ABCMdb

ABCG8 p.Thr400Lys

None has been submitted yet.

Publications

PMID: 11668628 [PubMed] Hubacek JA et al: "Mutations in ATP-cassette binding proteins G5 (ABCG5) and G8 (ABCG8) causing sitosterolemia."

No. Sentence Comment

6 Nine nonsynonymous polymorphisms are also reported: I523V, C600Y, Q604E, and M622V in ABCG5; and D19H, Y54C, T400K, A632V, and Y641F in ABCG8. Login to comment
36 Gene Exon NT change AA change Allele frequency RE ABCG5 ABCG8 ex. 11 ex. 13 ex. 13 ex. 13 ex. 1 ex. 2 ex. 8 ex. 13 ex. 13 c.1567 A>G c.1799 G>A c.1810 C>G c.1864 A>G c.52 G>C c.161 A>G c.1199 C>A c.1895 C>T c.1922 A>T I523V C600Y Q604E M622V D19H Y54C T400K A632V Y641F <1% <1% C=0.80/G=0.20 <1% G=0.94/C=0.06 A=0.61/G=0.39 C=0.80/A=0.20 C=0.83/T=0.17 A=0.99/T=0.01 XmnI TsrpI SexAI MseI NcoI MboII *The polymorphisms were found either in sitosterolemic probands or in genomic DNA from 24 individuals with high plasma cholesterol concentrations. Allele frequencies of the nonsynonymous sequence variants identified were determined in 50 unrelated Caucasians. Login to comment

PMID: 11893785 [PubMed] Berge KE et al: "Heritability of plasma noncholesterol sterols and relationship to DNA sequence polymorphism in ABCG5 and ABCG8."

No. Sentence Comment

125 Linkage disequilibrium between polymorphisms in ABCG5 and ABCG8 Locus 1 Locus 2 DЈ P ABCG5 Q604E ABCG8 D19H 0.47 0.001 ABCG8 Y54C 0.29 0.095 ABCG8 T400K 0.31 0.299 ABCG8 A632V 0.06 0.451 ABCG8 D19H ABCG8 Y54C 0.62 0.122 ABCG8 T400K 0.63 0.408 ABCG8 A632V 0.04 0.979 ABCG8 Y54C ABCG8 T400K 0.85 0 ABCG8 A632V 0.04 0.959 ABCG8 T400K ABCG8 A632V 0.69 0.016 Haplotypes were determined in 74 nuclear families. Login to comment
5 Two common sequence variations (D19H and T400K) in ABCG8, an ABC half-transporter defective in sitosterolemia, were associated with lower concentrations of plant sterols in parents, and in their offspring. Login to comment
109 The D19H polymorphism in exon 1 of ABCG8 was associated with the plasma cholestanol-cholesterol and campesterol-cholesterol ratios, and the T400K polymorphism in ABCG8 was associated with the plasma sitosterol-cholesterol ratio. Login to comment
166 A common nonconservative substitution (T400K) was associated with the plasma concentrations of sitosterol, although the association of this polymorphism with plasma campesterol concentration was marginal. Login to comment
173 Effect of ABCG8 polymorphisms on plasma sterol-cholesterol ratios in siblings Cholesterol Cholestanol Desmosterol Lathosterol Sitosterol Campesterol ABCG8 D19H 0.097 0.08 0.005 0.001 0.13 0.045 ABCG8 T400K 0.29 0.02 0.34 0.24 0.05 0.03 ABCG8 A632V 0.018 0.29 0.18 0.39 0.26 0.22 The relationships between ABCG8 polymorphisms and plasma sterol-cholesterol ratios were assessed by comparing the plasma sterol levels of siblings with different genotypes. Login to comment
110 The D19H polymorphism in exon 1 of ABCG8 was associated with the plasma cholestanol-cholesterol and campesterol-cholesterol ratios, and the T400K polymorphism in ABCG8 was associated with the plasma sitosterol-cholesterol ratio. Login to comment
126 Linkage disequilibrium between polymorphisms in ABCG5 and ABCG8 Locus 1 Locus 2 D9 P ABCG5 Q604E ABCG8 D19H 0.47 0.001 ABCG8 Y54C 0.29 0.095 ABCG8 T400K 0.31 0.299 ABCG8 A632V 0.06 0.451 ABCG8 D19H ABCG8 Y54C 0.62 0.122 ABCG8 T400K 0.63 0.408 ABCG8 A632V 0.04 0.979 ABCG8 Y54C ABCG8 T400K 0.85 0 ABCG8 A632V 0.04 0.959 ABCG8 T400K ABCG8 A632V 0.69 0.016 Haplotypes were determined in 74 nuclear families. Login to comment
128 Mean plasma sterol concentrations and sterol-cholesterol ratios in unrelated men and women with different ABCG5 and ABCG8 genotypes ABCG8 D19H ABCG8 Y54C ABCG8 T400K ABCG8 A632V ABCG5 Q604E DD n 5 128 DH/HH n 5 14 YY n 5 54 YC/CC n 5 85 TT n 5 95 TK/KK n 5 48 AA n 5 94 VA/VV n 5 49 QQ n 5 91 QE/EE n 5 51 Plasma sterol concentrations Cholesterol 202 6 41 194 6 33 199 6 39 203 6 40 197 6 38 207 6 42 195 6 38 b 213 6 40 198 6 40 204 6 40 Cholestanol 420 6 110 b 340 6 72 400 6 104 419 6 114 410 6 115 418 6 103 400 6 97 437 6 131 411 6 114 416 6 105 Desmosterol 200 6 70 196 6 79 195 6 66 202 6 74 1916 67 221 6 79 197 6 75 210 6 68 197 6 74 208 6 70 Lathosterol 308 6 135 365 6 252 308 6 120 320 6 168 296 6 136 354 6 171 309 6 165 329 6 116 314 6 154 322 6 145 Sitosterol 257 6 105 b 177 6 53 231 6 93 261 6 109 256 6 114 238 6 83 239 6 87 274 6 130 250 6 107 250 6 104 Campesterol 338 6 147 b 233 6 72 310 6 133 339 6 152 332 6 149 324 6 144 308 6 124 a 375 6 177 328 6 154 332 6 136 Plasma sterol-cholesterol ratios (mg/mg) Cholestanol 2.09 6 0.40 c 1.76 6 0.31 2.02 6 0.37 2.07 6 0.39 2.09 6 0.44 2.01 6 0.31 2.06 6 0.41 2.05 6 0.39 2.08 6 0.40 2.04 6 0.42 Desmosterol 0.99 6 0.26 1.00 6 0.32 0.97 6 0.25 0.99 6 0.28 0.96 6 0.25 a 1.06 6 0.30 1.00 6 0.29 0.98 6 0.23 0.98 6 0.27 1.02 6 0.27 Lathosterol 1.53 6 0.60 1.84 6 1.06 1.57 6 0.60 1.57 6 0.70 1.48 6 0.57 a 1.73 6 0.78 1.57 6 0.70 1.56 6 0.57 1.57 6 0.67 1.58 6 0.63 Sitosterol 1.28 6 0.45 c 0.94 6 0.32 1.18 6 0.45 1.29 6 0.45 1.30 6 0.48 a 1.15 6 0.35 1.24 6 0.42 1.29 6 0.51 1.27 6 0.44 1.23 6 0.48 Campesterol 1.67 6 0.62 c 1.21 6 0.36 1.56 6 0.59 1.66 6 0.63 1.68 6 0.62 1.54 6 0.60 1.58 6 0.59 1.74 6 0.65 1.64 6 0.63 1.61 6 0.59 Values are means 6 SD. Plasma cholesterol concentrations are in mg/dl. Login to comment
171 A common nonconservative substitution (T400K) was associated with the plasma concentrations of sitosterol, although the association of this polymorphism with plasma campesterol concentration was marginal. Login to comment
178 Effect of ABCG8 polymorphisms on plasma sterol-cholesterol ratios in siblings Cholesterol Cholestanol Desmosterol Lathosterol Sitosterol Campesterol ABCG8 D19H 0.097 0.08 0.005 0.001 0.13 0.045 ABCG8 T400K 0.29 0.02 0.34 0.24 0.05 0.03 ABCG8 A632V 0.018 0.29 0.18 0.39 0.26 0.22 The relationships between ABCG8 polymorphisms and plasma sterol-cholesterol ratios were assessed by comparing the plasma sterol levels of siblings with different genotypes. Login to comment

PMID: 14703505 [PubMed] Kajinami K et al: "ATP binding cassette transporter G5 and G8 genotypes and plasma lipoprotein levels before and after treatment with atorvastatin."

No. Sentence Comment

37 In the present study, five prevalent DNA polymorphisms, one in ABCG5 (Q604E) and four in ABCG8 (D19H, Y54C, T400K, and A632V), were studied using a PCR-restriction length polymorphism method. Login to comment
58 RESULTS Genotype, allele, haplotype frequencies, linkage disequilibrium Genotype distributions (wild-type allele homozygote, variant heterozygote, variant homozygote) in each polymorphism were as follows; Q604E (212, 112, 14), D19H (294, 43, 1), Y54C (138, 146, 54), T400K (196, 130, 12), and A632V (225, 96, 17). Login to comment
60 Allele frequencies (wild-type, variant) were Q604E (0.79, 0.21), D19H (0.93, 0.07), Y54C (0.62, 0.38), T400K (0.77, 0.23), and A632V (0.81, 0.19). Login to comment
63 Significant linkage disequilibrium was found in 5 out of 10 pairs of five polymorphisms: Q604E/D19H (D` ϭ 0.6503, P Ͻ 0.0001), Q604E/Y54C (-0.3461, 0.0244), D19H/Y54C (-0.9986, 0.0003), Y54C/T400K (-0.4957, 0.0003), and T400K/A632V (-0.5484, 0.0456). Login to comment
38 For the D19H polymorphism, a 131 bp fragment, including a G to C substitution site at codon 19 of the ABCG8 gene, was amplified using an oligonucleotide primer set (5Ј-GCTGGGTCTAAGAGAGCTGC-3Ј and 5Ј-CTTCCCATTGCT- CACTCACC-3Ј) with 35 cycles of amplification (95ЊC for 30 s, 60ЊC for 30 s, and 72ЊC for 30 s). Login to comment

PMID: 15175352 [PubMed] Gylling H et al: "Polymorphisms in the ABCG5 and ABCG8 genes associate with cholesterol absorption and insulin sensitivity."

No. Sentence Comment

18 Two sequence variations (D19H and T400K) in the G8 gene were shown to be associated with lower serum plant sterol levels in a normolipidemic family study (5). Login to comment
112 In a family study of a normal population by Berge et al. (5), the D19H substitution of the G8 gene resulted in a completely different situation: low serum cholestanol, sitosterol, and campesterol levels, suggesting limited sterol absorption. Login to comment
114 The authors also described the following two associations: the T400K polymorphism of the G8 gene was associated with high serum desmosterol and lathosterol ratios to cholesterol and low sitosterol ratios, and the A632V polymorphism of the G8 gene was associated with high serum total cholesterol value (5), none of which could be observed in the present study. Login to comment
17 Two sequence variations (D19H and T400K) in the G8 gene were shown to be associated with lower serum plant sterol levels in a normolipidemic family study (5). Login to comment
113 Concerning the D19H polymorphism of the G8 gene, the present results confirmed the findings by Berge et al. (5) that serum absorption marker sterols were lower in subjects with this polymorphism. Login to comment

PMID: 15209530 [PubMed] Stefkova J et al: "ATP-binding cassette (ABC) transporters in human metabolism and diseases."

No. Sentence Comment

105 A common nonconservative substitution (T400K) was associated with the plasma concentrations of sitosterol, although the association of this polymorphism with plasma campesterol concentration was marginal (Berge et al. 2002). Login to comment

PMID: 15311998 [PubMed] Hubacek JA et al: "Polymorphisms in ABCG5 and ABCG8 transporters and plasma cholesterol levels."

No. Sentence Comment

5 Missence polymorphisms (Gln604Glu in the ABCG5 and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) in these genes have been described. Login to comment
23 To evaluate the role of the ABCG5 and ABCG8 variants in the genetic determination of plasma lipids, we analyzed non-synonymous polymorphisms in the ABCG5 (C1810G = Gln604Glu) and ABCG8 (G55C = Asp19His, A161G = Tyr54Cys, C1199A = Thr400Lys and C1895T = Ala632Val) genes, and searched for associations between the polymorphisms and plasma lipid levels, and between the polymorphisms and plasma lipid changes over a 8 years´ follow-up. Login to comment
33 Polymorphism Primer sequence PCR product Enzyme Size Allele ABCG8 5`atggccgggaaggcggcagaggagag 83 bp BamH I 83 C (His) Asp19His 5`acttcccattgctcactcaccgagggat 56 + 27 G (Asp) ABCG8 5`agggcctccaggatagattgttctcctc 128 bp Bgl I 128 A (Tyr) Tyr54Cys 5`ccttgaacccaggcgtgcgcctacctg 102 + 26 G (Cys) ABCG8 5`agatgcctggggcggtgcagcagctt 108 bp Afl II 108 C (Thr) Thr400Lys 5`ggcttaatgtgatatacaaagacttggg 81 + 27 A (Lys) ABCG8 5`atgtctgtgtctccagatcctcaggg 105 bp Hae III 105 T (Val) Ala632Val 5`tacaggaccatgaagccaccgctgacgcc 79 + 26 C (Ala) ABCG5 5`aaccacacctgacactgtcaatcttttcct 117 bp Xho I 117 G (Glu) Gln604Glu 5`gggcaggttttctcaatgaattgaattcctc 86 + 31 C (Gln) DNA analysis Three ml of blood collected into EDTA tubes for DNA isolation were diluted with sterile water at a 1:1 ratio and stored at -20 °C. DNA was isolated by a standard method (Miller et al. 1988). Login to comment
58 Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment
11 We conclude that Tyr54Cys and Thr400Lys variations in the ABCG8 gene may play a role in the genetic determination of plasma cholesterol levels and could possibly influence the gender-specific response of plasma cholesterol levels after dietary changes. Login to comment
21 Recently, associations between the Asp19His and Thr400Lys polymorphisms and concentrations of plasma plant sterols (sitosterol and campesterol) have been described (Berge et al. 2002). Login to comment
39 In 13 individuals, the Thr400Lys polymorphism at the ABCG8 locus was unsuccessfully genotyped even when repeated 3 times. Login to comment
66 However, the Thr400Lys polymorphism in ABCG8 was associated with lipid level changes in males only. Login to comment
71 Thr400Lys polymorphism in ABCG8 and plasma levels of total cholesterol (T-C) and LDL-cholesterol (LDL-C) in 1988 and 1996 in males changes of T-C between 1988 and 1996. Login to comment
97 In males, a similar pattern was observed for the Thr400Lys polymorphism at the ABCG8 locus. Login to comment
103 In this sample, variations in the ABCG8 gene loci (Tyr54Cys and Thr400Lys polymorphisms) were found to play a role in gender-specific reduction in plasma lipid levels as a response to reduced dietary animal fat and cholesterol intake. Login to comment
104 Our results suggest that the Tyr54Cys and Thr400Lys polymorphisms in ABCG8 might play a role in the genetic determination of plasma lipids in a gender-specific gene-nutrition manner. Login to comment
57 Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment
65 However, the Thr400Lys polymorphism in ABCG8 was associated with lipid level changes in males only. Login to comment
70 Thr400Lys polymorphism in ABCG8 and plasma levels of total cholesterol (T-C) and LDL-cholesterol (LDL-C) in 1988 and 1996 in males changes of T-C between 1988 and 1996. Login to comment
96 In males, a similar pattern was observed for the Thr400Lys polymorphism at the ABCG8 locus. Login to comment
102 In this sample, variations in the ABCG8 gene loci (Tyr54Cys and Thr400Lys polymorphisms) were found to play a role in gender-specific reduction in plasma lipid levels as a response to reduced dietary animal fat and cholesterol intake. Login to comment

PMID: 15520451 [PubMed] Plat J et al: "Common sequence variations in ABCG8 are related to plant sterol metabolism in healthy volunteers."

