ABCMdb

ABCA4 p.Arg152*

ClinVar:

c.455G>A , p.Arg152Gln ? , not provided
c.454C>T , p.Arg152* ? , not provided

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Macular function in macular degenerations: repeata... Invest Ophthalmol Vis Sci. 2012 Feb 21;53(2):841-52. Print 2012 Feb. Cideciyan AV, Swider M, Aleman TS, Feuer WJ, Schwartz SB, Russell RC, Steinberg JD, Stone EM, Jacobson SG
Macular function in macular degenerations: repeatability of microperimetry as a potential outcome measure for ABCA4-associated retinopathy trials.
Invest Ophthalmol Vis Sci. 2012 Feb 21;53(2):841-52. Print 2012 Feb., [PMID:22247458]

Abstract [show]
PURPOSE: To measure macular visual function in patients with unstable fixation, to define the photoreceptor source of this function, and to estimate its test-retest repeatability as a prerequisite to clinical trials. METHODS: Patients (n = 38) with ABCA4-associated retinal degeneration (RD) or with retinitis pigmentosa (RP) were studied with retina-tracking microperimetry along the foveo-papillary profile between the fovea and the optic nerve head, and point-by-point test-retest repeatability was estimated. A subset with foveal fixation was also studied with dark-adapted projection perimetry using monochromatic blue and red stimuli along the horizontal meridian. RESULTS: Macular function in ABCA4-RD patients transitioned from lower sensitivity at the parafovea to higher sensitivity in the perifovea. RP patients had the inverse pattern. Red-on-red microperimetric sensitivities successfully avoided ceiling effects and were highly correlated with absolute sensitivities. Point-by-point test-retest limits (95% confidence intervals) were +/-4.2 dB; repeatability was not related to mean sensitivity, eccentricity from the fovea, age, fixation location, or instability. Repeatability was also not related to the local slope of sensitivity and was unchanged in the parapapillary retina. CONCLUSIONS: Microperimetry allows reliable testing of macular function in RD patients without foveal fixation in longitudinal studies evaluating natural disease progression or efficacy of therapeutic trials. A single estimate of test-retest repeatability can be used to determine significant changes in visual function at individual retinal loci within diseased regions that are homogeneous and those that are heterogeneous and also in transition zones at high risk for disease progression.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Clinical and Molecular Characteristics of the ABCA4 Patients Patient Age (y)/Sex ABCA4 Mutation Clinical Diagnosis Visual Acuity* Kinetic Visual Field Extent (V-4e)†Allele 1 Allele 2 Foveal Fixation P1‡ 12/M N965S W821R STGD 20/20 97 P2‡ 17/F V989A IVS28ϩ5 GϾT STGD 20/100 90 P3 18/M G1961E R1129L§ STGD 20/100 105 P4 21/F R212C P68R STGD 20/125 101 P5 24/M P1511 del1ccgC R1705Q STGD 20/25 114 P6 31/M G863A R1108C STGD 20/25 105 P7 32/F IVS40ϩ5 GϾA V935A STGD 20/32 103 P8 34/M G1961E - CRD 20/32 98 P9 37/F R681X P309R STGD 20/20 109 P10 39/M G1961E C54Y§ STGD 20/40 101 P11‡ 42/F G1961E V256V STGD 20/32 105 P12‡ 46/F G1961E V256V STGD 20/32 106 P13 52/F G1961E P1380L STGD 20/40 105 P14 58/M D600E R18W§ STGD 20/40 84 Extrafoveal Fixation P15 11/M V256V T1526M CRD 20/200 102 P16 15/M C54Y IVS35ϩ2 TϾC STGD 20/200 96 P17‡ 16/F V989A IVS28ϩ5 GϾT STGD 20/100 100 P18‡ 16/M N965S W821R STGD 20/125 100 P19 19/F A1038V/L541P N965S STGD 20/400 90 P20 21/M G863A IVS35ϩ2 TϾC STGD 20/200 99 P21 22/F G1961E R152X STGD 20/50 104 P22 27/M G863A P1660S§ STGD 20/100 98 P23 27/F G1961E A1038V/L541P STGD 20/100 109 P24 29/M G1961E T1019M STGD 20/100 104 P25 33/M P1486L deletion of exon 7 STGD 20/400 98 P26 36/F G863A C1490Y STGD 20/100 93 P27 41/M A1038V/L541P - STGD 20/125 108 P28 49/F T1526M R2030Q STGD 20/125 98 P29 55/F W855X - STGD 20/160 87 P30 56/F G1961E IVS37ϩ1 GϾA§ STGD 20/125 89 P31 60/F G1961E M669 del2ccAT STGD 20/125 104 STGD, Stargardt disease; CRD, cone-rod dystrophy. Login to comment

