forskolin and 3-isobutyl-1-methylxanthine (IBMX) was described by a single exponential. Deactivation after washout of the cocktail consisted of two phases: an initial slow phase, described by a latency, and an exponential decline. Rate analysis of CFTR variants bearing analogous mutations in NBF1 and NBF2 permitted us to characterize amino acid substitutions according to their effects on the accessibility and stability of the active state. Access to the active state was very sensitive to substitutions for the invariant glycine (G551) in NBF1, where mutations to alanine (A), serine (S), or aspartic acid (D) reduced the apparent on rate by more than tenfold. The analogous substitutions in NBF2 (G1349) also reduced the on rate, by twofold to 10-fold, but substantially destabilized the active state as well, as judged by increased deactivation rates. In the putative ATP-binding pocket of either NBF, substitution of alanine, glutamine (Q), or arginine (R) for the invariant lysine (K464 or K1250) reduced the on rate similarly, by two- to fourfold. In contrast, these analogous substitutions produced opposite effects on the deactivation rate. NBF1 mutations destabilized the active state, whereas the analogous substitutions in NBF2 stabilized the active state such that activation was prolonged compared with that seen with wild-type CFTR. Substitution of asparagine (N) for a highly conserved aspartic acid (D572) in the ATP-binding pocket of NBF1 dramatically slowed the on rate and destabilized the active state. In contrast, the analogous substitution in NBF2 (D1370N) did not appreciably affect the on rate and markedly stabilized the active state. These results are consistent with a hypothesis for CFTR activation that invokes the binding and hydrolysis of ATP at NBF1 as a crucial step in activation, while at NBF2, ATP binding enhances access to the active state, but the rate of ATP hydrolysis controls the duration of the active state. The relatively slow time courses for activation and deactivation suggest that slow processes modulate ATP-dependent gating.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 The Kj fbr IBMX block was estimated from the response of the hypersensitive mutant, K1250A. Login to comment
89 Because K1250A is maximally activated at an IBMX concentration of,'-,1 raM, the block by higher concentrations of IBMX is readily apparent. Login to comment
94 The value of N'!I/N'~I~ estimated for the mutant K1250A indicated that the maximum gcJ actually observed, g~'!i~'X,was nearly equal to the maximum possible activation, N'~l, presumably because this conductance is achieved at an IBMX concentration of 1 raM, where block is minimal. Login to comment
95 The calculated curves for activation and block of K1250A are shown in Fig. 3 A, where the values of gel are normalized to the theoretical maximum, N'!]. Login to comment
97 The magnitude of the transient increase in gel tor K1250A after removal of 5 mM IBMX in the rate experiments (cf. Fig. 5 B) was consistent with this interpretation. Login to comment
125 The fit of Eq. 2 to the combined data for the hypersensitive mutant K1250A yielded a value of K1for the block by IBMX, as described in the text. Login to comment
126 (A) The plotted points (O) are means -+ SEM for 10 oocytes expressing the mutant K1250A. Login to comment
129 (B) IBMX dose-response relations for steady state activation of K1250A (~), wild-type CFTR (Q, n = 26), and K464Q (A, n = 5). Login to comment
133 In Fig. 3 B, the activation components for wild-type CFTR and the mutants K1250A and K464Q were simulated by adding back the blocked component and plotting the adjusted data points along with the curves calculated using the estimated KAvalues. Login to comment
195 a~ODiap- 9 K464Q a I ' ' ' ' I ' ' ' ' I ' ' 0 10 20 ~ O -0 0, 9 -0~176176176o ....... 9.... -o*- -o*- 9 i~ e'~176176176176 9 D572N o i , , , , i , , , , i , , , , I , , , , i , , , , i , , , , 0 I0 20 30 40 50 minutes K1250A K1250C I i 30 D1370N 6O FIGURE4. Login to comment
281 + kott) (10-3 min-l kon kofr latency *k~m CFTR (mM) n (10-3min-]) mM-1) (10-3min 1) (10-3min-l) n (min) (10 3min i) n wt 0.65 • 0.08 26 664 • 51 118 • 9 558 • 45 76-+ 6 20 6.0 • 0.3 88 • 6 16 K464R 2.6 • 0.1": 4 153 + 20**+ 20 • 3*** 101 • 13''` 52 • 7*: 5 1.3 • 0.2*++ 174 • 14"** 7 K464Q 3.3 • 0.5"* 5 331 • 56*** 40 -+ 7* 199 • 34* 132 • 22*'` 5 1.9 • 0.3"I 142 -+ 19''` 5 K464A 4.6 • 0.7** 6 289 • 49* 30 • 5** 151 • 26*** 139 • 24*: 7 1.1 • 0.1"** 133 • 14"** 8 D572N 9.3 + 0.02*: 6 106 • 7*: 7-+0.5*: 37-+3*** 69 • 5+* 4 0.9 • 0.2*** 245 • 32*: 3 K1250R 0.17 • 0.07*: 5 239 •33*** 46 -+ 6"+* 231 • 32*: 8 • 1": 10 10.4 • 0.8"~ 100 • 7** 6 K1250Q 0.12 • 0.04*** 5 150 • 18''` 29 • 4* 146 -+ 18" 4 + 0.4"I 5 22.3 • 2.4*: 30 •5": 5 K1250A 0.07 + 0.02*: 10 218 • 18" 43 • 4*'` 215 • 18": 3 -+0.3*~* 5 15.6-+ 1.0"** 43 -+5** 5 D1370N 0.16 + 0.04*'` 7 449 - 79*: 87 • 15: 435 +76** 14 - 2*: 5 16.3-4-1.2"" 69-+ 6** 5 The symbols (*) and ('`) indicate significant differences from wild-type CFTR and the analogous mutant, respectively (P < 0.05). Login to comment
371 After washout of 10 tzM forskolin, there was no transient increase in gc~, but the rate of decline was Nfourfold slower for the hypersensitive K1250A mutant, which is consistent with the results seen with 5 mM IBMX. Login to comment
382 For example, the mutation K1250A increased the burst duration of CFTR by four- to fivefold, and the analysis of CFTR deactivation in oocytes indicates that this substitution produced at least a threefold increase in the stability of the active state (Table II and Fig. 7). Login to comment
384 However, the open probability of K1250A was decreased by more than twofold, largely because of a 30-50-fold increase in the interburst interval, an effect that is not predicted by the present results. Login to comment
90 Because K1250A is maximally activated at an IBMX concentration of,'-,1 raM, the block by higher concentrations of IBMX is readily apparent. Login to comment
96 The calculated curves for activation and block of K1250A are shown in Fig. 3 A, where the values of gel are normalized to the theoretical maximum, N'!]. Login to comment