No. Sentence Comment

44 These criteria resulted in the selection of three SNPs: ABCG8 T400K, ABCG8 A632V, and ABCG5 Q604E. Login to comment
54 Statistics Because of the limited number of subjects, and because plant sterol concentrations were not significantly different, heterozygous and homozygous carriers of the genetic variants [ABCG8 T400K (TKϩKK), ABCG8 A632V (VVϩVA), and ABCG5 Q604E (QEϩEE)] were combined before data analysis. Login to comment
61 Frequency distribution of the different genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 Subjects All Control Group Experimental Group All 112 42 70 ABCG8 T400K TT 77 (68.7) 30 (71.4) 47 (67.1) TK 31 (27.7) 11 (26.2) 20 (28.6) KK 4 (3.6) 1 (2.4) 3 (4.3) ABCG8 A632V AA 70 (62.5) 23 (54.8) 47 (67.1) VA 37 (33.0) 17 (40.5) 20 (28.6) VV 5 (4.5) 2 (4.8) 3 (4.3) ABCG5 Q604E QQ 81 (72.3) 33 (78.6) 48 (68.6) QE 29 (25.9) 9 (21.4) 20 (28.6) EE 2 (1.8) 0 (0) 2 (2.9) Values shown are absolute frequencies (with relative frequencies in parentheses). Login to comment
72 RESULTS Frequency distributions for the genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 are shown in Table 2. Login to comment
80 Linkage disequilibrium between genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 Locus 1 Locus 2 DЈ 95% Confidence Interval ABCG8 T400K ABCG8 A632V 0.29 0.03-0.76 ABCG5 Q604E 0.81 0.06-0.97 ABCG8 A632V ABCG5 Q604E 0.0 -0.01-0.22 DЈ and the corresponding 95% confidence intervals were calculated by using all 112 subjects included in the study. Login to comment
81 TABLE 4. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with absolute and cholesterol-standardized serum noncholesterol sterol concentrations Subjects Campesterol Sitosterol Lathosterol Campestanol Sitostanol Absolute concentrations (␮mol/l) All 15.8 Ϯ 5.3 6.0 Ϯ 2.4 5.2 Ϯ 2.1 0.5 Ϯ 0.3 0.4 Ϯ 0.2 ABCG8 T400K TT 16.9 Ϯ 5.5 6.6 Ϯ 2.6 5.0 Ϯ 2.1 0.5 Ϯ 0.4 0.4 Ϯ 0.2 TK/KK 13.5 Ϯ 3.8 4.8 Ϯ 1.4 5.7 Ϯ 2.1 0.5 Ϯ 0.3 0.4 Ϯ 0.2 P value Ͻ0.001 Ͻ0.001 0.070 0.887 0.675 ABCG8 A632V AA 16.3 Ϯ 5.6 6.2 Ϯ 2.6 5.1 Ϯ 2.0 0.5 Ϯ 0.3 0.4 Ϯ 0.2 VV/VA 15.1 Ϯ 4.8 5.7 Ϯ 2.1 5.4 Ϯ 2.4 0.6 Ϯ 0.4 0.4 Ϯ 0.2 P value 0.280 0.266 0.516 0.349 0.759 ABCG5 Q604E QQ 16.3 Ϯ 5.4 6.3 Ϯ 2.5 5.1 Ϯ 2.1 0.5 Ϯ 0.3 0.4 Ϯ 0.2 QE/EE 14.6 Ϯ 5.0 5.4 Ϯ 2.2 5.4 Ϯ 2.3 0.6 Ϯ 0.4 0.4 Ϯ 0.2 P value 0.125 0.093 0.517 0.043 0.768 Cholesterol-standardized concentrations (102 ϫ ␮mol/mmol cholesterol) All 303.4 Ϯ 98.0 115.0 Ϯ 44.5 97.3 Ϯ 33.5 9.8 Ϯ 6.6 7.6 Ϯ 4.3 ABCG8 T400K TT 324.2 Ϯ 98.5 125.2 Ϯ 45.8 93.2 Ϯ 35.0 9.6 Ϯ 6.8 7.5 Ϯ 4.4 TK/KK 257.7 Ϯ 80.8 92.4 Ϯ 31.9 106.4 Ϯ 28.4 10.2 Ϯ 6.1 7.7 Ϯ 3.9 P value Ͻ0.001 Ͻ0.001 0.053 0.636 0.862 ABCG8 A632V AA 305.8 Ϯ 95.3 117.3 Ϯ 47.3 95.2 Ϯ 32.2 9.3 Ϯ 6.1 7.6 Ϯ 4.2 VV/VA 299.3 Ϯ 103.3 111.0 Ϯ 39.8 101.0 Ϯ 35.8 10.6 Ϯ 7.2 7.6 Ϯ 4.4 P value 0.736 0.467 0.377 0.332 0.938 ABCG5 Q604E QQ 310.5 Ϯ 98.8 118.3 Ϯ 43.7 95.3 Ϯ 34.8 8.9 Ϯ 5.7 7.6 Ϯ 4.3 QE/EE 284.8 Ϯ 94.9 106.2 Ϯ 46.2 102.7 Ϯ 29.9 11.9 Ϯ 8.1 7.6 Ϯ 4.2 P value 0.216 0.198 0.298 0.029 0.987 Values shown are means Ϯ SD and were analyzed after a 4-week period of consumption of rapeseed oil-based margarine and shortening. Login to comment
101 TABLE 5. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with serum lipid and lipoprotein concentrations Subjects LDL Cholesterol HDL Cholesterol Triacylglycerol mmol/l All 2.95 Ϯ 0.78 1.59 Ϯ 0.38 0.92 Ϯ 0.52 ABCG8 T400K TT 2.97 Ϯ 0.74 1.59 Ϯ 0.37 0.85 Ϯ 0.47 TK/KK 2.89 Ϯ 0.86 1.60 Ϯ 0.40 1.08 Ϯ 0.58 P value 0.622 0.976 0.025 ABCG8 A632V AA 3.03 Ϯ 0.78 1.58 Ϯ 0.39 0.91 Ϯ 0.48 VV/VA 2.81 Ϯ 0.77 1.61 Ϯ 0.36 0.93 Ϯ 0.58 P value 0.137 0.666 0.883 ABCG5 Q604E QQ 3.04 Ϯ 0.75 1.56 Ϯ 0.35 0.89 Ϯ 0.45 QE/EE 2.70 Ϯ 0.81 1.68 Ϯ 0.43 0.99 Ϯ 0.65 P value 0.039 0.145 0.342 Values shown are means Ϯ SD and were analyzed after a 4-week period of consumption of rapeseed oil-based margarine and shortening. Login to comment
114 However, if ABCG8 transports the same proportion of plant sterols out of the enterocytes and hepatocytes into the lumen and bile, respectively, as before plant stanol ester TABLE 6. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with changes in absolute and cholesterol-standardized serum noncholesterol sterol concentrations after consumption of plant stanol esters Subjects Campesterol Sitosterol Lathosterol Campestanol Sitostanol Absolute concentrations (␮mol/l) Experimental group Control -0.5 Ϯ 2.2 -0.5 Ϯ 1.2 0.0 Ϯ 1.1 -0.0 Ϯ 0.4 0.0 Ϯ 0.2 Stanol -6.3 Ϯ 3.9 -3.0 Ϯ 2.1 0.2 Ϯ 1.4 0.3 Ϯ 0.4 0.3 Ϯ 0.2 P value Ͻ0.001 Ͻ0.001 Ͻ0.001 Ͻ0.001 Ͻ0.001 Genotype group ABCG8 T400K TT -7.0 Ϯ 4.4 -3.4 Ϯ 2.3 0.2 Ϯ 1.2 0.2 Ϯ 0.4 0.3 Ϯ 0.2 TK/KK -4.9 Ϯ 2.4 -2.1 Ϯ 0.9 0.2 Ϯ 1.7 0.3 Ϯ 0.4 0.3 Ϯ 0.2 P value 0.042 0.017 0.989 0.526 0.967 ABCG8 A632V AA -6.5 Ϯ 4.5 -2.9 Ϯ 2.3 0.3 Ϯ 1.1 0.3 Ϯ 0.4 0.3 Ϯ 0.2 VV/VA -6.0 Ϯ 2.7 -3.0 Ϯ 1.6 0.2 Ϯ 1.3 0.2 Ϯ 0.4 0.3 Ϯ 0.2 P value 0.598 0.831 0.836 0.832 0.395 ABCG5 Q604E QQ -6.6 Ϯ 4.3 -3.1 Ϯ 2.3 0.1 Ϯ 1.5 0.2 Ϯ 0.4 0.3 Ϯ 0.2 QE/EE -5.8 Ϯ 3.1 -2.7 Ϯ 1.6 0.6 Ϯ 1.2 0.2 Ϯ 0.4 0.4 Ϯ 0.2 P value 0.448 0.413 0.185 0.956 0.097 Cholesterol-standardized concentrations (102 ϫ ␮mol/mmol cholesterol) Experimental group Control -5.9 Ϯ 39.2 -7.8 Ϯ 22.4 0.5 Ϯ 19.5 -0.6 Ϯ 7.2 0.4 Ϯ 4.0 Stanol -103.1 Ϯ 70.6 -49.3 Ϯ 34.9 17.4 Ϯ 22.2 6.3 Ϯ 8.1 8.2 Ϯ 4.5 P value Ͻ0.001 Ͻ0.001 Ͻ0.001 Ͻ0.001 Ͻ0.001 Genotype group ABCG8 T400K TT -116.7 Ϯ 76.5 -57.1 Ϯ 38.3 16.5 Ϯ 19.8 6.1 Ϯ 8.3 8.4 Ϯ 4.5 TK/KK -75.4 Ϯ 46.9 -33.5 Ϯ 19.0 19.2 Ϯ 26.7 6.8 Ϯ 7.6 7.7 Ϯ 4.6 P value 0.020 0.007 0.624 0.737 0.541 ABCG8 A632V AA -107.3 Ϯ 75.4 -49.3 Ϯ 38.8 16.0 Ϯ 23.9 6.1 Ϯ 8.3 8.3 Ϯ 4.4 VV/VA -94.6 Ϯ 60.3 -49.4 Ϯ 25.9 20.2 Ϯ 18.3 6.7 Ϯ 7.8 8.0 Ϯ 4.9 P value 0.483 0.998 0.465 0.756 0.780 ABCG5 Q604E QQ -106.3 Ϯ 75.6 -50.9 Ϯ 36.9 14.7 Ϯ 21.3 6.3 Ϯ 8.2 7.6 Ϯ 4.2 QE/EE -96.1 Ϯ 59.2 -46.0 Ϯ 30.6 23.2 Ϯ 23.5 6.3 Ϯ 7.9 9.5 Ϯ 4.9 P value 0.579 0.596 0.140 0.997 0.087 Values shown are means Ϯ SD. Changes in all parameters were calculated as the difference between values at the end of the run-in period (weeks 3 and 4) and the experimental period (weeks 11 and 12). Login to comment
142 TABLE 7. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with changes in lipid and lipoprotein concentrations after consumption of plant stanol esters Subjects LDL Cholesterol HDL Cholesterol Triacylglycerol Control -0.06 Ϯ 0.36 0.01 Ϯ 0.16 0.02 Ϯ 0.23 Stanols -0.42 Ϯ 0.31 0.01 Ϯ 0.12 -0.04 Ϯ 0.30 P value Ͻ0.001 0.903 0.272 ABCG8 T400K TT -0.43 Ϯ 0.32 0.02 Ϯ 0.11 -0.01 Ϯ 0.22 TK/KK -0.38 Ϯ 0.30 -0.01 Ϯ 0.13 -0.09 Ϯ 0.42 P value 0.531 0.345 0.304 ABCG8 A632V AA -0.42 Ϯ 0.32 0.01 Ϯ 0.12 -0.00 Ϯ 0.25 VV/VA -0.41 Ϯ 0.29 -0.00 Ϯ 0.13 -0.10 Ϯ 0.38 P value 0.935 0.588 0.199 ABCG5 Q604E QQ -0.44 Ϯ 0.30 0.01 Ϯ 0.10 -0.01 Ϯ 0.34 QE/EE -0.36 Ϯ 0.34 -0.01 Ϯ 0.16 -0.09 Ϯ 0.18 P value 0.297 0.368 0.357 Values shown are means Ϯ SD. Changes in all parameters were calculated as the difference between values at the end of the run-in period (weeks 3 and 4) and the experimental period (weeks 11 and 12). Login to comment
3 Cholesterol-standardized serum campesterol and sitosterol concentrations were significantly associated with the ABCG8 T400K genotype, as were changes in serum plant sterol concentrations after consumption of plant stanols. Login to comment
82 T400K genotype (Table 4). Login to comment
92 Changes in cholesterol-standardized serum campesterol and sitosterol concentrations were significantly associated with the ABCG8 T400K polymorphism (Table 6, Fig. 1). Login to comment
95 Additional analysis to evaluate the association between the three different genotype groups of the ABCG8 T400K polymorphism (TT, TK, and KK) with changes in serum plant sterol and lipoprotein concentrations suggested an allele-dependent relation for both cholesterol-standardized serum campesterol and sitosterol concentrations (Fig. 1). Login to comment
97 Cholesterol-standardized campesterol (A), sitosterol (B), and LDL cholesterol (C) concentrations at the end of the run-in period (upper panels) and the change during the stanol ester feeding period (lower panels) in the different genotypes of the ABCG8 T400K polymorphism. Login to comment
103 Changes in serum campesterol concentrations showed a comparable association pattern with the ABCG8 T400K genotype. Login to comment
116 More detailed studies on the effects of the functional consequences of the T400K polymorphism on plant sterol metabolism are needed, which can be obtained through the development of specifically designed cell or transgenic animal models carrying this genetic variation. Login to comment
117 Concerning the potential functionality of the different genotypes, it should be remarked that the polymorphic site of the ABCG8 T400K polymorphisms is located in a coding region but is predicted not to contain a transmembrane domain, a signature, or a Walker motif (15). Login to comment
139 Furthermore, the observation that the T400K polymorphism in ABCG8 is associated with changes in plant sterol levels with stanol ester treatment, but not with changes in the cholesterol levels, suggests that individual variation in the cholesterol-lowering efficacy of plant stanols is not strongly determined by the magnitude of the reduction in intestinal cholesterol absorption achieved. Login to comment
43 These criteria resulted in the selection of three SNPs: ABCG8 T400K, ABCG8 A632V, and ABCG5 Q604E. Login to comment
53 Statistics Because of the limited number of subjects, and because plant sterol concentrations were not significantly different, heterozygous and homozygous carriers of the genetic variants [ABCG8 T400K (TKKK), ABCG8 A632V (VVVA), and ABCG5 Q604E (QEEE)] were combined before data analysis. Login to comment
60 Frequency distribution of the different genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 Subjects All Control Group Experimental Group All 112 42 70 ABCG8 T400K TT 77 (68.7) 30 (71.4) 47 (67.1) TK 31 (27.7) 11 (26.2) 20 (28.6) KK 4 (3.6) 1 (2.4) 3 (4.3) ABCG8 A632V AA 70 (62.5) 23 (54.8) 47 (67.1) VA 37 (33.0) 17 (40.5) 20 (28.6) VV 5 (4.5) 2 (4.8) 3 (4.3) ABCG5 Q604E QQ 81 (72.3) 33 (78.6) 48 (68.6) QE 29 (25.9) 9 (21.4) 20 (28.6) EE 2 (1.8) 0 (0) 2 (2.9) Values shown are absolute frequencies (with relative frequencies in parentheses). Login to comment
71 RESULTS Frequency distributions for the genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 are shown in Table 2. Login to comment
79 Linkage disequilibrium between genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 Locus 1 Locus 2 D 95% Confidence Interval ABCG8 T400K ABCG8 A632V 0.29 0.03-0.76 ABCG5 Q604E 0.81 0.06-0.97 ABCG8 A632V ABCG5 Q604E 0.0 0.01-0.22 D and the corresponding 95% confidence intervals were calculated by using all 112 subjects included in the study. Login to comment
91 Changes in cholesterol-standardized serum campesterol and sitosterol concentrations were significantly associated with the ABCG8 T400K polymorphism (Table 6, Fig. 1). Login to comment
94 Additional analysis to evaluate the association between the three different genotype groups of the ABCG8 T400K polymorphism (TT, TK, and KK) with changes in serum plant sterol and lipoprotein concentrations suggested an allele-dependent relation for both cholesterol-standardized serum campesterol and sitosterol concentrations (Fig. 1). Login to comment
96 Cholesterol-standardized campesterol (A), sitosterol (B), and LDL cholesterol (C) concentrations at the end of the run-in period (upper panels) and the change during the stanol ester feeding period (lower panels) in the different genotypes of the ABCG8 T400K polymorphism. Login to comment
100 TABLE 5. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with serum lipid and lipoprotein concentrations Subjects LDL Cholesterol HDL Cholesterol Triacylglycerol mmol/l All 2.95 0.78 1.59 0.38 0.92 0.52 ABCG8 T400K TT 2.97 0.74 1.59 0.37 0.85 0.47 TK/KK 2.89 0.86 1.60 0.40 1.08 0.58 P value 0.622 0.976 0.025 ABCG8 A632V AA 3.03 0.78 1.58 0.39 0.91 0.48 VV/VA 2.81 0.77 1.61 0.36 0.93 0.58 P value 0.137 0.666 0.883 ABCG5 Q604E QQ 3.04 0.75 1.56 0.35 0.89 0.45 QE/EE 2.70 0.81 1.68 0.43 0.99 0.65 P value 0.039 0.145 0.342 Values shown are means SD and were analyzed after a 4-week period of consumption of rapeseed oil-based margarine and shortening. Login to comment
102 Changes in serum campesterol concentrations showed a comparable association pattern with the ABCG8 T400K genotype. Login to comment
113 However, if ABCG8 transports the same proportion of plant sterols out of the enterocytes and hepatocytes into the lumen and bile, respectively, as before plant stanol ester TABLE 6. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with changes in absolute and cholesterol-standardized serum noncholesterol sterol concentrations after consumption of plant stanol esters Subjects Campesterol Sitosterol Lathosterol Campestanol Sitostanol Absolute concentrations (mol/l) Experimental group Control 0.5 2.2 0.5 1.2 0.0 1.1 0.0 0.4 0.0 0.2 Stanol 6.3 3.9 3.0 2.1 0.2 1.4 0.3 0.4 0.3 0.2 P value 0.001 0.001 0.001 0.001 0.001 Genotype group ABCG8 T400K TT 7.0 4.4 3.4 2.3 0.2 1.2 0.2 0.4 0.3 0.2 TK/KK 4.9 2.4 2.1 0.9 0.2 1.7 0.3 0.4 0.3 0.2 P value 0.042 0.017 0.989 0.526 0.967 ABCG8 A632V AA 6.5 4.5 2.9 2.3 0.3 1.1 0.3 0.4 0.3 0.2 VV/VA 6.0 2.7 3.0 1.6 0.2 1.3 0.2 0.4 0.3 0.2 P value 0.598 0.831 0.836 0.832 0.395 ABCG5 Q604E QQ 6.6 4.3 3.1 2.3 0.1 1.5 0.2 0.4 0.3 0.2 QE/EE 5.8 3.1 2.7 1.6 0.6 1.2 0.2 0.4 0.4 0.2 P value 0.448 0.413 0.185 0.956 0.097 Cholesterol-standardized concentrations (102 mol/mmol cholesterol) Experimental group Control 5.9 39.2 7.8 22.4 0.5 19.5 0.6 7.2 0.4 4.0 Stanol 103.1 70.6 49.3 34.9 17.4 22.2 6.3 8.1 8.2 4.5 P value 0.001 0.001 0.001 0.001 0.001 Genotype group ABCG8 T400K TT 116.7 76.5 57.1 38.3 16.5 19.8 6.1 8.3 8.4 4.5 TK/KK 75.4 46.9 33.5 19.0 19.2 26.7 6.8 7.6 7.7 4.6 P value 0.020 0.007 0.624 0.737 0.541 ABCG8 A632V AA 107.3 75.4 49.3 38.8 16.0 23.9 6.1 8.3 8.3 4.4 VV/VA 94.6 60.3 49.4 25.9 20.2 18.3 6.7 7.8 8.0 4.9 P value 0.483 0.998 0.465 0.756 0.780 ABCG5 Q604E QQ 106.3 75.6 50.9 36.9 14.7 21.3 6.3 8.2 7.6 4.2 QE/EE 96.1 59.2 46.0 30.6 23.2 23.5 6.3 7.9 9.5 4.9 P value 0.579 0.596 0.140 0.997 0.087 Values shown are means SD. Changes in all parameters were calculated as the difference between values at the end of the run-in period (weeks 3 and 4) and the experimental period (weeks 11 and 12). Login to comment
115 More detailed studies on the effects of the functional consequences of the T400K polymorphism on plant sterol metabolism are needed, which can be obtained through the development of specifically designed cell or transgenic animal models carrying this genetic variation. Login to comment
138 Furthermore, the observation that the T400K polymorphism in ABCG8 is associated with changes in plant sterol levels with stanol ester treatment, but not with changes in the cholesterol levels, suggests that individual variation in the cholesterol-lowering efficacy of plant stanols is not strongly determined by the magnitude of the reduction in intestinal cholesterol absorption achieved. Login to comment
141 TABLE 7. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with changes in lipid and lipoprotein concentrations after consumption of plant stanol esters Subjects LDL Cholesterol HDL Cholesterol Triacylglycerol Control 0.06 0.36 0.01 0.16 0.02 0.23 Stanols 0.42 0.31 0.01 0.12 0.04 0.30 P value 0.001 0.903 0.272 ABCG8 T400K TT 0.43 0.32 0.02 0.11 0.01 0.22 TK/KK 0.38 0.30 0.01 0.13 0.09 0.42 P value 0.531 0.345 0.304 ABCG8 A632V AA 0.42 0.32 0.01 0.12 0.00 0.25 VV/VA 0.41 0.29 0.00 0.13 0.10 0.38 P value 0.935 0.588 0.199 ABCG5 Q604E QQ 0.44 0.30 0.01 0.10 0.01 0.34 QE/EE 0.36 0.34 0.01 0.16 0.09 0.18 P value 0.297 0.368 0.357 Values shown are means SD. Changes in all parameters were calculated as the difference between values at the end of the run-in period (weeks 3 and 4) and the experimental period (weeks 11 and 12). Login to comment

PMID: 15816807 [PubMed] Miwa K et al: "ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects."

No. Sentence Comment

3 We identified a novel mutation [859T/C (C287R)] and a novel polymorphism [1285A/G (M429V)] at the ABCG5/ABCG8 loci, as well as four polymorphisms reported previously [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1895C/T (A632V)]. Login to comment
14 Nucleotide Annealing Position Mutation change* Forward primer (5 → 3 ) Reverse primer (5 → 3 ) temperature (◦ C) Enzyme Size (bp) ABCG5 Exon 7 C287R 859T → C TCACACACTAACTACCTTCTGTTGTC ATGATGGGGAATGTGAAAGAAA 54 BstUI 191 Exon 13 Q604E 1810C → G ATCTAGATTCACAATGAACTTTCTA GTCCCTGCAAGTTGTAAGAG 53 XhoI 193 ABCG8 Exon 2 C54Y 161G → A GGAGGTCAGAGACCTCAAgT GCCCACCCTTTTATTTCCAC 56 RsaI 107 Exon 8 T400K 1199C → A ACACCTGTGTGGAAAGGTAAGGT GCGGGTTCAGTAATAAAATGACAG 57 MseI 216 Exon 9 M429V 1285A → G ATGCTGTTGCCTCAGCATCT AAGCTGTGTTCCTCTGAGCT 56 Tsp45I 306 Exon 13 A632V 1895C → T ATGTCTGTGTCTCCAGATCCTCAGgG TACAGGACCATGAAGCCACCGCTGAcGCC 63 HaeIII 105 sterols to cholesterol are known to be positively related to cholesterol absorption and negatively to cholesterol synthesis [1-4]. Login to comment
21 Indeed, it was previously proposed that common sequence variants in ABCG5 (Q604E) and ABCG8 (D19H and T400K) are associated with plasma plant sterol and lipid levels in normocholesterolaemic or mildly hypercholesterolaemic European-American populations [10-12]. Login to comment
48 Frequency distributions for the genotypes in exon 7 (C287R) and exon 13 (Q604E) of ABCG5, and in exon 2 (C54Y), exon 8 (T400K), exon 9 (M429V) and exon 13 (A632V) of ABCG8 are shown in Table 3. Login to comment
51 Parameters Value Age (years) 62.4 +- 12.1 Gender (men/women) 48/52 BMI (kg/m2 ) 23.0 +- 3.5 Total cholesterol (mg/dl) 261 +- 48 Triacylglycerol (mg/dl) 135 +- 69 HDL-C (mg/dl) 56 +- 16 LDL-C (mg/dl) 179 +- 48 Sitosterol (µg/ml) 2.63 +- 1.0 Lathosterol (µg/ml) 3.00 +- 1.3 Table 3 Genotype distribution and allele frequencies of the polymorphisms in the ABCG5/ABCG8 gene Gene Mutation Nucleotide change Polymorphism Allele frequency ABCG5 Exon 7 C287R 859T → C T 0.99 C 0.01 Exon 13 Q604E 1810C → G C 0.89 G 0.11 ABCG8 Exon 2 C54Y 161G → A G 0.82 A 0.18 Exon 8 T400K 1199C → A C 0.88 A 0.12 Exon 9 M429V 1285A → G A 0.96 G 0.04 Exon 13 A632V 1895C → T C 0.995 T 0.005 found and the A632V variant was rare in our Japanese subjects. Login to comment
57 Sitosterol Lathosterol Sitosterol/chol Polymorphism Genotype n (µg/ml) P value (µg/ml) P value (µg/mg) P value Lathosterol/chol (µg/mg) P value ABCG5 Exon 13 Q604E (1810C → G) QQ 78 2.63 +- 1.06 0.81 2.97 +- 1.36 0.73 1.03 +- 0.3 0.97 1.19 +- 0.55 0.84 QE 21 2.69 +- 0.72 3.09 +- 1.12 1.03 +- 0.40 1.16 +- 0.38 EE 1 1.2 3.2 0.6 1.57 ABCG8 Exon 2 C54Y (161G → A) CC 67 2.69 +- 0.98 0.19 2.82 +- 1.11 0.06 1.05 +- 0.36 0.06 1.12 +- 0.45 0.2 CY 30 2.57 +- 1.06 3.20 +- 1.33 1.02 +- 0.43 1.27 +- 0.57 YY 3 1.93 +- 0.31 4.23 +- 3.17 0.65 +- 0.12 1.38 +- 0.98 ABCG8 Exon 8 T400K (1199C → A) TT 76 2.64 +- 0.98 0.85 2.87 +- 1.10 0.14 1.03 +- 0.37 0.96 1.14 +- 0.45 0.17 TK 24 2.60 +- 1.07 3.34 +- 1.70 1.03 +- 0.44 1.31 +- 0.66 KK 0 ABCG8 Exon 9 M429V (1285A → G) MM 92 2.56 +- 0.94 0.003 3.03 +- 1.30 0.08 1.00 +- 0.36 0.002 1.19 +- 0.51 0.16 MV 8 3.64 +- 1.26 1.95 +- 0.53 1.45 +- 0.56 0.84 +- 0.36 VV 0 Table 5 Effect of the four polymorphism haplotypes in the ABCG5/ABCG8 gene on serum non-cholesterol levels Values are means +- S.D. The haplotype effects on serum non-cholesterol levels were assigned in all individuals using PHASE in 94 individuals. Login to comment
67 Of the 16 possible four-polymorphism haplotypes [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1285A/G (M429V)], six haplotypes were estimated to be present. Login to comment
75 This result does not appear to be consistent with previous reports that the sequence variants in ABCG5 (Q604E) and ABCG8 (D19H and T400K) are associated with lower serum plant sterol levels in Western countries [10-12]. Login to comment
76 The results of our present study suggest that the frequencies of D19H and A632V variants of ABCG8 are rarer in Japanese than in European-American populations, and that these Q604E and T400K variants may not be as important in the regulation of non-cholesterol sterol levels in Japanese populations. Login to comment

PMID: 16507104 [PubMed] Pandit B et al: "A detailed Hapmap of the Sitosterolemia locus spanning 69 kb; differences between Caucasians and African-Americans."

