ABCA1 p.Ile883Met

[switch to full view]
Comments [show]
Publications
PMID: 22982414 [PubMed] Jiang M et al: "Meta-analysis on association between the ATP-binding cassette transporter A1 gene (ABCA1) and Alzheimer's disease."
No. Sentence Comment
9 34 Conclusions: In summary, there was no significant association detected between ABCA1 R219K, I883M and 35 R1587K polymorphisms and risk for AD.
X
ABCA1 p.Ile883Met 22982414:9:92
status: NEW
Login to comment

28 In consideration of the extensive role of ABCA1 in the develop- 77 ment of AD, we carried out a comprehensive meta-analysis on all eligible 78 case-control studies to estimate the overall AD risk of ABCA1 R219K 79 (rs2230806), I883M (rs4149313) and R1587K (rs2230808) polymor- 80 phisms as well as to quantify the between-study heterogeneity and po- 81 tential bias.
X
ABCA1 p.Ile883Met 22982414:28:227
status: NEW
Login to comment

63 For the R219K 155 polymorphism, 12 studies were available, including a total of 5372 156 cases and 5180 controls. For the I883M polymorphism, 5 studies in- 157 volved a total of 2118 cases and 1852 controls. For the R1587K poly- 158 morphism, 6 studies involved a total of 2942 cases and 2720 controls.
X
ABCA1 p.Ile883Met 22982414:63:122
status: NEW
Login to comment

78 t1:3 Study Year Ethnicity Genotyping method No. of case/control Diagnostic criterion Outcome Mean age of onset Mean age of case/control Gender of case/control (% male) Polymorphism t1:4 Wollmer 2003 Swedish Pyrosequencing 169/166 NINCDS-ADRDA LOAD; EOAD 70.1 73.5/69.0 42.0/51.0 R219K t1:5 Li 2004 American RT-PCR 418/376 NINCDS-ADRDA LOAD 75.5 77.5/NA 43.0/44.0 R219K, I883M, R1587K t1:6 Katzov 2004 Swedish; English DASH 974/751 NINCDS-ADRDA LOAD; EOAD 70.8 76.6/75.4 40.2/44.1 R219K, I883M, R1587K t1:7 Shibata 2006 North American SNAPshot 218/195 NINCDS-ADRDA LOAD 75.0 NA/73.1 47.0/48.0 R219K, I883M, R1587K t1:8 Kölsch 2006 German RFLP 241/294 DSM IV LOAD; EOAD NA 73.2/71.8 28.5/45.6 R219K t1:9 Wahrle 2007 American MassArray 1225/1431 AD patients LOAD NA NA/NA NA/NA R219K t1:10 Chu 2007 Chinese MassArray 272/278 NINCDS-ADRDA LOAD NA 78.0/72.0 51.0/70.1 R219K, I883M, R1587K t1:11 Wang 2007 Chinese RFLP 168/215 NINCDS-ADRDA LOAD; EOAD 69.3 73.5/72.3 46.0/41.4 R219K t1:12 Sundar 2007 American Pyrosequencing 992/699 NINCDS-ADRDA LOAD 72.3 NA/75.3 34.0/38.0 R219K t1:13 Rodríguez-Rodríguez 2007 Spainish TaqMan 371/436 NINCDS-ADRDA LOAD 72.3 75.8/80.8 34.0/31.0 R219K, I883M, R1587K t1:14 Li 2008 Canadian Affymetrix genechip 691/682 DSM IV LOAD 80.2 NA/NA 100/100 R1587K t1:15 Khorshid 2010 Iranian RFLP 154/162 DSM IV LOAD NA 78.5/77.1 40.9/38.9 R219K t1:16 Sun 2012 Chinese RFLP 321/349 DSM IV LOAD; EOAD NA 70.0/68.5 38.0/35.8 R219K t1:17 NA: Not available, DASH: Dynamic Allele Specific Hybridization, LOAD: Late-onset Alzheimer disease, EOAD: Early-onset Alzheimer disease, DSM-IV: Diagnostic and Statistical Manual of t1:18 Mental Disorders IV.
X
ABCA1 p.Ile883Met 22982414:78:370
status: NEW
X
ABCA1 p.Ile883Met 22982414:78:487
status: NEW
X
ABCA1 p.Ile883Met 22982414:78:599
status: NEW
X
ABCA1 p.Ile883Met 22982414:78:875
status: NEW
X
ABCA1 p.Ile883Met 22982414:78:1193
status: NEW
Login to comment

80 3 182 The data on genotypes of the R219K polymorphism among cases 183 and controls stratified by APOE ε4-allele status were available in 5 184 (including 2131 cases and 2343 controls) studies.
X
ABCA1 p.Ile883Met 22982414:80:355
status: NEW
X
ABCA1 p.Ile883Met 22982414:80:467
status: NEW
X
ABCA1 p.Ile883Met 22982414:80:574
status: NEW
X
ABCA1 p.Ile883Met 22982414:80:833
status: NEW
X
ABCA1 p.Ile883Met 22982414:80:1131
status: NEW
Login to comment

83 Association of I883M variant with AD 190 Overall, the per-allele OR of the 883M variant for AD was 1.10 191 (95% CI: 0.96-1.26; p=0.16; Fig. 3), with corresponding results for 192 heterozygous and homozygous of 1.12 (95% CI: 0.94-1.33; p=0.22) 193 and 1.21 (95% CI: 0.80-1.82; p=0.89), respectively. In the stratified 194 analysis by ethnicity and sample size, no significant associations be- 195 tween the I883M polymorphism and AD risk were detected in all ge- 196 netic models (Table 3).
X
ABCA1 p.Ile883Met 22982414:83:15
status: NEW
X
ABCA1 p.Ile883Met 22982414:83:407
status: NEW
Login to comment

87 t2:3 Sub-group analysis No. of data sets No. of case/control K allele Heterozygous Homozygous t2:4 OR (95% CI) P (Z) P (Q) I2 (%) OR (95% CI) P (Z) P (Q) I2 (%) OR (95% CI) P (Z) P (Q) I2 (%) t2:5 Total 15 5372/5180 1.03 (0.93-1.14) 0.56 0.01 23 1.07 (0.98-1.17) 0.12 0.43 10 0.95 (0.77-1.17) 0.62 0.06 21 t2:6 Ethnicity t2:7 Caucasian 11 4897/4669 1.04 (0.96-1.14) 0.32 0.18 14 1.09 (1.00-1.19) 0.06 0.64 0 1.02 (0.83-1.25) 0.87 0.18 19 t2:8 Asian 4 475/511 0.91 (0.72-1.16) 0.76 0.05 21 0.91 (0.61-1.36) 0.66 0.15 8 0.71 (0.38-1.30) 0.26 0.09 26 t2:9 Onset type t2:10 EOAD 2 244/293 1.06 (0.82-1.36) 0.68 0.55 5 1.16 (0.81-1.67) 0.42 0.93 0 1.02 (0.56-1.85) 0.95 0.53 0 t2:11 LOAD 10 3340/2785 1.06 (0.96-1.17) 0.27 0.19 16 1.14 (1.00-1.31) 0.06 0.51 12 0.99 (0.78-1.27) 0.94 0.15 17 t2:12 Mixed 4 1788/2102 0.92 (0.76-1.10) 0.35 0.06 33 0.92 (0.74-1.14) 0.44 0.17 19 0.85 (0.57-1.27) 0.43 0.07 22 t2:13 APOE status t2:14 ε4 carriers 5 1099/552 1.09 (0.93-1.28) 0.30 0.59 0 1.37 (0.96-1.96) 0.08 0.90 0 0.96 (0.66-1.40) 0.84 0.66 0 t2:15 ε4 non-carriers 5 1032/1791 0.97 (0.79-1.20) 0.80 0.07 24 1.07 (0.77-1.50) 0.67 0.04 57 0.88 (0.61-1.27) 0.49 0.13 18 t2:16 Sample size t2:17 b300 8 1334/1608 0.98 (0.85-1.14) 0.82 0.10 13 1.00 (0.85-1.18) 0.97 0.37 2 0.93 (0.67-1.29) 0.66 0.16 6 t2:18 ≥300 7 4038/3572 1.03 (0.91-1.17) 0.61 0.05 42 1.10 (1.00-1.22) 0.06 0.45 0 0.96 (0.71-1.30) 0.80 0.05 39 Fig. 3. Forest plot from the meta-analysis of Alzheimer's disease risk and ABCA1 I883M polymorphism (M versus I).
X
ABCA1 p.Ile883Met 22982414:87:1499
status: NEW
Login to comment

92 The statistical results still did not show publi- 210 cation bias in these studies for R219K (Begg test, P=0.67; Egger test, 211 P=0.83; Supplementary Fig. 4), I883M (Begg test, P=0.42; Egger 212 test, P=0.62; Supplementary Fig. 5) and R1587K (Begg test, P= 213 0.13; Egger test, P=0.49; Supplementary Fig. 6).
X
ABCA1 p.Ile883Met 22982414:92:150
status: NEW
X
ABCA1 p.Ile883Met 22982414:92:160
status: NEW
Login to comment

104 Second, many previous studies have shown that high Table 3 t3:1 t3:2 Main results of pooled ORs with CI for association of the I883M polymorphism and Alzheimer's disease risk in the meta-analysis.
X
ABCA1 p.Ile883Met 22982414:104:117
status: NEW
X
ABCA1 p.Ile883Met 22982414:104:127
status: NEW
Login to comment

122 Finally, 274 studies investigating I883M and R1587K are currently limited.
X
ABCA1 p.Ile883Met 22982414:122:35
status: NEW
Login to comment

127 282 To conclude, this meta-analysis suggests that the R219K, I883M 283 and R1587K polymorphisms of ABCA1 are not associated with AD 284 susceptibility.
X
ABCA1 p.Ile883Met 22982414:127:61
status: NEW
Login to comment

30 In consideration of the extensive role of ABCA1 in the development of AD, we carried out a comprehensive meta-analysis on all eligible case-control studies to estimate the overall AD risk of ABCA1 R219K (rs2230806), I883M (rs4149313) and R1587K (rs2230808) polymorphisms as well as to quantify the between-study heterogeneity and potential bias.
X
ABCA1 p.Ile883Met 22982414:30:216
status: NEW
Login to comment

65 For the R219K polymorphism, 12 studies were available, including a total of 5372 cases and 5180 controls. For the I883M polymorphism, 5 studies involved a total of 2118 cases and 1852 controls. For the R1587K polymorphism, 6 studies involved a total of 2942 cases and 2720 controls.
X
ABCA1 p.Ile883Met 22982414:65:114
status: NEW
Login to comment

85 Association of I883M variant with AD Overall, the per-allele OR of the 883M variant for AD was 1.10 (95% CI: 0.96-1.26; p=0.16; Fig. 3), with corresponding results for heterozygous and homozygous of 1.12 (95% CI: 0.94-1.33; p=0.22) and 1.21 (95% CI: 0.80-1.82; p=0.89), respectively. In the stratified analysis by ethnicity and sample size, no significant associations between the I883M polymorphism and AD risk were detected in all genetic models (Table 3).
X
ABCA1 p.Ile883Met 22982414:85:15
status: NEW
X
ABCA1 p.Ile883Met 22982414:85:381
status: NEW
Login to comment

88 Table 2 Main results of pooled ORs with CI for association of the R219K polymorphism and Alzheimer's disease risk in the meta-analysis. Sub-group analysis No. of data sets No. of case/control K allele Heterozygous Homozygous OR (95% CI) P (Z) P (Q) I2 (%) OR (95% CI) P (Z) P (Q) I2 (%) OR (95% CI) P (Z) P (Q) I2 (%) Total 15 5372/5180 1.03 (0.93-1.14) 0.56 0.01 23 1.07 (0.98-1.17) 0.12 0.43 10 0.95 (0.77-1.17) 0.62 0.06 21 Ethnicity Caucasian 11 4897/4669 1.04 (0.96-1.14) 0.32 0.18 14 1.09 (1.00-1.19) 0.06 0.64 0 1.02 (0.83-1.25) 0.87 0.18 19 Asian 4 475/511 0.91 (0.72-1.16) 0.76 0.05 21 0.91 (0.61-1.36) 0.66 0.15 8 0.71 (0.38-1.30) 0.26 0.09 26 Onset type EOAD 2 244/293 1.06 (0.82-1.36) 0.68 0.55 5 1.16 (0.81-1.67) 0.42 0.93 0 1.02 (0.56-1.85) 0.95 0.53 0 LOAD 10 3340/2785 1.06 (0.96-1.17) 0.27 0.19 16 1.14 (1.00-1.31) 0.06 0.51 12 0.99 (0.78-1.27) 0.94 0.15 17 Mixed 4 1788/2102 0.92 (0.76-1.10) 0.35 0.06 33 0.92 (0.74-1.14) 0.44 0.17 19 0.85 (0.57-1.27) 0.43 0.07 22 APOE status b5;4 carriers 5 1099/552 1.09 (0.93-1.28) 0.30 0.59 0 1.37 (0.96-1.96) 0.08 0.90 0 0.96 (0.66-1.40) 0.84 0.66 0 b5;4 non-carriers 5 1032/1791 0.97 (0.79-1.20) 0.80 0.07 24 1.07 (0.77-1.50) 0.67 0.04 57 0.88 (0.61-1.27) 0.49 0.13 18 Sample size b300 8 1334/1608 0.98 (0.85-1.14) 0.82 0.10 13 1.00 (0.85-1.18) 0.97 0.37 2 0.93 (0.67-1.29) 0.66 0.16 6 ࣙ300 7 4038/3572 1.03 (0.91-1.17) 0.61 0.05 42 1.10 (1.00-1.22) 0.06 0.45 0 0.96 (0.71-1.30) 0.80 0.05 39 Fig. 3. Forest plot from the meta-analysis of Alzheimer's disease risk and ABCA1 I883M polymorphism (M versus I).
X
ABCA1 p.Ile883Met 22982414:88:1543
status: NEW
Login to comment

121 Finally, studies investigating I883M and R1587K are currently limited.
X
ABCA1 p.Ile883Met 22982414:121:31
status: NEW
Login to comment

126 To conclude, this meta-analysis suggests that the R219K, I883M and R1587K polymorphisms of ABCA1 are not associated with AD susceptibility.
X
ABCA1 p.Ile883Met 22982414:126:57
status: NEW
Login to comment

PMID: 22668585 [PubMed] Kolovou V et al: "Association of gender, ABCA1 gene polymorphisms and lipid profile in Greek young nurses."
No. Sentence Comment
2 We analyzed SNPs in chromosome 9 such as rs2230806 (R219K) in the position 107620867, rs2230808 (R1587K) in the position 106602625 and rs4149313 (I883M) in the position 106626574 according to gender and lipid profile of Greek nurses.
X
ABCA1 p.Ile883Met 22668585:2:146
status: NEW
Login to comment

19 Several ABCA1 gene polymorphisms were identified such as rs2230806 (R219K) in the chromosomal position 107620867, rs2230808 (R1587K) in the chromosomal position 106602625 and rs4149313 (I883M) in the chromosomal position 106626574].
X
ABCA1 p.Ile883Met 22668585:19:186
status: NEW
Login to comment

34 DNA analysis and determination of blood lipids The ABCA1 gene polymorphisms (R219K, R1587K and I883M) were detected using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP`s).
X
ABCA1 p.Ile883Met 22668585:34:95
status: NEW
Login to comment

36 The oligonucleotide primers used for R219K and R1587K polymorphisms were described by Saleheen D et al. [7] and Tupitsina TV et al. [8] respectively. The oligonucleotide primers used for I883M polymorphism were 5`-GAGAAGAGCCACCCTGGTT- CCAACCAGAAGAGGAT-3` and 5`- AGAAAGGCAG- GAGACATCGCTT -3 as described by Clee SM et al. [9].
X
ABCA1 p.Ile883Met 22668585:36:187
status: NEW
Login to comment

42 The Kruskal - Wallis H statistic was employed in order to detect differences in lipid levels according to three different polymorphisms of ABCA1 gene (R219K, R1587K and I883M).
X
ABCA1 p.Ile883Met 22668585:42:169
status: NEW
Login to comment

53 Figure 1 Gel electrophoresis of I883M gene polymorphism.
X
ABCA1 p.Ile883Met 22668585:53:32
status: NEW
Login to comment

64 In the present study, we assessed more subjects, included men and evaluated one more polymorphism, namely rs4149313 (I883M).
X
ABCA1 p.Ile883Met 22668585:64:117
status: NEW
Login to comment

76 Table 2 Distribution of R219K, R1587K and I883M polymorphisms and allele frequencies according to sex Men(n = 87) Women(n = 360) P R219K RR 39 (17.3%) 186 (82.7%) 0.08* RK 45 (23.8%) 144 (76.2%) KK 3(9.4%) 29 (90.6%) R1587K RR 37 (17.5%) 174 (82.5%) 0.12* RK 45 (23.5%) 146 (76.5%) KK 5 (11.4%) 39 (88.6%) I883M II 64 (20.7%) 245 (79.3%) 0.66* IM 22 (17.2%) 106 (82.8%) MM 1 (12.5%) 7 (87.5 %) Allele frequencies for R219K polymorphism R allele frequency 0.71 0.72 0.85** K allele frequency 0.29 0.28 Allele frequencies for R1587K polymorphism R allele frequency 0.68 0.69 0.85** K allele frequency 0.32 0.31 Allele frequencies for I883M polymorphism I allele frequency 0.86 0.83 0.4** M allele frequency 0.17 0.14 Fisher`s exact test - **Test for equality of proportions.
X
ABCA1 p.Ile883Met 22668585:76:42
status: NEW
X
ABCA1 p.Ile883Met 22668585:76:306
status: NEW
X
ABCA1 p.Ile883Met 22668585:76:632
status: NEW
Login to comment

92 In this study we found according to gender that blood lipid levels did not Table 3 Blood lipid levels according to ABCA1 polymorphisms in all subjects ALL SUBJECTS (n = 447) Genotype Median IQR P† R219K Total cholesterol (mg/dl) RR 199 [160 - 239] 0.74 RK 194 [158 - 241] KK 205 [160-244] Triglycerides (mg/dl) RR 98 [65 - 162] 0.66 RK 98 [63 - 170] KK 95 [69 - 140] HDL cholesterol (mg/dl) RR 66 [51 - 80] 0.94 RK 64 [52.5 - 84] KK 63 [50.5 - 85] LDL cholesterol (mg/dl) RR 106 [78 - 131] 0.18 RK 104 [71.5 - 131] KK 118 [92-147] Apo A1 (mg/dl) RR 139 [108 - 180] 0.09 RK 152 [106-187] KK 164 [115-202] R1587K Total cholesterol (mg/dl) RR 190 [145 - 238] 0.08 RK 203 [170 - 241] KK 199 [158 - 222] Triglycerides (mg/dl) RR 95 [60 - 167] 0.35 RK 103 [68 - 168] KK 85 [69-150] HDL cholesterol (mg/dl) RR 65 [51 - 81] 0.73 RK 65 [53 - 83] KK 62 [47 - 85] LDL cholesterol (mg/dl) RR 100 [66 - 122] 0.0025 RK 114 [84 -139] KK 88 [87 - 89] Apo A1 (mg/dl) RR 145 [104 - 185] 0.78 RK 148 [109 - 180] KK 147 [107 - 194] I883M Total cholesterol (mg/dl) II 198 [155 - 240] 0.74 IM 198 [164 - 238] MM 197 [175 - 253] Triglycerides (mg/dl) II 99 [65 - 163] 0.49 IM 91 [62 - 171] MM 170 [78 - 233] HDL cholesterol (mg/dl) II 65 [51 - 82] 0.83 IM 64 [52 - 82] MM 68 [55 - 95] LDL cholesterol (mg/dl) II 105 [74 - 130] 0.52 IM 108 [81 - 133] MM 117 [64 - 132] Table 3 Blood lipid levels according to ABCA1 polymorphisms in all subjects (Continued) Apo A1 (mg/dl) II 143 [104 - 182] 0.62 IM 148 [109 - 184] MM 153 [111 - 200] HDL: high density lipoprotein, LDL: low density lipoprotein, Apo A1: apolipoprotein A1.
X
ABCA1 p.Ile883Met 22668585:92:1019
status: NEW
Login to comment

101 I883M polymorphism Tan et al. [19] studied the I883M variant in Malays and Chinese population.
X
ABCA1 p.Ile883Met 22668585:101:0
status: NEW
X
ABCA1 p.Ile883Met 22668585:101:47
status: NEW
X
ABCA1 p.Ile883Met 22668585:101:160
status: NEW
Login to comment

103 However, Clee et al. [9] did not find any difference according to lipid levels and genotypes in carriers of the I883M, although individuals with MM genotype had higher progression in minimum obstruction diameter and cardiac event rate compared with the II genotype individuals.
X
ABCA1 p.Ile883Met 22668585:103:101
status: NEW
X
ABCA1 p.Ile883Met 22668585:103:112
status: NEW
Login to comment

104 Hodoğlugil et al. [20] correlated the I883M variant with higher HDL-C concentration in both sexes.
X
ABCA1 p.Ile883Met 22668585:104:44
status: NEW
X
ABCA1 p.Ile883Met 22668585:104:971
status: NEW
Login to comment

105 Similarly, Jensen et al. [21] among younger women and Porchay-Baldérelli et al. [22] in population with type 2 diabetes mellitus found that the M allele of I883M was associated with higher HDL-C concentration.
X
ABCA1 p.Ile883Met 22668585:105:161
status: NEW
Login to comment

106 Additionally, Mantaring et al. [17] found some differences in allele frequency of I883M gene, which were also present between the highest and lowest HDL-C concentration groups (36% vs 20%; Ptrend = 0.05).
X
ABCA1 p.Ile883Met 22668585:106:49
status: NEW
X
ABCA1 p.Ile883Met 22668585:106:82
status: NEW
Login to comment

107 On the contrary, Kitjaroentham et al. [15] did not find any difference in HDL-C concentrations among I883M genotype polymorphism.
X
ABCA1 p.Ile883Met 22668585:107:39
status: NEW
X
ABCA1 p.Ile883Met 22668585:107:101
status: NEW
Login to comment

108 Although, this variant was common in Thai Table 4 Blood lipid levels according to ABCA1 polymorphisms in men MEN (n = 87) Genotype Median IQR P† R219K Total cholesterol (mg/dl) RR 199 [149 - 250] 0.86 RK 205 [164 - 258] KK 222 [122 - 240] Triglycerides (mg/dl) RR 125 [100 - 177] 0.58 RK 142 [97 - 196] KK 134 [50 - 163] HDL cholesterol (mg/dl) RR 61 [49 - 74] 0.28 RK 57 [46 - 81] KK 46 [45 - 48] LDL cholesterol (mg/dl) RR 109 [66 - 146] 0.84 RK 106 [76 - 150] KK 149 [67 - 159] Apo A1 (mg/dl) RR 112 [100 - 135] 0.58 RK 117 [95 - 168] KK 116 [81 - 180] R1587K Total cholesterol (mg/dl) RR 192 [146 - 273] 0.28 RK 206 [166 - 241] KK 122 [110 - 205] Triglycerides (mg/dl) RR 131 [79 - 199] 0.92 RK 131 [100 - 176] KK 153 [108 - 170] HDL cholesterol (mg/dl) RR 60 [51 - 74] 0.41 RK 58 [48 - 76] KK 45 [42 - 48] LDL cholesterol (mg/dl) RR 99 [70 - 150] 0.16 RK 119 [81 - 149] KK 67 [58-106] Apo A1 (mg/dl) RR 114 [94 - 156] 0.79 RK 116 [100 - 149] KK 100 [96 - 116] I883M Total cholesterol (mg/dl) II 201 [148 - 255] 0.27 IM 214 [180 - 241] MM 120 - Triglycerides (mg/dl) II 126 [84-177] 0.18 IM 169 [118 - 250] MM 152 - HDL cholesterol (mg/dl) II 59 [47 - 75] 0.44 IM 57 [48 - 78] MM 41 - LDL cholesterol (mg/dl) II 111 [70-148] 0.39 IM 105 [80 - 149] MM 49 - Table 4 Blood lipid levels according to ABCA1 polymorphisms in men (Continued) Apo A1 (mg/dl) II 110 [94 - 148] 0.14 IM 148 [107 - 169] MM 112 - HDL: high density lipoprotein, LDL: low density lipoprotein, Apo A1: apolipoprotein A1.
X
ABCA1 p.Ile883Met 22668585:108:972
status: NEW
Login to comment

111 Similarly, Frikke-Schmidt et al. [14] found that I883M did not affect HDL-C levels but predicted higher risk of CAD.
X
ABCA1 p.Ile883Met 22668585:111:49
status: NEW
Login to comment

112 Also, Sandhofer et al. [23] found that I883M variant showed no effect on plasma lipids or carotid atherosclerosis.
X
ABCA1 p.Ile883Met 22668585:112:39
status: NEW
Login to comment

124 Authors` contributions VK participated in the development of hypothesis, drafting of the manuscript and carried out the genetic analysis, AM participated in the molecular Table 5 Blood lipid levels according to ABCA1 polymorphisms in women WOMEN (n = 360) Genotype Median IQR P† R219K Total cholesterol (mg/dl) RR 200 [160 - 238] 0.64 RK 193 [155 - 238] KK 204 [163 - 249] Triglycerides (mg/dl) RR 89 [57 - 152] 0.88 RK 87 [61 - 159] KK 94 [70 - 134] HDL cholesterol (mg/dl) RR 66 [52 - 82] 0.84 RK 65 [55 - 85] KK 66 [55 - 85] LDL cholesterol (mg/dl) RR 105 [79 - 127] 0.18 RK 104 [70 - 126] KK 117 [93 - 141] Apo A1 (mg/dl) RR 145 [111 - 187] 0.16 RK 155 [110 - 194] KK 164 [122 - 204] R1587K Total cholesterol (mg/dl) RR 189 [145 - 231] 0.09 RK 203 [172 - 240] KK 203 [163 - 224] Triglycerides (mg/dl) RR 87 [57 - 146] 0.61 RK 96 [61 - 160] KK 81 [69 - 136] HDL cholesterol (mg/dl) RR 66 [51 - 82] 0.82 RK 67 [55 - 84] KK 64 [52 - 86] LDL cholesterol (mg/dl) RR 100 [66 - 121] 0.0053 RK 112 [85 - 132] KK 106 [83 - 133] Apo A1 (mg/dl) RR 152 [109 - 189] 0.59 RK 155 [114 - 188] KK 153 [116 - 194] I883M Total cholesterol (mg/dl) II 198 [156 - 237] 0.54 IM 196 [160 - 238] MM 214 [181 - 273] Triglycerides (mg/dl) II 90 [61-155] 0.45 IM 86 [58 - 148] MM 188 [73 - 274] HDL cholesterol (mg/dl) II 66 [52-82.5] 0.61 IM 66 [53 - 83] MM 73 [60 - 111] LDL cholesterol (mg/dl) II 104 [74 - 125] 0.34 IM 109 [83 - 132] MM 124 [66 - 134] Table 5 Blood lipid levels according to ABCA1 polymorphisms in women (Continued) Apo A1 (mg/dl) II 154 [111-189] 0.86 IM 149 [110 - 188] MM 166 [110 - 226] HDL: high density lipoprotein, LDL: low density lipoprotein, Apo A1: apolipoprotein A1.
X
ABCA1 p.Ile883Met 22668585:124:1107
status: NEW
Login to comment

18 ABCA1 protein is expressed in liver, macrophages, intestines, lungs etc. Several ABCA1 gene polymorphisms were identified such as rs2230806 (R219K) in the chromosomal position 107620867, rs2230808 (R1587K) in the chromosomal position 106602625 and rs4149313 (I883M) in the chromosomal position 106626574].
X
ABCA1 p.Ile883Met 22668585:18:259
status: NEW
Login to comment

31 DNA analysis and determination of blood lipids The ABCA1 gene polymorphisms (R219K, R1587K and I883M) were detected using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP`s).
X
ABCA1 p.Ile883Met 22668585:31:95
status: NEW
Login to comment

33 The oligonucleotide primers used for R219K and R1587K polymorphisms were described by Saleheen D et al. [7] and Tupitsina TV et al. [8] respectively. The oligonucleotide primers used for I883M polymorphism were 5`-GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT-3` and 5`- AGAAAGGCAG- GAGACATCGCTT -3 as described by Clee SM et al. [9].
X
ABCA1 p.Ile883Met 22668585:33:187
status: NEW
Login to comment

39 The Kruskal - Wallis H statistic was employed in order to detect differences in lipid levels according to three different polymorphisms of ABCA1 gene (R219K, R1587K and I883M).
X
ABCA1 p.Ile883Met 22668585:39:169
status: NEW
Login to comment

50 Figure 1 Gel electrophoresis of I883M gene polymorphism.
X
ABCA1 p.Ile883Met 22668585:50:32
status: NEW
Login to comment

61 In the present study, we assessed more subjects, included men and evaluated one more polymorphism, namely rs4149313 (I883M).
X
ABCA1 p.Ile883Met 22668585:61:117
status: NEW
Login to comment

73 Table 2 Distribution of R219K, R1587K and I883M polymorphisms and allele frequencies according to sex Men(n = 87) Women(n = 360) P R219K RR 39 (17.3%) 186 (82.7%) 0.08* RK 45 (23.8%) 144 (76.2%) KK 3(9.4%) 29 (90.6%) R1587K RR 37 (17.5%) 174 (82.5%) 0.12* RK 45 (23.5%) 146 (76.5%) KK 5 (11.4%) 39 (88.6%) I883M II 64 (20.7%) 245 (79.3%) 0.66* IM 22 (17.2%) 106 (82.8%) MM 1 (12.5%) 7 (87.5 %) Allele frequencies for R219K polymorphism R allele frequency 0.71 0.72 0.85** K allele frequency 0.29 0.28 Allele frequencies for R1587K polymorphism R allele frequency 0.68 0.69 0.85** K allele frequency 0.32 0.31 Allele frequencies for I883M polymorphism I allele frequency 0.86 0.83 0.4** M allele frequency 0.17 0.14 Fisher`s exact test - **Test for equality of proportions.
X
ABCA1 p.Ile883Met 22668585:73:42
status: NEW
X
ABCA1 p.Ile883Met 22668585:73:306
status: NEW
X
ABCA1 p.Ile883Met 22668585:73:632
status: NEW
Login to comment

89 In this study we found according to gender that blood lipid levels did not Table 3 Blood lipid levels according to ABCA1 polymorphisms in all subjects ALL SUBJECTS (n = 447) Genotype Median IQR Pߤ R219K Total cholesterol (mg/dl) RR 199 [160 - 239] 0.74 RK 194 [158 - 241] KK 205 [160-244] Triglycerides (mg/dl) RR 98 [65 - 162] 0.66 RK 98 [63 - 170] KK 95 [69 - 140] HDL cholesterol (mg/dl) RR 66 [51 - 80] 0.94 RK 64 [52.5 - 84] KK 63 [50.5 - 85] LDL cholesterol (mg/dl) RR 106 [78 - 131] 0.18 RK 104 [71.5 - 131] KK 118 [92-147] Apo A1 (mg/dl) RR 139 [108 - 180] 0.09 RK 152 [106-187] KK 164 [115-202] R1587K Total cholesterol (mg/dl) RR 190 [145 - 238] 0.08 RK 203 [170 - 241] KK 199 [158 - 222] Triglycerides (mg/dl) RR 95 [60 - 167] 0.35 RK 103 [68 - 168] KK 85 [69-150] HDL cholesterol (mg/dl) RR 65 [51 - 81] 0.73 RK 65 [53 - 83] KK 62 [47 - 85] LDL cholesterol (mg/dl) RR 100 [66 - 122] 0.0025 RK 114 [84 -139] KK 88 [87 - 89] Apo A1 (mg/dl) RR 145 [104 - 185] 0.78 RK 148 [109 - 180] KK 147 [107 - 194] I883M Total cholesterol (mg/dl) II 198 [155 - 240] 0.74 IM 198 [164 - 238] MM 197 [175 - 253] Triglycerides (mg/dl) II 99 [65 - 163] 0.49 IM 91 [62 - 171] MM 170 [78 - 233] HDL cholesterol (mg/dl) II 65 [51 - 82] 0.83 IM 64 [52 - 82] MM 68 [55 - 95] LDL cholesterol (mg/dl) II 105 [74 - 130] 0.52 IM 108 [81 - 133] MM 117 [64 - 132] Table 3 Blood lipid levels according to ABCA1 polymorphisms in all subjects (Continued) Apo A1 (mg/dl) II 143 [104 - 182] 0.62 IM 148 [109 - 184] MM 153 [111 - 200] HDL: high density lipoprotein, LDL: low density lipoprotein, Apo A1: apolipoprotein A1.
X
ABCA1 p.Ile883Met 22668585:89:1018
status: NEW
Login to comment

97 I883M polymorphism Tan et al. [19] studied the I883M variant in Malays and Chinese population.
X
ABCA1 p.Ile883Met 22668585:97:0
status: NEW
X
ABCA1 p.Ile883Met 22668585:97:47
status: NEW
Login to comment

99 However, Clee et al. [9] did not find any difference according to lipid levels and genotypes in carriers of the I883M, although individuals with MM genotype had higher progression in minimum obstruction diameter and cardiac event rate compared with the II genotype individuals.
X
ABCA1 p.Ile883Met 22668585:99:112
status: NEW
Login to comment

100 Hodo f;lugil et al. [20] correlated the I883M variant with higher HDL-C concentration in both sexes.
X
ABCA1 p.Ile883Met 22668585:100:43
status: NEW
Login to comment

102 Additionally, Mantaring et al. [17] found some differences in allele frequency of I883M gene, which were also present between the highest and lowest HDL-C concentration groups (36% vs 20%; Ptrend = 0.05).
X
ABCA1 p.Ile883Met 22668585:102:82
status: NEW
Login to comment

119 Authors` contributions VK participated in the development of hypothesis, drafting of the manuscript and carried out the genetic analysis, AM participated in the molecular Table 5 Blood lipid levels according to ABCA1 polymorphisms in women WOMEN (n = 360) Genotype Median IQR Pߤ R219K Total cholesterol (mg/dl) RR 200 [160 - 238] 0.64 RK 193 [155 - 238] KK 204 [163 - 249] Triglycerides (mg/dl) RR 89 [57 - 152] 0.88 RK 87 [61 - 159] KK 94 [70 - 134] HDL cholesterol (mg/dl) RR 66 [52 - 82] 0.84 RK 65 [55 - 85] KK 66 [55 - 85] LDL cholesterol (mg/dl) RR 105 [79 - 127] 0.18 RK 104 [70 - 126] KK 117 [93 - 141] Apo A1 (mg/dl) RR 145 [111 - 187] 0.16 RK 155 [110 - 194] KK 164 [122 - 204] R1587K Total cholesterol (mg/dl) RR 189 [145 - 231] 0.09 RK 203 [172 - 240] KK 203 [163 - 224] Triglycerides (mg/dl) RR 87 [57 - 146] 0.61 RK 96 [61 - 160] KK 81 [69 - 136] HDL cholesterol (mg/dl) RR 66 [51 - 82] 0.82 RK 67 [55 - 84] KK 64 [52 - 86] LDL cholesterol (mg/dl) RR 100 [66 - 121] 0.0053 RK 112 [85 - 132] KK 106 [83 - 133] Apo A1 (mg/dl) RR 152 [109 - 189] 0.59 RK 155 [114 - 188] KK 153 [116 - 194] I883M Total cholesterol (mg/dl) II 198 [156 - 237] 0.54 IM 196 [160 - 238] MM 214 [181 - 273] Triglycerides (mg/dl) II 90 [61-155] 0.45 IM 86 [58 - 148] MM 188 [73 - 274] HDL cholesterol (mg/dl) II 66 [52-82.5] 0.61 IM 66 [53 - 83] MM 73 [60 - 111] LDL cholesterol (mg/dl) II 104 [74 - 125] 0.34 IM 109 [83 - 132] MM 124 [66 - 134] Table 5 Blood lipid levels according to ABCA1 polymorphisms in women (Continued) Apo A1 (mg/dl) II 154 [111-189] 0.86 IM 149 [110 - 188] MM 166 [110 - 226] HDL: high density lipoprotein, LDL: low density lipoprotein, Apo A1: apolipoprotein A1.
X
ABCA1 p.Ile883Met 22668585:119:1106
status: NEW
Login to comment

PMID: 21839797 [PubMed] Ota M et al: "A polymorphism of the ABCA1 gene confers susceptibility to schizophrenia and related brain changes."
No. Sentence Comment
65 We found only four well-validated SNPs with a heterozygosity value of N0.10 in Asian populations: rs2230806 (R219K), rs2066718 (V771M), rs2066714 (I883M), and rs2230808 (R1587K).
X
ABCA1 p.Ile883Met 21839797:65:147
status: NEW
Login to comment

123 db SNP ID and aminoacid change Position⁎ Inter-SNP distance (bp) Gender Group N Genotype distribution (frequency) χ2 P Allele count (frequency) χ2 P HWE of Controls (df=1) R/R R/K K/K R K rs2230806 107620867 (-) All Schizophrenia 497 119 (0.24) 241 (0.48) 137 (0.28) 2.77 0.250 479 (0.48) 515 (0.52) 0.01 0.897 χ²=3.73 Arg219Lys exon 7 Controls 932 204 (0.22) 495 (0.53) 233 (0.25) 903 (0.48) 961 (0.52) P=0.053 M Schizophrenia 274 63 (0.23) 137 (0.50) 74 (0.27) 0.47 0.789 263 (0.48) 285 (0.52) 0.45 0.503 χ²=0.05 Controls 330 71 (0.22) 162 (0.49) 97 (0.29) 304 (0.46) 356 (0.54) P=0.827 F Schizophrenia 223 56 (0.25) 104 (0.47) 63 (0.28) 216 (0.48) 230 (0.52) χ²=6.81 Controls 602 133 (0.22) 333 (0.55) 136 (0.23) 599 (0.50) 605 (0.50) P=0.009 V/V V/M M/M V M rs2066718 107589255 31,612 All Schizophrenia 494 438 (0.89) 54 (0.11) 2 (0.00) 1.09 0.580 930 (0.94) 58 (0.06) 0.99 0.319 χ²=0.04 Val771Met exon 16 Controls 936 812 (0.87) 120 (0.13) 4 (0.00) 1744 (0.93) 128 (0.07) P=0.847 M Schizophrenia 273 242 (0.89) 29 (0.11) 2 (0.01) 1.70 0.428 513 (0.94) 33 (0.06) 0.50 0.480 χ²=0.30 Controls 333 287 (0.86) 45 (0.14) 1 (0.00) 619 (0.93) 47 (0.07) P=0.582 F Schizophrenia 221 196 (0.89) 25 (0.11) 0 (0.00) 1.32 0.518 417 (0.94) 25 (0.06) 0.60 0.437 χ²=0.03 Controls 603 525 (0.87) 75 (0.12) 3 (0.00) 1125 (0.93) 81 (0.07) P=0.856 I/I I/M M/M I M rs2066714 107586753 34,114 All Schizophrenia 487 208 (0.43) 212 (0.44) 67 (0.14) 3.86 0.145 628 (0.64) 346 (0.36) 1.75 0.186 χ²=0.91 Ile883Met exon 18 Controls 917 345 (0.38) 446 (0.49) 126 (0.14) 1136 (0.62) 698 (0.38) P=0.339 M Schizophrenia 266 115 (0.43) 116 (0.44) 35 (0.13) 3.23 0.199 346 (0.65) 186 (0.35) 0.87 0.335 χ²=2.40 Controls 330 122 (0.37) 168 (0.51) 40 (0.12) 412 (0.62) 248 (0.38) P=0.122 F Schizophrenia 221 93 (0.42) 96 (0.43) 32 (0.14) 1.23 0.542 282 (0.64) 160 (0.36) 0.62 0.430 χ²=0.002 Controls 587 223 (0.38) 278 (0.47) 86 (0.15) 724 (0.62) 450 (0.38) P=0.966 R/R R/K K/K R K rs2230808 107562804 58,063 All Schizophrenia 491 174 (0.35) 252 (0.51) 65 (0.13) 4.05 0.132 600 (0.61) 382 (0.39) 0.63 0.427 χ²=0.50 Arg1587Lys exon 35 Controls 923 367 (0.40) 422 (0.46) 134 (0.15) 1156 (0.63) 690 (0.37) P=0.478 M Schizophrenia 273 87 (0.32) 148 (0.54) 38 (0.14) 8.51 0.014 322 (0.59) 224 (0.41) 3.68 0.055 χ²=1.17 Controls 327 140 (0.43) 141 (0.43) 46 (0.14) 421 (0.64) 233 (0.36) P=0.278 F Schizophrenia 218 87 (0.40) 104 (0.48) 27 (0.12) 0.79 0.674 278 (0.64) 158 (0.36) 0.60 0.440 χ²=0.01 Controls 596 227 (0.38) 281 (0.47) 88 (0.15) 735 (0.62) 457 (0.38) P=0.945 HWE; Hardy-Weinberg equilibrium.
X
ABCA1 p.Ile883Met 21839797:123:1577
status: NEW
Login to comment

64 We found only four well-validated SNPs with a heterozygosity value of N0.10 in Asian populations: rs2230806 (R219K), rs2066718 (V771M), rs2066714 (I883M), and rs2230808 (R1587K).
X
ABCA1 p.Ile883Met 21839797:64:147
status: NEW
Login to comment

