ABCMdb

ABCC7 p.Lys1250Ala

None has been submitted yet.

Publications

PMID: 16442101 [PubMed] Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."

No. Sentence Comment

98 Two mutations, K464A (NBD1) and K1250A (NBD2) reduced ATP binding and hydrolysis [60-64]. Login to comment
99 K1250A abolished ATP hydrolysis by disrupting the catalytic activity because its position is in the P loop that forms the core of the ATP-binding pocket. Login to comment
103 Indeed, K1250A dramatically prolonged burst duration, suggesting that hydrolysis at NBD2 might be coupled to burst termination [52,65,67], whereas K464A slowed channel opening to a burst, suggesting that NBD1 might be a site of ATP interactions governing opening [68]. Login to comment

PMID: 10102935 [PubMed] Zeltwanger S et al: "Gating of cystic fibrosis transmembrane conductance regulator chloride channels by adenosine triphosphate hydrolysis. Quantitative analysis of a cyclic gating scheme."

No. Sentence Comment

7 Kinetic analysis of K1250A-CFTR, a mutant that abolishes ATP hydrolysis at NBD2, reveals the presence of two open states. Login to comment
34 We studied gating of CFTR in excised inside-out patches from NIH3T3 cells stably transfected with wild-type (wt) or K1250A-CFTR. Login to comment
36 This concentration dependence of the mean open time is more prominent in K1250A-CFTR, a mutant CFTR of which the conserved lysine residue in the Walker A motif of NBD2 is converted to alanine. Login to comment
38 m a t e r i a l s a n d m e t h o d s Cell Culture and Electrophysiology Both wt (Berger et al., 1991) and K1250A (lysine to alanine mutation) CFTR channels were stably expressed in NIH3T3 cells (NIH3T3-CFTR and NIH3T3-K1250A, respectively). Login to comment
39 NIH3T3-K1250A cells stably expressing K1250A-CFTR were established using the retroviral vector pLJ (a generous gift from Dr. Mitchell Drumm, Case Western Reserve University, Cleveland, OH). Login to comment
58 Curve fits of the time courses for deactivation by washout of AMP-PNP and ATP from patches containing wt-CFTR or the time courses for deactivation by washout of ATP from patches containing K1250A-CFTR were obtained by using the Igor software. Login to comment
153 due to ATP binding to NBD2, we next examined [ATP]-dependent gating of K1250A-CFTR, a mutant in which the conserved lysine in the Walker A motif of NBD2 is converted to alanine. Login to comment
155 Gating of K1250A-CFTR channels was examined in the presence of either 10 ␮M or 2.75 mM ATP. Login to comment
156 Fig. 6 A shows that a K1250A-CFTR channel, preactivated with PKA and ATP (not shown), was "locked" in an open state with 2.75 mM ATP and the channel closed ‫2ف‬ min after ATP washout. Login to comment
159 The single channel amplitude, obtained from the all-point histograms (not shown), of K1250A-CFTR channels opened with millimolar ATP is about the same as that for brief openings in the presence of 10 ␮M ATP (Fig. 6 B). Login to comment
162 To quantify the brief openings of K1250A-CFTR in the presence of 10 ␮M ATP, dwell time analysis of the cumulative open time from three different patches was performed. Login to comment
164 Since the "locked open" time of K1250A-CFTR is apparently very long (Fig. 6 A), it will be very difficult to collect enough events for dwell time analysis. Login to comment
165 Even if we obtain patches containing a single K1250A-CFTR channel, the flickering closures in locked open state may interfere with the analysis. Login to comment
166 Although excluding closing intervals Ͻ80 ms is appropriate for eliminating flickers in analysis of wt-CFTR, this exclusion is not sufficient to eliminate flickers from analysis of K1250A-CFTR because the ratio of flickers to "true" closings (gating) of CFTR is much higher. Login to comment
168 At this concentration, most of K1250A-CFTR channels are locked open, as can be judged from the small magnitude of macroscopic current fluctuations (Fig. 6 D). Login to comment
172 These results suggest that, at low micromolar [ATP], K1250A-CFTR can assume brief openings with a time constant close to that of wt-CFTR at equivalent [ATP], but this mutant CFTR Figure 6. Login to comment
173 ATP concentration dependence of the channel open time for K1250A-CFTR. Login to comment
174 (A) A continuous current trace of K1250A-CFTR in the presence or absence of ATP. Login to comment
178 (B) Single channel amplitudes of K1250A-CFTR (obtained from all point histograms of 30 s recordings) at 10 ␮M or 2.75 mM ATP. Login to comment
179 (C) The open time histogram of K1250A-CFTR at 10 ␮M ATP. Login to comment
182 (D) Slow closing of PKA-phosphorylated K1250A-CFTR. Login to comment
185 Macroscopic relaxation of the K1250A-CFTR channel current was constructed from multiple washouts of ATP from the same patch. Login to comment
188 Assuming ATP is not hydrolyzed by the NBD2 of K1250A-CFTR, the slow closing rate reflects a slow dissociation of ATP from CFTR (presumably from NBD2). Login to comment
189 If the brief openings of K1250A-CFTR at 10 ␮M ATP represent open channel conformations without NBD2 being occupied, this observation suggests that CFTR can close even when ATP acts exclusively on NBD1 (see Carson et al., 1995; also see discussion). Login to comment
205 This stabilizing effect is greatly magnified when hydrolysis at NBD2 is eliminated, either through chemical modification of the binding molecule (AMP-PNP) or molecular alteration of the CFTR protein itself (i.e., K1250A mutation). Login to comment
243 We clearly resolve two open times with K1250A-CFTR and demonstrate a dramatic [ATP] dependence of the channel open time for this mutant CFTR. Login to comment
244 One interesting observation is that at 10 ␮M ATP, the mean open time for K1250A-CFTR is ‫052ف‬ ms, a value very close to that for wt-CFTR at the equivalent [ATP]. Login to comment
247 Based on this interpretation, the brief opening with K1250A-CFTR is coupled to hydrolysis of one ATP molecule at NBD1 and subsequently the channel can close without ATP hydrolysis at NBD2. Login to comment
249 This same observation that the open time of K1250A-CFTR depends on [ATP] is also inconsistent with the proposal that ATP binding at NBD2 opens the channel (Gunderson and Kopito, 1995). Login to comment
250 According to this latter model, every opening of K1250A-CFTR should last for minutes. Login to comment
262 The fact that this short open time constant is very close to the mean open time of K1250A-CFTR at 10 ␮M ATP further supports this assignment. Login to comment
309 Carson et al. (1995), using 20 ms as a cutoff, reported a mean burst time of ‫1ف‬ s for K1250A-CFTR. Login to comment
310 This number is evidently an underestimation of the true ATP-coupled open time for K1250A-CFTR as a continuous burst of opening that lasts for minutes is observed even when ATP is removed (Fig. 6 A). Login to comment
342 Assuming the opening rate of K1250A-CFTR is the same as that of wt-CFTR, our kinetic data suggest a maximal ATP hydrolysis rate of ‫500.0ف‬ s-1, which is 1/200 of that for wt-CFTR. Login to comment
343 Recent preliminary data that K1250A-CFTR has a drastically reduced rate of ATP hydrolysis support this coupled ATP turnover hypothesis (Ramjeesingh et al., 1998). Login to comment

PMID: 10398691 [PubMed] Csanady L et al: "CFTR channel gating: incremental progress in irreversible steps."

No. Sentence Comment

13 The CFTR mutants K464A and K1250A, for instance, lie at the heart of challenges to the simple answers to both key questions. Login to comment
14 Thus, K1250A channels not only close much more slowly than wild-type (WT) channels, they also open more slowly, drawing speculation that ATP binding at NBD2 (rather than hydrolysis at NBD1) might trigger channel opening (Gunderson and Kopito, 1995; compare Sheppard and Welsh, 1999). Login to comment
15 And recent direct measurements on purified, reconstituted CFTR have revealed virtual abolition of ATPase activity by K1250A, a more than sevenfold reduction of ATP hydrolysis (compared with WT) for K464A, but only an approximately twofold decrement in open probability (Po) for K1250A channels (because the effect of their markedly slower closing is more than offset by that of their slowed opening) and an even smaller drop in Po (due to slightly slower opening) for K464A relative to WT (Ramjeesingh et al., 1999), prompting the conclusion that ATP hydrolysis and channel gating are not tightly coupled. Login to comment
16 As pointed out by Zeltwanger et al. (1999) (compare Gadsby and Nairn, 1999), it is not difficult to explain the K1250A findings, since the very low ATPase activity correlates well with observations of very few openings (still conceivably associated with ATP hydrolysis at NBD1) and, after very long open times, an equal number of closings that are presumably associated with dissociation of the ATP, not its hydrolysis, at NBD2. Login to comment
44 Zeltwanger et al. (1999) examined K1250A CFTR channels and found, at millimolar ATP, the extremely long open times (mean ~3 min) reported by others, but, at 10 ␮M ATP, only the same brief openings (mean ~250 ms) observed for WT CFTR at low [ATP]. Login to comment
46 In other words, the brief openings of both WT and K1250A CFTR channels are interpreted as simply reflecting ATP binding and hydrolysis, and dissociation of the hydrolysis products, at NBD1. Login to comment

PMID: 10398692 [PubMed] Weinreich F et al: "Dual effects of ADP and adenylylimidodiphosphate on CFTR channel kinetics show binding to two different nucleotide binding sites."

No. Sentence Comment

324 Their conclusions were derived from studying the gating (temperature not specified) and the ATPase activity (at 30ЊC) of purified CFTR protein, either WT or the mutants K464A or K1250A. Login to comment
325 However, in contrast to their open burst duration for the mutant K1250A of 265 ms (temperature not specified) are dramatically increased open burst durations found by other groups (65 s for Gunderson and Kopito, 1995; 3 min for Zeltwanger et al., 1999; both at room temperature). Login to comment
326 Carson et al. (1995) found an open burst duration for K1250A at 34-36ЊC of ‫1ف‬ s. Login to comment

PMID: 10880569 [PubMed] Ikuma M et al: "Regulation of CFTR Cl- channel gating by ATP binding and hydrolysis."

No. Sentence Comment

36 In CFTR, the NBD1 mutation K464A reduces ATPase activity to Ϸ15%, and the NBD2 mutation K1250A eliminates ATPase activity (24). Login to comment
39 Strikingly, a variant with both NBDs mutated (K464A͞K1250A) showed significant activity and gating not different from CFTR-K1250A (10). Login to comment
123 Prolongation of the burst duration is similar to the result of two other interventions that allow nucleotide binding but not hydrolysis: binding of the nonhydrolyzable AMP-PNP (9, 10, 16, 17, 38) and an NBD2 mutation that prevents hydrolysis, K1250A (10, 11, 14, 24). Login to comment
136 We tested variants with mutations in the Walker A lysine, CFTR-K464A and -K1250A. Login to comment
140 With MgATP, CFTR-K1250A showed prolonged bursts (Fig. 3 B and C), as previously reported (10, 11, 14, 24). Login to comment
144 There are two potential explanations for the difference between K464A and K1250A. Login to comment
155 Therefore, we studied CFTR-K1250A and CFTR-K464A at two different ATP concentrations. Login to comment
156 With 1 mM ATP and 4 mM Mg2ϩ , CFTR-K1250A showed prolonged bursts, but with a low MgATP concentration (5-20 ␮M ATP and 4 mM Mg2ϩ ), burst duration decreased (Fig. 4 A and C). Login to comment
159 This might prevent the channel from entering the prolonged bursts that result from NBD2 gating in K1250A. Login to comment
189 The K1250A variant has a similar effect, blocking the O1 3 O2 transition and thereby prolonging bursts with MgATP (Fig. 3). Login to comment
190 In contrast, with ATP alone, the O1 state of K1250A is unstable and ATP dissociates more quickly (Fig. 3). Login to comment
192 This result suggests that the K1250A mutation reduces ATP binding to NBD2. Login to comment
203 Effect of MgATP and ATP alone on CFTR-K1250A and -K464A. Login to comment
238 Effect of ATP concentration on gating of CFTR-K1250A (A and C) and K464A (B and D) channels. Login to comment

PMID: 10919864 [PubMed] Chan KW et al: "Severed molecules functionally define the boundaries of the cystic fibrosis transmembrane conductance regulator's NH(2)-terminal nucleotide binding domain."

No. Sentence Comment

319 Moreover, mutant K1250A CFTR channels, in which ATP hydrolysis at NBD2 is severely impaired (Ramjeesingh et al., 1999), show brief WT-like openings at low micromolar [ATP], but extremely long openings at higher [ATP] that reflect binding at NBD2 of ATP that cannot be hydrolyzed (Zeltwanger et al., 1999); those results imply that the brief openings at low [ATP] involve only NBD1. Login to comment

PMID: 10962022 [PubMed] Csanady L et al: "Severed channels probe regulation of gating of cystic fibrosis transmembrane conductance regulator by its cytoplasmic domains."

No. Sentence Comment

40 CFTR-K1250A was a gift from Dr. David Dawson (Oregon Health Sciences University, Portland, OR), and was subcloned into pGEMHE to give pGEMHE-K1250A. Login to comment
41 pGEMHE-837-1480(K1250A) was made using pGEMHE-K1250A as template, primers SK837FW (5Ј-TCCCCC- GGGCCGCCATGGAGAGCATACCAGCAGTGACT) and SP6 RV, followed by subcloning. Login to comment
79 [Typically, tc was 30-80 ms, 400-800 ms for cut-⌬R(K1250A).] Login to comment
252 Severed Channels with no R Domain, but with NBD2 Walker-A Mutation, Display Prolonged Bursts To probe the role of NBD2 function in cut-⌬R channels, we introduced the Walker-A lysine (Walker et al., 1982) mutation in NBD2, K1250A. Login to comment
253 In excised patches, cut- ⌬R(K1250A) channels had similar conductance to WT CFTR, required MgATP for activity but (like the other cut channels with no R domain) were active without exposure to PKA, and their activity was dominated by long open bursts, each interrupted by many (six to eight on average) flickery closures (Fig. 10 A; note time scale). Login to comment
256 Consistent with the interpretation that the prolonged bursts reflect nonhydrolytic binding of ATP at NBD2, these mean burst durations of cut-⌬R(K1250A) were comparable with the time constants of the slow components of current relaxation after exposure of cut-⌬R channels to AMPPNP at the corresponding temperatures (5.8 Ϯ 0.4 s and 13.5 Ϯ 2 s at 25Њ and 20ЊC, respectively; Figs. 6 D and 9; and Table II). Login to comment
257 To avoid the difficulties of steady state kinetic analysis, we examined the current relaxation after ATP removal in patches containing cut-⌬R(K1250A) channels. Login to comment
261 Analysis of the Ͻ100 isolated bursts recorded from cut-⌬R(K1250A) channels indicated a double-exponential distribution (Fig. 10 C), suggesting two distinct populations of bursts, although both components Figure 8. Login to comment
284 Walker-A mutant cut-⌬R(K1250A) [633ϩ837 (K1250A)] channels show prolonged open bursts. Login to comment
285 (A) Representative baseline-subtracted record of single cut-⌬R(K1250A) channel in 2 mM MgATP, no PKA, at 25ЊC. Login to comment
286 (B) Current relaxation of cut- ⌬R(K1250A) channels after removal of 2 mM MgATP (no PKA), constructed by summing synchronized decay currents from nine experiments, at 25ЊC; single-exponential fit (solid line) to quasi-macroscopic current decay gave ␶ ϭ 6.7 s. Login to comment
288 (C) Survivor function of burst durations, after exclusion of flickery closures, of cut-⌬R(K1250A) channels in 2 mM MgATP, constructed from events isolated from a total of 16 min of recordings suitable for such analysis, including 10 min from a single channel. Login to comment
306 (Strictly, if ADP leaves (SCHEME I) (SCHEME II) NBD2 during O1 → O2, that step is irreversible in the absence of ADP, and WT channels unlocking from AMPPNP, or K1250A channels closing from long bursts in ATP, must close through a state distinct from O1: the four-state schemes are clearly oversimplified.) Login to comment
401 ATP Binding to NBD2 of Severed Channels Lacking an R Domain Is Supported by Prolonged Bursts of Cut-⌬R(K1250A) Mutation of K1250 practically abolishes ATP hydrolysis in CFTR (Ramjeesingh et al., 1999), as does mutation of Walker-A lysines in other ABC transporters (e.g., Loo and Clarke, 1994; Müller et al., 1996). Login to comment
402 In intact CFTR, the K1250A mutation results in extremely long open bursts, comparable with those seen with AMPPNP, interpreted as nonhydrolytic tight binding of ATP to NBD2 (Carson et al., 1995; Gunderson and Kopito, 1995). Login to comment
403 If ATP can occupy NBD2 in severed CFTR channels with no R domain, then cut-⌬R(K1250A) channels ought to show prolonged bursts (like those induced by AMPPNP in cut-⌬R channels) whenever NBD2 binds ATP, since k3 ϭ 0. Login to comment
405 The large fraction of prolonged openings in cut-⌬R(K1250A) channels seems paradoxical, because only a small fraction of the bursts of cut-⌬R channels belonged to the slow component of the distribution (Fig. 8), implying that few bursts involved binding of ATP to the stabilizing site. Login to comment
406 Intriguingly, the same paradox seems to apply to intact K1250A CFTR channels, which also showed predominantly long openings under conditions where WT channels were only inefficiently locked by AMPPNP (see Carson and Welsh, 1993; Carson et al., 1995). Login to comment
407 Despite technical difficulties, such as excessive numbers of flickery closures coupled with the small overall number of bursts recorded, the distribution of cut- ⌬R(K1250A) burst durations indicated a mixture of two populations, both with lifetimes longer than the corresponding populations for cut-⌬R channels (Fig. 10 C). Login to comment
408 According to Scheme I, the slower components of those distributions reflect k3 for cut-⌬R channels, but k-2 for cut-⌬R(K1250A) channels. Login to comment
409 But the observation that the faster component was approximately fivefold prolonged for cut-⌬R(K1250A) channels, if correct, suggests that rate k-1 is also slowed in these channels, which would provide, during each burst, a longer time window for ATP to bind to NBD2. Login to comment
411 However, intact K1250A CFTR channels showed brief (‫-002ف‬ms) bursts at 10 ␮M ATP comparable with WT (Zeltwanger et al., 1999), and we occasionally saw comparably brief reopenings of cut- ⌬R(K1250A) channels in macropatches during ATP washout, when [ATP] was extremely low. Login to comment
412 In any event, an influence of the Walker-A mutation on more than one rate constant is not unexpected, since cut- ⌬R(K1250A) channels were also ‫-01ف‬fold slower in opening (␶ib ϭ 25 Ϯ 12 s in the absence of PKA, n ϭ 4) than cut-⌬R channels (␶ib ϭ 3.1 Ϯ 0.7 s in the absence of PKA, n ϭ 18; Table I), just like full-length K1250A CFTR channels, which reportedly open far more slowly than WT (Carson et al., 1995). Login to comment
465 For cut-⌬R(K1250A) channels, all parameters were measured in the absence of PKA. Login to comment
477 Parameters ash, al, ␶sh, and ␶l are fractional amplitudes and time constants of exponential components describing the distributions (Fig. 8) of burst durations (note al ϭ 1 - ash is not a free parameter); ␶b is mean burst duration, measured in the presence of PKA for WT and 633ϩ634, or pooled from all experiments for 835ϩ837, cut-⌬R (633ϩ837), and Flag-cut-⌬R (F633ϩ837); ␶AMPPNP and alocked are the time constant and fractional amplitude of the slowly relaxing macroscopic current component after removal of AMPPNP and ATP (see Table II); ␶relax and arelax, analogous, after just ATP, for cut-⌬R(K1250A) [633ϩ837(K1250A); Fig. 10 B]. Login to comment
480 The value of k1 KPo was obtained as the reciprocal of ␶ib in the presence of 2 mM MgATP and PKA (except for cut-⌬R(K1250A) channels, for which all data were obtained in the absence of PKA; apparent affinity was not measured for this construct). Login to comment
484 ***Rate k3, representing a compound step including ATP hydrolysis at NBD2, was set to zero for cut-⌬R(K1250A). Login to comment
486 Comparing cut-⌬R(K1250A) with cut-⌬R, the fit for the Walker-A mutant predicted nucleotide on and off rates at NBD2 (k2 and k-2) similar to those of cut-⌬R. However, to account for the observed distribution of bursts of the Walker mutant, k-1 had to be slowed by an order of magnitude compared with cut-⌬R channels, which, together with a similar decrease in opening rate (compare k1 with basal opening rate of cut-⌬R), calls into question either the assumed local nature of the effect on channel structure of the Walker-A point mutation, or all gating models in which the influence of ATP hydrolysis at NBD2 is limited to channel closure. Login to comment
496 Cut-⌬R channels seem capable of binding ATP at NBD2, evident from the locking effect of AMPPNP [and from the prolonged openings of cut- ⌬R(K1250A) channels], but the affinity of this binding site for nucleotide seems considerably lower than in phosphorylated WT channels (Figs. 6-8, and 10). Login to comment
500 We thank Dr. David Dawson for the CFTR K1250A clone, Atsuko Horiuchi and Peter Hoff for technical assistance, and Kate Hall for help with the preparation of the manuscript. Login to comment

PMID: 11160632 [PubMed] Al-Nakkash L et al: "A common mechanism for cystic fibrosis transmembrane conductance regulator protein activation by genistein and benzimidazolone analogs."

