ABCMdb

PMID: 10962022

Csanady L, Chan KW, Seto-Young D, Kopsco DC, Nairn AC, Gadsby DC
Severed channels probe regulation of gating of cystic fibrosis transmembrane conductance regulator by its cytoplasmic domains.
J Gen Physiol. 2000 Sep;116(3):477-500., [PubMed]

Sentences

No. Mutations Sentence Comment

40 ABCC7 p.Lys1250Ala ABCC7 p.Lys1250Ala CFTR-K1250A was a gift from Dr. David Dawson (Oregon Health Sciences University, Portland, OR), and was subcloned into pGEMHE to give pGEMHE-K1250A. Login to comment 41 ABCC7 p.Lys1250Ala ABCC7 p.Lys1250Ala pGEMHE-837-1480(K1250A) was made using pGEMHE-K1250A as template, primers SK837FW (5Ј-TCCCCC- GGGCCGCCATGGAGAGCATACCAGCAGTGACT) and SP6 RV, followed by subcloning. Login to comment 79 ABCC7 p.Lys1250Ala [Typically, tc was 30-80 ms, 400-800 ms for cut-⌬R(K1250A).] Login to comment 252 ABCC7 p.Lys1250Ala Severed Channels with no R Domain, but with NBD2 Walker-A Mutation, Display Prolonged Bursts To probe the role of NBD2 function in cut-⌬R channels, we introduced the Walker-A lysine (Walker et al., 1982) mutation in NBD2, K1250A. Login to comment 253 ABCC7 p.Lys1250Ala In excised patches, cut- ⌬R(K1250A) channels had similar conductance to WT CFTR, required MgATP for activity but (like the other cut channels with no R domain) were active without exposure to PKA, and their activity was dominated by long open bursts, each interrupted by many (six to eight on average) flickery closures (Fig. 10 A; note time scale). Login to comment 256 ABCC7 p.Lys1250Ala Consistent with the interpretation that the prolonged bursts reflect nonhydrolytic binding of ATP at NBD2, these mean burst durations of cut-⌬R(K1250A) were comparable with the time constants of the slow components of current relaxation after exposure of cut-⌬R channels to AMPPNP at the corresponding temperatures (5.8 Ϯ 0.4 s and 13.5 Ϯ 2 s at 25Њ and 20ЊC, respectively; Figs. 6 D and 9; and Table II). Login to comment 257 ABCC7 p.Lys1250Ala To avoid the difficulties of steady state kinetic analysis, we examined the current relaxation after ATP removal in patches containing cut-⌬R(K1250A) channels. Login to comment 261 ABCC7 p.Lys1250Ala Analysis of the Ͻ100 isolated bursts recorded from cut-⌬R(K1250A) channels indicated a double-exponential distribution (Fig. 10 C), suggesting two distinct populations of bursts, although both components Figure 8. Login to comment 284 ABCC7 p.Lys1250Ala ABCC7 p.Lys1250Ala Walker-A mutant cut-⌬R(K1250A) [633ϩ837 (K1250A)] channels show prolonged open bursts. Login to comment 285 ABCC7 p.Lys1250Ala (A) Representative baseline-subtracted record of single cut-⌬R(K1250A) channel in 2 mM MgATP, no PKA, at 25ЊC. Login to comment 286 ABCC7 p.Lys1250Ala (B) Current relaxation of cut- ⌬R(K1250A) channels after removal of 2 mM MgATP (no PKA), constructed by summing synchronized decay currents from nine experiments, at 25ЊC; single-exponential fit (solid line) to quasi-macroscopic current decay gave ␶ ϭ 6.7 s. Login to comment 288 ABCC7 p.Lys1250Ala (C) Survivor function of burst durations, after exclusion of flickery closures, of cut-⌬R(K1250A) channels in 2 mM MgATP, constructed from events isolated from a total of 16 min of recordings suitable for such analysis, including 10 min from a single channel. Login to comment 306 ABCC7 p.Lys1250Ala (Strictly, if ADP leaves (SCHEME I) (SCHEME II) NBD2 during O1 → O2, that step is irreversible in the absence of ADP, and WT channels unlocking from AMPPNP, or K1250A channels closing from long bursts in ATP, must close through a state distinct from O1: the four-state schemes are clearly oversimplified.) Login to comment 332 ABCC7 p.Ser660Ala Based on these findings, and the effect of phosphorylated R-domain peptide on ⌬R(708-835)-S660A channels, the phosphorylated R domain was