122 db SNP ID and aminoacid change PositionÌe; Inter-SNP distance (bp) Gender Group N Genotype distribution (frequency) c7;2 P Allele count (frequency) c7;2 P HWE of Controls (df=1) R/R R/K K/K R K rs2230806 107620867 (-) All Schizophrenia 497 119 (0.24) 241 (0.48) 137 (0.28) 2.77 0.250 479 (0.48) 515 (0.52) 0.01 0.897 c7;&#b2;=3.73 Arg219Lys exon 7 Controls 932 204 (0.22) 495 (0.53) 233 (0.25) 903 (0.48) 961 (0.52) P=0.053 M Schizophrenia 274 63 (0.23) 137 (0.50) 74 (0.27) 0.47 0.789 263 (0.48) 285 (0.52) 0.45 0.503 c7;&#b2;=0.05 Controls 330 71 (0.22) 162 (0.49) 97 (0.29) 304 (0.46) 356 (0.54) P=0.827 F Schizophrenia 223 56 (0.25) 104 (0.47) 63 (0.28) 216 (0.48) 230 (0.52) c7;&#b2;=6.81 Controls 602 133 (0.22) 333 (0.55) 136 (0.23) 599 (0.50) 605 (0.50) P=0.009 V/V V/M M/M V M rs2066718 107589255 31,612 All Schizophrenia 494 438 (0.89) 54 (0.11) 2 (0.00) 1.09 0.580 930 (0.94) 58 (0.06) 0.99 0.319 c7;&#b2;=0.04 Val771Met exon 16 Controls 936 812 (0.87) 120 (0.13) 4 (0.00) 1744 (0.93) 128 (0.07) P=0.847 M Schizophrenia 273 242 (0.89) 29 (0.11) 2 (0.01) 1.70 0.428 513 (0.94) 33 (0.06) 0.50 0.480 c7;&#b2;=0.30 Controls 333 287 (0.86) 45 (0.14) 1 (0.00) 619 (0.93) 47 (0.07) P=0.582 F Schizophrenia 221 196 (0.89) 25 (0.11) 0 (0.00) 1.32 0.518 417 (0.94) 25 (0.06) 0.60 0.437 c7;&#b2;=0.03 Controls 603 525 (0.87) 75 (0.12) 3 (0.00) 1125 (0.93) 81 (0.07) P=0.856 I/I I/M M/M I M rs2066714 107586753 34,114 All Schizophrenia 487 208 (0.43) 212 (0.44) 67 (0.14) 3.86 0.145 628 (0.64) 346 (0.36) 1.75 0.186 c7;&#b2;=0.91 Ile883Met exon 18 Controls 917 345 (0.38) 446 (0.49) 126 (0.14) 1136 (0.62) 698 (0.38) P=0.339 M Schizophrenia 266 115 (0.43) 116 (0.44) 35 (0.13) 3.23 0.199 346 (0.65) 186 (0.35) 0.87 0.335 c7;&#b2;=2.40 Controls 330 122 (0.37) 168 (0.51) 40 (0.12) 412 (0.62) 248 (0.38) P=0.122 F Schizophrenia 221 93 (0.42) 96 (0.43) 32 (0.14) 1.23 0.542 282 (0.64) 160 (0.36) 0.62 0.430 c7;&#b2;=0.002 Controls 587 223 (0.38) 278 (0.47) 86 (0.15) 724 (0.62) 450 (0.38) P=0.966 R/R R/K K/K R K rs2230808 107562804 58,063 All Schizophrenia 491 174 (0.35) 252 (0.51) 65 (0.13) 4.05 0.132 600 (0.61) 382 (0.39) 0.63 0.427 c7;&#b2;=0.50 Arg1587Lys exon 35 Controls 923 367 (0.40) 422 (0.46) 134 (0.15) 1156 (0.63) 690 (0.37) P=0.478 M Schizophrenia 273 87 (0.32) 148 (0.54) 38 (0.14) 8.51 0.014 322 (0.59) 224 (0.41) 3.68 0.055 c7;&#b2;=1.17 Controls 327 140 (0.43) 141 (0.43) 46 (0.14) 421 (0.64) 233 (0.36) P=0.278 F Schizophrenia 218 87 (0.40) 104 (0.48) 27 (0.12) 0.79 0.674 278 (0.64) 158 (0.36) 0.60 0.440 c7;&#b2;=0.01 Controls 596 227 (0.38) 281 (0.47) 88 (0.15) 735 (0.62) 457 (0.38) P=0.945 HWE; Hardy-Weinberg equilibrium.
X
ABCA1 p.Ile883Met 21839797:122:1560
status: NEW
Login to comment

PMID: 21300560 [PubMed] Jiang Z et al: "Genetic variation of the ATP-binding cassette transporter A1 and susceptibility to coronary heart disease."
No. Sentence Comment
7 However, no significant results were observed for I883M polymorphism of ABCA1 in all genetic models.
X
ABCA1 p.Ile883Met 21300560:7:50
status: NEW
Login to comment

33 Among them, two common polymorphisms in the coding region, which lead to a arginine→lysine substitution at exon 7 (R219K, rs2230806) and isoleucine→methionine substitution in exon 18 (I883M, rs4149313) were studied widely for their association with CHD susceptibility [8,9].
X
ABCA1 p.Ile883Met 21300560:33:196
status: NEW
Login to comment

35 In consideration of the extensive role of ABCA1 in the development of CHD, we carried out a comprehensive meta-analysis on all eligible case-control studies to estimate the overall CHD risk of ABCA1 R219K and I883M polymorphisms as well as to quantify the between-study heterogeneity and potential bias.
X
ABCA1 p.Ile883Met 21300560:35:209
status: NEW
Login to comment

38 Literature search and data extraction Genetic association studies published before the end of November 2010 on CHD and the R219K and I883M polymorphisms in the ABCA1 were sought through a search of PubMed, Web of Science, EMBASE, and CNKI (Chinese National Knowledge Infrastructure) database without language restrictions.
X
ABCA1 p.Ile883Met 21300560:38:133
status: NEW
Login to comment

49 The strength of association between R219K and I883M polymorphisms of ABCA1 and CHD risk was assessed by OR with the corresponding 95% confidence interval (CI).
X
ABCA1 p.Ile883Met 21300560:49:46
status: NEW
Login to comment

70 For the I883M polymorphism, 12 studies involved a total of 7189 cases and 23,350 controls.
X
ABCA1 p.Ile883Met 21300560:70:8
status: NEW
Login to comment

75 of cases/ controls Mean age of cases/ controls Gender component in cases/controls (% male) Diagnostic criterion Outcome Definition of control Control source Genotyping method HWE for control Qi [15] 2010 R219K Chinese 173/389 60.0/61.0 70.3/57.9 ≥50% stenosis CAD CAD- HB RFLP Y Doosti [16] 2010 R219K Iranian 207/84 49.1/55.1 83.1/59.6 NA CAD CAD- HB RFLP N Shi [17] 2009 R219K Chinese 132/157 61.7/61.1 NA/NA NA CHD CAD- HB RFLP Y Wang [18] 2009 R219K Chinese 150/139 53.5/51.1 80.0/64.7 ≥50% stenosis CHD CHD- HB RFLP N Porchay-Baldérelli [8] 2009 R219K, I883M French 482/2647 68.0/65.2 79.7/71.8 NA CHD CHD- PB allele-specific PCR Y Li [19] 2009 R219K Chinese 365/246 63.0/61.0 66.4/45.9 ≥50% stenosis CHD Healthy PB RFLP Y Zhang [20] 2008 R219K Chinese 162/186 68.3/63.5 74.7/66.1 ≥50% stenosis CHD CHD- HB RFLP Y Ni [21] 2008 R219K Chinese 260/248 63.5/62.1 64.6/66.1 ≥50% stenosis CHD CHD- HB RFLP N Liu [22] 2008 R219K Chinese 71/155 58.0/57.0 52.1/55.5 NA CHD Healthy, CHD- HB, PB RFLP Y Frikke-Schmidt [9] 2008 R219K, I883M Danish 2039/15,851 NA/NA NA IHD IHD- PB TaqMan Y Wang [23] 2008 R219K Chinese 321/294 NA/NA NA/NA ≥50% stenosis CHD CHD- HB RFLP Y Balcerzyk [24] 2007 R219K Pole 178/180 43.8/35.0 65.7/71.1 ≥50% stenosis CAD CAD- PB RFLP Y Jensen [25] 2007 I883M American 259/930 62.0/54.3 0/0 WHO CHD CHD- PB Probe Y Tsai [26] 2007 I883M Chinese 205/201 62.9/51.9 78.0/51.0 ≥50% stenosis CAD CAD- PB RFLP Y Nebel [27] 2007 I883M German 1090/728 NA/NA NA/NA ≥70% stenosis CHD Healthy PB TaqMan Y Andrikovics [28] 2006 R219K, I883M German 150/193 53.4/35.3 68.4/48.2 ≥50% stenosis CHD CHD- PB Probe Y Wang [29] 2006 R219K Chinese 234/198 64.9/62.5 61.1/59.1 ≥50% stenosis CHD CHD- HB RFLP Y Martin [30] 2006 R219K, I883M Spanish 100/100 NA/NA 100/100 NA MI CHD- HB NA Y Li [31] 2005 R219K Chinese 394/417 60.1/59.4 59.8/59.5 ≥50% stenosis CHD Healthy PB RFLP Y Woll [32] 2005 R219K American 838/257 49.5/48.3 NA/NA NA CAD Healthy PB RFLP Y Sun [33] 2005 R219K, I883M Chinese 224/248 63.7/59.6 66.9/55.2 ≥50% stenosis CHD CHD- PB RFLP Y Whiting [34] 2004 R219K American 2468/834 65.0/59.0 60.0/46.0 ≥70% stenosis CAD CAD- HB RFLP Y Wang [35] 2004 R219K Chinese 222/278 62.4/62.2 54.9/50.7 NA CHD Healthy PB RFLP Y Tregouet [36] 2004 R219K, I883M British 750/722 56.3/57.3 67.0/NA NA MI CHD- PB BigDye Y Zhao [37] 2004 R219K Chinese 236/251 NA/NA NA/NA NA CHD Healthy PB RFLP Y Bertolini [38] 2004 R219K Italian 97/97 53.9/53.8 58.8/58.8 ≥50% stenosis CAD CAD- PB RFLP Y Harada [39] 2003 R219K, I883M Janpanese 273/137 NA/NA NA/NA ≥50% stenosis CAD CAD- HB Probe Y Tan [40] 2003 I883M Chinese, Malays, Indians 616/640 58.4/45.1 100/100 ≥50% stenosis CAD Healthy PB RFLP Y Cenarro [41] 2003 R219K Spanish 216/158 53.3/67.9 66.7/41.8 NA CHD CHD- HB RFLP Y Evans [42] 2003 R219K German 114/629 55.5/43.4 71.1/53.3 NA CHD CHD- HB Probe Y Brousseau [43] 2001 R219K, I883M American 1014/1013 64.0/53.0 100/100 ≥50% stenosis CHD CHD- PB Probe Y NA: not available; MI: myocardial infarction; CAD: coronary artery disease; IHD: ischemic heart disease; RFLP: restriction fragment length polymorphisms; Y: yes; N: no; PB: population based; HB: hospital based; WHO: world health organization.
X
ABCA1 p.Ile883Met 21300560:75:574
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:577
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1062
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1068
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1320
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1328
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1396
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1404
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1493
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1502
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1600
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1610
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1801
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:1813
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:2053
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:2066
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:2343
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:2358
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:2603
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:2619
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:2693
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:2710
status: NEW
X
ABCA1 p.Ile883Met 21300560:75:2981
status: NEW
Login to comment

97 Subtotal (I-squared = 0.0%, p = 0.697) Frikke-Schmidt(Prospective) (2008) Tan (2003) Tregouet (2004) Other Caucasian Study Andrikovics (2006) 1.09 (0.98, 1.21) 0.98 (0.64, 1.51) 1.80 (0.94, 3.43) 1.03 (0.56, 1.89) ratio (95% CI) 0.79 (0.57, 1.10) 1.30 (0.76, 2.23) 1.31 (1.07, 1.61) 1.31 (1.04, 1.64) 1.08 (0.94, 1.24) 1.61 (0.81, 3.19) 0.89 (0.72, 1.11) 0.88 (0.42, 1.86) 1.14 (0.97, 1.33) 1.04 (0.60, 1.80) 1.11 (0.86, 1.44) 1.18 (1.02, 1.37) 1.04 (0.60, 1.80) 0.84 (0.66, 1.06) odds 0.35 (0.04, 3.19) 100.00 4.80 2.47 2.74 Weight 7.02 3.40 11.74 10.55 81.65 2.23 10.98 1.92 13.87 3.26 15.09 14.51 3.26 10.27 % 0.24 1.09 (0.98, 1.21) 0.98 (0.64, 1.51) 1.80 (0.94, 3.43) 1.03 (0.56, 1.89) ratio (95% CI) 0.79 (0.57, 1.10) 1.30 (0.76, 2.23) 1.31 (1.07, 1.61) 1.31 (1.04, 1.64) 1.08 (0.94, 1.24) 1.61 (0.81, 3.19) 0.89 (0.72, 1.11) 0.88 (0.42, 1.86) 1.14 (0.97, 1.33) 1.04 (0.60, 1.80) 1.11 (0.86, 1.44) 1.18 (1.02, 1.37) 1.04 (0.60, 1.80) 0.84 (0.66, 1.06) odds 0.35 (0.04, 3.19) 100.00 4.80 2.47 2.74 Weight 7.02 3.40 11.74 10.55 81.65 2.23 10.98 1.92 13.87 3.26 15.09 14.51 3.26 10.27 % 0.24 1 .2 1 5 Fig. 3. Forest plot (random-effects model) of CHD risk associated with ABCA1 I883M polymorphism using dominant genetic model.
X
ABCA1 p.Ile883Met 21300560:97:1180
status: NEW
Login to comment

102 Association of I883M variant with CHD Overall, the per-allele OR of the 883I variant for CHD was 1.08 (95% CI: 0.96-1.21), with corresponding results under dominant and recessive genetic models of 1.09 (95% CI: 0.98-1.21; Fig. 3) and 1.19 (95% CI: 0.95-1.48), respectively.
X
ABCA1 p.Ile883Met 21300560:102:15
status: NEW
Login to comment

104 In the stratified analysis by ethnicity, source of controls, genotyping methods, sample size and HWE status, no significant associations between the I883M polymorphism and CHD risk were detected in almost all genetic models (Table 3).
X
ABCA1 p.Ile883Met 21300560:104:149
status: NEW
Login to comment

113 Table 3 Results of meta-analysis for ABCA1 I883M polymorphism and CHD risk. Sub-group analysis No.
X
ABCA1 p.Ile883Met 21300560:113:43
status: NEW
Login to comment

123 In addition, we failed to detect any positive relationship between CHD and I883M polymorphism of the ABCA1 gene.
X
ABCA1 p.Ile883Met 21300560:123:75
status: NEW
Login to comment

150 Funnel plot for the association between ABCA1 I883M status and CHD risk (Begg test, P=0.71); Egger's test was also performed to investigate the symmetry of the funnel plot (P=0.23).
X
ABCA1 p.Ile883Met 21300560:150:46
status: NEW
Login to comment

152 In addition, our meta-analysis did not support an association of the I883M of ABCA1 with CHD.
X
ABCA1 p.Ile883Met 21300560:152:69
status: NEW
Login to comment

PMID: 20800056 [PubMed] Berge KE et al: "Mutations in APOA-I and ABCA1 in Norwegians with low levels of HDL cholesterol."
No. Sentence Comment
59 of patients (het/hom)a Mutation Nucleotide Exon/Intron (i) PolyPhen prediction (score) SNP rs ID, ref.# ABCA1 Missense 8/3 R219K c.656, GNA 7 Benign (0.489) rs2230806 0/1 R282Q c.845, GNA 9 Benign (0.592) Novel 1/0 V399A c.1196, TNC 11 Benign (0.040) rs9282543 1/0 M636V c.1906, ANG 15 Benign (0.418) Novel 3/0 V771M c.2311, GNA 16 Benign (0.931) rs2066718 2/0 V825I c.2473, GNA 17 Benign (0.440) rs2066715 3/1 I883M c.2649, ANG 18 Benign (0.147) rs2066714 1/0 C887F c.2660, GNT 19 Benign (0.888) Novel 3/0 E1172D c.3516, GNC 24 Benign (0.546) rs33918808 1/0 G1216V c.3647, GNT 25 Prob damb (2.154) Ref. [18] 1/0 L1244Q c.3731, TNA 25 Prob dam (2.269) Novel 1/0 C1477F c.4430, TNA 31 Prob dam (3.688) Ref. [17] 14/1 R1587K c.4760, ANT 35 Benign (0.284) rs2230808 1/0 V1674I c.5020, GNA 37 Benign (0.821) Novel 1/0 R1680Q c.5039, GNA 37 Poss damc (1.926) Ref. [17] 1/0 N1800H c.5398, ANC 40 Poss dam (1.845) Ref. [19] Nonsense/splice 1/0 IVS4+1, GNA c.302+1, GNA i4 - 1/0 C1429X c.4287, CNA 31 - 1/0 IVS32+1, GNA c.4559+1, GNA i32 - APOA-I 7/0 R160L c.551, GNT 4 Prob dam (2.491) Ref. [21] 1/0 del182K del c.616-618 AAG 4 - Novel a Het: heterozygote, hom: homozygote.
X
ABCA1 p.Ile883Met 20800056:59:411
status: NEW
Login to comment

78 Variants R219K, V399A, V771M, V825I, I883M, E1172D, and R1587K have been reported as single nucleotide polymorphisms (SNPs) (Table 1).
X
ABCA1 p.Ile883Met 20800056:78:37
status: NEW
Login to comment

80 In addition, R219K, V771M, V825I, I883M, E1172D, and R1587K have been found in similar frequencies in patients with low or high HDL cholesterol levels [18], indicating that these variants do not cause low HDL cholesterol levels.
X
ABCA1 p.Ile883Met 20800056:80:34
status: NEW
Login to comment

PMID: 20188211 [PubMed] Koldamova R et al: "The role of ATP-binding cassette transporter A1 in Alzheimer's disease and neurodegeneration."
No. Sentence Comment
55 In almost all of the reports R219K (rs2230806), I883M (rs4149313), and R1587K (rs2230808) variants are the most extensively investigated since they give rise to amino acid changes, are common in the European population and are closely associated with the risk for CAD.
X
ABCA1 p.Ile883Met 20188211:55:48
status: NEW
Login to comment

PMID: 19596329 [PubMed] Frikke-Schmidt R et al: "Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population."
No. Sentence Comment
2387 Common ABCA1 variants in the general population 5.1. Frequency of common variants in the extreme tails of the HDL distribution Several resequencing studies have identified a number of common non-synonymous variations in ABCA1 [57,58,81-84]: R219K, V771M, V825I, I883M, E1172D and R1587K.
X
ABCA1 p.Ile883Met 19596329:2387:262
status: NEW
Login to comment

2395 Frequencies of common variants and association with variation in lipid levels in the general population Frequencies for the most common non-synonymous ABCA1 SNPs (R219K, V825I, I883M, R1587K) are largely similar across studies that partly or as a whole represent general populations [57,58,81,82,86-88], whereas the less common SNPs (V771M, and E1172D) are reported in some [57,58,81,82,86,88], but not in all studies [58,87].
X
ABCA1 p.Ile883Met 19596329:2395:177
status: NEW
Login to comment

2402 The HDL cholesterol and/or apoAI lowering effect of the rare allele of the very common R1587K SNP has now been observed in several different studies [57,81,82], whereas the HDL cholesterol increasing effect of the V771M and V825I/I883M SNPs appears to be confined to specific genders in different populations [57,58,87-89].
X
ABCA1 p.Ile883Met 19596329:2402:230
status: NEW
Login to comment

2404 The isolated single site analysis by Frikke-Schmidt et al. revealed that the V825I, and not the I883M SNP, was responsible for the HDL increments [57].
X
ABCA1 p.Ile883Met 19596329:2404:96
status: NEW
Login to comment

2410 Frikke-Schmidt et al. showed for the first time in a large general population sample that three out of six non-synonymous SNPs (V771M, I883M, and E1172D) were independent predictors of IHD risk - risk increases that were not reflected in levels of HDL cholesterol [85].
X
ABCA1 p.Ile883Met 19596329:2410:34
status: NEW
X
ABCA1 p.Ile883Met 19596329:2410:95
status: NEW
X
ABCA1 p.Ile883Met 19596329:2410:135
status: NEW
Login to comment

2411 By stepwise regression, V771M and I883M were shown to be the best predictors in women, whereas I883M and E1172D were most informative in men.
X
ABCA1 p.Ile883Met 19596329:2411:34
status: NEW
X
ABCA1 p.Ile883Met 19596329:2411:95
status: NEW
Login to comment

2413 Additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs with up to three-fold increases in risk for specific subsets of the genotypes (Fig. 4, lower panels) [85].
X
ABCA1 p.Ile883Met 19596329:2413:52
status: NEW
X
ABCA1 p.Ile883Met 19596329:2413:62
status: NEW
Login to comment

2441 For V771M, I883M, and E1172D as single sites, heterozygotes and homozygotes for the variant allele were pooled (heterozygotes and homozygotes in red, wildtype in green).
X
ABCA1 p.Ile883Met 19596329:2441:11
status: NEW
Login to comment

2444 Cumulative incidence plots are shown for cells with significant hazard ratios except for the I883M/E1172D AGCC genotype in men, because only 2 incident events occurred in this group.
X
ABCA1 p.Ile883Met 19596329:2444:93
status: NEW
Login to comment

2386 Common ABCA1 variants in the general population 5.1. Frequency of common variants in the extreme tails of the HDL distribution Several resequencing studies have identified a number of common non-synonymous variations in ABCA1 [57,58,81-84]: R219K, V771M, V825I, I883M, E1172D and R1587K.
X
ABCA1 p.Ile883Met 19596329:2386:262
status: NEW
Login to comment

2394 Frequencies of common variants and association with variation in lipid levels in the general population Frequencies for the most common non-synonymous ABCA1 SNPs (R219K, V825I, I883M, R1587K) are largely similar across studies that partly or as a whole represent general populations [57,58,81,82,86-88], whereas the less common SNPs (V771M, and E1172D) are reported in some [57,58,81,82,86,88], but not in all studies [58,87].
X
ABCA1 p.Ile883Met 19596329:2394:177
status: NEW
Login to comment

2401 The HDL cholesterol and/or apoAI lowering effect of the rare allele of the very common R1587K SNP has now been observed in several different studies [57,81,82], whereas the HDL cholesterol increasing effect of the V771M and V825I/I883M SNPs appears to be confined to specific genders in different populations [57,58,87-89].
X
ABCA1 p.Ile883Met 19596329:2401:230
status: NEW
Login to comment

2403 The isolated single site analysis by Frikke-Schmidt et al. revealed that the V825I, and not the I883M SNP, was responsible for the HDL increments [57].
X
ABCA1 p.Ile883Met 19596329:2403:96
status: NEW
Login to comment

2409 Frikke-Schmidt et al. showed for the first time in a large general population sample that three out of six non-synonymous SNPs (V771M, I883M, and E1172D) were independent predictors of IHD risk - risk increases that were not reflected in levels of HDL cholesterol [85].
X
ABCA1 p.Ile883Met 19596329:2409:135
status: NEW
Login to comment

2412 Additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs with up to three-fold increases in risk for specific subsets of the genotypes (Fig. 4, lower panels) [85].
X
ABCA1 p.Ile883Met 19596329:2412:52
status: NEW
X
ABCA1 p.Ile883Met 19596329:2412:62
status: NEW
Login to comment

2440 For V771M, I883M, and E1172D as single sites, heterozygotes and homozygotes for the variant allele were pooled (heterozygotes and homozygotes in red, wildtype in green).
X
ABCA1 p.Ile883Met 19596329:2440:11
status: NEW
Login to comment

2443 Cumulative incidence plots are shown for cells with significant hazard ratios except for the I883M/E1172D AGCC genotype in men, because only 2 incident events occurred in this group.
X
ABCA1 p.Ile883Met 19596329:2443:93
status: NEW
Login to comment

PMID: 19606474 [PubMed] Reynolds CA et al: "A survey of ABCA1 sequence variation confirms association with dementia."
No. Sentence Comment
120 From the outset, we were particularly interested in rs2230806 (R219K), rs2230808 (R1587K), and rs4149313 (I883M), becuase these are the only known common nonsynonymous variants (nsSNPs) in the region.
X
ABCA1 p.Ile883Met 19606474:120:106
status: NEW
Login to comment

PMID: 19059534 [PubMed] Porchay-Balderelli I et al: "Relationships between common polymorphisms of adenosine triphosphate-binding cassette transporter A1 and high-density lipoprotein cholesterol and coronary heart disease in a population with type 2 diabetes mellitus."
No. Sentence Comment
3 We studied 5 SNPs: +69CNT, +378GNC, R219K, I883M, and R1587K.
X
ABCA1 p.Ile883Met 19059534:3:43
status: NEW
Login to comment

4 The C allele of +378GNC was significantly associated with lower HDL-C concentrations (P = .04); and the M allele of I883M, with higher HDL-C concentrations (P = .03).
X
ABCA1 p.Ile883Met 19059534:4:116
status: NEW
Login to comment

27 We chose to study 2 noncoding SNPs located in 5' untranslated regions- +69CNT and +378GNC-and 3 nonsynonymous SNPs- R219K, I883M, and R1587K-based on their potential regulatory role or their influence on lipid levels or CHD, as described in other population studies [5].
X
ABCA1 p.Ile883Met 19059534:27:122
status: NEW
Login to comment

46 The I883M (rs4149313) and the R1587K (rs2230808) SNPs were genotyped using Taqman LNA probes (Applied Table 1 Baseline characteristics of subjects in the DIABHYCAR study as a function of the prevalence and incidence of CHD events Prevalent CHD (at entry) Incident CHD (during follow-up) Without With Without With n = 2647 n = 482 n = 2906 n = 223 % Male 71.8 79.7*** 72.8 75.8 Age (y) 65.2 ± 8.3 68.0 ± 8.0*** 65.4 ± 8.2 68.6 ± 9.1*** BMI (kg/m2 ) 29.4 ± 4.7 29.1 ± 4.4 29.4 ± 4.6 28.9 ± 4.6 % Smokers 15.1 10.4** 14.5 12.6 HbA1c (%) 7.87 ± 1.79 7.86 ± 1.64 7.85 ± 1.76 8.06 ± 1.83 Diabetes duration (y) 10.0 ± 7.6 11.8 ± 8.1*** 10.2 ± 7.7 11.5 ± 8.1** SBP (mm Hg) 145.0 ± 14.1 144.9 ± 14.0 144.8 ± 14.1 147.7 ± 13.2** DBP (mm Hg) 82.2 ± 8.4 81.7 ± 8.7 82.1 ± 8.5 82.7 ± 8.0 % Hypertension 54.4 66.0*** 55.5 65.0* Total cholesterol (mmol/L) 5.79 ± 1.08 5.83 ± 1.06 5.78 ± 1.06 5.98 ± 1.06** LDL-C (mmol/L) 3.52 ± 0.89 3.57 ± 0.86 3.51 ± 0.88 3.67 ± 0.94* HDL-C (mmol/L) 1.32 ± 0.36 1.28 ± 0.34* 1.32 ± 0.36 1.25 ± 0.29** TG (mmol/L) 1.89 (1.85-1.93) 2.00 (1.91-2.10)* 1.90 (1.86-1.93) 2.03 (1.90-2.17)* Serum creatinine (μmol/L) 86.5 (85.7-87.2) 90.1 (88.2-92.0)*** 86.7 (86.0-87.4) 91.9 (89.4-94.5)*** Urinary albumin (mg/L) 94.8 (90.9-99.0) 118.7 (106.5-132.4)*** 95.8 (91.9-99.8) 135.6 (113.7-161.7)*** Serum CRP (mg/L) 3.12 (2.99-3.25) 3.33 (3.02-3.67) 3.11 (2.99-3.24) 3.76 (3.27-4.34)** % Previous MI - - 5.0 11.7*** % Ramipril - - 49.6 49.5 % Lipid-lowering treatment 33.8 39.2⁎ 34.6 34.5 Data are presented as mean ± SD, geometric mean (95 % CI), or percentages, as appropriate.
X
ABCA1 p.Ile883Met 19059534:46:4
status: NEW
Login to comment

62 The M allele of the I883M SNP was associated with higher HDL-C levels (Table 3) (P b.05).
X
ABCA1 p.Ile883Met 19059534:62:20
status: NEW
Login to comment

77 The influence of +378GNC on HDL-C is consistent with the results we previously obtained for a sample from the French general population in the Data From an Epidemio- Table 2 Sequences of primers and probes used for genotyping ABCA1 SNPs SNP Primers (5'-3') Allele-specific probes (5'-3') +69CNT (rs1800977) a U: GAGGAGGGAGAGCACAGG Fam-GCGACAACTAGTCCCGGCAAAAGTCGC-dabcyl L: CTCACTCTCGCTCGCAATTA Tamra-GCGACAACTAGTCTCGGCAAAAGTCGC-dabcyl +378GNC (rs1800978) a U: CCTGCTGTGAGCTCTGG Fam-GCGACACGCTGGGGGTGCTGGCGTCGC-dabcyl L: AGGTTCTTCCACAGCAGCA Tamra-GCGACACGCTGGGCGTGCTGGCGTCGC-dabcyl R219K (rs2230806)a U: GATTCAACTTGGTGACCAAG Fam-GCGACCCTACCAAAGGAGAAACGTCGC-dabcyl L: GAACGAAGTACTCGCTCTGC Tamra-GCGACCCTACCAAGGGAGAAACGTCGC-dabcyl I883M (rs4149313)b U: CTACTGGTTTGGCGAGGAAA Fam-CTTTCTGATATTCTCTTC-Bhq L: AGCAGGAGGTCAACAGCACT Hex-CTTTCTGACATTCTCTTC-Bhq R1587K (rs2230808)b U: CCCTGCCAACTTTACCATGA Fam-CATTATTTTTGGTGTCC-Bhq L: CGATTTCTCAACAGCTTGGG Hex-CATTATTTCTGGTGTCC-Bhq a Molecular beacon.
X
ABCA1 p.Ile883Met 19059534:77:728
status: NEW
Login to comment

79 Table 3 High-density lipoprotein cholesterol levels (mean ± SD; in millimoles per liter) as a function of ABCA1 SNPs +69CNT +378GNC R219K I883M R1587K 0 1.30 ± 0.35 1.32 ± 0.36 1.31 ± 0.36 1.31 ± 0.35 1.33 ± 0.35 1 1.33 ± 0.37 1.30 ± 0.35 1.32 ± 0.35 1.34 ± 0.36 1.31 ± 0.36 2 1.31 ± 0.33 1.26 ± 0.24 1.33 ± 0.36 1.35 ± 0.33 1.29 ± 034 P .18 .04 .69 .03 .06 Trend test (multiple linear regression) with genotypes coded 0, 1, or 2 according to the number of minor alleles, adjusted for sex, age, BMI, smoking, HbA1c, and lipid-lowering treatment.
X
ABCA1 p.Ile883Met 19059534:79:142
status: NEW
Login to comment

83 The effects of I883M and R1587K on HDL-C levels are consistent with the results of various studies [14-19].
X
ABCA1 p.Ile883Met 19059534:83:15
status: NEW
Login to comment

96 The cholesterol efflux from cells in the arterial wall that have the potential to transform into foam cells, primarily macrophages, Table 4 Genotype distribution (percentage) of ABCA1 SNPs as a function of CHD, with P values for χ2 tests CHD history MI history Angina history Incident CHD Without With Without With Without With Without With n = 2647 n = 482 n = 2957 n = 172 n = 2750 n = 379 n = 2906 n = 223 CC 41.7 40.5 41.2 47.1 41.9 38.3 41.5 40.8 +69CNT CT 45.4 48.9 45.7 48.8 45.5 48.7 45.8 47.5 TT 13.0 10.6 13.1 4.1 12.5 13.0 12.7 11.7 P .23 .002 .40 .85 GG 75.3 74.6 75.3 73.5 75.2 74.8 75.2 74.9 +378GNC GC 22.9 23.5 22.8 25.3 23.0 22.8 22.9 23.3 CC 1.9 1.9 1.9 1.2 1.8 2.4 1.9 1.8 P .95 .63 .72 .99 RR 50.1 56.1 50.6 56.6 50.4 55.9 51.3 47.3 R219K RK 41.9 36.3 41.6 33.9 41.6 37.2 40.7 45.9 KK 8.0 7.6 7.8 9.5 8.1 7.0 8.0 6.8 P .05 .15 .13 .29 II 70.7 73.0 70.9 72.8 70.8 73.1 70.8 74.2 I883M IM 26.9 25.2 26.7 25.4 27.0 24.5 26.9 23.1 MM 2.4 1.9 2.3 1.8 2.3 2.4 2.3 2.7 P .56 .82 .61 .44 RR 54.8 51.2 54.3 53.5 54.8 50.4 54.0 57.5 R1587K RK 37.8 42.9 38.4 41.9 38.0 43.2 38.9 34.8 KK 7.3 5.9 7.3 4.7 7.2 6.4 7.1 7.7 P .09 .36 .16 .49 Table 5 Logistic regression analysis for CHD history (odds ratio with 95% CI) CHD MI Angina +69CNT Codominant 0.98 (0.84-1.14) P = .79 0.71 (0.56-0.91) P = .006 1.11 (0.94-1.30) P = .21 Recessive (TT vs C+) 0.83 (0.60-1.14) P = .26 0.28 (0.13-0.61) P = .001 1.10 (0.79-1.53) P = .57 R219K Codominant 0.86 (0.74-1.02) P = .08 0.92 (0.71-1.18) P = .50 0.86 (0.72-1.03) P = .10 Dominant (K+ vs RR) 0.80 (0.65-0.98) P = .03 0.81 (0.59-1.11) P = .19 0.82 (0.65-1.02) P = .08 R1587K Dominant (K+ vs RR) 1.22 (1.00-1.49) P = .06 1.04 (0.76-1.43) P = .79 1.27 (1.01-1.58) P = .04 Odds ratios (95% CI) for minor alleles of ABCA1 SNPs adjusted for age, sex, smoking, BMI, diabetes duration, hypertension, lipid-lowering treatment, serum creatinine, plasma triglyceride, and urinary albumin concentrations.
X
ABCA1 p.Ile883Met 19059534:96:903
status: NEW
Login to comment

PMID: 18706283 [PubMed] Iatan I et al: "Effect of ABCA1 mutations on risk for myocardial infarction."
No. Sentence Comment
74 To date, the largest study examining ABCA1 single nucleotide polymorphisms (SNPs) and HDL-C is the Copenhagen City Heart Study [24], in which the relationship between six ABCA1 nonsynonymous common SNPs (R219K, V771M, M825I, I883M, E1172D, and R1587K) and HDL-C was analyzed.
X
ABCA1 p.Ile883Met 18706283:74:225
status: NEW
Login to comment

112 Additional insights into the effects of ABCA1 on MI have recently been described by Frikke-Schmidt et al. [35•] in a study where six nonsynonymous ABCA1 SNPs, R219K, V771M, V825I, I883M, E1172D, and R1587K (identified by resequencing ABCA1 in 190 individuals of Danish ancestry [24]), were genotyped in 9259 individuals from the Copenhagen City Heart Study to assess their risk of CHD (Table 2).
X
ABCA1 p.Ile883Met 18706283:112:187
status: NEW
Login to comment

113 The principal finding of the study indicated that common genetic variation in ABCA1 predicts risk of CHD in the general population, but that their association was independent of plasma HDL-C levels: SNPs predicting increased MI risk were associated with either increases (V771 and V825I) or decreases (R1587K) in HDL-C, or no effect on HDL-C (R219K, I883M, E1172D).
X
ABCA1 p.Ile883Met 18706283:113:350
status: NEW
Login to comment

115 In addition, to determine which ABCA1 SNPs were independent predictors of CHD and not caused by linkage disequilibrium among SNPs, a stepwise Cox regression approach was performed identifying V771M, I883M, and E1172D as the most important for the final IHD prediction model.
X
ABCA1 p.Ile883Met 18706283:115:199
status: NEW
Login to comment

116 Additive effects on CHD risk were also observed for the V771M/I883M and I883M/E1172D pairs.
X
ABCA1 p.Ile883Met 18706283:116:62
status: NEW
X
ABCA1 p.Ile883Met 18706283:116:72
status: NEW
Login to comment

117 In fact, the I883M and E1172D SNPs were previously determined by Brousseau et al. [30] in a study of 2028 white men to have increased frequencies in cases compared with controls, in addition to detecting increased risk of future CHD events associated with the 1172D allele (Table 2).
X
ABCA1 p.Ile883Met 18706283:117:13
status: NEW
Login to comment

121 TD patients ( n = 5) 0.08 ± 0.05 ABCA1 heterozygous patients ( n = 77) 0.74 ± 0.24 Unaffected individuals ( n = 156) 1.31 ± 0.35 Brousseau et al. [30] / 2001 VA-HIT study, men with established CHD ( n = 1014) 0.83 ± 0.13 R219K, I883M, E1172D † Frequencies of the 3 ABCA1 variants were signifi cantly increased in VA-HIT.
X
ABCA1 p.Ile883Met 18706283:121:248
status: NEW
Login to comment

135 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Evans and Beil [41] / 2003 Patients attending a lipid outpatient clinic ( n = 813) R219K genotype: R219K † The K219 allele was signifi cantly protective against CHD in patients with hyperlipidemia and elevated Lp(a), as well as decreasing TG levels RR: 1.32 ± 0.03 RK: 1.34 ± 0.03 KK: 1.27 ± 0.31 Harada et al. [29] / 2003 Japanese patients ( n = 410) I883M genotype: I883M, R219K The I883M polymorphism was signifi cantly associated with higher HDL-C in Japanese patients, but not with CHD II: 1.16 ± 0.30 IM: 1.26 ± 0.42 MM: 1.27 ± 0.37; P = 0.05 R219K genotype: RR: 1.26 ± 0.41 RK: 1.25 ± 0.40 KK: 1.24 ± 0.35 Tan et al. [42] / 2003 Cases: Chinese ( n = 512), Malay ( n = 110), and Indian ( n = 164) men with established CHD Chinese: CAD: 0.89 ± 0.28, Ctl: 1.19 ± 0.32; P < 0.0005 C-14T, 237indelG, V825I † , M883I † , A8994G The V825I and M883I polymorphisms are positive markers for the CHD phenotype in Malays, but with no effect on HDL-C Malays: CAD: 0.83 ± 0.27, Ctl: 1.15 ± 0.27; P < 0.0005 Controls: Chinese ( n = 271), Malay ( n = 179), and Indian ( n = 231) men Indians: CAD: 0.79 ± 0.24, Ctl: 1.00 ± 0.26; P < 0.0005 Tregouet et al. [31] / 2004 Subgroup of ECTIM cohort ( n = 452 cases and n = 465 controls) NA C-564T, R219K † , R1587K ABCA1 polymorphisms, but not haplotypes, are involved in variability of apoA-I and the susceptibility to CHD.
X
ABCA1 p.Ile883Met 18706283:135:510
status: NEW
X
ABCA1 p.Ile883Met 18706283:135:526
status: NEW
X
ABCA1 p.Ile883Met 18706283:135:543
status: NEW
Login to comment

146 Noncarriers ( n = 9039) Women: 1.72 ± 0.01 Men: 1.38 ± 0.01 K776N carriers ( n = 37) Women: 1.82 ± 0.11 Men: 1.18 ± 0.09 P = 0.05 Martin et al. [37] / 2006 Cohort of males diagnosed with MI ( n = 170) NA C-477T † , R219K, I883M In long-term MI prognosis, the C-477T ABCA1 variant was associated with an unfavorable clinical evolution Controls: valvular patients with normal coronariography controls ( n = 100) *Studies reporting the initial molecular and biochemical characterization of fewer than 5 probands with an ABCA1 gene defect and their families were not included in Table 2.
X
ABCA1 p.Ile883Met 18706283:146:249
status: NEW
Login to comment

149 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Andrikovics et al. [45] / 2006 Hungarian patients with ischemic stroke ( n = 244) NA R219K † , V771M † , I883M A higher frequency of R219K and V771M was observed in controls than in Hungarian stroke patients, suggesting a protective role against CHD Hungarian patients with CHD ( n = 150) Controls (n = 193) Benton et al. [46] / 2007 Subgroup of Multi-Ethnic Study of Atherosclerosis study group ( n = 969) R219K genotype: C-565T, R219K † The R219K polymorphism was associated with a 28% lower prevalence of coronary calcifi cation, a measure of subclinical atherosclerosis, and slightly higher HDL-C level RR: 1.34 ± 0.38 RK: 1.29 ± 0.35 KK: 1.37 ± 0.39 Tsai et al. [47] / 2007 Taiwanese patients with CHD ( n = 205) and controls ( n = 201) Cases: 1.04 ± 0.25 I823M The M823 allele was associated with higher HDL-C.
X
ABCA1 p.Ile883Met 18706283:149:255
status: NEW
Login to comment

151 Ctl: 1.27 ± 0.31; P < 0.0001 Jensen et al. [48] / 2007 Subgroup of the Nurses` Health Study, with MI ( n = 249) or without ( n = 494) Median (range) C-565T † , G-191C † , C-17G, I883M, R1587K The C-565T and G-191C polymorphisms were inversely associated with the risk of CHD, independent of HDL-C.
X
ABCA1 p.Ile883Met 18706283:151:197
status: NEW
Login to comment

152 Cases: 1.70 (1.5-2.0) Ctl: 1.30 (1.1-1.6) Pasdar et al. [49] / 2007 White ischemic stroke patients ( n = 400) Cases: 1.20 ± 0.40 L158L, R219K, G316G, R1587K The ABCA1 gene was not found to be associated with ischemic stroke, but R219K had the greatest impact on lipid profi le, especially on LDL and TG White controls ( n = 487) Ctl: 1.40 ± 0.40 Nebel et al. [50] / 2007 German patients with CHD ( n = 1090) and controls ( n = 728) NA R219K, V771M, I883M † , E1172D, R1587K Only the I883M polymorphism was signifi cantly associated with CHD *Studies reporting the initial molecular and biochemical characterization of fewer than 5 probands with an ABCA1 gene defect and their families were not included in Table 2.
X
ABCA1 p.Ile883Met 18706283:152:459
status: NEW
X
ABCA1 p.Ile883Met 18706283:152:500
status: NEW
Login to comment

