ABCMdb

PMID: 19365039

Roberts LJ, Ramesar RS, Greenberg J
Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip.
Arch Ophthalmol. 2009 Apr;127(4):549-54., [PubMed]

Sentences

No. Mutations Sentence Comment

31 ABCA4 p.Gly1961Glu ABCA4 p.Gly1961Glu ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp ABCA4 p.Arg602Trp ABCA4 p.Asn965Ser ABCA4 p.Asn965Ser ABCA4 p.Leu2027Phe ABCA4 p.Leu2027Phe ABCA4 p.Pro1380Leu ABCA4 p.Pro1380Leu ABCA4 p.Arg152* ABCA4 p.Arg152* ABCA4 p.Arg152* ABCA4 p.Arg152* ABCA4 p.Arg152* ABCA4 p.Arg152* ABCA4 p.Arg152* ABCA4 p.Arg152* ABCA4 p.Arg152* ABCA4 p.Arg152* ABCA4 p.Arg152* ABCA4 p.Arg152* ABCA4 p.Arg152Gln ABCA4 p.Arg152Gln ABCA4 p.Arg152Gln ABCA4 p.Arg152Gln Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 308;; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 308;; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction. Login to comment 36 ABCA4 p.Trp855* Case RPS1111.1, a Black African Xhosa-speaking individual with STGD, was found not to carry the homozygous c.2565GϾA (W855X) mutation that was detected using the chip. Login to comment 38 ABCA4 p.Trp855* Case RPS1111.1, a Black African Xhosa-speaking individual with STGD, was found not to carry the homozygous c.2565Gb0e;A (W855X) mutation that was detected using the chip. Login to comment 50 ABCA4 p.Trp855* A, Electropherogram showing the exon 16 sequence spanning the homozygous 2565delGTACCTTG identified instead of the W855X mutation in individual RPS1111.1. Login to comment 52 ABCA4 p.Trp855* A, Electropherogram showing the exon 16 sequence spanning the homozygous 2565delGTACCTTG identified instead of the W855X mutation in individual RPS1111.1. Login to comment 53 ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr Het C1490Y (No IVS38-10T>C) Het C1490Y Het IVS38-10T>C Het C1490Y Het IVS38-10T>C (No C1490Y) Het IVS38-10T>C Figure 2. Pedigree of family RPS1011, showing the mutations cosegregating with disease. Login to comment 54 ABCA4 p.Cys1490Tyr The common C1490Y mutation was identified as the second mutation in the proband`s father during cosegregation analysis. Login to comment 55 ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr Het C1490Y (No IVS38-10T>C) Het C1490Y Het IVS38-10T>C Het C1490Y Het IVS38-10T>C (No C1490Y) Het IVS38-10T>C Figure 2. Pedigree of family RPS1011, showing the mutations cosegregating with disease. Login to comment 56 ABCA4 p.Cys1490Tyr The common C1490Y mutation was identified as the second mutation in the proband`s father during cosegregation analysis. Login to comment 58 ABCA4 p.Arg2107His One proband was confirmed to have inherited the heterozygous R2107H mutation from her father. Login to comment 60 ABCA4 p.Arg2107His One proband was confirmed to have inherited the heterozygous R2107H mutation from her father. Login to comment 61 ABCA4 p.Arg2107His This insertion, 4535insC, causes a 41-amino acid frameshift followed by a stop codon at position 1554, leading to STGD.10,11 Compound heterozygosity of the R2107H and the 4535insC mutations is therefore causative of disease in this proband (Figure 5C). Login to comment 63 ABCA4 p.Arg2107His This insertion, 4535insC, causes a 41-amino acid frameshift followed by a stop codon at position 1554, leading to STGD.10,11 Compound heterozygosity of the R2107H and the 4535insC mutations is therefore causative of disease in this proband (Figure 5C). Login to comment 79 ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Phe1440Ser ABCA4 p.Phe1440Ser ABCA4 p.Phe1440Ser ABCA4 p.Phe1440Ser ABCA4 p.Phe1440Ser ABCA4 p.Phe1440Ser Due Het IVS45+7G>A+ Het F1440S (No G863A) Het IVS45+7G>A+ Het F1440S (No G863A) Het IVS45+7G>A+ Het F1440S Het G863A Het IVS45+7G>A+ Het F1440S Het G863A (No IVS45+7G>A+ No F1440S) Het G863A Figure 3. Pedigree of family RPS141 in which cosegregation analysis revealed that IVS45ϩ7GϾA and F1440S are transmitted on the paternal chromosome, while G863A is transmitted on the maternal chromosome. Login to comment 80 ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr (No C1490Y) Het V256V Het C1490Y Het V256V Het C1490Y Het V256V Het C1490Y Het V256V