proposed to stimulate channel activity by enhancing the affinity of CFTR for ATP (Winter and Welsh, 1997). Login to comment 337 ABCC7 p.Asp836* Interestingly, a half-channel truncated at that same cut site (D836X; Sheppard et al., 1994) also showed a low level of constitutive activity, but was strongly activated by PKA, and had a high apparent affinity for ATP, properties reminiscent of those described here for 835ϩ837 channels. Login to comment 357 ABCC7 p.Ser660Ala However, in the absence of the phosphopeptide, the opening rate of ⌬R(708-835)-S660A, with or without PKA, KrCO KPo ( ) was only ‫%03ف‬ that of phosphorylated WT, and increased only to ‫%54ف‬ of the latter, even in the presence of the phosphopeptide (Winter and Welsh, 1997; compare Ma et al., 1997). Login to comment 363 ABCC7 p.Ser660Ala ABCC7 p.Ser660Ala This activation is intriguing, because the effect of PKA on CFTR has generally been attributed to phosphorylation of serine residues within the R domain, based on both biochemical and functional evidence: CNBr cleavage and peptide mapping experiments on CFTR protein prephosphorylated by PKA with ␥-32P ATP found no evidence for phosphorylation outside the R domain (Cheng et al., 1991; Picciotto et al., 1992; Seibert et al., 1995), and PKA no longer stimulated ⌬R(708-835) channels after mutation of serine 660 [⌬R(708-835)-S660A, Rich et al., 1993; compare Ma et al., 1997]. Login to comment 365 ABCC7 p.Ser660Ala Also, lack of response of ⌬R(708-835)-S660A channels to PKA could reflect steric constraints introduced by linking residue 707 to 836. Login to comment 372 ABCC7 p.Ser660Ala Interestingly, a likely ␣-helical section of CFTR`s NH2 terminus (within residues 46-60) was recently reported to bind to the R domain, and enhance channel activity (Naren et al., 1999): point mutations in that stretch of amino acids impaired the gating of WT (an effect apparently on channel closing rate), but not of ⌬R(708-835)-S660A, channels. Login to comment 401 ABCC7 p.Lys1250Ala ATP Binding to NBD2 of Severed Channels Lacking an R Domain Is Supported by Prolonged Bursts of Cut-⌬R(K1250A) Mutation of K1250 practically abolishes ATP hydrolysis in CFTR (Ramjeesingh et al., 1999), as does mutation of Walker-A lysines in other ABC transporters (e.g., Loo and Clarke, 1994; Müller et al., 1996). Login to comment 402 ABCC7 p.Lys1250Ala In intact CFTR, the K1250A mutation results in extremely long open bursts, comparable with those seen with AMPPNP, interpreted as nonhydrolytic tight binding of ATP to NBD2 (Carson et al., 1995; Gunderson and Kopito, 1995). Login to comment 403 ABCC7 p.Lys1250Ala If ATP can occupy NBD2 in severed CFTR channels with no R domain, then cut-⌬R(K1250A) channels ought to show prolonged bursts (like those induced by AMPPNP in cut-⌬R channels) whenever NBD2 binds ATP, since k3 ϭ 0. Login to comment 405 ABCC7 p.Lys1250Ala The large fraction of prolonged openings in cut-⌬R(K1250A) channels seems paradoxical, because only a small fraction of the bursts of cut-⌬R channels belonged to the slow component of the distribution (Fig. 8), implying that few bursts involved binding of ATP to the stabilizing site. Login to comment 406 ABCC7 p.Lys1250Ala Intriguingly, the same paradox seems to apply to intact K1250A CFTR channels, which also showed predominantly long openings under conditions where WT channels were only inefficiently locked by AMPPNP (see Carson and Welsh, 1993; Carson et al., 1995). Login to comment 407 ABCC7 p.Lys1250Ala Despite technical difficulties, such as excessive numbers of flickery closures coupled with the small overall number of bursts recorded, the distribution of cut- ⌬R(K1250A) burst durations indicated a mixture of two populations, both with lifetimes longer than the corresponding populations for cut-⌬R