ABCMdb

ABCB1 p.Gly1249Ala

None has been submitted yet.

Publications

PMID: 16791115 [PubMed] Anderson PL et al: "Pharmacogenetic characteristics of indinavir, zidovudine, and lamivudine therapy in HIV-infected adults: a pilot study."

No. Sentence Comment

46 ABCC2 (MRP2) IDV pharmacokinetics j24 C/T Theoretical altered promoter function with -24 C/T G1249A G1249A associated with saquinavir plasma concentrations in one abstract ABCC4 (MRP4) ZDV-triphosphate and 3TC-triphosphate pharmacokinetics and pharmacodynamics C1612T, G3463A, G3724A, T4131G All SNPs have relatively high probability of altered mRNA splicing and potentially altered MRP4 protein expression based on exonic splicing enhancer analyses for SRp40, SF35, SF2/ASF, and SRp5 proteins. Login to comment
163 IDV is a substrate of MRP2, which lines the bile cannicular cells and the gut epithelia, with the potential consequence of limiting drug absorption and speeding drug elimination.19,20 Genetic variability in MRP2 has been identified, but the influence of common SNPs (frequencies 910%) on protein function is not clear.21 One study of 34 HIV-infected patients treated with other HIV protease inhibitors (saquinavir and lopinavir/ ritonavir) described 3-fold higher saquinavir concentrations in patients with the MRP2 G1249A GG genotype compared with variant carriers (P = 0.009).22 In the present study, MRP2 G1249A variant carrier status was not related with the pharmacokinetics or pharmacodynamics of IDV, whereas variant carrier status at MRP2 C-24T was associated with faster IDV CL/F after adjusting for African American race. Login to comment

PMID: 17597651 [PubMed] Atkinson DE et al: "Antiepileptic medication during pregnancy: does fetal genotype affect outcome?"

No. Sentence Comment

185 Meyer zu Schwabedissen et al. (49) demonstrated that the G1249A polymorphism resulted in a significant decrease in placental MRP2 mRNA expression in preterm placentas. Login to comment

PMID: 19167193 [PubMed] Kim DW et al: "Lack of association between ABCB1, ABCG2, and ABCC2 genetic polymorphisms and multidrug resistance in partial epilepsy."

No. Sentence Comment

70 We studied G1249A polymorphism because this polymorphism was strongly associated with higher activity of transporter function (Haenisch et al., 2008). Login to comment
88 Recent studies have failed to show significant interactions between BCRP protein and several AEDs (Cerveny et al., 2006), and association between the drug-resistant epilepsy and variations of ABCC2 gene including G1249A polymorphism (Seo et al., 2008). Login to comment

PMID: 19200005 [PubMed] Porcelli L et al: "Intracellular trafficking of MDR transporters and relevance of SNPs."

No. Sentence Comment

259 [122] studied the expression and cellular localization of the wild-type and three reported SNP variants of ABCC2 (G1249A (V417I), C2366T (S789F) and G4348A (A1450T)) in LLC-PK1 cells. Login to comment

PMID: 19788499 [PubMed] Vahakangas K et al: "Drug transporters in the human blood-placental barrier."

No. Sentence Comment

99 Table 4 Significance of drug transporter polymorphisms in human placenta Protein Gene polymorphisms Type of study Significance in placenta Reference P-gp/MDR1 G2677A/T (Ala toThr/Ser) T-129C 100 human placentas Less P-gp protein Less P-gp protein 1 P-gp/MDR1 G2677T/A C3435T 73 human placentas from Caucasians No effect on MDR1 mRNA Homozygosity of 3435T and 2677T lead to lower protein levels 2 P-gp/MDR1 C3435T 44 human placentas T allele associated with a higher expression 3 P-gp/MDR1 C3435T and G2677A/T Human placental perfusion No effect on saquinavir transfer 3, 4 P-gp/MDR1 C3435T Human placental perfusion 3435T associated with increased transfer of quetiapine 5 MRP2 G1249A 58 human placentas Reduced expression of MRP2 mRNA in preterm placentas only 6 BCRP G34A (Val12Met) C421A (Gln141Lys) 99 human placentas No effect on protein level Protein decreased 7 References: (1) Tanabe et al. (2001), (2) Hitzl et al. (2004), (3) Rahi et al. (2008), (4) Mölsä et al. (2005), (5) Rahi et al. (2007), (6) Meyer zu Schwabedissen et al. (2005b), (7) Kobayashi et al. (2005). Login to comment
181 Genetic polymorphisms of ABCC2/MRP2 have been found and at least one of them (G1249A) results in lower ABCC2/MRP2 expression. Login to comment

PMID: 11266082 [PubMed] Ito S et al: "Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects."

No. Sentence Comment

37 Four were associated with an amino acid substitution; G to A transversion at position 1249 (G1249A, Val to Ile at codon 417) in exon 10, C to T at 2302 (C2302T, Arg to Trp at 768) and C to T at 2366 (C2366T, Ser to Phe at 789) in exon 18, and G to A at 4348 (G4348A, Ala to Thr at 1450) in exon 31 (position numbering: Taniguchi et al., 1996; Toh et al., 1999) (Fig. 3). Login to comment
39 The allele frequencies of G1249A, C2302T, C2366T, G4348A and C-24T were 0.125, 0.01, 0.01, 0.01 and 0.188, respectively. Login to comment
81 In the MRP2/cMOAT gene, four missense mutations, G1249A, C2302T, C2366T and G4348A, were observed. Login to comment

PMID: 12392094 [PubMed] Moriya Y et al: "Effects of polymorphisms of MDR1, MRP1, and MRP2 genes on their mRNA expression levels in duodenal enterocytes of healthy Japanese subjects."