No. Sentence Comment

144 A number of studies have been implicated this locus in disease (or physiologi- Table 4: Results of pair-wise LD analyses Population M1 M2 ChiSq Pval ∆2 D' Caucasian INT1-21 INT1-7 20.01 1E-05 0.545 0.866 5'UTR-19 INT1-7 9.61 0.002 0.256 0.594 Q604E INT1-7 7.14 0.008 0.239 0.489 T400K A632V 6.13 0.013 0.125 1.000 5'UTR-19 T400K 5.84 0.016 0.153 1.000 Q604E D19H 5.02 0.025 0.174 1.000 INT1-7 T400K 4.94 0.026 0.111 1.000 R50C D19H 4.79 0.029 0.234 0.484 INT1-21 T400K 4.45 0.035 0.153 1.000 E238L INT10-50 4.42 0.036 0.238 1.000 INT1-7 C54Y 4.41 0.036 0.138 0.739 5'UTR-19 C54Y 4.24 0.040 0.134 0.619 T400K INT10-50 3.92 0.048 0.040 1.000 5'UTR-19 A565A 3.86 0.049 0.127 1.000 Q604E INT1-21 3.66 0.056 0.128 0.420 INT10-50 A632V 3.29 0.070 0.132 0.641 5'UTR-19 INT1-21 2.86 0.091 0.071 0.267 C54Y T400K 2.74 0.098 0.082 0.433 African-American 5'UTR-19 T400K 11.01 9E-04 0.080 1.000 INT1-7 A565A 8.09 0.004 0.085 0.587 R50C D19H 6.96 0.008 0.205 1.000 T400K A565A 6.56 0.010 0.088 0.557 Q604E INT1-21 5.82 0.016 0.119 0.505 5'UTR-19 A565A 5.10 0.024 0.059 0.460 C54Y A565A 3.93 0.047 0.053 0.270 5'UTR-19 C54Y 3.49 0.062 0.047 0.481 R50C INT1-7 3.05 0.081 0.044 1.000 INT1-7 A632V 3.05 0.081 0.044 1.000 Q604E D19H 3.01 0.083 0.038 1.000 M1 = 1st marker in pair of SNPs, M2 = 2nd marker in pair of SNPs, ChiSq = Value of chi-square test of association, Pval = Two-sided P-value corresponding to chi-square value in ChiSq column assuming 1 degree of freedom. Login to comment
177 SNP Allele Number of Disease Chromosomes* Number of Healthy Chromosomes* Frequency (disease chromosome) Frequency (healthy chromosome) Recombination Fraction Age Estimate (generations) R50C C 12 12 1 1 NA Q604E G 2 1 0.167 0.083 0.058833 17.7 5'UTR-19 T 11 10 0.917 0.833 0.033059 9.1 D19H G 12 12 1 1 NA NA INT1-21 C 12 7 1 0.583 0.005 0 INT1-7 C 11 11 0.917 0.917 NA C54Y A 9 5 0.75 0.417 0.02749 8.8 E238L G 12 12 1 1 NA T400K A 10 3 0.833 0.25 0.0002 2387 INT10-50 T 12 12 1 1 NA A565A C 12 12 1 1 NA G575R G 12 12 1 1 NA A632V C 11 10 0.917 0.833 0.005692 52.9 *Out of a total of 12 disease and 12 normal chromosomes, see Methods and ABCG8 are proposed to function as obligate heterodimers [54], and complete mutations in either gene seems to result in an identical phenotype [8], these genetic findings posit an enigma. Login to comment
124 Of the non-synonymous cSNPs, T400K of ABCG8 was found to be oldest polymorphism that arose GOLD plot of pair-wise ∆2 values for SNPs in CEPH and Yoruba Africans genotyped by the HapMap ConsortiumFigure 3 GOLD plot of pair-wise ∆2 values for SNPs in CEPH and Yoruba Africans genotyped by the HapMap Consortium. Login to comment

PMID: 17002235 [PubMed] Chan YM et al: "Plasma concentrations of plant sterols: physiology and relationship with coronary heart disease."

No. Sentence Comment

71 Aside from the rare mutation of a homozygous form resulting in sitosterolemia, several common sequence variations have been described.71 Different studies have shown independently that the cross-sectional plant sterol-to-cholesterol ratio is associated with different ABCG5 and ABCG8 polymorphisms.10,27,72 Out of the five polymorphisms analyzed in relation to concentrations of plant sterols, D19H, Y54C, T400K, A632V, and Q604E, the polymorphisms D19H in exon 1 and T400K in exon 8 of ABCG8 show the most pronounced association. Login to comment
72 Carriers of the H allele of the D19H polymorphism in ABCG8 were found to have a lower plasma campesterol-to-cholesterol ratio10,27 and sitosterol-to-cholesterol ratio,10 suggesting a higher activity of this variant. Login to comment
73 A similar finding was observed for the K allele of the T400K polymorphism in exon 8 of ABCG8.27,72 Interestingly, no consistent cross-sectional associations between plasma cholesterol concentrations and any of these ABCG5 or ABCG8 polymorphisms have been described so far.10,27,72,73 In addition to these cross-sectional associations, genetic variations in these ABC transporters may also predict which subjects are prone to develop elevated plant sterol concentrations. Login to comment
74 In this respect, carriers of the T allele of the T400K polymorphism showed a larger reduction in both the campesterol-to-cholesterol and the sitosterol-to-cholesterol ratios during interventions known to lower plasma plant sterols.72 Although not evaluated, it can be speculated that these subjects would also show larger elevations in circulating plant sterol levels as a result of consuming plant sterol-enriched functional foods18,70 or undergoing treatment with statins74 Table1. Login to comment
75 In this respect, carriers of the T allele of the T400K polymorphism showed a larger reduction in both the campesterol-to-cholesterol and the sitosterol-to-cholesterol ratios during interventions known to lower plasma plant sterols.72 Although not evaluated, it can be speculated that these subjects would also show larger elevations in circulating plant sterol levels as a result of consuming plant sterol-enriched functional foods18,70 or undergoing treatment with statins74 Table 1. Login to comment

PMID: 17827468 [PubMed] Santosa S et al: "Single nucleotide polymorphisms in ABCG5 and ABCG8 are associated with changes in cholesterol metabolism during weight loss."

No. Sentence Comment

32 More specifically, these SNPs include Q604E (RS6720173), I18427 (RS4148189), I7892 (RS4131229), and M216 (RS3806471) in ABCG5 and C54Y (RS4148211), D19H (RS11887534), T400K (RS4148217), and I14222 (RS6709904) in ABCG8 (11, 13, 16, 17). Login to comment
82 SNPs Q604E, I18429, I7892, and M216 in ABCG5 and C54Y, D19H, I14222, and T400K in ABCG8 were determined using PCR-based TaqMan allele discrimination assays (Applied Biosystems, Foster City, CA) (29). Login to comment
132 Individual subject genotypes for each SNP in ABCG5 and ABCG8 ABCG5 ABCG8 Q604E I18429 I7892 M216 C54Y D19H I14222 T400K 11 11 12 12 12 11 11 11 11 11 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 11 11 22 12 12 11 12 11 12 12 11 11 11 11 11 12 11 11 11 11 11 11 11 22 22 12 11 11 11 12 12 11 11 11 12 12 12 12 12 12 11 11 22 22 22 11 11 11 12 12 12 12 22 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 12 11 11 11 12 12 11 11 11 12 12 11 22 12 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 11 12 11 11 12 12 11 11 11 12 12 22 11 11 11 12 12 11 11 11 11 11 12 12 11 11 11 11 11 11 12 12 12 22 22 12 11 11 12 11 12 11 11 11 11 11 22 11 11 22 22 22 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 11 22 12 12 11 11 11 12 11 12 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 12 11 22 22 22 11 11 11 11 11 11 11 12 11 11 11 11 11 12 22 12 11 11 11 12 11 11 11 11 12 11 11 11 11 11 11 11 11 11 11 12 12 12 12 12 11 11 12 SNP, single nucleotide polymorphism. Login to comment
138 The Q604E SNP is located on exon 13 of the ABCG5 gene and is encoded on a loop that faces the luminal or cell surface (16). Login to comment
150 Cholesterol metabolism and change according to exon SNPs in ABCG5 and ABCG8 Cholesterol Biosynthesis Cholesterol Absorption Cholesterol Turnover SNP Initial Final Change Initial Final Change Initial Final Change %/day %/day %/day % % % % % % Q604E QQ 8.48 6 6.76 6.16 6 5.66 22.32 6 8.86 59.7 6 18.5a 65.7 6 13.7 5.94 6 18.3c 39.1 6 5.99 36.5 6 8.14 22.45 6 9.76 QE 13.9 6 9.05 6.48 6 3.95 27.39 6 9.36a 57.2 6 11.8b 64.5 6 18.0 7.33 6 15.6d 37.5 6 9.27 39.5 6 6.31 1.93 6 8.59 EE 7.91 6 4.91 9.60 6 5.09 1.69 6 10.0a 86.5 6 13.3a,b 55.7 6 13.5 230.8 6 1.90c,d 40.8 6 3.72 45.3 6 8.63 4.47 6 12.1 QE 1 EE 12.8 6 8.63 7.07 6 4.18 25.69 6 9.84 62.6 6 16.6 62.8 6 17.2 0.18 6 20.7 38.2 6 8.44 40.6 6 6.86 2.43 6 8.94 C54Y CC 9.96 6 8.83 5.18 6 4.88a 24.78 6 9.62 64.9 6 15.4 67.5 6 16.4 2.67 6 22.0 37.0 6 8.43 38.1 6 7.68 1.13 6 10.6 CY 8.95 6 5.34 8.79 6 5.35 20.17 6 7.60a 54.2 6 13.5 65.4 6 12.2 11.2 6 12.9 38.3 6 5.00 40.1 6 8.42 1.77 6 8.67 YY 14.1 6 9.07 5.99 6 3.74 28.09 6 10.3a 64.1 6 25.6 55.3 6 15.6 28.80 6 17.9 43.3 6 6.57 36.2 6 7.00 27.03 6 6.42 CY 1 YY 10.8 6 7.16 7.76 6 4.90a 23.08 6 9.28 57.9 6 18.8 61.7 6 14.0 3.85 6 17.5 40.0 6 5.87 38.8 6 8.00 21.17 6 8.89 D19H DD 10.1 6 6.68 6.54 6 5.28 23.55 6 8.28 58.8 6 15.9 61.8 6 13.3 3.00 6 17.2 39.1 6 6.00 38.2 6 7.59 20.70 6 8.41 DH 11.4 6 11.0 6.68 6 4.35 24.76 6 12.4 67.5 6 21.2 71.7 6 18.8 4.19 6 25.9 37.5 6 10.2 39.1 6 8.57 1.45 6 12.3 T400K TT 10.4 6 8.91 6.91 6 5.51 23.53 6 10.9 64.4 6 19.4 63.6 6 17.2 20.76 6 20.2 40.4 6 5.15 38.9 6 7.39 21.61 6 9.46 TK 1 KK 10.4 6 5.99 6.01 6 4.12 24.42 6 6.29 55.4 6 12.2 65.6 6 11.6 10.2 6 16.5 35.8 6 9.10 37.7 6 8.52 2.24 6 9.64 a,b Significant difference between groups (P , 0.05). Login to comment
153 Genotype distribution and frequency of SNPs in introns and exons of ABCG5 and ABCG8 in the studied population Homozygous Wild Type Heterozygous Homozygous Variant SNP n Age BMI n Age BMI n Age BMI % years kg/m2 % years kg/m2 % years kg/m2 ABCG5 Q604E 19 (54.3) 48.6 6 6.56 31.0 6 2.92 13 (37.1) 50.2 6 7.24 32.0 6 2.79 3 (8.6) 51.0 6 6.56 30.6 6 2.45 I18429 22 (62.9) 49.1 6 6.91 31.2 6 2.81 13 (37.1) 49.9 6 6.51 31.7 6 2.91 0 (0) I7892 15 (42.9) 50.1 6 7.09 30.6 6 2.55 13 (37.1) 46.9 6 6.59 32.1 6 3.02 7 (20.0) 52.3 6 4.96 31.5 6 2.98 M216 18 (51.4) 50.3 6 6.89 30.6 6 2.33a 10 (28.6) 45.0 6 5.19b 33.2 6 2.99a 7 (20.0) 53.1 6 5.21b 30.6 6 2.85 ABCG8 C54Y 16 (45.7) 50.4 6 7.10 30.8 6 2.42 12 (34.3) 46.9 6 6.33 31.5 6 2.28 7 (20.0) 51.3 6 5.88 32.5 6 4.26 D19H 26 (74.3) 48.9 6 7.06 31.7 6 3.00 9 (25.7) 50.8 6 5.89 30.3 6 2.01 0 (0) I14222 25 (71.4) 48.6 6 7.16 31.5 6 3.06 10 (28.6) 51.2 6 5.18 31.0 6 2.17 0 (0) T400K 22 (62.9) 50.6 6 5.67 31.2 6 3.03 11 (31.4) 46.6 6 8.43 31.9 6 2.40 2 (5.7) 50.5 6 3.54 31.0 6 3.82 BMI, body mass index. Login to comment
96 A Mann-Whitney U test was used to determine whether differences existed among the I18429 genotypes in final synthesis, initial turnover, and change in turnover, among the I1422 genotypes in final synthesis, final turnover, and change in turnover, and among the T400K genotypes in final synthesis. Login to comment
139 Nonsynonymous SNPs on ABCG8, specifically, D19H, C54Y, and T400K, are located on exons 1, 2, and 8, respectively (33). Login to comment
97 A Mann-Whitney U test was used to determine whether differences existed among the I18429 genotypes in final synthesis, initial turnover, and change in turnover, among the I1422 genotypes in final synthesis, final turnover, and change in turnover, and among the T400K genotypes in final synthesis. Login to comment
131 Individual subject genotypes for each SNP in ABCG5 and ABCG8 ABCG5 ABCG8 Q604E I18429 I7892 M216 C54Y D19H I14222 T400K 11 11 12 12 12 11 11 11 11 11 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 11 11 22 12 12 11 12 11 12 12 11 11 11 11 11 12 11 11 11 11 11 11 11 22 22 12 11 11 11 12 12 11 11 11 12 12 12 12 12 12 11 11 22 22 22 11 11 11 12 12 12 12 22 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 12 11 11 11 12 12 11 11 11 12 12 11 22 12 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 11 12 11 11 12 12 11 11 11 12 12 22 11 11 11 12 12 11 11 11 11 11 12 12 11 11 11 11 11 11 12 12 12 22 22 12 11 11 12 11 12 11 11 11 11 11 22 11 11 22 22 22 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 11 22 12 12 11 11 11 12 11 12 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 12 11 22 22 22 11 11 11 11 11 11 11 12 11 11 11 11 11 12 22 12 11 11 11 12 11 11 11 11 12 11 11 11 11 11 11 11 11 11 11 12 12 12 12 12 11 11 12 SNP, single nucleotide polymorphism. Login to comment
149 Cholesterol metabolism and change according to exon SNPs in ABCG5 and ABCG8 Cholesterol Biosynthesis Cholesterol Absorption Cholesterol Turnover SNP Initial Final Change Initial Final Change Initial Final Change %/day %/day %/day % % % % % % Q604E QQ 8.48 6 6.76 6.16 6 5.66 22.32 6 8.86 59.7 6 18.5a 65.7 6 13.7 5.94 6 18.3c 39.1 6 5.99 36.5 6 8.14 22.45 6 9.76 QE 13.9 6 9.05 6.48 6 3.95 27.39 6 9.36a 57.2 6 11.8b 64.5 6 18.0 7.33 6 15.6d 37.5 6 9.27 39.5 6 6.31 1.93 6 8.59 EE 7.91 6 4.91 9.60 6 5.09 1.69 6 10.0a 86.5 6 13.3a,b 55.7 6 13.5 230.8 6 1.90c,d 40.8 6 3.72 45.3 6 8.63 4.47 6 12.1 QE 1 EE 12.8 6 8.63 7.07 6 4.18 25.69 6 9.84 62.6 6 16.6 62.8 6 17.2 0.18 6 20.7 38.2 6 8.44 40.6 6 6.86 2.43 6 8.94 C54Y CC 9.96 6 8.83 5.18 6 4.88a 24.78 6 9.62 64.9 6 15.4 67.5 6 16.4 2.67 6 22.0 37.0 6 8.43 38.1 6 7.68 1.13 6 10.6 CY 8.95 6 5.34 8.79 6 5.35 20.17 6 7.60a 54.2 6 13.5 65.4 6 12.2 11.2 6 12.9 38.3 6 5.00 40.1 6 8.42 1.77 6 8.67 YY 14.1 6 9.07 5.99 6 3.74 28.09 6 10.3a 64.1 6 25.6 55.3 6 15.6 28.80 6 17.9 43.3 6 6.57 36.2 6 7.00 27.03 6 6.42 CY 1 YY 10.8 6 7.16 7.76 6 4.90a 23.08 6 9.28 57.9 6 18.8 61.7 6 14.0 3.85 6 17.5 40.0 6 5.87 38.8 6 8.00 21.17 6 8.89 D19H DD 10.1 6 6.68 6.54 6 5.28 23.55 6 8.28 58.8 6 15.9 61.8 6 13.3 3.00 6 17.2 39.1 6 6.00 38.2 6 7.59 20.70 6 8.41 DH 11.4 6 11.0 6.68 6 4.35 24.76 6 12.4 67.5 6 21.2 71.7 6 18.8 4.19 6 25.9 37.5 6 10.2 39.1 6 8.57 1.45 6 12.3 T400K TT 10.4 6 8.91 6.91 6 5.51 23.53 6 10.9 64.4 6 19.4 63.6 6 17.2 20.76 6 20.2 40.4 6 5.15 38.9 6 7.39 21.61 6 9.46 TK 1 KK 10.4 6 5.99 6.01 6 4.12 24.42 6 6.29 55.4 6 12.2 65.6 6 11.6 10.2 6 16.5 35.8 6 9.10 37.7 6 8.52 2.24 6 9.64 a,b Significant difference between groups (P , 0.05). Login to comment
152 Genotype distribution and frequency of SNPs in introns and exons of ABCG5 and ABCG8 in the studied population Homozygous Wild Type Heterozygous Homozygous Variant SNP n Age BMI n Age BMI n Age BMI % years kg/m2 % years kg/m2 % years kg/m2 ABCG5 Q604E 19 (54.3) 48.6 6 6.56 31.0 6 2.92 13 (37.1) 50.2 6 7.24 32.0 6 2.79 3 (8.6) 51.0 6 6.56 30.6 6 2.45 I18429 22 (62.9) 49.1 6 6.91 31.2 6 2.81 13 (37.1) 49.9 6 6.51 31.7 6 2.91 0 (0) I7892 15 (42.9) 50.1 6 7.09 30.6 6 2.55 13 (37.1) 46.9 6 6.59 32.1 6 3.02 7 (20.0) 52.3 6 4.96 31.5 6 2.98 M216 18 (51.4) 50.3 6 6.89 30.6 6 2.33a 10 (28.6) 45.0 6 5.19b 33.2 6 2.99a 7 (20.0) 53.1 6 5.21b 30.6 6 2.85 ABCG8 C54Y 16 (45.7) 50.4 6 7.10 30.8 6 2.42 12 (34.3) 46.9 6 6.33 31.5 6 2.28 7 (20.0) 51.3 6 5.88 32.5 6 4.26 D19H 26 (74.3) 48.9 6 7.06 31.7 6 3.00 9 (25.7) 50.8 6 5.89 30.3 6 2.01 0 (0) I14222 25 (71.4) 48.6 6 7.16 31.5 6 3.06 10 (28.6) 51.2 6 5.18 31.0 6 2.17 0 (0) T400K 22 (62.9) 50.6 6 5.67 31.2 6 3.03 11 (31.4) 46.6 6 8.43 31.9 6 2.40 2 (5.7) 50.5 6 3.54 31.0 6 3.82 BMI, body mass index. Login to comment

PMID: 18457353 [PubMed] Kuo KK et al: "Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease."

No. Sentence Comment

5 Five non-synonymous polymorphisms, E604Q (ABCG5), D19H, C54Y, T400K and A632V (ABCG8), were analysed using the TaqMan genotyping assay. Login to comment
26 In previous studies, five non-synonymous polymorphisms in ABCG5 (E604Q) and ABCG8 (C54Y, D19H, T400K, A632V) have been linked to cholesterol homeostasis, especially in cholesterol absorption efficiency and cholesterol saturation of bile. Login to comment
44 Relevant non-synonymous polymorphisms of ABCG5 (E604Q) and ABCG8 (C54Y, D19H, T400K, A632V) associated with biliary cholesterol secretion were chosen for this study. Login to comment
46 The specific primers were designed using Primer 3 software according to SNP reference of GenBank mapping in the National Center for Biotechnology Information database (rs6720173 for E604Q, rs11887534 for D19H, rs4148211 for C54Y, rs4148217 for T400K, rs6544718 for A632V). Login to comment
67 Table 2 shows allele frequencies of the five nonsynonymous polymorphisms (ABCG5: E604Q; ABCG8: D19H, C54Y, T400K, A632V). Login to comment
83 *Two-sample Student`s t test, except †Pearson χ2 test. Table 2 Allele frequencies of the polymorphisms in ABCG5 and ABCG8 genes in 979 subjects Gene Allele NCBI SNP reference Ratio Frequency (%) ABCG5: E604Q G1810C rs 6720173 G : C 89·5 : 10·5 ABCG8: D19H G55C rs 11887534 G : C 98·6 : 1·4 ABCG8: C54Y G161A rs 4148211 G : A 90·3 : 9·7 ABCG8: T400K C1199A rs 4148217 C : A 92·0 : 8·0 ABCG8: A632V T1895C rs 6544718 T : C 0 : 100 NCBI, National Center for Biotechnology Information; SNP, single nucleotide polymorphism. Login to comment
84 Table 3 Association of genotype frequency of ABCG5 and ABCG8 with gallstone development No stones (n = 905) Gallstones (n = 74) P* Power (%) ABCG5: E604Q (G1810C) Genotype GG 691 (79·2) 52 (74) 0·011 18 GC 175 (20·1) 15 (21) CC 6 (0·7) 3 (4) ABCG8: D19H (G55C) Genotype GG 851 (97·9) 66 (92) 0·001 79 GC 18 (2·1) 6 (8) ABCG8: C54Y (G161A) Genotype GG 747 (82·5) 54 (73) 0·041 53 GA 152 (16·8) 18 (24) AA 6 (0·7) 2 (3) ABCG8: T400K (C1199A) Genotype CC 739 (84·5) 58 (79) 0·463 22 CA 134 (15·3) 15 (21) AA 2 (0·2) 0 (0) Values in parentheses are percentages. Login to comment

PMID: 18522623 [PubMed] Rudkowska I et al: "Polymorphisms in ABCG5/G8 transporters linked to hypercholesterolemia and gallstone disease."