155 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Frikke-Schmidt et al. [35••] / 2008 Copenhagen City Heart Study: Women: R219K, V771M † , V825I † , I883M † , E1172D † , R1587K † Common genetic variation at the ABCA1 locus predicts IHD risk independently of plasma HDL-C levels.
X
ABCA1 p.Ile883Met 18706283:155:263
status: NEW
Login to comment

156 The V771M, I883M, and E1172D polymorphisms signifi cantly predicted IHD risk, but their association was not related to HDL-C.
X
ABCA1 p.Ile883Met 18706283:156:11
status: NEW
Login to comment

161 Taken together, the findings of this study show that three of the six nonsynonymous SNPs (V771M, I883M, and E1172D) in ABCA1 predict risk of IHD in the general population, and that ABCA1 may have proatherosclerosis effects independent of HDL-C levels [35•].
X
ABCA1 p.Ile883Met 18706283:161:97
status: NEW
Login to comment

PMID: 18803945 [PubMed] Sandhofer A et al: "The influence of two variants in the adenosine triphosphate-binding cassette transporter 1 gene on plasma lipids and carotid atherosclerosis."
No. Sentence Comment
1 We investigated the influence of the R219K and I883M variants in the ABCA1 gene on plasma lipids and carotid intima media thickness and plaque extent in 688 healthy men (40-60 years old).
X
ABCA1 p.Ile883Met 18803945:1:47
status: NEW
Login to comment

4 The I883M variant showed no effect on plasma lipids or carotid atherosclerosis.
X
ABCA1 p.Ile883Met 18803945:4:4
status: NEW
Login to comment

24 We investigated and report here the role of smoking on the influence of the R219K and I883M variants in the ABCA1 gene on plasma lipid levels and ultrasonographically quantified intima media thickness (IMT) and severity of atherosclerosis of the carotid artery in a cross-sectional cohort of 688 middle-aged men.
X
ABCA1 p.Ile883Met 18803945:24:86
status: NEW
Login to comment

43 The R219K and I883M status was determined using polymerase chain reaction-based restriction fragment length analysis, as described [5,6].
X
ABCA1 p.Ile883Met 18803945:43:14
status: NEW
Login to comment

50 Table 1 Clinical and laboratory characteristics R219K I883M RR (350) RK (274) KK (64) RK + KK II (522) IM (151) MM (15) IM + MM (166) Age (y) 50.0 (5.2) 49.4 (5.5) 50.9 (5.5) 49.7 (5.5) 50.1 (5.3) 49.2 (5.4) 47.9 (5.7) 49.1 (5.4) BMI (kg/m2 ) 27.2 (3.4) 27.2 (3.8) 26.9 (4.4) 27.2 (3.9) 27.2 (3.9) 27.1 (4.1) 26.3 (4.7) 27.0 (4.1) SBP (mm Hg) 130.9 (11.8) 129.4 (12.1) 130.9 (13.3) 129.7 (12.3) 130.7 (12.1 129.0 (11.9) 127.9 (12.2) 128.9 (11.9) DBP (mm Hg) 80.3 (7.4) 79.1 (7.1) 79.7 (6.5) 79.27 (7.0) 79.9 (7.1) 79.5 (7.6) 76.1 (5.2) 79.2 (7.4) Smoking (%)† 49.1 40.5 53.6 46.2 47.5 40.8 50.0 47.2 DM (%)† 4.9 4.7 0 3.8 4.4 4.0 6.7 4.2 TC (mg/dL) 230.5 (41.7) 225.5 (40.3) 228.5 (36.0) 226.1 (39.5) 226.9 (40.2) 233.0 (42.5) 234.1 (35.8) 233.1 (41.8) LDL-C (mg/dL) 148.2 (37.7) 144.2 (37.2) 150.0 (35.7) 145.3 (37.0) 145.2 (37.2) 151.5 (37.9) 155.0 (34.8) 151.8⁎ (37.5) HDL-C (mg/dL) 54.6 (13.2) 53.4 (12.9) 53.5 (11.4) 53.5 (12.7) 53.9 (13.0) 54.0 (13.0) 57.6 (11.9) 54.3 (12.9) TGs (mg/dL) 138.4 (92.0) 138.7 (81.0) 132.8 (74.5) 137.6 (79.7) 138.5 (87.2) 138.5 (85.7) 116.2 (45.6) 136.5 (83.0) Apo A-I (mg/dL) 149.0 (22.2) 148.7 (23.0) 148.8 (20.1) 148.7 (22.4) 148.8 (22.5) 148.7 (21.4) 150.9 (23.8) 148.9 (21.6) Apo B (mg/dL) 119.7 (25.4) 119.8 (25.5) 120.9 (25.7) 119.2 (25.5) 118.7 (24.8) 122.0 (18.0) 118.9 (19.5) 121.7 (27.3) LDL size (nm) 26.4 (1.11) 26.2 (1.17) 26.3 (1.28) 26.2 (1.19) 26.3 (1.14) 26.2 (1.20) 26.4 (0.88) 26.3 (1.17) Values are means (SD).
X
ABCA1 p.Ile883Met 18803945:50:54
status: NEW
Login to comment

68 Frequencies of the R219K and I883M variants Allele frequency was 29.2% for the K allele at position 219 and 13.1% for the M allele at position 883; carrier frequency was 49.1% for the K allele and 21.9% for the M allele.
X
ABCA1 p.Ile883Met 18803945:68:29
status: NEW
X
ABCA1 p.Ile883Met 18803945:68:96
status: NEW
Login to comment

69 Distribution of genotypes was in Hardy-Weinberg equilibrium (P = .30 and P = .33, for R219K and I883M, respectively).
X
ABCA1 p.Ile883Met 18803945:69:96
status: NEW
Login to comment

73 Effect of the R219K and I883M variants on plasma lipids and IMT Table 1 illustrates the clinical characteristics and laboratory parameters of the subjects according to the genotypes.
X
ABCA1 p.Ile883Met 18803945:73:16
status: NEW
X
ABCA1 p.Ile883Met 18803945:73:24
status: NEW
Login to comment

74 Carriers of the I883M variant had a higher LDL-C compared with men homozygous for the wild-type allele.
X
ABCA1 p.Ile883Met 18803945:74:16
status: NEW
X
ABCA1 p.Ile883Met 18803945:74:130
status: NEW
Login to comment

75 Carriers of the R219K variant had a lower IMT compared with noncarriers (781 ± 6 vs 802 ± 7 μm, P b.01), whereas the I883M variant had no effect on IMT (798 ± 9 vs 798 ± 6 μm, not significant [NS]) (Fig. 1).
X
ABCA1 p.Ile883Met 18803945:75:133
status: NEW
Login to comment

77 Effect of the R219K and I883M variants in combination on plasma lipids and IMT Furthermore, plasma lipids, apolipoproteins, and LDL size did not differ between the groups according to the combined carrier status of the 2 variants (Table 2).
X
ABCA1 p.Ile883Met 18803945:77:24
status: NEW
Login to comment

79 The R219K and I883M variants and IMT.
X
ABCA1 p.Ile883Met 18803945:79:14
status: NEW
Login to comment

85 Effect of the R219K and I883M variants on risk of atherosclerosis The risk of advanced atherosclerosis-defined as a plaque score of 3 and higher-was significantly reduced in carriers of the K allele (Table 3).
X
ABCA1 p.Ile883Met 18803945:85:24
status: NEW
Login to comment

90 The I883M variant had no effect on the risk of carotid atherosclerosis (Table 3).
X
ABCA1 p.Ile883Met 18803945:90:4
status: NEW
Login to comment

92 Effect of the R219K and I883M variants in combination on risk of atherosclerosis The reduced risk of advanced atherosclerosis observed in carriers of the K allele at position 219 was attenuated by the carrier status at position 883.
X
ABCA1 p.Ile883Met 18803945:92:24
status: NEW
X
ABCA1 p.Ile883Met 18803945:92:258
status: NEW
Login to comment

93 The unadjusted relative risk was 0.85 (95% CI, 0.72-1.00; P = .065) for carriers of the K allele alone, 1.04 (95% CI, 0.92-1.16; NS) for carriers of the M variant alone, and 0.87 (95% CI, 0.78-0.98; P b .05) for carriers of both variants, that is, R219K and I883M.
X
ABCA1 p.Ile883Met 18803945:93:258
status: NEW
Login to comment

110 The I883M variant had no influence irrespective of smoking history (Table 3).
X
ABCA1 p.Ile883Met 18803945:110:4
status: NEW
Login to comment

114 We therefore used this imaging technique to investigate the influence of the R219K and I883M variants in the ABCA1 gene on the extent of carotid atherosclerosis and plasma lipids in 688 middle-aged men.
X
ABCA1 p.Ile883Met 18803945:114:87
status: NEW
Login to comment

136 However, this possible effect of the R219K variant needs further investigation.
X
ABCA1 p.Ile883Met 18803945:136:4
status: NEW
Login to comment

137 The I883M variant had no effect on plasma lipids or carotid atherosclerosis in our study population.
X
ABCA1 p.Ile883Met 18803945:137:4
status: NEW
X
ABCA1 p.Ile883Met 18803945:137:234
status: NEW
Login to comment

138 This observation contrasts with previous studies reporting either an increased progression of CAD and increased risk of cardiac events without an effect on plasma lipids [6] or an increased HDL-C [5,36] in subjects homozygous for the I883M variant.
X
ABCA1 p.Ile883Met 18803945:138:234
status: NEW
Login to comment

140 To further investigate if the R219K variant is the causative variant, we combined the R219K carrier status with the I883M carrier status.
X
ABCA1 p.Ile883Met 18803945:140:116
status: NEW
Login to comment

143 However, in our population, the I883M variant itself had no effect on carotid atherosclerosis.
X
ABCA1 p.Ile883Met 18803945:143:32
status: NEW
Login to comment

67 Frequencies of the R219K and I883M variants Allele frequency was 29.2% for the K allele at position 219 and 13.1% for the M allele at position 883; carrier frequency was 49.1% for the K allele and 21.9% for the M allele.
X
ABCA1 p.Ile883Met 18803945:67:29
status: NEW
Login to comment

72 Effect of the R219K and I883M variants on plasma lipids and IMT Table 1 illustrates the clinical characteristics and laboratory parameters of the subjects according to the genotypes.
X
ABCA1 p.Ile883Met 18803945:72:24
status: NEW
Login to comment

76 Effect of the R219K and I883M variants in combination on plasma lipids and IMT Furthermore, plasma lipids, apolipoproteins, and LDL size did not differ between the groups according to the combined carrier status of the 2 variants (Table 2).
X
ABCA1 p.Ile883Met 18803945:76:24
status: NEW
Login to comment

78 The R219K and I883M variants and IMT.
X
ABCA1 p.Ile883Met 18803945:78:14
status: NEW
Login to comment

84 Effect of the R219K and I883M variants on risk of atherosclerosis The risk of advanced atherosclerosis-defined as a plaque score of 3 and higher-was significantly reduced in carriers of the K allele (Table 3).
X
ABCA1 p.Ile883Met 18803945:84:24
status: NEW
Login to comment

89 The I883M variant had no effect on the risk of carotid atherosclerosis (Table 3).
X
ABCA1 p.Ile883Met 18803945:89:4
status: NEW
Login to comment

91 Effect of the R219K and I883M variants in combination on risk of atherosclerosis The reduced risk of advanced atherosclerosis observed in carriers of the K allele at position 219 was attenuated by the carrier status at position 883.
X
ABCA1 p.Ile883Met 18803945:91:24
status: NEW
Login to comment

109 The I883M variant had no influence irrespective of smoking history (Table 3).
X
ABCA1 p.Ile883Met 18803945:109:4
status: NEW
Login to comment

113 We therefore used this imaging technique to investigate the influence of the R219K and I883M variants in the ABCA1 gene on the extent of carotid atherosclerosis and plasma lipids in 688 middle-aged men.
X
ABCA1 p.Ile883Met 18803945:113:87
status: NEW
Login to comment

139 To further investigate if the R219K variant is the causative variant, we combined the R219K carrier status with the I883M carrier status.
X
ABCA1 p.Ile883Met 18803945:139:116
status: NEW
Login to comment

142 However, in our population, the I883M variant itself had no effect on carotid atherosclerosis.
X
ABCA1 p.Ile883Met 18803945:142:32
status: NEW
Login to comment

PMID: 18468402 [PubMed] Ergen A et al: "Investigation of ABCA1 C69T and G-191C polymorphisms in coronary artery disease."
No. Sentence Comment
21 Martin et al. analyzed three polymorphisms of the ABCA1 gene (-477C/T, R219 K and I883M) in a cohort of young male survivors of MI in order to assess the influence of these polymorphisms on long-term prognosis (12).
X
ABCA1 p.Ile883Met 18468402:21:82
status: NEW
Login to comment

63 Jensen et al. indicated that the I883M variant was associated with higher HDL-cholesterol levels among younger women, with the -565C/T and the -191G/C variants being inversely associated with the risk of CHD among healthy women, without pronounced effects on plasma lipids (17).
X
ABCA1 p.Ile883Met 18468402:63:33
status: NEW
Login to comment

74 They found that the rare alleles of C-14T(C69T) and V771M polymorphisms were associated with higher HDL-C levels in men and, in combination with the rare alleles of R219K and I883M, respectively, with higher HDL-C in both sexes.
X
ABCA1 p.Ile883Met 18468402:74:175
status: NEW
Login to comment

PMID: 18199144 [PubMed] Slatter TL et al: "Novel rare mutations and promoter haplotypes in ABCA1 contribute to low-HDL-C levels."
No. Sentence Comment
9 The R1587K SNP was over-represented in low-HDL individuals, and the V825I and I883M SNPs over-represented in high-HDL individuals.
X
ABCA1 p.Ile883Met 18199144:9:78
status: NEW
Login to comment

20 The C-14T promoter SNP (17), and the R1587K coding SNP (9) have been associated with low HDL-C, while the V771M (9), V825I (9, 10) and I883M (10, 18) coding SNPs have been associated with elevated HDL-C.
X
ABCA1 p.Ile883Met 18199144:20:135
status: NEW
Login to comment

41 Genotyping of ABCA1 SNPs by RFLP Fourteen SNPs including five promoter SNPs (C-564T, G-407C, G-278C, G-99C, and C-14T), one 5#-UTR SNP [-76(-75) insG], six non-synonymous coding SNPs (R219K, V771M, V825I, I883M, E1172D, and R1587K) and two 3#-UTR SNPs [A-960G -383(-381)delGTT] were genotyped in the low-, mid-, and high-HDL-C groups by restriction fragment length polymorphism (RFLP) analysis.
X
ABCA1 p.Ile883Met 18199144:41:205
status: NEW
Login to comment

55 Six of the non-synonymous variants were previously reported SNPs (R219K, V771M, V825I, I883M, E1172D and R1587K).
X
ABCA1 p.Ile883Met 18199144:55:87
status: NEW
Login to comment

64 Two SNPs (V825I and I883M) were significantly over-represented in the high-HDL group [p ¼ 0.031 for I825 and p ¼ 0.030 for M883 (high vs low HDL-C)].
X
ABCA1 p.Ile883Met 18199144:64:20
status: NEW
Login to comment

98 Our study also identified two ABCA1 SNPs (V825I and I883M) that were over-represented in high-HDL individuals.
X
ABCA1 p.Ile883Met 18199144:98:52
status: NEW
Login to comment

105 a Coding haplotypes were derived from the following six non-synonymous SNPs (left to right): R219K (G.A), V771M (G.A), V825I (G.A), I883M (A.G), E1172D (G.C), and R1587K (G.A).
X
ABCA1 p.Ile883Met 18199144:105:132
status: NEW
Login to comment

PMID: 17951323 [PubMed] Frikke-Schmidt R et al: "Genetic variation in ABCA1 predicts ischemic heart disease in the general population."
No. Sentence Comment
7 Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels.
X
ABCA1 p.Ile883Met 17951323:7:130
status: NEW
Login to comment

8 Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD.
X
ABCA1 p.Ile883Met 17951323:8:45
status: NEW
Login to comment

10 A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs.
X
ABCA1 p.Ile883Met 17951323:10:49
status: NEW
X
ABCA1 p.Ile883Met 17951323:10:152
status: NEW
X
ABCA1 p.Ile883Met 17951323:10:163
status: NEW
X
ABCA1 p.Ile883Met 17951323:10:173
status: NEW
Login to comment

16 In the present study we included 9259 individuals from the 1991 to 1994 examination, whom we genotyped for all nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals of Danish ancestry.8 Information on diagnosis of IHD (nϭ1170; World Health Organization; International Classification of Diseases, 8th edition: codes 410 to 414; 10th edition: codes I20-I25) was collected and verified until 31st December 2000 by reviewing all hospital admissions and diagnoses entered in the national Danish Patient Registry, all causes of death entered in the national Danish Causes of Death Registry, and medical records from hospitals and general practitioners.
X
ABCA1 p.Ile883Met 17951323:16:152
status: NEW
Login to comment

29 The cohort was participants in The Copenhagen City Heart Study who attended the 1991 to 1994 examination, and for whom combined genotypes for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) were available as well as all clinical and biochemical data (nϭ9028 out of nϭ9259; Table 1).
X
ABCA1 p.Ile883Met 17951323:29:189
status: NEW
Login to comment

38 SNP Genotyping The ABI PRISM 7900HT Sequence Detection System (Applied Biosystem Inc) was used to genotype for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals, as previously described.8 Biochemical Analyses Colorimetric and turbidimetric assays (Hitachi autoanalyzer) were used to measure plasma levels of total cholesterol, HDL-C, triglycerides, and apolipoproteins B and -AI (all Boehringer Mannheim GmbH).
X
ABCA1 p.Ile883Met 17951323:38:158
status: NEW
Login to comment

55 Frikke-Schmidt et al ABCA1 and Ischemic Heart Disease 181 the entire ABCA1 gene in 190 individuals of Danish descent were: 0.26 (R219K), 0.03 (V771M), 0.03 (E1172D), 0.06 (V825I), 0.12 (I883M), and 0.24 (R1587K).8 Similar allele frequencies have been reported for other White populations.14 Please see Data Supplements, Expanded Results for description of Hardy-Weinberg equilibrium.
X
ABCA1 p.Ile883Met 17951323:55:176
status: NEW
X
ABCA1 p.Ile883Met 17951323:55:187
status: NEW
Login to comment

57 A strong positive DЈ was present for R219K/V771M, M825I/I883M, and E1172D/ R1587K (DЈϾ0.9), whereas a strong negative DЈ was present for R219K/V825I, V771M/V825I, and V771M/I883M (DЈϽ-0.9).
X
ABCA1 p.Ile883Met 17951323:57:62
status: NEW
X
ABCA1 p.Ile883Met 17951323:57:197
status: NEW
Login to comment

58 The r2 for the V825/I883M pair was 0.44 whereas the remaining SNP pairs had r2 Ͻ0.10 (Figure 1).
X
ABCA1 p.Ile883Met 17951323:58:20
status: NEW
Login to comment

60 Risk of IHD Prospective Study The cumulative incidence of IHD as a function of age was increased for V771M (GAϩAA versus GG, borderline Pϭ0.06), V825I (GAϩAA versus GG; Pϭ0.02), I883M (AGϩGG versus AA, Pϭ0.01), E1172D (GCϩCC versus GG, Pϭ0.03), and for R1587K (AA versus GG, borderline Pϭ0.06), but not for R219K (Figure 2).
X
ABCA1 p.Ile883Met 17951323:60:202
status: NEW
Login to comment

61 The age adjusted hazard ratios (HRs) for IHD were: V771M (GAϩAA versus GG) 1.2 (95% confidence interval [CI] 1.0 to 1.5), V825I (GAϩAA versus GG) 1.2 (1.0 to 1.5), I883M (AGϩGG versus AA) 1.2 (1.0 to 1.4), E1172D (GCϩCC versus GG) 1.3 (1.0 to 1.6) and R1587K (AA versus GG) 1.2 (1.0 to 1.6), respectively (Table 2).
X
ABCA1 p.Ile883Met 17951323:61:176
status: NEW
Login to comment

68 Probability values are for overall log-rank tests. For V771M, V825I, I883M, and E1172D, heterozygotes and homozygotes for the variant allele were pooled (combined genotype in red, common genotype in green).
X
ABCA1 p.Ile883Met 17951323:68:69
status: NEW
X
ABCA1 p.Ile883Met 17951323:68:137
status: NEW
Login to comment

71 There was evidence for a statistically significant interaction between gender and V771M (Pϭ0.04) in the prediction of IHD, whereas the remaining 5 SNPs did not interact with gender (all probability values Ͼ0.52).
X
ABCA1 p.Ile883Met 17951323:71:69
status: NEW
X
ABCA1 p.Ile883Met 17951323:71:118
status: NEW
Login to comment

74 The age-adjusted odds ratios (ORs) were: V771M (GAϩAA versus GG) 1.2 (0.9 to 1.5), V825I (GAϩAA versus GG) 1.2 (0.9 to 1.4), I883M (AGϩGG versus AA) 1.2 (1.0 to 1.4), E1172D (GCϩCC versus GG) 1.1 (0.8 to 1.4), and R1587K (GA versus GG) 1.2 (1.0 to 1.4).
X
ABCA1 p.Ile883Met 17951323:74:137
status: NEW
Login to comment

77 The final prediction model included the 3 noncorrelated SNPs, V771M, I883M, and E1172D (HRs: V771M, 1.2 [1.0 to 1.6]; I883M, 1.2 [1.0 to 1.4]; E1172D, 1.2 [1.0 to 1.6]).
X
ABCA1 p.Ile883Met 17951323:77:69
status: NEW
X
ABCA1 p.Ile883Met 17951323:77:118
status: NEW
Login to comment

78 Performing gender specific stepwise regression, V771M and I883M were the best predictors in women (HRs: V771M, 1.6 [1.2 to 2.3]; I883M, 1.3 [1.1 to 1.6]), whereas I883M and E1172D were best in men (HRs: I883M, 1.1 (1.0 to 1.4); E1172D, 1.3 (1.0 to 1.7).
X
ABCA1 p.Ile883Met 17951323:78:58
status: NEW
X
ABCA1 p.Ile883Met 17951323:78:129
status: NEW
X
ABCA1 p.Ile883Met 17951323:78:163
status: NEW
X
ABCA1 p.Ile883Met 17951323:78:203
status: NEW
Login to comment

82 R1587K was associated with a decrease in HDL-C of 0.03 mmol/L (PϽ0.005), whereas R219K, I883M, and E1172D were not associated with changes in HDL-C levels (Figure 3, upper panel).
X
ABCA1 p.Ile883Met 17951323:82:94
status: NEW
Login to comment

85 Risk of Ischemic Heart Disease as a Function of ABCA1 Genotype in the Prospective Study n, % Number of Events Incidence Rate (95% CI) per 10 000 Person-Years Hazard Ratio (95% CI) Observed Expected Age Adjusted HDL-C Adjusted Multifactorially Adjusted R219K GG 4863 (54) 603 603 64 (59-70) 1 1 1 GA 3461 (39) 429 426 64 (58-71) 1.0 (0.9-1.1) 1.0 (0.9-1.1) 1.0 (0.9-1.2) AA 641 (7) 75 79 64 (50-80) 1.0 (0.8-1.2) 1.0 (0.8-1.2) 1.0 (0.8-1.3) V771M GG 8379 (93) 1023 1040 64 (60-68) 1 1 1 GAϩAA 586 (7) 84 69 75 (60-93)* 1.2 (1.0-1.5) 1.3 (1.0-1.6) 1.2 (1.0-1.5) M825I GG 7959 (89) 962 988 63 (59-67) 1 1 1 GAϩAA 1006 (11) 145 122 76 (64-89)† 1.2 (1.0-1.5) 1.2 (1.0-1.5) 1.2 (1.0-1.4) I883M AA 6934 (77) 827 864 62 (58-66) 1 1 1 AGϩGG 2031 (23) 280 245 72 (64-81)† 1.2 (1.0-1.4) 1.2 (1.1-1.4) 1.2 (1.1-1.4) E1172D GG 8469 (94) 1026 1045 63 (59-67) 1 1 1 GCϩCC 496 (6) 81 64 86 (68-106)† 1.3 (1.0-1.6) 1.3 (1.0-1.6) 1.3 (1.0-1.6) R1587K GG 5216 (58) 626 645 62 (58-67) 1 1 1 GA 3213 (36) 399 396 65 (58-71) 1.0 (0.9-1.2) 1.0 (0.9-1.2) 1.0 (0.9-1.2) AA 536 (6) 82 68 82 (65-102)* 1.2 (1.0-1.6) 1.2 (1.0-1.5) 1.3 (1.0-1.6) Nonincident cases (nϭ63) were excluded, leaving 8965 individuals for the survival analyses and Cox regression.
X
ABCA1 p.Ile883Met 17951323:85:701
status: NEW
Login to comment

89 Rs numbers: R219K (rs2230806); V771M (rs2066718); V825I (rs2066715); I883M (rs4149313); E1172D (rs33918808); R1587K (rs2230808).
X
ABCA1 p.Ile883Met 17951323:89:69
status: NEW
Login to comment

97 Several studies have reported associations between V825I/ I883M and increased plasma HDL-C levels8,15,16 and associations between R1587K and a decreased HDL-C or apoAI.8,14,17 For in silico prediction of ABCA1 SNPs please see the Data Supplements Expanded Results.
X
ABCA1 p.Ile883Met 17951323:97:58
status: NEW
X
ABCA1 p.Ile883Met 17951323:97:93
status: NEW
Login to comment

98 The rare allele of the R219K SNP has previously been reported to be associated with decreased14,17 or increased risk of coronary heart disease.18 The present largest prospective results as well as a recent case-control study did not find any association with atherosclerosis susceptibility.19 In support of I883M and E1172D as 2 of the 3 most important ABCA1 SNPs for IHD prediction, a previous study of 2028 White men found increased frequencies in cases compared with controls, and also detected increased risk of future IHD events associated with the 1172D allele.18 The pairwise LD structure of the SNPs is important for the interpretation of the association results.
X
ABCA1 p.Ile883Met 17951323:98:307
status: NEW
Login to comment

102 The fact that the stepwise regression approach identified the V771M, I883M, and E1172D SNPs, which have very weak association between rare alleles (low r2 or negative DЈ), as important for the final IHD prediction model, supports that the observed findings for these 3 SNPs are not caused by LD.
X
ABCA1 p.Ile883Met 17951323:102:69
status: NEW
Login to comment

103 However, the single site result on IHD risk for V825I is most likely attributable to LD with I883M, and the findings for R1587K are most likely attributable to LD with E1172D, the latter also supported by the haplotype analysis presented in the Data Supplements, Table III and Expanded Results.
X
ABCA1 p.Ile883Met 17951323:103:93
status: NEW
Login to comment

1 Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels.
X
ABCA1 p.Ile883Met 17951323:1:130
status: NEW
Login to comment

2 Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD.
X
ABCA1 p.Ile883Met 17951323:2:45
status: NEW
Login to comment

4 A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs.
X
ABCA1 p.Ile883Met 17951323:4:49
status: NEW
X
ABCA1 p.Ile883Met 17951323:4:163
status: NEW
X
ABCA1 p.Ile883Met 17951323:4:173
status: NEW
Login to comment

23 The cohort was participants in The Copenhagen City Heart Study who attended the 1991 to 1994 examination, and for whom combined genotypes for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) were available as well as all clinical and biochemical data (nafd;9028 out of nafd;9259; Table 1).
X
ABCA1 p.Ile883Met 17951323:23:189
status: NEW
Login to comment

32 SNP Genotyping The ABI PRISM 7900HT Sequence Detection System (Applied Biosystem Inc) was used to genotype for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals, as previously described.8 Biochemical Analyses Colorimetric and turbidimetric assays (Hitachi autoanalyzer) were used to measure plasma levels of total cholesterol, HDL-C, triglycerides, and apolipoproteins B and -AI (all Boehringer Mannheim GmbH).
X
ABCA1 p.Ile883Met 17951323:32:158
status: NEW
Login to comment

49 Frikke-Schmidt et al ABCA1 and Ischemic Heart Disease 181 at Semmelweis University (Egyetem) on December 3, 2015 http://atvb.ahajournals.org/ Downloaded from the entire ABCA1 gene in 190 individuals of Danish descent were: 0.26 (R219K), 0.03 (V771M), 0.03 (E1172D), 0.06 (V825I), 0.12 (I883M), and 0.24 (R1587K).8 Similar allele frequencies have been reported for other White populations.14 Please see Data Supplements, Expanded Results for description of Hardy-Weinberg equilibrium.
X
ABCA1 p.Ile883Met 17951323:49:287
status: NEW
Login to comment

51 A strong positive Db18; was present for R219K/V771M, M825I/I883M, and E1172D/ R1587K (Db18;b0e;0.9), whereas a strong negative Db18; was present for R219K/V825I, V771M/V825I, and V771M/I883M (Db18;b0d;afa;0.9).
X
ABCA1 p.Ile883Met 17951323:51:62
status: NEW
X
ABCA1 p.Ile883Met 17951323:51:197
status: NEW
Login to comment

52 The r2 for the V825/I883M pair was 0.44 whereas the remaining SNP pairs had r2 b0d;0.10 (Figure 1).
X
ABCA1 p.Ile883Met 17951323:52:20
status: NEW
Login to comment

54 Risk of IHD Prospective Study The cumulative incidence of IHD as a function of age was increased for V771M (GAaf9;AA versus GG, borderline Pafd;0.06), V825I (GAaf9;AA versus GG; Pafd;0.02), I883M (AGaf9;GG versus AA, Pafd;0.01), E1172D (GCaf9;CC versus GG, Pafd;0.03), and for R1587K (AA versus GG, borderline Pafd;0.06), but not for R219K (Figure 2).
X
ABCA1 p.Ile883Met 17951323:54:202
status: NEW
Login to comment

62 Probability values are for overall log-rank tests. For V771M, V825I, I883M, and E1172D, heterozygotes and homozygotes for the variant allele were pooled (combined genotype in red, common genotype in green).
X
ABCA1 p.Ile883Met 17951323:62:69
status: NEW
Login to comment

72 Performing gender specific stepwise regression, V771M and I883M were the best predictors in women (HRs: V771M, 1.6 [1.2 to 2.3]; I883M, 1.3 [1.1 to 1.6]), whereas I883M and E1172D were best in men (HRs: I883M, 1.1 (1.0 to 1.4); E1172D, 1.3 (1.0 to 1.7).
X
ABCA1 p.Ile883Met 17951323:72:58
status: NEW
X
ABCA1 p.Ile883Met 17951323:72:129
status: NEW
X
ABCA1 p.Ile883Met 17951323:72:163
status: NEW
X
ABCA1 p.Ile883Met 17951323:72:203
status: NEW
Login to comment

76 R1587K was associated with a decrease in HDL-C of 0.03 mmol/L (Pb0d;0.005), whereas R219K, I883M, and E1172D were not associated with changes in HDL-C levels (Figure 3, upper panel).
X
ABCA1 p.Ile883Met 17951323:76:94
status: NEW
Login to comment

79 Risk of Ischemic Heart Disease as a Function of ABCA1 Genotype in the Prospective Study n, % Number of Events Incidence Rate (95% CI) per 10 000 Person-Years Hazard Ratio (95% CI) Observed Expected Age Adjusted HDL-C Adjusted Multifactorially Adjusted R219K GG 4863 (54) 603 603 64 (59-70) 1 1 1 GA 3461 (39) 429 426 64 (58-71) 1.0 (0.9-1.1) 1.0 (0.9-1.1) 1.0 (0.9-1.2) AA 641 (7) 75 79 64 (50-80) 1.0 (0.8-1.2) 1.0 (0.8-1.2) 1.0 (0.8-1.3) V771M GG 8379 (93) 1023 1040 64 (60-68) 1 1 1 GAaf9;AA 586 (7) 84 69 75 (60-93)* 1.2 (1.0-1.5) 1.3 (1.0-1.6) 1.2 (1.0-1.5) M825I GG 7959 (89) 962 988 63 (59-67) 1 1 1 GAaf9;AA 1006 (11) 145 122 76 (64-89)ߤ 1.2 (1.0-1.5) 1.2 (1.0-1.5) 1.2 (1.0-1.4) I883M AA 6934 (77) 827 864 62 (58-66) 1 1 1 AGaf9;GG 2031 (23) 280 245 72 (64-81)ߤ 1.2 (1.0-1.4) 1.2 (1.1-1.4) 1.2 (1.1-1.4) E1172D GG 8469 (94) 1026 1045 63 (59-67) 1 1 1 GCaf9;CC 496 (6) 81 64 86 (68-106)ߤ 1.3 (1.0-1.6) 1.3 (1.0-1.6) 1.3 (1.0-1.6) R1587K GG 5216 (58) 626 645 62 (58-67) 1 1 1 GA 3213 (36) 399 396 65 (58-71) 1.0 (0.9-1.2) 1.0 (0.9-1.2) 1.0 (0.9-1.2) AA 536 (6) 82 68 82 (65-102)* 1.2 (1.0-1.6) 1.2 (1.0-1.5) 1.3 (1.0-1.6) Nonincident cases (nafd;63) were excluded, leaving 8965 individuals for the survival analyses and Cox regression.
X
ABCA1 p.Ile883Met 17951323:79:700
status: NEW
Login to comment

83 Rs numbers: R219K (rs2230806); V771M (rs2066718); V825I (rs2066715); I883M (rs4149313); E1172D (rs33918808); R1587K (rs2230808).
X
ABCA1 p.Ile883Met 17951323:83:69
status: NEW
Login to comment

91 Several studies have reported associations between V825I/ I883M and increased plasma HDL-C levels8,15,16 and associations between R1587K and a decreased HDL-C or apoAI.8,14,17 For in silico prediction of ABCA1 SNPs please see the Data Supplements Expanded Results.
X
ABCA1 p.Ile883Met 17951323:91:58
status: NEW
Login to comment

92 The rare allele of the R219K SNP has previously been reported to be associated with decreased14,17 or increased risk of coronary heart disease.18 The present largest prospective results as well as a recent case-control study did not find any association with atherosclerosis susceptibility.19 In support of I883M and E1172D as 2 of the 3 most important ABCA1 SNPs for IHD prediction, a previous study of 2028 White men found increased frequencies in cases compared with controls, and also detected increased risk of future IHD events associated with the 1172D allele.18 The pairwise LD structure of the SNPs is important for the interpretation of the association results.
X
ABCA1 p.Ile883Met 17951323:92:307
status: NEW
Login to comment

96 The fact that the stepwise regression approach identified the V771M, I883M, and E1172D SNPs, which have very weak association between rare alleles (low r2 or negative Db18;), as important for the final IHD prediction model, supports that the observed findings for these 3 SNPs are not caused by LD.
X
ABCA1 p.Ile883Met 17951323:96:69
status: NEW
Login to comment

PMID: 17923263 [PubMed] Kitjaroentham A et al: "R219K polymorphism of ATP binding cassette transporter A1 related with low HDL in overweight/obese Thai males."
No. Sentence Comment
6 The presence of R219K and I883M genetic variant was determined by PCR-RFLP analysis in 112 overweight/obese and 117 control subjects of both sexes.
X
ABCA1 p.Ile883Met 17923263:6:26
status: NEW
Login to comment

11 On the contrary, there was no difference in HDL level among genotypes in I883M polymorphism.
X
ABCA1 p.Ile883Met 17923263:11:73
status: NEW
Login to comment

32 Some of these ABCA1 polymorphisms such as R219K (10) and I883M (9) are associated with increased HDL levels.
X
ABCA1 p.Ile883Met 17923263:32:57
status: NEW
Login to comment

34 Thus, we studied the prevalence of two frequently occurring common variants of the ABCA1 gene, R219K and I883M polymorphisms, and any association between these two polymorphisms and the lipid profiles of Thai overweight/obese subjects.
X
ABCA1 p.Ile883Met 17923263:34:105
status: NEW
Login to comment

53 I883M (A3044G) The forward primer was constructed for EcoRV recognition site (bold), 50 -GAG AAG AGC CAC CCT GGT TCC AAC CAG AAG AGG AT-30 and the reverse primer was 50 -AAG GCA GGA GAC ATC GCT T-30 .
X
ABCA1 p.Ile883Met 17923263:53:0
status: NEW
Login to comment

62 Obviously, carrier frequency was high, 60e65% for R219K and almost 90% for I883M.
X
ABCA1 p.Ile883Met 17923263:62:76
status: NEW
Login to comment

64 To determine whether the presence of the mutant allele of the two variants (K allele for R219K and M allele for I883M) affects the HDL levels of overweight/obese subjects compared with the control, the HDL levels of the obese and control groups were compared according to their genotype, as shown in Table 3.
X
ABCA1 p.Ile883Met 17923263:64:112
status: NEW
Login to comment

67 Bivariate logistic regression was used to test support for the suggestion that the low HDL levels found in overweight/obese men carrying the mutant R219K allele is the result of ABCA1 gene polymorphism.
X
ABCA1 p.Ile883Met 17923263:67:200
status: NEW
Login to comment

68 Table 4 shows the logistic regression and odds ratios for possible association between HDL at cutoff point 35 mg/dL and obesity, cholesterol, triglycerides, LDL, the two ABCA1 polymorphisms-R219K and I883M-and gender.
X
ABCA1 p.Ile883Met 17923263:68:200
status: NEW
Login to comment

73 No difference was observed between carriers and noncarriers of the M allele of the I883M polymorphism (data not shown).
X
ABCA1 p.Ile883Met 17923263:73:83
status: NEW
Login to comment

77 Our result was 61.61% in overweight/obese and 66.67% for R219K; for I883M, it was 87.5% and 90.18% for overweight/obese and control, respectively.
X
ABCA1 p.Ile883Met 17923263:77:68
status: NEW
Login to comment

80 Both polymorphisms appear to be more common among populations of Asian ethnicity than Westerners because R219K carrier frequency in Europeans is 46% (10).
X
ABCA1 p.Ile883Met 17923263:80:13
status: NEW
Login to comment

81 Furthermore, I883M is common in the Japanese as the carrier frequency is 65.4% (12).
X
ABCA1 p.Ile883Met 17923263:81:13
status: NEW
Login to comment

83 I883M SNP has been reported to be associated with variation in HDL level (9,10,12,13).
X
ABCA1 p.Ile883Met 17923263:83:0
status: NEW
X
ABCA1 p.Ile883Met 17923263:83:48
status: NEW
Login to comment

84 Although we did not find an association between I883M and any lipid parameter, new findings from a bioinformatics approach support the suggestion that this is still a functional variant.
X
ABCA1 p.Ile883Met 17923263:84:48
status: NEW
Login to comment

90 Frequency of the two ABCA1 SNPs-R219K and I883M-in overweight/obese and control subjects ABCA1 genotype Overweight/obese n (%) Control n (%) Odds ratio (95% CI) p value* R219K n 5 112 n 5 117 219RR 43 39 0.800 0.422 219RK þ KK 57þ12 (61.61%) 65þ13 (66.67%) (0.450e1.430) I883M n 5 112 n 5 112 883II 14 11 0.760 883IM þ MM 47þ51 (87.50%) 57þ44 (90.18%) (0.310e1.890) 0.520 *p value 0.05 or less was considered statistically significant.
X
ABCA1 p.Ile883Met 17923263:90:42
status: NEW
X
ABCA1 p.Ile883Met 17923263:90:286
status: NEW
Login to comment

104 Logistic regression results for relationship between HDL at cutoff point 35 mg/dL and obesity, cholesterol, triglycerides, LDL, ABCA1 polymorphisms at R219K and I883M, and gender Variables Odds ratio 95% CI p value* Obesity 0.365 0.027e4.971 0.449 Cholesterol 2.775 1.502e5.129 0.001 Triglycerides 0.817 0.724e0.920 0.001 LDL 0.358 0.192e0.665 0.001 R219K 0.824 0.089e7.622 0.864 I883M 0.634 0.027e14.942 0.777 Gender 1.816 0.173e19.111 0.619 *p value 0.05 or less was considered statistically significant.
X
ABCA1 p.Ile883Met 17923263:104:161
status: NEW
X
ABCA1 p.Ile883Met 17923263:104:380
status: NEW
Login to comment

112 In conclusion, our study showed that the R219K variant allele was associated with low levels of HDL in Thai overweight/obese men compared with their controls.
X
ABCA1 p.Ile883Met 17923263:112:9
status: NEW
Login to comment

113 However, I883M showed no association with any lipid profile parameters and both polymorphisms appear to be common variants among Thai and other Asian countries.
X
ABCA1 p.Ile883Met 17923263:113:9
status: NEW
Login to comment

31 Some of these ABCA1 polymorphisms such as R219K (10) and I883M (9) are associated with increased HDL levels.
X
ABCA1 p.Ile883Met 17923263:31:57
status: NEW
Login to comment

33 Thus, we studied the prevalence of two frequently occurring common variants of the ABCA1 gene, R219K and I883M polymorphisms, and any association between these two polymorphisms and the lipid profiles of Thai overweight/obese subjects.
X
ABCA1 p.Ile883Met 17923263:33:105
status: NEW
Login to comment

52 I883M (A3044G) The forward primer was constructed for EcoRV recognition site (bold), 50 -GAG AAG AGC CAC CCT GGT TCC AAC CAG AAG AGG AT-30 and the reverse primer was 50 -AAG GCA GGA GAC ATC GCT T-30 .
X
ABCA1 p.Ile883Met 17923263:52:0
status: NEW
Login to comment