98 The magnitude of the transient increase in gel tor K1250A after removal of 5 mM IBMX in the rate experiments (cf. Fig. 5 B) was consistent with this interpretation. Login to comment
127 The fit of Eq. 2 to the combined data for the hypersensitive mutant K1250A yielded a value of K1for the block by IBMX, as described in the text. Login to comment
128 (A) The plotted points (O) are means -+ SEM for 10 oocytes expressing the mutant K1250A. Login to comment
131 (B) IBMX dose-response relations for steady state activation of K1250A (~), wild-type CFTR (Q, n = 26), and K464Q (A, n = 5). Login to comment
135 In Fig. 3 B, the activation components for wild-type CFTR and the mutants K1250A and K464Q were simulated by adding back the blocked component and plotting the adjusted data points along with the curves calculated using the estimated KAvalues. Login to comment
198 a~ODiap- 9 K464Q a I ' ' ' ' I ' ' ' ' I ' ' 0 10 20 ~ O -0 0, 9 -0 ~176176176 o ....... 9.... -o*- -o*- 9 i~ e'~176176176176 9 D572N o i , , , , i , , , , i , , , , I , , , , i , , , , i , , , , 0 I0 20 30 40 50 minutes K1250A K1250C I i 30 D1370N 6O FIGURE4. Login to comment
283 + kott) (10-3 min-l kon kofr latency *k~m CFTR (mM) n (10-3 min-]) mM-1) (10-3 min 1) (10-3min-l) n (min) (10 3min i) n wt 0.65 ߦ 0.08 26 664 ߦ 51 118 ߦ 9 558 ߦ 45 76 -+ 6 20 6.0 ߦ 0.3 88 ߦ 6 16 K464R 2.6 ߦ 0.1": 4 153 + 20**+ 20 ߦ 3*** 101 ߦ 13''` 52 ߦ 7*: 5 1.3 ߦ 0.2*++ 174 ߦ 14"** 7 K464Q 3.3 ߦ 0.5"* 5 331 ߦ 56*** 40 -+ 7* 199 ߦ 34* 132 ߦ 22*'` 5 1.9 ߦ 0.3"I 142 -+ 19''` 5 K464A 4.6 ߦ 0.7** 6 289 ߦ 49* 30 ߦ 5** 151 ߦ 26*** 139 ߦ 24*: 7 1.1 ߦ 0.1"** 133 ߦ 14"** 8 D572N 9.3 + 0.02*: 6 106 ߦ 7*: 7 -+0.5*: 37 -+3*** 69 ߦ 5+* 4 0.9 ߦ 0.2*** 245 ߦ 32*: 3 K1250R 0.17 ߦ 0.07*: 5 239 ߦ 33*** 46 -+ 6"+* 231 ߦ 32*: 8 ߦ 1": 10 10.4 ߦ 0.8"~ 100 ߦ 7** 6 K1250Q 0.12 ߦ 0.04*** 5 150 ߦ 18''` 29 ߦ 4* 146 -+ 18" 4 + 0.4"I 5 22.3 ߦ 2.4*: 30 ߦ 5": 5 K1250A 0.07 + 0.02*: 10 218 ߦ 18" 43 ߦ 4*'` 215 ߦ 18": 3 -+0.3*~* 5 15.6 -+ 1.0"** 43 -+5** 5 D1370N 0.16 + 0.04*'` 7 449 - 79*: 87 ߦ 15: 435 + 76** 14 - 2*: 5 16.3 -4-1.2"" 69 -+ 6** 5 The symbols (*) and ('`) indicate significant differences from wild-type CFTR and the analogous mutant, respectively (P < 0.05). Login to comment
373 After washout of 10 tzM forskolin, there was no transient increase in gc~, but the rate of decline was Nfourfold slower for the hypersensitive K1250A mutant, which is consistent with the results seen with 5 mM IBMX. Login to comment
386 However, the open probability of K1250A was decreased by more than twofold, largely because of a 30-50-fold increase in the interburst interval, an effect that is not predicted by the present results. Login to comment

[hide] Conformational states of CFTR associated with chan... Cell. 1995 Jul 28;82(2):231-9. Gunderson KL, Kopito RR
Conformational states of CFTR associated with channel gating: the role ATP binding and hydrolysis.
Cell. 1995 Jul 28;82(2):231-9., [PMID:7543023]

Abstract [show]
CFTR is a member of the traffic ATPase superfamily and a Cl- ion channel that appears to require ATP hydrolysis for gating. Analysis of single CFTR Cl- channels reconstituted into planar lipid bilayers revealed the presence of two open conductance states that are connected to each other and to the closed state by an asymmetric cycle of gating events. We show here that the transition between the two open conductance states is directly coupled to ATP hydrolysis by one of the consensus nucleotide-binding folds, designated NBF2. Moreover, the transition between the closed state and one of the open states is linked to the binding of ATP. This analysis permits real-time visualization of conformational changes associated with a single cycle of ATP hydrolysis by a single protein molecule and suggests a model describing a role for ATP in CFTR gating.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 These NBF1 and NBF2 mutants, harboring the individual mutations K464A and K1250A, K1250G, K1250M, or K1250T, respectively, were expressed in HEK cells and reconstituted into planar lipid bilayers from which single-channel currents were recorded (Figures 3A and 3B). Login to comment
69 We propose that A -PPi +PPi • - 0[ •; K1250A KI250A . Login to comment
76 (B)Single-channelrecordsof K1250A,K1250G, K1250M, and K1250T filtered at 50 Hz under standard cis bath conditions. Login to comment
79 Mean conductance values are 9.0 _+ 0.19 pS (n = 4) for the O1state; 10.3 _+0.20 pS (n = 4) for the 02 state; and 8.9 _+ 0.13 pS (n = 4) for the single conductance state of the K1250A mutant. Login to comment
81 (D) Single-channel recording of K1250A mutant at different holding potentials used in generating the I-V curve shown above. Login to comment
121 The simplest interpretation of these data is that ATP binding ConformationalStatesof CFTR 09 08 07 06 Oo 05 040.3 * 32 wildtype K464A K1250A G1247D/ D1370N 01249E 6~se' B 2500 20O0 5 1500 1OO0 500 o~ 0 w[Id{ype K464A K1250A C1247D/ Ol 370N G1249E Figure5. Login to comment
214 Polymerase Chain Reaction Megaprimer Mutagenesis The following site-directed mutants were constructed by using the megaprimer polymerase chain reaction (PCR)-based mutagenesis protocol (Landt et al., 1990; Sarkar and Sommer, 1990): K464A, K1250A, K1250G, K1250T, and GG1247, 1249DE. Login to comment
122 The simplest interpretation of these data is that ATP binding ConformationalStatesof CFTR 09 08 07 06 Oo 05 040.3 * 32 wildtype K464A K1250A G1247D/ D1370N 01249E 6~se' B 2500 20O0 5 1500 1OO0 500 o ~ 0 w[Id{ype K464A K1250A C1247D/ Ol 370N G1249E Figure5. Login to comment
215 Polymerase Chain Reaction Megaprimer Mutagenesis The following site-directed mutants were constructed by using the megaprimer polymerase chain reaction (PCR)-based mutagenesis protocol (Landt et al., 1990; Sarkar and Sommer, 1990): K464A, K1250A, K1250G, K1250T, and GG1247, 1249DE. Login to comment

[hide] Functional roles of the nucleotide-binding folds i... Proc Natl Acad Sci U S A. 1993 Nov 1;90(21):9963-7. Smit LS, Wilkinson DJ, Mansoura MK, Collins FS, Dawson DC
Functional roles of the nucleotide-binding folds in the activation of the cystic fibrosis transmembrane conductance regulator.