No. Sentence Comment

3 Various polymorphisms (A632V, T400K, D19H, M429V, and C54Y) in the ABCG8 and ABCG5 (Q604E) gene have been found to be associated with several facets of cholesterol metabolism, including baseline cholesterol level, cholesterol kinetics, individual responsiveness of plasma cholesterol to dietary and pharmaceutical interventions for hypercholesterolemia, and increased risk of gallstones. Login to comment
27 In addition, these investigators also observed that carriers of the T400K and A632V polymorphisms in the ABCG8 gene exhibited higher cholesterol synthesis and higher plasma TC, respectively.8 Gylling et al.9 failed to show an association between cholesterol kinetics and T400K and A632V polymorphisms in the ABCG8 gene, but found that carriers of the mutant Q604E allele of the ABCG5 gene had high cholesterol absorption and thus had higher characteristics of the insulin resistance syndrome. Login to comment
29 ROLE OF RACE-RELATED DIFFERENCES IN ABC GENOTYPES Miwa et al.,15 studying a Japanese population, concluded that carriers of a novel ABCG8 M429V allele or a specific haplotype (wild-type allele of Q604E ABCG5, and wild-type allele of C54Y, wild-type allele of T400K, mutant allele of M429V in the ABCG8 gene), were associated with higher cholesterol absorption efficiency, as well as lower cholesterol synthesis rates. Login to comment
30 These findings in the Japanese group are not without exception; no difference was observed in lipid profiles in relation to common polymorphisms studied previously [ABCG8 (A632V, T400K, D19H, and C54Y) and ABCG5 (Q604E)],6,7,11,12 which might be explained by the fact that carriers of ABCG8 D19H and A632A polymorphisms are rare in the Japanese population compared to Western populations. Login to comment
31 Also, polymorphisms of Q604E and T400K alleles may not be as important in the regulation of non-cholesterol-sterol levels in the Japanese population.15 In a more recent trial, no detection of this SNP (ABCG8 M429V allele) was recorded in either the Caucasian or the African-American population studied, thereby potentially demonstrating a race-specific polymorphism.16 In general, these studies demonstrate the benefits of using an intermediate phenotype, such as cholesterol absorption and synthesis, to determine the link between SNPs and blood lipids in relation to a dietary treatment. Login to comment
38 Other ABCG5 and G8 polymorphisms (Q604E, C54Y, T400K, and A632V) and CYP7A1 in hypercholesterolemic patients had no apparent association with responsiveness to statin treatment. Login to comment
51 On the other hand, Wang et al.24 investigated a possible association between three polymorphisms, including C54Y, T400K alleles of ABCG8, and Q604E of ABCG5 gene, and gallstone formation in a Chinese population. Login to comment
61 Overall, these studies identify a variety of polymorphisms in ABCG8 (A632V, T400K, D19H, and C54Y) and in ABCG5 (Q604E) that have been linked with baseline cholesterol levels, cholesterol absorption, or responsiveness to dietary intervention.3-12,15-17 In addition, genetic variations in the ABCG8 gene (D19H and T400K) may increase the risk of gallstone disease in certain populations.22-24 Table 1 summarizes potential SNPs and the effects of the mutant allele on baseline blood lipid concentrations, cholesterol kinetics, responsiveness to interventions, and gallstone disease risk. Login to comment
22 Yet, when a subanalysis of male participants was performed, the ABCG8 T400K wild-type allele carriers exhibited a greater decrease in plasma TC and LDL-C than mutant allele carriers.12 This same study also demonstrated that subjects with the ABCG8 C54Y Tyr54 genotype had greater plasma TC and LDL-C reduction than theABCG8 C54Y Cys54 genotype, but only in female subjects.12 Therefore, the investigators concluded that ABCG8 T400K and ABCG5 C54Y genotypes influence plasma TC in a gender-specific manner following dietary intervention.12 Overall, the various studies reviewed above suggest that different ABC transporter gene polymorphisms influence plasma lipids in relation to dietary treatment; however, no single, common,ABC transporter gene polymorphism has been identified across existing studies. Login to comment
39 ABC GENE POLYMORPHISMS AND PLANT STEROL ABSORPTION Plat et al.17 found that cholesterol-standardized serum campesterol and sitosterol concentrations, as well as changes in serum campesterol and sitosterol concentrations after plant stanol consumption, were associated with the ABCG8 T400K genotype. Login to comment
40 Reductions in serum campesterol and sitosterol levels in subjects with a mutated allele of ABCG8 T400K were greater compared with reductions in subjects with the wild-type allele.17 These investigators hypothesized that their findings indicate the functionality of the ABCG5 and G8 heterodimer is reduced in the wild-type allele, resulting in decreased transport of plant sterols from enterocytes back into the gut lumen, or from hepatocytes into bile, thereby increasing serum concentrations of plant sterols.17 Given that the wild-type ABCG8 T400K allele is present in about 70% of the population,17 it should be relatively straightforward to verify these findings in future plant sterol/stanol studies. Login to comment
53 Wang et al.24 found that only male carriers of the mutant allele of ABCG8 T400K had an elevated risk for gallstone disease compared to males with the common genotype. Login to comment
55 Overall, these studies on ABC gene polymorphisms and gallstone disease associations demonstrate that the mutant allele of D19H and T400K of ABCG8 might help to predict gallstone disease risk within a given individual. Login to comment

PMID: 18581044 [PubMed] Chen ZC et al: "Significant association of ABCG8:D19H gene polymorphism with hypercholesterolemia and insulin resistance."

No. Sentence Comment

42 Five nonsynonymous polymorphisms, including Q604E (rs6720173) of the ABCG5 gene and D19H (rs11887534), C54Y (rs4148211), T400K (rs4148217) and A632V (rs6544718) of the ABCG8 gene, were chosen for genotyping (http://www.ncbi.nlm.nih.gov/). Login to comment
62 Five nonsynonymous polymorphisms (ABCG5: Q604E; ABCG8:D19H, C54Y, T400K, A632V) were genotyped in our population. Login to comment
64 The minor allele frequencies (MAFs) of Q604E (C:G); D19H (G:C), C54Y (G:A) and T400K (C:A) were 10.5, 1.4, 9.7 and 8.0%, respectively. Login to comment
43 Five nonsynonymous polymorphisms, including Q604E (rs6720173) of the ABCG5 gene and D19H (rs11887534), C54Y (rs4148211), T400K (rs4148217) and A632V (rs6544718) of the ABCG8 gene, were chosen for genotyping (http://www.ncbi.nlm.nih.gov/). Login to comment
63 Five nonsynonymous polymorphisms (ABCG5: Q604E; ABCG8:D19H, C54Y, T400K, A632V) were genotyped in our population. Login to comment
65 The minor allele frequencies (MAFs) of Q604E (C:G); D19H (G:C), C54Y (G:A) and T400K (C:A) were 10.5, 1.4, 9.7 and 8.0%, respectively. Login to comment

PMID: 19005228 [PubMed] Junyent M et al: "The effects of ABCG5/G8 polymorphisms on plasma HDL cholesterol concentrations depend on smoking habit in the Boston Puerto Rican Health Study."

No. Sentence Comment

30 Only two studies in patients with gallstone disease reported significant associations with HDL-C (16) and triglyceride (TG) concentrations (16, 18), but not with total cholesterol and LDL-C, for ABCG5 Gln604Glu and ABCG8 Thr400Lys SNPs, respectively. Login to comment
29 Only two studies in patients with gallstone disease reported significant associations with HDL-C (16) and triglyceride (TG) concentrations (16, 18), but not with total cholesterol and LDL-C, for ABCG5 Gln604Glu and ABCG8 Thr400Lys SNPs, respectively. Login to comment

PMID: 20581104 [PubMed] Jakulj L et al: "ABCG5/G8 polymorphisms and markers of cholesterol metabolism: systematic review and meta-analysis."

No. Sentence Comment

141 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (␮g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 ± 0.76 4.05 ± 0.61 1.54 ± 0.40 1.09 [0.29-3.56] 1.45 ± 0.64 1.12 ± 0.53 1.49 ± 0.33 1.24 ± 0.49 QE/EE 72 6.23 ± 0.73 4.11 ± 0.63 1.49 ± 0.36 1.19 [0.47-3.93] 1.47 ± 0.88 1.16 ± 0.63 1.46 ± 0.38 1.28 ± 0.57 D19H DD 219 6.19 ± 0.75 4.08 ± 0.61 1.52 ± 0.40 1.10 [0.29-3.93] 1.49 ± 0.69 1.16 ± 0.55 1.49 ± 0.34 1.24 ± 0.49 DH/HH 24 6.04 ± 0.81 3.90 ± 0.63 1.60 ± 0.38 1.15 [0.47-1.97] 1.24 ± 0.82 0.92 ± 0.53 1.38 ± 0.34 1.35 ± 0.64 Y54C YY 73 6.32 ± 0.73 4.14 ± 0.64 1.58 ± 0.37 1.09 [0.45-3.93] 1.59 ± 0.76 1.22 ± 0.60 1.53 ± 0.33 1.24 ± 0.53 YC/CC 171 6.12 ± 0.76 4.03 ± 0.61 1.51 ± 0.41 1.11 [0.29-3.56] 1.41 ± 0.68 1.09 ± 0.53 1.46 ± 0.34 1.26 ± 0.50 T400K TT 183 6.16 ± 0.75 4.03 ± 0.60 1.55 ± 0.40 1.10 [0.29-3.93] 1.48 ± 0.69 1.14 ± 0.55 1.49 ± 0.35 1.25 ± 0.48 TK/KK 61 6.24 ± 0.76 4.19 ± 0.66 1.47 ± 0.37 1.14 [0.47-2.61] 1.38 ± 0.76 1.09 ± 0.59 1.45 ± 0.31 1.27 ± 0.59 A632V AA 139 6.22 ± 0.72 4.12 ± 0.60 1.51 ± 0.37 1.12 [0.33-2.90] 1.49 ± 0.72 1.16 ± 0.58 1.51 ± 0.37 1.21 ± 0.49 AV/VV 105 6.14 ± 0.79 3.99 ± 0.63 1.57 ± 0.43 1.07 [0.29-3.93] 1.42 ± 0.70 1.09 ± 0.52 1.44 ± 0.30 1.31 ± 0.52 Values shown are means ± SD. Triglycerides are shown as median [range]. Login to comment
145 TABLE3.Characteristicsofstudiesincludedinthemeta-analysis Reference Number of SubjectsAge Male/ Female BodyMass IndexEthnicitySingleNucleotidePolymorphismsLipidsNon-CholesterolSterols nyearsnkg/m 2 Berge,2002(5)14855±1174/74NotreportedCaucasianD19H,T400K,Y54C,Q604E,A632VTCCAMP,SITO,CHOLST,LATHO Weggemans,2002(7)48626.3±11.6257/22921.7±3.0CaucasianQ604ETC- Gylling,2004(13)26253.1±8.1143/11926.4±6.5CaucasianD19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TGCAMP,SITO,CHOLST,LATHO Plat,2005(11)a 11233±1641/7122.9±3.6CaucasianT400K,Q604E,A632VLDL-C,HDL-C,TGCAMP,SITO,LATHO Acalovschi,2006(27)72 e 56.3(36-80)30/4230.1±4.9CaucasianD19H,T400K,Y54C,Q604E,A632VTC,HDL-C,TG- Jakulj,etal. b 24558.4±7.5189/4825.8±3.0CaucasianD19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TGCAMP,SITO,CHOLST,LATHO Miwa,2005(28)10062.4±12.148/5223.0±3.5AsianT400K,Y54C,Q604E-SITO,LATHO Wang,2007(29) a,c 13454.1±8.1134/023.2±2.3AsianT400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Chen,2008(8) a 104647.0±9.3894/15224.9±2.4AsianD19H,T400K,Y54C,Q604E i TC,LDL-C,HDL-C,TG- Caamano,2008(30) d 10440±1058/4625.5±3.3HispanicY54C,Q604ETC,LDL-C,HDL-C,TG- 11844±771/4727.6±4.9HispanicY54C,Q604ETC,LDL-C,HDL-C,TG- Santosa,2007(31) a 3549.4±6.70/3531.4±2.8Mixed f D19H,T400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Rudkowska,2008(32)2659.6±9.615/1126.4±2.7Mixed f D19H,T400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Chan,2004(33) a 4754.5±8.447/032±3.6Notreported g D19H,T400KTC,LDL-C,HDL-C,TGCAMP,SITO,LATHO Kajinami,2004(12) a 33858±11203/13527.0±3.0Notreported h D19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TG- Herron,2006(9) a 9131.1±9.240/5124.8±4.7Notreported h Q604ETC,LDL-C,HDL-C- Total(WM)336446.7±10.52251/111323.9±3.5 Numberandcharacteristicsofstudiesincludedinthemeta-analysis.CAMP,campesterol/TCratio;CHOLST,cholestanol/TCratio;HDL-C,HDL-cholesterol;LATHO,lathosterol/TCratio;LDL-C, LDL-cholesterol;SITO,sitosterol/TCratio;TC,totalcholesterol;TG,triglyceride;WM,weightedmean. Login to comment
12 We first investigated associations between five common ABCG5/G8 polymorphisms (p.Q604E, p.D19H, p.Y54C, p. T400K, and p.A632V) and plasma sterol levels in 245 hypercholesterolaemic individuals. Login to comment
68 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
131 The p.T400K polymorphism showed similar trends with borderline significance, whereas the remaining three polymorphisms were not associated with baseline non-cholesterol sterol levels (supplementary Table II). Login to comment
159 One study evaluated associations between p.T400K and p.D19H polymorphisms and CVD risk in a cohort of 2,012 heterozygous FH patients (22). Login to comment
160 Neither of the two variants was independently associated with total CVD risk; however, when combined p.T400K and p.D19H gene scores were calculated, a positive correlation was found. Login to comment
281 Twelve studies reported significant associations with baseline triglyceride levels, which mostly involved the p.T400K polymorphism (13, 29, 33); however, this was not consistent throughout all included studies (8, 11, 12, 27, 30-32). Login to comment
66 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
129 The p.T400K polymorphism showed similar trends with borderline significance, whereas the remaining three polymorphisms were not associated with baseline non-cholesterol sterol levels (supplementary Table II). Login to comment
139 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (òe;g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 &#b1; 0.76 4.05 &#b1; 0.61 1.54 &#b1; 0.40 1.09 [0.29-3.56] 1.45 &#b1; 0.64 1.12 &#b1; 0.53 1.49 &#b1; 0.33 1.24 &#b1; 0.49 QE/EE 72 6.23 &#b1; 0.73 4.11 &#b1; 0.63 1.49 &#b1; 0.36 1.19 [0.47-3.93] 1.47 &#b1; 0.88 1.16 &#b1; 0.63 1.46 &#b1; 0.38 1.28 &#b1; 0.57 D19H DD 219 6.19 &#b1; 0.75 4.08 &#b1; 0.61 1.52 &#b1; 0.40 1.10 [0.29-3.93] 1.49 &#b1; 0.69 1.16 &#b1; 0.55 1.49 &#b1; 0.34 1.24 &#b1; 0.49 DH/HH 24 6.04 &#b1; 0.81 3.90 &#b1; 0.63 1.60 &#b1; 0.38 1.15 [0.47-1.97] 1.24 &#b1; 0.82 0.92 &#b1; 0.53 1.38 &#b1; 0.34 1.35 &#b1; 0.64 Y54C YY 73 6.32 &#b1; 0.73 4.14 &#b1; 0.64 1.58 &#b1; 0.37 1.09 [0.45-3.93] 1.59 &#b1; 0.76 1.22 &#b1; 0.60 1.53 &#b1; 0.33 1.24 &#b1; 0.53 YC/CC 171 6.12 &#b1; 0.76 4.03 &#b1; 0.61 1.51 &#b1; 0.41 1.11 [0.29-3.56] 1.41 &#b1; 0.68 1.09 &#b1; 0.53 1.46 &#b1; 0.34 1.26 &#b1; 0.50 T400K TT 183 6.16 &#b1; 0.75 4.03 &#b1; 0.60 1.55 &#b1; 0.40 1.10 [0.29-3.93] 1.48 &#b1; 0.69 1.14 &#b1; 0.55 1.49 &#b1; 0.35 1.25 &#b1; 0.48 TK/KK 61 6.24 &#b1; 0.76 4.19 &#b1; 0.66 1.47 &#b1; 0.37 1.14 [0.47-2.61] 1.38 &#b1; 0.76 1.09 &#b1; 0.59 1.45 &#b1; 0.31 1.27 &#b1; 0.59 A632V AA 139 6.22 &#b1; 0.72 4.12 &#b1; 0.60 1.51 &#b1; 0.37 1.12 [0.33-2.90] 1.49 &#b1; 0.72 1.16 &#b1; 0.58 1.51 &#b1; 0.37 1.21 &#b1; 0.49 AV/VV 105 6.14 &#b1; 0.79 3.99 &#b1; 0.63 1.57 &#b1; 0.43 1.07 [0.29-3.93] 1.42 &#b1; 0.70 1.09 &#b1; 0.52 1.44 &#b1; 0.30 1.31 &#b1; 0.52 Values shown are means &#b1; SD. Triglycerides are shown as median [range]. Login to comment
144 Characteristics of studies included in the meta-analysis Reference Number of Subjects Age Male/ Female Body Mass Index Ethnicity Single Nucleotide Polymorphisms Lipids Non-Cholesterol Sterols n years n kg/m 2 Berge, 2002 (5) 148 55 &#b1; 11 74/74 Not reported Caucasian D19H, T400K, Y54C, Q604E, A632V TC CAMP, SITO, CHOLST, LATHO Weggemans, 2002 (7) 486 26.3 &#b1; 11.6 257/229 21.7 &#b1; 3.0 Caucasian Q604E TC - Gylling, 2004 (13) 262 53.1 &#b1; 8.1 143/119 26.4 &#b1; 6.5 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG CAMP, SITO, CHOLST, LATHO Plat, 2005 (11) a 112 33 &#b1; 16 41/71 22.9 &#b1; 3.6 Caucasian T400K, Q604E, A632V LDL-C, HDL-C, TG CAMP, SITO, LATHO Acalovschi, 2006 (27) 72 e 56.3 (36-80) 30/42 30.1 &#b1; 4.9 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, HDL-C, TG - Jakulj, et al. b 245 58.4 &#b1; 7.5 189/48 25.8 &#b1; 3.0 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG CAMP, SITO, CHOLST, LATHO Miwa, 2005 (28) 100 62.4 &#b1; 12.1 48/52 23.0 &#b1; 3.5 Asian T400K, Y54C, Q604E - SITO, LATHO Wang, 2007 (29) a , c 134 54.1 &#b1; 8.1 134/0 23.2 &#b1; 2.3 Asian T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Chen, 2008 (8) a 1046 47.0 &#b1; 9.3 894/152 24.9 &#b1; 2.4 Asian D19H, T400K, Y54C, Q604E i TC, LDL-C, HDL-C, TG - Caamano, 2008 (30) d 104 40 &#b1; 10 58/46 25.5 &#b1; 3.3 Hispanic Y54C, Q604E TC, LDL-C, HDL-C, TG - 118 44 &#b1; 7 71/47 27.6 &#b1; 4.9 Hispanic Y54C, Q604E TC, LDL-C, HDL-C, TG - Santosa, 2007 (31) a 35 49.4 &#b1; 6.7 0/35 31.4 &#b1; 2.8 Mixed f D19H, T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Rudkowska, 2008 (32) 26 59.6 &#b1; 9.6 15/11 26.4 &#b1; 2.7 Mixed f D19H, T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Chan, 2004 (33) a 47 54.5 &#b1; 8.4 47/0 32 &#b1; 3.6 Not reported g D19H, T400K TC, LDL-C, HDL-C, TG CAMP, SITO, LATHO Kajinami, 2004 (12) a 338 58 &#b1; 11 203/135 27.0 &#b1; 3.0 Not reported h D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG - Herron, 2006 (9) a 91 31.1 &#b1; 9.2 40/51 24.8 &#b1; 4.7 Not reported h Q604E TC, LDL-C, HDL-C - Total (WM) 3364 46.7 &#b1; 10.5 2251/ 1113 23.9 &#b1; 3.5 Number and characteristics of studies included in the meta-analysis. Login to comment
161 One study evaluated associations between p.T400K and p.D19H polymorphisms and CVD risk in a cohort of 2,012 heterozygous FH patients (22). Login to comment
162 Neither of the two variants was independently associated with total CVD risk; however, when combined p.T400K and p.D19H gene scores were calculated, a positive correlation was found. Login to comment
282 Twelve studies reported significant associations with baseline triglyceride levels, which mostly involved the p.T400K polymorphism (13, 29, 33); however, this was not consistent throughout all included studies (8, 11, 12, 27, 30-32). Login to comment
67 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
130 The p.T400K polymorphism showed similar trends with borderline significance, whereas the remaining three polymorphisms were not associated with baseline non-cholesterol sterol levels (supplementary Table II). Login to comment
140 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (òe;g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 &#b1; 0.76 4.05 &#b1; 0.61 1.54 &#b1; 0.40 1.09 [0.29-3.56] 1.45 &#b1; 0.64 1.12 &#b1; 0.53 1.49 &#b1; 0.33 1.24 &#b1; 0.49 QE/EE 72 6.23 &#b1; 0.73 4.11 &#b1; 0.63 1.49 &#b1; 0.36 1.19 [0.47-3.93] 1.47 &#b1; 0.88 1.16 &#b1; 0.63 1.46 &#b1; 0.38 1.28 &#b1; 0.57 D19H DD 219 6.19 &#b1; 0.75 4.08 &#b1; 0.61 1.52 &#b1; 0.40 1.10 [0.29-3.93] 1.49 &#b1; 0.69 1.16 &#b1; 0.55 1.49 &#b1; 0.34 1.24 &#b1; 0.49 DH/HH 24 6.04 &#b1; 0.81 3.90 &#b1; 0.63 1.60 &#b1; 0.38 1.15 [0.47-1.97] 1.24 &#b1; 0.82 0.92 &#b1; 0.53 1.38 &#b1; 0.34 1.35 &#b1; 0.64 Y54C YY 73 6.32 &#b1; 0.73 4.14 &#b1; 0.64 1.58 &#b1; 0.37 1.09 [0.45-3.93] 1.59 &#b1; 0.76 1.22 &#b1; 0.60 1.53 &#b1; 0.33 1.24 &#b1; 0.53 YC/CC 171 6.12 &#b1; 0.76 4.03 &#b1; 0.61 1.51 &#b1; 0.41 1.11 [0.29-3.56] 1.41 &#b1; 0.68 1.09 &#b1; 0.53 1.46 &#b1; 0.34 1.26 &#b1; 0.50 T400K TT 183 6.16 &#b1; 0.75 4.03 &#b1; 0.60 1.55 &#b1; 0.40 1.10 [0.29-3.93] 1.48 &#b1; 0.69 1.14 &#b1; 0.55 1.49 &#b1; 0.35 1.25 &#b1; 0.48 TK/KK 61 6.24 &#b1; 0.76 4.19 &#b1; 0.66 1.47 &#b1; 0.37 1.14 [0.47-2.61] 1.38 &#b1; 0.76 1.09 &#b1; 0.59 1.45 &#b1; 0.31 1.27 &#b1; 0.59 A632V AA 139 6.22 &#b1; 0.72 4.12 &#b1; 0.60 1.51 &#b1; 0.37 1.12 [0.33-2.90] 1.49 &#b1; 0.72 1.16 &#b1; 0.58 1.51 &#b1; 0.37 1.21 &#b1; 0.49 AV/VV 105 6.14 &#b1; 0.79 3.99 &#b1; 0.63 1.57 &#b1; 0.43 1.07 [0.29-3.93] 1.42 &#b1; 0.70 1.09 &#b1; 0.52 1.44 &#b1; 0.30 1.31 &#b1; 0.52 Values shown are means &#b1; SD. Triglycerides are shown as median [range]. Login to comment
163 Neither of the two variants was independently associated with total CVD risk; however, when combined p.T400K and p.D19H gene scores were calculated, a positive correlation was found. Login to comment
284 Twelve studies reported significant associations with baseline triglyceride levels, which mostly involved the p.T400K polymorphism (13, 29, 33); however, this was not consistent throughout all included studies (8, 11, 12, 27, 30-32). Login to comment

PMID: 21039829 [PubMed] Yoon JH et al: "ABCG8 D19H polymorphism: a basis for the genetic prediction of cholesterol gallstone disease."