61 Obviously, carrier frequency was high, 60e65% for R219K and almost 90% for I883M.
X
ABCA1 p.Ile883Met 17923263:61:77
status: NEW
Login to comment

63 To determine whether the presence of the mutant allele of the two variants (K allele for R219K and M allele for I883M) affects the HDL levels of overweight/obese subjects compared with the control, the HDL levels of the obese and control groups were compared according to their genotype, as shown in Table 3.
X
ABCA1 p.Ile883Met 17923263:63:112
status: NEW
Login to comment

72 No difference was observed between carriers and noncarriers of the M allele of the I883M polymorphism (data not shown).
X
ABCA1 p.Ile883Met 17923263:72:83
status: NEW
Login to comment

76 Our result was 61.61% in overweight/obese and 66.67% for R219K; for I883M, it was 87.5% and 90.18% for overweight/obese and control, respectively.
X
ABCA1 p.Ile883Met 17923263:76:68
status: NEW
Login to comment

82 I883M SNP has been reported to be associated with variation in HDL level (9,10,12,13).
X
ABCA1 p.Ile883Met 17923263:82:0
status: NEW
Login to comment

89 Frequency of the two ABCA1 SNPs-R219K and I883M-in overweight/obese and control subjects ABCA1 genotype Overweight/obese n (%) Control n (%) Odds ratio (95% CI) p value* R219K n 5 112 n 5 117 219RR 43 39 0.800 0.422 219RK &#fe; KK 57&#fe;12 (61.61%) 65&#fe;13 (66.67%) (0.450e1.430) I883M n 5 112 n 5 112 883II 14 11 0.760 883IM &#fe; MM 47&#fe;51 (87.50%) 57&#fe;44 (90.18%) (0.310e1.890) 0.520 *p value 0.05 or less was considered statistically significant.
X
ABCA1 p.Ile883Met 17923263:89:42
status: NEW
X
ABCA1 p.Ile883Met 17923263:89:283
status: NEW
Login to comment

103 Logistic regression results for relationship between HDL at cutoff point 35 mg/dL and obesity, cholesterol, triglycerides, LDL, ABCA1 polymorphisms at R219K and I883M, and gender Variables Odds ratio 95% CI p value* Obesity 0.365 0.027e4.971 0.449 Cholesterol 2.775 1.502e5.129 0.001 Triglycerides 0.817 0.724e0.920 0.001 LDL 0.358 0.192e0.665 0.001 R219K 0.824 0.089e7.622 0.864 I883M 0.634 0.027e14.942 0.777 Gender 1.816 0.173e19.111 0.619 *p value 0.05 or less was considered statistically significant.
X
ABCA1 p.Ile883Met 17923263:103:161
status: NEW
X
ABCA1 p.Ile883Met 17923263:103:380
status: NEW
Login to comment

PMID: 17368464 [PubMed] Jensen MK et al: "Common genetic variation in the ATP-binding cassette transporter A1, plasma lipids, and risk of coronary heart disease."
No. Sentence Comment
2 Three polymorphisms in the promoter region (-565C/T, -191G/C, and -17C/G) and two in the coding region (I883M and R1587K) were genotyped in the Nurses` Health Study.
X
ABCA1 p.Ile883Met 17368464:2:104
status: NEW
Login to comment

4 The I883M variant was associated with higher HDL-cholesterol levels among younger women.
X
ABCA1 p.Ile883Met 17368464:4:4
status: NEW
Login to comment

29 In total, three polymorphisms in the promoter: -565C/T (also referred to as -477C/T) [13,14], -191G/C (also known as C1176G) [17], and -17C/G (G1355C) [17], and two polymorphisms in the coding region: I883M in exon 18 (A2589G and I823M) [7,9], and R1587K in exon 35 [7] were genotyped in two well-characterized populations of female health professionals; the Nurses Health Studies I and II.
X
ABCA1 p.Ile883Met 17368464:29:201
status: NEW
Login to comment

50 Primers and probes used were designed by Applied Biosystems: -565C/T (rs2422493), -191G/C (rs1800976), -17C/G (rs2740483), I883M (rs4149313), and R1587K (rs2230808).Replicatequalitycontrolsampleswereincluded and genotyped with 100% concordance.
X
ABCA1 p.Ile883Met 17368464:50:123
status: NEW
Login to comment

84 Table 2 ABCA1 Genotype and allele distribution among cases and controls in the Nurses` Health Study I ABCA1 SNP n Cases (n = 249) n Controls (n = 494) B-allele frequency p* AA AB BB AA AB BB Cases Controls -565C/T 243 CC CT TT 484 CC CT TT T-allele frequency % 35 46 19 29 46 25 0.42 0.48 0.03 -191G/C 247 GG GC CC 492 GG GC CC C-allele frequency % 35 47 18 30 46 24 0.42 0.47 0.06 -17C/G 235 CC CG GG 477 CC CG GG G-allele frequency % 45 45 10 49 42 9 0.32 0.30 0.4 I883M 243 AA AG GG 482 AA AG GG M-allele frequency % 77 21 2 73 25 2 0.13 0.14 0.6 R1587K 246 GG GA AA 490 GG GA AA K-allele frequency % 58 37 5 56 38 6 0.23 0.25 0.6 Note: ABCA1 genotype frequencies in NHSII were as reported for NHSI controls.
X
ABCA1 p.Ile883Met 17368464:84:467
status: NEW
Login to comment

86 I883M: p = 0.004, and R1587K: p = 0.3).
X
ABCA1 p.Ile883Met 17368464:86:0
status: NEW
Login to comment

115 The I883M variant was associated with HDL-C concentrations among younger women, but not with CHD risk.
X
ABCA1 p.Ile883Met 17368464:115:4
status: NEW
Login to comment

118 0 ± 0.1 3.0 ± 0.1 GC 261 5.1 ± 0.1 1.0 ± 0.04 1.7 ± 0.02 2.8 ± 0.04 3.0 ± 0.0 CC 116 5.3 ± 0.1 1.0 ± 0.1 1.7 ± 0.03 3.1 ± 0.1 3.1 ± 0.1 p trend 0.9 0.4 0.2 0.5 0.4 -17C/G CC 267 5.2 ± 0.1 1.0 ± 0.04 1.7 ± 0.03 2.9 ± 0.04 3.0 ± 0.0 CG 236 5.1 ± 0.1 1.0 ± 0.04 1.7 ± 0.02 2.9 ± 0.1 3.1 ± 0.1 GG 51 5.3 ± 0.1 1.0 ± 0.1 1.8 ± 0.1 2.9 ± 0.1 2.9 ± 0.1 p trend 0.7 0.6 0.9 0.6 0.8 I883M AA 401 5.1 ± 0.04 1.0 ± 0.03 1.7 ± 0.02 2.9 ± 0.04 3.1 ± 0.0 AG 140 5.1 ± 0.1 1.0 ± 0.1 1.8 ± 0.04 2.7 ± 0.1 2.9 ± 0.1 GG 13 5.4 ± 0.2 1.1 ± 0.2 1.9 ± 0.1 2.9 ± 0.1 2.9 ± 0.1 p trend 0.8 0.6 <0.01 <0.01 0.02 R1587K GG 310 5.2 ± 0.1 1.0 ± 0.04 1.7 ± 0.02 2.9 ± 0.04 3.1 ± 0.0 GA 211 5.1 ± 0.1 1.0 ± 0.04 1.8 ± 0.03 2.8 ± 0.05 3.0 ± 0.1 AA 35 5.1 ± 0.1 0.8 ± 0.08 1.7 ± 0.1 2.8 ± 0.1 3.0 ± 0.1 p trend 0.2 0.01 0.4 0.1 0.1 Women ≥55 years of age -565C/T CC 105 5.8 ± 0.3 1.5 ± 0.1 1.5 ± 0.03 3.4 ± 0.1 3.9 ± 0.2 CT 173 7.0 ± 1.1 1.4 ± 0.06 1.6 ± 0.03 3.4 ± 0.1 4.6 ± 0.6 TT 100 6.4 ± 0.4 1.6 ± 0.1 1.5 ± 0.04 3.6 ± 0.1 4.4 ± 0.3 p trend 0.2 0.8 0.9 0.1 0.1 -191G/C GG 110 5.8 ± 0.3 1.5 ± 0.1 1.5 ± 0.03 3.5 ± 0.1 3.9 ± 0.1 GC 176 6.9 ± 1.0 1.4 ± 0.1 1.6 ± 0.03 3.4 ± 0.1 4.6 ± 0.6 CC 110 6.4 ± 0.4 1.6 ± 0.1 1.5 ± 0.04 3.7 ± 0.1 4.5 ± 0.3 p trend 0.2 0.6 0.7 0.2 0.03 -17C/G CC 187 6.2 ± 0.3 1.5 ± 0.1 1.5 ± 0.03 3.6 ± 0.1 4.3 ± 0.2 CG 153 6.9 ± 1.1 1.4 ± 0.1 1.5 ± 0.03 3.3 ± 0.1 4.6 ± 0.6 GG 34 5.7 &#xb1; 0.7 1.6 ± 0.1 1.6 ± 0.1 3.7 ± 0.2 4.3 ± 0.5 p trend 0.7 0.9 0.3 0.3 0.2 I883M AA 275 5.9 ± 0.1 1.5 ± 0.1 1.6 ± 0.03 3.4 ± 0.1 4.0 ± 0.1 AG 96 8.1 ± 2.0 1.5 ± 0.1 1.5 ± 0.04 3.6 ± 0.1 5.3 ± 1.1 GG 5 6.3 ± 0.4 3.0 ± 0.6 1.2 ± 0.1 3.6 ± 0.2 4.7 ± 0.4 p trend 0.3 0.3 0.1 0.1 0.3 R1587K GG 215 5.7 ± 0.2 1.5 ± 0.1 1.6 ± 0.02 3.4 ± 0.1 3.9 ± 0.1 GA 144 7.8 ± 1.7 1.5 ± 0.1 1.5 ± 0.03 3.5 ± 0.1 5.1 ± 0.9 AA 23 6.1 ± 0.5 1.6 ± 0.1 1.4 ± 0.1 3.6 ± 0.2 4.3 ± 0.3 p trend 0.2 0.9 0.4 0.6 0.2 Linear regression analyses were adjusted for age, smoking, BMI, alcohol intake, history of hypertension, parental history of CHD before age 60, diabetes at baseline, menopausal status and PMH.
X
ABCA1 p.Ile883Met 17368464:118:482
status: NEW
X
ABCA1 p.Ile883Met 17368464:118:509
status: NEW
X
ABCA1 p.Ile883Met 17368464:118:1867
status: NEW
X
ABCA1 p.Ile883Met 17368464:118:1970
status: NEW
Login to comment

121 Table 4 Odds ratios [OR] and 95% confidence intervals [CI] of coronary heart disease according to ABCA1 genotype in the Nurses` Health Study I SNP/inheritance Indicator Recessive Dominant Codominant AA AB BB AA/AB BB AA AB/BB Per B-allele -565C/T CC CT TT CC/CT TT CC CT/TT Cases/controls 86/142 112/222 45/120 198/364 45/120 86/142 157/342 OR (95% CI)a 1 0.8 (0.6-1.2) 0.6 (0.4-0.9) 1 0.7 (0.5-1.0) 1 0.7 (0.5-1.0) 0.8 (0.6-1.0) OR (95% CI)b 1 0.7 (0.5-1.1) 0.6 (0.4-0.9) 1 0.7 (0.5-1.1) 1 0.7 (0.5-1.0) 0.8 (0.6-1.0) -191G/C GG GC CC GG/GC CC GG GC/CC Cases/controls 87/150 115/224 45/118 202/374 45/118 87/150 160/342 OR (95% CI)a 1 0.9 (0.6-1.2) 0.6 (0.4-1.0) 1 0.7 (0.5-1.0) 1 0.8 (0.6-1.1) 0.8 (0.7-1.0) OR (95% CI)b 1 0.8 (0.5-1.1) 0.6 (0.4-1.0) 1 0.7 (0.5-1.1) 1 0.7 (0.5-1.0) 0.8 (0.6-1.0) -17C/G CC CG GG CC/CG GG CC CG/GG Cases/controls 106/233 106/200 23/44 212/433 23/44 106/233 129/244 OR (95% CI)a 1 1.2 (0.9-1.7) 1.1 (0.6-2.0) 1 1.0 (0.6-1.8) 1 1.2 (0.9-1.6) 1.1 (0.9-1.4) OR (95% CI)b 1 1.1 (0.7-1.5) 1.3 (0.7-2.4) 1 1.3 (0.7-2.3) 1 1.1 (0.8-1.6) 1.1 (0.9-1.5) I883M AA AG GG AA/AG GG AA AG/GG Cases/controls 184/353 54/121 5/8 238/474 5/8 184/353 59/129 OR (95% CI)a 1 0.8 (0.6-1.2) 1.3 (0.4-4.1) 1 1.4 (0.4-4.2) 1 0.9 (0.6-1.3) 0.9 (0.7-1.3) OR (95% CI)b 1 0.9 (0.6-1.4) 1.2 (0.3-4.5) 1 1.2 (0.3-4.6) 1 0.9 (0.6-1.4) 1.0 (0.7-1.4) R1587K GG GA AA GG/GA AA GG GA/AA Cases/controls 144/275 90/188 12/27 234/463 12/27 144/275 102/215 OR (95% CI)a 1 0.9 (0.6-1.2) 0.8 (0.4-1.7) 1 0.9 (0.4-1.8) 1 0.9 (0.7-1.2) 0.9 (0.7-1.2) OR (95% CI)b 1 0.9 (0.7-1.3) 0.7 (0.3-1.5) 1 0.7 (0.3-1.5) 1 0.9 (0.6-1.4) 0.9 (0.7-1.2) a Logistic regression models adjusted for age, smoking, time of blood draw.
X
ABCA1 p.Ile883Met 17368464:121:1078
status: NEW
Login to comment

135 Similarly discrepant results have been reported for other ABCA1 pro- Table 5 Pairwise linkage disequilibrium (D ) and correlation coefficient (r2) between ABCA1 polymorphisms Polymorphism Linkage disequilibrium (D ) -565C/T -191G/C -17C/G I883M R1587K Correlation coefficient (r2) -565C/T - 0.99 0.97 0.15 0.01 -191G/C 0.96 - 1.00 0.13 0.02 -17C/G 0.36 0.37 - 0.02 0.05 I883M 0.0 0.0 0.0 - 0.08 R1587K 0.0 0.0 0.0 0.0 - Note: Results presented from the Nurses` Health Study II (same estimates as among Nurses` Health Study I controls).
X
ABCA1 p.Ile883Met 17368464:135:239
status: NEW
X
ABCA1 p.Ile883Met 17368464:135:370
status: NEW
Login to comment

PMID: 17510946 [PubMed] Rodriguez-Rodriguez E et al: "Association of genetic variants of ABCA1 with Alzheimer's disease risk."
No. Sentence Comment
1 To evaluate the relationship between ABCA1 genetic variants and Alzheimer`s disease (AD), independently or in concert with the APOE e4 allele, we examined three ABCA1 polymorphisms located in the coding region (R219K, I883M, and R1587K) and two ABCA1 polymorphisms in the promoter region (CÀ14T and CÀ477T) in a group of 372 Spanish AD patients and 440 controls.
X
ABCA1 p.Ile883Met 17510946:1:218
status: NEW
Login to comment

16 We focused on the ABCA1 I883M, R1587K, and R219K variants in the coding region since these give rise to amino acid changes [Singaraja et al., 2003], they are common in European populations [Singaraja et al., 2003], and have been reported to alter the susceptibility to AD [Katzov et al., 2004; Sundar et al., 2006]; in addition, we examined two potentially functional polymorphisms (CÀ14T and CÀ477T) in the promoter region of ABCA1 gene [Hodoglugil et al., 2005; Kyriakou et al., 2005].
X
ABCA1 p.Ile883Met 17510946:16:24
status: NEW
Login to comment

35 Genotyping of ABCA1 I883M (rs 4149313), ABCA1 R1587K (rs 2230808), ABCA1 R219K (rs 2230806), ABCA1 CÀ14T (rs 1800977), and ABCA1 CÀ477T (rs 2422493) polymorphisms was performed by a Taq-Man single-nucleotide-polymorphism assay (Applied Biosystems, Warrington, Cheshire, UK) and an ABI PRISM 7000 sequence detection system (Applied Biosystems).
X
ABCA1 p.Ile883Met 17510946:35:20
status: NEW
Login to comment

43 RESULTS Control groups for ABCA1 I883M (P ¼ 0.16), ABCA1 R1587K (P ¼ 0.47), ABCA1 R219K (P ¼ 0.29), ABCA1 CÀ14T (P ¼ 0.46), and ABCA1 CÀ477T (P ¼ 0.70) polymorphisms were within the range of Hardy-Weinberg equilibrium; the same occurred in case groups for ABCA1 I883M (P ¼ 0.74), ABCA1 R1587K (P ¼ 0.29), ABCA1 R219K (P ¼ 0.82), ABCA1 CÀ14T (P ¼ 0.82), and ABCA1 CÀ477T (P ¼ 0.26).
X
ABCA1 p.Ile883Met 17510946:43:33
status: NEW
X
ABCA1 p.Ile883Met 17510946:43:297
status: NEW
Login to comment

49 ABCA1 polymorphisms in the coding region were in linkage disequilibrium (LD): I883M and R1587K, D0 ¼ 0.2071, P ¼ 0.033; I883M and R219K, D0 ¼ 0.2616, P < 0.001; R1587K and R219K, D0 ¼ 0.2343, P < 0.001.
X
ABCA1 p.Ile883Met 17510946:49:78
status: NEW
X
ABCA1 p.Ile883Met 17510946:49:130
status: NEW
Login to comment

67 Distribution of ABCA1 Polymorphisms in Patients and Controls Stratified by APOE e4 Allele Polymorphism APOE e4 allele carriers APOE e4 allele noncarriers Total sample Patients Controls Patients Controls Patients Controls I883M II 121 (0.63) 47 (0.59) 117 (0.65) 237 (0.66) 238 (0.64) 284 (0.65) IM 64 (0.34) 33 (0.41) 57 (0.31) 110 (0.31) 121 (0.33) 143 (0.33) MM 6 (0.03) 0 (0.00) 7 (0.04) 11 (0.03) 13 (0.03) 11 (0.02) Total 191 80 181 358 372 438 Allele frequency I/M 0.80/0.20 0.79/0.21 0.80/0.20 0.82/0.18 0.80/0.20 0.81/0.19 R1587K RR 109 (0.58) 44 (0.57) 110 (0.63) 228 (0.65) 219 (0.60) 272 (0.64) RK 72 (0.38) 30 (0.39) 62 (0.35) 109 (0.31) 134 (0.36) 139 (0.32) KK 8 (0.04) 3 (0.04) 6 (0.02) 17 (0.04) 14 (0.04) 20 (0.04) Total 189 77 178 354 367 431 Allele frequency R/K 0.77/0.23 0.77/0.23 0.79/0.21 0.80/0.20 0.78/0.22 0.79/0.21 R219K RR 83 (0.43) 40 (0.51) 82 (0.45) 192 (0.54) 165 (0.44) 232 (0.53) RK 82 (0.43) 30 (0.38) 85(0.48) 136 (0.38) 167 (0.45) 166 (0.38) KK 26 (0.14) 9(0.11) 13 (0.07) 29 (0.08) 39 (0.11) 38 (0.09) Total 191 79 180 357 371 436 Allele frequency R/K 0.65/0.35 0.70/0.30 0.69/0.31 0.73/0.27 0.67/0.33 0.72/0.28 CÀ14T CC 81 (0.42) 34 (0.42) 67 (0.37) 147 (0.42) 148 (0.40) 181 (0.42) CT 79 (0.41) 42 (0.53) 96 (0.53) 161 (0.46) 175 (0.47) 203 (0.47) TT 31 (0.17) 4 (0.05) 18 (0.10) 44 (0.12) 49 (0.13) 48 (0.11) Total 191 80 181 352 372 432 Allele frequency C/T 0.63/0.37 0.69/0.31 0.64/0.36 0.65/0.35 0.63/0.37 0.65/0.35 CÀ477T CC 50 (0.26) 19 (0.24) 43 (0.24) 103 (0.29) 93 (0.25) 122 (0.28) CT 88 (0.46) 47 (0.59) 87 (0.48) 177 (0.49) 175 (0.47) 224 (0.51) TT 53 (0.28) 14 (0.17) 51 (0.28) 80 (0.22) 104 (0.28) 94 (0.21) Total 191 80 181 360 372 440 Allele frequency C/T 0.49/0.51 0.53/0.47 0.48/0.52 0.53/0.47 0.49/0.51 0.53/0.47 Figures in parentheses indicate frequencies; P > 0.05 for all comparisons except 219 RK and KK genotypes versus RR: age, sex and APOE e4 status-adjusted OR ¼ 1.50 (95% CI ¼ 1.10-2.04; P ¼ 0.009).
X
ABCA1 p.Ile883Met 17510946:67:221
status: NEW
Login to comment

81 Distribution of ABCA1 Polymorphisms in Patients and Controls Stratified by Age Groups Polymorphism 72 yearsa >72 yearsa Patients Controls Patients Controls I883M II 123 (0.68) 47 (0.69) 115 (0.61) 237 (0.64) IM 52 (0.28) 18 (0.27) 69 (0.36) 125 (0.34) MM 7 (0.04) 3 (0.04) 6 (0.03) 8 (0.02) Total 182 68 190 370 Allele frequency I/M 0.82/0.18 0.82/0.18 0.79/0.21 0.81/0.19 R1587K RR 101 (0.57) 44 (0.65) 118 (0.63) 228 (0.63) RK 69 (0.39) 21 (0.31) 65 (0.34) 118 (0.32) KK 8 (0.04) 3 (0.04) 6 (0.03) 19 (0.05) Total 178 68 189 365 Allele frequency R/K 0.76/0.24 0.80/0.20 0.80/0.20 0.79/0.21 R219K RR 86 (0.47) 41 (0.60) 79 (0.42) 191 (0.52) RK 74 (0.41) 23 (0.34) 93 (0.49) 143 (0.39) KK 21 (0.12) 4 (0.06) 18 (0.09) 34 (0.09) Total 181 68 190 368 Allele frequency R/K 0.68/0.32 0.77/0.23 0.66/0.34 0.71/0.29 CÀ14T CC 65 (0.36) 31 (0.48) 83 (0.44) 150 (0.41) CT 96 (0.53) 28 (0.43) 79 (0.41) 175 (0.47) TT 21 (0.11) 6 (0.09) 28 (0.15) 43 (0.12) Total 182 65 190 368 Allele frequency C/T 0.62/0.38 0.69/0.31 0.64/0.36 0.65/0.35 CÀ477T CC 42 (0.23) 22 (0.32) 51 (0.27) 100 (0.27) CT 90 (0.49) 33 (0.49) 85 (0.45) 191 (0.51) TT 50 (0.28) 13 (0.19) 54 (0.28) 81 (0.22) Total 182 68 190 372 Allele frequency C/T 0.48/0.52 0.57/0.43 0.49/0.51 0.53/0.47 a Median age at AD onset (72 years) was set as cut-off; figures in parentheses indicate frequencies; P > 0.05 for all comparisons except 219 RK and KK genotypes versus RR: age, sex and APOE (4 status-adjusted OR ¼ 1.90 (95% CI ¼ 0.99-3.64; P ¼ 0.05) in the 72 years subgroup, and adjusted OR ¼ 1.51 (95% CI ¼ 1.02-2.23; P ¼ 0.04) in the >72 years subgroup.
X
ABCA1 p.Ile883Met 17510946:81:156
status: NEW
Login to comment

83 Odds Ratios for Alzheimer`s Disease Risk According to the Haplotype Frequencies of the ABCA1 Gene Coding Region Polymorphisms Among Patients and Controls R219K I883M R1587K Frequency in AD patients (n ¼ 369) Frequency in controls (n ¼ 435) ORa (95% CI) P* R I R 0.4794 0.5218 1 (reference) K I R 0.1402 0.1100 1.78 (1.17-2.70) 0.0073 R I K 0.0939 0.0995 0.83 (0.52-1.33) 0.43 K I K 0.0887 0.0808 1.27 (0.79-2.05) 0.31 R M R 0.0743 0.0869 0.92 (0.52-1.62) 0.78 K M R 0.0859 0.0701 1.49 (0.92-2.41) 0.11 R M K 0.0238 0.0147 4.85 (0.83-28.49) 0.081 K M K 0.0139 0.0163 1.13 (0.24-5.26) 0.88 a Odds ratios adjusting by age, sex and APOE genotype.
X
ABCA1 p.Ile883Met 17510946:83:160
status: NEW
Login to comment

PMID: 17070530 [PubMed] Nebel A et al: "Common coding polymorphisms in the ABCA1 gene and risk of early-onset coronary heart disease in northern Germany."
No. Sentence Comment
0 Atherosclerosis 193 (2007) 458-460 Letter to the Editor Common coding polymorphisms in the ABCA1 gene and risk of early-onset coronary heart disease in northern Germany Keywords: ATP-binding cassette transporter A1 gene (ABCA1 gene); Coronary heart disease; PopGen; Single nucleotide polymorphisms (SNPs); I883M Dear Editor, The ATP-binding cassette transporter A1 (ABCA1) influences the initial steps in high-density lipoprotein (HDL) formation and the cholesterol efflux across cell membranes to acceptor molecules in the plasma.
X
ABCA1 p.Ile883Met 17070530:0:306
status: NEW
Login to comment

7 In the present study, we have examined the potential association between the five known coding polymorphisms R219K, V771M, I883M, E1172D and R1587K in the ABCA1 gene and early-onset CHD in a large ethnically homogeneous sample from the northernmost province in Germany.
X
ABCA1 p.Ile883Met 17070530:7:123
status: NEW
Login to comment

14 Single-point case control analysis revealed a marginally significant association only for marker I883M (Table 1).
X
ABCA1 p.Ile883Met 17070530:14:97
status: NEW
Login to comment

20 In concordance with the single-point analysis, only marker I883M exhibited significant association with CHD (P = 0.034).
X
ABCA1 p.Ile883Met 17070530:20:59
status: NEW
Login to comment

25 We examined the five known ABCA1 polymorphisms R219K, V771M, I883M, E1172D and R1587K in early-onset 0021-9150/$ - see front matter (c) 2006 Elsevier Ireland Ltd.
X
ABCA1 p.Ile883Met 17070530:25:61
status: NEW
Login to comment

27 doi:10.1016/j.atherosclerosis.2006.09.022 Letter to the Editor / Atherosclerosis 193 (2007) 458-460 Table 1 Summary association statistics for common ABCA1 coding SNPs in German CHD patients and controls ABCA1 variant MAFa CHD MAFa control Pallele Pgenotype Pcarrier b ORcarrier c 95% CIcarrier d R219K (rs2230806)e 0.265 0.258 0.656 0.582 0.438 1.08 0.89-1.30 V771M (rs2066718)e 0.026 0.034 0.188 0.255 0.222 0.78 0.53-1.16 I883M (rs4149313)e 0.138 0.112 0.023 0.068 0.021 1.31 1.04-1.64 E1172D (hCV25924149)e 0.025 0.025 0.914 0.714 0.983 1.00 0.65-1.55 R1587K (rs2230808)e 0.261 0.234 0.067 0.197 0.097 1.18 0.97-1.42 a MAF, minor allele frequency.
X
ABCA1 p.Ile883Met 17070530:27:427
status: NEW
Login to comment

31 e R219K, V771M, I883M, E1172D and R1587K were typed using TaqMan® SNP Assays (Applied Biosystems, Foster City, USA).
X
ABCA1 p.Ile883Met 17070530:31:16
status: NEW
Login to comment

34 Only I883M was found to modulate susceptibility to CHD in the German population, albeit with a relatively modest effect (OR of ~1.3 for carriers of the rare variant).
X
ABCA1 p.Ile883Met 17070530:34:5
status: NEW
X
ABCA1 p.Ile883Met 17070530:34:24
status: NEW
Login to comment

35 Our association between I883M and CHD is consistent with several previous reports that have demonstrated an increased CHD risk for carriers in other populations [4,6,7].
X
ABCA1 p.Ile883Met 17070530:35:24
status: NEW
X
ABCA1 p.Ile883Met 17070530:35:71
status: NEW
Login to comment

36 However, additional studies have indicated no relevant effects for the I883M genotype on CHD or HDH-C levels [8,10,11].
X
ABCA1 p.Ile883Met 17070530:36:71
status: NEW
Login to comment

46 Table 2 Logistic regression analysis for five coding SNPs in the ABCA1 gene in German CHD patients and controls Predictora ORb 95% CIc P Gender 1.05 0.81-1.36 0.721 R219K 1.20 0.99-1.47 0.066 V771M 0.90 0.57-1.41 0.645 I883M 1.28 1.02-1.61 0.034 E1172D 0.78 0.52-1.19 0.253 R1587K 1.10 0.90-1.34 0.361 a Each marker binary classified for carriership of rare allele, gender was included as a predictive variable, logistic regression analysis was performed with the R-package [14].
X
ABCA1 p.Ile883Met 17070530:46:219
status: NEW
Login to comment

26 doi:10.1016/j.atherosclerosis.2006.09.022 Letter to the Editor / Atherosclerosis 193 (2007) 458-460 Table 1 Summary association statistics for common ABCA1 coding SNPs in German CHD patients and controls ABCA1 variant MAFa CHD MAFa control Pallele Pgenotype Pcarrier b ORcarrier c 95% CIcarrier d R219K (rs2230806)e 0.265 0.258 0.656 0.582 0.438 1.08 0.89-1.30 V771M (rs2066718)e 0.026 0.034 0.188 0.255 0.222 0.78 0.53-1.16 I883M (rs4149313)e 0.138 0.112 0.023 0.068 0.021 1.31 1.04-1.64 E1172D (hCV25924149)e 0.025 0.025 0.914 0.714 0.983 1.00 0.65-1.55 R1587K (rs2230808)e 0.261 0.234 0.067 0.197 0.097 1.18 0.97-1.42 a MAF, minor allele frequency.
X
ABCA1 p.Ile883Met 17070530:26:427
status: NEW
Login to comment

30 e R219K, V771M, I883M, E1172D and R1587K were typed using TaqMan&#ae; SNP Assays (Applied Biosystems, Foster City, USA).
X
ABCA1 p.Ile883Met 17070530:30:16
status: NEW
Login to comment

33 Only I883M was found to modulate susceptibility to CHD in the German population, albeit with a relatively modest effect (OR of ~1.3 for carriers of the rare variant).
X
ABCA1 p.Ile883Met 17070530:33:5
status: NEW
Login to comment

45 Table 2 Logistic regression analysis for five coding SNPs in the ABCA1 gene in German CHD patients and controls Predictora ORb 95% CIc P Gender 1.05 0.81-1.36 0.721 R219K 1.20 0.99-1.47 0.066 V771M 0.90 0.57-1.41 0.645 I883M 1.28 1.02-1.61 0.034 E1172D 0.78 0.52-1.19 0.253 R1587K 1.10 0.90-1.34 0.361 a Each marker binary classified for carriership of rare allele, gender was included as a predictive variable, logistic regression analysis was performed with the R-package [14].
X
ABCA1 p.Ile883Met 17070530:45:219
status: NEW
Login to comment

PMID: 17556888 [PubMed] Klos KL et al: "Genetic determinants of HDL: monogenic disorders and contributions to variation."
No. Sentence Comment
66 Interestingly, haplotype analysis in a sample of healthy Pakistani people revealed that the effect of a V825L polymorphism in ABCA1 on HDL-C was dependent on allelic state at R219K [32 ] and, in Turkish people, an effect of R219K on HDL-C was only seen when in combination with the I883M polymorphism [33].
X
ABCA1 p.Ile883Met 17556888:66:283
status: NEW
Login to comment

PMID: 17412755 [PubMed] Kyriakou T et al: "Functional polymorphism in ABCA1 influences age of symptom onset in coronary artery disease patients."
No. Sentence Comment
52 Comparing different genotypes of the I883M polymorphism, 883M/883M homozygotes and 883I/ 883M heterozygotes had higher mean HDL level than 883I/ 883I homozygotes [mean (SD) ¼ 1.34 (0.34), 1.39 (0.36) and 1.20 (0.27) mmol/l, respectively; P ¼ 0.0004; Table 5].
X
ABCA1 p.Ile883Met 17412755:52:37
status: NEW
Login to comment

53 The relationships were still observed after adjusting for age, gender, smoking, body mass index, hypertension, type 1 diabetes, type 2 diabetes and family history of CAD (P ¼ 0.048 for V825I and P ¼ 0.001 for I883M).
X
ABCA1 p.Ile883Met 17412755:53:219
status: NEW
Login to comment

54 Gender ratio, percentage of smokers, body mass index, total cholesterol and triglyceride levels, hypertension, type 1 and type 2 diabetes and family history of CAD did not significantly differ among the different genotypes of the V825I and I883M SNPs. No significant association was observed between HDL level and the other SNPs studied.
X
ABCA1 p.Ile883Met 17412755:54:37
status: NEW
X
ABCA1 p.Ile883Met 17412755:54:240
status: NEW
Login to comment

74 Coefficients (D 0 ) of pair-wise linkage disequilibrium between ABCA1 SNPs 21801 21652 21506 21395 21252 21217 21034 2940 2803 2565 2407 2302 2278 299 214 R219K V825I I883M 21652A.G 20.97 Ã 21506G.C 20.97 Ã 20.86 Ã 21395C.T 0.94 Ã 20.94 Ã 20.91 Ã 21252G.A 20.90 Ã 0.89 Ã 20.64 † 20.95 Ã 21217C.T 21.00 Ã 0.96 Ã 20.94 Ã 20.97 Ã 20.91 † 21034ATins/del 20.91 Ã 20.90 Ã 0.89 Ã 20.94 Ã 20.80 Ã 20.94 Ã 2940T.G 20.95 Ã 0.40 Ã 0.90 Ã 20.95 Ã 20.79 Ã 0.96 Ã 0.84 Ã 2803G.A 0.93 Ã 20.91 Ã 20.95 Ã 0.96 Ã 20.83 † 21.00 Ã 20.95 Ã 20.98 Ã 2565C.T 20.95 Ã 20.42 Ã 0.71 Ã 20.97 Ã 20.81 Ã 1.00 Ã 0.74 Ã 0.92 Ã 20.98 Ã 2407G.C 20.87 Ã 0.39 Ã 0.71 Ã 20.86 Ã 20.74 Ã 0.88 Ã 0.73 Ã 0.86 Ã 20.95 Ã 0.92 Ã 2302C.T 20.85 Ã 20.90 Ã 0.87 Ã 20.88 Ã 20.77 Ã 20.87 Ã 0.90 Ã 0.84 Ã 20.89 Ã 0.94 Ã 0.98 Ã 2278G.C 20.94 Ã 0.41 Ã 0.72 Ã 20.94 Ã 20.83 Ã 0.96 Ã 0.77 Ã 0.93 Ã 20.98 Ã 0.99 Ã 0.91 Ã 0.92 Ã 299G.C 0.79 Ã 20.81 Ã 20.84 Ã 0.82 Ã 20.96 Ã 20.88 Ã 20.80 Ã 20.82 Ã 20.96 Ã 20.85 Ã 20.75 Ã 20.88 Ã 20.85 Ã 214C.T 20.93 Ã 0.10 † 0.78 Ã 20.94 Ã 20.81 Ã 20.89 Ã 0.77 Ã 0.91 Ã 21.00 Ã 0.98 Ã 0.90 Ã 0.84 Ã 0.98 Ã 20.86 Ã R219K 0.14 † 20.17 † 20.18 ‡ 0.14 † 20.62 Ã 0.01 ‡ 20.16 ‡ 0.00 ‡ 0.09 ‡ 20.11 † 0.10 ‡ 20.17 ‡ 0.11 ‡ 0.04 ‡ 0.05 ‡ V825I 20.03 ‡ 20.39 † 0.14 † 0.19 ‡ 20.35 ‡ 20.62 ‡ 0.17 † 20.06 ‡ 0.02 ‡ 0.12 ‡ 0.15 ‡ 0.03 ‡ 20.12 ‡ 0.09 ‡ 0.04 ‡ 20.88 Ã I883M 0.08 ‡ 20.38 † 0.09 † 0.05 ‡ 20.24 ‡ 20.18 ‡ 0.11 † 0.02 ‡ 20.05 ‡ 0.04 ‡ 20.04 ‡ 0.04 ‡ 0.02 ‡ 20.12 ‡ 0.01 ‡ 0.25 Ã 0.81 Ã R1587K 0.00 ‡ 0.03 ‡ 20.04 ‡ 20.05 ‡ 0.06 ‡ 0.00 ‡ 0.01 ‡ 20.04 ‡ 20.08 ‡ 20.07 ‡ 20.08 ‡ 20.08 † 20.06 ‡ 0.01 ‡ 20.03 ‡ 0.14 † 20.27 ‡ 20.01 ‡ Ã P , 0.001.
X
ABCA1 p.Ile883Met 17412755:74:167
status: NEW
X
ABCA1 p.Ile883Met 17412755:74:2080
status: NEW
Login to comment

85 The V825I and I883M SNPs were found to be in strong LD in our sample and other European populations (14,15).
X
ABCA1 p.Ile883Met 17412755:85:14
status: NEW
Login to comment

86 In the in vitro assays, we found that the rate of cholesterol efflux in cells expressing the 825I variant was higher than in cells expressing the ABCA1 wild-type (825V), indicating a potential effect of V825I on ABCA1 function in facilitating cellular cholesterol efflux, which could potentially explain its association with HDL level.
X
ABCA1 p.Ile883Met 17412755:86:14
status: NEW
Login to comment

95 A G/G 59.94 (9.79), 708 0.57 299G.C (rs2740483) G/G 60.41 (9.90), 505 0.12 G/A 59.80 (9.88), 180 G/C 59.41 (9.68), 363 A/A 57.80 (8.82), 15 C/C 59.18 (9.35), 78 21217C.T (rs10991420) C/C 59.47 (9.82), 769 0.05 214C.T (rs1800977) C/C 59.80 (9.69), 460 0.54 C/T 61.11 (9.48), 209 C/T 59.74 (9.80), 401 T/T 59.82 (11.39), 11 T/T 60.68 (10.5), 113 21034ATins/del (rs34669957) AT/AT 59.63 (9.71), 621 0.37 R219K (rs2230806) R/R 60.07 (9.94), 503 0.52 AT/ 2 60.14 (9.73), 350 R/K 59.82 (9.84), 392 2/2 60.49 (11.13), 43 K/K 59.33 (8.81), 78 2940T.G (rs2980083) T/T 59.11 (9.51), 273 0.03 V825I (rs28587567) V/V 59.70 (9.86), 866 0.24 T/G 59.85 (9.68), 430 V/I 60.75 (9.52), 100 G/G 61.07 (9.86), 200 I/I 63.46 (9.07), 4 2803G.A (rs10991419) G/G 59.83 (9.74), 812 0.79 I883M (rs4149313) I/I 60.38 (9.66), 644 0.23 G/A 59.73 (9.91), 192 I/M 59.10 (9.65), 217 A/A 58.94 (10.85), 14 M/M 62.12 (6.36), 19 R1587K (rs2230808) R/R 60.23 (9.95), 496 0.30 R/K 58.90 (9.50), 301 K/K 60.93 (9.12), 41 1416 association was detected between the R219K SNP and plasma level of HDL.
X
ABCA1 p.Ile883Met 17412755:95:762
status: NEW
Login to comment

119 Plasma HDL levels (mmol/L) according to ABCA1 genotypes Polymorphism Genotype Mean (SD), n P-value Polymorphism Genotype Mean (SD), n P-value 21801C.T (rs2487046) C/C 1.26 (0.31), 93 0.88 2565C.T (rs2422493) C/C 1.25 (0.32), 81 0.78 C/T 1.23 (0.31), 122 C/T 1.24 (0.30), 137 T/T 1.29 (0.33), 40 T/T 1.23 (0.28), 54 21652A.G (rs10124728) A/A 1.22 (0.29), 99 0.37 2407G.C (rs2246293) G/G 1.24 (0.32), 76 0.80 A/G 1.25 (0.31), 131 G/C 1.23 (0.30), 123 G/G 1.29 (0.35), 30 C/C 1.24 (0.27), 52 21506G.C (rs2487047) G/G 1.26 (0.33), 156 0.47 2302C.T (rs2246298) C/C 1.26 (0.32), 165 0.67 G/C 1.21 (0.28), 90 C/T 1.21 (0.27), 68 C/C 1.24 (0.29), 14 T/T 1.27 (0.26), 13 21395C.T (rs2487048) C/C 1.26 (0.31), 96 0.83 2278G.C (rs1800976) G/G 1.25 (0.32), 80 0.79 C/T 1.22 (0.29), 115 G/C 1.24 (0.30), 126 T/T 1.26 (0.32), 45 C/C 1.23 (0.28), 51 21252G.A G/G 1.23 (0.29), 193 0.13 299G.C (rs2740483) G/G 1.25 (0.29), 139 0.83 G/A 1.27 (0.29), 44 G/C 1.23 (0.31), 93 A/A 1.27 (0.34), 7 C/C 1.30 (0.28), 21 21217C.T (rs10991420) C/C 1.25 (0.32), 202 0.64 214C.T (rs1800977) C/C 1.25 (0.31), 126 0.59 C/T 1.23 (0.28), 56 C/T 1.25 (0.32), 99 T/T 0.97 (2), 1 T/T 1.20 (0.23), 30 21034ATins/del (rs34669957) AT/AT 1.27 (0.33), 157 0.36 R219K (rs2230806) R/R 1.26 (0.30), 129 0.58 AT/ 2 1.21 (0.26), 89 R/K 1.23 (0.30), 104 2/2 1.24 (0.29), 14 K/K 1.25 (0.34), 18 2940T.G (rs2980083) T/T 1.24 (0.32), 70 0.77 V825I (rs28587567) V/V 1.23 (0.30), 232 0.01 T/G 1.24 (0.31), 117 V/I 1.34 (0.31), 26 G/G 1.22 (0.29), 53 I/I 1.54 (0.07), 3 2803G.A (rs10991419) G/G 1.26 (0.31), 208 0.40 I883M (rs4149313) I/I 1.20 (0.27), 172 0.0004 G/A 1.20 (0.28), 51 I/M 1.39 (0.36), 56 A/A 1.32 (0.47), 4 M/M 1.34 (0.34), 9 R1587K (rs2230808) R/R 1.27 (0.31), 142 0.39 R/K 1.24 (0.30), 84 K/K 1.18 (0.20), 9 Figure 2.
X
ABCA1 p.Ile883Met 17412755:119:1563
status: NEW
Login to comment