No. Sentence Comment

0 The small intestine is the primary site of absorption for many drugs administered orally, and P-glycoprotein (MDR1) located in the villus epithelium of the small intestine is considered to play a role in limiting the absorption of xenobiotics.1,2) The extrusive function of the multidrug resistance-associated proteins (MRPs) have also attracted a great deal of attention in the small intestine.3) MDR1, MRP1 and MRP2 have been reported to show genetic polymorphisms,4-8) and their genotypes are thought to be responsible for the inter-individual differences in absorption properties of the drugs that are their substrates.6,9,10) Kim et al. reported that plasma concentration of fexofenadine after single oral administration was lower in subjects homozygous for the mutant allele at exon 26, position 3435 of the MDR1 gene (T/T3435 ), than in those homozygous for the wild-type allele (C/C3435 ).9) We also demonstrated that systemic exposure to digoxin after single oral administration was lower in subjects with the mutation C3435T of the MDR1 gene.10) C3435T is a silent mutation without amino acid substitution, and its effects on phenotype have been discussed from the viewpoint of changes in the level of expression rather than changes in the function of MDR1.6,11) Thus, in the present study, the effects of the MDR1 genotypes of T-129C, G2677(A,T) and C3435T, MRP1 genotypes of G128C, C218T, G2168A and G3173A, and MRP2 genotypes of C-24T, G1249A, C2302T, C2366T and G4348A on their mRNA expression levels were examined in human duodenal enterocytes obtained from 13 healthy male Japanese subjects. Login to comment
14 MDR1 genotypes of T-129C, G2677(A,T) and C3435T, MRP1 genotypes of G128C, C218T, G2168A and G3173A, and MRP2 genotypes of C-24T, G1249A, C2302T, C2366T and G4348A were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) or direct sequencing. Login to comment
28 MDR1, MRP1 and MRP2 Genotyping Genomic DNA was extracted by the method described previously.10) In the present study, the mutation T-129C in the promoter region, 1 missence mutation (G2677(A,T)) and 1 silent mutation (C3435T) in the MDR1 gene, 4 missense mutations (G128C, C218T, G2168A and G3173A) in the MRP1 gene and 4 missense mutations (G1249A, C2302T, C2366T and G4348A) and the mutation C-24T in the 5Ј-flankling region in the MRP2 gene were examined. Login to comment
53 Among the mutations C-24T, G1249A, C2302T, C2366T and G4348A in the MRP2 gene, only C-24T was detected in the 13 subjects in the present study, and 61% (8/13) were homozygous for the wild-type allele (C/C-24 ), 31% (4/13) were compound heterozygotes (C/T-24 ), and only one subject (1/13, 8%) was homozygous for the mutant allele (T/T-24 ) (Table 1). Login to comment

PMID: 16821592 [PubMed] Obata H et al: "Association between single nucleotide polymorphisms of drug resistance-associated genes and response to chemotherapy in advanced ovarian cancer."

No. Sentence Comment

84 Gene Nucleic acid Amino acid Allele frequencies Allele frequencies location change substitution (major alleles) (major alleles) in this study in other subject* MDR1 Promotor 1 T/C - 0.908 - Promotor 2 A-41aG - 0.883 0.927 exon-12 T1236C Gly412Gly 0.633 0.615 exon-26 G/A IIe1144IIe 0.500 - exon-28 A/G - 0.742 - MRP1 exon-8 T825C Val275Val 0.600 0.625 exon-9 T1062C Asn354Asn 0.567 0.646 exon-13 T1684C Leu562Leu 0.750 0.802 exon-16 C2007T Pro669Pro 0.950 0.917 exon-17 G2168A Arg723Gln 0.917 0.927 exon-28 G4002A Ser1334Ser 0.883 0.844 MRP2 Promotor C-24T - 0.867 - exon-10 G1249A Val417IIe 0.925 0.875 exon-28 C3972T IIe1324IIe 0.758 0.781 *Ito S. et al. Login to comment

PMID: 12357145 [PubMed] Lotsch J et al: "Does the A118G polymorphism at the mu-opioid receptor gene protect against morphine-6-glucuronide toxicity?"

No. Sentence Comment

106 33 T/T T/T MDR1 2 A61G Asn21Asp 11.2 20.6 9 A/G A/G Forward: 5Ј-AGG AGC AAA GAA GAA GAA CTT TTT TAA ACT GAT C-3Ј 9.3 17.6 8 Reverse: 5Ј-GAT TCC AAA GGC TAG CTT GC-3Ј 5 T307C Phe103Leu 0.6 1.2 9 T/T T/T Forward: 5Ј-GTG GTT GCA CAC AGT CAG CA-3Ј Reverse: 5Ј-GGA GGA TGT CTA ATT ACC TGG TCA-3Ј 11 G1199A Ser400Asn 5.5 11.1 9 G/G G/G Forward: 5Ј-CAG CTA TTC GAA GAG TGG GC-3Ј 6.5 12.9 8 Reverse: 5Ј-CCG TGA GAA AAA AAC TTC AAG G-3Ј 21 G2677T Ala893Ser 41.6 49.2 9 T/T T/T Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј 63.9 43.4 8 Reverse: 5Ј-GTT TGA CTC ACC TTC CCA G-3Ј 21 G2677A Ala893Thr 0.9 2 9 NA NA Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј Reverse: 5Ј-TTT AGT TTG ACT CAC CTT CCC G-3Ј 26 A3320C Gln1107Pro 0.2 0.4 9 A/A A/A 26 C3396T Ala1132Ala 0.3 0.5 8 C/C C/C Forward: 5Ј-ATC TGT GAA CTC TTG TTT TCA GC-3Ј 26 C3435T Ile1145Ile 50.3 47.7 8 T/T T/T Reverse: 5Ј-TCG ATG AAG GCA TGT ATG TTG-3Ј 53.9 50.5 9 - - MRP2 10 G1249A Val417Ile 12.5 20.8 34 G/G G/G Forward: 5Ј-GGG TCC TAA TTT CAA TCC TTA-3Ј Reverse: 5Ј-TAT TCT TCT GGG TGA CTT TTT-3Ј 18 C2302T Arg768Trp 1 2.1 34 C/C C/C Forward: 5Ј-GGA GTA GTG CTT AAT ATG AAT-3Ј 18 C2366T Ser789Phe 1 2.1 34 C/C C/C Reverse: 5Ј-CCC ACC CCA CCT TTA TAT CTT-3Ј 28 C3972T Ile132Ile 21.9 35.4 34 C/T C/T Forward: 5Ј-TGC TAC CCT TCT CCT GTT CTA-3Ј Reverse: 5Ј-ATC CAG GCC TTC CTT CAC TCC-3Ј 31 G4348A Ala1450Thr 1 2.1 34 G/G G/G Forward: 5Ј-AGG AGC TAA CAC ATG GTT GCT-3Ј Reverse: 5Ј-GGG TTA AGC CAT CCG TGT CAA-3Ј † Sequence is not translated. Login to comment

PMID: 14598019 [PubMed] Gerloff T et al: "Impact of genetic polymorphisms in transmembrane carrier-systems on drug and xenobiotic distribution."