No. Sentence Comment

1 We conclude that benzimidazolone analogs and genistein act through a common mechanism, based on the following evidence: 1) both act only on phosphorylated CFTR, 2) the maximal ⌬F508-CFTR current activated by benzimidazolone analogs is identical to that induced by genistein, 3) benzimidazolone analogs increase the open probability of the forskolin-dependent ⌬F508-CFTR channel activity through an increase of the channel open time and a decrease of the channel closed time (effects indistinct from those reported for genistein), and 4) the prolonged K1250A-CFTR channel open time (in the presence of 10 ␮M forskolin) is unaffected by benzimidazolone analogs or genistein, supporting the hypothesis that these compounds stabilize the open state by inhibiting ATP hydrolysis at nucleotide binding domain 2 (NBD2). Login to comment
3 From our studies with the double mutant ⌬F508/K1250A-CFTR, we conclude that benzimidazolone analogs and genistein rectify the ⌬F508-CFTR prolonged closed time independent of their effects on channel open time, since these agonists enhance ⌬F508/K1250A-CFTR activity by shortening the channel closed time. Login to comment
34 Neither benzimidazolone analogs nor genistein potentiate cAMP-dependent K1250A-CFTR activity, a nucleotide binding domain 2 mutant with a prolonged open time due to diminished ATP hydrolysis activity. Login to comment
35 Although the ⌬F508-CFTR channel open time is increased by introducing the K1250A mutation into the ⌬F508 background, the prolonged closed time is unaffected, suggesting that the prolonged closed time associated with the ⌬F508 mutation is independent of channel open time. Login to comment
36 Since benzimidazolone analogs and genistein enhance ⌬F508/K1250A-CFTR activity by shortening the channel closed time, we conclude that their rectification of the ⌬F508-CFTR prolonged closed time is independent of their effects on the channel open time. Login to comment
38 Materials and Methods Cell Culture NIH3T3 mouse fibroblast cells stably expressing either ⌬F508-CFTR or K1250A-CFTR were prepared as described previously (Berger et al., 1991; Zeltwanger et al., 1999). Login to comment
39 The ⌬F508/K1250A-CFTR double mutation was generated as follows. Login to comment
40 Plasmids containing ⌬F508-CFTR (⌬F508pRBG4) or K1250A-CFTR (K1250ApRBG4) were generously provided by Dr. R. R. Kopito (Stanford University, Stanford, CA). Login to comment
44 Using Superfect reagent (Qiagen, Valencia, CA), the ⌬F508/K1250A-CFTR double mutant was transiently transfected into NIH3T3 mouse fibroblast cells, according to the manufacturer`s protocol. Login to comment
188 Effects of NS004 and NS1619 on K1250A-CFTR. Login to comment
189 To further corroborate our evidence that NS004 and NS1619 act to stabilize the channel open state, we examined the effect of these drugs upon the K1250A-CFTR mutant channel. Login to comment
191 Figure 7 shows a representative recording of K1250A-CFTR in a cell-attached patch. Login to comment
193 Fold increases in mean K1250A-CFTR current amplitude were 1.09 Ϯ 0.11 (n ϭ 3) and 1.15 Ϯ 0.18 (n ϭ 3), respectively. Login to comment
195 In the same patch forskolin alone can reactivate the K1250A-CFTR current, and subsequent addition of 20 ␮M genistein had minimal effect on the current (fold increase ϭ 1.03 Ϯ 0.02, n ϭ 5). Login to comment
197 Thus, neither benzimidazolone analogs nor genistein altered the Po of K1250A-CFTR in the presence of a maximal concentration of forskolin. Login to comment
198 We further examined the effect of benzimidazolone analogs and genistein upon the open time of K1250A-CFTR. Login to comment
199 In cell-attached patches, steady-state macroscopic K1250A-CFTR current was generated by forskolin alone or forskolin plus either genistein or NS004 (each 20 ␮M); the patch was then excised into an ATP-free bath. Login to comment
203 These data demonstrate that the open time of the K1250A-CFTR channels activated with a maximally effective concentration of forskolin (10 ␮M) is not affected by either genistein or benzimidazolone analogs. Since neither the Po nor the open time of K1250A-CFTR is affected by genistein or benzimidazolone analogs, we conclude that the closed time of K1250A-CFTR is not affected when the cAMP pathway is maximally activated. Login to comment
204 The fact that these drugs do not change the open time of K1250A-CFTR is consistent with the idea that genistein acts by inhibiting ATP hydrolysis at NBD2 (Wang et al., 1998; Randak et al., 1999). Login to comment
205 However, a lack of effect on the K1250A-CFTR mutant could be caused by an obliteration of the binding site for these compounds by the mutation. Login to comment
206 This is perhaps not the case, since these reagents increase K1250A-CFTR channel activity when the cAMP stimulation is submaximal. Login to comment
207 Like wt-CFTR, the activity of K1250A-CFTR can be manipulated using different concentrations of forskolin (Al-Nakkash and Hwang, 1999). Login to comment
208 For example, sequential addition of 100 nM and then 10 ␮M forskolin to the bath solution generates an incremental increase in the steady-state macroscopic K1250A-CFTR current (data not shown). Login to comment
209 Under conditions that produce submaximal stimulation of the cAMP-dependent K1250A-CFTR channel activation (i.e., 100 nM forskolin), benzimidazolone analogs enhanced mean K1250A-CFTR current. Login to comment
210 In the presence of 100 nM forskolin, 50 nM and 20 ␮M NS004 increased the K1250A-CFTR current by 6.22 Ϯ 2.55-fold (n ϭ 6) and 19.09 Ϯ 9.71-fold (n ϭ 6), respectively. Login to comment
212 These data suggest, for those K1250A-CFTR channels that are not maximally stimulated (i.e., have not attained a maximum Po), that benzimidazolone analogs can potentiate the cAMP-dependent channel current. Login to comment
213 Effect of NS004 and NS1619 upon the ⌬F508/K1250A Double Mutation. Login to comment
217 To address this, we examined the effects of benzimidazolone analogs and genistein on the double mutant ⌬F508/K1250A-CFTR. Login to comment
218 Figure 8A shows a 30-min cell-attached recording from an NIH3T3 cell expressing ⌬F508/K1250A-CFTR. Login to comment
224 Effect of NS1619 and genistein upon forskolin-dependent K1250A-CFTR channel current. Login to comment
225 In this continuous cell-attached recording (lasting 50 min), the application of 10 ␮M forskolin elicits a macroscopic K1250A-CFTR current. Login to comment
227 Similarly, there is no effect of 20 ␮M genistein upon the steady-state macroscopic K1250A-CFTR current generated by 10 ␮M forskolin. Login to comment
228 The expanded section shows the closure of all K1250A channels upon removal of agonists and a return to basal activity (expanded trace lasts for 200 s). Login to comment
230 K1250A mutation into the ⌬F508-CFTR background does not rectify the functional defect associated with ⌬F508-CFTR and that NS004 greatly potentiates the Po of ⌬F508/K1250A-CFTR. Login to comment
232 In this cell-attached patch recording of ⌬F508/K1250A-CFTR, one single channel opens for 20 s in the presence of forskolin alone (a phenotype for the K1250A-CFTR mutation), but the channel is predominantly closed (a phenotype for the ⌬F508-CFTR mutation). Login to comment
263 Effect of NS004 and NS1619 on ⌬F508/K1250A current. Login to comment
264 A, 30-min continuous recording showing the effect of NS004 on forskolin-dependent macroscopic ⌬F508/K1250A-CFTR current. Login to comment
267 B, effect of NS1619 on forskolin-dependent ⌬F508/ K1250A-CFTR channel current in a patch containing one single channel. Login to comment
273 Last, neither benzimidazolone analogs nor genistein can potentiate K1250A-CFTR channel current activated by a maximally effective concentration of forskolin. Login to comment
275 We show, from macroscopic relaxation analysis, that the open time for K1250A-CFTR is not changed by benzimidazolone analogs or genistein, supporting the hypothesis that these compounds stabilize the open state by inhibiting ATP hydrolysis at NBD2. Login to comment
285 First, when K1250A-CFTR is submaximally stimulated with nanomolar forskolin, the closed time can still be decreased by benzimidazolone analogs. Login to comment
286 Second, when the double mutant ⌬F508/ K1250A-CFTR is stimulated with a maximally effective concentration of forskolin, the prolonged open time caused by the K1250A mutation does not automatically correct the abnormally long closed time associated with the ⌬F508 mutation. Login to comment

PMID: 11279083 [PubMed] Aleksandrov L et al: "Differential interactions of nucleotides at the two nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

23 EXPERIMENTAL PROCEDURES Materials- BHK-21 cells stably expressing wild-type human CFTR were prepared and maintained as described previously (20) as were cells expressing the K464A and K1250A mutants. Login to comment
63 A, membranes from BHK cells expressing wild-type and the K1250A (15 ␮g of protein) and K464A variants (60 ␮g of protein) were incubated with 20 ␮M 8-azido-[␣-32 P]ATP in the presence of 0.5 mM orthovanadate and processed as under "Experimental Procedures." Login to comment
69 (K1250A) is reduced only a small amount compared with wild type indicating that normally there may be little hydrolysis and trapping at NBD2. Login to comment

PMID: 11306662 [PubMed] Zhou Z et al: "Voltage-dependent flickery block of an open cystic fibrosis transmembrane conductance regulator (CFTR) channel pore."

No. Sentence Comment

8 Fast flickery block of the cystic fibrosis transmembrane conductance regulator (CFTR) was studied with cell-attached and whole-cell patch-clamp recordings from mouse NIH3T3 cells stably expressing a mutant CFTR channel, K1250A-CFTR. Login to comment
12 Flickering block of K1250A-CFTR channels was voltage dependent since the open probability within an opening burst decreased as the membrane was hyperpolarized. Login to comment
22 Results from macroscopic current noise analysis of both wild-type CFTR and K1250A-CFTR channels further confirm the voltage dependence and Cl_ sensitivity of the fast flickery block observed with single-channel analysis. Login to comment
38 To overcome these technical difficulties, we characterized the kinetics of the flickery blockade using the CFTR mutant K1250A in which the conserved Walker A lysine (K) at amino acid position 1250 located in NBD2 is replaced by the neutral amino acid alanine (A). Login to comment
40 Within a long opening of K1250A-CFTR, fast flickers are clearly discernible (Zeltwanger et al. 1999). Login to comment
42 In the present paper, fast flickery block of CFTR was studied with cell-attached and whole-cell patch-clamp techniques in NIH3T3 cells stably expressing wild-type or K1250A-CFTR. Login to comment
46 Using spectrum analysis of macroscopic K1250A-CFTR and wild-type CFTR currents, we obtained corner frequencies (fc) at different membrane potentials. Login to comment
47 The measured fc agreed well with the fc calculated from the single-channel kinetic parameters obtained for K1250A-CFTR channels. Login to comment
50 METHODS Cell culture NIH3T3 cell lines stably expressing wild-type CFTR (Anderson et al. 1991) or K1250A-CFTR (Zeltwanger et al. 1999) were grown at 37°C and 5 % CO2 in Dulbecco`s Modified Eagle`s Medium (DMEM) supplemented with 10% fetal bovine serum. Login to comment
62 To obtain single-channel recordings, we activated multiple K1250A-CFTR channels with 10 µM forskolin, then washed out the forskolin and observed current decay. Login to comment
64 Under this condition, once the K1250A-CFTR channel closes from the activated state, it remains closed unless forskolin is re-applied. Login to comment
97 Noise analysis Macroscopic K1250A-CFTR or wild-type CFTR currents in cell-attached patches were elicited with 10 µM forskolin. Login to comment
99 At least 60 s of K1250A-CFTR current recordings or 180 s of wild-type CFTR current recordings were fast Fourier transformed to generate noise spectra that were further analysed in a bandwidth of 9.7-600 Hz for K1250A-CFTR or 3.9-800 Hz for wild-type CFTR with Igor software. Login to comment
100 Data from K1250A-CFTR were fitted with a single Lorentzian function to estimate the Lorentzian parameters: S(f) = S0/(1 + (f/fc)2 ) + S1, where fc is the corner frequency, S0 is the zero-frequency asymptote, S1 is non-specific basal noise and S(f) is the spectral density at the frequency f. Data from wild-type CFTR were fitted with the sum of two Lorentzian components: S(f) = S0/(1 + (f/fc1)2 ) + S1/(1 + (f/fc2)2 ) + S2, where S0 and S1 are the zero-frequency asymptotes corresponding to fc1 and fc2, respectively, and S2 is the basal noise. Login to comment
101 RESULTS Voltage-dependent fast flickery block of the K1250A-CFTR channels It has been shown previously that in cell-attached patches, the inward CFTR current shows more flickering events than the outward current, and that the number of these fast flickers is dramatically reduced upon patch excision (Haws et al. 1992; Fischer & Machen, 1994, 1996). Login to comment
102 The flickering block of K1250A-CFTR channels shares these two characteristic features with wild-type channels. Login to comment
103 Figure 1A shows that the fast flickery events present in a cell-attached patch from NIH3T3 cells stably expressing K1250A-CFTR channels were reduced in frequency upon patch excision. Login to comment
109 The fast flickery block of K1250A-CFTR channels also showed clear voltage dependence when recorded in the cell-attached configuration. Login to comment
112 Fast flickery block of K1250A-CFTR channels A, the fast flickery events diminished dramatically after patch excision. Login to comment
113 A cell-attached patch from an NIH3T3 cell stably expressing the K1250A-CFTR channel was held at _70 mV (_Vp). Login to comment
121 Voltage dependence of the fast flickery block of K1250A-CFTR channels A, representative single-channel current traces at different potentials (_Vp) recorded in the cell-attached configuration with 154 mM Cl_ pipette solution. Dotted lines indicate the baseline current level. Login to comment
132 In the present study, similar observations were made with the K1250A-CFTR channel. Login to comment
168 Voltage-dependent block of the whole-cell K1250A-CFTR current Our single-channel recordings were filtered at 100 Hz (dead time = 3 ms) in order to obtain a reasonable signal-to-noise ratio for dwell time analysis. Login to comment
172 Under symmetrical Cl_ conditions with 125 mM Cl_ in both the external and the internal solutions, the whole-cell instantaneous I-V relationship of K1250A-CFTR was linear whereas the steady-state I-V relationship was somewhat outwardly rectifying (data not shown). Login to comment
180 Flickery block of K1250A-CFTR in the absence of external Cl_ Representative single-channel current traces at different potentials (_Vp) recorded from a cell-attached patch with 0 mM Cl_ pipette solution. Dotted lines indicate the baseline current level. Login to comment
185 Voltage-dependent block of the whole-cell K1250A-CFTR current A, net CFTR currents were determined by subtracting the current response of the cell in the absence of forskolin from that in the presence of 10 µM forskolin with 125 mM internal Cl_ and 11 mM external Cl_ . Login to comment
186 The cAMP-activated K1250A-CFTR current density was 55 ± 12 pA pF_1 at 0 mV holding potential (n = 4). Login to comment
209 Noise analysis of macroscopic K1250A-CFTR and wild-type CFTR currents Ideally, one should analyse single-channel kinetics on data that are lightly filtered in order to obtain more reliable kinetic parameters. Login to comment
212 Macroscopic K1250A-CFTR currents were evoked by 10 µM forskolin in cell-attached patches from NIH3T3 cells stably expressing K1250A-CFTR. Login to comment
214 Figure 6 shows representative noise spectra of K1250A-CFTR macroscopic currents recorded at _50 mV in a cell-attached patch. Login to comment
226 K1250A-CFTR current noise spectra of recordings filtered at two different frequencies Macroscopic K1250A-CFTR currents, activated with 10 µM forskolin in a cell-attached patch held at _50 mV, were filtered at 1 kHz (A) or 5 kHz (B). Login to comment
238 On the other hand, fc2 was in the frequency range of the fast flickery events seen in K1250A-CFTR channels. Login to comment
239 Furthermore, fc2 showed a similar voltage dependence to that observed in K1250A-CFTR channels (Fig. 9B). Login to comment
241 Effects of voltage and external Cl_ on K1250A-CFTR current noise spectra Comparison of normalized K1250A-CFTR current noise spectra at _100 mV (0) and +50 mV (1) with 154 mM external Cl_ (A) and with 0 mM external Cl_ (B). Login to comment
248 Comparison of fc estimated from noise analysis and fc calculated from kinetic parameters from single-channel analysis Filled circles represent mean fc at _100, _50, _20 and +50 mV estimated from noise analysis of K1250A-CFTR macroscopic currents in the presence of 154 mM external Cl_ . Login to comment
250 fast flickery block of K1250A-CFTR channels is probably applicable to wild-type CFTR channels. Login to comment
275 Results from noise analysis of macroscopic K1250A-CFTR current further verify our conclusions Z. Zhou, S. Hu and T.-C. Hwang444 J. Physiol. 532.2 Figure 9. Login to comment
285 One concern of using the CFTR mutant K1250A-CFTR to study the mechanism of fast flickery block is whether K1250A-CFTR and wild-type CFTR share the same mechanism of voltage-dependent flickery block. Login to comment
288 Since fc2 of wild-type CFTR channels shows a similar voltage dependence to that of K1250A-CFTR (Fig. 9B), we believe that the voltage-dependent mechanism proposed for the fast flickery block of K1250A-CFTR channels is probably also applicable to wild-type CFTR channels. Login to comment
289 It is worth noting, however, that fc2 of wild-type CFTR channels is slightly higher than the fc of the fast flickers seen in K1250A-CFTR channels. Login to comment
328 In this study, we took the advantage of the CFTR mutant K1250A-CFTR, which can be 'locked` open for minutes to allow more accurate kinetic analysis of the flickery block of CFTR channels. Login to comment
331 We believe future studies of channel blockade in K1250A-CFTR channels by exogenously applied blockers could provide useful information on the mechanism of CFTR blockade as well as on the structure of the CFTR pore. Login to comment

PMID: 11341822 [PubMed] Zou X et al: "ATP hydrolysis-coupled gating of CFTR chloride channels: structure and function."

No. Sentence Comment

154 Converting lysine 1250 to alanine (K1250A) almost completely abolishes the ATPase activity (46). Login to comment
155 A critical role of this NBD2 lysine in CFTR gating was demonstrated by the result that the open time of the K1250A CFTR mutant is significantly prolonged from hundreds of milliseconds to minutes (38), an effect similar to the effect of AMP-PNP on wild-type channels (see the previous section). Login to comment
165 Kinetic studies of the K1250A CFTR channels have refined the function of NBD2. Login to comment
166 It was first suggested that hydrolysis of ATP at NBD2 plays an obligatory role in closing of the channel since the K1250A mutant CFTR exhibits a much longer open time (31, 32). Login to comment
167 This model predicts that the open time of the K1250A mutant CFTR will be independent of the concentration of ATP. Login to comment
170 However, while the K1250A CFTR channel, once opened by a millimolar level of ATP, can remain open for minutes, the mean open time is only ~250 ms when the channel is opened by a low micromolar ATP concentration. Login to comment
172 Assuming that lowering the concentration of ATP only affects the probability of the occupancy of NBDs, Zeltwanger et al. (38) hypothesize that at low micromolar ATP concentrations, the K1250A CFTR channels close before ATP binds at NBD2. Login to comment
236 Their model is based mainly on the studies of the K464A and K1250A mutants, assuming mutations of the Walker A lysines diminish the level of ATP hydrolysis at respective NBDs. Login to comment
240 This model explains the results showing that the K464A mutant shows a longer open time at micromolar ATP concentrations than that at millimolar ATP concentrations, whereas the K1250A mutant shows an opposite pattern of gating in response to changes in the ATP concentration (cf. ref 38). Login to comment
245 The demonstration that the K1250A mutant CFTR shows a drastically reduced ATP hydrolysis rate (48) is consistent with this idea of tight coupling since the duration of the gating cycle of this mutant is in the range of minutes (38). Login to comment

PMID: 11600681 [PubMed] Fu J et al: "A cluster of negative charges at the amino terminal tail of CFTR regulates ATP-dependent channel gating."

No. Sentence Comment

23 Introducing the N-tail mutations into K1250A CFTR, an NBD2 hydrolysis mutant that normally exhibits very long open channel bursts, destabilized the activity of this mutant as evidenced by decreased macroscopic currents and shortened open channel bursts. Login to comment
53 However, the N-tail mutations prevented the prolonged channel openings that are normally induced by AMP-PNP or by an NBD2 mutation that inhibits ATP hydrolysis (K1250A). Login to comment
194 If the N-tail mutations destabilize the long channel openings that predominate under conditions of reduced hydrolysis by NBD2, then they should also inhibit the very long bursts that are characteristic of K1250A. Login to comment
195 K1250A CFTR is a NBD2 mutant that lacks a lysine at the Walker A motif that is critical for ATPase activity. Login to comment
197 We introduced the N-tail triple mutations into K1250A CFTR as another test of whether the N-tail regulates gating by affecting a step prior to ATP hydrolysis (i.e. at NBD2). Login to comment
198 The triple/K1250A mutant exhibited lower macroscopic currents (Fig. 6A) and faster deactivation (Fig. 6B) compared with K1250A in voltage clamp studies of intact oocytes. Login to comment
199 In single channel studies we observed that the very long bursts of K1250A CFTR were disrupted by the N-tail mutations (Fig. 7). Login to comment
200 The triple/K1250A mutant exhibited a lower single channel open probability due to a marked reduction in open channel burst duration (Fig. 7D). Login to comment
203 The N-tail mutations inhibit the macroscopic currents and accelerate the deactivation kinetics of the hydrolysis mutant, K1250A CFTR A, macroscopic currents mediated by K1250A CFTR and triple/K1250A CFTR were measured in intact oocytes as described in Fig. 1 legend. Login to comment
204 Equal amounts of K1250A and triple/K1250A cRNAs (1 ng) were injected into oocytes (n = 6 oocytes for K1250A, n = 8 for triple/K1250A). Login to comment
205 B, deactivation of K1250A (n = 3) and triple/K1250A (n = 4) currents were monitored following washout of cAMP cocktail as described. Login to comment
208 The N-tail mutations disrupt the long open channel bursts of K1250A CFTR A and B, representative records from excised inside-out patches for K1250 and triple/K1250A, respectively (1.5 mM MgATP for each). Login to comment
209 C and D, mean single channel Po and burst duration for K1250A (n = 4 patches) and triple/K1250A (n = 5 patches). Login to comment
220 However, there does appear to be a rough correlation between macroscopic deactivation kinetics and single channel burst duration for a number of CFTR mutants that have been assayed for both parameters (e.g. K1250A CFTR, which exhibits both prolonged channel bursts and slower macroscopic deactivation; Carson et al. 1995; Gunderson & Kopito, 1995; Wilkinson et al. 1996). Login to comment
222 If so, perhaps mutations that destabilize (e.g. N-tail mutations) or stabilize (e.g. K1250A) channel openings also influence the stability of channel phosphorylation. Login to comment
231 In addition, the N-tail mutations destabilized the long bursts that are a feature of an NBD2 mutant (K1250A) that is defective at ATP hydrolysis (Ramjeesingh et al. 1999). Login to comment
241 We place this transition upstream of ATP hydrolysis because these mutants do inhibit the long bursts that are otherwise activated by manoeuvres that inhibit ATP hydrolysis (AMP-PNP and K1250A mutation). Login to comment
243 It appears from our data that the N-tail both facilitates the entry of the channel into the longer open state (as evidenced by a decreased rate of activation of N-tail mutants by AMP-PNP) and inhibits exit from this longer open state (as evidenced by destabilization of the long bursts of K1250A CFTR by introducing the N-tail mutations). Login to comment
244 The results of our K1250A and AMP-PNP experiments appear to link functionally NBD2 and the N-tail in the regulation of CFTR channel gating. Login to comment
270 AMP-PNP and the K1250A mutation normally prolong CFTR openings by blocking ATP hydrolysis, presumably at NBD2. Login to comment
384 They also thank Drs Dale Benos and Michael Quick for their support and guidance, and Dr David Dawson for the K1250A mutant. Login to comment

PMID: 11788611 [PubMed] Berger AL et al: "Mutations that change the position of the putative gamma-phosphate linker in the nucleotide binding domains of CFTR alter channel gating."

No. Sentence Comment

22 However, the effects of mutations in the two NBDs are not symmetrical; the K1250A mutation dramatically prolongs the burst duration, whereas the K464A mutation reduces the frequency of channel opening but does not change burst duration. Login to comment
145 For example, the CFTR-K1250A mutant markedly prolongs burst duration (9, 10, 13, 22). Login to comment
168 between CFTR-N1303K and CFTR-K1250A, we examined the effect of PPi and ADP. Login to comment

PMID: 11861646 [PubMed] Aleksandrov L et al: "The First Nucleotide Binding Domain of Cystic Fibrosis Transmembrane Conductance Regulator Is a Site of Stable Nucleotide Interaction, whereas the Second Is a Site of Rapid Turnover."