[hide] Clinical utility of the ABCR400 microarray: basing... Arch Ophthalmol. 2009 Apr;127(4):549-54. Roberts LJ, Ramesar RS, Greenberg J
Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip.
Arch Ophthalmol. 2009 Apr;127(4):549-54., [PMID:19365039]

Abstract [show]
OBJECTIVES: To assess the clinical utility of ABCR400 microarray testing in patients with ABCA4-associated retinopathies and to report on possible issues that could arise should genetic results be delivered without validation. METHODS: One hundred thirty-two probands were genotyped with the microarray. Diagnostic assays were designed to verify all mutations identified in individuals in whom at least 2 causative mutations were found. Mutations were verified in the probands, and wherever possible cosegregation analysis was performed in additional family members. RESULTS: Eighty-five of the 132 probands (64.4%) genotyped with the microarray had 2 or more disease-associated mutations identified. Verification of the genotyping, however, resulted in only 80 families being able to benefit from genetic result delivery. The remaining families could not receive results owing to the confounding effect of multiple ABCA4 mutations or the incorrect identification of mutations. CONCLUSIONS: The ABCR400 microarray is useful for mutation screening; however, raw data cannot be delivered directly to patients. All mutations should be verified and, whenever possible, investigated in other family members. CLINICAL RELEVANCE: Validated ABCR400 results provide an unequivocal molecular diagnosis, allowing family members to be offered diagnostic, predictive, carrier, and prenatal testing. Use of the microarray can inform decision-making and identify candidates for future therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 3Ј; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 3Ј; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction. Login to comment

[hide] ABCA4 disease progression and a proposed strategy ... Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12. Cideciyan AV, Swider M, Aleman TS, Tsybovsky Y, Schwartz SB, Windsor EA, Roman AJ, Sumaroka A, Steinberg JD, Jacobson SG, Stone EM, Palczewski K
ABCA4 disease progression and a proposed strategy for gene therapy.
Hum Mol Genet. 2009 Mar 1;18(5):931-41. Epub 2008 Dec 12., [PMID:19074458]

Abstract [show]
Autosomal recessive retinal diseases caused by mutations in the ABCA4 gene are being considered for gene replacement therapy. All individuals with ABCA4-disease show macular degeneration, but only some are thought to progress to retina-wide blindness. It is currently not predictable if or when specific ABCA4 genotypes will show extramacular disease, and how fast it will progress thereafter. Early clinical trials of focal subretinal gene therapy will aim to arrest disease progression in the extramacular retina. In 66 individuals with known disease-causing ABCA4 alleles, we defined retina-wide disease expression by measuring rod- and cone-photoreceptor-mediated vision. Serial measurements over a mean period of 8.7 years were consistent with a model wherein a normal plateau phase of variable length was followed by initiation of retina-wide disease that progressed exponentially. Once initiated, the mean rate of disease progression was 1.1 log/decade for rods and 0.45 log/decade for cones. Spatio-temporal progression of disease could be described as the sum of two components, one with a central-to-peripheral gradient and the other with a uniform retina-wide pattern. Estimates of the age of disease initiation were used as a severity metric and contributions made by each ABCA4 allele were predicted. One-third of the non-truncating alleles were found to cause more severe disease than premature truncations supporting the existence of a pathogenic component beyond simple loss of function. Genotype-based inclusion/exclusion criteria and prediction of the age of retina-wide disease initiation will be invaluable for selecting appropriate candidates for clinical trials in ABCA4 disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 For example, P10 (R152X/IVS38-10T.C) progressed from normal sensitivity (5.5 dB loss) at age 11 to a dramatically abnormal sensitivity (30.9 dB loss) at age 29. Login to comment
134 Unrelated individuals P11 and P12 had the same pair of mutant alleles, R152X and G1961E. Login to comment
153 c Nt, amino-terminal domain; ECD-1 and ECD-2, exocytoplasmic domains 1 and 2; NBD-1 and NBD-2, nucleotide binding domains 1 and 2; TM5, TM6, TM7, TM12, within, near or between transmembrane helices 5, 6, 7 and 12. d W41X, R152X, Y245X, Y362X, W663X, M669del2tccAT, R681X and A1739 del11gcTGGGCTGGTGG. retina-wide blindness, the quality of life deteriorates dramatically with loss of mobility and independence. Login to comment