Proc Natl Acad Sci U S A. 1993 Nov 1;90(21):9963-7., [PMID:7694298]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR), a member of the traffic ATPase superfamily, possesses two putative nucleotide-binding folds (NBFs). The NBFs are sufficiently similar that sequence alignment of highly conserved regions can be used to identify analogous residues in the two domains. To determine whether this structural homology is paralleled in function, we compared the activation of chloride conductance by forskolin and 3-isobutyl-1-methylxanthine in Xenopus oocytes expressing CFTRs bearing mutations in NBF1 or NBF2. Mutation of a conserved glycine in the putative linker domain in either NBF produced virtually identical changes in the sensitivity of chloride conductance to activating conditions, and mutation of this site in both NBFs produced additive effects, suggesting that in the two NBFs this region plays a similar and critical role in the activation process. In contrast, amino acid substitutions in the Walker A and B motifs, thought to form an integral part of the nucleotide-binding pockets, produced strikingly different effects in NBF1 and NBF2. Substitutions for the conserved lysine (Walker A) or aspartate (Walker B) in NBF1 resulted in a marked decrease in sensitivity to activation, whereas the same changes in NBF2 produced an increase in sensitivity. These results are consistent with a model for the activation of CFTR in which both NBF1 and NBF2 are required for normal function but in which either the nature or the exact consequences of nucleotide binding differ for the two domains.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Alanine and arginine substitutions at lysine-464 and -1250 were associated with sensitivities similar to those observed with the glutamine substitutions (K464A or K464R, Kil2 = 0.8 mM; K1250A or K1250R, K,12 < 0.02 mM). Login to comment

[hide] An intrinsic adenylate kinase activity regulates g... Cell. 2003 Dec 26;115(7):837-50. Randak C, Welsh MJ
An intrinsic adenylate kinase activity regulates gating of the ABC transporter CFTR.
Cell. 2003 Dec 26;115(7):837-50., [PMID:14697202]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP binding cassette (ABC) transporter family. Like other ABC transporters, it can hydrolyze ATP. Yet while ATP hydrolysis influences channel gating, it has long seemed puzzling that CFTR would require this reaction because anions flow passively through CFTR. Moreover, no other ion channel is known to require the large energy of ATP hydrolysis to gate. We found that CFTR also has adenylate kinase activity (ATP + AMP <=> ADP + ADP) that regulates gating. When functioning as an adenylate kinase, CFTR showed positive cooperativity for ATP suggesting its two nucleotide binding domains may dimerize. Thus, channel activity could be regulated by two different enzymatic reactions, ATPase and adenylate kinase, that share a common ATP binding site in the second nucleotide binding domain. At physiologic nucleotide concentrations, adenylate kinase activity, rather than ATPase activity may control gating, and therefore involve little energy consumption.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
228 In addition, we Walker A and B motif mutations (K1250A and D1370N) abolished both ATPase and adenylate kinase activities studied a relatively common CF-associated mutation, N1303K (Osborne et al., 1992); interestingly, two other (Figures 7A and 7B). Login to comment
263 The Walker A mutations (K464A in NBD1 and K1250A in stimulation (Berger et al., 2002). Login to comment
280 NBD2 was wild-type or contained K1250A, D1370N, or N1303K mutations. Login to comment
288 Data are from 5 (wild-type, K464A, D572N), 9 (K1250A), 10 (D1370N), and 3 (N1303K) membrane patches. Asterisks indicate p b0d; 0.05 compared to wild-type by ANOVA followed by Dunnett`s multiple comparison test. Login to comment

[hide] A stable ATP binding to the nucleotide binding dom... J Physiol Sci. 2010 Sep;60(5):353-62. doi: 10.1007/s12576-010-0102-2. Epub 2010 Jul 14. Shimizu H, Yu YC, Kono K, Kubota T, Yasui M, Li M, Hwang TC, Sohma Y
A stable ATP binding to the nucleotide binding domain is important for reliable gating cycle in an ABC transporter CFTR.
J Physiol Sci. 2010 Sep;60(5):353-62. doi: 10.1007/s12576-010-0102-2. Epub 2010 Jul 14., [PMID:20628841]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) anion channel, a member of ABC transporter superfamily, gates following ATP-dependent conformational changes of the nucleotide binding domains (NBD). Reflecting the hundreds of milliseconds duration of the channel open state corresponding to the dimerization of two NBDs, macroscopic WT-CFTR currents usually showed a fast, single exponential relaxation upon removal of cytoplasmic ATP. Mutations of tyrosine1219, a residue critical for ATP binding in second NBD (NBD2), induced a significant slow phase in the current relaxation, suggesting that weakening ATP binding affinity at NBD2 increases the probability of the stable open state. The slow phase was effectively diminished by a higher affinity ATP analogue. These data suggest that a stable binding of ATP to NBD2 is required for normal CFTR gating cycle, andthat the instability of ATP binding frequently halts the gating cycle in the open state presumably through a failure of ATP hydrolysis at NBD2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Contrary to WT-CFTR, CFTR mutants whose ATP hydrolysis at NBD2 is abolished (i.e., E1371S, K1250A), can remain open for minutes [9, 12, 17-20]. Login to comment
106 Since the life time of these long-lasting openings (in tens of seconds) is very similar to that of hydrolysis-deficient CFTR mutants such as K1250A and E1371S [9, 12, 17-20], it seems difficult to explain these events with the conventional theory that ATP hydrolysis closes the channel. Login to comment
118 On the other hand, CFTR channels can open for hundreds of seconds when ATP hydrolysis is abolished by mutations such as E1371S or K1250A [9, 12, 17-20]. Login to comment

[hide] Nonequilibrium gating of CFTR on an equilibrium th... Physiology (Bethesda). 2012 Dec;27(6):351-61. doi: 10.1152/physiol.00026.2012. Jih KY, Hwang TC
Nonequilibrium gating of CFTR on an equilibrium theme.