No. Sentence Comment

145 Frequently occurring SNPs were C24T (18.8%) of the promoter region and the two exonic SNPs G1249A (12.5%, exon 10) and C3972T (21.9%, exon 28). Login to comment

PMID: 15001973 [PubMed] Giessmann T et al: "CYP2D6 genotype and induction of intestinal drug transporters by rifampin predict presystemic clearance of carvedilol in healthy subjects."

No. Sentence Comment

30 Genotyping of the MRP2 gene identified 9 subjects with CC and 3 with CT of the promoter variant C-24T, 7 subjects with GG and 5 with GA of G1249A, and 6 subjects with CC and 6 with CT of C3972T. Login to comment
58 CYP2D6 was genotyped for the major deficient alleles in white subjects, *3 (2549AϾdel frameshift mutation), *4 (1846GϾA splice-site mutation), *5 (gene deletion), and *6 (1707TϾdel frameshift mutation), as well as for gene duplications (*1xN, *2xN), and MDR1 was genotyped for G2677T/A and C3435T.19-21 MRP2 genotypes C-24T in the promoter region, G1249A in exon 10, and C3972T in exon 28 were determined by use of polymerase chain reaction-based restriction fragment length polymorphism assays by use of BbsI for distinction of C-24T and mismatch primers for G1249A and C3972T, introducing an AclI or BsrDI site in the presence of the mutation. Login to comment
94 The basal expression of P-gp and MRP2 (mRNA and protein levels) in our small number of subjects was not dependent on G2677T/A and C3435T of MDR1 and C-24T, G1249A, and C3972T of the MRP2 gene. Login to comment

PMID: 16013981 [PubMed] Soranzo N et al: "The role of common variation in drug transporter genes in refractory epilepsy."

No. Sentence Comment

104 Individuals heterozygous at the MRP2 exon 10 G1249A site had higher expression compared with GG homozygotes in DNTs (6.12-fold, p < 0.05) and in PT (2.69-fold, not significant). Login to comment

PMID: 16107775 [PubMed] Nishioka C et al: "MDR1, MRP1 and MRP2 genotypes and in vitro chemosensitivity in Japanese patients with colorectal adenocarcinomas."

No. Sentence Comment

4 In this study, 3 genotypes of MDR1, 4 genotypes of MRP1, and 6 genotypes of MRP2 were additionally evaluated, and it was suggested that MDR1 C3435T and MRP2 G1249A were related with the susceptibility to colorectal adenocarcinoma. Login to comment
19 In the present study, the distributions of MDR1 genotypes of T-129C, G2677(A,T) and C3435T, MRP1 genotypes of G128C, C218T, G2168A and G3173A, and MRP2 genotypes of C-24T, G1249A, C2302T, C2366T, C3972T and G4348A were evaluated in Japanese patients with primary colorectal adenocarcinoma, and their effects on the chemosensitivity against 5-FU, SN-38, MMC and CDDP, and also on the growth rate of tumor and mRNA expression levels of MDR1, MRP1 and MRP2 in the adenocarcinoma were examined for future individualization of cancer chemotherapy based on the genotyping of these transporters. Login to comment
37 The polymorphism of T-129C in the promoter region, a missense polymorphism of G2677(A,T), and a silent polymorphism of C3435T in the MDR1 gene, 4 missense polymorphisms of G128C, C218T, G2168A and G3173A in the MRP1 gene, and a polymorphism of C-24T in the 5`-flanking region, 4 missense polymorphisms of G1249A, C2302T, C2366T and G4348A, and a silent polymorphism of C3972T in the MRP2 gene were evaluated by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), and confirmed by direct sequencing. Login to comment
46 Compared with the healthy subjects, T-allele at C3435T of MDR1 was more frequently found in patients with colorectal adenocarcinoma, whereas A-allele at G1249A of MRP2 was found less frequently, although this is from a small number of patients with insufficient statistical power. Login to comment
51 MDR1, MRP1 and MRP2 genotypes in 13 Japanese patients with colorectal adenocarcinomas Genotype Allele Position w/w w/m m/m w m MDR1 T-129C 11 2 0 24 2 G2677(A,T) 3 6 4 12 14 C3435T 3 6 4 12 14 MRP1 G128C 13 0 0 26 0 C218T 13 0 0 26 0 G2168A 10 3 0 23 3 G3173A 13 0 0 26 0 MRP2 C-24T 7 4 2 18 8 G1249A 12 1 0 25 1 C2302T 13 0 0 26 0 C2366T 13 0 0 26 0 C3972T 7 4 2 18 8 G4348A 13 0 0 26 0 The symbols "w" and "m" mean the polymorphisms with higher and lower frequency of allele, respectively. Login to comment
66 In conclusion, MDR1 genotypes of T-129C, G2677(A,T) and C3435T, MRP1 genotypes of G128C, C218T, G2168A and G3173A, and MRP2 genotypes of C-24T, G1249A, C2302T, C2366T, C3972T and G4348A were evaluated in the Japanese patients with primary colorectal adenocarcinoma, and it was suggested that MDR1 C3435T and MRP2 G1249A were related with the susceptibility to colorectal adenocarcinoma. Login to comment

PMID: 16142999 [PubMed] Biason P et al: "Sarcomas and pharmacogenetics."