126 Single nucleotide polymorphism selection and determination of genotypes The subjects of this study were genotyped for 15 common SNPs in the proximal promoter region, i.e. 21801C.T (rs2487046), 21652A.G (rs10124728), 21506G.C (rs2487047), 21395C.T (rs2487048), 21252G.A (rs number unavailable), 21217C.T (rs10991420), 21034A Tins/del (rs34669957), 2940T.G (rs2980083), 2803G.A (rs10991419), 2565C.T (rs2422493), 2407G.C (rs2246293), 2302C.T (rs2246298), 2278G.C (rs1800976), 299G.C (rs2740483) and 214C.T (rs1800977), respectively, and four common non-synonymous SNPs, i.e. R219K (rs2230806), V825I (rs28587567), I883M (rs4149313) and R1587K (rs2230808) (Fig. 1).
X
ABCA1 p.Ile883Met 17412755:126:612
status: NEW
Login to comment

55 The relationships were still observed after adjusting for age, gender, smoking, body mass index, hypertension, type 1 diabetes, type 2 diabetes and family history of CAD (P &#bc; 0.048 for V825I and P &#bc; 0.001 for I883M).
X
ABCA1 p.Ile883Met 17412755:55:217
status: NEW
Login to comment

56 Gender ratio, percentage of smokers, body mass index, total cholesterol and triglyceride levels, hypertension, type 1 and type 2 diabetes and family history of CAD did not significantly differ among the different genotypes of the V825I and I883M SNPs. No significant association was observed between HDL level and the other SNPs studied.
X
ABCA1 p.Ile883Met 17412755:56:240
status: NEW
Login to comment

76 Coefficients (D 0 ) of pair-wise linkage disequilibrium between ABCA1 SNPs 21801 21652 21506 21395 21252 21217 21034 2940 2803 2565 2407 2302 2278 299 214 R219K V825I I883M 21652A.G 20.97  21506G.C 20.97  20.86  21395C.T 0.94  20.94  20.91  21252G.A 20.90  0.89  20.64 ߤ 20.95  21217C.T 21.00  0.96  20.94  20.97  20.91 ߤ 21034ATins/del 20.91  20.90  0.89  20.94  20.80  20.94  2940T.G 20.95  0.40  0.90  20.95  20.79  0.96  0.84  2803G.A 0.93  20.91  20.95  0.96  20.83 ߤ 21.00  20.95  20.98  2565C.T 20.95  20.42  0.71  20.97  20.81  1.00  0.74  0.92  20.98  2407G.C 20.87  0.39  0.71  20.86  20.74  0.88  0.73  0.86  20.95  0.92  2302C.T 20.85  20.90  0.87  20.88  20.77  20.87  0.90  0.84  20.89  0.94  0.98  2278G.C 20.94  0.41  0.72  20.94  20.83  0.96  0.77  0.93  20.98  0.99  0.91  0.92  299G.C 0.79  20.81  20.84  0.82  20.96  20.88  20.80  20.82  20.96  20.85  20.75  20.88  20.85  214C.T 20.93  0.10 ߤ 0.78  20.94  20.81  20.89  0.77  0.91  21.00  0.98  0.90  0.84  0.98  20.86  R219K 0.14 ߤ 20.17 ߤ 20.18 ߥ 0.14 ߤ 20.62  0.01 ߥ 20.16 ߥ 0.00 ߥ 0.09 ߥ 20.11 ߤ 0.10 ߥ 20.17 ߥ 0.11 ߥ 0.04 ߥ 0.05 ߥ V825I 20.03 ߥ 20.39 ߤ 0.14 ߤ 0.19 ߥ 20.35 ߥ 20.62 ߥ 0.17 ߤ 20.06 ߥ 0.02 ߥ 0.12 ߥ 0.15 ߥ 0.03 ߥ 20.12 ߥ 0.09 ߥ 0.04 ߥ 20.88  I883M 0.08 ߥ 20.38 ߤ 0.09 ߤ 0.05 ߥ 20.24 ߥ 20.18 ߥ 0.11 ߤ 0.02 ߥ 20.05 ߥ 0.04 ߥ 20.04 ߥ 0.04 ߥ 0.02 ߥ 20.12 ߥ 0.01 ߥ 0.25  0.81  R1587K 0.00 ߥ 0.03 ߥ 20.04 ߥ 20.05 ߥ 0.06 ߥ 0.00 ߥ 0.01 ߥ 20.04 ߥ 20.08 ߥ 20.07 ߥ 20.08 ߥ 20.08 ߤ 20.06 ߥ 0.01 ߥ 20.03 ߥ 0.14 ߤ 20.27 ߥ 20.01 ߥ  P , 0.001.
X
ABCA1 p.Ile883Met 17412755:76:167
status: NEW
X
ABCA1 p.Ile883Met 17412755:76:1532
status: NEW
Login to comment

96 A G/G 59.94 (9.79), 708 0.57 299G.C (rs2740483) G/G 60.41 (9.90), 505 0.12 G/A 59.80 (9.88), 180 G/C 59.41 (9.68), 363 A/A 57.80 (8.82), 15 C/C 59.18 (9.35), 78 21217C.T (rs10991420) C/C 59.47 (9.82), 769 0.05 214C.T (rs1800977) C/C 59.80 (9.69), 460 0.54 C/T 61.11 (9.48), 209 C/T 59.74 (9.80), 401 T/T 59.82 (11.39), 11 T/T 60.68 (10.5), 113 21034ATins/del (rs34669957) AT/AT 59.63 (9.71), 621 0.37 R219K (rs2230806) R/R 60.07 (9.94), 503 0.52 AT/ 2 60.14 (9.73), 350 R/K 59.82 (9.84), 392 2/2 60.49 (11.13), 43 K/K 59.33 (8.81), 78 2940T.G (rs2980083) T/T 59.11 (9.51), 273 0.03 V825I (rs28587567) V/V 59.70 (9.86), 866 0.24 T/G 59.85 (9.68), 430 V/I 60.75 (9.52), 100 G/G 61.07 (9.86), 200 I/I 63.46 (9.07), 4 2803G.A (rs10991419) G/G 59.83 (9.74), 812 0.79 I883M (rs4149313) I/I 60.38 (9.66), 644 0.23 G/A 59.73 (9.91), 192 I/M 59.10 (9.65), 217 A/A 58.94 (10.85), 14 M/M 62.12 (6.36), 19 R1587K (rs2230808) R/R 60.23 (9.95), 496 0.30 R/K 58.90 (9.50), 301 K/K 60.93 (9.12), 41 association was detected between the R219K SNP and plasma level of HDL.
X
ABCA1 p.Ile883Met 17412755:96:762
status: NEW
Login to comment

120 Plasma HDL levels (mmol/L) according to ABCA1 genotypes Polymorphism Genotype Mean (SD), n P-value Polymorphism Genotype Mean (SD), n P-value 21801C.T (rs2487046) C/C 1.26 (0.31), 93 0.88 2565C.T (rs2422493) C/C 1.25 (0.32), 81 0.78 C/T 1.23 (0.31), 122 C/T 1.24 (0.30), 137 T/T 1.29 (0.33), 40 T/T 1.23 (0.28), 54 21652A.G (rs10124728) A/A 1.22 (0.29), 99 0.37 2407G.C (rs2246293) G/G 1.24 (0.32), 76 0.80 A/G 1.25 (0.31), 131 G/C 1.23 (0.30), 123 G/G 1.29 (0.35), 30 C/C 1.24 (0.27), 52 21506G.C (rs2487047) G/G 1.26 (0.33), 156 0.47 2302C.T (rs2246298) C/C 1.26 (0.32), 165 0.67 G/C 1.21 (0.28), 90 C/T 1.21 (0.27), 68 C/C 1.24 (0.29), 14 T/T 1.27 (0.26), 13 21395C.T (rs2487048) C/C 1.26 (0.31), 96 0.83 2278G.C (rs1800976) G/G 1.25 (0.32), 80 0.79 C/T 1.22 (0.29), 115 G/C 1.24 (0.30), 126 T/T 1.26 (0.32), 45 C/C 1.23 (0.28), 51 21252G.A G/G 1.23 (0.29), 193 0.13 299G.C (rs2740483) G/G 1.25 (0.29), 139 0.83 G/A 1.27 (0.29), 44 G/C 1.23 (0.31), 93 A/A 1.27 (0.34), 7 C/C 1.30 (0.28), 21 21217C.T (rs10991420) C/C 1.25 (0.32), 202 0.64 214C.T (rs1800977) C/C 1.25 (0.31), 126 0.59 C/T 1.23 (0.28), 56 C/T 1.25 (0.32), 99 T/T 0.97 (2), 1 T/T 1.20 (0.23), 30 21034ATins/del (rs34669957) AT/AT 1.27 (0.33), 157 0.36 R219K (rs2230806) R/R 1.26 (0.30), 129 0.58 AT/ 2 1.21 (0.26), 89 R/K 1.23 (0.30), 104 2/2 1.24 (0.29), 14 K/K 1.25 (0.34), 18 2940T.G (rs2980083) T/T 1.24 (0.32), 70 0.77 V825I (rs28587567) V/V 1.23 (0.30), 232 0.01 T/G 1.24 (0.31), 117 V/I 1.34 (0.31), 26 G/G 1.22 (0.29), 53 I/I 1.54 (0.07), 3 2803G.A (rs10991419) G/G 1.26 (0.31), 208 0.40 I883M (rs4149313) I/I 1.20 (0.27), 172 0.0004 G/A 1.20 (0.28), 51 I/M 1.39 (0.36), 56 A/A 1.32 (0.47), 4 M/M 1.34 (0.34), 9 R1587K (rs2230808) R/R 1.27 (0.31), 142 0.39 R/K 1.24 (0.30), 84 K/K 1.18 (0.20), 9 Figure 2.
X
ABCA1 p.Ile883Met 17412755:120:1563
status: NEW
Login to comment

127 Single nucleotide polymorphism selection and determination of genotypes The subjects of this study were genotyped for 15 common SNPs in the proximal promoter region, i.e. 21801C.T (rs2487046), 21652A.G (rs10124728), 21506G.C (rs2487047), 21395C.T (rs2487048), 21252G.A (rs number unavailable), 21217C.T (rs10991420), 21034A Tins/del (rs34669957), 2940T.G (rs2980083), 2803G.A (rs10991419), 2565C.T (rs2422493), 2407G.C (rs2246293), 2302C.T (rs2246298), 2278G.C (rs1800976), 299G.C (rs2740483) and 214C.T (rs1800977), respectively, and four common non-synonymous SNPs, i.e. R219K (rs2230806), V825I (rs28587567), I883M (rs4149313) and R1587K (rs2230808) (Fig. 1).
X
ABCA1 p.Ile883Met 17412755:127:612
status: NEW
Login to comment

PMID: 17303779 [PubMed] Kiss RS et al: "Genetic etiology of isolated low HDL syndrome: incidence and heterogeneity of efflux defects."
No. Sentence Comment
47 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N.
X
ABCA1 p.Ile883Met 17303779:47:289
status: NEW
Login to comment

42 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N.
X
ABCA1 p.Ile883Met 17303779:42:289
status: NEW
Login to comment

PMID: 17430597 [PubMed] Wahrle SE et al: "Apolipoprotein E levels in cerebrospinal fluid and the effects of ABCA1 polymorphisms."
No. Sentence Comment
40 In particular, studies have implicated the following SNPs in affecting levels of plasma HDL-C: rs2230806 (R219K) [33], rs2066718 (V771M) [31,32], rs2066715 (V825I) [31], rs4149313 (I883M) [34], rs2230808 (R1587K) [31].
X
ABCA1 p.Ile883Met 17430597:40:181
status: NEW
Login to comment

70 The subjects for whom we had CSF apoE data were genotyped for the following ABCA1 SNPs: rs2230806 (R219K), rs2066718 (V771M), rs2066715 (V825I), rs4149313 (I883M), rs2230808 (R1587K), rs1883025 (intron), rs2275544 (intron), rs2777799 (intron), rs3904999 (intron) and rs6479283 (intron).
X
ABCA1 p.Ile883Met 17430597:70:156
status: NEW
Login to comment

149 Genotyping The following SNPS in ABCA1 were genotyped in the Washington University sample of 168 subjects: rs2230806 (R219K), rs2066718 (V771M), rs2066715 (V825I), rs4149313 (I883M), rs2230808 (R1587K), rs1883025 (intron), rs2275544 (intron), rs2777799 (intron), rs3904999 (intron) and rs6479283 (intron).
X
ABCA1 p.Ile883Met 17430597:149:175
status: NEW
Login to comment

PMID: 17383594 [PubMed] Mantaring M et al: "Genotypic variation in ATP-binding cassette transporter-1 (ABCA1) as contributors to the high and low high-density lipoprotein-cholesterol (HDL-C) phenotype."
No. Sentence Comment
3 Carrier frequencies of common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K were also assessed.
X
ABCA1 p.Ile883Met 17383594:3:72
status: NEW
Login to comment

36 DNA was PCR amplified and digested using standard methods and the frequency of the 6 common polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K) in ABCA1, which was determined as described by Clee et al.8 Sequencing of PCR-amplified DNA.
X
ABCA1 p.Ile883Met 17383594:36:128
status: NEW
Login to comment

54 The prevalence of 6 common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K was also evaluated.
X
ABCA1 p.Ile883Met 17383594:54:69
status: NEW
Login to comment

57 Very high HDL-C was associated with a higher genotype frequency of R219K (RK and KK, 68.2%; Ptrend ϭ 0.04) although allele frequency was not materially different.
X
ABCA1 p.Ile883Met 17383594:57:150
status: NEW
Login to comment

58 Mild differences in allele frequency were also identified between the highest and lowest HDL-C groups for V771M (23% vs 10%; Ptrend ϭ 0.04) and I883M (36% vs 20%; Ptrend ϭ 0.05).
X
ABCA1 p.Ile883Met 17383594:58:150
status: NEW
Login to comment

77 Genotype and allele frequencies for 6 common ABCA1 polymorphisms in subgroups with HDL-C defined as very high (n ϭ 22), high (n ϭ 34), average (n ϭ 36), or low (n ϭ 32) R219K Genotype frequencies P value Allele frequencies P valueR/R R/K K/K R K Very high 31.8% 45.5% 22.7% 0.04 0.55 0.45 0.20 High 45.7% 51.4% 2.9% 0.71 0.29 Average 43.2% 56.8% 0.0% 0.72 0.28 Low 50.0% 40.0% 10.0% 0.70 0.30 V771M V/V V/M M/M V M Very high 59.0% 36.0% 4.5% 0.11 0.77 0.23 0.04 High 85.7% 14.3% 0.0% 0.93 0.07 Average 86.1% 13.9% 0.0% 0.93 0.07 Low 80.0% 20.0% 0.0% 0.90 0.10 V825I V/V V/I I/I V I Very high 77.3% 22.7% 0.0% 0.58 0.89 0.11 0.62 High 88.6% 11.4% 0.0% 0.94 0.06 Average 88.9% 11.1% 0.0% 0.94 0.06 Low 82.8% 17.2% 0.0% 0.92 0.08 I883M I/I I/M M/M I M Very high 40.9% 45.5% 13.6% 0.29 0.64 0.36 0.05 High 60.0% 34.3% 5.7% 0.78 0.22 Average 73.0% 24.3% 2.7% 0.85 0.15 Low 66.7% 26.7% 6.7% 0.80 0.20 E1172D E/E E/D D/D E D Very high 68.2% 31.8% 0.0% 0.0004 0.82 0.18 0.0002 High 94.3% 5.7% 0.0% 0.97 0.03 Average 94.6% 5.4% 0.0% 0.97 0.03 Low 100.00% 0.0% 0.0% 1.00 0.00 R1587K R/R R/K K/K R K Very high 31.8% 50.0% 18.2% 0.16 0.57 0.43 0.07 High 65.6% 25.0% 9.4% 0.78 0.22 Average 55.6% 41.7% 2.8% 0.76 0.24 Low 51.9% 33.3% 14.8% 0.69 0.31 of R219K may have a basis for reduced CVD risk as previously suggested.8-11,24 CONCLUSION The data extend previous findings that novel mutations in ABCA1 are associated with the low rather than the high HDL-C (FHA) phenotype.
X
ABCA1 p.Ile883Met 17383594:77:751
status: NEW
Login to comment

35 DNA was PCR amplified and digested using standard methods and the frequency of the 6 common polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K) in ABCA1, which was determined as described by Clee et al.8 Sequencing of PCR-amplified DNA.
X
ABCA1 p.Ile883Met 17383594:35:128
status: NEW
Login to comment

53 The prevalence of 6 common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K was also evaluated.
X
ABCA1 p.Ile883Met 17383594:53:69
status: NEW
Login to comment

PMID: 16313984 [PubMed] Martin M et al: "ABCA1 polymorphisms and prognosis after myocardial infarction in young patients."
No. Sentence Comment
3 We have analysed three polymorphisms of the ABCA1 gene (-477C/T, R219 K, and I883M) in a cohort of young male survivors of myocardial infarction in order to know their influence in long-term prognosis.
X
ABCA1 p.Ile883Met 16313984:3:77
status: NEW
Login to comment

9 In order to know whether there is a relationship between ABCA1 polymorphisms and prognosis after myocardial infarction in young patients, we have analysed three polymorphisms in ABCA1 gene (À477C/T, R219K, I883M) in a cohort of young male survivors of first myocardial infarction.
X
ABCA1 p.Ile883Met 16313984:9:206
status: NEW
Login to comment

19 Table 1 Frequency of genotypes of ABCA1 gene in study and control group Genotypes Patients (%) Controls (%) p ABCA1 R219K RR 48 49 ns RK 42 40 KK 10 11 ABCA1 À477C/T CC 24 30 ns TC 50 50 TT 26 20 ABCA1 I883M AA 69 80 ns AG/GG 31 20 International Journal of Cardiology 110 (2006) - 268 www.elsevier.com/locate/ijcard Fasting blood samples were drawn for measurements of total plasma cholesterol, HDL-C and triglycerides in the first 24 h after admission.
X
ABCA1 p.Ile883Met 16313984:19:201
status: NEW
X
ABCA1 p.Ile883Met 16313984:19:207
status: NEW
Login to comment

PMID: 16704350 [PubMed] Brunham LR et al: "Variations on a gene: rare and common variants in ABCA1 and their impact on HDL cholesterol levels and atherosclerosis."
No. Sentence Comment
605 Many of these variants have been studied in relationship to their association with HDL cholesterol levels and atherosclerosis (11, 15, 22, 27, 28, 38, TABLE 4 Nonsynonymous single-nucleotide polymorphisms (SNPs) in ABCA1 SNP id Nucleotidea Amino acidb Observed heterozygosity rs2230806 G969A R219K 0.488 rs9282541 C1001T R230C 0.029 rs9282543 T1509C V399A 0.020 rs4131108 A1556C M415L - rs13306068 A1949G I546V - rs2066718 G2624A V771M 0.074 rs2472458 G2804A D831N - rs4149313 A2962G I883M - rs2482437 C3326T E1005K - rs13306072 G3473A V1054I - rs13306073 G3599A V1096I - rs1997618 T4977C I1555T - rs2230808 A5073G K1587R 0.480 rs1883024 T5256C L1648P - - C5505G S1731C - a Nucleotide position is with respect to NM 005502. b Amino acid position is with respect to NP 005493.
X
ABCA1 p.Ile883Met 16704350:605:487
status: NEW
Login to comment

622 Notably, only two of the 15 common ABCA1 nonsynonymous SNPs, I883M and R219K,arerepresentedintheHapMapdataset,whichisanincompletedataset(the phaseIprojecthavingsetouttoidentify1SNPevery5000basepairs)(7).However, it is apparent from the haplotypes in which I883M and R219K reside that the minor alleles of each of these are unique to one particular, different haplotype, which may explain in part why these two SNPs have been consistently found to be associated with HDL levels and atherosclerosis risk.
X
ABCA1 p.Ile883Met 16704350:622:61
status: NEW
X
ABCA1 p.Ile883Met 16704350:622:256
status: NEW
Login to comment

PMID: 16446539 [PubMed] Andrikovics H et al: "Decreased frequencies of ABCA1 polymorphisms R219K and V771M in Hungarian patients with cerebrovascular and cardiovascular diseases."
No. Sentence Comment
7 Methods: We investigated 244 unrelated, consecutively enrolled patients with ischemic stroke, 150 patients with coronary heart disease (CHD) and 193 blood donors for allele frequencies (AFs) of three common ABCA1 polymorphisms (R219K, V771M and I883M).
X
ABCA1 p.Ile883Met 16446539:7:245
status: NEW
Login to comment

28 DNA Isolation and Detection of ABCA1 R219K, V771M and I883M Alleles with LightCycler Hybridization Probe Technique DNA isolation was performed from anticoagulated peripheral blood with the standard 'salting-out` procedure.
X
ABCA1 p.Ile883Met 16446539:28:54
status: NEW
Login to comment

29 The following ABCA1sequencevariantswerestudied:R219K(exon7,c.969A]G, substitution of Arg219 by Lys); V771M (exon 16, c.2624G]A, substitution of Val771 by Met), and I883M (exon 18, c.2962A]G, substitution of Ile883 by Met).
X
ABCA1 p.Ile883Met 16446539:29:164
status: NEW
X
ABCA1 p.Ile883Met 16446539:29:207
status: NEW
Login to comment

53 2006;21:254-259256 Results Genotyping for R219K, V771M and I883M ABCA1 Allelic Variants Using genomic DNA samples, simultaneous genotyping was carried out in the control blood donor and the stroke- and CHD-affected patient groups by PCR and fluorescent allelic discrimination techniques.
X
ABCA1 p.Ile883Met 16446539:53:59
status: NEW
Login to comment

55 In the control group, AF figures (30.8 8 4.7, 4.9 8 2.2 and 12.4 8 4.5%) were found in the expected range for R219K, V771M and I883M, respectively.
X
ABCA1 p.Ile883Met 16446539:55:127
status: NEW
Login to comment

61 The AF of the third allelic variant, I883M, did not show significant differences in the patient groups (12.3 8 3.8% in CHD and 15.2 8 3.2% in stroke patients) and the subgroups of different ages at onset studied.
X
ABCA1 p.Ile883Met 16446539:61:37
status: NEW
Login to comment

70 Genotyping results and statistical analyses for three common ABCA1 polymorphisms (R219K, V771M and I883M) in the control and patient groups Polymorphism AF % (895% CI) Heterozygous individuals n (%) Homozygous individuals n (%) p value Adjusted OR (95% CI) R219K Controls (n = 193) 30.8 (4.7) 73 (37.8) 23 (11.9) Patients with stroke (n = 244) 28.9 (4.1) 84 (34.1) 29 (11.8) 0.032 0.68 (0.48-0.97) Patients with CHD (n = 150) 25.7 (5.0) 55 (36.7) 11 (7.3) NS NS V771M Controls (n = 193) 4.9 (2.2) 19 (9.8) 0 Patients with stroke (n = 244) 3.3 (1.6) 14 (5.7) 1 (0.4) 0.017 0.34 (0.14-0.82) Patients with CHD (n = 150) 1.3 (1.3) 4 (2.7) 0 0.027 0.08 (0.01-0.75) I883M Controls (n = 105) 12.4 (4.5) 24 (22.9) 1 (1.0) Patients with stroke (n = 244) 15.2 (3.2) 61 (24.8) 7 (2.9) NS NS Patients with CHD (n = 150) 12.3 (3.8) 29 (19.3) 4 (2.6) NS NS AF = Allele frequency; CI = confidence interval; NS = nonsignificant.
X
ABCA1 p.Ile883Met 16446539:70:99
status: NEW
X
ABCA1 p.Ile883Met 16446539:70:660
status: NEW
Login to comment

87 Moreover, a similar, non-random allelic association was observed between R219K and I883M variants (p !
X
ABCA1 p.Ile883Met 16446539:87:83
status: NEW
Login to comment

89 Combining all genotyping results, 94/135 (69.6%) of I883M carriers were also positive for R219K, while only 148/374 (39.6%) of I883M wild-type individuals were positive for R219K.
X
ABCA1 p.Ile883Met 16446539:89:52
status: NEW
X
ABCA1 p.Ile883Met 16446539:89:127
status: NEW
Login to comment

90 The distribution of double-positive (R219K and I883M carriers) and single-positive (only I883M carriers) individuals was similar in the control, in the stroke and in the CHD-affected groups.
X
ABCA1 p.Ile883Met 16446539:90:47
status: NEW
X
ABCA1 p.Ile883Met 16446539:90:89
status: NEW
Login to comment

91 These results suggest that the R219K and I883M polymorphisms are also in linkage disequilibrium in our population, although the common occurrence of these variants in the same individual is not likely to be related to disease development.
X
ABCA1 p.Ile883Met 16446539:91:41
status: NEW
Login to comment

92 No significant linkage disequilibrium was observed between V771M and I883M.
X
ABCA1 p.Ile883Met 16446539:92:69
status: NEW
Login to comment

123 We found no correlation between ABCA1 I883M genotypes and CHD or stroke development.
X
ABCA1 p.Ile883Met 16446539:123:38
status: NEW
Login to comment

125 Clee et al. [9] reported that I883M carrier patients have more severe manifestation of CHD.
X
ABCA1 p.Ile883Met 16446539:125:30
status: NEW
Login to comment

126 Wang et al. [10] found that I883M homozygotes had significantly higher plasma HDL cholesterol compared to heterozygous and wild-type individuals [10].
X
ABCA1 p.Ile883Met 16446539:126:28
status: NEW
Login to comment

127 The differences between I883M genotypes might have remained hidden in the Hungarian population because of the low number of heterozygous and homozygous individuals.
X
ABCA1 p.Ile883Met 16446539:127:24
status: NEW
Login to comment

PMID: 16372134 [PubMed] Katzov H et al: "Quantitative trait loci in ABCA1 modify cerebrospinal fluid amyloid-beta 1-42 and plasma apolipoprotein levels."
No. Sentence Comment
40 Genotyping Information on the R219K, I883M, and R1587K variants [representing cDNA (GenBank accession number NM_005502.2) rs2230806, c.658 G>A; rs4149313, c.2650 A>G; rs2230808, c.4762 G>A, respectively] may be found at dbSNP (http://www.ncbi.nlm.nih.gov/ SNP/).
X
ABCA1 p.Ile883Met 16372134:40:37
status: NEW
Login to comment

70 We focussed on the R219K, I883M, and R1587K variants since these give rise to amino acid changes and because they are common in European populations (Clee et al. 2001).
X
ABCA1 p.Ile883Met 16372134:70:26
status: NEW
Login to comment

72 A significant effect of the R219K variant on CSF Ab1-42 levels was observed whereby RK heterozygotes had the highest trait levels (547±19.2, n=141; 658±35.1, n=71; 443±60.6, n=4; F2,212=6.2, P=0.0024, for RR, RK, and KK genotype classes, respectively; pg/ ml ±SEM).
X
ABCA1 p.Ile883Met 16372134:72:26
status: NEW
Login to comment

96 To begin exploring this latter possibility in the CVD sample (since it affords the most power to detect such effects), genotyping of the I883M and R1587K variants was performed, and ANOVA used to model the potential independent main effects in a joint analysis of all three markers (including R219K).
X
ABCA1 p.Ile883Met 16372134:96:137
status: NEW
Login to comment

98 In smokers, the main effect for R219K improved when adjusting for the other sites from F2,943=8.4, P=0.00024 in isolation to F2,898=9.9, P=0.000055 when all three markers were included.
X
ABCA1 p.Ile883Met 16372134:98:137
status: NEW
Login to comment

100 The I883M variant was not associated with the APOB trait either in isolation or in the full model.
X
ABCA1 p.Ile883Met 16372134:100:4
status: NEW
Login to comment

111 We also tested the R219K, I883M, and R1587K markers for association with MI risk in the whole sample and in smokers and non-smokers.
X
ABCA1 p.Ile883Met 16372134:111:26
status: NEW
Login to comment

127 The number of individuals in each category is shown in parenthesis. Comparisons were performed by ANOVATC total cholesterol, LDL-C low density lipoprotein cholesterol Traits KK RK RR F value P value APOA1a (g/l) 1.46±0.02 (157) 1.48±0.01 (966) 1.47±0.01 (1,439) 0.23 0.79 APOB (g/l) 1.64±0.03 (157) 1.53±0.01 (966) 1.55±0.01 (1,439) 5.4 0.0046 HDL-C (mmol/l) 1.16±0.26 (156) 1.20±0.01 (961) 1.20±0.01 (1,427) 1.1 0.34 LDL-C (mmol/l) 4.26±0.86 (154) 4.08±0.03 (951) 4.05±0.03 (1,415) 0.26 0.038 TC (mmol/l) 6.24±0.09 (157) 6.04±0.04 (969) 6.01±0.03 (1,439) 3.02 0.049 TGa (mmol/l) 1.87±0.11 (157) 1.71±0.04 (969) 1.72±0.03 (1,441) 1.38 0.25 a Log-transformed traits k.embl-heidelberg.de/PolyPhen/) (Ramensky et al. 2002) for five coding SNPs (cSNPs) in ABCA1 (R219K rs2230806; V771M rs2066718; V825I rs4149312; I883M rs2066714; R1587K rs2230808) (Frikke-Schmidt et al. 2004).
X
ABCA1 p.Ile883Met 16372134:127:902
status: NEW
Login to comment

153 MI Myocardial infarction R219K (rs2230806) KK RK RR P value Smokers MI 29 (0.05) 205 (0.39) 293 (0.56) 0.98 Controls 24 (0.06) 162 (0.38) 236 (0.56) Non-smokers MI 35 (0.06) 198 (0.36) 314 (0.57) 0.87 Controls 67 (0.67) 377 (0.37) 566 (0.56) I883M (rs4149313) II IM MM Smokers MI 418 (0.76) 127 (0.23) 4 (0.01) 0.14 Controls 349 (0.81) 77 (0.18) 3 (0.01) Non-smokers MI 445 (0.78) 115 (0.2) 12(.02) 0.31 Controls 843 (0.81) 184 (0.18) 16 (0.02) R1587K (rs2230808) (rs2230808) KK RK RR Smokers MI 29 (0.05) 160 (0.30) 342 (0.64) 0.025 Controls 14 (0.03) 159 (0.38) 250 (0.59) Non-smokers MI 25 (0.04) 182 (0.33) 346 (0.62) 0.66 Controls 57 (0.05) 329 (0.32) 650 (0.63) also serve as a point to revisit in large published studies, such as that of Frikke-Schmidt et al. (2004).
X
ABCA1 p.Ile883Met 16372134:153:242
status: NEW
Login to comment

39 Genotyping Information on the R219K, I883M, and R1587K variants [representing cDNA (GenBank accession number NM_005502.2) rs2230806, c.658 G>A; rs4149313, c.2650 A>G; rs2230808, c.4762 G>A, respectively] may be found at dbSNP (http://www.ncbi.nlm.nih.gov/ SNP/).
X
ABCA1 p.Ile883Met 16372134:39:37
status: NEW
Login to comment

102 The I883M variant was not associated with the APOB trait either in isolation or in the full model.
X
ABCA1 p.Ile883Met 16372134:102:4
status: NEW
Login to comment

113 We also tested the R219K, I883M, and R1587K markers for association with MI risk in the whole sample and in smokers and non-smokers.
X
ABCA1 p.Ile883Met 16372134:113:26
status: NEW
Login to comment

129 The number of individuals in each category is shown in parenthesis. Comparisons were performed by ANOVATC total cholesterol, LDL-C low density lipoprotein cholesterol Traits KK RK RR F value P value APOA1a (g/l) 1.46&#b1;0.02 (157) 1.48&#b1;0.01 (966) 1.47&#b1;0.01 (1,439) 0.23 0.79 APOB (g/l) 1.64&#b1;0.03 (157) 1.53&#b1;0.01 (966) 1.55&#b1;0.01 (1,439) 5.4 0.0046 HDL-C (mmol/l) 1.16&#b1;0.26 (156) 1.20&#b1;0.01 (961) 1.20&#b1;0.01 (1,427) 1.1 0.34 LDL-C (mmol/l) 4.26&#b1;0.86 (154) 4.08&#b1;0.03 (951) 4.05&#b1;0.03 (1,415) 0.26 0.038 TC (mmol/l) 6.24&#b1;0.09 (157) 6.04&#b1;0.04 (969) 6.01&#b1;0.03 (1,439) 3.02 0.049 TGa (mmol/l) 1.87&#b1;0.11 (157) 1.71&#b1;0.04 (969) 1.72&#b1;0.03 (1,441) 1.38 0.25 a Log-transformed traits k.embl-heidelberg.de/PolyPhen/) (Ramensky et al. 2002) for five coding SNPs (cSNPs) in ABCA1 (R219K rs2230806; V771M rs2066718; V825I rs4149312; I883M rs2066714; R1587K rs2230808) (Frikke-Schmidt et al. 2004).
X
ABCA1 p.Ile883Met 16372134:129:884
status: NEW
Login to comment

155 MI Myocardial infarction R219K (rs2230806) KK RK RR P value Smokers MI 29 (0.05) 205 (0.39) 293 (0.56) 0.98 Controls 24 (0.06) 162 (0.38) 236 (0.56) Non-smokers MI 35 (0.06) 198 (0.36) 314 (0.57) 0.87 Controls 67 (0.67) 377 (0.37) 566 (0.56) I883M (rs4149313) II IM MM Smokers MI 418 (0.76) 127 (0.23) 4 (0.01) 0.14 Controls 349 (0.81) 77 (0.18) 3 (0.01) Non-smokers MI 445 (0.78) 115 (0.2) 12(.02) 0.31 Controls 843 (0.81) 184 (0.18) 16 (0.02) R1587K (rs2230808) (rs2230808) KK RK RR Smokers MI 29 (0.05) 160 (0.30) 342 (0.64) 0.025 Controls 14 (0.03) 159 (0.38) 250 (0.59) Non-smokers MI 25 (0.04) 182 (0.33) 346 (0.62) 0.66 Controls 57 (0.05) 329 (0.32) 650 (0.63) also serve as a point to revisit in large published studies, such as that of Frikke-Schmidt et al. (2004).
X
ABCA1 p.Ile883Met 16372134:155:242
status: NEW
Login to comment

PMID: 15935359 [PubMed] Hodoglugil U et al: "Common polymorphisms of ATP binding cassette transporter A1, including a functional promoter polymorphism, associated with plasma high density lipoprotein cholesterol levels in Turks."
No. Sentence Comment
3 The rare alleles of C-14T and V771M polymorphisms were associated with higher HDL-C levels in men and, in combination with the rare alleles of R219K and I883M, respectively, with higher HDL-C in both sexes.
X
ABCA1 p.Ile883Met 15935359:3:153
status: NEW
Login to comment

10 The rare alleles of the V771M and the I883M polymorphisms do not exist together on any of the common haplotypes.
X
ABCA1 p.Ile883Met 15935359:10:38
status: NEW
Login to comment

11 In conclusion, we describe a functional promoter polymorphism (C-14T) and a coding sequence variant (V771M) of ABCA1 and their interactions with two other variants (R219K and I883M) on plasma HDL-C levels in Turks.
X
ABCA1 p.Ile883Met 15935359:11:175
status: NEW
Login to comment

22 doi:10.1016/j.atherosclerosis.2005.03.004 [9] and I883M [9-11], are associated with elevated HDL-C levels, although not in all studies [10,12-17].
X
ABCA1 p.Ile883Met 15935359:22:52
status: NEW
Login to comment

31 In onestudy,wheremalesandfemaleswereanalyzedseparately, R219K and I883M were associated with elevated HDL-C levels in females only [9].
X
ABCA1 p.Ile883Met 15935359:31:66
status: NEW
Login to comment

104 The G-803A Table 2 ABCA1 polymorphisms Nucleotide changea Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in 5 and promoter regions G-803A ~10 92/141 [19] T-564C 72.7 47.7 728/1268 [18] G-407C 62.5 40.7 220/233 [18] G-99C 42.2 24.2 875/1130 [46] C-14T 61.2 37.7 916/1416 [46] InsG 319 26.6 14.2 848/1288 [46] Nucleotide changed Amino acid change Exon Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in coding sequence Nonsynonymous G(70943)A R219K 7 62.3 38.5 996/1466 db 2230806 G(102555)A V771M 16 10.0 5.1 981/1477 db 2066718 G(103777)A V825I 17 12.3 6.2 960/1145 db 4149312 A(105057)G I883M 18 38.1 21.8 1084/1448 db 4149313 G(112177)C E1172D 24 9.0 4.6 1001/1237 [12,13] A(116887)G Q1328R 28 0.003e 0.0015 172/156 NR G(129004)A R1587K 35 55.1 33.0 937/1351 db 2230808 T(133402)C Y1767H 39 ~1.0e 40/55 NR G(133420)A V1773M 39 ~1.0e 40/55 NR Synonymous C(100538)A I620I 15 ~4.0 40/55 NR C(109469)T V990V 21 ~3.0 87/90 [17] T(109861)G V1053V 22 ~1.0 90/90 [12] C(109868)T L1056L 22 ~5.0 90/90 NR C(109906)T R1068R 22 ~3.0 90/90 NR A(113280)G E1211E 25 ~4.0 40/55 [17] A(116879)G T1325T 28 ~1.0 40/55 NR T(137043)C Y1921Y 43 ~1.0 40/55 NR Nucleotide changed Intron Carrier of rare allele (%) Intronic location nb Referencesc Frequency in noncoding sequence G(23816)A 1 ~1.0 11 bp 5 exon 1b 94 NR G(23819)C 1 42 8 bp 5 exon 1b 94 NR A(22997)T 1 46 90 bp 5 exon 1d 91 NR A(23004)G 1 ~1.0 83 bp 5 exon 1d 91 NR G(23058)C 1 46 29 bp 5 exon 1d 91 NR G(40504)A 3 2.6 26 bp 3 of exon 3 192 NR C(45217)T 4 0.7 64 bp 3 of exon 4 142 NR T(98628)A 14 35-40 24 bp 3 of exon 14 190 db 4743763 C(100332)T 14 4.3 59 bp 5 of exon 15 90 db 2066717 C(108020)T 19 0.7 3 bp 5 of exon 20 144 NR DelTTT(134503-6) 39 7.0 20-23 bp 5 of exon 40 90 NR C(142026)T 46 8.6 34 bp 5 of exon 47 116 NR A(142751)G 48 15.9 13 bp 3 of exon 48 107 NR a Relative to transcriptional start.
X
ABCA1 p.Ile883Met 15935359:104:629
status: NEW
Login to comment

109 Table 3 ABCA1 polymorphisms and mean plasma HDL-C levels (mg/dl ± S.D.) in a random Turkish population Females Males AAa AB BB AAa AB BB Promoter and 5 region T-564C 40.4 ± 8.4 (205) 41.0 ± 7.9 (365) 39.9 ± 7.6 (158) 35.6 ± 7.4 (339) 35.5 ± 6.5 (635) 34.9 ± 6.5 (294) G-407C 41.3 ± 11.2 (82) 40.7 ± 7.7 (101) 40.7 ± 12.2 (37) 35.7 ± 6.9 (88) 35.3 ± 6.7 (96) 35.4 ± 7.4 (49) G-99C 40.7 ± 7.5 (505) 41.0 ± 7.2 (317) 41.3 ± 8.4 (53) 35.1 ± 6.5 (654) 35.0 ± 6.3 (405) 34.9 ± 6.5 (71) C-14T 41.3 ± 9.0 (361) 41.0 ± 9.0 (417) 41.0 ± 9.4 (138) 34.8 ± 7.0b (547) 35.5 ± 7.5 (675) 36.7 ± 8.1b (194) InsG 319 41.3 ± 8.1 (641) 40.5 ± 7.7 (193) 43.1 ± 8.0 (14) 35.3 ± 6.4 (933) 34.7 ± 6.4 (332) 34.5 ± 6.5 (23) Nonsynonymous R219K 41.2 ± 9.4 (364) 40.8 ± 8.6 (480) 41.2 ± 10 (152) 35.2 ± 7.3 (574) 35.3 ± 7.3 (688) 35.2 ± 7.6 (204) V771M 40.9 ± 9.2 (896) 42.8 ± 9.3 (82) 38.7 ± 10 (3) 35.1 ± 7.2c (1330) 37.1 ± 8.0c (144) 45.7 ± 10.7 (3) V825I 40.6 ± 9.4 (842) 38.9 ± 8.5 (117) 42 (1) 35.8 ± 8.7 (1005) 37.1 ± 9.5 (140) (-) I883M 41.1 ± 9.5 (643) 40.8 ± 8.4 (372) 41.4 ± 9.1 (69) 35.0 ± 7.0 (922) 35.7 ± 8.0 (457) 35.6 ± 7.4 (69) E1172D 40.5 ± 8.8 (907) 40.5 ± 7.6 (93) 29 (1) 34.6 ± 7.3 (1129) 35.4 ± 7.6 (105) 30.7 ± 8.7 (3) R1587K 41.1 ± 9.4 (410) 40.8 ± 9.6 (433) 41.0 ± 10.1 (94) 35.9 ± 8.1 (617) 35.1 ± 7.6 (579) 35.3 ± 8.6 (155) Numbers of subjects are shown in parenthesis.
X
ABCA1 p.Ile883Met 15935359:109:1247
status: NEW
Login to comment