No. Sentence Comment

28 To distinguish between these possibilities, the Walker A lysine mutants K464A and K1250A were used; K464A ablated labeling of NBD1 without influencing that at NBD2, and hence the N3ADP that labeled * This work was supported by Grant DK51619 from the NIDDK, National Institutes of Health and by the Cystic Fibrosis Foundation. Login to comment
43 Stable BHK-21 cell lines expressing wild-type and K464A and K1250A variants of CFTR were established and cultured as described previously (16, 17). Login to comment
130 As expected, the mutations K464A and K1250A prevented photolabeling with either 8-azido-ATP or 8-azido-ADP of NBD1 and NBD2, respectively. Login to comment
131 However, there was no indication that the mutation in one domain had any influence on the labeling of the other, i.e. in K464A, NBD2 was labeled as in wild-type and in K1250A, NBD1 was not different from wild type. Login to comment
191 Membranes from BHK cells expressing wild-type and K464A and K1250A variants of CFTR were incubated as in Figs. Login to comment

PMID: 11882668 [PubMed] Powe AC Jr et al: "Mutation of Walker-A lysine 464 in cystic fibrosis transmembrane conductance regulator reveals functional interaction between its nucleotide-binding domains."

No. Sentence Comment

16 Since the delay of closing by AMP-PNP is thought to occur via NBD2, K464A`s effect on the NBD2 mutant K1250A was examined. Login to comment
17 In sharp contrast to K464A, K1250A single mutants exhibit reduced opening (~0.055 s_1 ) and closing (~0.006 s_1 ) rates at millimolar [ATP], suggesting a role for K1250 in both opening and closing. Login to comment
18 At millimolar [ATP], K464A-K1250A double mutants close ~5-fold faster (~0.029s_1 )thanK1250Abutopenwithasimilarrate(~0.059s_1 ),indicatinganeffectofK464Aon NBD2 function. Login to comment
22 The idea that this second functional site corresponds to NBD2 became prominent because millimolar [ATP] can prolong the opening of a Walker-A lysine mutant at NBD2 (i.e. K1250A), mimicking AMP-PNP`s effect on wild type CFTR (Carson et al. 1995; Gunderson & Kopito, 1995; Zeltwanger et al. 1999). Login to comment
31 The plasmids K464A-pRBG4 and K1250A-pRBG4 were gifts from Dr R. R. Kopito (Stanford University, CA, USA), and the plasmid CFTRwt-pBQ4.7 and the retroviral vector pLJ were gifts from Dr M. Drumm (Case Western Reserve University, Cleveland, OH, USA). Login to comment
32 To construct K464A-pBQ and K1250A-pBQ, the 0.7 kb BspEI-BstZ171 fragment from K464A-pRBG4 and the 3.0 kb BspEI-NcoI fragment from K1250A-pRBG4, respectively, replaced the corresponding ones in CFTRwt-pBQ4.7. Login to comment
33 To create WT-pLJ and K1250A-pLJ, the 4.7 kb EcoICRI fragments from CFTRwt-pBQ4.7 and K1250A-pBQ, respectively, were ligated to Bcl I linkers, cut with BclI, then ligated into the BamHI site of the pLJ vector. Login to comment
35 To generate WT-pCDNA, K464A-pCDNA and K1250A-pCDNA,the4.7 kbPstIfragmentsfromthecorresponding pBQ constructs were subcloned into the PstI site of pCDNA. Login to comment
36 For the creation of K464A-K1250A-pCDNA, the 2.7 kb BspEI-PflMI fragment from K464A-pCDNA was used to substitute the corresponding region in K1250A-pCDNA. Login to comment
40 To obtain recordings with few channels per patch, we used NIH3T3 cells stably transfected with wild type CFTR (Berger et al. 1991), CFTR-K1250A and CFTR-K464A (Zeltwanger et al. 1999; present study). Login to comment
75 EstimationofkineticparametersforK1250Aand K464A-K1250A For recordings of quasi-macroscopic K1250A and K464A-K1250A channel currents, open probability was estimated by means of variance analysis (Sigworth, 1980): Po = (1 _ (s2 /Ii)), where Po represents open probability, s2 the variance of steady-state current, I the mean steady-state current and i the single channel amplitude. Login to comment
80 RESULTS As a step towards understanding how CFTR`s NBDs participate in gating, we examined the kinetic behaviour of the NBD1 mutant K464A, the NBD2 mutant K1250A and double mutant K464A-K1250A. Login to comment
197 Thus, channels bearing K1250A, the lysine-to-alanine mutation in the Walker-A motif of NBD2, exhibit a prolonged open state, similar to the AMP-PNP-dependent locked open state (Carson et al. 1995; Gunderson & Kopito, 1995; Ramjeesingh et al. 1999; Zeltwanger et al. 1999). Login to comment
198 We wondered whether K464A reduces channel open time in K1250A mutants as it does with AMP-PNP. Login to comment
199 To test this idea, we determined the mean open time for both K1250A single mutant and K464A-K1250A double mutant channels using relaxation time courses upon ATP withdrawal (Fig. 7A). Login to comment
200 In the examples shown, the double mutant relaxes more rapidly than the single mutant. On average, K464A-K1250A channel currents decay fivefold morequicklythanK1250A(34 ± 7 s,n = 5versus167 ± 37 s, n = 6, respectively; Fig. 7C; cf. Zeltwanger et al.1999). Login to comment
202 We also examined the open probability of K1250A and K464A-K1250A. Login to comment
210 In this example, all four K1250A channels remain open for most of the sweep, whereas only two of the three double mutants channels are open most of the time, suggesting a lower Po for K464A-K1250A. Login to comment
211 As expected, K1250A channels exhibit a steady-state Po of 0.89 ± 0.02 (n = 6; Fig. 7C) and double mutants 0.67 ± 0.05 (n = 5; P < 0.005). Login to comment
212 Our estimates of Po for both mutants are much higher than previously reported (~ 0.2_0.34 for K1250A and ~ 0.25 for K464A-K1250A; Carson et al. 1995; Ramjeesingh et al. 1999; but cf. ~0.9 for K1250A; Gunderson & Kopito, 1995). Login to comment
213 The differences probably arise from measurements of presteady-state phosphorylated K1250A channels which exhibit a lower Po than those at the steady state (A.C.Powe & T.-C.Hwang, unpublished observations). Login to comment
214 To see whether the reduced Po of K464A-K1250A mutants arises only from shorter open times, we calculated mean closed times from steady-state Po and relaxation time constants (see Methods). Login to comment
215 The calculated mean closed time for K1250A at 2.75 m ATP was 18 ± 4 s (n = 6; Fig. 7C). Login to comment
216 Thus, K1250A prolongs closed time >30-fold compared either to wild type or to the K464A single mutant (Fig. 3B). Login to comment
218 The mean closed time for K464A-K1250A (17 ± 4 s, n = 5; Fig. 7B) is similar to that for K1250A (P ∆ 0.42). Login to comment
220 Although K1250A exhibits long open times at millimolar [ATP], the mutant channel opens only briefly at micromolar [ATP] (Zeltwanger et al. 1999). Login to comment
221 We tested whether K464A-K1250A behaved in a similar manner. Login to comment
226 This result is qualitatively similar to that shown for K1250A (Zeltwanger et al. 1999). Login to comment
227 We then examined the open time distribution of K464A-K1250A channels in the presence Functional interaction between nucleotide binding domains of CFTRJ. Physiol. 539.2 341 Figure 7. Login to comment
228 K464A shortens K1250A relaxation A, representative trace of macroscopic current relaxations from CFTR-K1250A (top trace) and CFTR-K464A-K1250A double mutant channels upon withdrawal of PKA (40 U ml_1 ) and ATP (1 m). Login to comment
229 Mean relaxation time constant for the CFTR-K1250A trace shown is 110 ± 1 s and for CFTR-K464A-K1250A is 30 ± 1 s. B, few-channel traces of CFTR-K1250A and CFTR-K464A-K1250A at the steady state in 2.75 m ATP. Login to comment
230 Dashed lines indicate baseline (all channels closed); marks at the left indicate open channel current levels (a total of 4 channels for K1250A and 3 for K464A-K1250A). Login to comment
231 C, comparison of steady-state Po, mean open (relaxation) times and mean closed times for CFTR-K1250A and CFTR-K464A-K1250A. Login to comment
232 Asterisks indicate significant differences between CFTR-K1250A and CFTR-K464A-K1250A (**P < 0.01; ***P < 0.005). Login to comment
234 A single exponential fit to the distribution provides an estimated open time of 241 ± 3 ms, similar to the open time of wild type, K464A and K1250A at 10 µ ATP (~250 ms; Zeltwanger et al. 1999; present study, Fig. 3A). Login to comment
235 Thus, K464A had little effect on brief openings seen in K1250A at micromolar [ATP]. Login to comment
241 We demonstrate that K1250A, but not K464A, affects the opening rate. Login to comment
242 We also show that both K464A and K1250A affect closing at millimolar [ATP] but in opposite ways. Login to comment
243 K464A accelerates closing whereas K1250A delays it. Login to comment
249 Ramjeesingh et al. (1999) showed that K464A only partly reduced CFTR`s ATPase activity while K1250A eliminates it altogether. Login to comment
250 Aleksandrov et al. (2001) showed that K1250A had no effect on 8-azido- [a-32 P]-ATP labelling of CFTR whereas K464A drastically reduced it. Login to comment
255 It was further hypothesized that hydrolysis is the main pathway for closing under normal conditions and that blocking hydrolysis with K464A or K1250A permits closing only through the slow unbinding pathway, resulting in prolonged openings. Login to comment
256 Based on that model, one would predict that the double mutant K464A-K1250A should exhibit long openings at all ATP concentrations, since the hydrolysis pathway at both A. C. Powe, Jr, L. Al-Nakkash, M. Li and T.-C. Hwang342 J. Physiol. 539.2 Figure 8. Login to comment
257 K464A-K1250A gating at millimolar and micromolar [ATP] A, representative sweep from experiments with CFTR-K464A-K1250A channels exposed first to 1 m and then to 10 µ MgATP. Login to comment
258 Arrow indicates the baseline, downward deflections channel openings. B, survivor plot of open dwell times for CFTR-K464A-K1250A at 10 µ MgATP. Login to comment
262 We find, however, that the mean open time for K464A-K1250A is ~250 ms at 10 µ ATP and ~30 s at 2.75 m ATP (Figs 7 and 8B). Login to comment
263 The double mutant open time at 10 µ ATP is similar to that of wild type, K464A and K1250A at the same [ATP] (Zeltwanger et al. 1999; present study). Login to comment
264 This finding, together with the dramatic differences between K464A and K1250A mutants, casts considerable doubt on the idea that the NBDs function identically. Login to comment
278 Furthermore, the NBD2 mutation K1250A greatly prolongs CFTR open time ~300-fold; that prolongation is then reduced ~5-fold by addition of the NBD1 mutation K464A (Fig. 7). Login to comment
288 Furthermore, Ramjeesingh et al. (1999) showed that K464A reduces ATPase activity by ~80% and K1250A virtually eliminates it, suggesting that mutating one NBD affects the biochemical activity of the other. Login to comment
299 Channel open times at 10 µ ATP for wild type, K464A, K1250A and K464A-K1250A are all ~250 ms (Zeltwanger et al. 1999; present study, Figs 3 and 8), indicating that the NBD mutations have no effect on brief openings. Login to comment
305 The NBD2 mutation K1250A prolongs opening (Fig. 7), which suggests that blocking ATP hydrolysis at NBD2 slows exit from an open state. Login to comment
311 While our results provide no evidence for involvement of NBD1 in channel opening, NBD2 seems to play a role, since the NBD2 mutation K1250A increases closed time > 30-fold (Fig. 7). Login to comment
333 If it turns out that NBD1 is truly involved in channel opening, then the delay of opening by NBD2 mutant K1250A would suggest that NBD1 and NBD2 interact to control opening as well as closing. Login to comment
338 Finally, K464A reduces the prolongation of open time seen in the NBD2 mutant K1250A at millimolar [ATP], strongly suggesting an interaction between NBD1 and NBD2 during CFTR`s open state. Login to comment
339 Although the NBD1 mutant K464A did not affect opening, the NBD2 mutant K1250A delays opening >30-fold compared to wild type. Login to comment

PMID: 11927666 [PubMed] Linsdell P et al: "Multiple inhibitory effects of Au(CN)(2-) ions on cystic fibrosis transmembrane conductance regulator Cl(-) channel currents."

No. Sentence Comment

141 A similar strategy using the CFTR mutant K1250A, which shows prolonged openings similar to that of wild type CFTR after locking the channels open with PPi (Gunderson & Kopito, 1995), has been used to dissociate open channel blocking from gating events at the single channel level (Zhou et al. 2001). Login to comment

PMID: 12034762 [PubMed] Dousmanis AG et al: "Distinct Mg(2+)-dependent steps rate limit opening and closing of a single CFTR Cl(-) channel."

No. Sentence Comment

25 Thus, although ATPase activity is diminished 10-20-fold in mutant K464A CFTR, and practically abolished in K1250A CFTR (Ramjeesingh et al., 1999), channel opening rate at millimolar [MgATP] has been reported to be reduced only 2-4-fold in K464A and somewhat more severely (5-10-fold) in K1250A CFTR (Carson et al., 1995; Gunderson and Kopito, 1995; Ramjeesingh et al., 1999); and gating persists even in double mutant K464A/K1250A CFTR channels (Carson et al., 1995). Login to comment
29 The finding that K1250A CFTR channels, mutated within the NBD2 catalytic site, when exposed to millimolar MgATP alone displayed prolonged open bursts comparable to those elicited by MgAMPPNP in wild-type channels, suggested that NBD2 comprises the active site that controls normal termination of open bursts (Carson et al., 1995; Gunderson and Kopito, 1995). Login to comment
31 A possibly related finding is that the open burst duration of K1250A CFTR channels, though prolonged at millimolar MgATP, has been reported to be brief at micromolar MgATP (Zeltwanger et al., 1999; Ikuma and Welsh, 2000). Login to comment
136 This is consonant with earlier conclusions that ATP hydrolysis prompts channel closure, based on extreme stabilization of the open state of WT CFTR channels exposed to MgATP plus a poorly hydrolyzable analogue (like MgAMPPNP; see below), or of K1250A mutant channels exposed to just MgATP (Hwang et al., 1994; compare with Gunderson and Kopito, 1994, 1995; Carson et al., 1995). Login to comment
195 The observation that mutant K1250A CFTR channels show similarly prolonged bursts during exposure to MgATP alone suggested that NBD2 contains the catalytic site where hydrolysis leads to channel closure (Gunderson and Kopito, 1994, 1995; Carson et al., 1995; Zeltwanger et al., 1999). Login to comment
196 Analysis of the temporal asymmetry of changes in character of rapid current blocking events during open bursts of CFTR channels, and their modification by nucleotide analogues and by mutation of NBD2 (K1250A) but not NBD1 (K464A), provided additional evidence that hydrolysis of ATP tightly bound at NBD2 causes the channel to close (Gunderson and Kopito, 1995). Login to comment
202 Presumably, when hydrolysis is prevented, either by lack of Mg2ϩ ions (Li et al., 1996) or by NBD mutation (e.g., K1250A; Ramjeesingh et al., 1999), dissociation of nonhydrolyzed nucleotide from NBD2 becomes the rate-limiting step for the delayed channel closure. Login to comment
246 Nucleotide binding assays (at 0ЊC to prevent hydrolysis) using 8-azidoATP photolabeling show that binding occurs with the same micromolar apparent affinity in wild-type, mutant K1250M, and double mutant K464A/ K1250A, CFTR (Carson et al., 1995). Login to comment
247 These findings, together with the fact that even double mutant K464A/ K1250A CFTR channels open and close at measurable rates (Carson et al., 1995), make it seem unlikely that ATP hydrolysis at either NBD1 or NBD2 is a prerequisite for channel opening. Login to comment

PMID: 12407077 [PubMed] Zhou Z et al: "Probing an open CFTR pore with organic anion blockers."

No. Sentence Comment

3 To simplify the kinetic analysis, a CFTR mutant, K1250A-CFTR, was used because this mutant channel, once opened, can remain open for minutes. Login to comment
51 M A T E R I A L S A N D M E T H O D S Cell Preparation NIH3T3 cells stably expressing K1250A-CFTR channels (Zeltwanger et al., 1999) were maintained at 37ЊC and 5% CO2 in Dulbecco`s Modified Eagle`s Medium (DMEM) supplemented with 10% fetal bovine serum. Login to comment
81 For quantitative analysis of isethionate blockade, net K1250A-CFTR single-channel I-V relationships were obtained by subtracting the I-V relationship of the leak (i.e., basal conductance before the channel is opened) from that of a single locked-open K1250A-CFTR channel. Login to comment
83 The average of these I-V relationships were then calculated to represent the single-channel I-V curve of K1250A-CFTR. Login to comment
93 R E S U L T S Glibenclamide Block of K1250A-CFTR Channels Previous studies show that glibenclamide blocks CFTR channels with a time constant in the range of tens of milliseconds that is slow enough to be resolved in single-channel recordings (Schultz et al., 1996; Sheppard and Robinson, 1997). Login to comment
97 To extract the kinetic parameters of glibenclamide-induced blocking events with minimal contamination of ATP-dependent gating events, we studied glibenclamide block with a CFTR mutant, K1250A-CFTR, instead of wt-CFTR. Login to comment
98 The advantage of using K1250A-CFTR is that this channel, once opened by ATP, can stay open for minutes even after a complete removal of ATP. Login to comment
100 Kd 1 Fb-( )Poc Glibenclamide[ ] Fb,/= kon V( ) kon V( )' X[ ] kon 0( )' X[ ] zδonFV RT/( )exp= = koff V( ) koff V( ) z- δoffFV RT/( ),exp= Kd V( ) koff V( ) kon V( )'/ koff 0( ) kon 0( )'/ z- δon δoff+[ ]FV RT/( )exp Kd 0( ) z- δKd FV RT/( ),exp = = = We first tested whether glibenclamide block of K1250A-CFTR channels is similar to that of wt-CFTR channels. Login to comment
101 Fig. 1 A shows an example of glibenclamide-induced block recorded from an inside-out patch excised from an NIH3T3 cell stably expressing K1250A-CFTR. Login to comment
102 K1250A-CFTR currents were first activated by PKA and 1mM ATP (not depicted). Login to comment
113 Therefore, glibenclamide-induced block in K1250A-CFTR channels is completely reversible as seen in wt-CFTR (Schultz et al., 1996; Sheppard and Robinson, 1997; Gupta and Linsdell, 2002; cf. Sheppard and Welsh, 1992). Login to comment
114 Next, we examined the sensitivity of K1250A-CFTR to glibenclamide block. Login to comment
119 The resulting dose-response relationship can be fitted with a Michaelis-Menten function with a K1/2 of 49.4 Ϯ 9.5 ␮M at -50 mV, which is similar to that reported for wt-CFTR (Schultz et al., 1996; Sheppard and Robinson, 1997), indicating that the K1250A mutation does not affect the sensitivity of the channel to glibenclamide. Login to comment
120 We then tested whether glibenclamide blocks K1250A-CFTR channels in a voltage-dependent manner as shown for wt-CFTR channels (Sheppard and Robinson, 1997; Gupta and Linsdell, 2002). Login to comment
126 We therefore conclude that the mechanisms of voltage dependence of glibenclamide block for K1250A-CFTR channels can also be applied to wt-CFTR channels. Login to comment
128 Glibenclamide block of K1250A-CFTR is reversible. Login to comment
129 K1250A-CFTR channel currents were activated by PKA and 1 mM ATP in an excised inside-out patch held at -50 mV with symmetric Cl- (154 mM [Cl-]o/154 mM [Cl-]i). Login to comment
130 (A) Continuous recording of K1250A-CFTR after the channels were locked open with PKA and ATP. Login to comment
137 Whole-cell Recordings of Glibenclamide Block of K1250A-CFTR With single-channel recordings in excised inside-out patches, we were only able to investigate glibenclamide block at negative membrane potentials since patches became unstable when held at positive potentials for a long period of time (essential for kinetic analysis). Login to comment
164 Net K1250A-CFTR current traces were obtained by subtracting the leak from the forskolin-activated current (Fig. 4 A). Login to comment
168 Net steady-state I-V relationships in the presence or absence of glibenclamide are shown in Fig. 4 C. Clearly, glibenclamide blocks whole-cell K1250A-CFTR currents in a voltage-dependent manner with more block at negative voltages. Login to comment
172 Glibenclamide block of whole-cell K1250A-CFTR currents. Login to comment
178 (D) Voltage dependence of glibenclamide block of K1250A-CFTR. Login to comment
182 Kinetic Analysis of Voltage-dependent Block of Glibenclamide on K1250A-CFTR For glibenclamide block of K1250A-CFTR, we were able to apply a simple scheme for kinetic analysis (Scheme I). Login to comment
196 The agreement between this Kd value, obtained from kinetic parameters based on Scheme I, and the model-independent K1/2 further demonstrates that Scheme I is adequate for describing glibenclamide block of K1250A-CFTR channels. Login to comment
236 Voltage-dependent Block of K1250A-CFTR Channels by Isethionate Glibenclamide is a powerful tool to probe the CFTR pore because it affords direct measurements of both the on and off rate constants. Login to comment
245 To compare their ability to block K1250A-CFTR channels, we applied voltage ramps on inside-out patches in the presence or absence of various blockers in the perfusion solution. Login to comment
247 All three anions block K1250A-CFTR channels in a voltage-dependent manner. Login to comment
258 Voltage-dependent block of K1250A-CFTR by hydrophilic organic anions. Login to comment
280 Effect of extracellular isethionate on K1250A-CFTR whole-cell current. Login to comment
282 K1250A-CFTR currents were activated by 10 ␮M Fsk. Login to comment
293 Block of K1250A-CFTR by Mixture of Glibenclamide and Isethionate If indeed these two blockers share a common binding site, then the kinetics of channel blockade by these two blockers can be described as: SCHEME II where X, XG, and XI represent the binding site, glibenclamide-occupied state and isethionate-occupied state, respectively. Login to comment
322 With the K1250A-CFTR mutant, we were able to quantify detailed kinetic parameters of glibenclamide block not provided by previous studies (Schultz et al., 1996; Sheppard and Robinson, 1997; Gupta and Linsdell, 2002). Login to comment
332 Block of K1250A-CFTR current in the presence of both glibenclamide and isethionate. Login to comment
338 reported that the voltage dependence of the intrinsic flickery blocking events seen in a locked-open K1250A-CFTR channel is mostly determined by the trans-ion effects (Zhou et al., 2001b). Login to comment

PMID: 12508051 [PubMed] Vergani P et al: "On the mechanism of MgATP-dependent gating of CFTR Cl- channels."