No. Sentence Comment

56 Gene Polymorphism Molecular effect of polymorphism Drug Effect on chemotherapy Ref. Phase I enzymes CYP2B6 CYP2B6*5 (C1459 T) Decreased enzyme expression Increased activity CPA Increased drug bioactivation [24] CYP2B6*6 (G516T, A785G) [28] CYP2B6*7 (G516T, A785G, C1459T) [24] CYP2C9 CYP2C9*2 (C430T) Decreased enzyme activity CPA Decreased drug bioactivation [31]CYP2C9*3 (A1075C) CYP2C19 CYP2C19*2 (G108620C) Lack of enzyme activity CPA No data available CYP3A4 CYP3A4*1B (A290G) Decreased mRNA expression CPA No data available [39,42] CYP3A5 CYP3A5*3 (A6986G) Lack of enzyme activity CPA No data available [42] CYP3A5*6 (G14690A) CYP2C8 CYP2C8*2 (A805T) Reduced protein activity Paclitaxel Reduced clearance of drug [44]CYP2C8*3 (G416A, A1196G) Reduced protein activity Paclitaxel Defective metabolism Phase II enzymes GST GSTA1*B (C-69T) Reduced enzyme activity CPA Increased survival [46] GSTM1 (null genotype) Complete absence of protein DOX CPA Poorer survival No impact in STS survival [47] [52] GSTT1 (null genotype) Complete absence of protein DOX CPA Increased response No impact in STS survival [49] [52] GSTP1 (A313G) Decreased enzyme activity DOX CPA Cisplatin Longer survival [53] Transporter MDR1 C3435T Decreased protein expression DOX MTX Better clinical response [59] MRP2 C24T Alteration in protein expression MTX Cisplatin No data available [63] G1249A RFC G80A Decreased affinity for MTX MTX Poorer response No correlation with toxicity [68,70] Intracellular target DHFR T91C Increased enzyme activity MTX Resistance to drug [72] MTHFR C677T Reduced enzyme activity MTX Higher toxicity [77] TYMS TSER (*3/*3 repeats) Increased mRNA expression MTX Necessity of higher dose of MTX [75] CPA: Cyclophosphamide; CYP: Cytochrome P450; DHFR: Dihydrofolate reductase; DOX: Doxorubicin; ERCC1: Excision repair cross-complementing rodent repair deficiency, complementation group 1; ET-743: Ecteinascidin-743; GST: Glutathione S-transferase; MDR: Multidrug resistance; MTHFR: Methylenetetrahydrofolate reductase; MTX: Methotrexate; RFC: Replication factor C; TYMS: Thymidylate synthetase; XPD: Xeroderma pigmentosum group D; XRCC1: X-ray repair complementing defective repair in Chinese hamster cells 1. Login to comment
143 Among these, two SNPs are mainly responsive to alterations in protein expression: C24T (promoter region) and G1249A (exon 10) [62]. Login to comment
235 Genetic analyses for MTX response are usually performed in transporter enzymes (RFC G80A, MRP C24T and G1249A) or in target enzymes (DHFR T91C, TSER and MTHFR C677T). Login to comment

PMID: 16370938 [PubMed] Dey S et al: "Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition."

No. Sentence Comment

179 Among them, C24T (promoter region), G1249A (exon 10) and C3972T (exon 28) are most frequently observed [80]. Login to comment
180 The SNP associated with G1249A also changes the amino acid residue from Val to Ile (Val417Ile); however, C3972T is a 'silent mutation` with no change in amino acid sequence. Login to comment

PMID: 16788565 [PubMed] Haenisch S et al: "Influence of polymorphisms of ABCB1 and ABCC2 on mRNA and protein expression in normal and cancerous kidney cortex."

No. Sentence Comment

52 The wild-type (ABCC2-C) and the variant (ABCC2-T) fragment were ligated into the pGL3 basic vector (Promega, Mannheim, Germany) being in-frame of the translation Table 1 Primers and restriction endonucleases used for genotyping of novel ABCB1 (MDR1) and ABCC2 (MRP2) variants and primers and fluorescent probes used for cDNA real-time quantification Gene SNP Name of primer Primer sequence Restriction enzyme Fragment length (bp) mut/wt ABCB1 T-692C MDR1-692f 50 -CTA GAG AGG TGC AAC GGA AAG MspA1I 32 117 208 MDR1-692r 50 -TAG TAG CTC CCA GCT TTG CG 117 240 G-2352A MDR1-2352f 50 -TTT ACC TGA TGC TCA AGA TTG TAG MboI 179 MDR1 -2352r* 50 - TCA CTT TTG TTT TGC TTT GTT GCT TGA T 144 35 ABCB1 mdr1 forward 50 -TTC GCA ACC CCA AGA TCC TC mdr1 reverse 50 -ACA ATG GTG GTC CGA CCT TT Probe 50 -6FAM-ATC CAG AGC CAC CTG AAC CAC TGC T XT p ABCC2 C-24T MRP2-Pro 50 -TAA ATG GTT GGG ATG AAA GG BbsI 301 MRP2-ProR2 50 -GCT TTA GAC CAA TTG CAC ATC 188 113 G1249A MRP2-10* 50 -AAC TTG GCC AGG AAG GAG TAC AAC AclI 260 MRP2-10R 50 -CTG GGT GAC TTT TTC TTT ACC TGA ATG 236 24 C3972T MRP2-28 50 -AAC TTA CTT CTC ATC TTG TCT CCT TGC BsrDI 156 28 MRP2-28R* 50 -CTC CAC CTA CCT TCT CCA TGC TAG 184 ABCC2 mrp2 forward 50 -CTG GGA ACA TGA TTC GGA AGC mrp2 reverse 50 -GAG GAT TTC CCA GAG CCG AC Probe 50 -6FAM-CAG TCC GAG ATG TGA ACC TGG ACA T XT p Abbreviations: MDR1, multidrug resistance protein 1; MRP2, multidrug resistance-associated protein. Login to comment
103 The difference, however, was statistically not significant (P ¼ 0.134), but there were increased mRNA expression levels among ABCB1 H1/H4 (P ¼ 0.044) and ABCB1 H2/H4 (P ¼ 0.01) (Mann-Whitney Table 2 Allele frequencies and frequencies of genotypes in 82 patients and in 164 controls Location Allele Allele frequency Genotype Frequency of genotypes Odds ratio P-value RCC Controls RCC controls 95% CI MDR1 G 99.4 99.1 GG 98.8 98.2 0.66 (0.03-7.29) 0.72 G-2352A A 0.6 0.9 GA 1.2 1.8 AA 0.0 0.0 T-692C T 98.0 97.0 TT 96.3 93.3 0.53 (0.11-2.12) 0.33 C 2.0 3.0 TC 3.7 6.7 CC 0.0 0.0 G2677T/A G 58.5 54.3 GG 35.4 32.3 0.87 (0.48-1.59) 0.63 T 39.6 43.6 GT 42.7 41.5 A 1.8 2.1 TT 18.3 22.0 GA 3.7 2.4 TA 0.0 1.8 AA 0.0 0.0 C3435T C 42.7 46.3 CC 18.3 22.6 1.3 (0.64-2.69) 0.44 T 57.3 53.7 CT 48.8 47.6 TT 32.9 29.9 MRP2 C 78 81.4 CC 64.6 68.9 1.21 (0.67-2.20) 0.50 C-24T T 22 18.6 CT 26.8 25.0 TT 8.5 6.1 G1249A G 83.5 77.8 GG 67.1 61.6 0.79 (0.43-1.43) 0.40 A 16.5 22.2 GA 32.9 32.3 AA 0.0 6.1 C3972T C 62.8 69.2 CC 41.5 51.2 1.48 (0.84-2.62) 0.15 T 37.2 30.8 CT 42.7 36.0 TT 15.9 12.8 Abbreviations: MDR1, multidrug resistance protein 1; MRP2, multidrug resistance-associated protein; RCC, renal cell carcinoma. Login to comment
121 Table 3 Frequencies of ABCB1 and ABCC2 haplotypes in RCC patients and controls estimated with the EH program26 ABCB1 haplotype G2677T/ A C3435T Frequency RCC Controls 1 G C 40.9 38.8 2 G T 17.7 15.5 3 T C 0.0 6.1 4 T T 39.6 37.5 5 A C 1.8 1.5 6 A T 0.0 0.6 w2 ¼ 11.63, d.f. ¼ 5, P ¼ 0.04 ABCC2 haplotype C-24T G1249A C3972T Frequency RCC Controls 1 C G C 45.8 47.0 2 T G C 0.0 1.4 3 C A C 16.4 20.8 4 T A C 0.0 0.0 5 C G T 15.8 12.2 6 T G T 22.0 17.2 7 C A T 0.0 1.4 8 T A T 0.0 0.0 w2 ¼ 8.55, d.f. ¼ 5, P ¼ 0.128 Twelve square w2 test was conducted to compare differences between haplotype frequencies of RCC and controls. Login to comment