[hide] Spectrum of the ABCA4 gene mutations implicated in... Invest Ophthalmol Vis Sci. 2007 Mar;48(3):985-90. Valverde D, Riveiro-Alvarez R, Aguirre-Lamban J, Baiget M, Carballo M, Antinolo G, Millan JM, Garcia Sandoval B, Ayuso C
Spectrum of the ABCA4 gene mutations implicated in severe retinopathies in Spanish patients.
Invest Ophthalmol Vis Sci. 2007 Mar;48(3):985-90., [PMID:17325136]

Abstract [show]
PURPOSE: The purpose of this study is to describe the spectrum of mutations in the ABCA4 gene found in Spanish patients affected with several retinal dystrophies. METHODS: Sixty Spanish families with different retinal dystrophies were studied. Samples were analyzed for variants in all 50 exons of the ABCA4 gene by screening with the ABCR400 microarray, and results were confirmed by direct sequencing. Haplotype analyses were also performed. For those families with only one mutation detected by the microarray, denaturing (d)HPLC was performed to complete the mutational screening of the ABCA4 gene. RESULTS: The sequence analysis of the ABCA4 gene led to the identification of 33 (27.5%) potential disease-associated alleles among the 60 patients. These comprised 16 distinct sequence variants in 25 of the 60 subjects investigated. For autosomal recessive cone-rod dystrophy (arCRD), we found that 50% of the CRD families with the mutation had two recurrent changes (2888delG and R943Q). For retinitis pigmentosa (RP) and autosomal dominant macular dystrophy (adMD), one putative disease-associated allele was identified in 9 of the 27 and 3 of the 7 families, respectively. CONCLUSIONS: In the population studied, ABCA4 plays an important role in the pathogenesis of arCRD. However, mutations in this gene are less frequently identified in other retinal dystrophies, like RP or adMD, and therefore it is still not clear whether ABCA4 is involved as a modifying factor or the relationship is a fortuitous association.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 In family ADDM-92, we detected the mutation I156V, which has been associated with a STGD recessive phenotype.21 The R152X mutation (located in exon 5, close to I156V) was present in a family with dominant STGD that demonstrated genetic linkage to the STGD region on 6q. FIGURE 2. Login to comment
86 In family ADDM-92, we detected the mutation I156V, which has been associated with a STGD recessive phenotype.21 The R152X mutation (located in exon 5, close to I156V) was present in a family with dominant STGD that demonstrated genetic linkage to the STGD region on 6q. FIGURE 2. Login to comment

[hide] Mutation spectrum and founder chromosomes for the ... Invest Ophthalmol Vis Sci. 2004 Jun;45(6):1705-11. September AV, Vorster AA, Ramesar RS, Greenberg LJ
Mutation spectrum and founder chromosomes for the ABCA4 gene in South African patients with Stargardt disease.
Invest Ophthalmol Vis Sci. 2004 Jun;45(6):1705-11., [PMID:15161829]