No. Sentence Comment

4 The rate of opening to a burst (1/␶ib) was a saturable function of [MgATP], but apparent affinity was reduced by mutations in either of CFTR`s nucleotide binding domains (NBDs): K464A in NBD1, and K1250A or D1370N in NBD2. Login to comment
7 NBD2 catalytic site mutations K1250A, D1370N, and E1371S were found to prolong open bursts. Login to comment
32 However, in CFTR the Walker A NBD2 mutation K1250A abolished ATP hydrolysis, whereas the NBD1 mutation K464A simply reduced overall hydrolytic activity (Ramjeesingh et al., 1999); and biochemical studies of Walker B aspartate mutations in CFTR (D572N in NBD1, D1370N in NBD2) have not yet been performed. Login to comment
34 Thus, the K1250A mutation dramatically prolonged burst duration, suggesting that hydrolysis at NBD2 might be coupled to burst termination (Carson et al., 1995; Gunderson and Kopito, 1995), whereas the NBD1 mutations K464A, Q552A, and Q552H somewhat slowed channel opening to a burst, suggesting that NBD1 might be a site of ATP interactions governing opening (Carson et al., 1995; Carson and Welsh 1995). Login to comment
41 We studied in detail the dependence of channel gating on [MgATP], gating in the presence of poorly hydrolyzable nucleotide analogs, as well as the effects of mutating residues in the Walker A (K464A and K1250A) and Walker B motifs (in particular, D1370N in NBD2). Login to comment
52 Amounts of cRNA injected were adjusted to vary the level of expression: up to 40 ng/oocyte was required for high expression of K1250A or K464A/K1250A mutant channels, whereas 0.1-0.25 ng/oocyte sufficed for single channel recordings of WT, K464A, or D1370N channels. Login to comment
85 We do not report absolute values for ␶ib and rCO in these cases, but only values relative to some other experimental condition applied to the same patch, and these should be relatively insensitive to N. Thus, for MgATP dose-response curves (Fig. 2), rates were normalized to those in bracketing segments at 5 mM MgATP; for the poorly hydrolyzable nucleotides, rates were normalized to those obtained in the same patches at 10 ␮M (Figs. 7 and 11) or 50 ␮M MgATP (Fig. 8); for K1250A mutant openings in 10 ␮M MgATP, rates were normalized to those in nominally MgATP-free bath solution. Login to comment
126 Similar kinetic analysis of patches containing few channels proved technically difficult for K1250A CFTR (NBD2 Walker A lysine mutant) due to the extremely prolonged bursts (see Fig. 6 C, below), which precluded collection of enough events to reliably estimate absolute values of rCO or Po. Login to comment
127 So we recorded macroscopic current in patches with hundreds or thousands of WT or K1250A channels (Fig. 3, A and B), and determined relative Po as a function of [MgATP] (Fig. 3 C) by normalizing current amplitude at each test [MgATP] to that during bracketing exposures at 5 mM MgATP (Fig. 3, A and B). Login to comment
128 The curve for K1250A was strongly shifted to higher [MgATP] and was still not saturated at 10 mM MgATP. Login to comment
132 Therefore, in K1250A, as in WT CFTR, it is only the dependence of channel opening rate on [MgATP] that underlies the [MgATP] dependence of Po. Login to comment
134 In fact, this relationship implies that the effective dissociation constant for MgATP activation of opening of K1250A channels is likely even larger than is apparent in Fig. 3 C because the other effect of the K1250A mutation, marked slowing of channel closure from bursts, would by itself shift the Po versus [MgATP] curve to lower [MgATP], opposite to our experimental observation. Login to comment
137 The K1250A mutation strongly shifts the [MgATP] dependence of Po to higher [MgATP]. Login to comment
140 (B) Macroscopic current of K1250A channels was reduced Ն2-fold on lowering [MgATP] from 5 to 1 mM. Login to comment
144 Michaelis fit parameters for WT: Po max ϭ 1.04 Ϯ 0.01, K0.5 ϭ 57 Ϯ 2 ␮M; for K1250A: Po max ϭ 2.45 Ϯ 0.88, K0.5 ϭ 6.5 Ϯ 4.8 mM; for display, WT (circles) and K1250A (inverted triangles) data (mean Ϯ SD, 3 Յ n Յ9) were renormalized to these Po max values. Login to comment
145 Because 10 mM, the highest [MgATP] used, was still far from saturating for K1250A channels, the fit for this mutant is less accurate, evident from large errors on fit parameters. Login to comment
169 The K1250A mutation more dramatically slowed channel closing from bursts, resulting in prolonged bursts lasting tens of seconds (Fig. 6 C; cf. Carson et al., 1995; Gunderson and Kopito, 1995; Ramjeesingh et al., 1999; Zeltwanger et al., 1999). Login to comment
170 Analysis of the macroscopic current relaxation upon nucleotide withdrawal in patches containing many K1250A channels indicates that their average burst duration was ‫08ف‬ s in the presence of PKA (see below, Fig. 10, E and G) but ‫04ف‬ s after PKA had been removed (Fig. 3 B), at least two orders of magnitude longer than bursts of WT channels under the same conditions (Fig. 3, A vs. B; Fig. 6, A vs. C). Login to comment
171 Moreover, for both K1250A and D1370N mutants, this macroscopic current decay followed a single exponential time course, implying the presence of a single population of open bursts (for K1250A, see Figs. 3 B and 10 E; for D1370N, decay time constants were: ␶[after 5 mM MgATP ϩ PKA] ϭ 6.4 Ϯ 1.6 s, n ϭ 6; ␶[after 5 mM MgATP] ϭ 2.2 Ϯ 0.5 s, n ϭ 7; ␶[after 300 ␮M MgATP] ϭ 1.9 Ϯ 0.3 s, n ϭ 8; cf. Table I). Login to comment
179 WT (A), D1370N (B), K1250A (C), and E1371S (D) CFTR channels were activated by 5 mM MgATP plus PKA as indicated: burst termination (‫-4.0ف‬pA downward steps) after nucleotide washout was slowed for NBD2 mutants, relative to WT. Login to comment
180 Note persistence of brief (intraburst) closures during K1250A and E1371S bursts, long after nucleotide withdrawal. Login to comment
234 The K464A mutation also shortened (Fig. 10, E-G) the similarly prolonged bursts of NBD2 mutant K1250A channels exposed to MgATP alone (Fig. 6 C). Login to comment
235 The control record (Fig. 10 E) illustrates the slow decay of macroscopic current after washout of MgATP and PKA from a patch containing hundreds of K1250A CFTR Figure 9. Login to comment
248 (E) Macroscopic K1250A currents, activated by 5 mM MgATP ϩ PKA, decay slowly on nucleotide withdrawal. Login to comment
249 (F) The additional K464A mutation accelerates channel closure from bursts: for the traces shown, ␶ ϭ 71.7s (K1250A) and ␶ ϭ 29.7s (K464A/K1250A). Login to comment
250 (G) Mean time constants of all 9 K1250A and 9 K464A/K1250A relaxations, each well fit by a single exponential. Login to comment
253 However, in double mutant K464A/K1250A CFTR channels (Fig. 10 F) the current relaxation time constant (␶ ϭ 36 Ϯ 4 s, n ϭ 9), and hence the mean open-burst dwell time, was less than half that of channels bearing the K1250A mutation alone (Fig. 10 G). Login to comment
270 K1250A) reduce the apparent affinity of the MgATP binding site(s) involved in channel opening (Figs. 2 and 3), but (at least for K464A and D1370N) affect the maximal opening rate little (Table I). Login to comment
275 Accordingly, although no major difference in [␣32P]8-azidoATP photolabeling at 0ЊC was detected between WT and K464A/K1250A (Carson et al., 1995) or K464A CFTR (Vergani et al., 2002), the K464A mutation alone greatly reduced photolabeling of NBD1 by ␮M [␣32P]8-azidoATP at 37ЊC (Aleksandrov et al., 2002) and virtually abolished stable (i.e., surviving extensive post-incubation washing) photolabeling at 30ЊC (unpublished data). Login to comment
280 Therefore, the simplest interpretation of the reduced apparent affinity with which MgATP elicits opening of K464A and D1370N (and K1250A) mutants compared with WT is that the mutations impair nucleotide binding at two different sites, such that at subsaturating [MgATP] channel opening is limited by MgATP binding at NBD1 in K464A, but at NBD2 in D1370N (and K1250A). Login to comment
286 Allosteric interactions between CFTR`s two NBDs (compare Powe et al., 2002) could, therefore, permit the K464A, D1370N, and K1250A mutations to all affect the same binding site. Login to comment
291 Moreover, covalent modification of the NBD2 Walker A sequence (Cotten and Welsh, 1998), and the K1250A (Fig. 3 C) and the D1370N (Fig. 2 D) mutations (‫9-8ف‬ Å apart; e.g., Hung et al., 1998), all reduce apparent affinity for MgATP activation of opening. Login to comment
293 Most likely, therefore, the rightward shift in [MgATP] dependence of D1370N (and K1250A) open- ing rate reflects the lower affinity of a binding step, required for channel opening, at NBD2 itself. Login to comment
300 Therefore, present evidence suggests that nucleotide normally binds to both of WT CFTR`s NBDs before the channel opens, and that opening is limited by nucleotide binding at NBD2 in WT, D1370N, and K1250A CFTR channels, but probably by nucleotide binding at NBD1 in K464A CFTR channels. Login to comment
318 On the other hand, ATPase measurements on purified CFTR have shown that the K1250A mutation abolished ATP hydrolysis (Ramjeesingh et al., 1999), whereas opening of K1250A channels was impaired, but not abolished, at normal [MgATP] (Carson et al., 1995; Gunderson and Kopito, 1995; Ramjeesingh et al., 1999; Powe et al., 2002); indeed, the greatly reduced apparent affinity for MgATP we observed (Fig. 3 C) implies that the maximal opening rate of K1250A may be several-fold greater than that measured at 1-2 mM MgATP. Login to comment
324 We found no clear dependence of burst duration on [MgATP] (10 ␮M to 5 mM) in WT CFTR (Figs. 2 E, 3 A, and 4, B and C) or in K464A, D1370N, or K1250A mutant channels (Figs. 2 E, 3 B, and 4, E-H), indicating that all ATP binding events precede channel opening and no further binding to the open channel is needed to complete the gating cycle. Login to comment
326 This [MgATP] dependence of burst duration was reported to be exaggerated in K1250A mutant channels, in which brief bursts were observed at 10 ␮M MgATP and only at higher concentrations did the characteristic (e.g., Fig. 6 C, above) prolonged bursts appear (Zeltwanger et al., 1999; Ikuma and Welsh, 2000; Powe et al., 2002). Login to comment
327 Though we occasionally observed brief bursts in K1250A channels at 10 ␮M MgATP (not illustrated), these were very rare, with a frequency of occurrence not demonstrably different from that in nominally MgATP-free bath solution (rCO10 ␮M/rCObath soln ϭ 0.72 Ϯ 0.12, n ϭ 6). Login to comment
328 Thus, brief bursts of K1250A channels might reflect infrequent nucleotide-independent events, unrelated to the physiological gating cycle of WT channels, an interpretation consistent with those brief bursts surviving mutation of the Walker A lysine in either, or both, NBDs (Zeltwanger et al., 1999; Ikuma and Welsh, 2000; Powe et al., 2002). Login to comment
369 But when hydrolysis (at NBD2) was prevented, by supplying nucleotide resistant to hydrolysis (Figs. 9, and 10, A-D; Fig. 7 vs. Fig. 11), by adding VO4 (Vergani et al., 2002), or by mutating the NBD2 Walker A lysine (K1250A; Fig. 10, E-G), the K464A mutation resulted in less prolonged bursts. Login to comment

PMID: 12727866 [PubMed] Kogan I et al: "CFTR directly mediates nucleotide-regulated glutathione flux."

No. Sentence Comment

2 We show that CFTR-expressing membrane vesicles mediate nucleotide-activated GSH ¯ux, which is disrupted in the R347D pore mutant, and in the Walker A K464A and K1250A mutants. Login to comment
94 To assess the nucleotide dependence of GSH permeation through CFTR, we determined the consequences of lysine mutations in the conserved Walker A consensus motifs for ATP binding in NBD1 and NBD2: K464A and K1250A, respectively. Login to comment
96 In Figure 4, we show that both the K464A and K1250A mutants exhibit similar signi®cant reductions in GSH ¯ux. Login to comment
97 We observed that GSH uptake in both the K464A and K1250A membrane vesicles was 3to 4-fold lower than in vesicles expressing wild-type CFTR protein, yielding permeability values of 132 and 120 pmol/mg CFTR/h, respectively (P < 0.001). Login to comment
102 Membrane vesicles expressing phosphorylated wild-type, K464A or K1250A CFTR were incubated with 20 nM [35S]GSH and 1 mM cold GSH in CFTR transport buffer, in the presence of MgAMPPNP. Login to comment
104 Values shown represent the mean activity (T SEM; for K464A and K1250A, n = 4; for wild-type CFTR, n = 5). Login to comment
105 Inset: expression of CFTR in membranes from Sf9 cells transfected with wild-type, K464A or K1250A CFTR constructs. Login to comment
194 An Sf9 cell pellet (0.5 l) expressing either recombinant CFTR-His proteins (wild type or mutant: R347D, K464A, K1250A) or no CFTR was solubilized in 30 ml of homogenization buffer containing 250 mM sucrose, 50 mM Tris±HCl, 0.25 mM CaCl2 pH 7.5 and protease inhibitors (Roche Diagnostics GmbH, Mannheim, Germany). Login to comment

PMID: 12939393 [PubMed] Basso C et al: "Prolonged nonhydrolytic interaction of nucleotide with CFTR's NH2-terminal nucleotide binding domain and its role in channel gating."

No. Sentence Comment

299 Second, purified NBD1 mutant, K464A, CFTR was reported to hydrolyze MgATP at a maximal rate 10-20-fold lower than that of wild-type CFTR, whereas the equivalent mutation in NBD2, K1250A, essentially abolished hydrolysis (Ramjeesingh et al., 1999). Login to comment
302 However, the mutation does substantially shorten prolonged (locked) open bursts ascribed to NBD2 catalytic-site occupancy by the equivalent of nonhydrolyzed nucleotide, due to the K1250A mutation or to exposure of wild-type CFTR to MgATP plus nonhydrolyzable ATP analogs (Powe et al., 2002; Vergani et al., 2003) or to MgATP plus Vi (Fig. 4 vs. Fig. 8, C and D). Login to comment
314 In accord with this interpretation, NBD2 does appear to hydrolyze ATP (Aleksandrov et al., 2002; cf. Ramjeesingh et al., 1999) and is where the hydrolysis- abolishing mutation, K1250A, similarly (like Vi) prolongs bursts (Carson et al., 1995; Gunderson and Kopito, 1995; Ramjeesingh et al., 1999; Zeltwanger et al., 1999; Vergani et al., 2003). Login to comment

PMID: 14502435 [PubMed] Derand R et al: "Comparative pharmacology of the activity of wild-type and G551D mutated CFTR chloride channel: effect of the benzimidazolone derivative NS004."

No. Sentence Comment

204 Further studies have also demonstrated that NS004 is a modulator of P574H (Champigny et al., 1995), K1250A (Al-Nakkash et al., 2001) and delF508 (Gribkoff et al., 1994; He et al., 1998; Al-Nakkash et al., 2001). Login to comment

PMID: 14581585 [PubMed] Cai Z et al: "Voltage-dependent gating of the cystic fibrosis transmembrane conductance regulator Cl- channel."

No. Sentence Comment

385 Third, to investigate the flickery closures that interrupt bursts of channel openings, Zhou et al. (2001) analyzed the gating kinetics of the CFTR variant K1250A whose prolonged openings facilitate the discrimination of fast and slow gating events. Login to comment

PMID: 14745501 [PubMed] Callebaut I et al: "Nucleotide-binding domains of human cystic fibrosis transmembrane conductance regulator: detailed sequence analysis and three-dimensional modeling of the heterodimer."

No. Sentence Comment

235 These results are in agreement with the recent work of Aleksandrov et al. [54] with the Walker A lysine mutants K464A and K1250A, with the finding that NBD2 is a site of rapid nucleotide turnover, while NBD1 is a site of stable nucleotide interaction. Login to comment

PMID: 15284228 [PubMed] Kidd JF et al: "A heteromeric complex of the two nucleotide binding domains of cystic fibrosis transmembrane conductance regulator (CFTR) mediates ATPase activity."

No. Sentence Comment

188 Mutation of the canonical Walker A lysine in either NBD1 (K464A, targeting Site A) or NBD2 (K1250A, targeting Site B) decreased ATPase activity of the whole protein by greater than 50% (39). Login to comment
189 Interestingly, the most severe effects on ATPase activity and channel gating were observed in the K1250A mutant, wherein ATPase activity was virtually abolished, consistent with this conventional site playing a more important role in generating the overall catalytic function of CFTR. Login to comment
191 However, an electrophysiological study found that these mutations caused a marked slowing of channel closing from bursts as did K1250A, which is known to reduce the ATPase activity of CFTR to around 1% of wild type (40). Login to comment

PMID: 15290302 [PubMed] Ai T et al: "Direct effects of 9-anthracene compounds on cystic fibrosis transmembrane conductance regulator gating."

No. Sentence Comment

32 Materials and methods Cell culture NIH3T3 cells stably expressing wild-type CFTR (NIH3T3/CFTR) or K1250A-CFTR mutant channels were grown as previously described [32] at 37°C and 5% CO2 in DMEM supplemented with 10% FBS. Login to comment
78 Since K1250A-CFTR channels Fig. 1A-D Effects of anthracene-9-carboxylic acid (9-AC) on whole-cell cystic fibrosis transmembrane conductance regulator (CFTR) currents. Login to comment
82 Net potentiation effects in wild-type CFTR were calculated by correcting for the inhibitory effects obtained from recordings of 9-AC on K1250A-CFTR currents. Login to comment
83 ycomp=yraw/(1-x/100), where ycomp, is the compensated value; yraw, the measured fold increase; x, the percentage inhibition of whole-cell K1250A-CFTR currents with 1 mM 9-AC at a pipette potential (Vp) of +100 mV or -100 mV. Login to comment
85 C A whole-cell K1250A-CFTR current trace. Login to comment
86 I-V relationships show net K1250A-CFTR currents in the presence or absence of 9-AC. Login to comment
87 D Dose-response relationships of the inhibitory effect on K1250A-CFTR currents at three different voltages. Login to comment
91 Figure 1C shows the whole-cell current trace from an NIH3T3 cell stably expressing K1250A-CFTR. Login to comment
93 Figure 1D shows the dose-response relationships of this inhibitory effect of 9-AC on K1250A-CFTR at three different membrane potentials (-60, -80, and -100 mV). Login to comment

PMID: 15366420 [PubMed] Zhang ZR et al: "Steady-state interactions of glibenclamide with CFTR: evidence for multiple sites in the pore."

No. Sentence Comment

265 A recent study by Hwang and coworkers (Zhou et al., 2002) used the opposite approach in relying upon the K1250A-CFTR mutant that exhibits greatly diminished (but not completely abolished) ATP-dependent gating. Login to comment
313 In that study, the behavior of mutant K1250A-CFTR was assayed with significant filtering of the single-channel records (100 Hz), resulting in loss of brief events. Login to comment
314 It is unclear whether this mutation, outside of the pore domain, might have any effect on block of the pore by glibenclamide; certainly, if glibenclamide binding is state-dependent, one would expect the results in K1250A-CFTR to differ substantially from those in wt-CFTR. Login to comment

PMID: 15504728 [PubMed] Zhang ZR et al: "Determination of the functional unit of the cystic fibrosis transmembrane conductance regulator chloride channel. One polypeptide forms one pore."

No. Sentence Comment

156 A similar result was obtained using a double mutant, R334C/K1250A, that exhibits a prolonged open state duration (data not shown). Login to comment

PMID: 15623556 [PubMed] Berger AL et al: "Normal gating of CFTR requires ATP binding to both nucleotide-binding domains and hydrolysis at the second nucleotide-binding domain."

No. Sentence Comment

6 We also studied mutations of the conserved Walker A lysine residues (K464A and K1250A) that prevent hydrolysis. Login to comment
8 The K1250A mutation prolonged burst duration; however, blocking ATP binding prevented the long bursts. Login to comment
122 The possibility that the K1250A mutation might reduce ATP binding is based on the observation that Walker A Lys mutations can reduce the interaction with ATP in some ABC transporters (35-37). Login to comment
123 In CFTR, it has been reported that the K1250A and K464A mutations prevented [␣-32 P]8-N3-ATP photolabeling of the respective NBD (14, 15), whereas another study found that K464A did not prevent [␣-32 P]8-N3-ATP NBD1 photolabeling (36). Login to comment
124 We found that neither the K1250A nor K464A mutations prevented [␣-32 P]8-N3-ATP photolabeling of the NBDs (Fig. 3A). Login to comment
132 (A) Autoradiogram of [␣-32P]8-N3-ATP labeling of CFTR-K464A and K1250A; labeling of both NBDs was observed for each mutant. Login to comment
134 (C) Effect of NEM modification of CFTR-S1248C͞ K1250A on relative current and burst duration. Login to comment
135 Because we were not able to accurately assess the number of channels in a patch before adding NEM (K1250A has a long interburst interval), Po and the interburst interval were not determined. Login to comment
139 Thus, our data, considered together with that in the literature, suggest that K1250A does not abolish nucleotide binding at NBD2, although it might reduce binding affinity. Login to comment
140 The finding that channels unable to bind nucleotide at NBD2 (S1248F and NEM-modified S1248C) had a normal burst duration suggested that the prolonged burst duration of K1250A (16-18, 20, 21) arose when ATP bound NBD2 but then did not undergo hydrolysis. Login to comment
141 To test this hypothesis, we combined the K1250A mutation with S1248C. Login to comment
142 CFTR-S1248C͞ K1250A showed the prolonged burst duration typical of CFTR-K1250A (Fig. 3 B and C). Login to comment
150 Third, ATP binds the K1250A variant, and while bound it generated a long burst duration. Login to comment
212 As we argued above, although these labeling studies do not assess equilibrium binding, taken together they suggest that K1250A probably reduced binding affinity. Login to comment
213 The functional consequences of the K1250A mutation have also been reported; the mutation reduced the rate of channel opening, and once the channel opened, it delayed its closure (16-18, 20, 21). Login to comment
218 What causes the long burst duration of K1250A? Login to comment
222 Second, ATP could bind the K1250A mutant (perhaps with reduced affinity), but impaired hydrolysis could slow channel closing. Login to comment
131 Fig. 3. Effect of blocking ATP binding to NBD2 on the gating of CFTR-K1250A. Login to comment
217 They also suggest that the reduced opening rate of CFTR-K1250A might result from reduced binding affinity. Login to comment

PMID: 15684079 [PubMed] Randak CO et al: "ADP inhibits function of the ABC transporter cystic fibrosis transmembrane conductance regulator via its adenylate kinase activity."

No. Sentence Comment

31 For example, structural studies predict that the K1250A and D1370N mutations alter the ATP-binding sites, and these mutations disrupted both ATPase activity and adenylate kinase activities, as well as ADP-dependent inhibition. Login to comment

PMID: 15767296 [PubMed] Bompadre SG et al: "CFTR gating II: Effects of nucleotide binding on the stability of open states."