channels (Fig. 10 C). Login to comment 408 ABCC7 p.Lys1250Ala According to Scheme I, the slower components of those distributions reflect k3 for cut-⌬R channels, but k-2 for cut-⌬R(K1250A) channels. Login to comment 409 ABCC7 p.Lys1250Ala But the observation that the faster component was approximately fivefold prolonged for cut-⌬R(K1250A) channels, if correct, suggests that rate k-1 is also slowed in these channels, which would provide, during each burst, a longer time window for ATP to bind to NBD2. Login to comment 411 ABCC7 p.Lys1250Ala ABCC7 p.Lys1250Ala However, intact K1250A CFTR channels showed brief (‫-002ف‬ms) bursts at 10 ␮M ATP comparable with WT (Zeltwanger et al., 1999), and we occasionally saw comparably brief reopenings of cut- ⌬R(K1250A) channels in macropatches during ATP washout, when [ATP] was extremely low. Login to comment 412 ABCC7 p.Lys1250Ala ABCC7 p.Lys1250Ala In any event, an influence of the Walker-A mutation on more than one rate constant is not unexpected, since cut- ⌬R(K1250A) channels were also ‫-01ف‬fold slower in opening (␶ib ϭ 25 Ϯ 12 s in the absence of PKA, n ϭ 4) than cut-⌬R channels (␶ib ϭ 3.1 Ϯ 0.7 s in the absence of PKA, n ϭ 18; Table I), just like full-length K1250A CFTR channels, which reportedly open far more slowly than WT (Carson et al., 1995). Login to comment 465 ABCC7 p.Lys1250Ala For cut-⌬R(K1250A) channels, all parameters were measured in the absence of PKA. Login to comment 477 ABCC7 p.Lys1250Ala ABCC7 p.Lys1250Ala Parameters ash, al, ␶sh, and ␶l are fractional amplitudes and time constants of exponential components describing the distributions (Fig. 8) of burst durations (note al ϭ 1 - ash is not a free parameter); ␶b is mean burst duration, measured in the presence of PKA for WT and 633ϩ634, or pooled from all experiments for 835ϩ837, cut-⌬R (633ϩ837), and Flag-cut-⌬R (F633ϩ837); ␶AMPPNP and alocked are the time constant and fractional amplitude of the slowly relaxing macroscopic current component after removal of AMPPNP and ATP (see Table II); ␶relax and arelax, analogous, after just ATP, for cut-⌬R(K1250A) [633ϩ837(K1250A); Fig. 10 B]. Login to comment 480 ABCC7 p.Lys1250Ala The value of k1 KPo was obtained as the reciprocal of ␶ib in the presence of 2 mM MgATP and PKA (except for cut-⌬R(K1250A) channels, for which all data were obtained in the absence of PKA; apparent affinity was not measured for this construct). Login to comment 484 ABCC7 p.Lys1250Ala ***Rate k3, representing a compound step including ATP hydrolysis at NBD2, was set to zero for cut-⌬R(K1250A). Login to comment 486 ABCC7 p.Lys1250Ala Comparing cut-⌬R(K1250A) with cut-⌬R, the fit for the Walker-A mutant predicted nucleotide on and off rates at NBD2 (k2 and k-2) similar to those of cut-⌬R. However, to account for the observed distribution of bursts of the Walker mutant, k-1 had to be slowed by an order of magnitude compared with cut-⌬R channels, which, together with a similar decrease in opening rate (compare k1 with basal opening rate of cut-⌬R), calls into question either the assumed local nature of the effect on channel structure of the Walker-A point mutation, or all gating models in which the influence of ATP hydrolysis at NBD2 is limited to channel closure. Login to comment 496 ABCC7 p.Lys1250Ala Cut-⌬R channels seem capable of binding ATP at NBD2, evident from the locking effect of AMPPNP [and from the prolonged openings of cut- ⌬R(K1250A) channels], but the affinity of this binding site for nucleotide seems considerably lower than in phosphorylated WT channels (Figs. 6-8, and 10). Login to comment 500 ABCC7 p.Lys1250Ala We thank Dr. David Dawson for the CFTR K1250A clone, Atsuko Horiuchi and Peter Hoff for technical assistance, and Kate Hall for help with the preparation of the manuscript. Login to comment