Abstract [show]
PURPOSE: To assess the mutation spectrum of ABCA4 underlying Stargardt disease (STGD) in South Africa (SA) and to determine whether there is a single or a few founder chromosomes in SA STGD families. METHODS: Sixty-four probands exhibiting the STGD phenotype were screened for mutations in the 50 exons of ABCA4 by single-strand conformational polymorphism-heteroduplex analysis sequencing and restriction fragment length polymorphism analysis. Microsatellite marker haplotyping was used to determine the ancestry in 10 families. RESULTS: Fifty-seven ABCA4 disease-associated alleles were identified that comprised 16 different sequence variants, of which two were novel, in 40 individuals of the cohort of 64 subjects. The most common variants identified included the C1490Y, L2027F, R602W, V256splice, R152X, and 2588G-->C mutations. The C1490Y variant was the most common disease-associated variant identified (19/64 subjects) and was absent in 392 control chromosomes. At least 10 ABCA4 disease-associated haplotypes were identified. Two of these haplotypes, which carried the C1490Y mutation, were identified in three unrelated families. CONCLUSIONS: Results suggest that ABCA4 is the major gene underlying STGD in the cohort investigated. Five of the six common sequence variants identified were at a higher frequency in the SA cohort than reported in published data on individuals of similar ancestry. The mutation and haplotype data suggests that there are several ancestral haplotypes underlying STGD in SA. There seems to be at least two different origins for the common C1490Y mutation, as well as two for the R602W mutation, thereby suggesting several founder effects for STGD in SA.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 The most common variants identified included the C1490Y, L2027F, R602W, V256splice, R152X, and 2588G3C mutations. Login to comment
71 List of 16 Different Potential Disease-Associated Sequence Variants Identified in 64 SA Subjects with arSTGD Nucleotide Change Amino Acid Change Families (N ‫؍‬ 64) Exon Reference C454T R152X 4 5 3,33 G455A R152Q 1 5 35 C634T R212C 1 6 16,27 G768T (Splice donor) V256splice 5 6 15 C1885T R602W 6 13 9 2588G3C G863A 4 17 8 T3047C V989A 1 20 11 T4319C F1440S 1 29 9 G4328A* R1443H 1 29 This study G4469A C1490Y 19 30 15,9 G5077A V16931 1 36 36 C6079T L2027F 8 44 8 C6088A R2030X 1 44 9,37 C6112T R2038W 2 44 5 IVS45ϩ7G3A Splice donor 1 45 26 6352⌬A* Frameshift 1 46 This study No individuals positive for the R1443H variant were identified in 47 control individuals of Indian ancestry. Login to comment
90 Individual 105.1 was heterozygous for two different mutations, the V256splice variant and the R152X variant. Login to comment
96 A single STGD-associated haplotype was identified for the (1) L2027F sequence variant, in two unrelated families; (2) V256splice variant, in two unrelated families; (3) R152X variant, three unrelated families; (4) 2588G3C variant, in one family; (5) F1440S variant, in one family; and (6) IVS45ϩ7G3A variant, in one family. Login to comment
119 The C1490Y sequence variant was the most common disease-associated variant identified in this study (19/64; 30%), followed by the L2027F (8/64; 13%), the R602W variant (6/64; 9%), the V256splice variant (5/64; 8%), and the 2588G3C and R152X sequence variants occurred at equal frequencies (4/64; 6%). Login to comment
121 Five (C1490Y, L2027F, R602W, V256splice and R152X) of the six common sequence variants identified were at a higher frequency in the SA STGD cohort than in populations from Europe and the United States. Login to comment
122 Of interest, the C1490Y, R602W, V256splice, and R152X variants were found to be some of the rarer ABCA4 mutations observed in populations of Europe. Login to comment
125 AO (y) Phenotype Mutation 1 Mutation 2 224.1 9 STGD C1490Y R602W 170.2 10 STGD C1490Y R602W 241.1 9 STGD C1490Y 25883C 448.1 20 STGD C1490Y 2588G3C 113.3 10 STGD C1490Y L2027F 209.1 18 STGD C1490Y L2027F 165.4 10 STGD C1490Y V256splice 166.3 27 STGD C1490Y R152X 151.4 5 STGD C1490Y ND 219.1 5 (rapid clinical progression was observed by 9 years) STGD C1490Y ND 223.1 9 STGD C1490Y ND 307.1 9 STGD C1490Y ND 319.3 9 STGD C1490Y ND 385.1 10 STGD C1490Y ND 226.1 10 STGD C1490Y ND 142.2 10 STGD C1490Y ND 273.1 11 STGD C1490Y ND 382.1 12 STGD C1490Y ND 449.1 14 STGD C1490Y ND 344.2 ND STGD C1490Y ND 374.1 10 STGD L2027F 6352⌬A† 305.1 18 STGD L2027F R2038W 377.1 25 STGD L2027F R2038W 276.1 27 STGD L2027F R212C 204.4 8 STGD L2027F ND 135.4 13 STGD L2027F ND 446.1 9 STGD R602W ND 109.3 11 STGD R602W ND 110.7 13 STGD R602W ND 438.3 12 STGD R602W ND 123.1 9 STGD V256splice R152X 105.1* 10 STGD AND atypical RP V256splice R152X 24 129.3* 10 (rapid clinical progression was observed) STGD V256splice ND 163.22 10 STGD V256splice ND 173.1 8 STGD 2588G3C ND 9.4 27 STGD 2588G3C R152X 330.2 29 STGD R152Q V989A 372.1 31 STGD R1443H† R2030X 141.3 11 STGD F1440S IVS45ϩ7G3A (splice site mutation) 206.3 ND STGD V1693I ND Rows are arranged according to the age of onset (AO) starting with the earliest AO for the most common sequence variant. Login to comment
133 This study presents further supporting evidence that mutations such as R152X and V256splice variants within ABCA4 can cause recessive panretinal degeneration, which is typified by changes in the clinical presentation from STGD to a more severe arRP phenotype over time.32 Individual 105.1 was heterozygous for two different mutations: the V256splice variant and the R152X sequence variant. Login to comment
134 The R152X change has been associated with a mild clinical phenotype of fundus flavimaculatus, which has a late AO and a slow progressive clinical phenotype.13,33 In this study, the R152X sequence variant is associated with an earlier AO (Ͻ28 years) than the published data of 70 and 52 years. Login to comment
136 Without in vitro functional analyses of the effects of these two mutations (R152X and V256splice) on the ABCA4 protein, it is difficult to predict accurately whether both variants contribute TABLE 4. Login to comment
137 The 10 ABCA4 Disease-Associated Haplotypes Identified in the 10 STGD Families Investigated Family D1S188 Marker ABCA4 MutationD1S406 D1S236 166 14 6 12 C1490Y 170 15 4 9 C1490Y 151 15 4 9 C1490Y 204 9 5 14 L2027F 135 9 5 14 L2027F 105 8 4 14 V256splice 129 8 4 14 V256splice 170 10 5 12 R602W 110 16 6 3 R602W 9 7 5 14 2588G3C 9 16 5 4 R152X 105 16 5 4 R152X 166 16 5 4 R152X 141 8 3 6 F1440S 141 9 5 14 IVS45ϩ7G3A The numbers in column 1 denote the identity number of the family. Login to comment
146 However, the findings of the present investigation suggest that the V256splice variant and the R152X variant both affected the ABCA4 protein function severely and that this could explain the severe clinical phenotype. Login to comment