116 Informative associations between HDL-C levels and the R219K, V771M, and I883M polymorphisms will be discussed.
X
ABCA1 p.Ile883Met 15935359:116:72
status: NEW
Login to comment

168 Effect of combined ABCA1 polymorphisms on HDL-C levels in a random Turkish population The R219K and I883M polymorphisms have been shown to affect lipid metabolism or CAD risk [9,10,12,15,43].
X
ABCA1 p.Ile883Met 15935359:168:100
status: NEW
Login to comment

170 In contrast, the combinations of C-14T with R219K and of V771M with I883M were associated with altered HDL-C levels.
X
ABCA1 p.Ile883Met 15935359:170:68
status: NEW
Login to comment

177 To assess the combined effect of the V771M and I883M polymorphisms on HDL-C levels, subjects were stratified by the I883M genotype (II, IM, or MM) versus V771M.
X
ABCA1 p.Ile883Met 15935359:177:47
status: NEW
X
ABCA1 p.Ile883Met 15935359:177:116
status: NEW
Login to comment

181 Separate haplotype blocks of ABCA1 In order to assess whether the length of the ABCA1 locus could be treated as a single haplotype block, haplotypes were constructed and significant LDs between polymorphisms were calculated using 10 common ABCA1 polymorphisms Table 4 Interactive effects of ABCA1 polymorphisms on mean plasma HDL-C levels (mg/dl ± S.D.) R219K C-14T Females Males RR CC 41.4 ± 8.5 (128) 34.7 ± 6.7 (207) CT 41.6 ± 9.8 (150) 35.7 ± 7.6 (253) TT 41.3 ± 8.9 (55) 36.3 ± 7.8 (84) RK CC 41.8 ± 8.3 (169) 34.8 ± 7.4 (261) CT 39.9 ± 8.3 (203) 35.5 ± 6.8 (309) TT 39.5 ± 9.0 (60) 36.8 ± 8.5 (84) KK CC 39.8 ± 11.2 (60) 34.0 ± 6.2 (69) CT 41.1 ± 9.0 (60) 35.7 ± 8.4 (102) TT 44.7 ± 9.8a (22) 37.1 ± 7.8a (22) I883M V771M II VV 40.9 ± 9.8 (499) 34.8 ± 6.8 (797) VM 41.4 ± 8.3 (74) 36.7 ± 8.3b (112) IM VV 40.3 ± 8.0 (313) 35.1 ± 8.1 (427) VM 44.2 ± 11.5b (17) 37.3 ± 7.4b (26) MM VV 41.6 ± 9.2 (60) 35.6 ± 7.5 (67) Numbers of subjects are shown in parenthesis.
X
ABCA1 p.Ile883Met 15935359:181:811
status: NEW
Login to comment

204 However, further analysis Table 5 Allele frequency and significant (P < 0.01) pair-wise linkage disequilibrium coefficients between the ABCA1 polymorphisms in a random Turkish population Position Allele % T-564C G-99C C-14T InsG 319 R219K V771M V825I I883M E1172D R1587K T-564C 52.3/47.7 - G-99C 75.8/24.2 0.36 - C-14T 62.3/37.7 -0.96 -0.98 - InsG 319 85.8/14.2 - - - - R219K 61.5/38.5 - - - - V771M 94.9/5.1 - - - 0.99 - V825I 93.8/6.2 -0.40 -0.69 - - -0.76 - - I883M 78.2/21.8 - -0.42 - - 0.20 -0.79 0.91 - E1172D 95.4/4.6 - - - - - 0.34 - - - R1587K 67.0/33.0 - - -0.23 - - 0.56 - - 0.87 - Table 6 Common haplotypes of promoter and coding regions of ABCA1 gene in a random Turkish population Promoter region haplotypes % T-564C G-99C C-14T InsG 319 1 31.7 0 0 1 0 2 20.1 1 1 0 0 3 19.9 1 0 0 0 4 12.7 0 0 0 0 5 4.6 0 0 1 1 6 4.2 1 1 0 1 7 3.2 1 0 0 1 8 2.5 0 0 0 1 Sum 98.9 Coding region haplotypes % R219K V771M V825I I883M E1172D R1587K 1 39.3 0 0 0 0 0 0 2 12.6 1 0 0 0 0 0 3 12.0 0 0 0 0 0 1 4 8.7 1 0 0 1 0 0 5 8.3 1 0 0 0 0 1 6 4.0 0 0 1 1 0 0 7 3.4 0 0 0 0 1 1 8 1.6 1 0 0 1 0 1 9 1.3 1 1 0 0 0 0 10 1.3 0 1 0 0 1 1 11 1.3 0 0 1 1 0 1 12 1.1 1 1 0 0 0 1 Sum 95.1 0: common allele; 1: rare allele.
X
ABCA1 p.Ile883Met 15935359:204:251
status: NEW
X
ABCA1 p.Ile883Met 15935359:204:463
status: NEW
X
ABCA1 p.Ile883Met 15935359:204:925
status: NEW
Login to comment

215 Haplotype structure and haplotype-phenotype association of polymorphisms in the coding region of ABCA1 When the haplotype structure of the coding region was constructed using six polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K; Table 6), 12 haplotypes with a frequency >1% accounted for 95.1% of all haplotypes.
X
ABCA1 p.Ile883Met 15935359:215:215
status: NEW
Login to comment

221 Those remaining must be distributed among the rare (<1%) haplotypes, and this distribution may explain the lack of association for the V771M on haplotype analysis.
X
ABCA1 p.Ile883Met 15935359:221:49
status: NEW
Login to comment

222 We observed an interaction between the V771M and I883M polymorphisms (Table 4).
X
ABCA1 p.Ile883Met 15935359:222:49
status: NEW
Login to comment

230 (rare allele in LD with rare allele) was observed between pairs of V771M and InsG 319, V825I and I883M, and R1587K and E1172D.
X
ABCA1 p.Ile883Met 15935359:230:61
status: NEW
X
ABCA1 p.Ile883Met 15935359:230:97
status: NEW
Login to comment

231 There was negative LD (rare allele to common allele) between I883M and V771M as seen in Table 4.
X
ABCA1 p.Ile883Met 15935359:231:61
status: NEW
Login to comment

290 In Turkish males but not females, the M allele of the V771M polymorphism was associated with high plasma HDL-C levels. After stratification by HDL-C levels, the M allele was significantly more frequent in the high than in the low HDL-C group, further supporting an association with high plasma HDL-C levels.
X
ABCA1 p.Ile883Met 15935359:290:136
status: NEW
Login to comment

291 The 771VM genotype was associated with high HDL-C in both males and females when it occurred in combination with the IM genotype of the I883M polymorphism.
X
ABCA1 p.Ile883Met 15935359:291:136
status: NEW
Login to comment

295 The V771M polymorphism was associated with high HDL-C in females and consistent trends in males [17], whereas male subjects with the 771M allele had decreased focal atherosclerosis without alterations in plasma lipid levels [12].
X
ABCA1 p.Ile883Met 15935359:295:4
status: NEW
Login to comment

296 The I883M polymorphism alone did not appear to alter HDL-C levels in Turks.
X
ABCA1 p.Ile883Met 15935359:296:4
status: NEW
Login to comment

299 In contrast, the M allele of the I883M polymorphism was associated with increased progression of atherosclerosis [12].
X
ABCA1 p.Ile883Met 15935359:299:29
status: NEW
Login to comment

300 The combination of V771M and I883M alone or with other factors may modulate plasma HDL-C levels and CAD risk.
X
ABCA1 p.Ile883Met 15935359:300:29
status: NEW
Login to comment

304 A functional promoter polymorphism, C-14T, and a coding sequence polymorphism, V771M, in the ABCA1 gene appeared to affect HDL-C levels in Turks and these results could be replicated when our entire data set was randomly divided in two different subsets (Supplemental Table II).
X
ABCA1 p.Ile883Met 15935359:304:65
status: NEW
Login to comment

305 Two combinations of rare alleles-C-14T with R219K and V771M with I883M-were associated with high HDL-C in both males and females.
X
ABCA1 p.Ile883Met 15935359:305:65
status: NEW
Login to comment

103 The G-803A Table 2 ABCA1 polymorphisms Nucleotide changea Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in 5 and promoter regions G-803A ~10 92/141 [19] T-564C 72.7 47.7 728/1268 [18] G-407C 62.5 40.7 220/233 [18] G-99C 42.2 24.2 875/1130 [46] C-14T 61.2 37.7 916/1416 [46] InsG 319 26.6 14.2 848/1288 [46] Nucleotide changed Amino acid change Exon Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in coding sequence Nonsynonymous G(70943)A R219K 7 62.3 38.5 996/1466 db 2230806 G(102555)A V771M 16 10.0 5.1 981/1477 db 2066718 G(103777)A V825I 17 12.3 6.2 960/1145 db 4149312 A(105057)G I883M 18 38.1 21.8 1084/1448 db 4149313 G(112177)C E1172D 24 9.0 4.6 1001/1237 [12,13] A(116887)G Q1328R 28 0.003e 0.0015 172/156 NR G(129004)A R1587K 35 55.1 33.0 937/1351 db 2230808 T(133402)C Y1767H 39 ~1.0e 40/55 NR G(133420)A V1773M 39 ~1.0e 40/55 NR Synonymous C(100538)A I620I 15 ~4.0 40/55 NR C(109469)T V990V 21 ~3.0 87/90 [17] T(109861)G V1053V 22 ~1.0 90/90 [12] C(109868)T L1056L 22 ~5.0 90/90 NR C(109906)T R1068R 22 ~3.0 90/90 NR A(113280)G E1211E 25 ~4.0 40/55 [17] A(116879)G T1325T 28 ~1.0 40/55 NR T(137043)C Y1921Y 43 ~1.0 40/55 NR Nucleotide changed Intron Carrier of rare allele (%) Intronic location nb Referencesc Frequency in noncoding sequence G(23816)A 1 ~1.0 11 bp 5 exon 1b 94 NR G(23819)C 1 42 8 bp 5 exon 1b 94 NR A(22997)T 1 46 90 bp 5 exon 1d 91 NR A(23004)G 1 ~1.0 83 bp 5 exon 1d 91 NR G(23058)C 1 46 29 bp 5 exon 1d 91 NR G(40504)A 3 2.6 26 bp 3 of exon 3 192 NR C(45217)T 4 0.7 64 bp 3 of exon 4 142 NR T(98628)A 14 35-40 24 bp 3 of exon 14 190 db 4743763 C(100332)T 14 4.3 59 bp 5 of exon 15 90 db 2066717 C(108020)T 19 0.7 3 bp 5 of exon 20 144 NR DelTTT(134503-6) 39 7.0 20-23 bp 5 of exon 40 90 NR C(142026)T 46 8.6 34 bp 5 of exon 47 116 NR A(142751)G 48 15.9 13 bp 3 of exon 48 107 NR a Relative to transcriptional start.
X
ABCA1 p.Ile883Met 15935359:103:630
status: NEW
Login to comment

108 Table 3 ABCA1 polymorphisms and mean plasma HDL-C levels (mg/dl &#b1; S.D.) in a random Turkish population Females Males AAa AB BB AAa AB BB Promoter and 5 region T-564C 40.4 &#b1; 8.4 (205) 41.0 &#b1; 7.9 (365) 39.9 &#b1; 7.6 (158) 35.6 &#b1; 7.4 (339) 35.5 &#b1; 6.5 (635) 34.9 &#b1; 6.5 (294) G-407C 41.3 &#b1; 11.2 (82) 40.7 &#b1; 7.7 (101) 40.7 &#b1; 12.2 (37) 35.7 &#b1; 6.9 (88) 35.3 &#b1; 6.7 (96) 35.4 &#b1; 7.4 (49) G-99C 40.7 &#b1; 7.5 (505) 41.0 &#b1; 7.2 (317) 41.3 &#b1; 8.4 (53) 35.1 &#b1; 6.5 (654) 35.0 &#b1; 6.3 (405) 34.9 &#b1; 6.5 (71) C-14T 41.3 &#b1; 9.0 (361) 41.0 &#b1; 9.0 (417) 41.0 &#b1; 9.4 (138) 34.8 &#b1; 7.0b (547) 35.5 &#b1; 7.5 (675) 36.7 &#b1; 8.1b (194) InsG 319 41.3 &#b1; 8.1 (641) 40.5 &#b1; 7.7 (193) 43.1 &#b1; 8.0 (14) 35.3 &#b1; 6.4 (933) 34.7 &#b1; 6.4 (332) 34.5 &#b1; 6.5 (23) Nonsynonymous R219K 41.2 &#b1; 9.4 (364) 40.8 &#b1; 8.6 (480) 41.2 &#b1; 10 (152) 35.2 &#b1; 7.3 (574) 35.3 &#b1; 7.3 (688) 35.2 &#b1; 7.6 (204) V771M 40.9 &#b1; 9.2 (896) 42.8 &#b1; 9.3 (82) 38.7 &#b1; 10 (3) 35.1 &#b1; 7.2c (1330) 37.1 &#b1; 8.0c (144) 45.7 &#b1; 10.7 (3) V825I 40.6 &#b1; 9.4 (842) 38.9 &#b1; 8.5 (117) 42 (1) 35.8 &#b1; 8.7 (1005) 37.1 &#b1; 9.5 (140) (-) I883M 41.1 &#b1; 9.5 (643) 40.8 &#b1; 8.4 (372) 41.4 &#b1; 9.1 (69) 35.0 &#b1; 7.0 (922) 35.7 &#b1; 8.0 (457) 35.6 &#b1; 7.4 (69) E1172D 40.5 &#b1; 8.8 (907) 40.5 &#b1; 7.6 (93) 29 (1) 34.6 &#b1; 7.3 (1129) 35.4 &#b1; 7.6 (105) 30.7 &#b1; 8.7 (3) R1587K 41.1 &#b1; 9.4 (410) 40.8 &#b1; 9.6 (433) 41.0 &#b1; 10.1 (94) 35.9 &#b1; 8.1 (617) 35.1 &#b1; 7.6 (579) 35.3 &#b1; 8.6 (155) Numbers of subjects are shown in parenthesis.
X
ABCA1 p.Ile883Met 15935359:108:1201
status: NEW
Login to comment

115 Informative associations between HDL-C levels and the R219K, V771M, and I883M polymorphisms will be discussed.
X
ABCA1 p.Ile883Met 15935359:115:72
status: NEW
Login to comment

167 Effect of combined ABCA1 polymorphisms on HDL-C levels in a random Turkish population The R219K and I883M polymorphisms have been shown to affect lipid metabolism or CAD risk [9,10,12,15,43].
X
ABCA1 p.Ile883Met 15935359:167:100
status: NEW
Login to comment

169 In contrast, the combinations of C-14T with R219K and of V771M with I883M were associated with altered HDL-C levels.
X
ABCA1 p.Ile883Met 15935359:169:68
status: NEW
Login to comment

176 To assess the combined effect of the V771M and I883M polymorphisms on HDL-C levels, subjects were stratified by the I883M genotype (II, IM, or MM) versus V771M.
X
ABCA1 p.Ile883Met 15935359:176:47
status: NEW
X
ABCA1 p.Ile883Met 15935359:176:116
status: NEW
Login to comment

180 Separate haplotype blocks of ABCA1 In order to assess whether the length of the ABCA1 locus could be treated as a single haplotype block, haplotypes were constructed and significant LDs between polymorphisms were calculated using 10 common ABCA1 polymorphisms Table 4 Interactive effects of ABCA1 polymorphisms on mean plasma HDL-C levels (mg/dl &#b1; S.D.) R219K C-14T Females Males RR CC 41.4 &#b1; 8.5 (128) 34.7 &#b1; 6.7 (207) CT 41.6 &#b1; 9.8 (150) 35.7 &#b1; 7.6 (253) TT 41.3 &#b1; 8.9 (55) 36.3 &#b1; 7.8 (84) RK CC 41.8 &#b1; 8.3 (169) 34.8 &#b1; 7.4 (261) CT 39.9 &#b1; 8.3 (203) 35.5 &#b1; 6.8 (309) TT 39.5 &#b1; 9.0 (60) 36.8 &#b1; 8.5 (84) KK CC 39.8 &#b1; 11.2 (60) 34.0 &#b1; 6.2 (69) CT 41.1 &#b1; 9.0 (60) 35.7 &#b1; 8.4 (102) TT 44.7 &#b1; 9.8a (22) 37.1 &#b1; 7.8a (22) I883M V771M II VV 40.9 &#b1; 9.8 (499) 34.8 &#b1; 6.8 (797) VM 41.4 &#b1; 8.3 (74) 36.7 &#b1; 8.3b (112) IM VV 40.3 &#b1; 8.0 (313) 35.1 &#b1; 8.1 (427) VM 44.2 &#b1; 11.5b (17) 37.3 &#b1; 7.4b (26) MM VV 41.6 &#b1; 9.2 (60) 35.6 &#b1; 7.5 (67) Numbers of subjects are shown in parenthesis.
X
ABCA1 p.Ile883Met 15935359:180:792
status: NEW
Login to comment

203 However, further analysis Table 5 Allele frequency and significant (P < 0.01) pair-wise linkage disequilibrium coefficients between the ABCA1 polymorphisms in a random Turkish population Position Allele % T-564C G-99C C-14T InsG 319 R219K V771M V825I I883M E1172D R1587K T-564C 52.3/47.7 - G-99C 75.8/24.2 0.36 - C-14T 62.3/37.7 -0.96 -0.98 - InsG 319 85.8/14.2 - - - - R219K 61.5/38.5 - - - - V771M 94.9/5.1 - - - 0.99 - V825I 93.8/6.2 -0.40 -0.69 - - -0.76 - - I883M 78.2/21.8 - -0.42 - - 0.20 -0.79 0.91 - E1172D 95.4/4.6 - - - - - 0.34 - - - R1587K 67.0/33.0 - - -0.23 - - 0.56 - - 0.87 - Table 6 Common haplotypes of promoter and coding regions of ABCA1 gene in a random Turkish population Promoter region haplotypes % T-564C G-99C C-14T InsG 319 1 31.7 0 0 1 0 2 20.1 1 1 0 0 3 19.9 1 0 0 0 4 12.7 0 0 0 0 5 4.6 0 0 1 1 6 4.2 1 1 0 1 7 3.2 1 0 0 1 8 2.5 0 0 0 1 Sum 98.9 Coding region haplotypes % R219K V771M V825I I883M E1172D R1587K 1 39.3 0 0 0 0 0 0 2 12.6 1 0 0 0 0 0 3 12.0 0 0 0 0 0 1 4 8.7 1 0 0 1 0 0 5 8.3 1 0 0 0 0 1 6 4.0 0 0 1 1 0 0 7 3.4 0 0 0 0 1 1 8 1.6 1 0 0 1 0 1 9 1.3 1 1 0 0 0 0 10 1.3 0 1 0 0 1 1 11 1.3 0 0 1 1 0 1 12 1.1 1 1 0 0 0 1 Sum 95.1 0: common allele; 1: rare allele.
X
ABCA1 p.Ile883Met 15935359:203:251
status: NEW
X
ABCA1 p.Ile883Met 15935359:203:463
status: NEW
X
ABCA1 p.Ile883Met 15935359:203:925
status: NEW
Login to comment

214 Haplotype structure and haplotype-phenotype association of polymorphisms in the coding region of ABCA1 When the haplotype structure of the coding region was constructed using six polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K; Table 6), 12 haplotypes with a frequency >1% accounted for 95.1% of all haplotypes.
X
ABCA1 p.Ile883Met 15935359:214:215
status: NEW
Login to comment

229 (rare allele in LD with rare allele) was observed between pairs of V771M and InsG 319, V825I and I883M, and R1587K and E1172D.
X
ABCA1 p.Ile883Met 15935359:229:97
status: NEW
Login to comment

298 In contrast, the M allele of the I883M polymorphism was associated with increased progression of atherosclerosis [12].
X
ABCA1 p.Ile883Met 15935359:298:33
status: NEW
Login to comment

PMID: 16429166 [PubMed] Brunham LR et al: "Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene."
No. Sentence Comment
45 À3), R219K, V771M, I883M, D1289N, and P2150L, four had cholesterol efflux values that were not statistically different from wild-type ABCA1.
X
ABCA1 p.Ile883Met 16429166:45:19
status: NEW
Login to comment

47 One variant, I883M, was predicted to be functionally neutral but found to have cholesterol efflux modestly but significantly reduced (approximately 70% of wild-type ABCA1, p , 0.01).
X
ABCA1 p.Ile883Met 16429166:47:13
status: NEW
Login to comment

48 This SNP has been reported to be associated with decreased HDL cholesterol and increased severity of atherosclerosis in Table 1. subPSEC Scores and Probability of Functional Impairment (Pdeleterious) for ABCA1 Mutations and SNPs Mutations SNPs Variant SubPSEC Pdeleterious Variant subPSEC Pdeleterious P85L À4.62 0.83 R219K À0.57 0.08 H160F À2.79 0.45 V399A À2.26 0.32 R230C À4.27 0.78 V771M À2.86 0.46 A255T À1.81 0.23 T774P À1.99 0.27 E284K À2.34 0.34 K776N À3.53 0.63 Y482C À4.21 0.77 V825I À1.06 0.13 R587W À6.04 0.95 I883M À1.38 0.17 W590S À5.19 0.9 E1172D À1.96 0.26 W590L À4.48 0.82 R1587K À0.58 0.08 Q597R À7.15 0.98 S1731C À4.21 0.77 T929I À4.29 0.78 N935H À8.54 1 N935S À7.53 0.99 A937V À6.6 0.97 A1046D À7.52 0.99 M1091T À3.56 0.64 D1099Y À6.09 0.96 D1289N À2.48 0.37 L1379F À3.81 0.69 C1477R À5.44 0.92 S1506L À5.17 0.9 N1611D À5.69 0.94 R1680W À6.02 0.95 V1704D À3.21 0.55 N1800H À4.23 0.77 R1901S À5.06 0.89 F2009S À2.73 0.43 R2081W À8.08 0.99 P2150L À2.88 0.47 Q2196H À2.74 0.43 DOI: 10.1371/journal.pgen.0010083.t001 PLoS Genetics | www.plosgenetics.org December 2005 | Volume 1 | Issue 6 | e83 0740 Accurate Prediction of ABCA1 Variants Synopsis A major goal of human genetics research is to understand how genetic variation leads to differences in the function of genes.
X
ABCA1 p.Ile883Met 16429166:48:522
status: NEW
X
ABCA1 p.Ile883Met 16429166:48:587
status: NEW
Login to comment

75 Cholesterol Efflux Values for 293 Cells Transfected with ABCA1 Variants and subPSEC and PolyPhen Predictions of the Functional Impact of these Variants Variant Variant Type subPSEC Cholesterol Efflux PolyPhen R2081W Mutation À8.08 21.1 6 21%* Probably damaging N935S Mutation À7.53 29.3 6 13%* Benign A1046D Mutation À7.52 16.8 6 7%* Possibly damaging Q597R Mutation À7.15 17.7 6 14%* Probably damaging R587W Mutation À6.04 31.7 6 33%* Probably damaging C1477R Mutation À5.44 20.5 6 10%* Probably damaging W590S Mutation À5.19 47.1 6 13%* Probably damaging S1506L Mutation À5.17 17.8 6 15%* Probably damaging T929I Mutation À4.29 69.9 6 11%* Possibly damaging N1800H Mutation À4.23 31.3 6 16%* Possibly damaging S1731C SNP À4.21 12.3 6 10%* Possibly damaging M1091T Mutation À3.56 6.9 6 20%* Probably damaging P2150L Mutation À2.88 88.4 6 21% Probably damaging V771M SNP &#xc0;2.86 145.4 6 33% Benign D1289N Mutation À2.48 137.7 6 86% Benign I883M SNP À1.38 69.1 6 16%* Benign R219K SNP À0.57 103.7 6 21.05 Benign Wild-type - 0.0 100% - *p , 0.01 compared to wild-type ABCA1.
X
ABCA1 p.Ile883Met 16429166:75:937
status: NEW
X
ABCA1 p.Ile883Met 16429166:75:1012
status: NEW
Login to comment

147 The I883M substitution results in a milder phenotype, with a modest but significant reduction in ABCA1-mediated cholesterol efflux.
X
ABCA1 p.Ile883Met 16429166:147:4
status: NEW
Login to comment

150 This divergence explains why a simple conservation-based approach predicts that I883M is a neutral substitution.
X
ABCA1 p.Ile883Met 16429166:150:80
status: NEW
Login to comment

PMID: 16226177 [PubMed] Frikke-Schmidt R et al: "Mutation in ABCA1 predicted risk of ischemic heart disease in the Copenhagen City Heart Study Population."
No. Sentence Comment
107 However, at the individual level, K776N appears to have a marked impact on risk.
X
ABCA1 p.Ile883Met 16226177:107:972
status: NEW
Login to comment

109 However, several arguments favor a true observation: 1) the involved amino acid residue is completely conserved between species and relatively conserved between 12 ABCAs with very different transport functions; 2) the amino acid substitution changes the charge of the side-chain, potentially leading to structural alterations of the protein, and consequently to altered protein interactions or transport properties; 3) in the CFTR (or ABCC7), a disease-causing mutation (R347P) has been identified at a site that corresponds to residue 764 in ABCA1 (15), and thus in close vicinity to K776N; 4) the present study is of a large cohort, and therefore includes only incident cases, avoiding the normal pitfalls of case reports and case-control studies (30); 5) we observed a similar trend on risk of IHD in a separate case-control study; 6) we have previously determined effects on lipids and lipoproteins of all non-synonymous SNPs identified in ABCA1 (R219K, V771M, V825I, I883M, E1172D, R1587K).
X
ABCA1 p.Ile883Met 16226177:109:972
status: NEW
Login to comment

PMID: 15262183 [PubMed] Probst MC et al: "Screening for functional sequence variations and mutations in ABCA1."
No. Sentence Comment
188 The patient was also heterozygous for two known polymorphisms (R219K and I883M), but no second mutation could be identified so far.
X
ABCA1 p.Ile883Met 15262183:188:73
status: NEW
Login to comment

PMID: 15044381 [PubMed] Knoblauch H et al: "Haplotypes and SNPs in 13 lipid-relevant genes explain most of the genetic variance in high-density lipoprotein and low-density lipoprotein cholesterol."
No. Sentence Comment
77 SNP characteristics including SNP identification system, localization, allele frequencies, nucleotide exchange and pseudonym are shown Gene/SNP no. SNP Id. Localization Allele frequency Nucleotide exchange Pseudonym APOB apob.snp1 rs512535 Promotor 0.45 G/A G-837A apob.snp2 rs1367117 Exon/non-syn 0.32 C/T Thr71Ile apob.snp3 rs520354 Intron 0.44 T/C apob.snp4 rs679899 Exon/non-syn 0.44 C/T Ala618Val apob.snp5 rs673548 Intron 0.21 C/T apob.snp6 rs693 Exon/syn 0.50 T/C XbaI apob.snp7 rs1800479 Intron 0.16 C/G Gþ50/in27C apob.snp8 rs1801703 Exon/non-syn 0.01 C/T Val4101Met apob.snp9 rs1042034 Exon/non-syn 0.22 T/C Asn4311Ser APOE apoe.snp1 rs449647 Promotor 0.17 A/T t-491a apoe.snp2 rs405509 Promotor 0.48 C/A g-219t apoe.snp3 rs440446 Intron 0.36 G/C Variant 1163 apoe.snp4 rs769450 Intron 0.41 C/T Variant 2440 apoe.snp5 rs429358 Exon/non-syn 0.16 T/C Cys112Arg apoe.snp6 rs7412 Exon/non-syn 0.06 C/T Arg158Cys ABCA1 abca1.snp1 rs2422493 Promotor 0.45 G/A 2477c/t abca1.snp2 rs1800977 50 UTR 0.50 C/T t69c abca1.snp3 50 UTR 0.04 C/G c117g abca1.snp4 rs2575879 Intron 0.46 G/C abca1.snp5 rs1800978 50 UTR 0.01 G/C G378C abca1.snp6 rs1999429 Intron 0.03 G/T abca1.snp7 rs2230806 Exon/non-syn 0.26 C/T Arg219Lys abca1.snp8 rs2274873 Exon/syn 0.08 C/T Pro312Pro abca1.snp9 rs4149313 Exon/non-syn 0.13 T/C A3044G, Ile883Met abca1.snp10 Exon/non-syn 0.03 C/G G3911C, Glu1172Asp abca1.snp11 rs2066716 Exon/syn 0.08 G/A Thr1367Thr abca1.snp12 rs363717 30 UTR 0.20 A/G CETP cetp.snp1 rs4783961 Promotor 0.47 C/T 2971 g/a cetp.snp2 rs1800776 Promotor 0.07 G/T 2631 cetp.snp3 rs1800775 Promotor 0.49 G/T 2629 cetp.snp4 rs711752 Intron 0.45 C/T Gþ202/in1A cetp.snp5 rs708272 Intron 0.45 C/T Taq1B; Gþ279/in1A cetp.snp6 rs158478 Intron 0.46 C/A EcoNI cetp.snp7 rs1532625 Intron 0.43 G/A Cþ8/in7T cetp.snp8 rs289718 Intron 0.29 T/C cetp.snp9 rs289719 Intron 0.29 C/T cetp.snp10 rs5880 Exon/non-syn 0.04 C/G CETPu1, Ala373Pro cetp.snp11 rs5882 Exon/non-syn 0.35 A/G CETPu2 cetp.snp12 rs1801706 30 UTR 0.18 C/T Gþ84A LCAT lcat.snp1 rs1109166 Intron 0.17 A/G lcat.snp2 rs4986970 Exon/non-syn 0.04 A/T Ser232Thr lcat.snp3 rs5923 Exon/syn 0.04 G/A LCATu3 LIPC lipc.snp1 rs723967 50 regiona 0.46 G/A lipc.snp2 rs1800588 Promotor 0.28 G/A 2C480T lipc.snp3 rs1869144 Intron 0.39 A/G lipc.snp4 rs6078 Exon/non-syn 0.04 G/A LIPCu1; Val73Met lipc.snp5 rs690 Exon/syn 0.49 T/G LIPCu3; Val155Val lipc.snp6 rs6082 Exon/syn 0.08 A/G LIPCu5; Gly197Gly lipc.snp7 rs6083 Exon/non-syn 0.36 T/C LIPCu6; Asn193Ser lipc.snp8 rs6084 Exon/syn 0.44 C/G LIPCu8; Thr224Thr lipc.snp9 rs6074 Exon/syn 0.13 G/T Thr479Thr LPL lpl.snp1 Promotor 0.00 C/A G-95T lpl.snp2 rs1800590 Promotor 0.01 A/C G-93T lpl.snp3 rs1031045 Intron 0.01 C/T lpl.snp4 rs253 Intron 0.47 C/T Continued Human Molecular Genetics, 2004, Vol. 13, No. 10 995 13 candidate genes important to lipid metabolism.
X
ABCA1 p.Ile883Met 15044381:77:1321
status: NEW
Login to comment

79 SNP characteristics including SNP identification system, localization, allele frequencies, nucleotide exchange and pseudonym are shown Gene/SNP no. SNP Id. Localization Allele frequency Nucleotide exchange Pseudonym APOB apob.snp1 rs512535 Promotor 0.45 G/A G-837A apob.snp2 rs1367117 Exon/non-syn 0.32 C/T Thr71Ile apob.snp3 rs520354 Intron 0.44 T/C apob.snp4 rs679899 Exon/non-syn 0.44 C/T Ala618Val apob.snp5 rs673548 Intron 0.21 C/T apob.snp6 rs693 Exon/syn 0.50 T/C XbaI apob.snp7 rs1800479 Intron 0.16 C/G G&#fe;50/in27C apob.snp8 rs1801703 Exon/non-syn 0.01 C/T Val4101Met apob.snp9 rs1042034 Exon/non-syn 0.22 T/C Asn4311Ser APOE apoe.snp1 rs449647 Promotor 0.17 A/T t-491a apoe.snp2 rs405509 Promotor 0.48 C/A g-219t apoe.snp3 rs440446 Intron 0.36 G/C Variant 1163 apoe.snp4 rs769450 Intron 0.41 C/T Variant 2440 apoe.snp5 rs429358 Exon/non-syn 0.16 T/C Cys112Arg apoe.snp6 rs7412 Exon/non-syn 0.06 C/T Arg158Cys ABCA1 abca1.snp1 rs2422493 Promotor 0.45 G/A 2477c/t abca1.snp2 rs1800977 50 UTR 0.50 C/T t69c abca1.snp3 50 UTR 0.04 C/G c117g abca1.snp4 rs2575879 Intron 0.46 G/C abca1.snp5 rs1800978 50 UTR 0.01 G/C G378C abca1.snp6 rs1999429 Intron 0.03 G/T abca1.snp7 rs2230806 Exon/non-syn 0.26 C/T Arg219Lys abca1.snp8 rs2274873 Exon/syn 0.08 C/T Pro312Pro abca1.snp9 rs4149313 Exon/non-syn 0.13 T/C A3044G, Ile883Met abca1.snp10 Exon/non-syn 0.03 C/G G3911C, Glu1172Asp abca1.snp11 rs2066716 Exon/syn 0.08 G/A Thr1367Thr abca1.snp12 rs363717 30 UTR 0.20 A/G CETP cetp.snp1 rs4783961 Promotor 0.47 C/T 2971 g/a cetp.snp2 rs1800776 Promotor 0.07 G/T 2631 cetp.snp3 rs1800775 Promotor 0.49 G/T 2629 cetp.snp4 rs711752 Intron 0.45 C/T G&#fe;202/in1A cetp.snp5 rs708272 Intron 0.45 C/T Taq1B; G&#fe;279/in1A cetp.snp6 rs158478 Intron 0.46 C/A EcoNI cetp.snp7 rs1532625 Intron 0.43 G/A C&#fe;8/in7T cetp.snp8 rs289718 Intron 0.29 T/C cetp.snp9 rs289719 Intron 0.29 C/T cetp.snp10 rs5880 Exon/non-syn 0.04 C/G CETPu1, Ala373Pro cetp.snp11 rs5882 Exon/non-syn 0.35 A/G CETPu2 cetp.snp12 rs1801706 30 UTR 0.18 C/T G&#fe;84A LCAT lcat.snp1 rs1109166 Intron 0.17 A/G lcat.snp2 rs4986970 Exon/non-syn 0.04 A/T Ser232Thr lcat.snp3 rs5923 Exon/syn 0.04 G/A LCATu3 LIPC lipc.snp1 rs723967 50 regiona 0.46 G/A lipc.snp2 rs1800588 Promotor 0.28 G/A 2C480T lipc.snp3 rs1869144 Intron 0.39 A/G lipc.snp4 rs6078 Exon/non-syn 0.04 G/A LIPCu1; Val73Met lipc.snp5 rs690 Exon/syn 0.49 T/G LIPCu3; Val155Val lipc.snp6 rs6082 Exon/syn 0.08 A/G LIPCu5; Gly197Gly lipc.snp7 rs6083 Exon/non-syn 0.36 T/C LIPCu6; Asn193Ser lipc.snp8 rs6084 Exon/syn 0.44 C/G LIPCu8; Thr224Thr lipc.snp9 rs6074 Exon/syn 0.13 G/T Thr479Thr LPL lpl.snp1 Promotor 0.00 C/A G-95T lpl.snp2 rs1800590 Promotor 0.01 A/C G-93T lpl.snp3 rs1031045 Intron 0.01 C/T lpl.snp4 rs253 Intron 0.47 C/T Continued 13 candidate genes important to lipid metabolism.
X
ABCA1 p.Ile883Met 15044381:79:1320
status: NEW
Login to comment

PMID: 15024730 [PubMed] Katzov H et al: "Genetic variants of ABCA1 modify Alzheimer disease risk and quantitative traits related to beta-amyloid metabolism."
No. Sentence Comment
74 Details of ABCA1 SNPs, and Oligos for PCR and DASHn Variant dbSNP rsID Base change Forward primer sequence (50 ^30 ) Reverse primer sequence (30 ^50 ) Probe sequence (50 ^30 ) p.R219K rs2230806 c.658G4A g.10300705G4A b-TTTCTGAGCTTTGTGGCCTACC GCTCTGCTGCAGCCAGTTTCTC GTTTCTCCCTTGGTAGG p.V771M rs2066718 c.2314G4A g.102969093G4A b-TGTGTGTGGCATGGCAGGACTA GCGAAGATCTTGAGTGTGAAGC GAAGCCCACGTAGTCCT p.V825I rs4149312 c.2476G4A g.102967871G4A b-ATGGCTTCAATCTCACCACTTG GGTGTCAAACAGCATCATGGAG CATGGAGACCCAAGTGG p.I883M rs4149313 c.2650A4G g.102966591A4G b-GAGGTCAACAGCACTTACTTTCT AGAAGAGCCACCCTTGTTCCAA AAGAGAATGTCAGAAAG p.R1587K rs2230808 c.4762G4A g.102942642G4A b-ATTTATGACAGGACTGGACACC AGCGGTTTACCTTGACATTATT CATTATTTCTGGTGTCC n Genotyping of SNPs was performed using dynamic allele speci'c hybridization (DASH) [Prince et al., 2001].
X
ABCA1 p.Ile883Met 15024730:74:503
status: NEW
Login to comment

93 Single MarkerAssociations forABCA1and Alzheimer Diseasew p.R219K (rs2230806) G/G G/A A/A P value Set A AD 238 (.62) 125 (.33) 21 (.05) 0.014n Controls 102 (.58) 51 (.29) 22 (.13) Set B AD 58 (.48) 53 (.44) 9 (.08) 0.76 Controls 76 (.53) 59 (.41) 9 (.06) Set C AD 82 (.57) 53 (.37) 8 (.06) 0.66 Controls 183 (.56) 117 (.36) 26 (.08) Set D AD 183 (.56) 122 (.37) 22 (.07) 0.93 Controls 60 (.57) 40 (.38) 6 (.06) p.I883M (rs4149313) C/C C/T T/T Set A AD 2 (.01) 81 (.21) 301 (.78) 0.39 Controls 0 (.00) 31 (.18) 145 (.82) Set B AD 0 (.00) 29 (.24) 91 (.76) 0.27 Controls 3 (.02) 32 (.21) 115 (.77) Set C AD 2 (.01) 27 (.19) 116 (.80) 0.84 Controls 3 (.01) 53 (.17) 256 (.82) Set D AD 3 (.01) 68 (.21) 253 (.78) 0.61 Controls 2 (.02) 19 (.19) 83 (.80) p.R1587K (rs2230808) G/G G/A A/A Set A AD 253 (.66) 114 (.30) 15 (.04) 0.13 Controls 101 (.57) 66 (.38) 9 (.05) Set B AD 56 (.46) 58 (.48) 7 (.06) 0.016n Controls 96 (.64) 48 (.32) 7 (.05) Set C AD 80 (.55) 56 (.39) 9 (.06) 0.70 Controls 189 (.58) 121 (.37) 15 (.05) Det D AD 185 (.57) 118 (.36) 24 (.07) 0.18 Controls 68 (.64) 28 (.26) 10 (.09) p.V771M (rs2066718) G/G G/A A/A Set A AD 365 (.95) 20 (.05) 0 (.00) 0.28 Controls 167 (.95) 7 (.04) 1 (.01) Set B AD 109 (.98) 2 (.02) 0 (.00) 0.029n Controls 126 (.92) 11 (.08) 0 (.00) p.V825I (rs4149312) G/G G/A A/A Set A AD 341 (.93) 20 (.05) 4 (.01) 0.17 Controls 164 (.92) 15 (.08) 0 (.00) w Genotype frequencies for all studied SNPs in ABCA1 are presented.
X
ABCA1 p.Ile883Met 15024730:93:412
status: NEW
Login to comment

99 We noted from this that typing markers rs2230806, rs4149313 (c.2650A4G, p.I883M), and rs2230808 would be sufficient to differentiate between the six most common haplotypes (all with frequencies above 3%), thereby provisionally acting as ''tag`` SNPs [Johnson et al., 2001].
X
ABCA1 p.Ile883Met 15024730:99:74
status: NEW
Login to comment

144 Single Marker QuantitativeTrait Associationsn p.R219K (rs2230806) Trait G/G G/A A/A P-value Set A CSF Tau 6407280 (156) 6447280 (78) 7097240 (12) NS CSFAb42 4627167 (149) 4877176 (75) 5067230 (11) NS AAO 72.478.4 (205) 72.377.8 (99) 72.577.0 (18) NS SP-NFT 7.472.0 (43) 6.972.2 (25) 4.771.2 (3) 0.039 Set B AAO 52.077.6 (56) 52.276.2 (52) 55.474.9 (8) NS Set C AAO 76.777.1 (80) 77.276.4 (52) 74.478.1 (8) NS Set D Ab load 4.671.9 (35) 4.372.3 (26) 4.972.7 (7) NS AAO 71.9712.3 (81) 7378.9 (58) 70.176.2 (10) NS p.I883M (rs4149313) Trait C/C C/T T/T Set A CSF Tau 5747318 (2) 6907328 (52) 6337262 (192) NS CSFAb42 354754 (2) 4437137 (48) 4817181 (185) NS AAO 64.978.6 (2) 72.078.8 (68) 72.477.8 (253) NS SP-NFT N/A 6.372.4 (16) 7.371.9 (55) 0.078 Set B AAO N/A 52.075.7 (28) 52.477.2 (88) NS Set C AAO 73.5719.
X
ABCA1 p.Ile883Met 15024730:144:514
status: NEW
Login to comment