No. Sentence Comment

354 A similar short-lived open state was reported previously for K1250A-CFTR (␶o ϭ ‫052ف‬ ms), another hydrolysis-deficient mutant (Zeltwanger et al., 1999). Login to comment
364 Furthermore, mutations that abolish ATP hydrolysis (e.g., K1250A and E1371S) dramatically prolong the open state (Gunderson and Kopito, 1995; Zeltwanger et al., 1999; Powe et al., 2002; Vergani et al., 2003). Login to comment
367 Interestingly, introducing the K464A mutations into the K1250A construct significantly decreases the locked-open time (Powe et al., 2002; Vergani et al., 2003). Login to comment
380 This hypothesis is based on the observation that mutations that affect ATP binding at NBD1 (e.g., K464A) alter the stability of the open state of K1250A, suggesting an interaction between two ATP-binding sites. Login to comment
406 While we did observe a decrease of the opening rate by the K1250A mutation (Powe et al., 2002; cf. Login to comment

PMID: 16223764 [PubMed] Zhou Z et al: "High affinity ATP/ADP analogues as new tools for studying CFTR gating."

No. Sentence Comment

224 In addition, K464A mutation decreases the locked open time of hydrolysis-deficient mutants K464A/K1250A and K464A/E1371S (Powe et al. 2002; Vergani et al. 2003; Bompadre et al. 2005b), supporting the idea that the strength of ligand binding at the NBD1 site affects the stability of the open state. Login to comment

PMID: 16227620 [PubMed] Zhang ZR et al: "State-dependent chemical reactivity of an engineered cysteine reveals conformational changes in the outer vestibule of the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

5 Modification was much slower when channels were locked open by the addition of nonhydrolyzable nucleotide or when the R334C mutation was coupled to a second mutation, K1250A, which greatly decreases channel closing rate. Login to comment
40 All single channel recordings for R334C- and R34C/K1250A-CFTR used asymmetrical [Cl- ] in order to increase the single channel amplitude at VM ϭ -100 mV, where the pipettes were filled with a low [Cl- ]-containing solution (see below). Login to comment
45 R334C-, R334C/ K464A-, and R334C/K1250A-CFTR channels were activated by excision into intracellular solution containing 300 mM NMDG-Cl, 1.1 mM MgCl2, 2 mM Tris-EGTA, 1 mM MgATP, 10 mM TES (pH 7.4), 50 units/ml PKA. Login to comment
60 The bin widths for R334C-CFTR recordings in the absence of AMP-PNP were 100 ms, and for R334C-CFTR in the presence of additional AMP-PNP or for a dual mutant R334C/K1250A, bin widths were 500 and 1000 ms, respectively. Login to comment
77 To test this hypothesis, we coupled the R334C mutation with a mutation at the Walker lysine of NBD2, K1250A, which prolongs the open burst duration of CFTR channels (21-23). Login to comment
78 Fig. 1B shows a recording of a single R334C/ K1250A-CFTR channel, where the electrode was backfilled with 200 ␮M MTSETϩ . Login to comment
81 Hence, even when Po was increased by the K1250A mutation, modification at R334C did not take place in the open state. Login to comment
84 In contrast, all of the open bursts of R334C/K1250A-CFTR before modification lacked transitions between conductance states and were "locked" in the s2 state (Fig. 1B). Login to comment
85 Following MTSETϩ -induced modification, R334C/K1250A-CFTR channels opened to, and remained locked in, the s2 state. Login to comment
86 Amplitudes for the s2 state in R334C/K1250A-CFTR were not significantly different from the amplitudes of the s2 state of R334C-CFTR before and after modification (p ϭ 0.85) (17). Login to comment
107 Furthermore, the prolonged unmodified FIGURE1.RealtimemodificationofR334C-CFTRandR334C/K1250A-CFTRchannels by MTSET؉ . Login to comment
112 B, representative trace for R334C/K1250A-CFTR under identical conditions. Login to comment
122 Movement in the Outer Vestibule of the CFTR Pore DECEMBER 23, 2005•VOLUME 280•NUMBER 51 JOURNAL OF BIOLOGICAL CHEMISTRY 41999 openings and prolonged modified openings induced by AMP-PNP were "locked" in the s state, as was found for R334C/K1250A-CFTR with ATP alone, and the s2 state amplitudes were virtually identical to those for the s2 state of R334C-CFTR in the presence of ATP alone (p Ͼ 0.5). Login to comment
130 TABLEONE KineticsofmodificationofR334Cunderavarietyofconditions ValuesshownaremeanϮS.E. Condition1mMATP0.2mMATP1mMATP 1mMATP؉2.75mM AMP-PNP 1mMATP1mMATP1mMATP1mMATP MutantR334CR334CR334C/K464AR334CR334C/K1250AR334CR334CR334C/K1250A ͓MTSETϩ ͔(␮M)101010101050 ͓MTSES- ͔(␮M)5050 ␶(s)(n)5.93Ϯ1.37(4)5.88Ϯ0.49(5)2.44Ϯ0.27(3)a 4.35Ϯ0.9and 157Ϯ14.9(5) 12.5Ϯ0.94and 225Ϯ29(5)a 2.73Ϯ0.24(5)4.23Ϯ0.18(3)b 11.3Ϯ0.7and 132Ϯ30.1(5) a SignificantdifferencefromvalueforR334C-CFTRwith1mMATP,exposedto10␮MMTSETϩ . Login to comment
144 Mutation K1250A reduces the channel closing rate (Fig. 1B). Login to comment
146 We studied outside-out macropatches from oocytes expressing R334C/K1250A- or R334C/K464A-CFTR to determine the effects of these gating domain mutations on the kinetics of modification, using experimental procedures similar to those described above. Login to comment
147 Upon exposure to MTSETϩ , the macroscopic current for R334C/K1250A-CFTR increased rapidly at first, followed by a slower increase in current, reflecting a complicated modification process (Fig. 5A); the kinetics of modification were described best by the sum of two exponential functions. Login to comment
148 Hence, the consequences of introducing the K1250A mutation were similar to the consequences of the addition of nonhydrolyzable nucleotide; the time-course of macroscopic modification was biphasic, with a component that is much slower than that seen in the single mutant with ATP alone. Login to comment
151 The modification rate coefficients for MTSETϩ in R334C/K1250A-CFTR were 9,840 Ϯ 626 M -1 s-1 and 482 Ϯ 65 M -1 s-1 , respectively. Login to comment
152 The biphasic nature of the macroscopic kinetics of modification in these experiments probably reflects the fact that the K1250A mutation reduces the closing rate in some channels but not all (23). Login to comment
153 In other words, while R334C/K1250A-CFTR channels are closed, they stay closed approximately as long as R334C-CFTR channels do, which provides an opportunity for rapid modification. Login to comment
154 When R334C/K1250A-CFTR channels are open, they typically stay open much longer than R334C-CFTR channels do, which reduces the macroscopic modification rate coefficient. Login to comment
155 These interpretations are supported, at least in part, by the single channel behavior of R334C/K1250A-CFTR. Login to comment
157 The top, middle, and bottom traces are from near the beginning, middle, and end of the experiment, respectively. One can see that R334C/K1250A-CFTR channel openings lack prominent transitions between conductance states, no matter how long the burst duration. Login to comment
161 However, we were able to estimate mean burst duration of R334C/K1250A-CFTR channels. Login to comment
163 The fractional amplitudes contributed by ␶B1 and ␶B2 were 77 and 23%, respectively, which are very compatible with the fractional amplitudes for ␶1 (75%) and ␶2 (25%) for the kinetics of macroscopic modification of R334C/K1250A-CFTR. Login to comment
164 This suggests that the faster phase of macroscopic modification of R334C/K1250A-CFTR by MTSETϩ could be attributed to modification of channels with burst duration of ϳ4 s, FIGURE 5. Login to comment
165 MTSET؉ -induced modification of R334C/K1250A-CFTR and R334C/ K464A-CFTR. Login to comment
166 Shown are outside-out macropatches from oocytes expressing either R334C/K1250A-CFTR (A and C) or R334C/K464A-CFTR (B). Login to comment
169 The process of modification of R334C/K1250A-CFTR by MTSETϩ at Vm ϭ ϩ80 mVwasfitbestwiththesumoftwoexponentialfunctions,with␶1 ϭ14.8sand␶2 ϭ158s in this experiment. Login to comment
170 The kinetics of modification of R334C/K1250A-CFTR by MTSETϩ at Vm ϭ -80 mV also were described best by the sum of two exponential functions, having values of ␶1 ϭ 12.9 s and ␶2 ϭ 126 s in this experiment. Login to comment
183 This behavior also is characteristic of the K1250A single mutant, which under identical conditions exhibits PO of only ϳ0.77 (27). Login to comment
197 Fig. 7 shows outside-out macropatch recordings from oocytes expressing either R334C-CFTR or R334C/K1250A-CFTR, with rapid exposure to 50 ␮M MTSES- . Login to comment
198 Macroscopic currents from R334C- and R334C/K1250A-CFTR were decreased upon exposure to MTSES- (due to deposition of negative charge) by 75 Ϯ 6 and 77 Ϯ 5%, respectively. Login to comment
200 The macroscopic kinetics of modification of R334C/K1250A-CFTR were fit best with the sum of two exponential functions (TABLE ONE; the fractional amplitudes were 84 Ϯ 2.7% for ␶1 and 16 Ϯ 2.7% for ␶2), as was found for MTSETϩ . Login to comment
201 The modification rate coefficients for MTSES- in both R334C-CFTR and R334C/K1250A-CFTR were Ͼ3-fold lower than those measured for MTSETϩ in the same mutants (p Ͻ 0.001). Login to comment
206 Upon rapid exposure to MTSETϩ , macroscopic inward current was increased, reflecting modification of R334C/ K1250A-CFTR channels. Login to comment
208 Kinetics of modification of single R334C/K1250A-CFTR channels. Login to comment
217 All openings of R334C/K1250A-CFTR channels exhibited conductance equivalent to the s2 conductance state of R334C-CFTR. Login to comment
220 MTSES- -induced modification of R334C-CFTR and R334C/K1250A-CFTR. Login to comment
221 Outside-out macropatches were pulled from oocytes expressing either R334C-CFTR or R334C/K1250A-CFTR. Login to comment
225 The dashed line indicates a fit of the data to a first-order exponentialfunction,having␶ϭ4.5sinthisexperiment.B,arepresentativerecordingof macroscopic current of R334C/K1250A-CFTR under identical conditions. Login to comment
231 Single R334C-CFTR channels studied using real time modification only showed a reaction to MTSETϩ during a closed state, even when channel Po was increased dramatically by exposure to mixtures of ATP and AMP-PNP or by the addition of the Walker A mutation K1250A. Login to comment
233 Under conditions that increase channel activity (i.e. R334C-CFTR with ATP ϩ AMP-PNP, or R334C/K1250A-CFTR with ATP alone), the kinetics of modification were slowed. Login to comment
249 Results from the present study show that when R334C-CFTR channels are locked open by either AMP-PNP or the addition of the K1250A mutation, they are locked into the s2 state. Login to comment
252 Consistent with this notion, we recently reported that WT-CFTR channels locked open by either AMP-PNP or vanadate (and K1250A-CFTR channels with ATP alone) exhibit a reduced frequency of flickery closures compared with WT-CFTR channels in the presence of ATP alone (27). Login to comment

PMID: 16361259 [PubMed] Gross CH et al: "Nucleotide-binding domains of cystic fibrosis transmembrane conductance regulator, an ABC transporter, catalyze adenylate kinase activity but not ATP hydrolysis."

No. Sentence Comment

191 B, thin layer chromatography plateshowingtheAKactivityofthewild-typehNBD2 protein and the K1250A mutant protein. Login to comment
205 The hNBD2 (K1250A) mutant result is in agreement with the results reported by Randak and Welsh (16). Login to comment

PMID: 16472140 [PubMed] Becq F et al: "On the discovery and development of CFTR chloride channel activators."

No. Sentence Comment

175 Importantly, NS004 is a modulator of several mutated forms of CFTR; P574H [60], K1250A [61], delF508 [31, 35, 61] and G551D [59]. Login to comment

PMID: 16554808 [PubMed] Gadsby DC et al: "The ABC protein turned chloride channel whose failure causes cystic fibrosis."

No. Sentence Comment

139 But they are 11 22 11 2 a b ATP ATP ATP ATP C2 Open Concentration of MgATP in µM Relativeopeningrate K1250A K464A C1C0 101 1.0 WT K464A K1250A 0.5 0 102 103 104 Figure 3 | The conserved Walker A lysine is critical for ATP binding in each NBD. Login to comment
144 ATP first binds to the non-mutant site, that is to the NBD2 site (blue) in K464A channels (upper row), but to the NDB1 site (green) in K1250A channels (lower row). Login to comment

PMID: 16966475 [PubMed] Zhou Z et al: "The two ATP binding sites of cystic fibrosis transmembrane conductance regulator (CFTR) play distinct roles in gating kinetics and energetics."

No. Sentence Comment

18 It is generally agreed that ATP hydrolysis at NBD2 precedes channel closing since mutations (e.g., K1250A and E1371S) that abolish ATP hydrolysis at the NBD2 site drastically prolong the open time (Carson et al., 1995; Gunderson and Kopito, 1995; Zeltwanger et al., 1999; Vergani et al., 2003; Bompadre et al., 2005b). Login to comment
194 Studies using different mutations that perturb ATP hydrolysis (e.g., K1250A, E1371S) indicate that ATP hydrolysis drives channel closure. Login to comment
198 Although these studies have provided significant insight into the role of ATP hydrolysis in CFTR gating, this kind of approach does not provide a distinct advantage in understanding the role of ATP binding since altering the ligand binding affinity with these mutations is often complicated by the mutational effect on ATP hydrolysis (e.g., K1250A in Vergani et al., 2003). Login to comment

PMID: 16989640 [PubMed] Stratford FL et al: "The Walker B motif of the second nucleotide-binding domain (NBD2) of CFTR plays a key role in ATPase activity by the NBD1-NBD2 heterodimer."

No. Sentence Comment

30 In support of this model, mutation of the Walker A lysine (K1250A) or the Walker B glutamate (E1371A/Q) in the conventional catalytic site leads to defective channel closure, resulting in prolonged channel open Abbreviations used: ABC, ATP-binding cassette; CF, cystic fibrosis; CFTR, CF transmembrane conductance regulator; HA, haemagglutinin; NBD, nucleotide-binding domain; MSD, membrane spanning domain; PFO, pentadecafluorooctanoic acid; TNP-ATP, 2 (3)-O-(2,4,6-trinitrophenyl)adenosine 5-triphosphate. Login to comment
34 Although the consequences of mutating the Walker A lysine of NBD2 (K1250A) on nucleotide binding and hydrolysis have been measured [19], to date there have been no direct measurements of the consequences of mutating the putative catalytic base, Glu1371 , on nucleotide binding and hydrolysis. Login to comment

PMID: 17043148 [PubMed] Csanady L et al: "Thermodynamics of CFTR channel gating: a spreading conformational change initiates an irreversible gating cycle."

No. Sentence Comment

9 ∆H‡ for reversal of the channel opening step, estimated from closure of ATP hydrolysis-deficient NBD2 mutant K1250R and K1250A channels, and from unlocking of WT channels locked open with ATP+AMPPNP, was 43 ± 2, 39 ± 4, and 37 ± 6 kJ/mol, respectively. Login to comment
41 M AT E R I A L S A N D M E T H O D S Molecular Biology pGEMHE-WT was constructed as previously described (Chan et al., 2000), and the K1250R and K1250A mutations introduced using QuikChange (Stratagene) as previously described (Vergani et al., 2003, 2005). Login to comment
88 S2-S4 show parallel macroscopic current and temperature records illustrating temperature dependence of closure of partially phosphorylated K1250R and K1250A, and of AMPPNP-locked WT, CFTR, respectively, recorded at -80 to -20 mV between 25°C and 31°C. Fig. S5 demonstrates that exposure to millimolar levels of the hydrolysis products ADP+Pi does not cause opening of prephosphorylated WT CFTR channels. Login to comment
89 Fig. S6 shows the predicted energetic profile of CFTR gating obtained using K1250A, not K1250R (as in Fig. 6), as a model for nonhydrolytic channel closure. Login to comment
105 Temperature Dependence of Closing Rate of Hydrolysis-deficient Mutant K1250R and K1250A CFTR Channels To estimate ∆H‡ for channel closing when the normal route for channel closure via ATP hydrolysis was unavailable, we studied the temperature dependence of the closing rate of two channel constructs in which the composite NBD2 site was made catalytically inactive by mutation of the conserved NBD2 Walker A lysine, K1250. Login to comment
106 The mutation K1250A has been shown to abolish ATPase activity of purified CFTR (Ramjeesingh et al., 1999). Login to comment
108 Closure of K1250R or of K1250A mutant CFTR channels is too slow to allow kinetic analysis of individual gating events and so it was assayed as current decay after sudden removal of ATP. Login to comment
113 Because the K1250A mutation greatly diminishes the affinity for ATP binding (Vergani et al., 2003), 10 mM MgATP was used to repeatedly activate macroscopic K1250A currents at temperatures alternating between 25°C and either ‫°51ف‬C (Fig. 4 A) or ‫°13ف‬C (Fig. S3). Login to comment
117 For K1250A channels, the closing time constant after simultaneous removal of ATP and PKA was rarely assessed (τ = 38 ± 4 s, n = 3), and is not easily compared with that after removal of just ATP (τ = 25 ± 2 s, n = 29), as the latter usually progressively shortened during an experiment (τ = 29 ± 3 s, n = 18, for the first decay from each Figure 1. Login to comment
136 Temperature dependence of gating of partially phosphorylated K1250A CFTR. Login to comment
137 (A) Macroscopic current recording (top) from K1250A CFTR channels with simultaneously recorded temperature (bottom). Login to comment
140 (B) Eyring plot of normalized closing rates ( ˆk ) of K1250A CFTR channels upon ATP removal, fitted by a straight line to obtain ∆H‡; closing rates, obtained as 1/τ from single-exponential fits, as in A, were normalized to their average values in bracketing control segments at 25°C. Login to comment
145 From an Eyring plot of normalized unlocking rates (Fig. 5 B), the rough estimate of ∆H‡ for unlocking from AMPPNP of partially phosphorylated WT CFTR was 37 ± 6 kJ/ mol, similar to the value obtained above for closure of partially phosphorylated K1250R and K1250A channels opened by just ATP (Fig. 3 B and Fig. 4 B). Login to comment
167 We selected the mutant K1250A as a second model for nonhydrolytic closure because it displays much slower closure than K1250R (e.g., Vergani et al., 2003, 2005) and because the K1250A mutation abolishes ATP hydrolysis by CFTR (Ramjeesingh et al., 1999). Login to comment
188 The charge-neutralizing mutation K1250A, on the other hand,doesabrogateATPhydrolysisinCFTR(Ramjeesingh et al., 1999) and yields an open burst state more stable than that of K1250R (Vergani et al., 2003, 2005). Login to comment
189 But using the closing rate of K1250A (instead of K1250R) channels as a model for nonhydrolytic closure, and hence for reversal of channel opening, yields barrier values for this step (∆H‡ = 39 kJ/mol and Δ maxG‡ = 81 kJ/mol) that are onlyslightlydifferentfromthoseestimatedusingK1250R. Login to comment

PMID: 17353351 [PubMed] Bompadre SG et al: "G551D and G1349D, two CF-associated mutations in the signature sequences of CFTR, exhibit distinct gating defects."

No. Sentence Comment

200 It remains possible that this mutation lowers ATP binding affinity as other mutations in ABP2 (e.g., Y1219G in Zhou et al., 2006; K1250A in Vergani et al., 2003). Login to comment

PMID: 17700963 [PubMed] Bompadre SG et al: "Cystic fibrosis transmembrane conductance regulator: a chloride channel gated by ATP binding and hydrolysis."

No. Sentence Comment

135 In addition, introducing the K464A mutation into the K1250A mutant whose ATP hydrolysis at NBD2 is diminished[25,27] dramatically shortens the stable open state seen in the K1250A mutation (Fig.3). Login to comment
160 This conclusion was reached after finding that the ATP dose-response relationships of the Walker A mutants K464A and K1250A and the Walker B mutant D1370N were shifted towards higher [ATP] com- paredto theATPdose-response curvefor wild-typechannels. Login to comment
164 The K464A mutation shortens current relaxation of K1250A-CFTR. Login to comment
165 A: Representative traces for the current relaxation of K1250A-CFTR and K464A/K1250A-CFTR upon withdrawal of ATP and PKA. Login to comment
168 ** P<0.01, *** P<0.005 vs K1250A. Login to comment
181 Single channel analysis indicates that theY1219G mutation reduces the opening rate of the channel while not affecting the open time (i.e. this mutation probably does not affect ATP hydrolysis in ABP2 like K1250A or D1370N). Login to comment

PMID: 18056267 [PubMed] Beck EJ et al: "Conformational changes in a pore-lining helix coupled to cystic fibrosis transmembrane conductance regulator channel gating."

No. Sentence Comment

245 Zhang et al. (26) reported that the rate of MTSET modification of R334C-CFTR expressed in oocytes was monotonic in the WT background but followed a bi-exponential decay because of an additional slower (nearly 20 times slower) component in the K1250A background. Login to comment
246 The authors suggested that the slower reactivity in the open state that is stabilized in the K1250A mutant channel was due to changes in the local electrostatic environment (see above). Login to comment
249 A notable difference between the two mutations is that the Walker A mutation K1250A, unlike E1371Q, decreases the ATP binding affinity of NBD2 (27), which profoundly reduces the channel opening rate (28, 29) in addition to decreasing the closing rate (30) of CFTR. Login to comment
250 Hence, the slower modification rate observed in the earlier study (26) may be specific to K1250A and not a general characteristic of the open state. Login to comment

PMID: 18391167 [PubMed] Chen TY et al: "CLC-0 and CFTR: chloride channels evolved from transporters."

No. Sentence Comment

684 However, since CFTR mutants whose ATP hydrolysis is abolished (e.g., K1250A, E1371S) (251, 302), once opened by ATP, can remain open for minutes (34, 112, 323, 324, 350; cf. Refs. 42, 251), it is now generally accepted that hydrolysis of ATP at ABP2 closes the channel (97, 358). Login to comment
715 For hydrolysis-deficient mutants such as K1250A, the bursting time estimated with different methods in different reports can differ by ϳ100-fold. Login to comment
718 (237) reported a locked open-time constant of ϳ2-3 min for K1250A-CFTR. Login to comment
777 For example, the hydrolysis-deficient mutant K1250A-CFTR, once opened by ATP, stays open for minutes (but cf. Refs. 42, 251). Login to comment

PMID: 19332621 [PubMed] Tsai MF et al: "State-dependent modulation of CFTR gating by pyrophosphate."

No. Sentence Comment

10 The idea that ATP hydrolysis precedes channel closing is further supported by the observations that CFTR mutations whose ATPase activity is abrogated (e.g., K1250A and E1371S) (Ramjeesingh et al., 1999) can remain open for minutes (Gunderson and Kopito, 1995; Zeltwanger et al., 1999; Vergani et al., 2003; Bompadre et al., 2005b), and that channel closure is markedly delayed in the presence of nonhydrolyzable ATP analogue AMP-PNP (Hwang et al., 1994), or of inorganic phosphate analogue orthovanadate, which presumably forms a stable complex with the hydrolytic product ADP (Baukrowitz et al., 1994). Login to comment

PMID: 19837660 [PubMed] Chen JH et al: "Direct sensing of intracellular pH by the cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel."