No. Sentence Comment

11 Other studies have identified a variety of polymorphisms in ABCG8 (A632V, T400K, D19H, and C54Y) and in ABCG5 (Q604E) that have been linked to baseline plasma cholesterol levels, cholesterol absorption, or responsiveness to dietary intervention. Login to comment
15 Wang et al.11 examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H,Y54C, T400K, A632V) genes in 287 patients with gallstone disease. Login to comment
12 In addition, genetic variations in the ABCG8 gene (D19H and T400K) might increase the risk of gallstone disease in certain populations.9 These sex- and population-specific gene polymorphisms, and the interactions between sex, genes, and diet also need to be considered in studies of polymorphisms of Lith genes. Login to comment
14 Yet when a subanalysis of male participants was performed, the ABCG8 T400K wild-type allele carriers exhibited a greater decrease in plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) than mutant allele carriers.10 Wang et al.11 suggested that the T400K polymorphism in ABCG8 might be associated with gallstone disease in Chinese males by revealing a possible association between this transporter gene polymorphism and gallstone formation. Login to comment
16 The relative risk of gallstone formation was 2.31 (95% CI: 1.12-4.76) for males carrying the K400 allele of ABCG8 T400K. Login to comment

PMID: 21128988 [PubMed] Wei KK et al: "Interactions between CYP7A1 A-204C and ABCG8 C1199A polymorphisms on lipid lowering with atorvastatin."

No. Sentence Comment

27 Several previous studies have found that 5 nonsynonymous single-nucleotide polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) coding sequences may affect plasma plant sterol or cholesterol levels (16-19). Login to comment
29 Allele frequencies of 19H and 632V were found to be rare in a Chinese population (20), and the Y54C and T400K alleles showed strong linkage disequilibrium. Login to comment
30 Therefore, we investigated the effect of the interactions between the CYP7A1 A-204C and ABCG8 C1199A (T400K) polymorphisms on lipid-lowering with atorvastatin treatment in a Chinese population. Login to comment
88 However, these findings are inconsistent with those of Kajinami et al., who found homozygotes for both CYP7A1 A-204 and ABCG8 19H alleles with increased reduction in LDL-C level and ABCG8 T400K polymorphism without an important interaction with CYP7A1 polymorphism (15). Login to comment

PMID: 21437027 [PubMed] Izar MC et al: "Phytosterols and phytosterolemia: gene-diet interactions."

No. Sentence Comment

127 Missense polymorphisms (Gln604Glu in the ABCG5, and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) were examined, and the Thr400Lys in the ABCG8 gene was associated with changes in lipid levels in response to reduced dietary animal fat and cholesterol intake. Login to comment
129 Missense polymorphisms (Gln604Glu in the ABCG5, and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) were examined, and the Thr400Lys in the ABCG8 gene was associated with changes in lipid levels in response to reduced dietary animal fat and cholesterol intake. Login to comment

PMID: 12446833 [PubMed] Sehayek E et al: "Loci on chromosomes 14 and 2, distinct from ABCG5/ABCG8, regulate plasma plant sterol levels in a C57BL/6J x CASA/Rk intercross."

No. Sentence Comment

159 ABCG8 D19H in 10% of the population had a 31% lower genotypic mean campesterol level, and ABCG8 T400K in 36% of the population had a 2% lower genotypic mean. Login to comment

PMID: 12671028 [PubMed] Kwiterovich PO Jr et al: "Response of obligate heterozygotes for phytosterolemia to a low-fat diet and to a plant sterol ester dietary challenge."

No. Sentence Comment

258 Berge et al. (50) have recently found that the plasma levels of campesterol and sitosterol are heritable, and that two common DNA sequence variations (D19H and T400K) in the ABCG8 gene are associated with lower concentrations of these plant sterols. Login to comment

PMID: 12897193 [PubMed] Sehayek E et al: "Genetic regulation of cholesterol absorption and plasma plant sterol levels: commonalities and differences."

No. Sentence Comment

109 Carriers of ABCG8 D19H in 10% of the population had a 31% lower genotypic mean in absolute campesterol level, and carriers of ABCG8 T400K in 36% of the population had a 2% lower genotypic mean. Login to comment
108 Carriers of ABCG8 D19H in 10% of the population had a 31% lower genotypic mean in absolute campesterol level, and carriers of ABCG8 T400K in 36% of the population had a 2% lower genotypic mean. Login to comment
107 Carriers of ABCG8 D19H in 10% of the population had a 31% lower genotypic mean in absolute campesterol level, and carriers of ABCG8 T400K in 36% of the population had a 2% lower genotypic mean. Login to comment

PMID: 15331430 [PubMed] Chan DC et al: "ATP-binding cassette transporter G8 gene as a determinant of apolipoprotein B-100 kinetics in overweight men."

No. Sentence Comment

38 Plasma lathosterol, sitosterol, and campesterol concentrations were measured by gas-liquid chromatography and expressed in mmol/Lϫ102 per mol/L cholesterol.13,14 ABCG8 (T400K, D19H) and ApoE Genotyping ABCG8 (exon 1 D19H, exon 8 T400K) genotypes were determined by polymerase chain reaction amplification using as forward primer 5Ј AGG AAA CAG AGT GAA GAC ACT GG 3Ј and as reverse primer 5Ј AGA AAG GTT TGA TTT CTC CTA CCC 3Ј (T400K); and for D19H forward primer 5Ј ACA CCT GTG TGG AAA GGT AAG GT 3Ј and reverse primer 5Ј GCG GGT trichloroacetic acid GTA ATA AAA TGA CAG 3Ј as described by Hubacek et al.10 ApoE genotype was determined as described by Hixson and Vernier.15 Statistical Analysis All analyses were performed using SPSS 10.1 (SPSS). Login to comment
48 Allele frequencies of T400K were 0.86 (wild-type) and 0.14 (variant) and D19H were 0.92 (wild-type) and 0.08 (variant). Login to comment
49 Significant linkage disequilibrium was not found between T400K and D19H (DЈϭ0.44; Pϭ0.32). Login to comment
67 Discussion This is the first study to demonstrate that ABCG8 (T400K) genotype may determine the metabolism of apoB in overweight/obese subjects. Our major finding was that compared with TT, ABCG8 TK individuals had lower VLDL-apoB PR and higher LDL production and FCRs. Login to comment
35 Plasma lathosterol, sitosterol, and campesterol concentrations were measured by gas-liquid chromatography and expressed in mmol/Lϫ102 per mol/L cholesterol.13,14 ABCG8 (T400K, D19H) and ApoE Genotyping ABCG8 (exon 1 D19H, exon 8 T400K) genotypes were determined by polymerase chain reaction amplification using as forward primer 5Ј AGG AAA CAG AGT GAA GAC ACT GG 3Ј and as reverse primer 5Ј AGA AAG GTT TGA TTT CTC CTA CCC 3Ј (T400K); and for D19H forward primer 5Ј ACA CCT GTG TGG AAA GGT AAG GT 3Ј and reverse primer 5Ј GCG GGT trichloroacetic acid GTA ATA AAA TGA CAG 3Ј as described by Hubacek et al.10 ApoE genotype was determined as described by Hixson and Vernier.15 Statistical Analysis All analyses were performed using SPSS 10.1 (SPSS). Login to comment
45 Allele frequencies of T400K were 0.86 (wild-type) and 0.14 (variant) and D19H were 0.92 (wild-type) and 0.08 (variant). Login to comment
46 Significant linkage disequilibrium was not found between T400K and D19H (DЈϭ0.44; Pϭ0.32). Login to comment
64 Discussion This is the first study to demonstrate that ABCG8 (T400K) genotype may determine the metabolism of apoB in overweight/obese subjects. Our major finding was that compared with TT, ABCG8 TK individuals had lower VLDL-apoB PR and higher LDL production and FCRs. Login to comment

PMID: 17495606 [PubMed] Levy E et al: "Intestinal cholesterol transport proteins: an update and beyond."

No. Sentence Comment

100 On the other hand, patients with primary hypercholesterolemia, according to NCEP,were associated with a specific ABCB1 haplotype, suggesting this polymorphism may contribute to increased plasma cholesterol and LDL levels [42].ABCG8(A632V,T400K,Y54C)andABCG5(Q604E) variants, however, are likely to be important forthe genetic determination of plasma cholesterol levels, probably via their influence on intestinal absorption and biliary secretion [43-45]. Login to comment

PMID: 17626266 [PubMed] Grunhage F et al: "Increased gallstone risk in humans conferred by common variant of hepatic ATP-binding cassette transporter for cholesterol."

No. Sentence Comment

94 In contrast to ABCG8 D19H, no significant single-point linkage was detected for the other ABCG5/G8 SNPs (p.E604Q, p.Y54C, p.T400K, p.A632V). Login to comment
52 Forgenotyping,weselectedfunctionallyrelevantnonsyn- onymous coding single-nucleotide polymorphisms (SNPs) of the ABCG5/G8 genes (Fig. 1): ABCG5 rs6720173 ϭ c.1810GϾC(p.E604Q);ABCG8rs11887534ϭc.55GϾC (p.D19H), rs4148211 ϭ c.161AϾG (p.Y54C), rs4148217 ϭ c.1199CϾA (p.T400K), and rs6544718 ϭ c.1895CϾT (p.A632V).22,23,25,28,29 All SNPs were genotyped using solution-phase hybridization reactions with 5Ј-nuclease and fluorescence detection (TaqMan assays) in a 7300 Real-Time polymerase chain reaction (PCR) system (Applera, Norwalk, CT). Login to comment

PMID: 18408466 [PubMed] Hoblinger A et al: "Genetics of biliary tract diseases: new insights into gallstone disease and biliary tract cancers."

No. Sentence Comment

21 Of note, this variant was also a susceptibility factor for gallstones in Chilean Hispanics [18 ] and yet another ABCG8 variant (T400K) may affect the risk of gallstone disease among Chinese males [20]. Login to comment

PMID: 19306529 [PubMed] Sabeva NS et al: "The ABCG5 ABCG8 sterol transporter and phytosterols: implications for cardiometabolic disease."

No. Sentence Comment

123 In this same cohort, the presence of both D19H and T400K increased risk of coronary heart disease and cardiovascular disease . Login to comment
126 Although the T400K polymorphism in ABCG8 influences the cholesterol-lowering effect of phytosterol supplementation, efficacy is independent of baseline plant sterol levels as well as cholesterol intake [31,34,35]. Login to comment

PMID: 20529992 [PubMed] Teupser D et al: "Genetic regulation of serum phytosterol levels and risk of coronary artery disease."

No. Sentence Comment

55 These included SNP rs4245791, which had initially violated quality criteria (call rate and Hardy-Weinberg equilibrium) on the 500K Array Set due to misgenotyping, and the 2 coding SNPs rs11887534 (D19H) and rs4148217 (T400K) not present on the 500K Array Set with known associations with serum phytosterol levels.9 SNPs were genotyped using the Sequenom assay. Login to comment
49 These included SNP rs4245791, which had initially violated quality criteria (call rate and Hardy-Weinberg equilibrium) on the 500K Array Set due to misgenotyping, and the 2 coding SNPs rs11887534 (D19H) and rs4148217 (T400K) not present on the 500K Array Set with known associations with serum phytosterol levels.9 SNPs were genotyped using the Sequenom assay. Login to comment
48 These included SNP rs4245791, which had initially violated quality criteria (call rate and Hardy-Weinberg equilibrium) on the 500K Array Set due to misgenotyping, and the 2 coding SNPs rs11887534 (D19H) and rs4148217 (T400K) not present on the 500K Array Set with known associations with serum phytosterol levels.9 SNPs were genotyped using the Sequenom assay. Login to comment

PMID: 20594224 [PubMed] Siddapuram SP et al: "Hepatic cholesterol transporter ABCG8 polymorphisms in gallstone disease in an Indian population."

No. Sentence Comment

3 Studies have identified single nucleotide polymorphisms (SNP) D19H and T400K in the cholesterol transporter gene ATP-binding cassette, subfamily G, member 8 (ABCG8) in patients with cholesterol gallstones. Login to comment
4 The aim of this study was to analyze the relationship between D19H and T400K polymorphisms in the ABCG8 gene and GSD in an Indian population, and the effects of these polymorphisms on cholesterol levels in sera and bile. Login to comment
7 The genotype of SNP D19H and T400K of ABCG8 was analyzed in 226 patients and 222 control samples. Login to comment
8 SNP D19H was analyzed by direct sequencing, and SNP T400K genotyping was assayed by the amplification refractory mutation system-polymerase chain reaction. Login to comment
9 Results: There was no significant difference in the allelic distribution of SNP T400K between the GSD and gallstone-free groups (P > 0.05), but the distribution of the SNP variant, D19H, was significantly higher (P = 0.017, odds ratio = 2.274) in patients compared to controls. Login to comment
11 Conclusion: SNP D19H, but not SNP T400K, in the ABCG8 gene is significantly associated with GSD in an Indian population. Login to comment
18 Principally, gallstones are composed of cholesterol monohydrate crystals.14 Previous studies have found that the single nucleotide polymorphism (SNP) D19H of ABCG8 was stronger in patients with cholesterol gallstones (odds ratio =3.3), suggesting that H19 might be associated with more efficient transport of cholesterol into the bile; SNP T400K is found in Chinese males.15,16 The present study was undertaken to investigate, for the first time, the relationship between these two polymorphisms and GSD within an Indian population and to analyze their association with cholesterol in sera and bile. Login to comment
26 ABCG8 T400K analysis SNP T400K genotyping was assayed by tetra-primer ARMS-PCR that adopts principles of both the tetra-primer PCR method and the ARMS. Login to comment
42 The PCR reaction mixture and PCR conditions described for T400K were similar to SNP D19H, with the exception of the annealing temperature, which was 68°C. Login to comment
45 Low-density lipoprotein (LDL) cholesterol was Table 1 Polymerase chain reaction primer details of single nucleotide polymorphisms D19H and T400K of the ABCG8 gene Polymorphisms Primer sequence Annealing temperature Amplicon size D19H Forward primer: 68°C 306 bp 5'-ACTCGCAGCCCTGTTTCTAG 3' Reverse primer: 5'-GATGGGCTTTCACCTTGTTG 3' T400K Forward inner primer (A allele): 5'-ATGCCTGGGGCGGTGCAGCAGTTCAA3' Reverse inner primer (C allele): 5'-AAATGACAGATAATTACCGGATCAGCGCCG3' Forward outer primer (5'-3'): 5'-ACATCCCCTGCTTGCAGTGGACCTGACC3' Reverse outer primer (5'-3'): 5'-AGATGGGCTTTCACCTTGTTGCCCAGGC3' 65°C 287 bp (A allele) 365 bp (C allele) 596 bp (from two outer primers) Genetic basis of gallstone disease in India SP Siddapuram et al. 1094 Journal of Gastroenterology and Hepatology 25 (2010) 1093-1098 calculated using the Friedewald formula: T/5 = very low density lipoprotein (VLDL) TC-(HDL + VLDL). Login to comment
54 2 3 4 5 6 7 8 9 10 11 12 13 14 M 596 bp 365 bp 287 bp Figure 1 Electrophoresis of single nucleotide polymorphism T400K amplification refractory mutation system-polymerase chain reaction products. Login to comment
55 Tetra-primer-based genotyping of the ABCG8 T400K polymorphism: 596-bp product is common to both mutant and wild-type alleles; 365-bp product is specific for wild-type alleles; and 287-bp product is specific for mutant alleles. Login to comment
69 Distribution of SNP T400K and D19H between the GSD and GSF groups In the present study, 226 patients and 222 controls were analyzed for two SNP: T400K and D19H of the ABCG8 gene. Login to comment
71 No significant difference was observed in the distribution of genotypic frequency of SNP T400K when compared to the GSD and GSF groups (P = 0.520), whereas the distribution of SNP D19H showed a significant difference between the patient and control groups (P = 0.046). Login to comment
74 No significant difference was noted in any allele distribution of SNP T400K between the GSD and GSF groups, but the distribution of the heterozygous variant allele of SNP D19H was significantly higher (P = 0.048, OR = 2.219, CI: 1.054-4.672) in the GSD patients compared to the GSF individuals (Table 4). Login to comment
76 Thus, in the present study, allelic distribution infers that the T400K genotype might not be associated with gallstone formation in our cohort, whereas SNP D19H was shown to be associated with the disease. Login to comment
78 A strong association between elevated bile cholesterol and SNP D19H (P < 0.001) was observed in the analysis, where the mean bile cholesterol for SNP T400K (heterozygous + homozygous variants) was 155.13 mg/dL, and that of SNP D19H (heterozygous + homozygous variants) was 385.37 mg/dL Table 2 Demography and plasma lipid profile of gallstone disease and gallstone-free individuals Parameter Patient group Control group P-value Mean SD Mean SD Age (years) 45.88 14.840 39.92 11.864 0.063 BMI (kg/m2 ) 26.430 10.830 24.727 5.003 0.018 Plasma CH CH (mg/dL) 182.623 55.996 224.979 0.352 0.0001 HDL-C (mg/dL) 32.168 9.130 39.081 9.771 0.0001 LDL-C (mg/dL) 120.305 43.311 138.896 39.712 0.0001 TG (mg/dL) 149.672 83.945 147.207 89.148 0.324 BMI, body mass index; CH, cholesterol; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; SD, standard deviation; TG, triglycerides. Login to comment
79 Table 3 Frequency of genotype distribution of single nucleotide polymorphisms T400K and D19H between gallstone disease and gallstone-free individuals Single nucleotide polymorphisms of ABCG8 Wild type Heterozygous Homozygous P-value T400K (patients/controls) 69.47%/67.56% 29.20%/31.98% 1.32%/0.45% 0.520 D19H (patients/controls) 86.72%/93.69% 10.17%/4.95% 3.09%/1.35% 0.046 Table 4 Statistical analysis of single nucleotide polymorphisms T400K and D19H of ABCG8 between the gallstone disease and gallstone-free groups for possible alleles Allele P-value c2 -test Odds ratio 95% confidence interval T400K TT vs TK 0.608 0.33 0.888 0.594-1.329 TT vs. Login to comment
84 Discussion Genotyping The aim of present study was to determine whether SNP T400K and D19H of the ABCG8 gene were associated with GSD. Login to comment
87 A previous study mapped a susceptibility locus for gallstone formation to the murine ortholog of the ABCG5/ABCG8 genes, using a quantitative trait locus analysis in experimental crosses of inbred mouse strains.20 A recent linkage study of 715 individuals from 39 Mexican-American families with gallstone disease provided suggestive evidence of linkage to gallbladder disease on chromosome 2p21, the site of the ABCG5/ABCG8 genes.21 A genetic association study demonstrated that the ABCG8 D19H variant was significantly associated with the presence of gallstones in cases; the 19H (c.55C) allele was significantly more common in cases than in controls (OR = 3.018, P = 0.017).15 Carriers of the 19H allele, whether homozygous or heterozygous, were significantly overrepresented in the cases compared with the controls (OR = 3.118, P = 0.019), and in a case-control study, heterozygous 19H carriers (OR = 2.2) indicated a robust association of ABCG8 with gallstones in different populations.22 Previous studies have indicated the role of T400K polymorphisms in lipid parameters and the formation of gallstones.12 The frequencies of the K400 allele (12.4% vs 6.2%, P = 0.018) of ABCG8, and the TK/KK genotype (24.8% vs 12.4%, P = 0.025) were significantly higher in GSD groups than in GSF groups.23 In contrast, the present study frequencies of SNP genotypes T400K were not significantly different (Table 4) between patients and controls. Login to comment
88 Demography and lipid profile Several studies have reported that gallstones are more common in women than men and at all age groups, as the present study has indicated.24 In the present study, of the 226 patients, 56.7% (128) were females and 43.3% (98) were males. The demographic analysis in the present study showed a significantly higher BMI in GSD patients, which supports an earlier study.16 Hypersecretion of cholesterol from the liver and supersaturation of bile with cholesterol represents the common defects in patients with cholesterol gallstones.25,26 Another study suggested that the ABCG8 T400K polymorphism affects the reduction in total plasma cholesterol and LDL cholesterol levels.23 In earlier studies, researchers found a lower concentration of serum campesterol in 19H carriers, and hypothesized that the H allele leads to increased ABCG8transporter activity.10 Further, this hypothesis was supported by the observation that 19H carriership is associated with lower total serum cholesterol levels.27 Perhaps the basic function of both the T400K and D19H polymorphisms is the same to regulate cholesterol transport. Login to comment
92 In conclusion, our study shows for the first time in India that the D19H SNP of ABCG8 was shown to have a strong association with GSD, whereas the T400K SNP of ABCG8 was not found to be significant with the disease in the study cohort. Login to comment
96 Our sincere thanks to Dr Jamuna Cherri (Asian Healthcare Foundation) for her constant help in the plasma lipid profile analysis. We are extremely thankful to Ms Mary Thomas and Ms Vasantha Rani (Asian Healthcare Foundation) for 3040N = Group D19hT400k Bilecholesterol 700 600 500 400 300 200 100 0 Figure 3 Distribution of bile cholesterol in gallstone patients between mutant alleles of single nucleotide polymorphisms T400K and D19H of ABCG8. Login to comment
25 DNA was isolated from lymphocytes using standard methods.17 Two SNP, rs 4148217 = c.1199C>A (p.T400K) and rs 11887534 = c.55G>C (p.D19H) in the ABCG8 gene were analyzed by the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR; tetra-primer based) and direct sequencing methods, respectively. Login to comment

PMID: 21039838 [PubMed] Srivastava A et al: "Role of ABCG8 D19H (rs11887534) variant in gallstone susceptibility in northern India."