[hide] Late-onset Stargardt disease is associated with mi... Hum Genet. 2001 Apr;108(4):346-55. Yatsenko AN, Shroyer NF, Lewis RA, Lupski JR
Late-onset Stargardt disease is associated with missense mutations that map outside known functional regions of ABCR (ABCA4).
Hum Genet. 2001 Apr;108(4):346-55., [PMID:11379881]

Abstract [show]
Based on recent studies of the photoreceptor-specific ABC transporter gene ABCR (ABCA4) in Stargardt disease (STGD1) and other retinal dystrophies, we and others have developed a model in which the severity of retinal disease correlates inversely with residual ABCR activity. This model predicts that patients with late-onset STGDI may retain partial ABCR activity attributable to mild missense alleles. To test this hypothesis, we used late-onset STGDI patients (onset: > or =35 years) to provide an in vivo functional analysis of various combinations of mutant alleles. We sequenced directly the entire coding region of ABCR and detected mutations in 33/50 (66%) disease chromosomes, but surprisingly, 11/33 (33%) were truncating alleles. Importantly, all 22 missense mutations were located outside the known functional domains of ABCR (ATP-binding or transmembrane), whereas in our general cohort of STGDI subjects, alterations occurred with equal frequency across the entire protein. We suggest that these missense mutations in regions of unknown function are milder alleles and more susceptible to modifier effects. Thus, we have corroborated a prediction from the model of ABCR pathogenicity that (1) one mutant ABCR allele is always missense in late-onset STGD1 patients, and (2) the age-of-onset is correlated with the amount of ABCR activity of this allele. In addition, we report three new pseudodominant families that now comprise eight of 178 outbred STGD1 families and suggest a carrier frequency of STGD1-associated ABCR mutations of about 4.5% (approximately 1/22).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Allele 1 nucleotide Amino acid Allele 2 Amino acid Age of change nucleotide change onset (years) AR129-08 37 AR140-01 6079C→T L2027F 3322C→T R1108C 36 AR204-04 35 AR280-03 6316C→T R2106C 6710insA T2237fs 35 AR311-04 4462T→C C1488R 35 AR336-03 2588G→C G863A 5898+1G→A E1966splice 39 AR343-06 2588G→C G863A 3322C→T R1108C 43 AR387-03 4919G→A R1640Q 2971G→C G991R 40 AR410-04 768G→T V256splice 3113C→T A1038V 38 AR440-03 6238-6239del2 bp S2080fs 44 AR448-01a 454C→T R152X 6089G→A R2030Q 52 AR452-04 2005-2006del2 bp M669fs 6089G→A R2030Q 40 AR455-05 [1622T→C;3113C→T] [L541P;A1038V] 43 AR474-02 36 AR516-01a 5196+1G→A I1732splice 3113C→T A1038V 47 AR518-03 3322C→T R1108C 35 AR540-01a 4685T→C I1562T 51 AR594-02a 5196+1G→A I1732splice 36 AR606-04 3322C→T R1108C 2588G→C G863A 39 AR608-02 1025-1038del14 bp D342fs 40 AR617-03 2827C→T R943W 39 AR632-02a 3386G→T R1129L 50 AR649-03 3303G→A W1101X 3113C→T A1038V 36 AR662-02a 1015T→G W339G 50 AR723-01a 3602T→G L1201R 65 Fig.1 Pedigrees of late-onset Stargardt disease families (filled symbols STGD1-affected individuals). Login to comment
79 Of note, subject AR448-01 with onset of STGD1 at 52 years was a compound heterozygote for the nonsense allele R152X and missense allele R2030Q. Login to comment
80 The truncated R152X (454C→T) allele has been reported previously in the heterozygous state in one AMD patient (Zhang et al. 1999), one dominant STGD family (Zhang et al. 1999), and one late-onset STGD1/FFM patient (Souied et al. 1999b). Login to comment
143 In addition, evidence for modifier gene effects on ABCR has been suggested recently in a family with dominant STGD1 linked to chromosome 6q and in which some members are reported to carry an ABCR nonsense mutation, R152X (Zhang et al. 1999). Login to comment