No. Sentence Comment

300 Accordingly, the Walker A lysine mutant K1250A-CFTR is an ATP-dependent channel with moderate Po (16), whereas the LSGGQ motif mutant G551D-CFTR is an ATP-independent channel with extremely low Po (14, 33). Login to comment

PMID: 19966305 [PubMed] Csanady L et al: "Strict coupling between CFTR's catalytic cycle and gating of its Cl- ion pore revealed by distributions of open channel burst durations."

No. Sentence Comment

78 As a three-parameter fit of scheme 2 to the data in Fig. 1B (and also Fig. 3) did not provide a reliable estimate of this small rate (SI Text), to estimate k-1 we measured the macroscopic closing rates of prephosphorylated K1250A, K1250R, and E1371S mutant channels (e.g., Fig. 2A) upon sudden removal of ATP. Login to comment
79 These rates, obtained as the reciprocals of the time constants of fitted single exponentials (e.g., Fig. 2A, blue line), were 0.044 ± 0.004 s-1 (n = 9) for K1250A (Fig. 2C, blue bar), 0.22 ± 0.01 s-1 (n = 17) for K1250R, and 0.036 ± 0.002 s-1 (n = 16) for E1371S. Login to comment
87 For instance, closure of the catalytically incompetent NBD2 Walker A mutant K1250A is accelerated ~10-fold in the double-mutant K464A/K1250A, as reported by the rate of macroscopic current decay upon ATP removal (Fig. 2B; red line is a single-exponential fit; Fig. 2C, red bar). Login to comment
98 (A and B) Macroscopic currents of prephosphorylated K1250A (A) and K464A/K1250A (B) CFTR channels were activated by application of 10 mM ATP. Login to comment
100 (C) Mean (±SEM) closing rates estimated as the inverses of the current relaxation time constants (τrelax), for K1250A (blue) and K464A/K1250A (red). Login to comment

PMID: 20667826 [PubMed] Thibodeau PH et al: "The cystic fibrosis-causing mutation deltaF508 affects multiple steps in cystic fibrosis transmembrane conductance regulator biogenesis."

No. Sentence Comment

200 Mutations of the Walker A lysine (K464A and K1250A in NBD1 and NBD2, respectively) have been shown to dramatically decrease ATP affinity (40). Login to comment
205 Similarly, the introduction of the K1250A mutation had minimal effects on the maturation of wild type CFTR and failed to rescue the ⌬F508 CFTR protein. Login to comment
281 Mutation of the equivalent position in NBD2, K1250A, has minimal effect on CFTR maturation. Login to comment
329 As well, disruption of the composite ATP-binding site in NBD2 by the K1250A mutant had no discernible effect on CFTR maturation. Login to comment

PMID: 20876359 [PubMed] Szollosi A et al: "Involvement of F1296 and N1303 of CFTR in induced-fit conformational change in response to ATP binding at NBD2."

No. Sentence Comment

242 Although for WT CFTR and for the nonhydrolytic mutant D1370N these two parameters are in rough agreement (Csanády et al., 2010), such comparisons have not yet been done for several other NBD2mutantsdefectiveinATPhydrolysis(e.g.,K1250R, K1250A, E1371S, and E1371Q). Login to comment

PMID: 21594801 [PubMed] Csanady L et al: "Electrophysiological, biochemical, and bioinformatic methods for studying CFTR channel gating and its regulation."

No. Sentence Comment

187 This technique for estimating mean burst duration has been preferentially used for catalytic site mutants which abolish ATP hydrolysis at the composite NBD2 site (e.g., K1250A), or when non-hydrolyzable ATP analogs (e.g., AMP-PNP and pyrophosphate) are applied, because in either case burst durations are prolonged to several seconds or tens of seconds. Login to comment

PMID: 21658632 [PubMed] Becq F et al: "Pharmacological therapy for cystic fibrosis: from bench to bedside."

No. Sentence Comment

216 [121] NIH3T3 cells F508del, K1250A Electrophysiology Genistein and benzimidazolones shared the same mechanism of action. Login to comment

PMID: 9922377 [PubMed] Gadsby DC et al: "Control of CFTR channel gating by phosphorylation and nucleotide hydrolysis."

No. Sentence Comment

567 K1250A CFTR channels bearing a mutation at the the functional analogy between CFTR`s NBDs and G proteins (discussed in sect. IVD2) could be resurrected andWalker A Lys of NBD2, expected to impair ATP hydrolysis there, have been reported to display slowed opening as reconciled with the new structural evidence. Login to comment
569 The overall result the information presently available, so they must await new experimental reults.is that Po of K1250A CFTR is reduced to about one-half that of wild-type CFTR channels (25, 159) and that the ATPase rate is even more markedly diminished (159). Login to comment
570 Sub- VI. CONCLUDING REMARKSstantially reduced ATPase activity of K1250A CFTR would be expected from the loss of ATP hydrolysis associated with wild-type CFTR channel closing, a loss inferred from The correlation between genotype and phenotype in terms of CF disease remains perplexingly elusive. Login to comment
571 But,detailed electrophysiological analysis of single K1250A channel records (75). Login to comment
572 If K1250A channels eventually close although in two-thirds of CF patients the disease stems from the same mutation in one chromosome 7 copy (caus-following dissociation, rather than hydrolysis, of the ATP at NBD2, the latter might reasonably be expected to tem- ing deletion of Phe-508), other influences of nature and nurture probably make it unrealistic to expect the sameporarily adopt a conformation different from that attained after hydrolysis. Login to comment

PMID: 9931011 [PubMed] Ramjeesingh M et al: "Walker mutations reveal loose relationship between catalytic and channel-gating activities of purified CFTR (cystic fibrosis transmembrane conductance regulator)."

No. Sentence Comment

21 While it was determined that the K464A mutation abrogated ATPase activity of the CFTR-NBF1 fusion protein (15), the effect of the K1250A mutation in the context of the CFTR-NBF2 fusion protein is not known. Login to comment
32 A small cassette containing the specific mutation, i.e., a BspE1/SphI fragment for the K464A mutation or a Pm1I/Tth111I fragment for the K1250A mutation was subcloned into a new pBQ6.2 and then sequenced to confirm the introduction of the mutations. Login to comment
33 Ultimately, K464A (as an XbaI/SphI fragment) or K1250A (as a Pm1I/Tth111I fragment) was subcloned into pBlueBac4 (Invitrogen, Carlsbad, CA) for baculovirus expression. Login to comment
123 Disruption of the Chloride Channel ActiVity of the Intact Purified CFTR Protein by Mutation of the Walker A Lysine in either NBF1 or NBF2. We assessed the consequences of each of the Walker lysine mutations, K464A and K1250A, on the chloride channel activity of CFTR using two assays. Login to comment
166 The double mutant, CFTRK464A/K1250A, also exhibits negligible catalytic activity, comparable to that of CFTRK1250A (data not shown), supporting our suggestion that the two Walker sites are not symmetrical. Login to comment

PMID: 9521779 [PubMed] Urbatsch IL et al: "Mutations in either nucleotide-binding site of P-glycoprotein (Mdr3) prevent vanadate trapping of nucleotide at both sites."

No. Sentence Comment

254 In the cystic fibrosis transmembrane conductance regulator (CFTR), mutations of the conserved Walker A lysine altered the conductive properties of the Cl- channel: the K464A mutation in NB1 decreased the frequency of channel openings, whereas K1250A or K1250M in NB2 prolonged the open state of the channel (59). Login to comment

PMID: 22966014 [PubMed] Jih KY et al: "Nonintegral stoichiometry in CFTR gating revealed by a pore-lining mutation."

No. Sentence Comment

44 For example, the drastic effect of nonhydrolyzable ATP analogues or mutations (e.g., E1371S or K1250A) that abolish ATP hydrolysis on the open time supports the notion that ATP hydrolysis is coupled to channel Figure 1. An updated model illustrating the relationship between an opening/closing cycle of the gate and ATP consumption in CFTR` s NBDs. Login to comment
43 For example, the drastic effect of nonhydrolyzable ATP analogues or mutations (e.g., E1371S or K1250A) that abolish ATP hydrolysis on the open time supports the notion that ATP hydrolysis is coupled to channel Figure 1.ߓ An updated model illustrating the relationship between an opening/closing cycle of the gate and ATP consumption in CFTR` s NBDs. Login to comment

PMID: 22966013 [PubMed] Tsai MF et al: "CFTR: An ion channel with a transporter-type energy-coupling mechanism."

No. Sentence Comment

53 Indeed, unlike ABC transporters, which absolutely require ATPase activity to move substrates, CFTR mutants incapable of catalyzing ATP hydrolysis (e.g., K1250A, D13710N, and E1371Q) exhibit gating transitions with open probabilities comparable to WT (Powe et al., 2002; Vergani et al., 2003). Login to comment
51 Indeed, unlike ABC transporters, which absolutely require ATPase activity to move substrates, CFTR mutants incapable of catalyzing ATP hydrolysis (e.g., K1250A, D13710N, and E1371Q) exhibit gating transitions with open probabilities comparable to WT (Powe et al., 2002; Vergani et al., 2003). Login to comment

PMID: 22948143 [PubMed] Randak CO et al: "Demonstration of Phosphoryl Group Transfer Indicates That the ATP-binding Cassette (ABC) Transporter Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Exhibits Adenylate Kinase Activity."

No. Sentence Comment

183 2) Patch clamp studies showed that mutations K1250A and D1370N, located within conserved motifs of ATP-binding site 2, abolished the effects of Ap5A and AMP on CFTR current. Login to comment

PMID: 22680785 [PubMed] Liu X et al: "Thermal instability of DeltaF508 cystic fibrosis transmembrane conductance regulator (CFTR) channel function: protection by single suppressor mutations and inhibiting channel activity."

No. Sentence Comment

6 Another mutation, K1250A, known to increase open probability (Po) of ΔF508 CFTR channels, exacerbated thermal inactivation. Login to comment
179 K1250A/ΔF508/CFTR Channels Inactivate More Rapidly at 37 °C. Login to comment
180 The Po of ΔF508 CFTR channels can be enhanced by substitutions for the "Walker lysine" in NBD2 (K1250) which slow the hydrolysis of ATP at composite site 2 of the NBD1/NBD2 dimer47 such that channels exhibit prolonged open times at room temperature.47 The results depicted in Figure 9 show that channel function of the double mutant (K1250A/ΔF508 CFTR) is even less stable than ΔF508 CFTR as judged by the increased rate of thermal inactivation. Login to comment
202 K1250A accelerated thermal inactivation of ΔF508 CFTR. Login to comment
203 (A) After stimulation, an oocyte expressing ΔF508 CFTR (gray bar and circles) or K1250A/ΔF508 CFTR (gray bar and downward triangles) was warmed to 37 °C for 10 min and then the bath was cooled to 22 °C. Login to comment
204 (B) Summary of the half-time of thermal inactivation of K1250A/ΔF508 and ΔF508 CFTR. Login to comment
274 Likewise, two experimental maneuvers that increased channel open probability, a second site mutation in NBD2 (K1250A) and a CFTR potentiator (P2), actually exacerbated thermal inactivation, although two other potentiators (P1 and Genistein) did not. Login to comment

PMID: 22508846 [PubMed] Jih KY et al: "Identification of a novel post-hydrolytic state in CFTR gating."

No. Sentence Comment

217 These flickering closings have been long thought to be ATP independent, as they can be easily discerned in a complete absence of ATP within an opening burst of hydrolysis-deficient mutants, such as E1371S or K1250A (Carson et al., 1995; Powe et al., 2002; Bompadre et al., 2005b; Vergani et al., 2005). Login to comment

PMID: 21461971 [PubMed] Krasilnikov OV et al: "ATP hydrolysis-dependent asymmetry of the conformation of CFTR channel pore."

No. Sentence Comment

31 This locked-open phenotype is also observed when the ATPase activity of NBD2 is abolished by the mutation of K1250A or E1371S [10, 23, 39]. Login to comment
225 An intriguing question as to whether the mutation at the site essential for ATP hydrolysis in NBD2 (such as K1250A and E1371S) causes a similar conformational change remains for future studies. Login to comment

PMID: 18805924 [PubMed] Dong Q et al: "A mutation in CFTR modifies the effects of the adenylate kinase inhibitor Ap5A on channel gating."

No. Sentence Comment

171 For example, the K1250A and D1370N mutations also have a reduced opening rate, prolonged burst duration, and increased ATP EC50 (11,12,14,15,29,32,39,43). Login to comment

PMID: 18417076 [PubMed] Cheung JC et al: "Molecular basis for the ATPase activity of CFTR."

No. Sentence Comment

124 For example, mutations of residues in the catalytic site (Site A, Fig. 1) that decrease ATPase activity, such as mutation of the Walker A lysine residue in NBD2 (K1250A) [29] and mutation of the putative catalytic base: E1371Q leads to a decrease in the rate of channel closing [51,52,55]. Login to comment

PMID: 18595696 [PubMed] Al-Nakkash L et al: "Activation of CFTR by UCCF-029 and genistein."

No. Sentence Comment

3 Using NIH3T3 cells stably transfected with K1250A-CFTR we find that CFTR channel open time is unaffected by UCCF-029 or genistein, supporting the hypothesis that these compounds stabilize the open state by inhibiting ATP hydrolysis at NBD2. Login to comment
56 To examine whether UCCF-029 acts to stabilize the channel open state, we determined its effect upon the K1250A-CFTR channel (a CFTR channel mutation that can stay open for minutes once opened).16 A representative recording of K1250A-CFTR in cell-attached patch is shown (Fig. Login to comment
63 In addition, we demonstrate that UCCF-029 is unable to further stimulate the K1250A-CFTR chloride current activated by a maximally effective concentration of forskolin. Login to comment
64 We have previously shown similar results with genistein and benzimidazolone analogs.6 Our earlier data using relaxation analysis demonstrated that these compounds stabilize open state by inhibiting ATP hydrolysis at NBD2.6 K1250A-CFTR, a mutation of the Walker A lysine at NBD2 prolongs channel opening by eliminating ATP hydrolysis at NBD2.19,16 The original work describing UCCF-029 compared its effects to several other novel compounds generated using combinatorial libraries and with genistein,11 using the halide-sensitive yellow fluorescent protein on Wt-CFTR transfected Fischer rat thyroid (FRT) cells. Login to comment
62 In addition, we demonstrate that UCCF-029 is unable to further stimulate the K1250A-CFTR chloride current activated by a maximally effective concentration of forskolin. Login to comment

PMID: 16183882 [PubMed] Fuller MD et al: "The block of CFTR by scorpion venom is state-dependent."

No. Sentence Comment

6 The on-rate of venom binding for intraburst block could be modulated by changing CFTR activity with vanadate or adenylyl-imidodiphosphate, or by introducing the Walker A mutation K1250A. Login to comment
33 We also found that the potency of venom for intraburst inhibition was reduced in single-channel recordings of WT-CFTR channels with very high open probability or when the venom was applied to K1250A-CFTR channels. Login to comment
41 The mutant K1250A-CFTR construct was prepared with the QuikChange protocol (Stratagene, La Jolla, CA) using oligonucleotide-mediated mutagenesis. Login to comment
163 Mutations in NBD-B, such as K1250A, result in channels that follow the initial WT-CFTR gating steps; however, rates of ATP binding at NBD-B and hydrolysis of that ATP are greatly reduced (boxes). Login to comment
216 K1250A-CFTR channels exhibit a greatly reduced rate of ATP hydrolysis, resulting in channels that are open for tens of seconds; however, K1250A-CFTR channels also exhibit a reduced opening rate such that they remain in the C2 closed state longer than WT-CFTR channels (18). Login to comment
217 Studies were performed with K1250A-CFTR in multichannel patches with 50 U/mL PKA and 1 mM MgATP continuously present. Login to comment
227 However, results from studies with WT-CFTR in macropatch recordings (Fig. 1 C), as well as K1250A-CFTR in recordings of only a few channels (Fig. 4 B), suggested that the venom does not interact with the open state. Login to comment
239 (C) Representative single-channel recording of K1250A-CFTR before and during treatment with 0.1 mg/mL Lqh-pf venom. Login to comment
293 TABLE 1 Lqh-pf venom becomes a more effective blocker at lower CFTR channel activity Condition Venom dose (mg/mL) Control Po With venom Po Fractional inhibition n Wild-type (low Po)* 0.1 0.181 6 0.031 0.118 6 0.018y 31.4 6 6.96y 6 Wild-type (high Po)z 0.1 0.584 6 0.091 0.554 6 0.087 5.08 6 0.19 2 Wild-type (high Po)z 0.2 0.419 6 0.020 0.226 6 0.080 46.7 6 16.4 2 Wild-type 1 VO4 § 0.2 0.569 6 0.158§ 0.391 6 0.121y§ 31.9 6 6.32y§ 3 Wild-type 1 AMP-PNP§ 0.2 0.618 6 0.107§ 0.442 6 0.095y§ 29.5 6 5.22y§ 3 K1250A 0.1 0.772 6 0.079 0.751 6 0.074 2.66 6 0.59 3 Inhibition of CFTR by Lqh-pf venom was determined under several experimental conditions used to control channel-open probability. Login to comment
301 In addition, we also employed the Walker A mutant K1250A-CFTR, which gates open much like WT-CFTR, although the rate of ATP binding to NBD-B is somewhat reduced, whereas hydrolysis of ATP is greatly reduced, resulting in open bursts that are many tens of seconds in duration (Fig. 2, boxes). Login to comment
310 In control conditions, K1250A-CFTR channels remained almost entirely in the open state (Fig. 7 C, top), with few brief closures. Login to comment
312 Treatment of single K1250A-CFTR channels with 0.1 mg/mL Lqh-pf venom resulted in only 2.66 6 0.59% inhibition of channel activity (Po ¼ 0.772 6 0.079 vs. 0.751 6 0.074, n ¼ 3). Login to comment
313 Notably, the durations of the venom-induced intraburst blocked states in K1250A-CFTR and WT-CFTR with ATP 1 AMP-PNP, or WT-CFTR with ATP 1 vanadate, were similar to those observed in WT-CFTR with ATP alone (400-700 ms). Login to comment
315 The results described above suggested that Lqh-pf venom might be less effective at inhibiting K1250A-CFTR channels or WT-CFTR channels locked open by AMP-PNP or vanadate because those channels occupy the FC state less frequently. Login to comment
320 Similar results were seen when WT-CFTR channels were locked open with vanadate (Fig. 8 B) or when K1250A-CFTR channels were activated with MgATP (Fig. 8 C). Login to comment
323 All K1250A-CFTR openings were used. Login to comment
330 (C) Representative trace of K1250A-CFTR with 1 mM MgATP and 50 U/mL PKA continuously present before and during application of 0.1 mg/mL Lqh-pf venom. Login to comment
334 The largest increase in mean open time between intraburst closings was seen in K1250A-CFTR where the channels remained open for an average of 1580.9 6 106.8 ms (n ¼ 3 recordings, n ¼ 3 bursts, n ¼ 177 open duration events; p # 0.001 compared to WT-CFTR) between intraburst closings. Login to comment
340 Additionally, WT-CFTR channels that were locked in the open conformation by vanadate or AMP-PNP, and CFTR channels bearing the K1250A mutation, were inhibited by venom only at higher concentrations. Login to comment
356 (C) Representative trace of K1250A-CFTR from an excised inside-out patch with 1 mM MgATP and 50 U/mL PKA continuously present. Login to comment
357 All recordings at Vm ¼ ÿ100 mV. Note that brief closings, $5 ms in duration, occur less frequently when CFTR channel activity is manipulated by drug (vanadate or AMP-PNP) or mutation (K1250A), compared to WT-CFTR channels that are activated by MgATP and PKA only. Login to comment
358 (D) Effect of vanadate, AMP-PNP or K1250A mutation on the frequency of intraburst closings in records filtered at 500 Hz. Login to comment
379 Furthermore, K1250A-CFTR channels and WT-CFTR channels locked open by AMP-PNP basically never reach the C4 state, and yet do show the lengthening of interburst durations (Fig. 4). Login to comment
391 The effect oninterburst kinetics cannot fully explain the reduced efficacy of inhibition of single K1250A-CFTR channels or single WT-CFTR channels in the presence of AMP-PNP or vanadate. Login to comment
400 This was most apparent in experiments with channels locked open by vanadate, AMP-PNP, or mutation K1250A. Login to comment
424 The previous results could also explain why Lqh-pf venom is significantly less effective when applied to K1250A-CFTR, since the frequency of short intraburst closings in this mutant is much less than that seen with WT-CFTR (Fig. 8 D). Login to comment
439 The K1250A-CFTR results are also consistent with this notion. Login to comment
441 As a result, the NBD-ICD interaction would be stabilized, resulting in a decrease in the frequency of FC intraburst closings during open bursts in K1250A-CFTR, which is what we see in Fig. 8 C. The structural differences that are dependent on the nucleotide species bound at NBD-B could also have a large effect on the on-rate of venom binding during the FC intraburst closings. Login to comment
442 This would explain the decrease in intraburst inhibition of K1250A-CFTR channels and of WT-CFTR channels that are locked open with AMP-PNP or vanadate when a low concentration of the venom was applied (Fig. 7). Login to comment
446 K1250A-CFTR with ATP) (Table 1) is similar to the predicted order shown in Fig. 8 D. Small conformational changes in the NBD dimer are needed to signal for channel opening (9). Login to comment

PMID: 15463939 [PubMed] Sheppard DN et al: "The patch-clamp and planar lipid bilayer techniques: powerful and versatile tools to investigate the CFTR Cl- channel."

No. Sentence Comment

153 To investigate the gating kinetics of the brief flickery closures interrupting channel openings, Zhou et al. [22] used K1250A, a CFTR construct with an elevated Po ( Po f 0.9), and a simple model of channel block: Open X a b Blocked; ð6Þ where a is the apparent on-rate of the blocker and b the off-rate. Login to comment
148 To investigate the gating kinetics of the brief flickery closures interrupting channel openings, Zhou et al. [22] used K1250A, a CFTR construct with an elevated Po ( Po f 0.9), and a simple model of channel block: Open X a b Blocked; &#f0;6&#de; where a is the apparent on-rate of the blocker and b the off-rate. Login to comment

PMID: 9512029 [PubMed] Mansoura MK et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) anion binding as a probe of the pore."