PMID: 17001288 [PubMed] Owen A et al: "Pharmacogenetics of HIV therapy."

No. Sentence Comment

171 Pharmacogenetics of HIV therapy Owen et al. 699 Table 1 Polymorphisms that have been studied within the context of metabolism, transport and toxicity (but not progression and response) along with the reference ID (where available), the genotypic consequence and the observed phenotype for antiretroviral drugs Gene SNP (haplotype) Reference SNP Genotypic consequence Phenotypic consequence Confirmation CYP3A4 A - 392G (CYP3A4*1B) rs2740574 Promoter; altered expression No effect on nelfinavir or efavirenz Yes for nelfinavir; controversial for efavirenz T878C (CYP3A4*18) rs4986909 L293P; altered activity No effect on efavirenz No CYP3A5 A6986G (CYP3A5*3) rs776746 Splice defect No effect on nelfinavir, saquinavir or efavirenz AUC but altered urinary metabolic ratio of saquinavir Yes for efavirenz G14690A (CYP3A5*6) rs10264272 Splice defect No effect on nelfinavir or efavirenz Yes CYP2C19 G681A (CYP2C19*2) rs4244285 Truncated protein Higher nelfinavir AUC and trend toward decreased virological failure; no effect on efavirenz Yes for efavirenz; controversial for nelfinavir CYP2D6 A2549del (CYP2D6*3) NT21914757 Frameshift Trend to higher plasma levels of nelfinavir and efavirenz No G1846A (CYP2D6*4) rs3892097 Splice defect Trend to higher plasma levels of nelfinavir and efavirenz No T1707del (CYP2D6*6) rs5030655 Frameshift Higher plasma nelfinavir concentrations No CYP2B6 G516 T (CYP2B6*6, *7, *9, *13, *19 and *20) rs3745274 Q172H Higher plasma and intracellular efavirenz AUCs and increased neurotoxicity Yes, numerous studies C1459T (CYP2B6*5 and *7) rs3211371 R487C No effect on nelfinavir or efavirenz No ABCB1 IVS1 - 80delG rs3214119 N/A No influence on cellular nelfinavir No A61G rs9282564 N21D No influence on cellular nelfinavir No TAG1 rs3789243 N/A No influence on cellular nelfinavir No G1199A rs2229109 S400N No influence on cellular nelfinavir No TAG5 rs1128503 N/A No influence on cellular nelfinavir No TAG6 rs2235046 N/A No influence on cellular nelfinavir No IVS21 + T49C rs2032583 N/A No influence on cellular nelfinavir No C3435T rs1045642 Synonymous Some evidence of an influence on plasma and intracellular nelfinavir; decreased efavirenz plasma concentrations; currently under debate; increase in HDL cholesterol with efavirenz Controversial G2677T rs2032582 Ala893Ser No effect on efavirenz, ritonavir, nelfinavir, indinavir or viral decay and CD4 count Yes IVS26 + T59G rs2235047 N/A No influence on cellular nelfinavir No IVS26 + T80C rs2235048 N/A Increased intracellular nelfinavir concentrations No TAG11 rs1186746 N/A No influence on cellular nelfinavir No TAG12 rs1186745 N/A No influence on cellular nelfinavir No ABCC1 G816A P272P No influence on cellular nelfinavir No T825C rs246221 V275V No influence on cellular nelfinavir No T1062C rs35587 Synonymous No influence on cellular nelfinavir No IVS9 + A8G rs35588 N/A No influence on cellular nelfinavir No IVS10 + C64T N/A No influence on cellular nelfinavir No ABCC2 C - 24T rs717620 N/A No influence on cellular nelfinavir No G1249A rs2273697 V417I No influence on cellular nelfinavir No C1436G Synonymous No influence on cellular nelfinavir No IVS16 - G47A N/A No influence on cellular nelfinavir No T3563A rs8187694 V1188E No influence on cellular nelfinavir No C4488T rs8187707 Synonymous No influence on cellular nelfinavir No IVS31 + G12A rs8187708 N/A No influence on cellular nelfinavir No IVS31 + C74T N/A No influence on cellular nelfinavir No G4544A rs8187710 C1515Y No influence on cellular nelfinavir No G + 259T N/A No influence on cellular nelfinavir No ABCG2 - 19571_ - 19568delT- CAC rs4148162 Deletion No influence on cellular nelfinavir No A-19541G N/A No influence on cellular nelfinavir No G34A rs2231137 V12M No influence on cellular nelfinavir No IVS2 + 35G rs4148152 N/A No influence on cellular nelfinavir No C421A rs2231142 Q141K No influence on cellular nelfinavir No APOCIII C-482T Pending Promoter Hyperlipidaemia in presence of ritonavir Yes T-455C Pending Promoter Hyperlipidaemia in presence of ritonavir Yes C3238G rs5128 30 UTR variant Hyperlipidaemia in presence of ritonavir Yes APOE 2060T/2198T (APOEe2) rs429358 R112C/R158C Hyperlipidaemia in presence of ritonavir Yes 2060T/2198C (APOEe3) rs7412 R112C/R158R Hyperlipidaemia in presence of ritonavir Yes TNFa G - 238A rs361525 Promoter Rapid development of lipoatrophy Controversial SPINK-1 C112T rs17107315 N34S Associated with risk of pancreatitis Yes, in general population CFTR G1717 - 1A Splice defect Associated with risk of pancreatitis Yes, in general population IVS8 5T Splice defect Associated with risk of pancreatitis Yes, in general population HLA-B HLA-B*57.1 N/A Abacavir hypersensitivity Yes, but not in all populations HLA-DR HLA-DRB1*0101 N/A Nevirapine hypersensitivity No HSPA1L C2437T rs2227956 M493T Abacavir hypersensitivity No UGT1A1 A(TA)7TAA, - 43_ - 42in- sTA (UGT1A1*28) rs8175347 Promoter; insertion at TATA box Gilberts syndrome, hyperbilirubinaemia in presence of atazanavir and indinavir but not saquinavir Yes MT-CO1 C7028T Synonymous Haplogroup T associated with greater incidence of peripheral neuropathy No 700 Pharmacogenetics and Genomics 2006, Vol 16 No The NNRTI nevirapine can also cause a hypersensitivity syndrome characterized by a rash with systemic symptoms; occasionally liver injury may be part of the clinical picture, or alternatively, may actually be the only manifestation. Login to comment