No. Sentence Comment

70 Various recent studies have identified the ABCG8 D19H variant as the first common susceptibility factor for cholesterol gallstones in humans.16,34,35 However, Wang et al.17 showed that the ABCG8 T400K polymorphism, not D19H, might play a role in the lipid metabolism and formation of gallstones in the Chinese population. Login to comment

PMID: 20170916 [PubMed] Abellan R et al: "Association of selected ABC gene family single nucleotide polymorphisms with postprandial lipoproteins: results from the population-based Hortega study."

No. Sentence Comment

149 Regarding the Y54H polymorphism, diverging results have been observed in previous studies for associations with lipid levels [13,14,16,18,19]; these divergences in the results could be related with the degree of the reduction of total plasma cholesterol and LDLc with dietary changes [13]. Login to comment
151 However, Wang et al. [17] found higher but not significant plasma LDLc levels for carriers of the less frequent K allele of ABCG8 T400K, which was in strong linkage disequilibrium with the SNP Y54C of ABCG8. Login to comment

PMID: 22271308 [PubMed] Portincasa P et al: "Intestinal absorption, hepatic synthesis, and biliary secretion of cholesterol: where are we for cholesterol gallstone formation?"

No. Sentence Comment

32 The ABCG8 p.D19H and p.T400K coding variants might play a role as putative susceptibility variants for gallstone formation in humans.14-16 Despite much evidence in this respect, the authors could not confirm such an interesting hypothesis, possibly due to the small cohort size. Login to comment

PMID: 22213168 [PubMed] Krawczyk M et al: "Phytosterol and cholesterol precursor levels indicate increased cholesterol excretion and biosynthesis in gallstone disease."

No. Sentence Comment

47 p.Y54C (rs4148211, c__29535502_10), p.T400K (rs4148217, c__375061_10), and p.A632V (rs6544718, c__25642779_10) variants, as described in Supporting Methods. Login to comment
48 The ABCG8 p.D19H and p.T400K coding variants have been described previously as putative susceptibility variants for gallstone formation in humans.13-15 Measurement of Sterols and Clinical Chemical Parameters. Login to comment

PMID: 22297561 [PubMed] Wang G et al: "Macrothrombocytopenia/Stomatocytosis specially associated with phytosterolemia."

No. Sentence Comment

72 In addition, several neutral polymorphisms, such as Q604E of ABCG5, C54Y, T400K, and A632V of ABCG8 which had been previously described were also found in this study (not shown). Login to comment
71 In addition, several neutral polymorphisms, such as Q604E of ABCG5, C54Y, T400K, and A632V of ABCG8 which had been previously described were also found in this study (not shown). Login to comment

PMID: 22655090 [PubMed] Li Q et al: "ATP-binding cassette transporter G5 and G8 polymorphisms and several environmental factors with serum lipid levels."

No. Sentence Comment

182 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment
217 The other ABCG5/G8 SNPs (Q604E, Y54C, T400K and A632V) did not show any significant interactions with the CYP7A1 polymorphism. Login to comment
218 No association was observed between ABCG8 T400K and total and LDL-C levels [32-34,36,38-41]. Login to comment
226 The remaining SNPs (Q604E, D19H, Y54C, and T400K) were not associated with plasma lipid levels [60]. Login to comment
241 020 0.062 2.509 0.012 Systolic blood pressure 0.001 0.001 0.066 2.590 0.010 ApoA1/ApoB Waist circumference 20.019 0.002 20.198 27.862 0.000 Age 20.005 0.001 20.089 23.544 0.000 Han TC Waist circumference 0.019 0.005 0.131 3.767 0.000 Age 0.009 0.003 0.126 3.443 0.001 Alcohol consumption 0.302 0.057 0.179 5.286 0.000 Diastolic blood pressure 0.017 0.004 0.168 4.661 0.000 Blood glucose 0.066 0.024 0.095 2.723 0.007 TG Waist circumference 0.075 0.013 0.254 5.661 0.000 Cigarette smoking 0.805 0.165 0.185 4.889 0.000 Blood glucose 0.265 0.049 0.186 5.407 0.000 Diastolic blood pressure 0.030 0.007 0.147 4.120 0.000 Age 20.017 0.005 20.113 23.114 0.002 Alcohol consumption 0.269 0.132 0.078 2.040 0.042 Body mass index 20.065 0.030 20.096 22.157 0.031 HDL-C Waist circumference 20.011 0.002 20.155 24.279 0.000 Gender 0.130 0.046 0.120 2.825 0.005 Alcohol consumption 0.111 0.034 0.138 3.317 0.001 LDL-C Age 0.012 0.002 0.212 6.219 0.000 Body mass index 0.026 0.012 0.101 2.222 0.027 Waist circumference 0.013 0.005 0.115 2.471 0.014 Cigarette smoking 20.310 0.072 20.187 24.227 0.000 hypercholesterolaemic Japanese subjects, Miwa et al. [42] reported that carriers of the ABCG8 M429V or a specific haplotype (wild-type allele of ABCG5 Q604E, and wild-type alleles of ABCG8 C54Y, T400K, and M429V) had higher cholesterol absorption efficiency than non-carriers. Login to comment
242 However, no difference was observed in serum lipid profiles in relation to common SNPs studied previously in Caucasian populations (ABCG5 Q604E and ABCG8 A632V, T400K, D19H and C54Y). Login to comment
244 Interestingly, in 1046 Chinese, Chen et al. [43] observed that the heterozygote of ABCG8 D19H had higher serum total and LDL-C levels than homozygote DD, which is opposite to the effect observed in Caucasian populations. Login to comment
246 No association with ABCG8 C54Y and T400K regarding total and LDL-C levels was observed. Login to comment
254 Recently, in 845 self-identified Puerto Ricans from Boston, Junyent et al. [38] reported that ABCG5/G8 (i7892T.C, rs4131229; 5U145A.C, rs3806471; Y54C; T400K) SNPs were significantly associated with HDL-C concentrations. Login to comment
258 Also, for ABCG8 T400K, smokers, but not nonsmokers, homozygous for the T allele displayed lower HDL-C levels. Login to comment
264 Recently, significant gene-gene interactions for HDL-C were found between ABCG8 (5U145 A.C, T54C A.G, T400K C.A) SNPs and ABCA1_i48168 G.A genetic variant, in which carriers of the 5U145C and 54C alleles, and homozygotes for the T400 allele at ABCG8 genetic variants displayed lower HDL-C concentrations than homozygotes for the 5U145A and T54 alleles, and heterozygotes for the 400K allele at ABCG8 SNPs, only if they were also homozygous for the minor allele (A) at the aforementioned ABCA1 SNP [63]. Login to comment
180 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment
215 The other ABCG5/G8 SNPs (Q604E, Y54C, T400K and A632V) did not show any significant interactions with the CYP7A1 polymorphism. Login to comment
216 No association was observed between ABCG8 T400K and total and LDL-C levels [32-34,36,38-41]. Login to comment
224 The remaining SNPs (Q604E, D19H, Y54C, and T400K) were not associated with plasma lipid levels [60]. Login to comment
239 020 0.062 2.509 0.012 Systolic blood pressure 0.001 0.001 0.066 2.590 0.010 ApoA1/ApoB Waist circumference 20.019 0.002 20.198 27.862 0.000 Age 20.005 0.001 20.089 23.544 0.000 Han TC Waist circumference 0.019 0.005 0.131 3.767 0.000 Age 0.009 0.003 0.126 3.443 0.001 Alcohol consumption 0.302 0.057 0.179 5.286 0.000 Diastolic blood pressure 0.017 0.004 0.168 4.661 0.000 Blood glucose 0.066 0.024 0.095 2.723 0.007 TG Waist circumference 0.075 0.013 0.254 5.661 0.000 Cigarette smoking 0.805 0.165 0.185 4.889 0.000 Blood glucose 0.265 0.049 0.186 5.407 0.000 Diastolic blood pressure 0.030 0.007 0.147 4.120 0.000 Age 20.017 0.005 20.113 23.114 0.002 Alcohol consumption 0.269 0.132 0.078 2.040 0.042 Body mass index 20.065 0.030 20.096 22.157 0.031 HDL-C Waist circumference 20.011 0.002 20.155 24.279 0.000 Gender 0.130 0.046 0.120 2.825 0.005 Alcohol consumption 0.111 0.034 0.138 3.317 0.001 LDL-C Age 0.012 0.002 0.212 6.219 0.000 Body mass index 0.026 0.012 0.101 2.222 0.027 Waist circumference 0.013 0.005 0.115 2.471 0.014 Cigarette smoking 20.310 0.072 20.187 24.227 0.000 hypercholesterolaemic Japanese subjects, Miwa et al. [42] reported that carriers of the ABCG8 M429V or a specific haplotype (wild-type allele of ABCG5 Q604E, and wild-type alleles of ABCG8 C54Y, T400K, and M429V) had higher cholesterol absorption efficiency than non-carriers. Login to comment
240 However, no difference was observed in serum lipid profiles in relation to common SNPs studied previously in Caucasian populations (ABCG5 Q604E and ABCG8 A632V, T400K, D19H and C54Y). Login to comment
252 Recently, in 845 self-identified Puerto Ricans from Boston, Junyent et al. [38] reported that ABCG5/G8 (i7892T.C, rs4131229; 5U145A.C, rs3806471; Y54C; T400K) SNPs were significantly associated with HDL-C concentrations. Login to comment
255 Carriers of the minor alleles at ABCG5/G8 (Q604E, D19H, i14222 A.G, rs6709904) SNPs displayed lower levels of HDL-C only if they were smokers. Login to comment
256 Also, for ABCG8 T400K, smokers, but not nonsmokers, homozygous for the T allele displayed lower HDL-C levels. Login to comment
262 Recently, significant gene-gene interactions for HDL-C were found between ABCG8 (5U145 A.C, T54C A.G, T400K C.A) SNPs and ABCA1_i48168 G.A genetic variant, in which carriers of the 5U145C and 54C alleles, and homozygotes for the T400 allele at ABCG8 genetic variants displayed lower HDL-C concentrations than homozygotes for the 5U145A and T54 alleles, and heterozygotes for the 400K allele at ABCG8 SNPs, only if they were also homozygous for the minor allele (A) at the aforementioned ABCA1 SNP [63]. Login to comment
181 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment
225 The remaining SNPs (Q604E, D19H, Y54C, and T400K) were not associated with plasma lipid levels [60]. Login to comment
251 Recently, in 845 self-identified Puerto Ricans from Boston, Junyent et al. [38] reported that ABCG5/G8 (i7892T.C, rs4131229; 5U145A.C, rs3806471; Y54C; T400K) SNPs were significantly associated with HDL-C concentrations. Login to comment
261 Recently, significant gene-gene interactions for HDL-C were found between ABCG8 (5U145 A.C, T54C A.G, T400K C.A) SNPs and ABCA1_i48168 G.A genetic variant, in which carriers of the 5U145C and 54C alleles, and homozygotes for the T400 allele at ABCG8 genetic variants displayed lower HDL-C concentrations than homozygotes for the 5U145A and T54 alleles, and heterozygotes for the 400K allele at ABCG8 SNPs, only if they were also homozygous for the minor allele (A) at the aforementioned ABCA1 SNP [63]. Login to comment

PMID: 21664501 [PubMed] Keller S et al: "Increased plasma plant sterol concentrations and a heterozygous amino acid exchange in ATP binding cassette transporter ABCG5: a case report."

No. Sentence Comment

3 The resulting gene analysis for ATP binding cassette transporter G5/G8 (ABCG5/G8) revealed a heterozygous polymorphism in ABCG8 (Thr400Lys, rs4148217), which the proband had inherited from his father. Login to comment
50 A heterozygous nucleotide change (c.1199C > A; NM_022437.2) resulting in an amino acid exchange (Thr400Lys, ACG400AAG; NP_071882.1) was found for the ABCG8 gene. Login to comment
53 Koeijvoets et al. [12] did not find an association between the polymorphism Thr400Lys in ABCG8 and cardiovascular endpoints. Login to comment

PMID: 20172523 [PubMed] Garcia-Rios A et al: "Genetic variations at ABCG5/G8 genes modulate plasma lipids concentrations in patients with familial hypercholesterolemia."

No. Sentence Comment

22 Another study examined the relationship between SNPs in the ABCG8 gene (D19H and T400K) and plasma cholesterol concentrations in patients with heterozygous FH [12]. Login to comment
145 In this context, Koeijvoets et al. [12] explored the effect of two common ABCG8 (D19H and T400K) SNPs on lipids and CVD in 2,012 patients with heterozygous FH but did not find significant associations with plasma lipid concentrations. Login to comment
150 On the other hand, Miwa et al. [11] reported no significant associations between three ABCG5/G8 (Q604E, C54Y and T400K) SNPs and serum lipid concentrations in 100 Japanese primary hypercholesterolaemic patients. Login to comment
151 Consistent with both studies [11,12] we did not find associations between D19H, T400K and C54Y SNPs and plasma lipid concentrations. Login to comment
152 However, in contrast to Miwa et al. our data showed association between Q604E SNP and VLDL-C and TG concentrations. Login to comment
154 Additionally, Santosa et al. [10] examined the association of four SNPs at ABCG5 (Q604E, i7892, i18429 and M216) and four ABCG8 (C54Y, D19H, i14222 and T400K) with plasma lipids concentrations in 35 young women with mildly hypercholesterolemia. Login to comment
155 They found that C54Y and Q604E SNPs were associated with the response of cholesterol metabolism to weight loss. Login to comment
146 In this context, Koeijvoets et al. [12] explored the effect of two common ABCG8 (D19H and T400K) SNPs on lipids and CVD in 2,012 patients with heterozygous FH but did not find significant associations with plasma lipid concentrations. Login to comment
21 Another study examined the relationship between SNPs in the ABCG8 gene (D19H and T400K) and plasma cholesterol concentrations in patients with heterozygous FH [12]. Login to comment
143 In this context, Koeijvoets et al. [12] explored the effect of two common ABCG8 (D19H and T400K) SNPs on lipids and CVD in 2,012 patients with heterozygous FH but did not find significant associations with plasma lipid concentrations. Login to comment
148 On the other hand, Miwa et al. [11] reported no significant associations between three ABCG5/G8 (Q604E, C54Y and T400K) SNPs and serum lipid concentrations in 100 Japanese primary hypercholesterolaemic patients. Login to comment
149 Consistent with both studies [11,12] we did not find associations between D19H, T400K and C54Y SNPs and plasma lipid concentrations. Login to comment

PMID: 19932478 [PubMed] Lu Y et al: "The potential influence of genetic variants in genes along bile acid and bile metabolic pathway on blood cholesterol levels in the population."

No. Sentence Comment

1748 Several polymorphisms in ABCG5 (Q604E, rs6720173) and ABCG8 (T400K, rs4148217; D19H, rs11887534; A632V, rs6544718; and Y54C, rs4148211) have been found to be associated with several facets of cholesterol metabolism, including cholesterol level, cholesterol kinetics, and individual responsiveness of blood cholesterol to dietary and pharmaceutical intervention [41]. Login to comment
1773 No association was observed between T400K of the ABCG8 gene and total and LDL cholesterol levels [44,45,47-50,53,55]. Login to comment
1785 Overall, no consistent results on effects of T400K, A632V and Y54C in ABCG8 gene on blood cholesterol levels and cholesterol metabolic kinetics were reported so far. Login to comment
1787 No modulating effect was observed from T400K, A632V or Y54C on cholesterol lowering response to atorvastatin [25,26]. Login to comment
1795 In 100 hypercholesterolaemic Japanese subjects, Miwa et al. [56] reported that carriers of the M429V variant of ABCG8 or a specific haplotype (wild-type allele of Q604E ABCG5, and wild-type allele of C54Y, wild-type allele of T400K, mutant allele of M429V ABCG8) had higher cholesterol absorption efficiency than non-carriers. Login to comment
1796 However, no difference was observed in serum lipid profiles in relation to common polymorphisms studied previously in Caucasian populations [ABCG5 (Q604E) and ABCG8 (A632V, T400K, D19H and C54Y)]. Login to comment
1800 No association with C54Y and T400K of ABCG8 regarding total and LDL cholesterol levels was observed. Login to comment
1802 Recently, in 845 self-identified Puerto Ricans from Boston, Junyent et al. [47] reported that ABCG5/G8 (i7892T > C, rs4131229; 5U145A > C, rs3806471; Y54C; T400K) SNPs were significantly associated with HDL-C concentrations. Login to comment
1806 Also, for ABCG8 T400K, smokers, but not nonsmokers, homozygous for the T allele displayed lower HDL cholesterol levels. Login to comment
1862 Gylling et al. [45] 262 mildly to moderately hypercholesterolemic Finnish subjects No difference in TC, LDL-C and HDL-C Junyent et al. [47] 845 self-identified Puerto Ricans No difference in TC and LDL-C, but K allele carriers had higher HDL-C than TT Santosa et al. [48] 42 overweight/obese Canadian women No difference in TC, LDL-C and HDL-C Acalovschi et al. [49] 68 Romanian siblings with gallstone disease No difference in TC and HDL-C Plat et al. [50] 112 healthy Dutch volunteers No difference in LDL-C and HDL-C Koeijvoets et al. [53] 2012 Dutch patients with heterozygous familial hypercholesteroemia No difference in TC, LDL-C and HDL-C Chan et al. [55] 47 nonsmoking overweight/obese Australian men No difference in TC, LDL-C and HDL-C Hubacek et al. [46] 285 Czech participants A smaller decrease in TC and LDL-C in K allele carriers than TT after changing dietary habits (less meat and more vegetable) Berge et al. [44] 143 healthy American Caucasians Lower cholesterol absorption marker sterol (serum cholesterol adjusted sitosterol levels) and higher cholesterol synthesis marker sterol (serum cholesterol adjusted desmosterol and lathosterol levels) in K allele carriers than TT Plat et al. [50] 112 healthy Dutch volunteers Higher absorption in campesterol and sitosterol and a stronger inhibitor effect of plant stanol ester on campesterol and sitosterol absorption in TT than K allele carriers Gylling et al. [45] 262 mildly to moderately hypercholesterolemic Finnish subjects No difference in plasma cholesterol absorption and synthesis markers Kajinami et al. [25] 337 hypercholesterolemic subjects, mainly Caucasians No modulating effect from T400K on cholesterol lowering response to atorvastatin Y.Luetal./Atherosclerosis210(2010)14-27 Table 1(Continued). Login to comment

PMID: 19019257 [PubMed] Gylling H et al: "Long-term consumption of plant stanol and sterol esters, vascular function and genetic regulation."

No. Sentence Comment

155 The present results differ from a previous study conducted in healthy subjects, in whom the serum plant sterol response to stanol esters was associated with the ABCG8 T400K genotype(23) . Login to comment
176 During the intervention the T400K polymorphic site of ABCG8 was associated with the increase in IMT. Login to comment
179 Since at baseline the same T400K polymorphic site of ABCG8 separated subjects with a profile of cholesterol metabolism characteristic for the metabolic syndrome, we assume that low cholesterol absorption and high synthesis as part of the metabolic syndrome is unfavourable for the progression of IMT. Login to comment

PMID: 19217458 [PubMed] Gylling H et al: "The metabolism of plant sterols is disturbed in postmenopausal women with coronary artery disease."

No. Sentence Comment

34 Sequence variations in D19H [18,19] and T400K [18] of ABCG8 were associated with low serum plant sterol [18,19] and high serum synthesis marker [19] ratios to cholesterol in earlier studies. Login to comment

PMID: 19071091 [PubMed] Jiang ZY et al: "Increased NPC1L1 and ACAT2 expression in the jejunal mucosa from Chinese gallstone patients."