Physiology (Bethesda). 2012 Dec;27(6):351-61. doi: 10.1152/physiol.00026.2012., [PMID:23223629]

Abstract [show]
Malfunction of cystic fibrosis transmembrane conductance regulator (CFTR), a member of the ABC protein superfamily that functions as an ATP-gated chloride channel, causes the lethal genetic disease, cystic fibrosis. This review focuses on the most recent findings on the gating mechanism of CFTR. Potential clinical relevance and implications to ABC transporter function are also discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Nonetheless, for hydrolysis-deficient mutants such as E1371S- and K1250A-CFTR, ATP is still capable of activating these channels and the open probability (Po) of these hydrolysis-deficient mutants is even higher than that of WT-CFTR, suggesting that, under an equilibrium condition when ATP hydrolysis is absent, CFTR can still function fairly well. Login to comment

[hide] Conformational changes in the catalytically inacti... J Gen Physiol. 2013 Jul;142(1):61-73. doi: 10.1085/jgp.201210954. Epub 2013 Jun 10. Csanady L, Mihalyi C, Szollosi A, Torocsik B, Vergani P
Conformational changes in the catalytically inactive nucleotide-binding site of CFTR.
J Gen Physiol. 2013 Jul;142(1):61-73. doi: 10.1085/jgp.201210954. Epub 2013 Jun 10., [PMID:23752332]

Abstract [show]
A central step in the gating of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is the association of its two cytosolic nucleotide-binding domains (NBDs) into a head-to-tail dimer, with two nucleotides bound at the interface. Channel opening and closing, respectively, are coupled to formation and disruption of this tight NBD dimer. CFTR is an asymmetric adenosine triphosphate (ATP)-binding cassette protein in which the two interfacial-binding sites (composite sites 1 and 2) are functionally different. During gating, the canonical, catalytically active nucleotide-binding site (site 2) cycles between dimerized prehydrolytic (state O1), dimerized post-hydrolytic (state O2), and dissociated (state C) forms in a preferential C-->O1-->O2-->C sequence. In contrast, the catalytically inactive nucleotide-binding site (site 1) is believed to remain associated, ATP-bound, for several gating cycles. Here, we have examined the possibility of conformational changes in site 1 during gating, by studying gating effects of perturbations in site 1. Previous work showed that channel closure is slowed, both under hydrolytic and nonhydrolytic conditions, by occupancy of site 1 by N(6)-(2-phenylethyl)-ATP (P-ATP) as well as by the site-1 mutation H1348A (NBD2 signature sequence). Here, we found that P-ATP prolongs wild-type (WT) CFTR burst durations by selectively slowing (>2x) transition O1-->O2 and decreases the nonhydrolytic closing rate (transition O1-->C) of CFTR mutants K1250A ( approximately 4x) and E1371S ( approximately 3x). Mutation H1348A also slowed ( approximately 3x) the O1-->O2 transition in the WT background and decreased the nonhydrolytic closing rate of both K1250A ( approximately 3x) and E1371S ( approximately 3x) background mutants. Neither P-ATP nor the H1348A mutation affected the 1:1 stoichiometry between ATP occlusion and channel burst events characteristic to WT CFTR gating in ATP. The marked effect that different structural perturbations at site 1 have on both steps O1-->C and O1-->O2 suggests that the overall conformational changes that CFTR undergoes upon opening and coincident with hydrolysis at the active site 2 include significant structural rearrangement at site 1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
19 Here, we found that P-ATP prolongs wild-type (WT) CFTR burst durations by selectively slowing (>2&#d7;) transition O1࢐O2 and decreases the nonhydrolytic closing rate (transition O1࢐C) of CFTR mutants K1250A (&#e07a;4&#d7;) and E1371S (&#e07a;3&#d7;). Login to comment
20 Mutation H1348A also slowed (&#e07a;3&#d7;) the O1࢐O2 transition in the WT background and decreased the nonhydrolytic closing rate of both K1250A (&#e07a;3&#d7;) and E1371S (&#e07a;3&#d7;) background mutants. Login to comment
35 M A T E R I A L S A N D M E T H O D S Molecular biology Human WT CFTR and CFTR segment 433-1480 in the pGEMHE plasmid (Chan et al., 2000) served as templates for mutants H1348A, K1250A, E1371S, K1250A/H1348A, E1371S/H1348A, E1371S/K464A, and 433-1480(K1250A), which were created using the QuikChange kit (Agilent Technologies). Login to comment
57 For the nonhydrolytic mutants (K1250A, E1371S, and double mutants), the decay time courses after nucleotide removal often required a double-exponential function-of the form I(t) = I0(A1exp(&#e032;t/&#e074;1) + (1 &#e032; A1)exp(&#e032;t/&#e074;2))-with two slow time constants for a satisfactory fit (e.g., Fig. 3, B and E), suggesting the presence of two populations of open-channel bursts. Login to comment
72 MgATP (Sigma-Aldrich) was added from a 400-mM aqueous stock solution (pH 7.1 with NMDG) to achieve a final concentration of 2 mM (or 10 mM for channels bearing the K1250A mutation). Login to comment
73 A 10-mM aqueous stock solution of P-ATP Na+ salt (BIOLOG Life Science Institute) was stored at &#e032;80&#b0;C and diluted into the bath solution immediately before recording to achieve a final concentration of 10 &#b5;M (or 50 &#b5;M for K1250A mutants). Login to comment
107 Thus, the nonhydrolytic closing rate (Fig. 3, C and F, bars; calculated from the fitted relaxation time constants as described in Materials and methods) was similarly affected by both site-1 perturbations, and this was true regardless of whether the K1250A (Fig. 3 C) or the E1371S (Fig. 3 F) mutant was chosen as the nonhydrolytic model; i.e., both site-1 perturbations decreased this rate by two- to threefold. Login to comment
115 We therefore compared the effects of our site-1 perturbations on the closing rates of two nonhydrolytic mutants, NBD2 Walker A mutant K1250A (Fig. 3, A-C) and NBD2 Walker B mutant E1371S (Fig. 3, D-F). Login to comment
117 (A and D) Macroscopic currents of prephosphorylated K1250A (A) and E1371S (D) CFTR channels elicited by exposure (bars) to either 10 mM ATP alternating with 50 &#b5;M P-ATP (A) or 2 mM ATP alternating with 10 &#b5;M P-ATP (D); the fivefold higher nucleotide concentrations for the K1250A constructs were used to compensate for the large decrease in apparent ATP affinity caused by this mutation (Vergani et al., 2003). Login to comment
119 (B and E) Macroscopic currents of prephosphorylated K1250A/ H1348A (B) and E1371S/ H1348A (E) CFTR channels elicited by transient exposure (bars) to either 10 mM (B) or 2 mM (E) ATP. Login to comment