No. Sentence Comment

97 Finally, dose-dependent inhibition of CFTR conductance by [SCN]o (see below) was identical in wtCFTR and a CFTR mutant exhibiting highly altered gating, K1250A (Wilkinson et al., 1996). Login to comment
146 Sensitivity to [SCN]o was identical to wtCFTR in a construct bearing a mutation in NBF2, K1250A (data not shown), which exhibits severely altered activation in the form of a highly stabilized active state (Wilkinson et al., 1996). Login to comment
147 The data in Table 3 show that for wtCFTR and G314Q and G314E, two of the most severely affected constructs, PSCN/PCl calculated from the shift in Vr was independent of the fractional abundance of [SCN]o. Login to comment
98 Finally, dose-dependent inhibition of CFTR conductance by [SCN]o (see below) was identical in wtCFTR and a CFTR mutant exhibiting highly altered gating, K1250A (Wilkinson et al., 1996). Login to comment

PMID: 9463368 [PubMed] Sugita M et al: "CFTR Cl- channel and CFTR-associated ATP channel: distinct pores regulated by common gates."

No. Sentence Comment

131 The residues altered in CFTR∆R-S660A, CFTR S-oct-D, K464A and K1250A mutants are shown. Login to comment
155 These NBD1 and NBD2 mutants, containing the individual mutations K464A and K1250A, respectively, were expressed in MDCK cells and single-channel currents of CFTR Cl- channels and CFTR-associated ATP channels were analyzed. Login to comment
163 The K464A mutation similarly had no significant effects on the gating of the CFTR-associated ATP channels (Figure 10B, C, D and E). Login to comment
164 In contrast, mutation of the corresponding lysine in NBD2 (K1250A) resulted in CFTR-associated ATP channels (p Ͻ0.01) as well as CFTR Cl- channels (p Ͻ0.02) that exhibited significantly prolonged to (Figure 10A and D). Login to comment
165 The K1250A mutation resulted in gating behaviors of wild-type CFTR Cl- channels and CFTR-associated ATP channels which mimicked those induced by non-hydrolyzable nucleotide analogues (Figure 10A). Login to comment
166 In addition, we noted that the K1250A mutation also decreased tc of both CFTR Cl- channels (p Ͻ0.01) as well as CFTR-associated ATP channels (p Ͻ0.01) (Figure 10E). Login to comment
167 As a result, the K1250A mutation caused a substantial increase in the Po of both channels (p Ͻ0.01) (Figure 10C). Login to comment
171 (A) Current traces from a MDCK cell expressing K1250A in an inside-out patch with 100 mM ATP in the pipette and 140 mM Clin the bath at various membrane potentials (representative of six independently observed channels). Login to comment
173 (B) Current traces from a MDCK cell expressing K464A at various membrane potentials (representative of nine independently observed channels). Login to comment
205 Mutations in the conserved Walker A motif lysines of NBD1 (K464A) and NBD2 (K1250A) are thought to attenuate ATP hydrolysis with minimal effect on ATP binding (Sung et al., 1988; Schneider et al., 1994; Carson et al., 1995). Login to comment
209 The K1250A mutation had more pronounced effects. Login to comment
211 The prolonged channel open time in the K1250A mutant suggests that ATP hydrolysis at NBD2 closes the channel, consistent with previous observations (Carson et al., 1995; Gunderson and Kopito, 1995). Login to comment
272 Acknowledgements We thank M.Welsh for providing the CFTR∆R-S660A and CFTR S-oct-D mutants, R.Kopito for providing the K1250A and K464A mutants, J.Engelhardt for providing the R347E mutant, U.Patel for her precious technical help and D.Mak for helpful discussions. Login to comment
138 The residues altered in CFTRƊR-S660A, CFTR S-oct-D, K464A and K1250A mutants are shown. Login to comment
174 The K1250A mutation resulted in gating behaviors of wild-type CFTR Cl-channels and CFTR-associated ATP channels which mimicked those induced by non-hydrolyzable nucleotide analogues (Figure 10A). Login to comment
175 In addition, we noted that the K1250A mutation also decreased tc of both CFTR Cl-channels (p b0d;0.01) as well as CFTR-associated ATP channels (p b0d;0.01) (Figure 10E). Login to comment
176 As a result, the K1250A mutation caused a substantial increase in the Po of both channels (p b0d;0.01) (Figure 10C). Login to comment
180 (A) Current traces from a MDCK cell expressing K1250A in an inside-out patch with 100 mM ATP in the pipette and 140 mM Clin the bath at various membrane potentials (representative of six independently observed channels). Login to comment
215 Mutations in the conserved Walker A motif lysines of NBD1 (K464A) and NBD2 (K1250A) are thought to attenuate ATP hydrolysis with minimal effect on ATP binding (Sung et al., 1988; Schneider et al., 1994; Carson et al., 1995). Login to comment
219 The K1250A mutation had more pronounced effects. Login to comment
221 The prolonged channel open time in the K1250A mutant suggests that ATP hydrolysis at NBD2 closes the channel, consistent with previous observations (Carson et al., 1995; Gunderson and Kopito, 1995). Login to comment
282 Acknowledgements We thank M.Welsh for providing the CFTRƊR-S660A and CFTR S-oct-D mutants, R.Kopito for providing the K1250A and K464A mutants, J.Engelhardt for providing the R347E mutant, U.Patel for her precious technical help and D.Mak for helpful discussions. Login to comment

PMID: 9558482 [PubMed] Foskett JK et al: "ClC and CFTR chloride channel gating."

No. Sentence Comment

321 The prolonged openings observed in the K1250A mutant are distinguished from those induced by nonhydrolyzable ATP analogues because they are independent of the degree of channel phosphorylation (145), whereas nonhydrolyzable analogues may only affect fully phosphorylated channels (127). Login to comment
324 An interesting contrast to the effects of the K1250A mutation in the Walker A motif was revealed in a D1370N mutant in the Walker B motif. Login to comment
325 In the latter, openings as well as closings were prolonged, but the prolonged openings (≈1.5 s) were considerably shorter than those seen in the K1250A mutant (tens of seconds) (150). Login to comment
329 Furthermore, they suggest that the prolonged openings induced by polyphosphates and the K1250A mutation require Mg2+ and nucleotide binding at NBD2. Login to comment

PMID: 9346969 [PubMed] Ma J et al: "Function of the R domain in the cystic fibrosis transmembrane conductance regulator chloride channel."

No. Sentence Comment

258 Point mutations within the conserved Walker A motif of NBF1 decreased the opening rate of the CFTR channel, while the corresponding mutations in NBF2 (K1250A, K1250M) prolong the open lifetime of CFTR (14, 15). Login to comment
259 The functional effects of K1250A and K1250M on the CFTR channel are similar to the effects of AMP-PNP and PPi (19, 24), suggesting that a decrease in the ATP hydrolysis rate at NBF2 leads to prolonged opening of the CFTR channel. Login to comment
260 The functional effects of K1250A and K1250M on the CFTR channel are similar to the effects of AMP-PNP and PPi (19, 24), suggesting that a decrease in the ATP hydrolysis rate at NBF2 leads to prolonged opening of the CFTR channel. Login to comment

PMID: 9511929 [PubMed] Devidas S et al: "CFTR: domains, structure, and function."

No. Sentence Comment

113 (1995) demonstrated that CFTR variants which contained mutations in the conserved Walker A motif of either NBD1 (K464A) or NBD2 (K1250M and K1250A) decreased the open probability of the channel compared to wt-CFTR. Login to comment
114 Mutations in NBD1 alone decreased the open probability whereas mutations at NBD2 or simultaneously at both the NBDs (K464A/ K1250A) prolonged the frequency of bursts of activity. These data point out convincingly that the two NBD's cooperate to control channel gating. Login to comment

PMID: 9252549 [PubMed] Wilkinson DJ et al: "CFTR activation: additive effects of stimulatory and inhibitory phosphorylation sites in the R domain."

No. Sentence Comment

64 Interpretation of Dose Response and Rate Analyses In a previous study (20), we used a CFTR (K1250A) mutant that is hypersensitive to activation by IBMX [half-maximal activation constant (&) = 0.07 mM] to obtain evidence that IBMX blocks CFTR channels with a half-maximal inhibition constant (&) of -9.5 mM. Login to comment

PMID: 8741733 [PubMed] Wilkinson DJ et al: "CFTR: the nucleotide binding folds regulate the accessibility and stability of the activated state."

No. Sentence Comment

88 The Kj fbr IBMX block was estimated from the response of the hypersensitive mutant, K1250A. Login to comment
89 Because K1250A is maximally activated at an IBMX concentration of,'-,1 raM, the block by higher concentrations of IBMX is readily apparent. Login to comment
94 The value of N'!I/N'~I~ estimated for the mutant K1250A indicated that the maximum gcJ actually observed, g~'!i~'X,was nearly equal to the maximum possible activation, N'~l, presumably because this conductance is achieved at an IBMX concentration of 1 raM, where block is minimal. Login to comment
95 The calculated curves for activation and block of K1250A are shown in Fig. 3 A, where the values of gel are normalized to the theoretical maximum, N'!]. Login to comment
97 The magnitude of the transient increase in gel tor K1250A after removal of 5 mM IBMX in the rate experiments (cf. Fig. 5 B) was consistent with this interpretation. Login to comment
125 The fit of Eq. 2 to the combined data for the hypersensitive mutant K1250A yielded a value of K1for the block by IBMX, as described in the text. Login to comment
126 (A) The plotted points (O) are means -+ SEM for 10 oocytes expressing the mutant K1250A. Login to comment
129 (B) IBMX dose-response relations for steady state activation of K1250A (~), wild-type CFTR (Q, n = 26), and K464Q (A, n = 5). Login to comment
133 In Fig. 3 B, the activation components for wild-type CFTR and the mutants K1250A and K464Q were simulated by adding back the blocked component and plotting the adjusted data points along with the curves calculated using the estimated KAvalues. Login to comment
195 a~ODiap- 9 K464Q a I ' ' ' ' I ' ' ' ' I ' ' 0 10 20 ~ O -0 0, 9 -0~176176176o ....... 9.... -o*- -o*- 9 i~ e'~176176176176 9 D572N o i , , , , i , , , , i , , , , I , , , , i , , , , i , , , , 0 I0 20 30 40 50 minutes K1250A K1250C I i 30 D1370N 6O FIGURE4. Login to comment
281 + kott) (10-3 min-l kon kofr latency *k~m CFTR (mM) n (10-3min-]) mM-1) (10-3min 1) (10-3min-l) n (min) (10 3min i) n wt 0.65 • 0.08 26 664 • 51 118 • 9 558 • 45 76-+ 6 20 6.0 • 0.3 88 • 6 16 K464R 2.6 • 0.1": 4 153 + 20**+ 20 • 3*** 101 • 13''` 52 • 7*: 5 1.3 • 0.2*++ 174 • 14"** 7 K464Q 3.3 • 0.5"* 5 331 • 56*** 40 -+ 7* 199 • 34* 132 • 22*'` 5 1.9 • 0.3"I 142 -+ 19''` 5 K464A 4.6 • 0.7** 6 289 • 49* 30 • 5** 151 • 26*** 139 • 24*: 7 1.1 • 0.1"** 133 • 14"** 8 D572N 9.3 + 0.02*: 6 106 • 7*: 7-+0.5*: 37-+3*** 69 • 5+* 4 0.9 • 0.2*** 245 • 32*: 3 K1250R 0.17 • 0.07*: 5 239 •33*** 46 -+ 6"+* 231 • 32*: 8 • 1": 10 10.4 • 0.8"~ 100 • 7** 6 K1250Q 0.12 • 0.04*** 5 150 • 18''` 29 • 4* 146 -+ 18" 4 + 0.4"I 5 22.3 • 2.4*: 30 •5": 5 K1250A 0.07 + 0.02*: 10 218 • 18" 43 • 4*'` 215 • 18": 3 -+0.3*~* 5 15.6-+ 1.0"** 43 -+5** 5 D1370N 0.16 + 0.04*'` 7 449 - 79*: 87 • 15: 435 +76** 14 - 2*: 5 16.3-4-1.2"" 69-+ 6** 5 The symbols (*) and ('`) indicate significant differences from wild-type CFTR and the analogous mutant, respectively (P < 0.05). Login to comment
371 After washout of 10 tzM forskolin, there was no transient increase in gc~, but the rate of decline was Nfourfold slower for the hypersensitive K1250A mutant, which is consistent with the results seen with 5 mM IBMX. Login to comment
382 For example, the mutation K1250A increased the burst duration of CFTR by four- to fivefold, and the analysis of CFTR deactivation in oocytes indicates that this substitution produced at least a threefold increase in the stability of the active state (Table II and Fig. 7). Login to comment
384 However, the open probability of K1250A was decreased by more than twofold, largely because of a 30-50-fold increase in the interburst interval, an effect that is not predicted by the present results. Login to comment
90 Because K1250A is maximally activated at an IBMX concentration of,'-,1 raM, the block by higher concentrations of IBMX is readily apparent. Login to comment
96 The calculated curves for activation and block of K1250A are shown in Fig. 3 A, where the values of gel are normalized to the theoretical maximum, N'!]. Login to comment
98 The magnitude of the transient increase in gel tor K1250A after removal of 5 mM IBMX in the rate experiments (cf. Fig. 5 B) was consistent with this interpretation. Login to comment
127 The fit of Eq. 2 to the combined data for the hypersensitive mutant K1250A yielded a value of K1for the block by IBMX, as described in the text. Login to comment
128 (A) The plotted points (O) are means -+ SEM for 10 oocytes expressing the mutant K1250A. Login to comment
131 (B) IBMX dose-response relations for steady state activation of K1250A (~), wild-type CFTR (Q, n = 26), and K464Q (A, n = 5). Login to comment
135 In Fig. 3 B, the activation components for wild-type CFTR and the mutants K1250A and K464Q were simulated by adding back the blocked component and plotting the adjusted data points along with the curves calculated using the estimated KAvalues. Login to comment
198 a~ODiap- 9 K464Q a I ' ' ' ' I ' ' ' ' I ' ' 0 10 20 ~ O -0 0, 9 -0 ~176176176 o ....... 9.... -o*- -o*- 9 i~ e'~176176176176 9 D572N o i , , , , i , , , , i , , , , I , , , , i , , , , i , , , , 0 I0 20 30 40 50 minutes K1250A K1250C I i 30 D1370N 6O FIGURE4. Login to comment
283 + kott) (10-3 min-l kon kofr latency *k~m CFTR (mM) n (10-3 min-]) mM-1) (10-3 min 1) (10-3min-l) n (min) (10 3min i) n wt 0.65 ߦ 0.08 26 664 ߦ 51 118 ߦ 9 558 ߦ 45 76 -+ 6 20 6.0 ߦ 0.3 88 ߦ 6 16 K464R 2.6 ߦ 0.1": 4 153 + 20**+ 20 ߦ 3*** 101 ߦ 13''` 52 ߦ 7*: 5 1.3 ߦ 0.2*++ 174 ߦ 14"** 7 K464Q 3.3 ߦ 0.5"* 5 331 ߦ 56*** 40 -+ 7* 199 ߦ 34* 132 ߦ 22*'` 5 1.9 ߦ 0.3"I 142 -+ 19''` 5 K464A 4.6 ߦ 0.7** 6 289 ߦ 49* 30 ߦ 5** 151 ߦ 26*** 139 ߦ 24*: 7 1.1 ߦ 0.1"** 133 ߦ 14"** 8 D572N 9.3 + 0.02*: 6 106 ߦ 7*: 7 -+0.5*: 37 -+3*** 69 ߦ 5+* 4 0.9 ߦ 0.2*** 245 ߦ 32*: 3 K1250R 0.17 ߦ 0.07*: 5 239 ߦ 33*** 46 -+ 6"+* 231 ߦ 32*: 8 ߦ 1": 10 10.4 ߦ 0.8"~ 100 ߦ 7** 6 K1250Q 0.12 ߦ 0.04*** 5 150 ߦ 18''` 29 ߦ 4* 146 -+ 18" 4 + 0.4"I 5 22.3 ߦ 2.4*: 30 ߦ 5": 5 K1250A 0.07 + 0.02*: 10 218 ߦ 18" 43 ߦ 4*'` 215 ߦ 18": 3 -+0.3*~* 5 15.6 -+ 1.0"** 43 -+5** 5 D1370N 0.16 + 0.04*'` 7 449 - 79*: 87 ߦ 15: 435 + 76** 14 - 2*: 5 16.3 -4-1.2"" 69 -+ 6** 5 The symbols (*) and ('`) indicate significant differences from wild-type CFTR and the analogous mutant, respectively (P < 0.05). Login to comment
373 After washout of 10 tzM forskolin, there was no transient increase in gc~, but the rate of decline was Nfourfold slower for the hypersensitive K1250A mutant, which is consistent with the results seen with 5 mM IBMX. Login to comment
386 However, the open probability of K1250A was decreased by more than twofold, largely because of a 30-50-fold increase in the interburst interval, an effect that is not predicted by the present results. Login to comment

PMID: 7543023 [PubMed] Gunderson KL et al: "Conformational states of CFTR associated with channel gating: the role ATP binding and hydrolysis."

No. Sentence Comment

57 These NBF1 and NBF2 mutants, harboring the individual mutations K464A and K1250A, K1250G, K1250M, or K1250T, respectively, were expressed in HEK cells and reconstituted into planar lipid bilayers from which single-channel currents were recorded (Figures 3A and 3B). Login to comment
69 We propose that A -PPi +PPi • - 0[ •; K1250A KI250A . Login to comment
76 (B)Single-channelrecordsof K1250A,K1250G, K1250M, and K1250T filtered at 50 Hz under standard cis bath conditions. Login to comment
79 Mean conductance values are 9.0 _+ 0.19 pS (n = 4) for the O1state; 10.3 _+0.20 pS (n = 4) for the 02 state; and 8.9 _+ 0.13 pS (n = 4) for the single conductance state of the K1250A mutant. Login to comment
81 (D) Single-channel recording of K1250A mutant at different holding potentials used in generating the I-V curve shown above. Login to comment
121 The simplest interpretation of these data is that ATP binding ConformationalStatesof CFTR 09 08 07 06 Oo 05 040.3 * 32 wildtype K464A K1250A G1247D/ D1370N 01249E 6~se' B 2500 20O0 5 1500 1OO0 500 o~ 0 w[Id{ype K464A K1250A C1247D/ Ol 370N G1249E Figure5. Login to comment
214 Polymerase Chain Reaction Megaprimer Mutagenesis The following site-directed mutants were constructed by using the megaprimer polymerase chain reaction (PCR)-based mutagenesis protocol (Landt et al., 1990; Sarkar and Sommer, 1990): K464A, K1250A, K1250G, K1250T, and GG1247, 1249DE. Login to comment
122 The simplest interpretation of these data is that ATP binding ConformationalStatesof CFTR 09 08 07 06 Oo 05 040.3 * 32 wildtype K464A K1250A G1247D/ D1370N 01249E 6~se' B 2500 20O0 5 1500 1OO0 500 o ~ 0 w[Id{ype K464A K1250A C1247D/ Ol 370N G1249E Figure5. Login to comment
215 Polymerase Chain Reaction Megaprimer Mutagenesis The following site-directed mutants were constructed by using the megaprimer polymerase chain reaction (PCR)-based mutagenesis protocol (Landt et al., 1990; Sarkar and Sommer, 1990): K464A, K1250A, K1250G, K1250T, and GG1247, 1249DE. Login to comment

PMID: 7694298 [PubMed] Smit LS et al: "Functional roles of the nucleotide-binding folds in the activation of the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

89 Alanine and arginine substitutions at lysine-464 and -1250 were associated with sensitivities similar to those observed with the glutamine substitutions (K464A or K464R, Kil2 = 0.8 mM; K1250A or K1250R, K,12 < 0.02 mM). Login to comment

PMID: 14697202 [PubMed] Randak C et al: "An intrinsic adenylate kinase activity regulates gating of the ABC transporter CFTR."

No. Sentence Comment

228 In addition, we Walker A and B motif mutations (K1250A and D1370N) abolished both ATPase and adenylate kinase activities studied a relatively common CF-associated mutation, N1303K (Osborne et al., 1992); interestingly, two other (Figures 7A and 7B). Login to comment
263 The Walker A mutations (K464A in NBD1 and K1250A in stimulation (Berger et al., 2002). Login to comment
280 NBD2 was wild-type or contained K1250A, D1370N, or N1303K mutations. Login to comment
288 Data are from 5 (wild-type, K464A, D572N), 9 (K1250A), 10 (D1370N), and 3 (N1303K) membrane patches. Asterisks indicate p b0d; 0.05 compared to wild-type by ANOVA followed by Dunnett`s multiple comparison test. Login to comment

PMID: 20628841 [PubMed] Shimizu H et al: "A stable ATP binding to the nucleotide binding domain is important for reliable gating cycle in an ABC transporter CFTR."

No. Sentence Comment

16 Contrary to WT-CFTR, CFTR mutants whose ATP hydrolysis at NBD2 is abolished (i.e., E1371S, K1250A), can remain open for minutes [9, 12, 17-20]. Login to comment
106 Since the life time of these long-lasting openings (in tens of seconds) is very similar to that of hydrolysis-deficient CFTR mutants such as K1250A and E1371S [9, 12, 17-20], it seems difficult to explain these events with the conventional theory that ATP hydrolysis closes the channel. Login to comment
118 On the other hand, CFTR channels can open for hundreds of seconds when ATP hydrolysis is abolished by mutations such as E1371S or K1250A [9, 12, 17-20]. Login to comment

PMID: 23223629 [PubMed] Jih KY et al: "Nonequilibrium gating of CFTR on an equilibrium theme."

No. Sentence Comment

87 Nonetheless, for hydrolysis-deficient mutants such as E1371S- and K1250A-CFTR, ATP is still capable of activating these channels and the open probability (Po) of these hydrolysis-deficient mutants is even higher than that of WT-CFTR, suggesting that, under an equilibrium condition when ATP hydrolysis is absent, CFTR can still function fairly well. Login to comment

PMID: 23752332 [PubMed] Csanady L et al: "Conformational changes in the catalytically inactive nucleotide-binding site of CFTR."