Figure 4. Pedigree of family RPS165 in which the presence of a third mutation did not confound result delivery. Login to comment 81 ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Gly863Ala ABCA4 p.Phe1440Ser ABCA4 p.Phe1440Ser ABCA4 p.Phe1440Ser ABCA4 p.Phe1440Ser ABCA4 p.Phe1440Ser ABCA4 p.Phe1440Ser Due Het IVS45+7G>A+ Het F1440S (No G863A) Het IVS45+7G>A+ Het F1440S (No G863A) Het IVS45+7G>A+ Het F1440S Het G863A Het IVS45+7G>A+ Het F1440S Het G863A (No IVS45+7G>A+ No F1440S) Het G863A Figure 3. Pedigree of family RPS141 in which cosegregation analysis revealed that IVS45af9;7Gb0e;A and F1440S are transmitted on the paternal chromosome, while G863A is transmitted on the maternal chromosome. Login to comment 82 ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr ABCA4 p.Cys1490Tyr (No C1490Y) Het V256V Het C1490Y Het V256V Het C1490Y Het V256V Het C1490Y Het V256V Figure 4. Pedigree of family RPS165 in which the presence of a third mutation did not confound result delivery. Login to comment 87 ABCA4 p.Arg2107His ABCA4 p.Arg2107His If the microarray probes position 4537 and the sequence containing the insertion displays a C/C genotype at position 4537, no mutation should C Het R2107H (No 4535insC) Het R2107H (No 4535insC) 150 160 170 200 190 180 A C C C C C C C C C C C C C C C C C C C C C C C C C C C A G G G G G G G G G G G G G G G G G G G T T T T T T A A A A A A A A A B 180 190 200 210 220 230 C C C C C C C C C C C C C C C C C C C C C C N N N N N N N N N N N N N N A A A A A A A G G G G G G G G G G G G G G G G G T T Figure 5. Login to comment 89 ABCA4 p.Arg2107His ABCA4 p.Arg2107His If the microarray probes position 4537 and the sequence containing the insertion displays a C/C genotype at position 4537, no mutation should C Het R2107H (No 4535insC) Het R2107H (No 4535insC) 150 160 170 200 190 180 A C C C C C C C C C C C C C C C C C C C C C C C C C C C A G G G G G G G G G G G G G G G G G G G T T T T T T A A A A A A A A A B 180 190 200 210 220 230 C C C C C C C C C C C C C C C C C C C C C C N N N N N N N N N N N N N N A A A A A A A G G G G G G G G G G G G G G G G G T T Figure 5. Login to comment 91 ABCA4 p.Arg2107His C, The pedigree of family RPS145, showing the compound heterozygosity of R2107H and 4535insC. Login to comment 92 ABCA4 p.Arg1300Gln ABCA4 p.Arg1300Gln ABCA4 p.Arg1300Gln Homozygous R1300Q Heterozygous R1300Q Heterozygous R1300Q ? Login to comment 93 ABCA4 p.Arg2107His C, The pedigree of family RPS145, showing the compound heterozygosity of R2107H and 4535insC. Login to comment 94 ABCA4 p.Arg1300Gln ABCA4 p.Arg1300Gln ABCA4 p.Arg1300Gln ABCA4 p.Arg1300Gln A homozygous R1300Q mutation was identified in the proband; however, 2 affected siblings are heterozygous mutation carriers. Login to comment 96 ABCA4 p.Arg1640Trp ABCA4 p.Arg1640Trp ABCA4 p.Arg1640Trp ABCA4 p.Arg1300Gln ABCA4 p.Trp1408Arg ABCA4 p.Trp1408Arg ABCA4 p.Trp1408Arg (No R1640W) (No W1408R) Het R1640W Het W1408R Het R1640W Het W1408R Figure 7. Pedigree of family RPS593 in which both mutations in the proband were found to be transmitted on a single parental (paternal) allele. Login to comment 98 ABCA4 p.Arg1640Trp ABCA4 p.Arg1640Trp ABCA4 p.Arg1640Trp ABCA4 p.Trp1408Arg ABCA4 p.Trp1408Arg ABCA4 p.Trp1408Arg (No R1640W) (No W1408R) Het R1640W Het W1408R Het R1640W Het W1408R Figure 7. Pedigree of family RPS593 in which both mutations in the proband were found to be transmitted on a single parental (paternal) allele. Login to comment 100 ABCA4 p.Trp855* The novel 2565delGTACCTTG variation was also incorrectly identified by the ABCR400 microarray as the W855X mutation (Figure 1). Login to comment 101 ABCA4 p.Trp855* The presence of this deletion causes the sequence at position 855 to be that expected from the W855X mutation (TGGϾTGA). Login to comment 102 ABCA4 p.Trp855* The novel 2565delGTACCTTG variation was also incorrectly identified by the ABCR400 microarray as the W855X mutation (Figure 1). Login to comment 103 ABCA4 p.Trp855* The presence of this deletion causes the sequence at position 855 to be that expected from the W855X mutation (TGGb0e;TGA). Login to comment