122 (C and F) Nonhydrolytic closing rates of channels opened by ATP (blue bars) or P-ATP (red bars), or of channels bearing the H1348A mutation opened by ATP (green bars), measured in the K1250A (C) or E1371S (F) background. Login to comment
145 Thus, whereas P-ATP slowed nonhydrolytic closure by approximately fourfold for K1250A channels with an intact site 1 (Fig. 3 C; compare red with blue bar; replotted in Fig. 5, B and E), this effect increased to greater than sixfold and to approximately ninefold, respectively, in the presence of the site-1 perturbations H1348A and &#e044;RI (Fig. 5, B and E; compare brown with green bars), again suggesting nonadditivity. Login to comment
149 Nonadditive effects of P-ATP and site-1 mutations on nonhydrolytic closure support the slowing of this gating step by P-ATP bound in site 1 Additivity of effects on nonhydrolytic closure of the same site-1 perturbations with those of P-ATP was tested in the K1250A nonhydrolytic background (Fig. 5) by measuring the macroscopic closing rate of K1250A/H1348A channels (Fig. 5 A), and of channels obtained by co-expression of segments 1-414 and 433-1480(K1250A) (K1250A/&#e044;RI; Fig. 5 D) upon nucleotide removal. Login to comment
151 (A and D) Macroscopic currents from K1250A/H1348A (A) and K1250A/&#e044;RI (D) CFTR channels elicited by exposures to 10 mM ATP or 50 &#b5;M P-ATP (bars). Login to comment
153 (B and E) Nonhydrolytic closing rates for K1250A/ H1348A (B) and K1250A/&#e044;RI (E) CFTR channels, obtained as the inverses of the relaxation time constants upon removal of ATP (green bars) or P-ATP (brown bars); closing rates of K1250A CFTR upon removal of ATP (blue bars) and P-ATP (red bars) were replotted from Fig. 3 C. Login to comment
219 Interestingly, the K464A mutation, which perturbs site 1 by removing the conserved Walker A lysine, was also shown to affect the energetics of both of the C1࢒O1 and O1࢐O2 gating steps (Csan&#e1;dy et al., 2010), although in a different way: in this mutant, rate k1 decreased approximately fourfold, whereas the rate of nonhydrolytic closure, in a K1250A mutant background, increased by &#e07a;10-fold (this is also replicated in the E1371S background; Fig. S2). Login to comment

[hide] ATP and AMP mutually influence their interaction w... J Biol Chem. 2013 Sep 20;288(38):27692-701. doi: 10.1074/jbc.M113.479675. Epub 2013 Aug 6. Randak CO, Dong Q, Ver Heul AR, Elcock AH, Welsh MJ
ATP and AMP mutually influence their interaction with the ATP-binding cassette (ABC) adenylate kinase cystic fibrosis transmembrane conductance regulator (CFTR) at separate binding sites.
J Biol Chem. 2013 Sep 20;288(38):27692-701. doi: 10.1074/jbc.M113.479675. Epub 2013 Aug 6., [PMID:23921386]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP &lrarr2; 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5'-triphosphate (8-N3-ATP) and 8-azidoadenosine 5'-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P(1),P(5)-di(adenosine-5') pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
245 Our results are consistent with the previous observations that mutations of conserved residues in the Walker A and B motifs of ATP-binding site 2, K1250A and FIGURE 8. Login to comment
302 (b) Patch clamp studies showed that CFTR mutations K1250A and D1370N, located within the conserved Walker A and B motifs of ATP-binding site 2, abolished the effects of Ap5A and AMP on CFTR current. Login to comment

[hide] Catalyst-like modulation of transition states for ... J Gen Physiol. 2014 Feb;143(2):269-87. doi: 10.1085/jgp.201311089. Epub 2014 Jan 13. Csanady L, Torocsik B
Catalyst-like modulation of transition states for CFTR channel opening and closing: new stimulation strategy exploits nonequilibrium gating.
J Gen Physiol. 2014 Feb;143(2):269-87. doi: 10.1085/jgp.201311089. Epub 2014 Jan 13., [PMID:24420771]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is the chloride ion channel mutated in cystic fibrosis (CF) patients. It is an ATP-binding cassette protein, and its resulting cyclic nonequilibrium gating mechanism sets it apart from most other ion channels. The most common CF mutation (DeltaF508) impairs folding of CFTR but also channel gating, reducing open probability (Po). This gating defect must be addressed to effectively treat CF. Combining single-channel and macroscopic current measurements in inside-out patches, we show here that the two effects of 5-nitro-2-(3-phenylpropylamino)benzoate (NPPB) on CFTR, pore block and gating stimulation, are independent, suggesting action at distinct sites. Furthermore, detailed kinetic analysis revealed that NPPB potently increases Po, also of DeltaF508 CFTR, by affecting the stability of gating transition states. This finding is unexpected, because for most ion channels, which gate at equilibrium, altering transition-state stabilities has no effect on Po; rather, agonists usually stimulate by stabilizing open states. Our results highlight how for CFTR, because of its unique cyclic mechanism, gating transition states determine Po and offer strategic targets for potentiator compounds to achieve maximal efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Recordings were done in the presence of saturating (2 mM) MgATP; for the K1250A mutant 10 mM MgATP was used to compensate for its greatly impaired apparent ATP affinity (Vergani et al., 2003). Login to comment
117 To test this, we studied the closing rate of K1250A CFTR channels, in which mutation of the NBD2 Walker A lysine abrogates ATP hydrolysis at site 2 (Ramjeesingh et al., 1999) and reduces gating to reversible caused simple monophasic current relaxations (Fig. 3 E), both the addition and removal of NPPB elicited biphasic responses (Fig. 3 D), attesting to the dual effects of this compound. Login to comment
123 (A) Macroscopic K1250A CFTR current at &#e032;120 mV elicited by exposures to 10 mM ATP in the absence or presence of blockers. Login to comment
126 The K1250A mutation (B and E, cartoons, red stars) disrupts ATP hydrolysis in site 2 (red cross). Login to comment
127 (C) Macroscopic K1250A CFTR current elicited by 10 mM ATP at &#e032;40 mV, prolonged exposure to 210 &#b5;M NPPB of channels gating at steady state, and brief exposure to NPPB of surviving locked-open channels after ATP removal (10-s yellow box, expanded in inset). Login to comment
129 (D) Fractional K1250A CFTR currents at &#e032;40 mV in 210 &#b5;M NPPB applied during steady-state gating (red bar) or in the locked-open state (yellow bar). Login to comment