[hide] A comprehensive survey of sequence variation in th... Am J Hum Genet. 2000 Oct;67(4):800-13. Epub 2000 Aug 24. Rivera A, White K, Stohr H, Steiner K, Hemmrich N, Grimm T, Jurklies B, Lorenz B, Scholl HP, Apfelstedt-Sylla E, Weber BH
A comprehensive survey of sequence variation in the ABCA4 (ABCR) gene in Stargardt disease and age-related macular degeneration.
Am J Hum Genet. 2000 Oct;67(4):800-13. Epub 2000 Aug 24., [PMID:10958763]

Abstract [show]
Stargardt disease (STGD) is a common autosomal recessive maculopathy of early and young-adult onset and is caused by alterations in the gene encoding the photoreceptor-specific ATP-binding cassette (ABC) transporter (ABCA4). We have studied 144 patients with STGD and 220 unaffected individuals ascertained from the German population, to complete a comprehensive, population-specific survey of the sequence variation in the ABCA4 gene. In addition, we have assessed the proposed role for ABCA4 in age-related macular degeneration (AMD), a common cause of late-onset blindness, by studying 200 affected individuals with late-stage disease. Using a screening strategy based primarily on denaturing gradient gel electrophoresis, we have identified in the three study groups a total of 127 unique alterations, of which 90 have not been previously reported, and have classified 72 as probable pathogenic mutations. Of the 288 STGD chromosomes studied, mutations were identified in 166, resulting in a detection rate of approximately 58%. Eight different alleles account for 61% of the identified disease alleles, and at least one of these, the L541P-A1038V complex allele, appears to be a founder mutation in the German population. When the group with AMD and the control group were analyzed with the same methodology, 18 patients with AMD and 12 controls were found to harbor possible disease-associated alterations. This represents no significant difference between the two groups; however, for detection of modest effects of rare alleles in complex diseases, the analysis of larger cohorts of patients may be required.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Nucleotide alterations occurring in sim- Table 2 ABCA4 Mutations Found in Patients with STGD and AMD and in Controls EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 3: 178GrA A60T 1 0 0 This study 179CrT A60E 1 0 0 This study 194GrA G65E 1 0 0 Fishman et al. (1999) 203CrT P68L 1 0 0 This study 214GrA G72R 1 0 0 This study 296insA Frameshift 2 0 0 This study 5: 454CrT R152X 1 0 0 This study 6: 634CrT R212C 1 0 0 Lewis et al. (1999) 688TrA C230S 1 0 0 This study 730delCT Frameshift 1 0 0 This study 740ArG N247S 1 0 0 This study 768GrT Splice 2 0 0 Maugeri et al. (1999) 8: 983ArT E328V 1a 0 0 This study 1086TrA Y362X 1 0 0 This study 10: 1317GrA W438X 1 0 0 This study 11: 1411GrA E471K 1 0 0 Lewis et al. (1999) 12: 1622TrC L541P 21a 1a 0 Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) 1715GrA R572Q 1a 0 0 Lewis et al. (1999) 13: 1819GrA G607R 1 0 0 This study 1903CrA Q635K 2a 0 0 This study 1903CrT Q635X 1 0 0 This study IVS13ϩ1GrA Splice 2 0 0 This study 14: 1957CrT R653C 1 0 0 This study 1988GrA W663X 1 0 0 This study 2041CrT R681X 4 0 0 Maugeri et al. (1999) 15: 2291GrA C764Y 1 0 0 This study 2292delT Frameshift 1a 0 0 This study 2295TrG S765R 1a 0 0 This study 16: 2564GrA W855X 1 0 0 Nasonkin et al. (1998) 17: 2588GrC Spliceb 17a 6 5 Allikmets et al. (1997a), Cremers et al. (1998), Lewis et al. (1999), Maugeri et al. (1999), Papaioannou et al. (2000) 18: 2701ArG T901A 0 2 0 This study 2741ArG H914A 0 0 1 This study 19: 2876CrT T959I 1 0 0 This study 20: IVS20ϩ5GrA Splice 1 0 0 This study 21: 3106GrA E1036K 1a 0 0 Nasonkin et al. (1998) 3113CrT A1038V 26a 4a 1 Allikmets et al. (1997a), Cremers et al. (1998), Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) T3187TrC S1063P 1 0 0 This study (Continued) 805 Table 2 Continued EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 22: 3292CrT R1097C 1 0 0 This study 3322CrT R1108C 4 0 0 Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999) 24: 3528insTGCA Frameshift 1 0 0 This study 25: 3808GrT E1270X 1 0 0 This study 27: 3898CrT R1300X 1 0 0 This study 28: IVS28ϩ5GrA Splice 1 0 0 This study 4139CrT P1380L 1 0 0 Lewis et al. (1999) 4195GrA E1399K 2 0 0 This study 4234CrT Q1412X 4 0 0 Maugeri et al. (1999) 29: 4289TrC L1430P 2 0 0 This study 4318TrG F1440V 1 0 0 This study 4328GrA R1443H 1 0 0 This study 30: 4457CrT P1486L 1 0 0 Lewis et al. (1999) 4463GrA C1488Y 1 0 0 This study 31: 4610CrT T1537M 1 0 0 This study 35: IVS35ϩ2TrA Splice 1 0 0 This study 36: 5065TrC S1689P 1 0 0 This study 5114GrT R1705L 1 0 0 This study IVS36ϩ1GrA Splice 1 0 0 This study 37: 5198TrC M1733T 0 0 1 This study 5242GrA G1748R 1 0 0 This study 5248CrT Q1750X 1 0 0 This study 5288TrC L1763P 1 0 0 This study 38: IVS38ϩ1GrA Splice 1 0 0 This study 40: 5653GrA E1885K 1 0 0 This study 5693GrA R1898H 5 2 1 Allikmets et al. (1997b), Lewis et al. (1999) IVS40ϩ5GrA Splice 8a 0 0 Cremers et al. (1998), Lewis et al. (1999), Maugeri et al. (1999) 42: 5882GrA G1961E 34 4 2 Allikmets et al. (1997b), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) 43: 5917delG Frameshift 3 0 0 This study 5923GrC G1975R 1 0 0 This study 5929GrA G1977S 1 0 0 Rozet et al. (1998), Lewis et al. (1999) 45: 6229CrG R2077G 1 0 0 This study 6229CrT R2077W 1 0 0 Allikmets et al. (1997a), Fishman et al. (1999), Lewis et al. (1999) 48: 6609CrA Y2203X 2 0 0 This study 6647GrT A2216V 0 0 1 This study a Mutation pairs occurring on a single haplotype. Login to comment