No. Sentence Comment

4 The frequency of two SNPs in the ABCG8 gene (Y54C and T400K) was determined by allelic discrimination. Login to comment
7 No correlations were observed between patients carrying the different genotypes for Y54C or T400K and their mRNA levels for ABCG5 or ABCG8. Login to comment
55 Single nucleotide polymorphism (SNP) analysis of the polymorphic sites Y54C and T400K in the ABCG8 gene were determined by allelic discrimination using intestinal cDNA as template. Login to comment
58 T400K: forward primer: GCC TCC CGA GTC CTA CGA A; reverse primer: CGG AAG TCG TTG GAA ATC TGA C. Login to comment
85 for the Y54C and T400K polymorphisms in ABCG8 gene in the GS and GSF patients. Login to comment
86 Previously, T400K had been shown to associate with gallstone disease in Chinese patients [24], but this material was too small to allow a similar evaluation. Login to comment
88 The campesterol and sitosterol levels were lower in subjects heterozygous or homozygous for the Y54C or the T400K polymorphism compared to individuals homozygous for the WT allele, but significance was only obtained for campesterol (Table 1, P < 0.05). Login to comment
101 (D) Comparison between mRNA levels of the genes ABCG5/G8, NPC1L1, and ACCAT2 in the individuals of the total material (GS + GSF) with reference to the T400K polymorphic site in the ABCG8 gene. Login to comment
102 Table 1 Plasma lipid and plant sterol levels in the total material with reference to the polymorphic sites Y54C and T400K in the ABCG8 gene (means ± SEM). Login to comment
126 T400K was overrepresented in a Chinese GS patient material [24], and we also concluded that individuals with this SNP showed lower levels of plasma campesterol. Login to comment

PMID: 18641716 [PubMed] Rudkowska I et al: "Association between non-responsiveness to plant sterol intervention and polymorphisms in cholesterol metabolism genes: a case-control study."

No. Sentence Comment

112 In general, results show that all subjects were homozygous for all ABCG5/G8 polymorphisms, except for 1 non-responder, who was heterozygous for A632V (rs6544718) and T400K (rs414817) in the ABCG8 transporters. Login to comment
114 Hubacek et al. (2004) showed that T400K in the ABCG8 gene associates with changes in lipid levels in males in response to reduced dietary animal fat and cholesterol intake. Login to comment
115 In particular, males had greater reductions of TC with the wild-type allele than with the mutant allele of the T400K in the ABCG8 gene. Login to comment
117 In addition, Plat et al. (2005) showed that cholesterol-standardized serum PS concentrations, as well as changes in serum PS concentrations after consumption of PS, were associated with the ABCG8 T400K genotype. Login to comment
118 However, similar to the present study, no associations were seen between any common variations in T400K with lipids responsiveness to PS intervention (Plat et al. 2005). Login to comment

PMID: 17612515 [PubMed] Wang Y et al: "ATP binding cassette G8 T400K polymorphism may affect the risk of gallstone disease among Chinese males."

No. Sentence Comment

2 To investigate a possible association between transporter gene polymorphism and gallstone formation, we examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) genes in patients with gallstone disease (GS). Login to comment
6 Results: 2 SNPs of ABCG8 gene (Y54C and T400K) showed strong linkage disequilibrium (D'=0.824, r2 =0.579). Login to comment
7 Male carriers of the less frequent K allele of ABCG8 T400K had a 2.31-fold elevated risk [95% confidence interval (CI) 1.12~4.76, P=0.023] for gallstone disease compared to male with the common genotype after the adjustment for age, body mass index. Login to comment
10 Conclusions: These findings indicate that the T400K polymorphism in ABCG8 may be associated with the incidence of gallstone disease in males. Login to comment
24 Of these variants, it is suggested that 5 non-synonymous single nucleotide polymorphisms (SNPs) in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) coding sequences may effect plasma plant sterol or cholesterol levels [11-14]. Login to comment
41 Four SNP sites in ABCG5 Q604E, ABCG8 Y54C, ABCG8 T400K, and ABCG8 A632V were assayed by PCR amplification and RFLP analysis, as previously described [10,11]. Login to comment
72 Table 2 Linkage disequilibrium in 5 common polymorphisms of ABCG5 and ABCG8 genes D' Locus Q604E D19H Y54C T400K A632V r2 Q604E - 0.368 0.007 0.477 0.087 D19H 0.009 - 0.843 0.718 1.000 Y54C 0.000 0.045 - 0.824 0.211 T400K 0.003 0.000 0.579 - 1.000 A632V 0.000 0.000 0.000 0.001 - D' and r2 were calculated from all 506 subjects in the study. Login to comment
79 Thus, only the Y54C and T400K SNPs showed strong linkage disequilibrium (D'N0.8, r2 N1/3) [19]. Login to comment
85 Table 4 Logistic regression analysis All Male Female OR 95% CI P OR 95% CI P OR 95% CI P T400K 1.17 0.73~1.87 NS 2.31 1.12~4.76 0.023 0.70 0.36~1.34 NS Age 0.99 0.97~1.00 NS 0.98 0.96~1.01 NS 0.98 0.96~1.00 0.074 BMI 1.15 1.08~1.23 b0.001 0.99 0.90~1.09 NS 1.30 1.19~1.43 b0.001 Gender 1.50 1.03~2.17 0.033 - - ABCG8 T400K genotypes were coded as 1=the TT genotype and 2=the TK+KK genotype. Login to comment
90 The risk for GS was 2.31 [95% CI 1.12~4.76; P=0.023] for male carrying the K400 allele of ABCG8 T400K, compared to T400 homozygotes after the adjustment for age and BMI. Login to comment
110 The results indicated that of the five most common polymorphisms in ABCG5 and ABCG8 genes, ABCG8 T400K may be associated with gallstone disease in males. Login to comment
115 A, Concentrations of total plasma cholesterol (T-CH), triglycerides (TG), high density lipoprotein cholesterol (HDL-C), and low density lipoprotein cholesterol (LDL-C) between the ABCG8 T400K genotypes in males (n=134). Login to comment
116 B, Concentration (A) of biliary total bile acids (BA), phospholipid (PL), and cholesterol (CH) between the ABCG8 T400K genotypes in males (n=37). Login to comment
125 Berge et al. [11] were the first to report that the ABCG8 D19H and T400K polymorphisms were associated with a lower concentration of plant sterols in both parents and their offspring. Login to comment
129 It was suggested that the ABCG8 T400K polymorphism influenced the reduction in total plasma cholesterol and LDL cholesterol levels in males, but not in females. Login to comment
131 Interestingly, our data showed an association of T400K polymorphism with gallstone disease in male only, a similar gender-specific relationship as in the Czech population. Login to comment
147 We speculated that a change from threonine to lysine in the male T400K polymorphism might play a potential role on ABCB4 expression, and thus influence phospholipid secretion. Login to comment
149 In conclusion, we have demonstrated that the T400K polymorphism in ABCG8 may play a role in the lipid metabolism and formation of gallstones, and may help to predict gallstone disease risk in males, at least within the Chinese population. Login to comment
73 Table 2 Linkage disequilibrium in 5 common polymorphisms of ABCG5 and ABCG8 genes D' Locus Q604E D19H Y54C T400K A632V r2 Q604E - 0.368 0.007 0.477 0.087 D19H 0.009 - 0.843 0.718 1.000 Y54C 0.000 0.045 - 0.824 0.211 T400K 0.003 0.000 0.579 - 1.000 A632V 0.000 0.000 0.000 0.001 - D' and r2 were calculated from all 506 subjects in the study. Login to comment
80 Thus, only the Y54C and T400K SNPs showed strong linkage disequilibrium (D'N0.8, r2 N1/3) [19]. Login to comment
86 Table 4 Logistic regression analysis All Male Female OR 95% CI P OR 95% CI P OR 95% CI P T400K 1.17 0.73~1.87 NS 2.31 1.12~4.76 0.023 0.70 0.36~1.34 NS Age 0.99 0.97~1.00 NS 0.98 0.96~1.01 NS 0.98 0.96~1.00 0.074 BMI 1.15 1.08~1.23 b0.001 0.99 0.90~1.09 NS 1.30 1.19~1.43 b0.001 Gender 1.50 1.03~2.17 0.033 - - ABCG8 T400K genotypes were coded as 1=the TT genotype and 2=the TK+KK genotype. Login to comment
91 The risk for GS was 2.31 [95% CI 1.12~4.76; P=0.023] for male carrying the K400 allele of ABCG8 T400K, compared to T400 homozygotes after the adjustment for age and BMI. Login to comment
111 The results indicated that of the five most common polymorphisms in ABCG5 and ABCG8 genes, ABCG8 T400K may be associated with gallstone disease in males. Login to comment
117 B, Concentration (A) of biliary total bile acids (BA), phospholipid (PL), and cholesterol (CH) between the ABCG8 T400K genotypes in males (n=37). Login to comment
126 Berge et al. [11] were the first to report that the ABCG8 D19H and T400K polymorphisms were associated with a lower concentration of plant sterols in both parents and their offspring. Login to comment
130 It was suggested that the ABCG8 T400K polymorphism influenced the reduction in total plasma cholesterol and LDL cholesterol levels in males, but not in females. Login to comment
132 Interestingly, our data showed an association of T400K polymorphism with gallstone disease in male only, a similar gender-specific relationship as in the Czech population. Login to comment
148 We speculated that a change from threonine to lysine in the male T400K polymorphism might play a potential role on ABCB4 expression, and thus influence phospholipid secretion. Login to comment
150 In conclusion, we have demonstrated that the T400K polymorphism in ABCG8 may play a role in the lipid metabolism and formation of gallstones, and may help to predict gallstone disease risk in males, at least within the Chinese population. Login to comment

PMID: 17543849 [PubMed] Gylling H et al: "Cholesterol synthesis prevails over absorption in metabolic syndrome."

No. Sentence Comment

111 Polymorphisms of the different genes tested were evenly distributed between MBO and controls (heterozygotesϩhomozygotes/wild type: ABCG8: D19H, MBO 16/56, controls 13/61; T400K, MBO 29/ 43, controls 26/48; A632V, MBO 27/45, controls 27/ 47; ABCG5: Q604E, MBO 16/56, controls 16/58). Login to comment
110 Polymorphisms of the different genes tested were evenly distributed between MBO and controls (heterozygotesaf9;homozygotes/wild type: ABCG8: D19H, MBO 16/56, controls 13/61; T400K, MBO 29/ 43, controls 26/48; A632V, MBO 27/45, controls 27/ 47; ABCG5: Q604E, MBO 16/56, controls 16/58). Login to comment

PMID: 17098593 [PubMed] Acalovschi M et al: "Are plasma lipid levels related to ABCG5/ABCG8 polymorphisms? A preliminary study in siblings with gallstones."

No. Sentence Comment

54 Genotype analysis The patients were genotyped for the ABCG5 single nucleotide polymorphism (SNP) Q604E and the ABCG8 SNPs D19H, Y54C, T400K, and A632V [5,11,12] by TaqMan allelic discrimination. Login to comment
109 Variation in plasma concentrations of non-cholesterol sterols has been demonstrated to be highly heritable, and D19H and T400K polymorphisms in ABCG8 have been found to contribute to genetic variations in the plasma concentrations of plant sterols [10]. Login to comment
110 Other polymorphisms in ABCG8 (A632V [10], T400K, and Y54C [27]) and in ABCG5 (Q604E [28]) have been suggested to be associated with plasma cholesterol levels. Login to comment
119 Plasma lipids in affected siblings Table 4 Plasma triglycerides, cholesterol, and HDL-cholesterol in the 68 siblings with gallstones in relation to ABCG5/G8 genotypes (bold indicates pb0.05) Triglycerides (mg/dl) Cholesterol (mg/dl) HDL cholesterol (mg/dl) ABCG8 A632V CT/TT=28 155.5±57.3 205.7±32.6 48.1±13.2 CC=44 154.1±67.3 204.6±39.2 45.6±18.2 T400K CA/AA=30 168.5±76.9 209.9±37.5 46.0±17.3 CC=42 144.7±50.1 201.5±35.8 48.2±14.4 Y54C AG/GG=44 144.5±58.4 202.7±39.6 44.9±17.0 AA=28 170.6±68.3 210.3±32.8 48.0±15.6 D19H GC/CC=12 130.9±52.6 192.5±27.3 49.0±19.5 GG=60 159.4±64.5 208.3±38.4 46.0±16.0 ABCG5 Q604E CG/GG=24 127.4±51.9 191.7±35.1 55.9±12.9 CC=48 168.2±64.5 212.7±36.3 42.7±15.7 did not correlate with those in controls. Login to comment
53 Genotype analysis The patients were genotyped for the ABCG5 single nucleotide polymorphism (SNP) Q604E and the ABCG8 SNPs D19H, Y54C, T400K, and A632V [5,11,12] by TaqMan allelic discrimination. Login to comment
108 Variation in plasma concentrations of non-cholesterol sterols has been demonstrated to be highly heritable, and D19H and T400K polymorphisms in ABCG8 have been found to contribute to genetic variations in the plasma concentrations of plant sterols [10]. Login to comment
118 Plasma lipids in affected siblings Table 4 Plasma triglycerides, cholesterol, and HDL-cholesterol in the 68 siblings with gallstones in relation to ABCG5/G8 genotypes (bold indicates pb0.05) Triglycerides (mg/dl) Cholesterol (mg/dl) HDL cholesterol (mg/dl) ABCG8 A632V CT/TT=28 155.5&#b1;57.3 205.7&#b1;32.6 48.1&#b1;13.2 CC=44 154.1&#b1;67.3 204.6&#b1;39.2 45.6&#b1;18.2 T400K CA/AA=30 168.5&#b1;76.9 209.9&#b1;37.5 46.0&#b1;17.3 CC=42 144.7&#b1;50.1 201.5&#b1;35.8 48.2&#b1;14.4 Y54C AG/GG=44 144.5&#b1;58.4 202.7&#b1;39.6 44.9&#b1;17.0 AA=28 170.6&#b1;68.3 210.3&#b1;32.8 48.0&#b1;15.6 D19H GC/CC=12 130.9&#b1;52.6 192.5&#b1;27.3 49.0&#b1;19.5 GG=60 159.4&#b1;64.5 208.3&#b1;38.4 46.0&#b1;16.0 ABCG5 Q604E CG/GG=24 127.4&#b1;51.9 191.7&#b1;35.1 55.9&#b1;12.9 CC=48 168.2&#b1;64.5 212.7&#b1;36.3 42.7&#b1;15.7 did not correlate with those in controls. Login to comment

PMID: 15262185 [PubMed] Kajinami K et al: "Interactions between common genetic polymorphisms in ABCG5/G8 and CYP7A1 on LDL cholesterol-lowering response to atorvastatin."

No. Sentence Comment

43 The set of polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and CYP7A1 (A-204C) was examined in 337 subjects from the atorvastatin (10 mg per day) arm. The means (±S.D.) of age and BMI were 58 ± 11 years old and 27.0 ± 3.0 kg/m2, respectively [15]. Login to comment
76 K.Kajinamietal./Atherosclerosis175(2004)287-293291 Table 3 Associations between ABCG5 Q604E, ABCG8 T400K, ABCG8 A632V/CYP7A1 A-204C and the LDL-lowering response to atorvastatin* ABCG5/G8 All subjects CYP7A1 P-values among CYP7A1 genotype† Unadjusted Adjusted AA AC CC Additive Dominant Recessive ABCG5 Q604E QQ 36.9 ± 10.1 37.0, 35.7-38.2 (212) 39.4, 37.0-41.8 (57) 36.6, 34.8-38.4 (104) 35.0, 32.4-37.5 (51) 0.055 0.031 0.080 QE 37.1 ± 9.5 36.9, 35.1-38.6 (111) 37.6, 34.7-40.5 (39) 37.3, 34.8-39.9 (54) 33.9, 29.6-38.2 (18) 0.321 0.646 0.131 EE 36.9 ± 9.3 37.8, 32.9-42.7 (14) 44.3, 35.1-53.4 (4) 36.9, 30.0-43.7 (7) 31.0, 20.5-41.5 (3) 0.159 0.081 0.164 ABCG8 T400K TT 37.3 ± 10.3 37.4, 36.2-38.8 (197) 37.5, 34.4-40.6 (62) 36.4, 34.4-38.4 (92) 34.1, 30.4-37.7 (43) 0.022 0.030 0.019 TK 36.5 ± 8.6 36.2, 34.6-37.9 (128) 38.7, 36.2-41.3 (33) 36.4, 34.1-38.8 (67) 35.4, 32.5-38.4 (28) 0.611 0.726 0.320 KK 35.8 ± 13.5 36.0, 30.7-41.3 (12) 42.4, 37.9-46.9 (5) 39.1, 35.7-42.5 (6) 31.9, 26.1-37.6 (1) 0.157 0.046 0.988 ABCG8 A632V AA 36.5 ± 10.0 36.4, 35.2-37.6 (224) 39.8, 37.4-42.1 (65) 37.4, 35.6-39.3 (116) 34.3, 31.4-37.1 (43) 0.005 0.004 0.020 AV 38.0 ± 9.6 38.3, 36.4-40.2 (97) 36.7, 33.5-39.8 (28) 36.6, 34.4-38.8 (41) 34.9, 31.6-38.3 (28) 0.288 0.794 0.126 VV 36.9 ± 7.3 36.2, 31.7-40.8 (16) 42.4, 34.3-50.5 (7) 30.4, 23.0-37.8 (8) 37.0, 18.9-55.1 (1) 0.697 0.992 0.397 In testing the effects of ABCG5 (Q604E) or ABCG8 (T400K and A632V) genotype on LDL-lowering response, none of P-values reached statistical significance. Login to comment
78 Corresponding values between ABCG8 T400K and CYP7A1 were 0.439, 0.709, and 0.641, and those between ABCG8 A632V and CYP7A1 were 0.267, 0.593, and 0.279, respectively. Login to comment
44 The set of polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and CYP7A1 (A-204C) was examined in 337 subjects from the atorvastatin (10 mg per day) arm. The means (&#b1;S.D.) of age and BMI were 58 &#b1; 11 years old and 27.0 &#b1; 3.0 kg/m2, respectively [15]. Login to comment
80 Corresponding values between ABCG8 T400K and CYP7A1 were 0.439, 0.709, and 0.641, and those between ABCG8 A632V and CYP7A1 were 0.267, 0.593, and 0.279, respectively. Login to comment

PMID: 11452359 [PubMed] Lu K et al: "Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively."

No. Sentence Comment

169 OF IDENTIFIED POLYMORPHISMS HARDY-WEINBERG EQUILIBRIUM?ϩ/ϩ ϩ/- -/- ABCG5: 167CrT (Pro9Pro) Gain of BstNI … … … … 1950CrG (Gln604Glu) Loss of SmlI 46 25 1 Yes ABCG8: Exon 1 141CrT (Pro17Pro) … 49 1 0 Yes Exon 1 145GrC (Asp19His) Loss of BaeI 74 3 1 No Exon 2 251GrA (Cys54Tyr) Gain of SexAI 21 23 23 No Exon 6 802GrA (Glu238Lys) … 10 1 0 Yes Exon 6 866CrT (Ala259Val) Loss of HaeIII 0 5 0 … Exon 8 1289CrA (Thr400Lys) Gain of MseI 116 53 4 Yes Exon 11 1785CrT (Ala565Ala) Loss of MnlI 20 7 1 Yes Exon 11 1813GrC (Gly575Arg) Gain of HhaI 188 6 4 No Exon 13 1984CrT (Ala632Val) Loss of StyI 107 50 13 No 5 UTR -15ArC Gain of BstEII 47 4 0 Yes 5 UTR -19TrG Loss of Tsp451 38 42 29 No 5 UTR -41CrT Loss of DdeI 7 2 4 No Intron 1 -7CrT Loss of BsmAI 21 23 4 Yes Intron 1 -21CrA Loss of MnlI 20 23 4 Yes Intron 9 -19CrT … 1 3 4 … Intron 10 IVS10 ϩ34delCC … 3 1 4 … Intron 10 -50CrT … 4 4 2 … cohort of patients with sitosterolemia. Login to comment
170 af9;/af9; af9;/afa; afa;/afa; ABCG5: 167CrT (Pro9Pro) Gain of BstNI ߪ ߪ ߪ ߪ 1950CrG (Gln604Glu) Loss of SmlI 46 25 1 Yes ABCG8: Exon 1 141CrT (Pro17Pro) ߪ 49 1 0 Yes Exon 1 145GrC (Asp19His) Loss of BaeI 74 3 1 No Exon 2 251GrA (Cys54Tyr) Gain of SexAI 21 23 23 No Exon 6 802GrA (Glu238Lys) ߪ 10 1 0 Yes Exon 6 866CrT (Ala259Val) Loss of HaeIII 0 5 0 ߪ Exon 8 1289CrA (Thr400Lys) Gain of MseI 116 53 4 Yes Exon 11 1785CrT (Ala565Ala) Loss of MnlI 20 7 1 Yes Exon 11 1813GrC (Gly575Arg) Gain of HhaI 188 6 4 No Exon 13 1984CrT (Ala632Val) Loss of StyI 107 50 13 No 5 UTR afa;15ArC Gain of BstEII 47 4 0 Yes 5 UTR afa;19TrG Loss of Tsp451 38 42 29 No 5 UTR afa;41CrT Loss of DdeI 7 2 4 No Intron 1 afa;7CrT Loss of BsmAI 21 23 4 Yes Intron 1 afa;21CrA Loss of MnlI 20 23 4 Yes Intron 9 afa;19CrT ߪ 1 3 4 ߪ Intron 10 IVS10 af9;34delCC ߪ 3 1 4 ߪ Intron 10 afa;50CrT ߪ 4 4 2 ߪ cohort of patients with sitosterolemia. Login to comment
171 af9;/af9; af9;/afa; afa;/afa; ABCG5: 167CrT (Pro9Pro) Gain of BstNI ߪ ߪ ߪ ߪ 1950CrG (Gln604Glu) Loss of SmlI 46 25 1 Yes ABCG8: Exon 1 141CrT (Pro17Pro) ߪ 49 1 0 Yes Exon 1 145GrC (Asp19His) Loss of BaeI 74 3 1 No Exon 2 251GrA (Cys54Tyr) Gain of SexAI 21 23 23 No Exon 6 802GrA (Glu238Lys) ߪ 10 1 0 Yes Exon 6 866CrT (Ala259Val) Loss of HaeIII 0 5 0 ߪ Exon 8 1289CrA (Thr400Lys) Gain of MseI 116 53 4 Yes Exon 11 1785CrT (Ala565Ala) Loss of MnlI 20 7 1 Yes Exon 11 1813GrC (Gly575Arg) Gain of HhaI 188 6 4 No Exon 13 1984CrT (Ala632Val) Loss of StyI 107 50 13 No 5 UTR afa;15ArC Gain of BstEII 47 4 0 Yes 5 UTR afa;19TrG Loss of Tsp451 38 42 29 No 5 UTR afa;41CrT Loss of DdeI 7 2 4 No Intron 1 afa;7CrT Loss of BsmAI 21 23 4 Yes Intron 1 afa;21CrA Loss of MnlI 20 23 4 Yes Intron 9 afa;19CrT ߪ 1 3 4 ߪ Intron 10 IVS10 af9;34delCC ߪ 3 1 4 ߪ Intron 10 afa;50CrT ߪ 4 4 2 ߪ cohort of patients with sitosterolemia. Login to comment

PMID: 22548731 [PubMed] Li Q et al: "Association of ATP binding cassette transporter G8 rs4148217 SNP and serum lipid levels in Mulao and Han nationalities."