131 Fractional effect on Po for K1250A CFTR (blue bar) was calculated as in Fig. 2 E. rate of K1250A upon removal of bath ATP (Fig. 4 A) was &#e07a;100 times slower than for WT channels (Fig. 4, A, red fit line, and B, red bar; compare to Fig. 3, A and C). Login to comment
134 Consistent with its effect on K1250A closing rate (Fig. 4, A and B), 210 &#b5;M NPPB also accelerated the unlocking rate of pyrophosphate-locked WT CFTR channels by two- to threefold (Fig. S2). Login to comment
135 Because NPPB accelerated both forward (Fig. 3 F) and backward (Fig. 4 B) transitions of the C1࢒O1 step, we examined whether it affects the equilibrium constant between those two states (Fig. 4 E, cartoon, purple double arrow; Keq), i.e., Po for K1250A channels. Login to comment
136 Even prolonged exposure to 210 &#b5;M NPPB of K1250A channels gating at steady state in 10 mM ATP (Fig. 4 C; note Vm = &#e032;40 mV) failed to elicit biphasic responses like those seen for WT channels (see Fig. 3 D). Login to comment
141 Given the observed increase in nonhydrolytic closing rate (Fig. 4, A and B), this result indicates that NPPB must also speed the opening rate of K1250A CFTR, just as it does for WT (Fig. 3 F). Login to comment
160 (E; left) Macroscopic K1250A CFTR current at +60 mV elicited by exposures to 10 mM ATP in the absence or presence of 210 &#b5;M NPPB; colored lines, single-exponential fits (&#e074;, time constants). Login to comment
161 (Right) Macroscopic K1250A closing rates (bars, 1/&#e074;) in the absence (red) and presence (blue) of NPPB. Login to comment
176 Finally, at +60 mV, 210 &#b5;M NPPB increased the nonhydrolytic closing rate of K1250A CFTR by approximately threefold (Fig. 6 E), just as it did at &#e032;120 mV cyan bar). Login to comment
222 In fact, because of its dual action on both i and Po, fractional reduction of macroscopic current by NPPB is not a good measure of pore block, unless observed on "locked-open" channels, which are not gating (Po of &#e07a;1), such as surviving E1371S (Fig. 1, E and I) or K1250A (Fig. 4 D, inset) channels after the removal of ATP. Login to comment
255 Accordingly, although the apparent KI of NPPB for pore block was &#e07a;20 &#b5;M at &#e032;120 mV (Fig. 1 J; replotted in Fig. 10, open diamonds), the apparent K1/2 for slowing hydrolytic closure of WT CFTR (Fig. 10, closed circles) was at least four times higher (&#e07a;90 &#b5;M), and a tentative fit to the dose-response curve for acceleration of nonhydrolytic closure (measured for the K1250A mutant; Fig. 10, closed squares) suggested a similar K1/2 of &#e07a;100 &#b5;M (although reliability of the latter fit is limited by the uncertainty of its asymptotic value). Login to comment
259 Macroscopic closing rates of WT (closed circles) and K1250A (closed squares) CFTR in the presence of various cytosolic [NPPB], measured at &#e032;120 mV using the protocols shown in Figs. 3 A and 4 A, respectively; leftmost data points represent control values in the absence of NPPB. Login to comment
260 The 50- and 100-&#b5;M data points for K1250A were measured at &#e032;40 mV. Login to comment
261 Solid lines are fits to the equation rOC([NPPB]) = r0 + (r&#e060; &#e032; r0)([NPPB]/([NPPB] + K1/2)), with r&#e060; fixed to zero for WT but left free for K1250A; K1/2 values are plotted. Login to comment
280 Accordingly, for the nonhydrolytic K1250A mutant, which gates at equilibrium, NPPB speeds gating transitions but does not alter Po (Fig. 4 E). Login to comment
297 Third, the presence of NPPB does not slow closure of the nonhydrolytic mutant K1250A (Fig. 4, A and B), confirming that the gate can close with NPPB bound in the pore, just as it can close in the presence of bound MOPS&#e032; , as the latter does not affect the closing rate of either WT (Fig. 3, B and C) or K1250A CFTR (Fig. 4, A and B). Login to comment
316 Gating effects of the K1250A mutation were modeled by setting rate O1࢐O2 to zero while increasing the Kd for ATP to 5 mM (Vergani et al., 2003), those of the &#e044;F508 mutation were modeled by decreasing rate C1࢐O1 30-fold while increasing rate O1࢐C1 threefold (Miki et al., 2010; Jih et al., 2011). Login to comment
320 ߒ (Fig. 12 A, cube) reduces to the four-state model to its right (blue): apparent rate c6; c6; C O 1 1 ࢐ reflects the observed opening rate in 210 &#b5;M NPPB (Figs. 3 F and 6, B and F), rate c6; c6; O O 1 2 ࢐ is the rate-limiting step for closure and reflects closing rate in 210 &#b5;M NPPB (Figs. 3 C and 6, C and F), c6; c6; O C 2 2 ࢐ seemed unaffected by NPPB (see fits to the distributions of open burst durations in 20 &#b5;M NPPB; Fig. 5 D), whereas rate c6; c6; O C 1 1 ࢐ reflects K1250A closing rate in 210 &#b5;M NPPB (Fig. 4 B). Login to comment
327 Indeed, the model faithfully reproduced (a) robust stimulation of WT Po as reflected by a discrepancy between fractional effects on steady-state macroscopic and unitary currents (Fig. 12, B and C; compare to Figs. 2, A, B, and E, and 6, A and B) and current over- shoots upon rapid removal of NPPB (Fig. 12 E; compare to Figs. 3 D and 6 D); (b) slowing of WT (hydrolytic) macroscopic closing rate (Fig. 12 D; compare to Figs. 3, A and C, and 6 C); (c) acceleration of WT macroscopic opening rate (Fig. 12 E; compare to Figs. 3 F and 6 D); (d) shortening and prolongation, respectively, of steady-state single-channel mean closed (interburst) and open (burst) durations (Fig. 12, F and H; compare to Figs. 5 B and 6 F), the latter being caused by a slowed rate c6; c6; O O 1 2 ࢐ (Fig. 12 G; compare to Fig. 5, C and D); (e) accelerated closing rate of the nonhydrolytic K1250A mutant (Fig. 12 I; compare to Figs. 4, A and B, and 6 E), but (f) lack of effect on the Po of this channel (Fig. 12 J; compare to Fig. 4, C and D), (g) observed apparent affinities of the NPPB gating effects (Fig. 12 K; compare to Fig. 10), as well as (h) extremely efficient stimulation of low Po mutants such as &#e044;F508 (Fig. 12 L; compare to Fig. 7; also compare to Fig. 8). Login to comment
335 Finally, rate O1࢐C1 represents the slow rate of nonhydrolytic closure, modeled by the closing rates of nonhydrolytic mutants K1250A (Fig. 4 A) or E1371S (Fig. 1 K), or of WT channels that have been locked open by ATP plus pyrophosphate (Fig. S2); the time constant of this slow process is &#e07a;30 s. Login to comment

[hide] Structure-activity analysis of a CFTR channel pote... J Gen Physiol. 2014 Oct;144(4):321-36. doi: 10.1085/jgp.201411246. Csanady L, Torocsik B
Structure-activity analysis of a CFTR channel potentiator: Distinct molecular parts underlie dual gating effects.