[hide] The ABCR gene in recessive and dominant Stargardt ... Genomics. 1999 Sep 1;60(2):234-7. Zhang K, Kniazeva M, Hutchinson A, Han M, Dean M, Allikmets R
The ABCR gene in recessive and dominant Stargardt diseases: a genetic pathway in macular degeneration.
Genomics. 1999 Sep 1;60(2):234-7., [PMID:10486215]

Abstract [show]
Stargardt disease (STGD) is a juvenile-onset macular dystrophy and can be inherited in an autosomal recessive or in an autosomal dominant manner. Genes involved in dominant STDG have been mapped to human chromosomes 13q (STGD2) and 6q (STGD3). Here, we identify a new kindred with dominant STGD and demonstrate genetic linkage to the STGD3 locus. Because of a more severe macular degeneration phenotype of one of the patients in this family, the gene responsible for the recessive STGD1, ABCR, was analyzed for sequence variants in all family members. One allele of the ABCR gene was shown to carry a stop codon-generating mutation (R152X) in three family members, including the one patient who had inherited also the dominant gene. A grandparent of that patient with the same ABCR mutation developed age-related macular degeneration (AMD), consistent with our earlier observation that some variants in the ABCR gene may increase susceptibility to AMD in the heterozygous state. Based on these results, we propose that there is a common genetic pathway in macular degeneration that includes genes for both recessive and dominant STGD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 One allele of the ABCR gene was shown to carry a stop codon-generating mutation (R152X) in three family members, including the one patient who had inherited also the dominant gene. Login to comment
36 This substitution creates a stop codon (R152X) in exon 5 of ABCR and, therefore, inactivates one allele of the gene. Login to comment
41 The identification of the R152X mutation in the AMD patient further supports the role of ABCR in predisposing patients to AMD in the heterozygous state. Login to comment
54 Segregation of the ABCR R152X variant in this pedigree is shown below as detected by SSCP analysis. Login to comment

[hide] Inner and outer retinal changes in retinal degener... Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768. Huang WC, Cideciyan AV, Roman AJ, Sumaroka A, Sheplock R, Schwartz SB, Stone EM, Jacobson SG
Inner and outer retinal changes in retinal degenerations associated with ABCA4 mutations.
Invest Ophthalmol Vis Sci. 2014 Mar 20;55(3):1810-22. doi: 10.1167/iovs.13-13768., [PMID:24550365]