PMID: 18058331 [PubMed] Wang JS et al: "The emerging importance of transporter proteins in the psychopharmacological treatment of the pregnant patient."

No. Sentence Comment

115 One study of 58 human placenta samples found a significant influence of the MRP2 G1249A missense mutation on mRNA associated with a lower expression in pre-term samples. Login to comment

PMID: 18195111 [PubMed] May K et al: "Role of the multidrug transporter proteins ABCB1 and ABCC2 in the diaplacental transport of talinolol in the term human placenta."

No. Sentence Comment

126 There is evidence from literature that the genetic polymorphisms ABCB1 G2677T and C3435T and ABCC2 G1249A are associated with altered expression of the transporters in the human placenta (Hitzl et al., 2004; Meyer zu Schwabedissen et al., 2005). Login to comment

PMID: 18416940 [PubMed] Seo T et al: "ABCC2 haplotype is not associated with drug-resistant epilepsy."

No. Sentence Comment

5 On the other hand, the delGCGC haplotype at G-1774delG, C-24T, G1249A and C3972T was over represented among the epileptic patients with a complication of mental retardation in comparison with those without (32.4% vs 22.0%; P=0.009); and the G-1774delG allele was also associated with mental retardation (P=0.03). Login to comment
12 Therefore a linkage disequilibrium analysis was performed to investigate the association between the ABCC2 genotypes of G-1774delG, C-24T, G1249A and C3972T or these haplotypes and clarify the responsiveness to the AED therapy among epileptic patients. Login to comment
34 ABCC2 polymorphisms at C-24T (rs717620), G1249A (rs2273697) and C3972T (rs3740066) were determined by polymerase chain reaction (PCR)-restriction fragment length polymorphism as reported by Naesens et al (2006) and Rau et al (2006). Login to comment
45 On the other hand, a significant linkage disequilibrium was detected among G-1774delG, C-24T, G1249A and C3972T (each ⏐D`⏐ > 0.75; P < 0.0001). Login to comment
56 In this study, the ABCC2 genotypes or haplotypes did not have any impact on the responsiveness to AEDs, while significant associations between mental retardation and the G-1774delG polymorphism or delGCGC haplotype at G-1774delG, C-24T, G1249A and C3972T were observed. Login to comment
67 Responsive (n = 146) Resistant (n = 133) P value Male 79 (54.1%) 77 (57.9%) 0.55 Age (years) 20.7 ± 11.0 21.1 ± 9.1 0.69 Body weight (kg) 49.1 ± 18.5 46.4 ± 20.4 0.25 Onset of epilepsy (years) 5.8 ± 5.0 3.7 ± 4.6 <0.001 Duration of therapy (years) 8.7 ± 4.4 9.6 ± 4.5 0.09 Mental retardation 72(49.3%) 113 (85.0%) <0.001 Seizure typea Partial 95(65.1%) 95(71.4%) 0.38 Generalized 47(32.2%) 33(24.8%) Aetiology Idiopathic 42(28.8%) 8(6.0%) <0.001 Cryptogenic 66(45.2%) 50(37.6%) Symptomatic 38(26.0%) 75(56.4%) Prescribed AEDsb Carbamazepine 64(43.8%) 76(57.1%) 0.031 Phenytoin 6(4.1%) 19(14.3%) 0.003 Phenobarbital 14(9.6%) 24(18.0%) 0.054 Valproic acid 38(26.0%) 47(35.3%) 0.12 Zonisamide 12(8.2%) 22(16.5%) 0.043 Clobazam 17 (11.6%) 44(33.1%) < 0.001 Table 2 Frequency of ABCC2 genotypes and haplotypes in drug-responsive and -resistant epilepsy a P values were determined by Fisher`s exact test for genotype frequencies and 10 000 permutation test for haplotype frequencies. b Haplotype configuration was defined as G-1774delG, C-24T, G1249A and C3972T. Login to comment
69 Variant Responsive (n = 146) Resistant (n = 133) P valuea G-1774delG G/G 77(58.8%) 54(41.2%) 0.08 G/delG 58(45.0%) 71(55.0%) delG/delG 11(57.9%) 8(42.1%) C-24T C/C 93(53.1%) 82(46.9%) 0.81 C/T 47(50.0%) 47(50.0%) T/T 6(60.0%) 4(40.0%) G1249A G/G 104(50.5%) 102(49.5%) 0.25 G/A 35(54.7%) 29(45.3%) A/A 7(77.8%) 2(22.2%) C3972T C/C 89(52.0%) 82(48.0%) 0.66 C/T 48(51.1%) 46(48.9%) T/T 9(64.3%) 5(35.7%) Haplotypesb GCGC 33.2% 32.3% 0.83 delGCGC 25.5% 32.7% 0.049 GTGT 17.7% 18.8% 0.73 GCAC 16.2% 12.0% 0.19 Otherc 7.4% 4.2% - 634 Takayuki Seo et al (2007b) indicated that substrate recognition or transport efficacy by efflux transporters differed between man and mouse for certain AEDs. Login to comment
74 A significant linkage was found among the C-24T, G1249A and C3972T polymorphisms of ABCC2, and the genotypes and haplotypes were reported to influence the expression of ABCC2 mRNA or protein, dispositions of the substrates, and adverse reactions (Naesens et al 2006; Rau et al 2006; de Jong et al 2007; Haenisch et al 2007). Login to comment
95 Table 3 Frequency of ABCC2 genotypes and haplotypes in mental retardation and non-mental retardation groups a P values were determined by Fisher`s exact test for genotype frequencies and 10000 permutation test for haplotype frequencies. b delG carriers vs non-carriers, P = 0.03. c Haplotype configuration was defined as G-1774delG, C-24T, G1249A and C3972T. Login to comment
97 Variant Non-mental retardation (n = 94) Mental retardation (n = 185) P valuea G-1774delGb G/G 53(40.5%) 78(59.5%) 0.08 G/delG 36(27.9%) 93(72.1%) delG/delG 5(26.3%) 14(73.7%) C-24T C/C 58(33.1%) 117(66.9%) 0.55 C/T 31(33.0%) 63(67.0%) T/T 5(50.0%) 5(50.0%) G1249A G/G 66(32.0%) 140(68.0%) 0.54 G/A 25(39.1%) 39(60.9%) A/A 3(33.3%) 6(66.7%) C3972T C/C 58(33.9%) 113(66.1%) 0.13 C/T 28(29.8%) 66(70.2%) T/T 8(57.1%) 6(42.9%) Haplotypesc GCGC 35.5% 31.4% 0.34 delGCGC 22.0% 32.4% 0.009 GTGT 17.9% 18.3% 1.00 GCAC 15.2% 13.8% 0.61 Otherd 9.4% 4.1% - 635 Conclusion This study showed that ABCC2 polymorphisms may not have influenced the AED responsiveness. Login to comment