J Gen Physiol. 2014 Oct;144(4):321-36. doi: 10.1085/jgp.201411246., [PMID:25267914]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) is a member of the ATP-binding cassette transporter superfamily that functions as an epithelial chloride channel. Gating of the CFTR ion conduction pore involves a conserved irreversible cyclic mechanism driven by ATP binding and hydrolysis at two cytosolic nucleotide-binding domains (NBDs): formation of an intramolecular NBD dimer that occludes two ATP molecules opens the pore, whereas dimer disruption after ATP hydrolysis closes it. CFTR dysfunction resulting from inherited mutations causes CF. The most common CF mutation, deletion of phenylalanine 508 (DeltaF508), impairs both protein folding and processing and channel gating. Development of DeltaF508 CFTR correctors (to increase cell surface expression) and potentiators (to enhance open probability, Po) is therefore a key focus of CF research. The practical utility of 5-nitro-2-(3-phenylpropylamino)benzoate (NPPB), one of the most efficacious potentiators of DeltaF508 CFTR identified to date, is limited by its pore-blocking side effect. NPPB-mediated stimulation of Po is unique in that it involves modulation of gating transition state stability. Although stabilization by NPPB of the transition state for pore opening enhances both the rate of channel opening and the very slow rate of nonhydrolytic closure, because of CFTR's cyclic gating mechanism, the net effect is Po stimulation. In addition, slowing of ATP hydrolysis by NPPB delays pore closure, further enhancing Po. Here we show that NPPB stimulates gating at a site outside the pore and that these individual actions of NPPB on CFTR are fully attributable to one or the other of its two complementary molecular parts, 3-nitrobenzoate (3NB) and 3-phenylpropylamine (3PP), both of which stimulate Po: the pore-blocking 3NB selectively stabilizes the transition state for opening, whereas the nonblocking 3PP selectively slows the ATP hydrolysis step. Understanding structure-activity relationships of NPPB might prove useful for designing potent, clinically relevant CFTR potentiators.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Second, it increased by approximately threefold both the rate of opening of WT channels (step C1࢐O1) and the slow rate of nonhydrolytic closure (step O1࢐C1) of catalytically inactive mutants, such as K1250A CFTR in which lack of the conserved NBD2 Walker A lysine side chain abrogates ATP hydrolysis at site 2 (Ramjeesingh et al., 1999). Login to comment
49 pore-block measurements on E1371S (see Fig. 2 A) or K1250A CFTR (see Figs. 3 and 4), surviving currents of channels opened in resting oocytes as the result of endogenous phosphorylation were also used (Csan&#e1;dy and T&#f6;r&#f6;csik, 2014). Login to comment
70 M A T E R I A L S A N D M E T H O D S Molecular biology WT and K1250A CFTR cDNA subcloned into the pGEMHE plasmid (Vergani et al., 2003) was linearized using NheI and transcribed in vitro using T7 polymerase (mMESSAGE kit; Ambion). Login to comment
77 MgATP (Sigma-Aldrich) was made up at 400 mM (adjusted to pH 7.1 with NMDG) and diluted into the bath solution at 2 and 10 mM final concentrations, respectively, for recordings on WT and K1250A CFTR (the higher [ATP] for K1250A was used to compensate for its reduced ATP-binding affinity [Vergani et al., 2003]). Login to comment
83 A convenient macroscopic assay for measuring fractional effects on average ion flux rates through bursting channels is provided by nonhydrolytic mutant CFTR channels such as E1371S (Vergani et al., 2003) or K1250A. Login to comment
106 We next probed acceleration by NPPB of the slow nonhydrolytic closing rate of K1250A CFTR channels (Fig. 2 F, gray bar) upon removal of ATP (Fig. 2 E, gray fit lines and time constants). Login to comment
117 (E) Macroscopic K1250A CFTR currents at &#e032;40 mV elicited by brief exposures to 10 mM ATP in the absence or presence of blockers. Current relaxations after ATP removal were fitted by single exponentials with time constants indicated. Login to comment
118 (F) Macroscopic K1250A closing rates in the absence of blocker (gray) and in the presence of 100 &#b5;M NPPB (brown), 80 mM MOPS&#e032; (green), or 100 &#b5;M NPPB + 80 mM MOPS&#e032; (striped). Login to comment
121 In the presence of 100 &#b5;M NPPB, K1250A closing rate was accelerated by approximately twofold (Fig. 2, E [top and bottom traces, brown fit line and time constant] and F [brown bar]). Login to comment
122 In contrast, 80 mM MOPS&#e032; neither affected K1250A closing rate (Fig. 2, E [top trace, green fit line and time constant] and F [green bar]), nor prevented the accelerating effect of 100 &#b5;M NPPB (Fig. 2, E [bottom trace, second application of NPPB] and F [striped bar]). Login to comment
125 To dissect potential effects of 3NB (the NPPB head) and 3PP (the NPPB tail) on permeation and gating, we first characterized effects on permeation using locked-open macroscopic K1250A CFTR currents at two different voltages (&#e032;80 and 60 mV). Login to comment
126 As expected, 3NB, which contains the pore-blocking carboxylate, dose-dependently suppressed currents through locked-open K1250A channels, and pore block was more pronounced at negative voltages, attesting to its voltage dependence (Fig. 3, A and B). Login to comment
130 (A, B, F, G, I, and J) Decaying macroscopic currents of locked-open K1250A CFTR channels after removal of ATP, recorded at membrane potentials of &#e032;80 (A, F, and I) or 60 mV (B, G, and J) and responses to brief applications of various concentrations of 3NB (A and B, blue bars), 3PP-sulfate (F and G, red bars), or sulfate (I and J, green bars). Login to comment
135 (D) Responses of decaying macroscopic locked-open K1250A CFTR current to brief applications of 32 mM 3NB (blue bars) at various membrane potentials. Login to comment
142 Thus, using macroscopic locked-open K1250A CFTR currents elicited at either &#e032;80 (Fig. 4, A, C, and E) or 60 mV (Fig. 4, B, D, F), we compared fractional effects of coapplying 32 mM 3NB with 210 &#b5;M NPPB (Fig. 4, A and B, blue and brown bars), 20 mM 3PP with 210 &#b5;M NPPB (Fig. 4, C and D, red and brown bars), or 32 mM 3NB with 20 mM 3PP (Fig. 4, E and F, blue and red bars) with the fractional effects of the same three compounds when applied in isolation at the respective concentrations. Login to comment
151 Indeed, at positive voltages only a small (&#e07a;10%) enhancement (rather than impairment) of the rate of ion flow through locked-open K1250A channels was observed at high 3PP concentrations (Fig. 3 G); a tentative fit to its dose-response curve yielded a K1/2 of &#e07a;10 mM (Fig. 3 H, red-yellow symbols and red fit line). Login to comment
154 Indeed, at &#e032;80 mV, exposure of locked-open K1250A CFTR channels to sulfate caused substantial pore block (Fig. 3 I) with similarly anomalous dose dependence, yielding maximal block at &#e07a;5 mM sulfate (Fig. 3 H, green-cyan symbols and green abscissa). Login to comment