Abstract [show]
PURPOSE: To investigate in vivo inner and outer retinal microstructure and effects of structural abnormalities on visual function in patients with retinal degeneration caused by ABCA4 mutations (ABCA4-RD). METHODS: Patients with ABCA4-RD (n = 45; age range, 9-71 years) were studied by spectral-domain optical coherence tomography (OCT) scans extending from the fovea to 30 degrees eccentricity along horizontal and vertical meridians. Thicknesses of outer and inner retinal laminae were analyzed. Serial OCT measurements available over a mean period of 4 years (range, 2-8 years) allowed examination of the progression of outer and inner retinal changes. A subset of patients had dark-adapted chromatic static threshold perimetry. RESULTS: There was a spectrum of photoreceptor layer thickness changes from localized central retinal abnormalities to extensive thinning across central and near midperipheral retina. The inner retina also showed changes. There was thickening of the inner nuclear layer (INL) that was mainly associated with regions of photoreceptor loss. Serial data documented only limited change in some patients while others showed an increase in outer nuclear layer (ONL) thinning accompanied by increased INL thickening in some regions imaged. Visual function in regions both with and without INL thickening was describable with a previously defined model based on photoreceptor quantum catch. CONCLUSIONS: Inner retinal laminar abnormalities, as in other human photoreceptor diseases, can be a feature of ABCA4-RD. These changes are likely due to the retinal remodeling that accompanies photoreceptor loss. Rod photoreceptor-mediated visual loss in retinal regionswith inner laminopathy at the stages studied did not exceed the prediction from photoreceptor loss alone.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Characteristics of the ABCA4-Related Retinal Disease Patients Patient Age at Visits, y Sex Allele 1 Allele 2 Previous Report*ߤ P1 9, 12 M E341G F608I P2 9, 15 M R681X C2150Y P28* P3ߥ 12 M N965S W821R P1ߤ P4 13, 16 M V256V T1526M P21*, P15ߤ P5 14, 20 F W1408R IVS40&#fe;5 G>A P49* P6ߥ 16 F V989A IVS28&#fe;5 G>T P17ߤ P7ߥ 16 M N965S W821R P18ߤ P8 18, 20 F Y362X IVS38-10 T>C P9ߥ 18 F V989A IVS28&#fe;5 G>T P10 18, 22 M G1961E R1129L P3ߤ P11 20 M R1640Q c.5174_5175insG P12ߥ 20 M G1961E G1961E/P68L P13 22, 25 M G863A IVS35&#fe;2 T>C P20ߤ P14 22, 24 F G1961E R152X P12*, P21ߤ P15ߥ 23 M G1961E G1961E/P68L P16 25, 27 M G1961E R152X P11* P17 26, 32 F L1940P R1129L P64* P18 27, 34 F R1925G A1038V/L541P P19 27, 29 M c.4530_4531insC R1705Q P52*, P5ߤ P20 28, 30 F G1961E A1038V/L541P P23ߤ P21 31, 35 M T1019M G1961E P34* P22ߥ 32, 37 M P1486L Deletion of exon 7 P25ߤ P23 33, 35 M G863A R1108C P29*, P6ߤ P24 34, 37 F IVS40&#fe;5 G>A V935A P32*, P7ߤ P25 34 M G1961E &#a7; P8ߤ P26 37, 43 F C54Y G863A P4* P27 39, 44 F G863A C1490Y P30*, P26ߤ P28 40 M G1961E C54Y P7*, P10ߤ P29 41 F IVS38-10 T>C E1087D P59* P30ߥ 43, 47 F G1961E V256V P23*, P11ߤ P31ߥ 47, 51 F P1486L Deletion of exon 7 P32 47 M Y245X Y245X P20* P33ߥ 48, 51 F G1961E V256V P22*, P12ߤ P34 48, 50 F c.3208_3209insTG IVS40&#fe;5 G>A P35 50, 54 M V1433I L2027F P50* P36ߥ 52, 55 F T1526M R2030Q P55*, P28ߤ P37 53, 59 F G1961E P1380L P47*, P13ߤ P38ߥ 53, 61 M L1940P IVS40&#fe;5 G>A P61* P39 58 M D600E R18W P2*, P14ߤ P40 59, 62 M E1122K G1961E P44* P41 59, 62 F R1640Q G1961E P58* P42ߥ 62 F T1526M R2030Q P54* P43ߥ 64, 68 M L1940P IVS40&#fe;5 G>A P62* P44 68 F R1108C IVS40&#fe;5 G>A P42* P45 71 F IVS38-10 T>C &#a7; Novel variants are bold and italicized. Login to comment