No. Sentence Comment

31 Thus, the aim of the present study was to detect the association of ABCG8 rs4148217 (T400K) SNP and several environmental factors with serum lipid profiles in the Mulao and Han populations. Login to comment
272 Wang Y, Jiang ZY, Fei J, Xin L, Cai Q, Jiang ZH, Zhu ZG, Han TQ, Zhang SD: ATP binding cassette G8 T400K polymorphism may affect the risk of gallstone disease among Chinese males. Login to comment
32 Thus, the aim of the present study was to detect the association of ABCG8 rs4148217 (T400K) SNP and several environmental factors with serum lipid profiles in the Mulao and Han populations. Login to comment

PMID: 18977479 [PubMed] Koeijvoets KC et al: "ABCG8 gene polymorphisms, plasma cholesterol concentrations, and risk of cardiovascular disease in familial hypercholesterolemia."

No. Sentence Comment

3 Therefore, we examined associations between the D19H and T400K polymorphisms in the ABCG8 gene and CVD in a large cohort study of 2012 patients with heterozygous familial hypercholesterolemia (FH). Login to comment
4 A total of 244 individuals carried one or two alleles of the D19H variant and 568 individuals the T400K variant. Login to comment
7 We observed no relationship between the T400K polymorphism and cardiovascular endpoints (p > 0.1). Login to comment
42 Since the D19H and T400K polymorphisms in the ABCG8 gene showed the strongest relationship with cholesterol standardized serum plant sterol concentrations [15,16], we decided to evaluate associations with these ABCG8 variants. Login to comment
69 This resulted in the selection of two polymorphisms in ABCG8: D19H (substitution of histidine for aspartic acid at amino acid 19 in exon 1) and T400K (substitution of thyrosine for lysine at amino acid 400 in exon 8) that resulted both in lower cholesterol standardized plasma plant sterol concentrations [15,16]. Login to comment
71 Taqman SNP Genotyping Assay ID for the D19H was C 26135643 10 and for the T400K C 375061 10 (Applied Biosystems). Login to comment
76 Genotyping was successful in 2053 (95.7%) patients for the T400K polymorphism, and in 2065 (96.3%) patients for the D19H polymorphism. Login to comment
86 The association between the D19H and T400K polymorphisms in ABCG8 and the occurrence of CVD or CHD was assessed using a Cox proportional hazard regression analysis. Login to comment
99 For the T400K polymorphism, 45 (2.2%) patients were homozygous (KK), 523 (26.0%) patients were heterozygous (TK), and in 1444 (71.8%) patients the homozygous wild type allele (TT) was detected. Login to comment
101 Using chi-square analyses, ABCG8 genotype distributions were similar between individuals without and with a history of CVD (D19H, p = 0.9; T400K, p = 0.1) 3.2. Login to comment
102 ABCG8 genotypes and plasma cholesterol concentrations Plasma cholesterol concentrations according to D19H and T400K genotypes are presented in Table 3. Login to comment
103 No significant differences in plasma lipid concentrations among D19H and T400K genotypes were found. Login to comment
105 Patients homozygous or heterozygous for the T400K polymorphism had significantly less often hypertension compared to carriers of the wild type alleles (7.0% vs. 9.8%; p = 0.03). Login to comment
109 The percentage of D19H and T400K carriers that were Table 2 Genotype and allele distributions for D19H and T400K polymorphisms in ABCG8. Login to comment
110 D19H T400K Total CVD- CVD+ Total CVD- CVD+ N (%) N (%) N (%) N (%) N (%) N (%) Genotypes Wild type (DD or TT) 1768 (87.9) 1198 (87.8) 570 (88.0) 1444 (71.8) 965 (70.7) 479 (73.9) Heterozygous (DH or TK) 237 (11.8) 161 (11.8) 76 (11.7) 523 (26.0) 372 (27.3) 151 (23.3) Homozygous (HH or KK) 7 (0.3) 5 (0.4) 2 (0.3) 45 (2.2) 27 (2.0) 18 (2.8) Total 2012 (100.0) 1364 (100.0) 648 (100.0) 2012 (100.0) 1364 (100.0) 648 (100.0) Alleles Wild type allele (D or T) 3773 (93.8) 2557 (93.7) 1216 (93.8) 3411 (84.8) 2302 (84.4) 1109 (85.6) Minor allele (H or K) 251 (6.2) 171 (6.3) 80 (6.2) 613 (15.2) 426 (15.6) 187 (14.4) Total 4024 (100.0) 2728 (100.0) 1296 (100.0) 4024 (100.0) 2728 (100.0) 1296 (100.0) CVD+ indicates history of cardiovascular disease, CVD- indicates no cardiovascular disease. Login to comment
111 Table 3 Plasma cholesterol concentrations according to D19H and T400K genotypes. Login to comment
112 Polymorphism Genotype Total cholesterol LDL cholesterol HDL cholesterol Triglycerides D19H DD 9.50 (±1.99) 7.32 (±1.91) 1.22 (±0.36) 1.81 (±1.04) DH/HH 9.50 (±1.92) 7.40 (±1.87) 1.22 (±0.36) 1.75 (1;1.04) T400K TT 9.50 (±2.00) 7.32 (±1.91) 1.21 (±0.34) 1.82 (±1.04) TK/KK 9.51 (±1.94) 7.36 (±1.92) 1.24 (±0.39) 1.78 (±1.07) LDL indicates low-density lipoprotein HDL indicates high-density lipoprotein. Login to comment
121 As shown in Table 5, we found no evidence for associations of the D19H or T400K polymorphisms with total CVD risk. Login to comment
124 Although we found no significant relationship between the ABCG8 variants and CVD overall, the effect estimates seemed opposite for the D19H and T400K polymorphisms (Table 5). Login to comment
126 The risk genotype for the D19H variant was the DH/HH genotype ("carriers" of the D19H polymorphism) and the risk genotype for the T400K variant was the frequent TT genotype ("non-carriers" of the T400K polymorphism). Login to comment
138 We found no significant relationship of the T400K polymorphism with susceptibility of CHD. Login to comment
144 Model 1 Model 2 Model 3 Polymorphism RR (95% CI) p RR (95% CI) p RR (95% CI) p ABCG8 D19H CVD 1.13 (0.89-1.46) 0.3 1.26 (0.93-1.71) 0.1 1.27 (0.93-1.72) 0.1 CHD 1.27 (0.98-1.64) 0.07 1.42 (1.04-1.95) 0.03 1.42 (1.04-1.95) 0.03 ABCG8 T400K CVD 0.88 (0.73-1.05) 0.2 0.87 (0.70-1.08) 0.2 0.87 (0.69-1.08) 0.2 CHD 0.87 (0.72-1.06) 0.2 0.84 (0.66-1.06) 0.1 0.83 (0.65-1.05) 0.1 RR indicates relative risk, CI indicates confidence interval, CVD indicates cardiovascular disease, CHD indicates coronary heart disease. Login to comment
152 We observed no significant association between the T400K polymorphism and plasma cholesterol levels or cardiovascular endpoints. Login to comment
168 We found no association between the T400K polymorphism and any cardiovascular event nor with plasma cholesterol concentrations. Login to comment
170 In line with our observations, none of these studies found a significant relationship between the T400K variant and plasma cholesterol levels. Login to comment
190 In conclusion, in this large, multicenter, cohort study amongst high-risk individuals with FH, we found a modest effect of the ABCG8 D19H gene variant on risk of CHD, but we did not observe a relationship between the ABCG8 T400K polymorphism and cardiovascular endpoints. Login to comment

PMID: 23340007 [PubMed] Krawczyk M et al: "Genetics of biliary lithiasis from an ethnic perspective."

No. Sentence Comment

39 For this study, common ABCG5 (p.Q604E) and ABCG8 (p.D19H, p.Y54C, p.T400K, p.A632V) variants were selected and the nonparametric linkage (NPL) as well as case-control analyses were performed. Login to comment

PMID: 24252657 [PubMed] Yu XH et al: "ABCG5/ABCG8 in cholesterol excretion and atherosclerosis."

No. Sentence Comment

749 A recent report in a heterozygous familial hypercholesterolemia cohort indicates that the T400K polymorphism in the ABCG8 gene has an increased risk of cardiovascular disease but is not associated with cardiovascular endpoints [31]. Login to comment

PMID: 24498041 [PubMed] Jiang ZY et al: "Association of three common single nucleotide polymorphisms of ATP binding cassette G8 gene with gallstone disease: a meta-analysis."

No. Sentence Comment

2 Genotypes of Y54C and T400K in the ABCG8 gene were determined by allelic discrimination using either genomic DNA or hepatic cDNA as template by Taqman assays. Login to comment
5 In the genotype model, the overall association between genotype with gallstone was significant for D19H (OR = 2.43, 95%CI: 2.23-2.64, P,0.001), and for Y54C (OR = 1.36, 95%CI: 1.01-1.83, P = 0.044), or T400K (OR = 1.17, 95%CI: 0.96-1.43. Login to comment
7 In allele model, minor alleles of D19H polymorphism (allele D: OR = 2.25, 95%CI: 2.10-2.42, P,0.001) and of T400K polymorphism (allele K: OR = 1.18, 95%CI: 1.061.31, P,0.001) were related with an increased risk of gallstone disease. Login to comment
11 However, no association of T400K and Y54C polymorphism with hepatic ABCG8/G5 mRNA expression or biliary lipids composition was found. Login to comment
13 T400K and Y54C polymorphism, though to a less extent, may also relate with gallstone disease. Login to comment
32 The most studied loci are D19H, T400K and Y54C. Login to comment
37 The aims of our study are: 1) to evaluate the association between polymorphisms at D19H, T400K and Y54C and gallstone disease using meta-analysis; 2) to compare the hepatic ABCG5/G8 mRNA expression and biliary lipids composition in patients with different genotypes of T400K and Y54C. Methods Literature Search Publication were searched via public database PubMed (http:// www.ncbi.nlm.nih. Login to comment

PMID: 24657701 [PubMed] Stender S et al: "The ABCG5/8 cholesterol transporter and myocardial infarction versus gallstone disease."

No. Sentence Comment

22 We genotyped all common nonsynonymous variants (minor allelefrequency >5%) inABCG5/ 8 (ABCG8D19H, Y54C, T400K, A632V; ABCG5 Q604E) and a functional intronic variant (ABCG8 IVS3&#fe;981) in 2 prospective studies of the Danish general population, CGPS (Copenhagen General Population Study) and CCHS (Copenhagen City Heart Study), and in a case-control study, CIHDS (Copenhagen Ischemic Heart Disease Study), totaling 60,239 participants, including 5,647 with MI and 3,174 with symptomatic gallstone disease. Login to comment
40 From the 5 genotypes that were individually associated with reductions in LDL cholesterol levels, we generated combined, weighted genotype scores based on the percentage reductions in LDL cholesterol compared to the reference genotype: ABCG8 D19H, DD &#bc; 0, DH &#bc; 2.7, HH &#bc; 5.8; IVS3&#fe;981 T>C, CC &#bc; 0, TC &#bc; 2.5, TT &#bc; 4.5; Y54C, YY &#bc; 0, YC &#bc; 0.2, CC &#bc; 1.1; T400K, TT &#bc; 0, TK &#bc; 0.9, KK &#bc; 2.9; A632V, VV &#bc; 0, AV &#bc; 0.9, AA &#bc; 1.1. Login to comment
45 In analyses stratified on ABCG8 D19H, a weighted genotype score without D19H was constructed (i.e., including IVS3&#fe;981, Y54C, T400K, and A632V). Login to comment
78 For the individual genotypes, ORs for MI ranged from 0.83 (95% CI: 0.76 to 0.92) for IVS3&#fe;981 TT to 1.07 (95% CI: 0.91 to 1.25) for T400K KK versus noncarriers, while ORs for gallstone disease ranged from 3.82 (95% CI: 2.66 to 5.49) for D19H HH to 1.11 (95% CI: 0.99 to 1.23) for Y54C CC versus noncarriers (Online Fig. 3). Login to comment
87 The corresponding multifactorially adjusted ORs for MI and symptomatic gallstone disease were 0.88 (95% CI: 0.80 to 0.98), and 1.74 (95% CI: 1.48 to 2.05), respectively (p for trend Figure 2 Lipid and Lipoprotein Levels as a Function of ABCG5/8 Genotypes, Individually and Combined The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test. Login to comment
105 Figure 3 Cumulative Incidence of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of Age and ABCG5/8 Genotype Score The genotype score was constructed by summation of weighted low-density lipoprotein cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are by log-rank trend test. Login to comment
122 For instance, a common intronic ABCG8 variant was recently used together with Figure 4 Risk of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of ABCG5/8 Genotype Score The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test, or for trend tests of odds ratios (ORs). Login to comment
137 Although 3 smaller studies (287 gallstone cases) have reported associations for ABCG5 Q604E and ABCG8 T400K with risk of gallstone disease, the large genome-wide association study (n &#bc; 2,280 cases) that initially identified ABCG8 D19H did not report other risk variants in ABCG5/8 (27-30). Login to comment
138 However, re-evaluating the thorough fine-mapping of variants in the ABCG5/8-region performed in this genome-wide association study revealed that ABCG8 IVS&#fe;981 and T400K, as well as ABCG5 Q604E, were indeed associated with gallstone disease, but that the associations did not reach the stringent requirements for statistical significance and/or replication (30). Login to comment
139 We found that ABCG8 IVS&#fe;981 and T400K, as well as ABCG5 Q604E, were individually associated with risk of symptomatic gallstone disease independent of D19H genotype. Login to comment
142 For ABCG8 IVS3&#fe;981 and T400K, the gallstone risk alleles were also associated with decreased levels of plasma LDL cholesterol. Login to comment
143 This resembles the association seen for D19H, suggesting that gain-of-function effects similar to the H-allele of D19H might underlie the associations for IVS3&#fe;981 and T400K. Login to comment
159 However, other cohorts with measurements of both LDL cholesterol and plant sterols may be better suited to directly assess the LDL cholesterol Figure 6 Risk of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of ABCG5/8 Genotype Score on a D19H DD Background The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering alleles of adenosine triphosphate-binding cassette transporter G8 (ABCG8) IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test, or for trend tests of odds ratios (ORs). Login to comment

PMID: 24691589 [PubMed] Wu G et al: "ABCG5/8 variants are associated with susceptibility to coronary heart disease."

No. Sentence Comment

105 Genotype All participants Tobacco smoke Non-smokers Male Female Alcohol drinking Non-drinkers Thr400Lys C>A (allele) OR (95%CI) 2.107 2.700 1.625 2.059 2.108 2.722 1.926 (1.068-4.157) (1.024-7.120) (0.597-4.421) (0.774-5.476) (0.816-5.447) (0.612-12.101) (0.895-4.143) P-value 0.032 0.045 0.342 0.148 0.124 0.188 0.094 Adjusted log-dominant model OR (95%CI) 2.034 2.663 1.472 2.220 1.975 2.152 1.972 (0.983-4.207) (0.973-7.286) (0.467-4.640) (0.746-6.608) (0.717-5.439) (0.359-12.914) (0.873-4.454) P-value 0.048 0.049 0.509 0.152 0.188 0.402 0.102 CI is adjusted for age, smoking, diabetes and HDL-C. Login to comment
158 Several other studies have also demonstrated a significant association between baseline TG levels and the p.T400K polymorphism (16,32,33). Login to comment
159 Notably, several association studies have also demonstrated that there is no significant association between the T400K polymorphism and plasma levels of TG (28,29,34,35). Login to comment
161 Furthermore, neither ABCG8 T400K nor D19H polymorphisms are independently associated with the risk of CHD in a cohort containing 2,012 heterozygous FH patients (37). Login to comment
166 In the current study, ABCG8 CC homozygotes had >two-fold risk of CHD compared with A allele carriers, which may imply that ABCG8 T400K variants are a novel gene marker for CHD risk in the northern Han Chinese population. Login to comment
167 Indeed, the T400K variant is a missense mutation that changes the amino acid residue at position 400 from arginine to histidine in ABCG8. Login to comment
172 Thus, it may be expected that the expression of the ABCG5/8 gene, in C allele carriers at Thr400Lys, is able to increase markedly while consuming a high fat diet to limit cholesterol absorption but promote hepatic secretion. Login to comment

PMID: 25804128 [PubMed] Nicolas A et al: "ABCG8 polymorphisms and renal disease in type 2 diabetic patients."

No. Sentence Comment

2 The ATP-binding cassette transporters G5 and G8 (ABCG5 and ABCG8) play an important role in intestinal sterol absorption and bile acid secretion. The aim of our study was to assess the associations between two ABCG8 coding polymorphisms, T400K and D19H, and the incidence of renal events in type 2 diabetic subjects. Login to comment
33 In particular, the variants of ABCG8 D19H (rs11887534, G>C, exon 1) and ABCG8 T400K (rs4148217, C>A, exon 8) have been the most frequently reported to be associated with phenotypic variability. Login to comment
35 In the present investigation, we assessed associations of D19H and T400K variants in the coding region of ABCG8 with the incidence of severe kidney outcomes in the prospective DIABHYCAR cohort of French type 2 diabetic patients [27-30]. Login to comment
54 Polymorphism determination Polymorphisms T400K (rs4148217, C>A, exon 8) and D19H (rs11887534, G>C, exon 1) were genotyped using the Kaspar method (LGC Genomics, Hoddesdon, UK). Login to comment
71 The characteristics of participants at baseline according to the incidence of renal events during 714 M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L 6 follow-upareshowninTable1.Thegenotypeswerenotsignificantly associated with any of the baseline characteristics of the patients, except a trend for an association between T400K and eGFR, the K allele being associated with a lower rate (eGFR in ml/mn/1.73 m2 : 81.7 (65.4-102.5), 81.1 (63.8-101.5) and 77.8 (63.6-96.7) for the TT, TK and KK genotypes, respectively, P = 0.08). Login to comment
77 Validation population In order to validate our findings, we tested the ABCG8 T400K polymorphism in the DIAB2NEPHROGENE population. Login to comment
107 Since FXR is a bile acid receptor, it might interact with ABCG8 involved in bile acid secretion. The D19H polymorphism was not significantly associated with renal disease in our study, although its effects on plasma plant sterols and bile acid secretion seem of greater magnitude than those of T400K [22]. Login to comment
111 Polymorphism Renal event Statistics Without, n (%) With, n (%) Incidence, % P c7;2 unadjusted Hazard ratio (95% CI) Model 1 Model 2 a T400K (C>A) TT 1948 (64.9) 39 (52.0) 2.0 2 df: 0.018 Additive: 0.007 Dominant (CA + AA vs CC): 0.022 1.75 (1.20-2.56), P = 0.003 1.52 (1.05-2.21), P = 0.03 TK 953 (31.8) 30 (40.0) 3.1 KK 100 (3.3) 6 (8.0) 5.7 MAF 0.192 0.280 D19H (G>C) DD 2,615 (87.2) 69 (93.2) 2.6 2 df: 0.29 Additive: 0.13 Dominant (GC + CC vs GG): 0.14 0.53 (0.21-1.31), P = 0.16 0.53 (0.21-1.33), P = 0.18 DH 372 (12.4) 5 (6.8) 1.3 HH 11 (0.4) 0 (0) 0.0 MAF 0.066 0.034 MAF: minor allele frequency. a Cox regression analysis for the additive model, model 1: adjustment for sex, age, BMI, TG, total and HDL cholesterol, CRP, HbA1c, glycemia, diabetes duration, and prior myocardial infarction; model 2: idem + eGFR, UAE, SBP, DBP at baseline. Login to comment
122 Nevertheless, the association of ABCG8 T400K polymorphism with renal disease was validated in the DIAB2NEPHROGENE population of patients with type 2 diabetes. Login to comment
145 M. Marre (Bichat Hospital, Paris, France); steering committee: Table 4 - ABCG8 T400K (C>A) polymorphism genotype frequencies according to end-stage renal disease prevalence in DIAB2NEPHROGENE. Login to comment
146 T400K (C>A) End-stage renal disease Statistics Without, n (%) With, n (%) Prevalence, % P c7;2 unadjusted Odds ratio (95% CI) a TT 1366 (65.5) 26 (49.1) 1.9 2 df: 0.028; additive: 0.05 Dominant (CA + AA vs CC): 0.015 Additive model 1 1.54 (0.99-2.38), P = 0.055 Additive model 2 1.63 (1.05-2.54), P = 0.03 TK 627 (30.0) 25 (47.2) 3.8 KK 94 (4.5) 2 (3.8) 2.1 MAF 0.195 0.273 Dominant model 1 2.01 (1.15-3.54), P = 0.015 Dominant model 2 2.22 (1.25-3.94), P = 0.007 MAF: minor allele frequency. a Logistic regression analysis, model 1: adjusted for sex, age, BMI, total cholesterol, HbA1c, diabetes duration and prior myocardial infarction. Login to comment