167 (A-F) Responses of decaying macroscopic locked-open K1250A CFTR currents, recorded at membrane potentials of &#e032;80 (A, C, and E) or 60 mV (B, D, and F), to brief exposures to the following drug combinations: (A and B) 32 mM 3NB (blue bars) and/ or 210 &#b5;M NPPB (brown bars), (C and D) 20 mM 3PP (red bars) and/or 210 &#b5;M NPPB (brown bars), and (E and F) 32 mM 3NB (blue bars) and/or 20 mM 3PP (red bars). Login to comment
219 The effects on average unitary conductance of WT CFTR, as observed in heavily (at 50 Hz) filtered current traces (Fig. 7 A), were consistent with the predictions of the macroscopic pore-block assays performed on locked open K1250A channels (Fig. 3, C and H). Login to comment
228 To test this, we compared fractional effects of 3NB on steady-state macroscopic (I/Icontrol) and average unitary (i/icontrol) K1250A currents by applying 32 mM 3NB for extended time periods to channels gating at steady-state (in 10 mM ATP; Fig. 8 D, first and second 3NB applications) or briefly to locked-open channels after ATP removal (Fig. 8 D, third 3NB application, expanded in inset; this maneuver measures i/icontrol; compare with Fig. 3). Login to comment
229 (Note that to increase the success rate of very long recordings, all experiments on K1250A gating shown in Fig. 8 were performed at &#e032;20 mV.) Login to comment
230 Both application and removal of 3NB to K1250A channels, which are gating at steady-state, evoked simple monophasic current responses (Fig. 8 D; in contrast with Fig. 5 A), and the fractional current reduction under such conditions (Fig. 8 F, left gray bar) was well matched by the fractional effect on ATP removal in patches containing K1250A CFTR channels; the K1250A mutation (Fig. 8 C, cartoon, red stars) disrupts ATP hydrolysis (Fig. 8 C, cartoon, red cross; compare with Ramjeesingh et al. [1999]). Login to comment
231 Indeed, the presence of 32 mM 3NB accelerated K1250A closing rate by two- to threefold (Fig. 8, A [blue vs. gray fit lines and time constants] and C [blue vs. gray bar]), to a similar extent as reported for NPPB (Fig. 8 C, brown bar; replotted from Csan&#e1;dy and T&#f6;r&#f6;csik [2014]). Login to comment
232 In contrast, 20 mM 3PP, which did not significantly stimulate WT CFTR opening rate (Fig. 7 E), accelerated K1250A closing rate only slightly, by &#e07a;20% (Fig. 8, B and C [red vs. gray bar]). Login to comment
233 If 3NB indeed acted as a catalyst for the C1࢒O1 step, then the equilibrium between those two states (Fig. 8 G, cartoon, purple double arrow), as reflected by the open probability of the K1250A mutant (Keq = Po/(1 &#e032; Po)), Figure 8.ߓ Effects of 3NB and 3PP on gating rates under nonhydrolytic conditions. Login to comment
234 (A and B) Macroscopic K1250A CFTR currents at &#e032;20 mV, elicited by exposures to 10 mM ATP (gray bars) in the absence of drug or in the presence of either 32 mM 3NB (A, blue bar) or 20 mM 3PP (B, red bar). Login to comment
237 The K1250A mutation (cartoon, red stars) disrupts ATP hydrolysis in site 2 (red cross). Login to comment
238 (D and E) Macroscopic K1250A CFTR currents elicited by 10 mM ATP at &#e032;20 mV and prolonged exposures to 32 mM 3NB (D, blue bars) or 20 mM 3PP (E, red bars) of channels gating at steady-state. Login to comment
241 (F) Fractional K1250A CFTR currents at &#e032;20 mV in 32 mM 3NB (left pair of bars) or 20 mM 3PP (right pair of bars) applied during steady-state gating (gray bars) or in the locked-open state (yellow bars). Login to comment
243 Fractional effects on Po for K1250A CFTR were calculated as in Fig. 5 (D and H). Login to comment
252 Similarly, the small fractional effect of 20 mM 3PP on steady-state K1250A currents (Fig. 8, E and F [right gray bar]) was well explained by a similar small fractional increase in unitary conductance at this voltage (Fig. 8 F, right yellow bar), revealing no change in Po (Fig. 8 G, red bar). Login to comment

[hide] Cysteine accessibility probes timing and extent of... J Gen Physiol. 2015 Apr;145(4):261-83. doi: 10.1085/jgp.201411347. Chaves LA, Gadsby DC
Cysteine accessibility probes timing and extent of NBD separation along the dimer interface in gating CFTR channels.
J Gen Physiol. 2015 Apr;145(4):261-83. doi: 10.1085/jgp.201411347., [PMID:25825169]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) channel opening and closing are driven by cycles of adenosine triphosphate (ATP) binding-induced formation and hydrolysis-triggered disruption of a heterodimer of its cytoplasmic nucleotide-binding domains (NBDs). Although both composite sites enclosed within the heterodimer interface contain ATP in an open CFTR channel, ATP hydrolysis in the sole catalytically competent site causes channel closure. Opening of the NBD interface at that site then allows ADP-ATP exchange. But how frequently, and how far, the NBD surfaces separate at the other, inactive composite site remains unclear. We assessed separation at each composite site by monitoring access of nucleotide-sized hydrophilic, thiol-specific methanothiosulfonate (MTS) reagents to interfacial target cysteines introduced into either LSGGQ-like ATP-binding cassette signature sequence (replacing equivalent conserved serines: S549 and S1347). Covalent MTS-dependent modification of either cysteine while channels were kept closed by the absence of ATP impaired subsequent opening upon ATP readdition. Modification while channels were opening and closing in the presence of ATP caused macroscopic CFTR current to decline at the same speed as when the unmodified channels shut upon sudden ATP withdrawal. These results suggest that the target cysteines can be modified only in closed channels; that after modification the attached MTS adduct interferes with ATP-mediated opening; and that modification in the presence of ATP occurs rapidly once channels close, before they can reopen. This interpretation was corroborated by the finding that, for either cysteine target, the addition of the hydrolysis-impairing mutation K1250R (catalytic site Walker A Lys) similarly slowed, by an order of magnitude, channel closing on ATP removal and the speed of modification by MTS reagent in ATP. We conclude that, in every CFTR channel gating cycle, the NBD dimer interface separates simultaneously at both composite sites sufficiently to allow MTS reagents to access both signature-sequence serines. Relatively rapid modification of S1347C channels by larger reagents-MTS-glucose, MTS-biotin, and MTS-rhodamine-demonstrates that, at the noncatalytic composite site, this separation must exceed 8 A.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
181 In CFTR channels mutated at NBD2 Walker A K1250, open burst durations are prolonged by about one (K1250R) or two (K1250A) orders of magnitude, in oocyte patches at room temperature (Vergani et al., 2003, 2005; Csan&#e1;dy et al., 2006). Login to comment