PMID: 12763760 [PubMed] Singaraja RR et al: "Efflux and atherosclerosis: the clinical and biochemical impact of variations in the ABCA1 gene."
No. Sentence Comment
136 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon -1095A/G Promoter ⅐ ⅐ ⅐ -477C/T Promoter ⅐ ⅐ ⅐ -419A/C Promoter ⅐ ⅐ ⅐ -320G/C Promoter ⅐ ⅐ ⅐ -191G/C Promoter ⅐ ⅐ ⅐ C69T 5ЈUTR 1 C117G 5ЈUTR 1 InsG319 5ЈUTR 2 G378C 5ЈUTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I.
X
ABCA1 p.Ile883Met 12763760:136:481
status: NEW
Login to comment

147 The R219K, V771M, and I883M variants have been recognized as putative antiatherogenic polymorphisms, associated with increased HDL-C and decreased triglyceride levels (K219 and M883) and increased HDL-C and ApoA-I (M771).41,75,82 The E1172D, R1587K cSNPs have been reported to be associated with decreased HDL-C.75 Five promoter SNPs are associated with increased severity of atherosclerosis, including the -191C/-320C/-477T hap- lotype76,78 as well as the G-191C and A-1096G SNPs.
X
ABCA1 p.Ile883Met 12763760:147:22
status: NEW
Login to comment

148 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ⅐ ⅐ ⅐ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ⅐ ⅐ ⅐ ⅐ ⅐ ⅐ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2).
X
ABCA1 p.Ile883Met 12763760:148:248
status: NEW
Login to comment

153 The V825I, I883M, and E1172D SNPs have also been associated with increased clinical events and severity of atherosclerosis.75,77 The R219K Variant The R219K SNP has been most studied and highlights many of the difficulties associated with the study of SNPs in general.
X
ABCA1 p.Ile883Met 12763760:153:11
status: NEW
Login to comment

160 Clee et al75 reported significant LD between the R219K and the V771M, K776N, I883M, and R1587K cSNPs but found that after carriers of these variants were excluded, R219K remained significantly associated with degree of atherosclerosis and triglyceride levels.
X
ABCA1 p.Ile883Met 12763760:160:77
status: NEW
Login to comment

162 Functional Effects of cSNPs and Regulatory SNPs in the ABCA1 Gene Nucleotide Amino Acid/Position Lipids CAD/Atherosclerosis Antiatherogenic SNPs C-17G Promoter No change 2 InsG319 5ЈUTR No change 2 G1051A R219K 2 TG, 1 HDL, 1 ApoA-1, 1 ApoB, 1 LDL 2 A3044G I883M 2 TG, 1 HDL 1 Proatherogenic SNPs -191C/-320C/-477T haplotype Promoter No change 1 G-191C Promoter No change 1 A-1095G Promoter No change 1 C117G 5ЈUTR 1 TG No change G2706A V771M No change 1 G2868A V825I No change 1 G3911C E1172D 2 HDL, 2 ApoB 1 G5155A R1587K 2 HDL No change Associations with lipid levels and CAD are shown by arrows to represent the direction of association.
X
ABCA1 p.Ile883Met 12763760:162:263
status: NEW
Login to comment

128 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon afa;1095A/G Promoter ዼ ዼ ዼ afa;477C/T Promoter ዼ ዼ ዼ afa;419A/C Promoter ዼ ዼ ዼ afa;320G/C Promoter ዼ ዼ ዼ afa;191G/C Promoter ዼ ዼ ዼ C69T 5b18;UTR 1 C117G 5b18;UTR 1 InsG319 5b18;UTR 2 G378C 5b18;UTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 Singaraja et al Clinical and Biochemical Impact of ABCA1 Variants markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I.
X
ABCA1 p.Ile883Met 12763760:128:496
status: NEW
Login to comment

139 The R219K, V771M, and I883M variants have been recognized as putative antiatherogenic polymorphisms, associated with increased HDL-C and decreased triglyceride levels (K219 and M883) and increased HDL-C and ApoA-I (M771).41,75,82 The E1172D, R1587K cSNPs have been reported to be associated with decreased HDL-C.75 Five promoter SNPs are associated with increased severity of atherosclerosis, including the afa;191C/afa;320C/afa;477T hap- lotype76,78 as well as the G-191C and A-1096G SNPs.
X
ABCA1 p.Ile883Met 12763760:139:22
status: NEW
Login to comment

140 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ዼ ዼ ዼ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ዼ ዼ ዼ ዼ ዼ ዼ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2).
X
ABCA1 p.Ile883Met 12763760:140:245
status: NEW
Login to comment

145 The V825I, I883M, and E1172D SNPs have also been associated with increased clinical events and severity of atherosclerosis.75,77 The R219K Variant The R219K SNP has been most studied and highlights many of the difficulties associated with the study of SNPs in general.
X
ABCA1 p.Ile883Met 12763760:145:11
status: NEW
Login to comment

152 Clee et al75 reported significant LD between the R219K and the V771M, K776N, I883M, and R1587K cSNPs but found that after carriers of these variants were excluded, R219K remained significantly associated with degree of atherosclerosis and triglyceride levels.
X
ABCA1 p.Ile883Met 12763760:152:77
status: NEW
Login to comment

154 Functional Effects of cSNPs and Regulatory SNPs in the ABCA1 Gene Nucleotide Amino Acid/Position Lipids CAD/Atherosclerosis Antiatherogenic SNPs C-17G Promoter No change 2 InsG319 5b18;UTR No change 2 G1051A R219K 2 TG, 1 HDL, 1 ApoA-1, 1 ApoB, 1 LDL 2 A3044G I883M 2 TG, 1 HDL 1 Proatherogenic SNPs afa;191C/afa;320C/afa;477T haplotype Promoter No change 1 G-191C Promoter No change 1 A-1095G Promoter No change 1 C117G 5b18;UTR 1 TG No change G2706A V771M No change 1 G2868A V825I No change 1 G3911C E1172D 2 HDL, 2 ApoB 1 G5155A R1587K 2 HDL No change Associations with lipid levels and CAD are shown by arrows to represent the direction of association.
X
ABCA1 p.Ile883Met 12763760:154:263
status: NEW
Login to comment

PMID: 12709788 [PubMed] Tan JH et al: "ABCA1 gene polymorphisms and their associations with coronary artery disease and plasma lipids in males from three ethnic populations in Singapore."
No. Sentence Comment
44 SNPs -14C>T, 237indelG, V825I and I883M were genotyped by restriction fragment length polymorphism (RFLP) assays.
X
ABCA1 p.Ile883Met 12709788:44:34
status: NEW
Login to comment

133 Notably, the seven significant disequilibria (out of a possible eight) in the Chinese CAD group involved both V825I and I883M; however, two of these disequilibria were also found in the Chinese control group and therefore it was hard to deduce the effects of V825I and I883M on the CAD status in Chinese.
X
ABCA1 p.Ile883Met 12709788:133:120
status: NEW
X
ABCA1 p.Ile883Met 12709788:133:269
status: NEW
Login to comment

PMID: 12840658 [PubMed] Miller M et al: "Genetics of HDL regulation in humans."
No. Sentence Comment
66 TD 1591 T/C 11 V399A extracellular [68] TD 1979 (110bpAlu Ins) 12 truncated truncation [60] TD/FHA 2154 C/T 14 R587W extracellular [67,69] TD 2164 G/C 14 W590S extracellular [61] TD 2185 A/G 14 Q597R extracellular [59,67] TD 2219 G/del 14 truncated, 635X truncated [60,61] FHA 2472-2474 3bp del 15 Del L693 TM domain #3 [59] phosphorylation 2706 G/A 16 V771M extracellular [68] 2715 A/C 16 T774P extracellular [68] 2723 G/C 16 K776N extracellular [68] 2868 G/A 17 V825I TM domain #6 [67,68] TD/FHA 3044 A/G 18 I883M cytoplasmic [68] phosphorylat site FHA 3120 C/T 19 R909X truncation [63,71] TD 3181 C/T 19 T929I cytoplasmic [62] TD 3199 A/G 19 N935S Walker A [61] TD 3205 C/T 19 A937V Walker A [61] TD 3532 C/A 22 A1046D cytoplasmic, Walker A/B [70] FHA 3667 T/C 23 M1091T cytoplasmic [63] 3690 G/T 23 D1099Y cytoplasmic [9] TD 3738 2bp del 23 1145X truncation [66] FHA 3911 G/C 24 E1172D linker/cytoplasmic [68] FHA 4242 4bp del 27 1297X truncated [64] TD 4260 G/A 27 D1289N linker cytoplasm [64,65] TD 4824 T/C 31 C1477R extracellular [59] TD 4912 C/T 32 S1506L extracellular loop #2 [71] TD 5025 ins A 34 A1544S?1552X truncation [70] 5059 T/C 34 I1555T extracellular loop #2 [67] 5155 G/A 35 R1587K extracellular loop #2 [68] FHA 5226 A/G 36 N1611D extracellular loop #2 [75..] 5338 T/C 36 L1648P extracellular loop #2 [67] TD 5443 C/T 37 R1680W cytoplasmic [74.]
X
ABCA1 p.Ile883Met 12840658:66:510
status: NEW
Login to comment

PMID: 12700893 [PubMed] Evans D et al: "The association of the R219K polymorphism in the ATP-binding cassette transporter 1 ( ABCA1) gene with coronary heart disease and hyperlipidaemia."
No. Sentence Comment
88 Similarly they observed that the R219K effects were independent of the I883M and R1587K variants.
X
ABCA1 p.Ile883Met 12700893:88:71
status: NEW
Login to comment

PMID: 11328826 [PubMed] Fitzgerald ML et al: "ATP-binding cassette transporter A1 contains an NH2-terminal signal anchor sequence that translocates the protein's first hydrophilic domain to the exoplasmic space."
No. Sentence Comment
46 The resulting clones were sequenced in their entirety on both strands and found to be identical to previously published wild type human cDNA sequences except at four codons that have been reported to represent common human polymorphisms (G for A at 2649 (Met for Ile at amino acid 883), T for C at 4943 (Leu for Pro at amino acid 1648), A for G at 5921 (Lys for Arg at amino acid 1974), T for C at 6503 (Leu for Pro at amino acid 2168) (12, 22, 23).
X
ABCA1 p.Ile883Met 11328826:46:255
status: NEW
Login to comment

PMID: 11238261 [PubMed] Clee SM et al: "Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease."
No. Sentence Comment
44 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed.
X
ABCA1 p.Ile883Met 11238261:44:35
status: NEW
Login to comment

48 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site.
X
ABCA1 p.Ile883Met 11238261:48:941
status: NEW
Login to comment

85 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened.
X
ABCA1 p.Ile883Met 11238261:85:322
status: NEW
Login to comment

112 Although there were no differences in mean lipid levels between the genotypes in carriers of the I883M cSNP (IMϩMM, Table 6), MM individuals (nϭ14) had an increased progression in MOD (mean change, 0.53Ϯ0.79 versus 0.11Ϯ0.25 mm in noncarriers, PϽ0.001) and a cardiac event rate double that of the II individuals (nϭ320; 21.4% versus 10.6%, Pϭ0.19).
X
ABCA1 p.Ile883Met 11238261:112:97
status: NEW
Login to comment

141 In unaffected family members, although carriers of S1731C (nϭ6) had slightly lower HDL-C compared with noncarriers (nϭ14, 1.03Ϯ0.22 versus 1.09Ϯ0.23 mmol/L), the difference was not statistically significant.
X
ABCA1 p.Ile883Met 11238261:141:4
status: NEW
Login to comment

145 If all V771M and K776N carriers are excluded, the results are unaltered, with increased MOD (1.80Ϯ0.35 versus 1.73Ϯ0.35 mm, Pϭ0.006) and MSD (2.76Ϯ0.36 versus 2.70Ϯ0.37 mm, Pϭ0.02) and lower mean TG levels (1.71Ϯ0.75 versus 1.84Ϯ0.77 mmol/L, Pϭ0.02) in carriers of R219K (nϭ329) compared with noncarriers (nϭ422).
X
ABCA1 p.Ile883Met 11238261:145:62
status: NEW
Login to comment

146 The I883M and R1587K cSNPs are also often seen in carriers of R219K.
X
ABCA1 p.Ile883Met 11238261:146:4
status: NEW
X
ABCA1 p.Ile883Met 11238261:146:53
status: NEW
Login to comment

147 We identified R219K carriers who do not also carry either the I883M or R1587K genotype (nϭ62) and compared them with the group of individuals who do not carry any of the 3 variants (nϭ116).
X
ABCA1 p.Ile883Met 11238261:147:27
status: NEW
X
ABCA1 p.Ile883Met 11238261:147:62
status: NEW
Login to comment

150 The V825I cSNP was found to be in linkage disequilibrium with I883M.
X
ABCA1 p.Ile883Met 11238261:150:62
status: NEW
Login to comment

151 The relative risk of the V825I carriers adjusted for I883M genotype was 2.31 (95% CI, 0.78 to 6.85).
X
ABCA1 p.Ile883Met 11238261:151:53
status: NEW
Login to comment

152 Because the effects of the I883M variant were only evident in homozygous carriers, the number of individuals was too few to correct for V825I genotype.
X
ABCA1 p.Ile883Met 11238261:152:27
status: NEW
Login to comment

156 No significant differences in lipid levels or CAD were observed for E1172D carriers compared with R1587K heterozygotes without E1172D.
X
ABCA1 p.Ile883Met 11238261:156:313
status: NEW
Login to comment

161 ABCA cSNPs in REGRESS MOD, mm MSD, mm HDL-C, mmol/L TG, mmol/L Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P V825I 1.74Ϯ0.37 (107) 1.77Ϯ0.35 (575) 0.39 2.70Ϯ0.38 2.75Ϯ0.38 0.21 0.91Ϯ0.23 0.93Ϯ0.22 0.42 1.86Ϯ0.84 1.80Ϯ0.76 0.49 I883M 1.74Ϯ0.38 (100) 1.75Ϯ0.36 (320) 0.71 2.69Ϯ0.38 2.73Ϯ0.36 0.41 0.91Ϯ0.22 0.91Ϯ0.21 0.97 1.75Ϯ0.77 1.82Ϯ0.75 0.42 R1587K 1.77Ϯ0.34 (346) 1.76Ϯ0.37 (433) 0.75 2.73Ϯ0.39 2.74Ϯ0.36 0.64 0.90Ϯ0.22 0.94Ϯ0.23 0.03 1.79Ϯ0.76 1.81Ϯ0.78 0.77 V399A 1.92Ϯ0.32 (9) 1.73Ϯ0.35 (540) 0.13 2.73Ϯ0.40 2.71Ϯ0.37 0.89 1.03Ϯ0.28 0.92Ϯ0.23 0.15 1.71Ϯ0.63 1.82Ϯ0.78 0.68 V771M 1.89Ϯ0.38 (37) 1.76Ϯ0.35 (598) 0.045 2.83Ϯ0.49 2.73Ϯ0.37 0.13 0.91Ϯ0.20 0.92Ϯ0.22 0.58 1.98Ϯ0.79 1.78Ϯ0.76 0.11 T774P 1.63Ϯ0.31 (4) 1.76Ϯ0.36 (621) 0.47 2.85Ϯ0.34 2.73Ϯ0.37 0.52 0.85Ϯ0.07 0.93Ϯ0.22 0.50 1.90Ϯ1.04 1.82Ϯ0.77 0.84 K776N 1.92Ϯ0.33 (3) 1.78Ϯ0.34 (546) 0.48 2.95Ϯ0.48 2.76Ϯ0.37 0.36 0.94Ϯ0.28 0.93Ϯ0.22 0.93 2.25Ϯ0.94 1.76Ϯ0.76 0.26 E117SD 1.80Ϯ0.39 (34) 1.77Ϯ0.36 (610) 0.67 2.78Ϯ0.35 2.74Ϯ0.37 0.42 0.93Ϯ0.23 0.94Ϯ0.23 0.89 1.80Ϯ0.90 1.77Ϯ0.76 0.80 Values are meanϮSD (n).
X
ABCA1 p.Ile883Met 11238261:161:313
status: NEW
Login to comment

166 The phenotypic effects of the remaining cSNPs are less striking than those of R219K.
X
ABCA1 p.Ile883Met 11238261:166:91
status: NEW
Login to comment

171 The lack of obvious differences in HDL-C in carriers of different cSNPs (R219K, V771M, and I883M), together with clear differences in CAD, suggests that stimulating the RCT pathway can increase the net flux of cholesterol toward the liver without altering steady-state plasma HDL-C levels.
X
ABCA1 p.Ile883Met 11238261:171:91
status: NEW
Login to comment

179 In heterozygotes, the phenotype is more pronounced in older individuals.9 This suggests that ABCA1 activity may normally increase with age but that this is blunted in R219K heterozygotes.
X
ABCA1 p.Ile883Met 11238261:179:23
status: NEW
Login to comment

184 Of note, the V399A and I883M variants were shown to cosegregate on a mutation-bearing chromosome in one of the initial Tangier families described.6 The authors suggested that 1 of these 2 variants was likely the functional mutation.
X
ABCA1 p.Ile883Met 11238261:184:23
status: NEW
X
ABCA1 p.Ile883Met 11238261:184:219
status: NEW
Login to comment

186 Furthermore, we show that I883M is a common variant that is possibly associated with an increased risk of CAD in the homozygous state, although no differences in HDL-C were evident.
X
ABCA1 p.Ile883Met 11238261:186:26
status: NEW
Login to comment

189 The distribution of cSNPs was not random (Figure 1); they were found away from known functional domains, such as the ATP-binding cassettes and regions where mutations cluster.9 The one exception to this pattern was the I883M variant, which was located just N-terminal of the first ATP-binding cassette region, where several mutations have been shown to occur (amino acids 909 to 93724).
X
ABCA1 p.Ile883Met 11238261:189:219
status: NEW
Login to comment

39 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed.
X
ABCA1 p.Ile883Met 11238261:39:35
status: NEW
Login to comment

43 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site.
X
ABCA1 p.Ile883Met 11238261:43:940
status: NEW
Login to comment

80 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened.
X
ABCA1 p.Ile883Met 11238261:80:322
status: NEW
Login to comment

107 Although there were no differences in mean lipid levels between the genotypes in carriers of the I883M cSNP (IMaf9;MM, Table 6), MM individuals (nafd;14) had an increased progression in MOD (mean change, 0.53afe;0.79 versus 0.11afe;0.25 mm in noncarriers, Pb0d;0.001) and a cardiac event rate double that of the II individuals (nafd;320; 21.4% versus 10.6%, Pafd;0.19).
X
ABCA1 p.Ile883Met 11238261:107:97
status: NEW
Login to comment

142 We identified R219K carriers who do not also carry either the I883M or R1587K genotype (nafd;62) and compared them with the group of individuals who do not carry any of the 3 variants (nafd;116).
X
ABCA1 p.Ile883Met 11238261:142:62
status: NEW
Login to comment

181 Furthermore, we show that I883M is a common variant that is possibly associated with an increased risk of CAD in the homozygous state, although no differences in HDL-C were evident.
X
ABCA1 p.Ile883Met 11238261:181:26
status: NEW
Login to comment

PMID: 11558901 [PubMed] Iida A et al: "High-density single-nucleotide polymorphism (SNP) map of the 150-kb region corresponding to the human ATP-binding cassette transporter A1 (ABCA1) gene."
No. Sentence Comment
15 Therefore, information concerning naturally occurring genetic variants in human transporter genes such as ABCA1 Fig.1.Single-nucleotidepolymorphism(SNP)mapspanningthe150-kbregioncontainingtheABCA1gene.Exonsarerepresentedbyopenrectanglesandintronsbyhorizontallines.SNPs areindicatedabovethelinesaccordingtonumber(correspondingtothenumbersinthefar-leftcolumnofTable1);thepositionsofeightinsertion-deletionpolymorphismsareindicatedbelow thelines(seeTable2).Microsatellitesequencesarealsoshown Table 1. Characterization of 162 single-nucleotide polymorphisms (SNPs) within the ABCA1 locus Repetitive Identity Number Location Exon SNP (5Ј to 3Ј) Substituion sequence to dbSNP Reference 1 -278 G Ͼ C 5Ј flanking region gggcccgggcgggggaaggg G/C acgcagaccgcggaccctaa rs1800976 2 -99 G Ͼ C 5Ј flanking region acataaacagaggccgggaa G/C ggggcggggaggagggagag 3 159 G Ͼ T intron 1 gcggtgttaaatggggagac G/T atgtcctagtacgagctctg 4 506 G Ͼ C intron 1 gaattggctatatgctcccc G/C ggactggagcggcacagtcc 5 5897 T Ͼ G intron 1 gtacaaaaccctttagcttt T/G gcaaacctcctttaagaccc 6 5929 C Ͼ T intron 1 ttaagacccgatttaaatgc C/T tccctcctcatgaagctctt 7 5962 T Ͼ C intron 1 aagctcttctggatccactc T/C ttcccatcactaagttgaaa 8 5985 A Ͼ C intron 1 cccatcactaagttgaaagt A/C agatccccttctctttactt 9 11416 G Ͼ A intron 1 ttacagtgccctttatagga G/A agaaagaagaaattgtgtct 10 11935 G Ͼ A intron 1 tctctgtggagcaaatagag G/A gctgtctgacacttggttcc 11 12281 T Ͼ A intron 1 gaatgtttgatttgtgaaaa T/A cttaataacagtagtttttt 12 12924 T Ͼ C intron 1 gtgctgacaatcttatactc T/C aggttgaacctccggggaag 13 13002 C Ͼ G intron 1 gagcctcaatcacagattct C/G tctagctcacatgaagttaa 14 17715 C Ͼ T intron 1 ggagcatgactttgtggaag C/T ctctcctcttccacccagag 15 17848 T Ͼ C intron 1 gagggctgactgtcaccctt T/C gataggagcccagcactaaa 16 21384 G Ͼ C intron 1 gtgggtgggaggaattggag G/C aggaagcttgcctaagtgtg 17 22145 C Ͼ G intron 1 gtagcttctaaatcaacgaa C/G tgattcctggagagcagctt rs1340361 18 23063 G Ͼ A intron 1 ggaggcacctgtgacaccca G/A cggagtaggggggcggtgtg 19 23131 G Ͼ A intron 1 agtgtgcatatgtgctgacc G/A tgggagcttgtttgtcggtt 20 156 T Ͼ C intron 2 ggacacaggactgtgtggtc T/C ggatatggcatgtggcttat rs1078143 21 384 A Ͼ G intron 2 gctgtgggtgaagtgagtta A/G tggccccactcttagagatc rs1078144 22 1081 G Ͼ A intron 2 agtgcagccaaaattgcaaa G/A tcataccattcaaattaata rs752187 23 2801 A Ͼ G intron 2 aagaaaagtgatttatttca A/G gttgctgatgcttagattgt 24 2830 C Ͼ G intron 2 tgcttagattgttagagttg C/G aaagatctggcttgcatctt 25 2856 A Ͼ G intron 2 tctggcttgcatcttgtaca A/G ctgacagaactggggctcag 26 3187 A Ͼ G intron 2 tgatagctgttgcctgcagc A/G tacggacgttcattgcgcag 27 3190 C Ͼ T intron 2 tagctgttgcctgcagcata C/T ggacgttcattgcgcagttc 28 3194 C Ͼ T intron 2 tgttgcctgcagcatacgga C/T gttcattgcgcagttcctgt 29 3204 G Ͼ A intron 2 agcatacggacgttcattgc G/A cagttcctgtctcctgagat 30 3401 T Ͼ C intron 2 acataaagcctgtgtgctgc T/C gccaggaagactagaaacgc 31 13927 A Ͼ G intron 2 gtcaccacatacctggcact A/G tgctaaggctgggaatgcag L2 32 4163 G Ͼ A intron 3 ccagcccacttcatcttacc G/A tagttacctccttagagtat 33 4262 T Ͼ C intron 3 tgtcaaagaggaactaagga T/C gccagggactttctgcttag 34 4306 C Ͼ T intron 3 ccctctcatcacttctccaa C/T gctggtatcatgaaccccat 35 240 G Ͼ A intron 5 gacagaagaaaagtccccag G/A gaagaatactacagacttgg rs1107281 36 490 G Ͼ A intron 5 gatgggcatttgaacttgtt G/A tctttaaaaagtgaaatctt 37 583 T Ͼ G intron 5 tatctggggagtgggcattt T/G ctgactgaggcattggctgc 38 1051 C Ͼ T inton 5 ggctacaaaactgtgctttc C/T ttgggcagtaaaagaggcaa 39 3051 G Ͼ A intron 5 tagagaacaagtctaattct G/A ttttccttgaaatagtcgaa 40 3127 A Ͼ G intron 5 aagtccatgattttttaggc A/G aaatggcctcctttcctctt 41 5924 C Ͼ T intron 5 ctttctttcacaaaattgcc C/T cccagagctttctggaaggg 42 6831 T Ͼ C intron 5 ccagtccctcagccttgcca T/C tgcttatgctggtctggaaa 43 12678 G Ͼ C intron 5 gctcaccgctctgctcaccc G/C accctctggccatctcctct 44 14214 G Ͼ A intron 5 cagcttggtcccagaggcct G/A gacctgggtcccagaggtcc 45 14257 C Ͼ T intron 5 gctggttccccggcttggtc C/T cagaggcctggatgtgtggc 46 18078 C Ͼ T intron 5 cctaccacaccatgcacgtg C/T acagccaagggttgttgact 47 18795 G Ͼ A intron 5 ctgggctcttcctggacctg G/A ccagctaaaaggaaatctcc 48 18948 G Ͼ A intron 5 gcattggtggtactaagaac G/A catattccctatcctatagg L2 49 19053 T Ͼ C intron 5 ctcccccaacattaaaagtg T/C aagggatgcttattcaaatg MER5A 50 19148 C Ͼ A intron 5 ggcccaagaaactgcatttt C/A gcatgctccctaaatgaagc MER5A 51 19229 C Ͼ T intron 5 atgctaacagtgtagagtca C/T atgtgatgggaagcatcagg 52 19405 T Ͼ C intron 5 cttgctcaatttattctgtc T/C atataactcaatattactga 53 19534 G Ͼ A intron 5 catgtgaccctcttagctcc G/A cggattaactcctgtcctca 54 474 G Ͼ A coding region 6 gaaaccttctctgggttcct G/A tatcacaacctctctctccc Leu 158 Leu 55 210 A Ͼ C intron 6 gcaacctggcgtcatgggcc A/C gctggttaaaataaaattga 56 334 G Ͼ A intron 6 acagttctgaggcaataacc G/A tggttaagggttattgatct 57 2288 C Ͼ T intron 6 cttctttcaaagcttgtggt C/T cactggaccacgtatgaagt 58 2322 T Ͼ C intron 6 atgaagtagaatagtttagg T/C ccagaaaggcaattaagtaa 59 2820 T Ͼ G intron 6 gtgctttgatacattctgag T/G ttcagtaaagagacctgatg 60 656 G Ͼ A coding region 7 tgagctttgtggcctaccaa G/A ggagaaactggctgcagcag Arg 219 Lys Clee et al. 2001 61 416 G Ͼ A intron 7 catcataaagatgacattgt G/A ggctgtcacagttggaaggc 62 471 C Ͼ T intron 7 agaccacactatttagctta C/T ttagtaataacattgcaaag 63 504 G Ͼ A intron 7 ttgcaaagaaaaattccgac G/A aagttttttcagcctaggaa 64 679 G Ͼ C intron 7 gctctggtgaaattcctctc G/C ctaccccaaacatcatcatt 65 1740 C Ͼ T intron 7 acaaatgctcaccctttcag C/T tggaatgattgaaattttgg 66 2122 A Ͼ G intron 7 tgattaaggtggctactacc A/G ggtgctttctgcatatctcg 67 7753 T Ͼ C intrion 7 taggaattccaagctgtgaa T/C tttttactgaagctctttgg 68 8973 A Ͼ T intron 7 atggaaatttgtttatattg A/T ctacagattgccaatattat 69 8976 A Ͼ G intron 7 gaaatttgtttatattgact A/G cagattgccaatattattag Table 1. Continued Repetitive Identity Number Location Exon SNP (5Ј to 3Ј) Substituion sequence to dbSNP Reference 70 11327 G Ͼ C intron 7 ctaacaatcttatttccatt G/C agtccttataaaagaagtgg 71 11738 C Ͼ T intron 7 ctgacgtttaagggagaccg C/T gtaggtccctttgaggactg 72 12295 T Ͼ A intron 7 agtctgtaaattattgttct T/A ttttttctttagcttatgct 73 387 C Ͼ G intron 8 tagcaaggccaatcatttta C/G caacacacatgcttgctaac 74 697 A Ͼ T intron 8 ggaactgtctggtgtccccc A/T gcataggaagctgagccagg 75 1312 G Ͼ A intron 8 attgctctgcagatcccctc G/A cagccctctgtcccttgttc rs1175929 76 3036 T Ͼ G intron 8 ctttatgtgggaagaaattt T/G tttttttgattggggagtgg 77 3176 C Ͼ A intron 8 aaatggcctggttctctgtc C/A cctttctgtctgtatgcctc 78 3364 A Ͼ T intron 8 ggcagaaggcaaagcttagg A/T cctagagagtgctggaccac 79 3373 G Ͼ A intron 8 caaagcttaggacctagaga G/A tgctggaccacgccactcac 80 3561 C Ͼ A intron 8 cagggatttattaatgattt C/A ttgtgaaatgtttggaaata 81 3654 T Ͼ C intron 8 agtgccggaatacatttgca T/C gtaagacagaacgctgcctg 82 4715 C Ͼ T intron 8 ggcagaggggtctcagaatc C/T gcatttccaacaatgtctcc 83 936 C Ͼ T coding region 9 cgtattgtctgcgggcatcc C/T gagggaggggggctgaagat Pro 312 Pro 84 2309 A Ͼ G intron 9 cccctcaagagtcagtttaa A/G tgttggtcatgttagttgtc 85 2392 T Ͼ C intron 9 atgggagggcttgtgcttca T/C gaaaacatttttccagatca 86 228 A Ͼ G intron 10 tggggatggggaggactggc A/G cagggctgctgtgatggggt 87 319 C Ͼ T intron 10 ttctgcggtccctggctccc C/T acctgactccaggtgaacaa 88 377 A Ͼ C intron 11 gaaagaagtgtgggagcaaa A/C gcatgatgttacatgtagac 89 521 G Ͼ A intron 11 agtgctctagagacaattgg G/A ttcaaatgtggagcaggctg 90 2850 G Ͼ C intron 11 ctctatacaatcattatgct G/C ccattgaaataataaataca 91 2976 A Ͼ G intron 11 ctccaattcggtagaaccag A/G gcttcatcttctctgtcgaa 92 3056 C Ͼ T intron 11 gtttgcagctgctgtttttc C/T ggcagcacatctgtgcaggc 93 340 T Ͼ C intron 12 ggcattatttgtgaaactta T/C ctaaaatcgaattcgggtcc 94 381 A Ͼ G intron 12 aattaaatttttgaaatttt A/G tattaaaaattatattagta 95 1728 C Ͼ T intron 14 caggctcagaggccttggcc C/T atcaccctggctcacgtgtg 96 2040 C Ͼ A coding region 15 atgggcctggacaacagcat C/A ctctggtttagctggttcat Ile 680 Ile 97 1382 G Ͼ A intron 15 cttttagacagaaaagttac G/A tgggatattatctcccacag 98 1453 G Ͼ A intron 15 tatataaggagaaaccagtt G/A aaattacctattgaagaaac 99 1567 G Ͼ A intron 15 ttctgcgtagttttgggtaa G/A tcacttatcttctttaggat MIR 100 1617 T Ͼ A intron 15 cagttgcctcatcagaaaga T/A gaacagcattacgcctctgc MIR 101 95 T Ͼ A intron 16 agttgagaacagaagatgat T/A gtcttttccaatgggacatg 102 452 G Ͼ A intron 16 tggtgttttgcttgagtaat G/A ttttctgaactaagcacaac 103 657 T Ͼ C intron 16 ctgttgcctcagtctgggct T/C cataggcatcagcagcccca 104 2473 G Ͼ A coding region 17 gcttcaatctcaccacttcg G/A tctccatgatgctgtttgac Val 825 Ile Clee et al. 2001 105 2649 A Ͼ G coding region 18 ggttccaaccagaagagaat A/G tcagaaagtaagtgctgttg Ile 883 Met Clee et al. 2001 106 1730 C Ͼ G intron 18 tgaaagttcaagcgcagtgc C/G ctgtgtccttacactccact 107 426 A Ͼ G intron 19 aggaccttacagtgggtagt A/G tcaggaggggtcaggggctg 108 468 A Ͼ G intron 19 aaagcaccagcgttagcctc A/G gtggcttccagcacgattcc 109 876 C Ͼ T intron 20 ccctcctcatctaaagtgaa C/T acatggggctcatgtgcagg 110 118 T Ͼ G intron 22 catgggatactcttctgtta T/G cacagaagagataaagggca 111 560 G Ͼ A intron 22 aaagctttgccattctaggg G/A tcatagccatacagggtgaa 112 102 A Ͼ G intron 23 accccttttgccatgttgaa A/G ccaccatctccctgctctgt 113 287 C Ͼ T intron 23 gtcaaagaaaagagacttgt C/T aagaggtaagagccttggct 114 1063 G Ͼ A intron 23 acctttcaccctcaggaagc G/A aggctgttcacacggcacac 115 321 T Ͼ G intron 25 ctctttacttaagtacagtg T/G gaggaacagcggcatcagga MER5A 116 376 G Ͼ C intron 25 gttagaaattcagcaacttg G/C gcccagctcagacctactga MER5A 117 478 C Ͼ T intron 25 catacataggaaatgacaaa C/T gtttatggatggatagtcta 118 579 G Ͼ T intron 25 tcatttaattctcaaaaaaa G/T atgaaaaaatgaacactcag 119 153 C Ͼ T intron 27 aatggtaaaagccacttgtt C/T tttgcagcatcgtgcatgtg 120 1058 C Ͼ T intron 28 actatcatgggagataatga C/T tatggttgtccatgattgga 121 1317 C Ͼ T intron 28 caggacccagtgttctgagt C/T accctgaatgtgagcactat 122 372 T Ͼ C intron 30 tatatgatttttaggttttg T/C ttatcagcttcttcgctttt 123 506 A Ͼ G intron 30 ccttttaaaaagtaagcagt A/G gataaataaattcagtgaag 124 1033 G Ͼ C intron 30 ctggatttcatggtgccttt G/C attttccacatgaaggttgt 125 4281 G Ͼ A coding region 31 tcttccctttgcagagacac G/A ccctgccaggcaggggagga Thr 1427 Thr 126 626 C Ͼ T intron 33 ggctccttgttactgatttc C/T gtcttttctctctgcctttt 127 719 G Ͼ A intron 33 taatagccctcatgctagaa G/A ggagccggagcctgtgtata 128 726 G Ͼ A intron 33 cctcatgctagaagggagcc G/A gagcctgtgtataaggccag 129 889 A Ͼ G intron 33 ctttcctcaatgtctcagct A/G tctaactgtgtgtgtaatca 130 1097 G Ͼ C intron 33 ctgtgcaccccactgtctgg G/C ttttaatgtcaggctgttct 131 4760 G Ͼ A coding region 35 tatgacaggactggacacca G/A aaataatgtcaaggtaaacc Arg 1587 Lys Clee et al. 2001 132 234 T Ͼ C intron 35 aacctatctaaacctcagtt T/C cctcatctgtgaaatggaga MIR 133 411 C Ͼ T intron 37 aactctgtacattttatcag C/T agcttatccatccattgcaa 134 1224 A Ͼ G intron 37 caggcataggtgattcagag A/G tgaaaggtcaagtccctgaa L2 135 1720 G Ͼ T intron 37 aaattaaaattactctgact G/T ggaatccatcgttcagtaag 136 251 T Ͼ G intron 40 tgaaggtaaggaaaatagtg T/G tatttgcttggatccactgg 137 252 T Ͼ C intron 40 gaaggtaaggaaaatagtgt T/C atttgcttggatccactggc 138 319 A Ͼ G intron 40 agcactggaaaagtcaaacc A/G taactttgagaattaggtga Table 2. Characterization of insertion/deletion polymorphisms at the ABCA1 locus Number Location Variations (5Ј to 3Ј) 1 (-1033)-(-1032) ins AT 5Ј flanking region tgacttaaatatttagacat (AT/ϩ) ggtgtgtaggcctgcattcc 2 6368 del C intron 5 ttctgatggggttgttgctg (C/-) tgagaatcatgactgggtgg 3 9709 del T intron 5 cattttctgtctgaaccccc (T/-) cacccattcaggcagctgct 4 13816 del T intron 5 tccctacttctccttttttt (T/-) catttgcctcctccacccac 5 270-271 ins G intron 10 cttttcagggaggagccaaa (G/ϩ) cgctcattgtctgtgcttct 6 611-612 ins C intron 20 tttagcccatcctctccccc (C/ϩ) gccaccctccttattgaggc 7 391-392 ins T intron 32 gagtgccttgggtactctct (T/ϩ) gatgggggactccatgataa 8 847 del C intron 37 gctgtatattgtgaatgtcc (C/-) gttttcaaaagcaaagccaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) (ϩ), insertion polymorphism; (-), deletion polymorphism Table 1. Continued Repetitive Identity Number Location Exon SNP (5Ј to 3Ј) Substituion sequence to dbSNP Reference 139 957 G Ͼ C intron 40 cttgttactcttttttcctt G/C tcatgggtgatagccatttg 140 146 C Ͼ T intron 41 tgatgtgggcatcccgcagc C/T ccctccctgcccatcctgga 141 239 A Ͼ C intron 42 cattggttttatatgcttac A/C tttatgtgttagttattaaa 142 321 T Ͼ A intron 42 aataaatggttgattttgag T/A ttgagtttcatagtccaaaa 143 322 T Ͼ C intron 42 ataaatggttgattttgagt T/C tgagtttcatagtccaaaaa 144 533 G Ͼ A intron 42 agatgaaaaattatgtagat G/A ataatgaatgatacggttct 145 546 A Ͼ G intron 42 tgtagatgataatgaatgat A/G cggttctaaaaagacaggtt 146 739 T Ͼ A intron 43 tacagccacacttaaaatgg T/A cccattatgaaatacatatt 147 18 T Ͼ C intron 44 taggtgagaaaagaagtggc T/C tgtattttgctgcaaagact 148 264 T Ͼ C intron 44 acaatataatttgcttgttt T/C ttaagagtataatttagtga L1MB8 149 279 T Ͼ C intron 44 tgttttttaagagtataatt T/C agtgatttttggtaaattga L1MB8 150 508 C Ͼ T intron 44 tttacattgctacataaaat C/T cccctatgtacatgtaccta 151 1477 A Ͼ T intron 44 gatctcctctcctgtctctt A/T catttttgcagtagcaatgt 152 1665 G Ͼ A intron 44 tggttgtaagaactgatttg G/A ttggtatagctgtgagggcc 153 1956 T Ͼ G intron 44 gtgttgctcacactcaaaat T/G tctgggccttctcatttggt 154 68 T Ͼ C intron 45 aatatataccttatggcttt T/C ccacacgcattgacttcagg 155 608 G Ͼ C intron 46 ttatactgacttcaatagag G/C tttcagacaaaaagttgttt 156 336 T Ͼ C intron 47 ttcacaattgtaaacaccac T/C acactgaacagcatcatccc L1MD2 157 55 G Ͼ C intron 49 agggtgtggattcctgcccc G/C acactcccgcccataggtcc rs1331924 158 7479 C Ͼ T 3Ј untranslated region 50 aacaaaaatgtgggtgtctc C/T aggcacgggaaacttggttc 159 8226 C Ͼ T 3Ј untranslated region 50 aggagcccactgtaacaata C/T tgggcagccttttttttttt 160 8682 G Ͼ A 3Ј untranslated region 50 aacttcttccactttttcca G/A aatttgaatattaacgctaa rs363717 161 8697 C Ͼ T 3Ј untranslated region 50 ttccagaatttgaatattaa C/T gctaaaggtgtaagacttca 162 9097 A Ͼ G 3Ј untranslated region 50 aactattttgaagaaaacac A/G acattttaatacagattgaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) is an important resource for understanding not only the etiology and risk of some diseases, but also the pharmacokinetics or pharmacodyamics of drugs used to treat them.
X
ABCA1 p.Ile883Met 11558901:15:8980
status: NEW
Login to comment