No. Sentence Comment

19 Here, we found that P-ATP prolongs wild-type (WT) CFTR burst durations by selectively slowing (>2&#d7;) transition O1࢐O2 and decreases the nonhydrolytic closing rate (transition O1࢐C) of CFTR mutants K1250A (&#e07a;4&#d7;) and E1371S (&#e07a;3&#d7;). Login to comment
20 Mutation H1348A also slowed (&#e07a;3&#d7;) the O1࢐O2 transition in the WT background and decreased the nonhydrolytic closing rate of both K1250A (&#e07a;3&#d7;) and E1371S (&#e07a;3&#d7;) background mutants. Login to comment
35 M A T E R I A L S A N D M E T H O D S Molecular biology Human WT CFTR and CFTR segment 433-1480 in the pGEMHE plasmid (Chan et al., 2000) served as templates for mutants H1348A, K1250A, E1371S, K1250A/H1348A, E1371S/H1348A, E1371S/K464A, and 433-1480(K1250A), which were created using the QuikChange kit (Agilent Technologies). Login to comment
57 For the nonhydrolytic mutants (K1250A, E1371S, and double mutants), the decay time courses after nucleotide removal often required a double-exponential function-of the form I(t) = I0(A1exp(&#e032;t/&#e074;1) + (1 &#e032; A1)exp(&#e032;t/&#e074;2))-with two slow time constants for a satisfactory fit (e.g., Fig. 3, B and E), suggesting the presence of two populations of open-channel bursts. Login to comment
72 MgATP (Sigma-Aldrich) was added from a 400-mM aqueous stock solution (pH 7.1 with NMDG) to achieve a final concentration of 2 mM (or 10 mM for channels bearing the K1250A mutation). Login to comment
73 A 10-mM aqueous stock solution of P-ATP Na+ salt (BIOLOG Life Science Institute) was stored at &#e032;80&#b0;C and diluted into the bath solution immediately before recording to achieve a final concentration of 10 &#b5;M (or 50 &#b5;M for K1250A mutants). Login to comment
107 Thus, the nonhydrolytic closing rate (Fig. 3, C and F, bars; calculated from the fitted relaxation time constants as described in Materials and methods) was similarly affected by both site-1 perturbations, and this was true regardless of whether the K1250A (Fig. 3 C) or the E1371S (Fig. 3 F) mutant was chosen as the nonhydrolytic model; i.e., both site-1 perturbations decreased this rate by two- to threefold. Login to comment
115 We therefore compared the effects of our site-1 perturbations on the closing rates of two nonhydrolytic mutants, NBD2 Walker A mutant K1250A (Fig. 3, A-C) and NBD2 Walker B mutant E1371S (Fig. 3, D-F). Login to comment
117 (A and D) Macroscopic currents of prephosphorylated K1250A (A) and E1371S (D) CFTR channels elicited by exposure (bars) to either 10 mM ATP alternating with 50 &#b5;M P-ATP (A) or 2 mM ATP alternating with 10 &#b5;M P-ATP (D); the fivefold higher nucleotide concentrations for the K1250A constructs were used to compensate for the large decrease in apparent ATP affinity caused by this mutation (Vergani et al., 2003). Login to comment
119 (B and E) Macroscopic currents of prephosphorylated K1250A/ H1348A (B) and E1371S/ H1348A (E) CFTR channels elicited by transient exposure (bars) to either 10 mM (B) or 2 mM (E) ATP. Login to comment
122 (C and F) Nonhydrolytic closing rates of channels opened by ATP (blue bars) or P-ATP (red bars), or of channels bearing the H1348A mutation opened by ATP (green bars), measured in the K1250A (C) or E1371S (F) background. Login to comment
145 Thus, whereas P-ATP slowed nonhydrolytic closure by approximately fourfold for K1250A channels with an intact site 1 (Fig. 3 C; compare red with blue bar; replotted in Fig. 5, B and E), this effect increased to greater than sixfold and to approximately ninefold, respectively, in the presence of the site-1 perturbations H1348A and &#e044;RI (Fig. 5, B and E; compare brown with green bars), again suggesting nonadditivity. Login to comment
149 Nonadditive effects of P-ATP and site-1 mutations on nonhydrolytic closure support the slowing of this gating step by P-ATP bound in site 1 Additivity of effects on nonhydrolytic closure of the same site-1 perturbations with those of P-ATP was tested in the K1250A nonhydrolytic background (Fig. 5) by measuring the macroscopic closing rate of K1250A/H1348A channels (Fig. 5 A), and of channels obtained by co-expression of segments 1-414 and 433-1480(K1250A) (K1250A/&#e044;RI; Fig. 5 D) upon nucleotide removal. Login to comment
151 (A and D) Macroscopic currents from K1250A/H1348A (A) and K1250A/&#e044;RI (D) CFTR channels elicited by exposures to 10 mM ATP or 50 &#b5;M P-ATP (bars). Login to comment
153 (B and E) Nonhydrolytic closing rates for K1250A/ H1348A (B) and K1250A/&#e044;RI (E) CFTR channels, obtained as the inverses of the relaxation time constants upon removal of ATP (green bars) or P-ATP (brown bars); closing rates of K1250A CFTR upon removal of ATP (blue bars) and P-ATP (red bars) were replotted from Fig. 3 C. Login to comment
219 Interestingly, the K464A mutation, which perturbs site 1 by removing the conserved Walker A lysine, was also shown to affect the energetics of both of the C1࢒O1 and O1࢐O2 gating steps (Csan&#e1;dy et al., 2010), although in a different way: in this mutant, rate k1 decreased approximately fourfold, whereas the rate of nonhydrolytic closure, in a K1250A mutant background, increased by &#e07a;10-fold (this is also replicated in the E1371S background; Fig. S2). Login to comment

PMID: 23921386 [PubMed] Randak CO et al: "ATP and AMP mutually influence their interaction with the ATP-binding cassette (ABC) adenylate kinase cystic fibrosis transmembrane conductance regulator (CFTR) at separate binding sites."

No. Sentence Comment

245 Our results are consistent with the previous observations that mutations of conserved residues in the Walker A and B motifs of ATP-binding site 2, K1250A and FIGURE 8. Login to comment
302 (b) Patch clamp studies showed that CFTR mutations K1250A and D1370N, located within the conserved Walker A and B motifs of ATP-binding site 2, abolished the effects of Ap5A and AMP on CFTR current. Login to comment

PMID: 24420771 [PubMed] Csanady L et al: "Catalyst-like modulation of transition states for CFTR channel opening and closing: new stimulation strategy exploits nonequilibrium gating."

No. Sentence Comment

30 Recordings were done in the presence of saturating (2 mM) MgATP; for the K1250A mutant 10 mM MgATP was used to compensate for its greatly impaired apparent ATP affinity (Vergani et al., 2003). Login to comment
117 To test this, we studied the closing rate of K1250A CFTR channels, in which mutation of the NBD2 Walker A lysine abrogates ATP hydrolysis at site 2 (Ramjeesingh et al., 1999) and reduces gating to reversible caused simple monophasic current relaxations (Fig. 3 E), both the addition and removal of NPPB elicited biphasic responses (Fig. 3 D), attesting to the dual effects of this compound. Login to comment
123 (A) Macroscopic K1250A CFTR current at &#e032;120 mV elicited by exposures to 10 mM ATP in the absence or presence of blockers. Login to comment
126 The K1250A mutation (B and E, cartoons, red stars) disrupts ATP hydrolysis in site 2 (red cross). Login to comment
127 (C) Macroscopic K1250A CFTR current elicited by 10 mM ATP at &#e032;40 mV, prolonged exposure to 210 &#b5;M NPPB of channels gating at steady state, and brief exposure to NPPB of surviving locked-open channels after ATP removal (10-s yellow box, expanded in inset). Login to comment
129 (D) Fractional K1250A CFTR currents at &#e032;40 mV in 210 &#b5;M NPPB applied during steady-state gating (red bar) or in the locked-open state (yellow bar). Login to comment
131 Fractional effect on Po for K1250A CFTR (blue bar) was calculated as in Fig. 2 E. rate of K1250A upon removal of bath ATP (Fig. 4 A) was &#e07a;100 times slower than for WT channels (Fig. 4, A, red fit line, and B, red bar; compare to Fig. 3, A and C). Login to comment
134 Consistent with its effect on K1250A closing rate (Fig. 4, A and B), 210 &#b5;M NPPB also accelerated the unlocking rate of pyrophosphate-locked WT CFTR channels by two- to threefold (Fig. S2). Login to comment
135 Because NPPB accelerated both forward (Fig. 3 F) and backward (Fig. 4 B) transitions of the C1࢒O1 step, we examined whether it affects the equilibrium constant between those two states (Fig. 4 E, cartoon, purple double arrow; Keq), i.e., Po for K1250A channels. Login to comment
136 Even prolonged exposure to 210 &#b5;M NPPB of K1250A channels gating at steady state in 10 mM ATP (Fig. 4 C; note Vm = &#e032;40 mV) failed to elicit biphasic responses like those seen for WT channels (see Fig. 3 D). Login to comment
141 Given the observed increase in nonhydrolytic closing rate (Fig. 4, A and B), this result indicates that NPPB must also speed the opening rate of K1250A CFTR, just as it does for WT (Fig. 3 F). Login to comment
160 (E; left) Macroscopic K1250A CFTR current at +60 mV elicited by exposures to 10 mM ATP in the absence or presence of 210 &#b5;M NPPB; colored lines, single-exponential fits (&#e074;, time constants). Login to comment
161 (Right) Macroscopic K1250A closing rates (bars, 1/&#e074;) in the absence (red) and presence (blue) of NPPB. Login to comment
176 Finally, at +60 mV, 210 &#b5;M NPPB increased the nonhydrolytic closing rate of K1250A CFTR by approximately threefold (Fig. 6 E), just as it did at &#e032;120 mV cyan bar). Login to comment
222 In fact, because of its dual action on both i and Po, fractional reduction of macroscopic current by NPPB is not a good measure of pore block, unless observed on "locked-open" channels, which are not gating (Po of &#e07a;1), such as surviving E1371S (Fig. 1, E and I) or K1250A (Fig. 4 D, inset) channels after the removal of ATP. Login to comment
255 Accordingly, although the apparent KI of NPPB for pore block was &#e07a;20 &#b5;M at &#e032;120 mV (Fig. 1 J; replotted in Fig. 10, open diamonds), the apparent K1/2 for slowing hydrolytic closure of WT CFTR (Fig. 10, closed circles) was at least four times higher (&#e07a;90 &#b5;M), and a tentative fit to the dose-response curve for acceleration of nonhydrolytic closure (measured for the K1250A mutant; Fig. 10, closed squares) suggested a similar K1/2 of &#e07a;100 &#b5;M (although reliability of the latter fit is limited by the uncertainty of its asymptotic value). Login to comment
259 Macroscopic closing rates of WT (closed circles) and K1250A (closed squares) CFTR in the presence of various cytosolic [NPPB], measured at &#e032;120 mV using the protocols shown in Figs. 3 A and 4 A, respectively; leftmost data points represent control values in the absence of NPPB. Login to comment
260 The 50- and 100-&#b5;M data points for K1250A were measured at &#e032;40 mV. Login to comment
261 Solid lines are fits to the equation rOC([NPPB]) = r0 + (r&#e060; &#e032; r0)([NPPB]/([NPPB] + K1/2)), with r&#e060; fixed to zero for WT but left free for K1250A; K1/2 values are plotted. Login to comment
280 Accordingly, for the nonhydrolytic K1250A mutant, which gates at equilibrium, NPPB speeds gating transitions but does not alter Po (Fig. 4 E). Login to comment
297 Third, the presence of NPPB does not slow closure of the nonhydrolytic mutant K1250A (Fig. 4, A and B), confirming that the gate can close with NPPB bound in the pore, just as it can close in the presence of bound MOPS&#e032; , as the latter does not affect the closing rate of either WT (Fig. 3, B and C) or K1250A CFTR (Fig. 4, A and B). Login to comment
316 Gating effects of the K1250A mutation were modeled by setting rate O1࢐O2 to zero while increasing the Kd for ATP to 5 mM (Vergani et al., 2003), those of the &#e044;F508 mutation were modeled by decreasing rate C1࢐O1 30-fold while increasing rate O1࢐C1 threefold (Miki et al., 2010; Jih et al., 2011). Login to comment
320 ߒ (Fig. 12 A, cube) reduces to the four-state model to its right (blue): apparent rate c6; c6; C O 1 1 ࢐ reflects the observed opening rate in 210 &#b5;M NPPB (Figs. 3 F and 6, B and F), rate c6; c6; O O 1 2 ࢐ is the rate-limiting step for closure and reflects closing rate in 210 &#b5;M NPPB (Figs. 3 C and 6, C and F), c6; c6; O C 2 2 ࢐ seemed unaffected by NPPB (see fits to the distributions of open burst durations in 20 &#b5;M NPPB; Fig. 5 D), whereas rate c6; c6; O C 1 1 ࢐ reflects K1250A closing rate in 210 &#b5;M NPPB (Fig. 4 B). Login to comment
327 Indeed, the model faithfully reproduced (a) robust stimulation of WT Po as reflected by a discrepancy between fractional effects on steady-state macroscopic and unitary currents (Fig. 12, B and C; compare to Figs. 2, A, B, and E, and 6, A and B) and current over- shoots upon rapid removal of NPPB (Fig. 12 E; compare to Figs. 3 D and 6 D); (b) slowing of WT (hydrolytic) macroscopic closing rate (Fig. 12 D; compare to Figs. 3, A and C, and 6 C); (c) acceleration of WT macroscopic opening rate (Fig. 12 E; compare to Figs. 3 F and 6 D); (d) shortening and prolongation, respectively, of steady-state single-channel mean closed (interburst) and open (burst) durations (Fig. 12, F and H; compare to Figs. 5 B and 6 F), the latter being caused by a slowed rate c6; c6; O O 1 2 ࢐ (Fig. 12 G; compare to Fig. 5, C and D); (e) accelerated closing rate of the nonhydrolytic K1250A mutant (Fig. 12 I; compare to Figs. 4, A and B, and 6 E), but (f) lack of effect on the Po of this channel (Fig. 12 J; compare to Fig. 4, C and D), (g) observed apparent affinities of the NPPB gating effects (Fig. 12 K; compare to Fig. 10), as well as (h) extremely efficient stimulation of low Po mutants such as &#e044;F508 (Fig. 12 L; compare to Fig. 7; also compare to Fig. 8). Login to comment
335 Finally, rate O1࢐C1 represents the slow rate of nonhydrolytic closure, modeled by the closing rates of nonhydrolytic mutants K1250A (Fig. 4 A) or E1371S (Fig. 1 K), or of WT channels that have been locked open by ATP plus pyrophosphate (Fig. S2); the time constant of this slow process is &#e07a;30 s. Login to comment

PMID: 25267914 [PubMed] Csanady L et al: "Structure-activity analysis of a CFTR channel potentiator: Distinct molecular parts underlie dual gating effects."

No. Sentence Comment

32 Second, it increased by approximately threefold both the rate of opening of WT channels (step C1࢐O1) and the slow rate of nonhydrolytic closure (step O1࢐C1) of catalytically inactive mutants, such as K1250A CFTR in which lack of the conserved NBD2 Walker A lysine side chain abrogates ATP hydrolysis at site 2 (Ramjeesingh et al., 1999). Login to comment
49 pore-block measurements on E1371S (see Fig. 2 A) or K1250A CFTR (see Figs. 3 and 4), surviving currents of channels opened in resting oocytes as the result of endogenous phosphorylation were also used (Csan&#e1;dy and T&#f6;r&#f6;csik, 2014). Login to comment
70 M A T E R I A L S A N D M E T H O D S Molecular biology WT and K1250A CFTR cDNA subcloned into the pGEMHE plasmid (Vergani et al., 2003) was linearized using NheI and transcribed in vitro using T7 polymerase (mMESSAGE kit; Ambion). Login to comment
77 MgATP (Sigma-Aldrich) was made up at 400 mM (adjusted to pH 7.1 with NMDG) and diluted into the bath solution at 2 and 10 mM final concentrations, respectively, for recordings on WT and K1250A CFTR (the higher [ATP] for K1250A was used to compensate for its reduced ATP-binding affinity [Vergani et al., 2003]). Login to comment
83 A convenient macroscopic assay for measuring fractional effects on average ion flux rates through bursting channels is provided by nonhydrolytic mutant CFTR channels such as E1371S (Vergani et al., 2003) or K1250A. Login to comment
106 We next probed acceleration by NPPB of the slow nonhydrolytic closing rate of K1250A CFTR channels (Fig. 2 F, gray bar) upon removal of ATP (Fig. 2 E, gray fit lines and time constants). Login to comment
117 (E) Macroscopic K1250A CFTR currents at &#e032;40 mV elicited by brief exposures to 10 mM ATP in the absence or presence of blockers. Current relaxations after ATP removal were fitted by single exponentials with time constants indicated. Login to comment
118 (F) Macroscopic K1250A closing rates in the absence of blocker (gray) and in the presence of 100 &#b5;M NPPB (brown), 80 mM MOPS&#e032; (green), or 100 &#b5;M NPPB + 80 mM MOPS&#e032; (striped). Login to comment
121 In the presence of 100 &#b5;M NPPB, K1250A closing rate was accelerated by approximately twofold (Fig. 2, E [top and bottom traces, brown fit line and time constant] and F [brown bar]). Login to comment
122 In contrast, 80 mM MOPS&#e032; neither affected K1250A closing rate (Fig. 2, E [top trace, green fit line and time constant] and F [green bar]), nor prevented the accelerating effect of 100 &#b5;M NPPB (Fig. 2, E [bottom trace, second application of NPPB] and F [striped bar]). Login to comment
125 To dissect potential effects of 3NB (the NPPB head) and 3PP (the NPPB tail) on permeation and gating, we first characterized effects on permeation using locked-open macroscopic K1250A CFTR currents at two different voltages (&#e032;80 and 60 mV). Login to comment
126 As expected, 3NB, which contains the pore-blocking carboxylate, dose-dependently suppressed currents through locked-open K1250A channels, and pore block was more pronounced at negative voltages, attesting to its voltage dependence (Fig. 3, A and B). Login to comment
130 (A, B, F, G, I, and J) Decaying macroscopic currents of locked-open K1250A CFTR channels after removal of ATP, recorded at membrane potentials of &#e032;80 (A, F, and I) or 60 mV (B, G, and J) and responses to brief applications of various concentrations of 3NB (A and B, blue bars), 3PP-sulfate (F and G, red bars), or sulfate (I and J, green bars). Login to comment
135 (D) Responses of decaying macroscopic locked-open K1250A CFTR current to brief applications of 32 mM 3NB (blue bars) at various membrane potentials. Login to comment
142 Thus, using macroscopic locked-open K1250A CFTR currents elicited at either &#e032;80 (Fig. 4, A, C, and E) or 60 mV (Fig. 4, B, D, F), we compared fractional effects of coapplying 32 mM 3NB with 210 &#b5;M NPPB (Fig. 4, A and B, blue and brown bars), 20 mM 3PP with 210 &#b5;M NPPB (Fig. 4, C and D, red and brown bars), or 32 mM 3NB with 20 mM 3PP (Fig. 4, E and F, blue and red bars) with the fractional effects of the same three compounds when applied in isolation at the respective concentrations. Login to comment
151 Indeed, at positive voltages only a small (&#e07a;10%) enhancement (rather than impairment) of the rate of ion flow through locked-open K1250A channels was observed at high 3PP concentrations (Fig. 3 G); a tentative fit to its dose-response curve yielded a K1/2 of &#e07a;10 mM (Fig. 3 H, red-yellow symbols and red fit line). Login to comment
154 Indeed, at &#e032;80 mV, exposure of locked-open K1250A CFTR channels to sulfate caused substantial pore block (Fig. 3 I) with similarly anomalous dose dependence, yielding maximal block at &#e07a;5 mM sulfate (Fig. 3 H, green-cyan symbols and green abscissa). Login to comment
167 (A-F) Responses of decaying macroscopic locked-open K1250A CFTR currents, recorded at membrane potentials of &#e032;80 (A, C, and E) or 60 mV (B, D, and F), to brief exposures to the following drug combinations: (A and B) 32 mM 3NB (blue bars) and/ or 210 &#b5;M NPPB (brown bars), (C and D) 20 mM 3PP (red bars) and/or 210 &#b5;M NPPB (brown bars), and (E and F) 32 mM 3NB (blue bars) and/or 20 mM 3PP (red bars). Login to comment
219 The effects on average unitary conductance of WT CFTR, as observed in heavily (at 50 Hz) filtered current traces (Fig. 7 A), were consistent with the predictions of the macroscopic pore-block assays performed on locked open K1250A channels (Fig. 3, C and H). Login to comment
228 To test this, we compared fractional effects of 3NB on steady-state macroscopic (I/Icontrol) and average unitary (i/icontrol) K1250A currents by applying 32 mM 3NB for extended time periods to channels gating at steady-state (in 10 mM ATP; Fig. 8 D, first and second 3NB applications) or briefly to locked-open channels after ATP removal (Fig. 8 D, third 3NB application, expanded in inset; this maneuver measures i/icontrol; compare with Fig. 3). Login to comment
229 (Note that to increase the success rate of very long recordings, all experiments on K1250A gating shown in Fig. 8 were performed at &#e032;20 mV.) Login to comment
230 Both application and removal of 3NB to K1250A channels, which are gating at steady-state, evoked simple monophasic current responses (Fig. 8 D; in contrast with Fig. 5 A), and the fractional current reduction under such conditions (Fig. 8 F, left gray bar) was well matched by the fractional effect on ATP removal in patches containing K1250A CFTR channels; the K1250A mutation (Fig. 8 C, cartoon, red stars) disrupts ATP hydrolysis (Fig. 8 C, cartoon, red cross; compare with Ramjeesingh et al. [1999]). Login to comment
231 Indeed, the presence of 32 mM 3NB accelerated K1250A closing rate by two- to threefold (Fig. 8, A [blue vs. gray fit lines and time constants] and C [blue vs. gray bar]), to a similar extent as reported for NPPB (Fig. 8 C, brown bar; replotted from Csan&#e1;dy and T&#f6;r&#f6;csik [2014]). Login to comment
232 In contrast, 20 mM 3PP, which did not significantly stimulate WT CFTR opening rate (Fig. 7 E), accelerated K1250A closing rate only slightly, by &#e07a;20% (Fig. 8, B and C [red vs. gray bar]). Login to comment
233 If 3NB indeed acted as a catalyst for the C1࢒O1 step, then the equilibrium between those two states (Fig. 8 G, cartoon, purple double arrow), as reflected by the open probability of the K1250A mutant (Keq = Po/(1 &#e032; Po)), Figure 8.ߓ Effects of 3NB and 3PP on gating rates under nonhydrolytic conditions. Login to comment
234 (A and B) Macroscopic K1250A CFTR currents at &#e032;20 mV, elicited by exposures to 10 mM ATP (gray bars) in the absence of drug or in the presence of either 32 mM 3NB (A, blue bar) or 20 mM 3PP (B, red bar). Login to comment
237 The K1250A mutation (cartoon, red stars) disrupts ATP hydrolysis in site 2 (red cross). Login to comment
238 (D and E) Macroscopic K1250A CFTR currents elicited by 10 mM ATP at &#e032;20 mV and prolonged exposures to 32 mM 3NB (D, blue bars) or 20 mM 3PP (E, red bars) of channels gating at steady-state. Login to comment
241 (F) Fractional K1250A CFTR currents at &#e032;20 mV in 32 mM 3NB (left pair of bars) or 20 mM 3PP (right pair of bars) applied during steady-state gating (gray bars) or in the locked-open state (yellow bars). Login to comment
243 Fractional effects on Po for K1250A CFTR were calculated as in Fig. 5 (D and H). Login to comment
252 Similarly, the small fractional effect of 20 mM 3PP on steady-state K1250A currents (Fig. 8, E and F [right gray bar]) was well explained by a similar small fractional increase in unitary conductance at this voltage (Fig. 8 F, right yellow bar), revealing no change in Po (Fig. 8 G, red bar). Login to comment

PMID: 25825169 [PubMed] Chaves LA et al: "Cysteine accessibility probes timing and extent of NBD separation along the dimer interface in gating CFTR channels."

No. Sentence Comment

181 In CFTR channels mutated at NBD2 Walker A K1250, open burst durations are prolonged by about one (K1250R) or two (K1250A) orders of magnitude, in oocyte patches at room temperature (Vergani et al., 2003, 2005; Csan&#e1;dy et al., 2006). Login to comment