PMID: 20237075 [PubMed] Janneh O et al: "Concentration-dependent effects and intracellular accumulation of HIV protease inhibitors in cultured CD4 T cells and primary human lymphocytes."

No. Sentence Comment

21 For example, despite some of the HPIs, e.g. lopinavir, being a substrate for ABCB1 and ABCC,12,19 an earlier retrospective study of HIV-infected patients under antiretroviral therapy found no influence of the ABCB1 C3435T polymorphism on the plasma and peripheral blood mononuclear cell (PBMC) levels of lopinavir (or the non-nucleoside reverse transcriptase inhibitor, efavirenz)20,21 even though polymorphisms at the ABCB1 C3435T and G2677T/ A, MRP1 (ABCC1) C218T and G2168A and MRP2 (ABCC2) G1249A have been associated with alterations in ABCB1, ABCC1 and ABCC2 activity.22 - 26 However, some studies found no association between the concentrations of saquinavir (alone or when boosted with ritonavir), atazanavir or lopinavir and polymorphisms in ABCB1 C3435T and G2677T/A.27,28 Furthermore, recent studies on three common exonic ABCB1 polymorphisms, C1236T, G2677T/A and C3435T, showed that these are poor predictors of the concentrations of lopinavir and ritonavir in saliva, semen and plasma.29 However, there is evidence of some association between G4544A polymorphism in ABCC2 and higher accumulation of lopinavir in PBMCs of HIV-treated patients.21 Similar studies on 74 HIV-infected patients showed significantly higher plasma levels of atazanavir in patients with genotype CC than those with CT or TT for polymorphism at the ABCB1 C3435T.30 Studies in cultured cells showed that the permeability of amprenavir, indinavir, lopinavir and ritonavir was greater in ABCB1 (G1199A) cells than in ABCB1 wt cells, suggesting that ABCB1 G1199A polymorphism may impact on the systemic bioavailability of HPIs.12 Clearly if inter-individual differences in the bioavailability of HPIs is caused by genetic variants of ABCB1, ABCC1 and ABCC2, this may have a profound effect on the pharmacokinetics and pharmacodynamics of substrate drugs. Login to comment
120 This is because being efficient inhibitors, substrates and inducers of some drug efflux proteins and drug metabolizing enzymes,9,46,47,51-53,60-65 there is a complex interaction between HPIs and drug efflux/influx transporters and enzymes, especially if the patients are on other medications.66-69 Indeed alterations in ABCB1 and ABCC2 activity have been associated with single nucleotide polymorphisms in ABCB1 (C3435T and G2677T/A), ABCC1 and ABCC2 (G1249A).22-26 While some studies showed no association between the exposure of HPIs and polymorphisms in ABCB1 C3435T, C1236T and G2677T/A,27 -29 some in vitro and in vivo studies found some association between G4544A and G1199A polymorphisms in ABCC2 and ABCB1, respectively and higher accumulation of some HPIs,12,21,30 suggesting that these polymorphisms may impact on the systemic bioavailability of various HPIs that are substrates of ABCB1 and ABCC2. Login to comment

PMID: 19545654 [PubMed] Rosso Felipe C et al: "Clinical impact of polymorphisms of transport proteins and enzymes involved in the metabolism of immunosuppressive drugs."