19 Microsatellite sequences are also shown Table 1. Characterization of 162 single-nucleotide polymorphisms (SNPs) within the ABCA1 locus Repetitive Identity Number Location Exon SNP (5b18; to 3b18;) Substituion sequence to dbSNP Reference 1 afa;278 G b0e; C 5b18; flanking region gggcccgggcgggggaaggg G/C acgcagaccgcggaccctaa rs1800976 2 afa;99 G b0e; C 5b18; flanking region acataaacagaggccgggaa G/C ggggcggggaggagggagag 3 159 G b0e; T intron 1 gcggtgttaaatggggagac G/T atgtcctagtacgagctctg 4 506 G b0e; C intron 1 gaattggctatatgctcccc G/C ggactggagcggcacagtcc 5 5897 T b0e; G intron 1 gtacaaaaccctttagcttt T/G gcaaacctcctttaagaccc 6 5929 C b0e; T intron 1 ttaagacccgatttaaatgc C/T tccctcctcatgaagctctt 7 5962 T b0e; C intron 1 aagctcttctggatccactc T/C ttcccatcactaagttgaaa 8 5985 A b0e; C intron 1 cccatcactaagttgaaagt A/C agatccccttctctttactt 9 11416 G b0e; A intron 1 ttacagtgccctttatagga G/A agaaagaagaaattgtgtct 10 11935 G b0e; A intron 1 tctctgtggagcaaatagag G/A gctgtctgacacttggttcc 11 12281 T b0e; A intron 1 gaatgtttgatttgtgaaaa T/A cttaataacagtagtttttt 12 12924 T b0e; C intron 1 gtgctgacaatcttatactc T/C aggttgaacctccggggaag 13 13002 C b0e; G intron 1 gagcctcaatcacagattct C/G tctagctcacatgaagttaa 14 17715 C b0e; T intron 1 ggagcatgactttgtggaag C/T ctctcctcttccacccagag 15 17848 T b0e; C intron 1 gagggctgactgtcaccctt T/C gataggagcccagcactaaa 16 21384 G b0e; C intron 1 gtgggtgggaggaattggag G/C aggaagcttgcctaagtgtg 17 22145 C b0e; G intron 1 gtagcttctaaatcaacgaa C/G tgattcctggagagcagctt rs1340361 18 23063 G b0e; A intron 1 ggaggcacctgtgacaccca G/A cggagtaggggggcggtgtg 19 23131 G b0e; A intron 1 agtgtgcatatgtgctgacc G/A tgggagcttgtttgtcggtt 20 156 T b0e; C intron 2 ggacacaggactgtgtggtc T/C ggatatggcatgtggcttat rs1078143 21 384 A b0e; G intron 2 gctgtgggtgaagtgagtta A/G tggccccactcttagagatc rs1078144 22 1081 G b0e; A intron 2 agtgcagccaaaattgcaaa G/A tcataccattcaaattaata rs752187 23 2801 A b0e; G intron 2 aagaaaagtgatttatttca A/G gttgctgatgcttagattgt 24 2830 C b0e; G intron 2 tgcttagattgttagagttg C/G aaagatctggcttgcatctt 25 2856 A b0e; G intron 2 tctggcttgcatcttgtaca A/G ctgacagaactggggctcag 26 3187 A b0e; G intron 2 tgatagctgttgcctgcagc A/G tacggacgttcattgcgcag 27 3190 C b0e; T intron 2 tagctgttgcctgcagcata C/T ggacgttcattgcgcagttc 28 3194 C b0e; T intron 2 tgttgcctgcagcatacgga C/T gttcattgcgcagttcctgt 29 3204 G b0e; A intron 2 agcatacggacgttcattgc G/A cagttcctgtctcctgagat 30 3401 T b0e; C intron 2 acataaagcctgtgtgctgc T/C gccaggaagactagaaacgc 31 13927 A b0e; G intron 2 gtcaccacatacctggcact A/G tgctaaggctgggaatgcag L2 32 4163 G b0e; A intron 3 ccagcccacttcatcttacc G/A tagttacctccttagagtat 33 4262 T b0e; C intron 3 tgtcaaagaggaactaagga T/C gccagggactttctgcttag 34 4306 C b0e; T intron 3 ccctctcatcacttctccaa C/T gctggtatcatgaaccccat 35 240 G b0e; A intron 5 gacagaagaaaagtccccag G/A gaagaatactacagacttgg rs1107281 36 490 G b0e; A intron 5 gatgggcatttgaacttgtt G/A tctttaaaaagtgaaatctt 37 583 T b0e; G intron 5 tatctggggagtgggcattt T/G ctgactgaggcattggctgc 38 1051 C b0e; T inton 5 ggctacaaaactgtgctttc C/T ttgggcagtaaaagaggcaa 39 3051 G b0e; A intron 5 tagagaacaagtctaattct G/A ttttccttgaaatagtcgaa 40 3127 A b0e; G intron 5 aagtccatgattttttaggc A/G aaatggcctcctttcctctt 41 5924 C b0e; T intron 5 ctttctttcacaaaattgcc C/T cccagagctttctggaaggg 42 6831 T b0e; C intron 5 ccagtccctcagccttgcca T/C tgcttatgctggtctggaaa 43 12678 G b0e; C intron 5 gctcaccgctctgctcaccc G/C accctctggccatctcctct 44 14214 G b0e; A intron 5 cagcttggtcccagaggcct G/A gacctgggtcccagaggtcc 45 14257 C b0e; T intron 5 gctggttccccggcttggtc C/T cagaggcctggatgtgtggc 46 18078 C b0e; T intron 5 cctaccacaccatgcacgtg C/T acagccaagggttgttgact 47 18795 G b0e; A intron 5 ctgggctcttcctggacctg G/A ccagctaaaaggaaatctcc 48 18948 G b0e; A intron 5 gcattggtggtactaagaac G/A catattccctatcctatagg L2 49 19053 T b0e; C intron 5 ctcccccaacattaaaagtg T/C aagggatgcttattcaaatg MER5A 50 19148 C b0e; A intron 5 ggcccaagaaactgcatttt C/A gcatgctccctaaatgaagc MER5A 51 19229 C b0e; T intron 5 atgctaacagtgtagagtca C/T atgtgatgggaagcatcagg 52 19405 T b0e; C intron 5 cttgctcaatttattctgtc T/C atataactcaatattactga 53 19534 G b0e; A intron 5 catgtgaccctcttagctcc G/A cggattaactcctgtcctca 54 474 G b0e; A coding region 6 gaaaccttctctgggttcct G/A tatcacaacctctctctccc Leu 158 Leu 55 210 A b0e; C intron 6 gcaacctggcgtcatgggcc A/C gctggttaaaataaaattga 56 334 G b0e; A intron 6 acagttctgaggcaataacc G/A tggttaagggttattgatct 57 2288 C b0e; T intron 6 cttctttcaaagcttgtggt C/T cactggaccacgtatgaagt 58 2322 T b0e; C intron 6 atgaagtagaatagtttagg T/C ccagaaaggcaattaagtaa 59 2820 T b0e; G intron 6 gtgctttgatacattctgag T/G ttcagtaaagagacctgatg 60 656 G b0e; A coding region 7 tgagctttgtggcctaccaa G/A ggagaaactggctgcagcag Arg 219 Lys Clee et al. 2001 61 416 G b0e; A intron 7 catcataaagatgacattgt G/A ggctgtcacagttggaaggc 62 471 C b0e; T intron 7 agaccacactatttagctta C/T ttagtaataacattgcaaag 63 504 G b0e; A intron 7 ttgcaaagaaaaattccgac G/A aagttttttcagcctaggaa 64 679 G b0e; C intron 7 gctctggtgaaattcctctc G/C ctaccccaaacatcatcatt 65 1740 C b0e; T intron 7 acaaatgctcaccctttcag C/T tggaatgattgaaattttgg 66 2122 A b0e; G intron 7 tgattaaggtggctactacc A/G ggtgctttctgcatatctcg 67 7753 T b0e; C intrion 7 taggaattccaagctgtgaa T/C tttttactgaagctctttgg 68 8973 A b0e; T intron 7 atggaaatttgtttatattg A/T ctacagattgccaatattat 69 8976 A b0e; G intron 7 gaaatttgtttatattgact A/G cagattgccaatattattag Table 1. Continued Repetitive Identity Number Location Exon SNP (5b18; to 3b18;) Substituion sequence to dbSNP Reference 70 11327 G b0e; C intron 7 ctaacaatcttatttccatt G/C agtccttataaaagaagtgg 71 11738 C b0e; T intron 7 ctgacgtttaagggagaccg C/T gtaggtccctttgaggactg 72 12295 T b0e; A intron 7 agtctgtaaattattgttct T/A ttttttctttagcttatgct 73 387 C b0e; G intron 8 tagcaaggccaatcatttta C/G caacacacatgcttgctaac 74 697 A b0e; T intron 8 ggaactgtctggtgtccccc A/T gcataggaagctgagccagg 75 1312 G b0e; A intron 8 attgctctgcagatcccctc G/A cagccctctgtcccttgttc rs1175929 76 3036 T b0e; G intron 8 ctttatgtgggaagaaattt T/G tttttttgattggggagtgg 77 3176 C b0e; A intron 8 aaatggcctggttctctgtc C/A cctttctgtctgtatgcctc 78 3364 A b0e; T intron 8 ggcagaaggcaaagcttagg A/T cctagagagtgctggaccac 79 3373 G b0e; A intron 8 caaagcttaggacctagaga G/A tgctggaccacgccactcac 80 3561 C b0e; A intron 8 cagggatttattaatgattt C/A ttgtgaaatgtttggaaata 81 3654 T b0e; C intron 8 agtgccggaatacatttgca T/C gtaagacagaacgctgcctg 82 4715 C b0e; T intron 8 ggcagaggggtctcagaatc C/T gcatttccaacaatgtctcc 83 936 C b0e; T coding region 9 cgtattgtctgcgggcatcc C/T gagggaggggggctgaagat Pro 312 Pro 84 2309 A b0e; G intron 9 cccctcaagagtcagtttaa A/G tgttggtcatgttagttgtc 85 2392 T b0e; C intron 9 atgggagggcttgtgcttca T/C gaaaacatttttccagatca 86 228 A b0e; G intron 10 tggggatggggaggactggc A/G cagggctgctgtgatggggt 87 319 C b0e; T intron 10 ttctgcggtccctggctccc C/T acctgactccaggtgaacaa 88 377 A b0e; C intron 11 gaaagaagtgtgggagcaaa A/C gcatgatgttacatgtagac 89 521 G b0e; A intron 11 agtgctctagagacaattgg G/A ttcaaatgtggagcaggctg 90 2850 G b0e; C intron 11 ctctatacaatcattatgct G/C ccattgaaataataaataca 91 2976 A b0e; G intron 11 ctccaattcggtagaaccag A/G gcttcatcttctctgtcgaa 92 3056 C b0e; T intron 11 gtttgcagctgctgtttttc C/T ggcagcacatctgtgcaggc 93 340 T b0e; C intron 12 ggcattatttgtgaaactta T/C ctaaaatcgaattcgggtcc 94 381 A b0e; G intron 12 aattaaatttttgaaatttt A/G tattaaaaattatattagta 95 1728 C b0e; T intron 14 caggctcagaggccttggcc C/T atcaccctggctcacgtgtg 96 2040 C b0e; A coding region 15 atgggcctggacaacagcat C/A ctctggtttagctggttcat Ile 680 Ile 97 1382 G b0e; A intron 15 cttttagacagaaaagttac G/A tgggatattatctcccacag 98 1453 G b0e; A intron 15 tatataaggagaaaccagtt G/A aaattacctattgaagaaac 99 1567 G b0e; A intron 15 ttctgcgtagttttgggtaa G/A tcacttatcttctttaggat MIR 100 1617 T b0e; A intron 15 cagttgcctcatcagaaaga T/A gaacagcattacgcctctgc MIR 101 95 T b0e; A intron 16 agttgagaacagaagatgat T/A gtcttttccaatgggacatg 102 452 G b0e; A intron 16 tggtgttttgcttgagtaat G/A ttttctgaactaagcacaac 103 657 T b0e; C intron 16 ctgttgcctcagtctgggct T/C cataggcatcagcagcccca 104 2473 G b0e; A coding region 17 gcttcaatctcaccacttcg G/A tctccatgatgctgtttgac Val 825 Ile Clee et al. 2001 105 2649 A b0e; G coding region 18 ggttccaaccagaagagaat A/G tcagaaagtaagtgctgttg Ile 883 Met Clee et al. 2001 106 1730 C b0e; G intron 18 tgaaagttcaagcgcagtgc C/G ctgtgtccttacactccact 107 426 A b0e; G intron 19 aggaccttacagtgggtagt A/G tcaggaggggtcaggggctg 108 468 A b0e; G intron 19 aaagcaccagcgttagcctc A/G gtggcttccagcacgattcc 109 876 C b0e; T intron 20 ccctcctcatctaaagtgaa C/T acatggggctcatgtgcagg 110 118 T b0e; G intron 22 catgggatactcttctgtta T/G cacagaagagataaagggca 111 560 G b0e; A intron 22 aaagctttgccattctaggg G/A tcatagccatacagggtgaa 112 102 A b0e; G intron 23 accccttttgccatgttgaa A/G ccaccatctccctgctctgt 113 287 C b0e; T intron 23 gtcaaagaaaagagacttgt C/T aagaggtaagagccttggct 114 1063 G b0e; A intron 23 acctttcaccctcaggaagc G/A aggctgttcacacggcacac 115 321 T b0e; G intron 25 ctctttacttaagtacagtg T/G gaggaacagcggcatcagga MER5A 116 376 G b0e; C intron 25 gttagaaattcagcaacttg G/C gcccagctcagacctactga MER5A 117 478 C b0e; T intron 25 catacataggaaatgacaaa C/T gtttatggatggatagtcta 118 579 G b0e; T intron 25 tcatttaattctcaaaaaaa G/T atgaaaaaatgaacactcag 119 153 C b0e; T intron 27 aatggtaaaagccacttgtt C/T tttgcagcatcgtgcatgtg 120 1058 C b0e; T intron 28 actatcatgggagataatga C/T tatggttgtccatgattgga 121 1317 C b0e; T intron 28 caggacccagtgttctgagt C/T accctgaatgtgagcactat 122 372 T b0e; C intron 30 tatatgatttttaggttttg T/C ttatcagcttcttcgctttt 123 506 A b0e; G intron 30 ccttttaaaaagtaagcagt A/G gataaataaattcagtgaag 124 1033 G b0e; C intron 30 ctggatttcatggtgccttt G/C attttccacatgaaggttgt 125 4281 G b0e; A coding region 31 tcttccctttgcagagacac G/A ccctgccaggcaggggagga Thr 1427 Thr 126 626 C b0e; T intron 33 ggctccttgttactgatttc C/T gtcttttctctctgcctttt 127 719 G b0e; A intron 33 taatagccctcatgctagaa G/A ggagccggagcctgtgtata 128 726 G b0e; A intron 33 cctcatgctagaagggagcc G/A gagcctgtgtataaggccag 129 889 A b0e; G intron 33 ctttcctcaatgtctcagct A/G tctaactgtgtgtgtaatca 130 1097 G b0e; C intron 33 ctgtgcaccccactgtctgg G/C ttttaatgtcaggctgttct 131 4760 G b0e; A coding region 35 tatgacaggactggacacca G/A aaataatgtcaaggtaaacc Arg 1587 Lys Clee et al. 2001 132 234 T b0e; C intron 35 aacctatctaaacctcagtt T/C cctcatctgtgaaatggaga MIR 133 411 C b0e; T intron 37 aactctgtacattttatcag C/T agcttatccatccattgcaa 134 1224 A b0e; G intron 37 caggcataggtgattcagag A/G tgaaaggtcaagtccctgaa L2 135 1720 G b0e; T intron 37 aaattaaaattactctgact G/T ggaatccatcgttcagtaag 136 251 T b0e; G intron 40 tgaaggtaaggaaaatagtg T/G tatttgcttggatccactgg 137 252 T b0e; C intron 40 gaaggtaaggaaaatagtgt T/C atttgcttggatccactggc 138 319 A b0e; G intron 40 agcactggaaaagtcaaacc A/G taactttgagaattaggtga Table 2. Characterization of insertion/deletion polymorphisms at the ABCA1 locus Number Location Variations (5b18; to 3b18;) 1 (afa;1033)-(afa;1032) ins AT 5b18; flanking region tgacttaaatatttagacat (AT/af9;) ggtgtgtaggcctgcattcc 2 6368 del C intron 5 ttctgatggggttgttgctg (C/afa;) tgagaatcatgactgggtgg 3 9709 del T intron 5 cattttctgtctgaaccccc (T/afa;) cacccattcaggcagctgct 4 13816 del T intron 5 tccctacttctccttttttt (T/afa;) catttgcctcctccacccac 5 270-271 ins G intron 10 cttttcagggaggagccaaa (G/af9;) cgctcattgtctgtgcttct 6 611-612 ins C intron 20 tttagcccatcctctccccc (C/af9;) gccaccctccttattgaggc 7 391-392 ins T intron 32 gagtgccttgggtactctct (T/af9;) gatgggggactccatgataa 8 847 del C intron 37 gctgtatattgtgaatgtcc (C/afa;) gttttcaaaagcaaagccaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) (af9;), insertion polymorphism; (afa;), deletion polymorphism Table 1. Continued Repetitive Identity Number Location Exon SNP (5b18; to 3b18;) Substituion sequence to dbSNP Reference 139 957 G b0e; C intron 40 cttgttactcttttttcctt G/C tcatgggtgatagccatttg 140 146 C b0e; T intron 41 tgatgtgggcatcccgcagc C/T ccctccctgcccatcctgga 141 239 A b0e; C intron 42 cattggttttatatgcttac A/C tttatgtgttagttattaaa 142 321 T b0e; A intron 42 aataaatggttgattttgag T/A ttgagtttcatagtccaaaa 143 322 T b0e; C intron 42 ataaatggttgattttgagt T/C tgagtttcatagtccaaaaa 144 533 G b0e; A intron 42 agatgaaaaattatgtagat G/A ataatgaatgatacggttct 145 546 A b0e; G intron 42 tgtagatgataatgaatgat A/G cggttctaaaaagacaggtt 146 739 T b0e; A intron 43 tacagccacacttaaaatgg T/A cccattatgaaatacatatt 147 18 T b0e; C intron 44 taggtgagaaaagaagtggc T/C tgtattttgctgcaaagact 148 264 T b0e; C intron 44 acaatataatttgcttgttt T/C ttaagagtataatttagtga L1MB8 149 279 T b0e; C intron 44 tgttttttaagagtataatt T/C agtgatttttggtaaattga L1MB8 150 508 C b0e; T intron 44 tttacattgctacataaaat C/T cccctatgtacatgtaccta 151 1477 A b0e; T intron 44 gatctcctctcctgtctctt A/T catttttgcagtagcaatgt 152 1665 G b0e; A intron 44 tggttgtaagaactgatttg G/A ttggtatagctgtgagggcc 153 1956 T b0e; G intron 44 gtgttgctcacactcaaaat T/G tctgggccttctcatttggt 154 68 T b0e; C intron 45 aatatataccttatggcttt T/C ccacacgcattgacttcagg 155 608 G b0e; C intron 46 ttatactgacttcaatagag G/C tttcagacaaaaagttgttt 156 336 T b0e; C intron 47 ttcacaattgtaaacaccac T/C acactgaacagcatcatccc L1MD2 157 55 G b0e; C intron 49 agggtgtggattcctgcccc G/C acactcccgcccataggtcc rs1331924 158 7479 C b0e; T 3b18; untranslated region 50 aacaaaaatgtgggtgtctc C/T aggcacgggaaacttggttc 159 8226 C b0e; T 3b18; untranslated region 50 aggagcccactgtaacaata C/T tgggcagccttttttttttt 160 8682 G b0e; A 3b18; untranslated region 50 aacttcttccactttttcca G/A aatttgaatattaacgctaa rs363717 161 8697 C b0e; T 3b18; untranslated region 50 ttccagaatttgaatattaa C/T gctaaaggtgtaagacttca 162 9097 A b0e; G 3b18; untranslated region 50 aactattttgaagaaaacac A/G acattttaatacagattgaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) is an important resource for understanding not only the etiology and risk of some diseases, but also the pharmacokinetics or pharmacodyamics of drugs used to treat them.
X
ABCA1 p.Ile883Met 11558901:19:8539
status: NEW
Login to comment

PMID: 22403555 [PubMed] Piehler AP et al: "A-Subclass ATP-Binding Cassette Proteins in Brain Lipid Homeostasis and Neurodegeneration."
No. Sentence Comment
97 Among the allelic variants identified in the ABCA1 gene, the SNPs rs2230806 (R219K), rs4149313 (I883M), and rs2230808 (R1587K) have been most extensively studied.
X
ABCA1 p.Ile883Met 22403555:97:96
status: NEW
Login to comment

96 Among the allelic variants identified in the ABCA1 gene, the SNPs rs2230806 (R219K), rs4149313 (I883M), and rs2230808 (R1587K) have been most extensively studied.
X
ABCA1 p.Ile883Met 22403555:96:96
status: NEW
Login to comment

PMID: 23555974 [PubMed] Song C et al: "Genetic variants from lipid-related pathways and risk for incident myocardial infarction."
No. Sentence Comment
107 rs4149313 is a non-synonymous SNP located in exon 18 of ABCA1, which encodes an amino acid substitution, Ile.Met (Ile883Met).
X
ABCA1 p.Ile883Met 23555974:107:114
status: NEW
Login to comment

108 Ile883Met is located at N-terminal of the first nucleotide-binding motif, suggesting its potential function on formatting stable structure of ATP-binding cassette.
X
ABCA1 p.Ile883Met 23555974:108:0
status: NEW
Login to comment

109 In vitro experiments showed that cholesterol efflux in transfected 293 cells with the I883M variant significantly differed from wild-type cells[20], which supports the biological functionality of this variant.
X
ABCA1 p.Ile883Met 23555974:109:86
status: NEW
Login to comment

PMID: 24385509 [PubMed] Westerterp M et al: "ATP-binding cassette transporters, atherosclerosis, and inflammation."
No. Sentence Comment
59 In a Mendelian randomization approach in a prospective cohort comprising ࣈ9000 individuals, heterozygosity for the ABCA1 mutation K776N led to a 2-to-3 times higher risk of ischemic heart disease.105 Furthermore, 5 single-nucleotide polymorphisms (SNPs) inABCA1 (V771M,V825I, I883M, E1172D, R1587K) were shown to predict risk of ischemic heart disease in a cohort of 9259 individuals.106 However, the same group reported more recently that heterozygosity for 4 loss-of-function mutations (P1065S, G1216V, N1800H, R2144X) was not associated with a higher risk of ischemic heart disease in 3 prospective cohorts comprising 56ߙ886 individuals.107 It must be noted, however, that only small decreases in HDL, of ࣈ28% as opposed to ࣈ50% in previously reported ABCA1 heterozygotes, were observed.94,101-103,107 Also, the residual cholesterol efflux was substantial (74%-79% for P1065S and G1216V and 48%-49% for N1800H and R2144X for homozygous mutations compared with controls),107 whereas in patients with TD there was only 20% to 30% residual cholesterol efflux.108 In addition, LDL levels were reduced by ࣈ25%, probably offsetting the effects of reduced HDL on CVD.107 Thus, the conflicting results in these studies could be related to inclusion of relatively mild ABCA1 mutations as well as offsetting effects of reduced LDL cholesterol levels.109 In a meta-analysis of genome-wide association studies, SNPs near the ABCA1 gene have been associated with HDL and total cholesterol levels,110,111 but not with cardiovascular risk.112 Although these studies have the benefit of huge statistical power, some caution is merited in the interpretation of findings.
X
ABCA1 p.Ile883Met 24385509:59:282
status: NEW
Login to comment

PMID: 24844148 [PubMed] Koldamova R et al: "ATP-binding cassette transporter A1: from metabolism to neurodegeneration."
No. Sentence Comment
978 R219K (rs2230806), I883M (rs4149313), and R1587K (rs2230808) are the non-synonymous variants most extensively investigated since they translate into amino acid changes and have been shown to associate with the risk for CAD.
X
ABCA1 p.Ile883Met 24844148:978:19
status: NEW
Login to comment

PMID: 25104170 [PubMed] Liu N et al: "The R219K polymorphism on ATP-binding cassette transporter A1 gene is associated with coronary heart disease risk in Asia population: evidence from a meta-analysis."
No. Sentence Comment
24 methionine substitution in exon 18 (I883M, rs4149313) were studied widely for their association with CHD susceptibility [12, 23].
X
ABCA1 p.Ile883Met 25104170:24:36
status: NEW
Login to comment

PMID: 25279016 [PubMed] Marvaki A et al: "Impact of 3 Common ABCA1 Gene Polymorphisms on Optimal vs Non-Optimal Lipid Profile in Greek Young Nurses."
No. Sentence Comment
1 They evaluated the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms [such as rs2230806 (R219K), rs2230808 (R1587K) and rs4149313 (I883M)] on the human lipid profile (defined as Optimal and Non-Optimal).
X
ABCA1 p.Ile883Met 25279016:1:157
status: NEW
Login to comment

3 All subjects were genotyped and the ABCA1 polymorphisms (R219K, R1587K and I883M) were recorded.
X
ABCA1 p.Ile883Met 25279016:3:75
status: NEW
Login to comment

5 Results: No statistical differences were observed in the distribution of R219K, R1587K and I883M polymorphisms according to the lipid profile (p>0.05 in all cases).
X
ABCA1 p.Ile883Met 25279016:5:91
status: NEW
Login to comment

6 No statistical differences were observed in the distribution of R219K, R1587K and I883M polymorphisms according to sex (p>0.05 in all cases).
X
ABCA1 p.Ile883Met 25279016:6:82
status: NEW
Login to comment

15 Several ABCA1 gene polymorphisms have been identified, such as rs2230806 (R219K) in the chromosomal position 107620867, rs2230808 (R1587K) in the chromosomal position 106602625 and rs4149313 (I883M) in the chromosomal position 106626574.
X
ABCA1 p.Ile883Met 25279016:15:192
status: NEW
Login to comment

17 The aim of the study, in line with our previous work [57], was to evaluate the R219K, R1587K and I883M of ABCA1 gene polymorphisms according to lipid profile.
X
ABCA1 p.Ile883Met 25279016:17:97
status: NEW
Login to comment

26 According to Genotypes We evaluated single nucleotide polymorphisms (SNPs) in chromosome 9 such as rs2230806 (R219K) in the position 107620867, rs2230808 (R1587K) in the position 106602625 and rs4149313 (I883M) in the position 106626574 according to lipid profile by using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP`s) (see below).
X
ABCA1 p.Ile883Met 25279016:26:204
status: NEW
Login to comment

29 DNA Analysis and Determination of Blood Lipids The ABCA1 gene polymorphisms (R219K, R1587K and I883M) were detected using PCR and RFLP`s.
X
ABCA1 p.Ile883Met 25279016:29:95
status: NEW
Login to comment

35 The oligonucleotide primers used for I883M polymorphism were 5`-GAGAAGAGCCACCCTGGTTCCAACCA GAAGAGGAT-3` and 5`- AGAAAGGCAGGAGACAT CGCTT -3 as described by Clee SM et al [4].
X
ABCA1 p.Ile883Met 25279016:35:37
status: NEW
Login to comment

45 There was no difference in R219K, R1587K and I883M polymorphisms frequency according to Optimal and Non-Optimal lipid profile (p = 0.49, 0.29 and 0.42, respectively).
X
ABCA1 p.Ile883Met 25279016:45:45
status: NEW
Login to comment

48 DISCUSSION We examined the impact of the R219K, R1587K and I883M of ABCA1 polymorphisms as a genetic influence on the lipid profile in Greek subjects.
X
ABCA1 p.Ile883Met 25279016:48:59
status: NEW
Login to comment

52 The relationship between ABCA1 R219K, R1587K and I883M and Alzheimer disease has been reported in various ethnic groups with contradictory results.
X
ABCA1 p.Ile883Met 25279016:52:49
status: NEW
Login to comment

54 With regard to subgroups with low HDL-C, Hodo f;lugil et al. [17] reported that R219K and I883M polymorphisms were related to higher HDL-C levels, Slatter et al. [18] found that R1587K was overexpressed in low HDL-C individuals, whereas Frikke-Schmidt et al. [19] did not observe any association with R219K but reported that R1587K polymorphism was overexpressed in individuals with low HDL-C concentrations.
X
ABCA1 p.Ile883Met 25279016:54:93
status: NEW
Login to comment

58 R219K R1587K I883M n (%) n (%) n (%) RR 225 (50.2) RR 211 (47.1) II 309 (69.0) RK 191 (42.6) RK 193 (43.1) IM 131 (29.2) KK 32 (7.1) KK 44 (9.8) MM 8 (1.8) R 71.5 R 68.6 I 83.6 K 28.5 K 31.4 M 16.4 Table 1.
X
ABCA1 p.Ile883Met 25279016:58:13
status: NEW
Login to comment

PMID: 25527331 [PubMed] Yin YW et al: "ATP-binding cassette transporter 1 C69T and V825I polymorphisms in the development of atherosclerosis: a meta-analysis of 18,320 subjects."
No. Sentence Comment
36 Previously, we performed a meta-analysis to evaluate the associations between the ABCA1 R219K and I883M polymorphisms and AS risk, and demonstrated the above variants were the protective roles for AS [17].
X
ABCA1 p.Ile883Met 25527331:36:98
status: NEW
Login to comment

PMID: 26243156 [PubMed] Fawzy MS et al: "Functional and Structural Impact of ATP-Binding Cassette Transporter A1 R219K and I883M Gene Polymorphisms in Obese Children and Adolescents."
No. Sentence Comment
4 Two genetic variants in ABCA1 gene-R219K (rs2230806; G/A) and I883M (rs2066714; A/G)-were genotyped in 128 normal weight and 128 overweight/obese subjects using polymerase chain reaction-restriction fragment length polymorphism technology.
X
ABCA1 p.Ile883Met 26243156:4:62
status: NEW
Login to comment

9 On the other hand, individuals with the G variant of I883M polymorphism showed lower susceptibility to obesity under all genetic models (allelic, homozygote, heterozygote, dominant, and recessive models; p \ 0.05), with no observed association with body mass index or degree of obesity.
X
ABCA1 p.Ile883Met 26243156:9:53
status: NEW
Login to comment

11 Conclusions The study results suggest that R219K and I883M SNPs of the ABCA1 gene may play a role in susceptibility to obesity in our Egyptian population; the former increases susceptibility and phenotype severity, and the latter is protective.
X
ABCA1 p.Ile883Met 26243156:11:53
status: NEW
Login to comment

16 The GA genotype of R219K polymorphism increased susceptibility to obesity under the heterozygous model, the A variant was associated with a higher degree of obesity, the G variant of I883M polymorphism significantly decreased the risk of obesity under all genetic models.
X
ABCA1 p.Ile883Met 26243156:16:183
status: NEW
Login to comment

40 Another missense polymorphism, I883M with nucleotide change A[G in exon 18 at position 3044 (rs4149313, replaced by rs2066714), has been reported as a milder phenotype with a significant reduction of HDL-cholesterol (HDL-c) and cholesterol efflux (approximately 70 % of wild-type) [23-25].
X
ABCA1 p.Ile883Met 26243156:40:31
status: NEW
Login to comment

43 In this study, we investigated the prevalence of these frequently occurring variants of the ABCA1 gene, R219K and I883M polymorphisms, in association with anthropometric parameters and lipid profile in Egyptian overweight/obese children and adolescents.
X
ABCA1 p.Ile883Met 26243156:43:114
status: NEW
Login to comment

60 The most frequent endocrine diseases causing obesity (such as Cushing syndrome, hypothyroidism, and pseudohypoparathyroidism), or genetic syndromes associated with obesity (such as Prader- Fig. 3 Workflow for PCR genotyping of R219K and I883M polymorphisms in the study population.
X
ABCA1 p.Ile883Met 26243156:60:237
status: NEW
Login to comment

80 Genotyping of ABCA1 R219K and I883M variations were conducted by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method.
X
ABCA1 p.Ile883Met 26243156:80:30
status: NEW
Login to comment

105 In I883M rs2066714, 129-bp amplified fragment containing the genetic variant (ATA/ATG) in exon 18 (coordinates: 104,824,578- 104,824,465) and part of intron 18 (coordinates: 104,824,464- 104,822,668) existed in ABCA1-002 transcript only.
X
ABCA1 p.Ile883Met 26243156:105:3
status: NEW
Login to comment

112 I883M (rs2066714): M, DNA marker 50 bp each.
X
ABCA1 p.Ile883Met 26243156:112:0
status: NEW
Login to comment

124 Experimentally-genotyped polymorphisms (R219K and I883M) in the study population are shown in electronic supplementary Fig. 5.
X
ABCA1 p.Ile883Met 26243156:124:50
status: NEW
Login to comment

127 However, R219K (rs2230806) and I883M (rs2066714) are in linkage disequilibrium with other nearby intronic SNPs which might have deleterious effects on the protein function.
X
ABCA1 p.Ile883Met 26243156:127:31
status: NEW
Login to comment

129 Both ABCA1 R219K (g.1060G[A) and I883M (g.3044A[G) genotypes were in agreement with those expected by the HWE (p [ 0.05).
X
ABCA1 p.Ile883Met 26243156:129:33
status: NEW
Login to comment

133 Regarding I883M polymorphism, significantly decreased susceptibility of obesity was observed among G carriers (M allele) in the overall and stratified analysis, with OR showing protective effects in all genetic models.
X
ABCA1 p.Ile883Met 26243156:133:10
status: NEW
Login to comment

135 R219K and I883M polymorphisms are far apart, existing in different haplotype blocks in the ABCA1 gene.
X
ABCA1 p.Ile883Met 26243156:135:10
status: NEW
Login to comment

140 In contrast, no observed association was determined between I883M polymorphism and any of the clinical characteristics, even under all genetic models.
X
ABCA1 p.Ile883Met 26243156:140:60
status: NEW
Login to comment

142 However, overweight/obese subjects with AA-R219K had significantly higher levels of TC, LDL-c, and TC/HDL-c ratio, and lower HDL-c compared with non-carriers, while GG-I883M carriers had decreased levels of TC, HDL-c and LDL-c levels compared with those with other genotypes (p \ 0.05) (Table 3 and electronic supplementary Fig. 7).
X
ABCA1 p.Ile883Met 26243156:142:168
status: NEW
Login to comment

148 To the best of our knowledge, there are no published data on the screening of the ABCA1 R219K and I883M polymorphisms in association with obesity and lipid profile among the Egyptian population.
X
ABCA1 p.Ile883Met 26243156:148:98
status: NEW
Login to comment

153 In silico data analysis predicted our cSNPs (R219K and I883M) to be functionally neutral using the PolyPhen and MutPred web-based programs.
X
ABCA1 p.Ile883Met 26243156:153:55
status: NEW
Login to comment

155 In our study population, the R219K variant showed increased risk of developing obesity among GA heterozygote carriers, especially in children and females, whereas in I883M SNP analysis, carriers of the M allele (GA and GG genotypes) displayed reduced susceptibility to obesity in children and adolescents and in both genders compared with those with the AA genotype (I allele).
X
ABCA1 p.Ile883Met 26243156:155:166
status: NEW
Login to comment

157 AA 107 (83.6) 118 (92.2) 2.31 (1.04-5.13) 2.10 (0.85-5.07) HWE-P 0.116 0.059 Alleles G 93 (36.3) 87 (34) 0.308 0.578 Reference Reference A 163 (63.7) 169 (66) 1.10 (0.77-1.59) 0.85 (0.52-1.38) I883M (A/G) Genotypes AA 37 (28.9) 66 (51.6) 14.72 <0.001 Reference Reference AG 70 (54.7) 52 (40.6) 0.41 (0.24-0.71) 0.38 (0.21-0.64) GG 21 (16.4) 10 (7.8) 0.26 (0.11-0.62) 0.24 (0.09-0.54) AG ?
X
ABCA1 p.Ile883Met 26243156:157:193
status: NEW
Login to comment

158 GG 91 (71.1) 62 (48.4) 0.38 (0.22-0.63) 0.37 (0.20-0.58) HWE-P 0.208 0.956 Alleles A 144 (56.2) 184 (71.9) 13.57 <0.001 Reference Reference G 112 (43.8) 72 (28.1) 0.50 (0.34-0.72) 0.49 (0.31-0.77) Data are expressed as n (%) Bold values indicate statistically significant at p \ 0.05 ABCA1 ATP-binding cassette transporter A1, OW/OB overweight/obese group, R219K c.656G[A, I883M c.2649A[G, adjusted OR (95 % CI) odds ratio for confidence interval adjusted for confounding variables (age, gender, degree of obesity, and dyslipidemia) Fig. 5 Linkage disequilibrium between R219K and I883M.
X
ABCA1 p.Ile883Met 26243156:158:373
status: NEW
X
ABCA1 p.Ile883Met 26243156:158:581
status: NEW
Login to comment

159 Experimentally-tested SNPs in ABCA1 gene: I883M (rs2066714) and R219K (rs2230806) are noted.
X
ABCA1 p.Ile883Met 26243156:159:42
status: NEW
Login to comment

168 Brunham et al. found I883M to cause modest reduction of cholesterol efflux and significant suppression of ABCA1 protein expression by 70 % in the wild-type allele [52].
X
ABCA1 p.Ile883Met 26243156:168:21
status: NEW
Login to comment

175 Intracellular ABCA1 domains could interact and hydrolyze ATP, generating energy for Table 3 Anthropometric measurements and lipid profile in overweight/obese subjects according to R219K and I883M genotypesa R219K (G/A) genotypes p value I883M (A/G) genotypes p value GG (n = 10) GA (n = 67) AA (n = 51) AA (n = 66) AG (n = 52) GG (n = 10) Age, years 11.3 &#b1; 3.1 12.5 &#b1; 3.8 12.5 &#b1; 3.5 0.61 12.9 &#b1; 3.3 12.1 &#b1; 3.6 14.8 &#b1; 2.5 0.05 Anthropometric data BMI, kg/m2 29.8 &#b1; 2.7 33.6 &#b1; 6.7 35.6 &#b1; 7.0b 0.03b 34.7 &#b1; 6.3 33.7 &#b1; 6.4 33.7 &#b1; 5.4 0.67 WHR 0.84 &#b1; 0.1 0.86 &#b1; 0.1 0.89 &#b1; 0.1 0.17 0.88 &#b1; 0.1 0.87 &#b1; 0.1 0.89 &#b1; 0.1 0.84 WHtR 0.63 &#b1; 0.1 0.64 &#b1; 0.1 0.68 &#b1; 0.2 0.30 0.70 &#b1; 0.2 0.66 &#b1; 0.1 0.68 &#b1; 0.2 0.43 Lipid profile TC, mg/dl 196.0 &#b1; 70.4 221.0 &#b1; 38.0 235.9 &#b1; 38.6b 0.02b 209.4 &#b1; 44.7 232.9 &#b1; 35.5b 166.0 &#b1; 38.4c <0.001b TG, mg/dl 74.7 &#b1; 18.2 92.9 &#b1; 30.4 99.8 &#b1; 34.4 0.07 94.1 &#b1; 35.6 96.6 &#b1; 30.2 100.0 &#b1; 33.0 0.84 HDL-c, mg/dl 67.0 &#b1;26.9 67.9 &#b1; 20.5 57.5 &#b1; 19.9c 0.03b 56.5 &#b1;18.0 69.4 &#b1; 19.6b 39.7 &#b1; 9.6b,c <0.001b LDL-c, mg/dl 114.0 &#b1; 43.0 132.2 &#b1; 30.6 158.0 &#b1; 37.2b,c <0.001b 134.2 &#b1; 39.8 140.9 &#b1; 31.6 106.7 &#b1; 25.6b,c 0.02b Values are expressed as mean &#b1; SD or n (%) Comparisons between genotypes of each polymorphism were performed by one-way ANOVA followed by Newman-Keuls multiple comparisons test Bold values indicate statistically significant at p \ 0.05 BMI body mass index, WHR waist/hip ratio, WHtR waist/height ratio, TC total cholesterol, TG triglycerides, HDL-c high-density lipoprotein cholesterol, LDL-c low-density lipoprotein cholesterol, ANOVA analysis of variance a Age and sex were used as covariates in the analysis to adjust for the genotyping effect.
X
ABCA1 p.Ile883Met 26243156:175:190
status: NEW
X
ABCA1 p.Ile883Met 26243156:175:237
status: NEW
Login to comment

176 Degree of obesity was classified according to the BMI z score b Indicates significant difference from homozygous carriers of the wild allele in the same group at p \ 0.05 c Indicates significant difference from heterozygous carriers in the same group at p \ 0.05 0% 20% 40% 60% 80% 100% OW OB1 OB2 Degree of obesity R219K genotype GG (n=10) GA (n=67) AA (n=51) p<0.001* 0% 20% 40% 60% 80% 100% OW OB1 OB2 Degree of obesity I883M genotype AA (n=66) AG (n=52) GG (n=10) p=0.098 (b) (a) Fig. 6 Genotype frequencies according to the degree of obesity.
X
ABCA1 p.Ile883Met 26243156:176:423
status: NEW
Login to comment

190 On the other hand, no association of I883M SNP was observed with the degree or distribution of obesity, independent of age, gender, and pubertal status.
X
ABCA1 p.Ile883Met 26243156:190:37
status: NEW
Login to comment

199 However, GG-I883M carriers had significantly lower levels of TC, HDL-c, and LDL-c when compared with other corresponding carriers of similar age and sex.
X
ABCA1 p.Ile883Met 26243156:199:12
status: NEW
Login to comment

200 There was no association between I883M genotypes and the ratio of lipid parameters associated with cardiometabolic burden.
X
ABCA1 p.Ile883Met 26243156:200:33
status: NEW
Login to comment

209 In obesity, the K allele of the R219K polymorphism was also associated with lower HDL-c levels than controls among overweight/ obese Thai males, with no difference in HDL-c concentrations among genotypes of I883M polymorphism [10].
X
ABCA1 p.Ile883Met 26243156:209:207
status: NEW
Login to comment

220 Moreover, in the ABCA1 gene, a strong linkage disequilibrium exists between R219K/V771M and M825I/I883M (D0 [ 0.9) [21].
X
ABCA1 p.Ile883Met 26243156:220:98
status: NEW
Login to comment

221 The two SNPs (V771M and M825I) were previously found to be associated with increased plasma HDL-c and cholesterol concentration, respectively, thus speculating the probability that R219K and I883M may not be the true associated variants, but could instead reflect the functional impact of other nearby linked gene polymorphisms.
X
ABCA1 p.Ile883Met 26243156:221:191
status: NEW
Login to comment

228 5 Conclusions The present study suggested that the R219K (rs2230806) polymorphism of the ABCA1 gene is associated with higher susceptibility to obesity and unfavorable outcome in the Egyptian population, while I883M (rs2066714) polymorphism is associated with a reduced risk of obesity in childhood and adolescence.
X
ABCA1 p.Ile883Met 26243156:228:210
status: NEW
Login to comment