No. Sentence Comment

207 Influence of Genetic Polymorphisms of Drug Transporters and Metabolizing Enzymes on Mycophenolic Acid Pharmacokinetics Population Investigated Polymorphisms Findings References 95 de novo kidney transplant recipients receiving MMF/TAC/ steroids UGT1A9 C-2152T, T-275A - 86 MRP2C-24T, C3972T (CC, CT, TT) Lower MPA AUC0-12* MRP2 G-1549A, G-1023A, A-1019G, G1249A - 95 de novo kidney transplant recipients receiving MMF/TAC/ steroids UGT1A9 T-275A, C-2152T Lower MPA C0 and AUC0-12 95 40 renal transplant recipients receiving MMF/CSA UGT1A9 C-440T, T-331C Lower/higher MPA AUC0-12 96 (Caucasian) ABCC2-C-24T, G1249A - 80 renal transplant recipients receiving MMF/TAC UGT1A7 (*1/*1, *1/*2, *1/*3, *2/*3, *3/*3) No difference in MPA AUC0-12 98 (Japanese) UGT1A9 intronic 1399 (CC, CT, TT) 92 renal transplant recipients receiving MMF/SRL UGT2B7 G-842A (GG, GA, AA) Higher Acyl-MPA AUC0-9 † 99 (n ϭ 40), TAC/MMF (n ϭ 24), CsA/ MMF, (n ϭ 28) 72 renal transplant recipients receiving MMF/TAC UGT1A8 (*1/*1, *1/*2, *2/*2) No difference in MPA AUC0-12 100 (Japanese) 87 renal transplant recipients receiving MMF/TAC OATP/SLCO1B1 (*1/*1, *1/*3, *3/*3) No difference in MPA AUC0-12 103 (Japanese) ABCC2 C-24T (CC, CT, TT) No difference in MPA AUC0-12 MMF, mycophenolate mofetil; TAC, tacrolimus; CsA, cyclosporine; SRL, sirolimus; MPA, mycophenolic acid; AUC, area under the concentration-time curve; C0, trough concentrations; -, no effect. Login to comment
206 Influence of Genetic Polymorphisms of Drug Transporters and Metabolizing Enzymes on Mycophenolic Acid Pharmacokinetics Population Investigated Polymorphisms Findings References 95 de novo kidney transplant recipients receiving MMF/TAC/ steroids UGT1A9 C-2152T, T-275A - 86 MRP2C-24T, C3972T (CC, CT, TT) Lower MPA AUC0-12* MRP2 G-1549A, G-1023A, A-1019G, G1249A - 95 de novo kidney transplant recipients receiving MMF/TAC/ steroids UGT1A9 T-275A, C-2152T Lower MPA C0 and AUC0-12 95 40 renal transplant recipients receiving MMF/CSA UGT1A9 C-440T, T-331C Lower/higher MPA AUC0-12 96 (Caucasian) ABCC2-C-24T, G1249A - 80 renal transplant recipients receiving MMF/TAC UGT1A7 (*1/*1, *1/*2, *1/*3, *2/*3, *3/*3) No difference in MPA AUC0-12 98 (Japanese) UGT1A9 intronic 1399 (CC, CT, TT) 92 renal transplant recipients receiving MMF/SRL UGT2B7 G-842A (GG, GA, AA) Higher Acyl-MPA AUC0-9 ߤ 99 (n afd; 40), TAC/MMF (n afd; 24), CsA/ MMF, (n afd; 28) 72 renal transplant recipients receiving MMF/TAC UGT1A8 (*1/*1, *1/*2, *2/*2) No difference in MPA AUC0-12 100 (Japanese) 87 renal transplant recipients receiving MMF/TAC OATP/SLCO1B1 (*1/*1, *1/*3, *3/*3) No difference in MPA AUC0-12 103 (Japanese) ABCC2 C-24T (CC, CT, TT) No difference in MPA AUC0-12 MMF, mycophenolate mofetil; TAC, tacrolimus; CsA, cyclosporine; SRL, sirolimus; MPA, mycophenolic acid; AUC, area under the concentration-time curve; C0, trough concentrations; -, no effect. Login to comment

PMID: 22796246 [PubMed] Kim IW et al: "ABCB1 C3435T genetic polymorphism on population pharmacokinetics of methotrexate after hematopoietic stem cell transplantation in Korean patients: a prospective analysis."

No. Sentence Comment

128 Minor Allele Frequency P* ABCB1 G2677T/A rs2032582 0.488 0.293 ABCB1 C3435T rs1045642 0.615 0.575 ABCC2 C-24T rs717620 0.439 0.909 ABCC2 G1249A rs2273697 0.139 0.717 ATIC C347G rs2372536 0.349 0.987 GGH C-401T rs3758149 0.375 0.371 MTHFR C677T rs1801133 0.495 0.964 MTHFR A1298C rs1801131 0.180 0.619 TYMS TSER 2R/3R rs699517 0.399 0.585 *Derived from ␹2 test (Hardy-Weinberg equilibrium). Login to comment
125 Minor Allele Frequency P* ABCB1 G2677T/A rs2032582 0.488 0.293 ABCB1 C3435T rs1045642 0.615 0.575 ABCC2 C-24T rs717620 0.439 0.909 ABCC2 G1249A rs2273697 0.139 0.717 ATIC C347G rs2372536 0.349 0.987 GGH C-401T rs3758149 0.375 0.371 MTHFR C677T rs1801133 0.495 0.964 MTHFR A1298C rs1801131 0.180 0.619 TYMS TSER 2R/3R rs699517 0.399 0.585 *Derived from ই2 test (Hardy-Weinberg equilibrium). Login to comment

PMID: 22112610 [PubMed] Tian C et al: "Common variants in ABCB1, ABCC2 and ABCG2 genes and clinical outcomes among women with advanced stage ovarian cancer treated with platinum and taxane-based chemotherapy: a Gynecologic Oncology Group study."

No. Sentence Comment

4 Sequenom iPLEXTMGOLD Assay and MALDI-TOF platform were used to genotype the non-synonymous G2677T/A (rs2032582; encoding Ala893Ser/Thr) and synonymous C3435T (rs1045642; encoding Ile1145Ile) variants in ABCB1, the non-synonymous G1249A variant in ABCC2 (rs2273697; encoding Val417Ile), and the non-synonymous C421A variant in ABCG2 (rs2231142; encoding Q141K, Gln141Lys) in normal DNA from up to 511 women in Gynecologic Oncology Group (GOG) phase III trials, GOG-172 or GOG-182. Login to comment
57 Sequenom iPLEXTMGOLD Assay and MALDI-TOF platform were used to genotype the G2677T/ A (rs2032582) and C3435T (rs1045642) polymorphisms in ABCB1, the G1249A polymorphism in ABCC2 (rs2273697), and the C421A polymorphism in ABCG2 (rs2231142) in normal DNA as described previously [28]. Login to comment
84 (%) PFS OS HR 95% CI P value HR 95% CI P value ABCB1 (G2677T/A) GG 165 (32.7) Referent Referent GT+GA 259 (51.4) 0.98 0.79-1.22 0.856 0.88 0.69-1.11 0.271 TT+TA 80 (15.9) 1.02 0.76-1.38 0.877 0.93 0.67-1.29 0.663 GT+G A+TT+TA 339 (67.3) 0.99 0.81-1.22 0.924 0.89 0.71-1.11 0.299 ABCB1 (C3435T) CC 127 (25.8) Referent Referent CT 266 (54.1) 1.11 0.88-1.40 0.399 1.00 0.77-1.30 0.981 TT 99 (20.1) 0.98 0.73-1.32 0.908 0.88 0.64-1.23 0.454 CT+TT 365 (74.2) 1.07 0.86-1.34 0.550 0.97 0.76-1.24 0.803 ABCC2 (G1249A) GG 313 (61.7) Referent Referent GA 167 (32.9) 0.98 0.80-1.20 0.839 0.89 0.71-1.12 0.318 AA 27 (5.3) 1.62 1.06-2.48 0.025 0.86 0.52-1.44 0.572 GA+AA 194 (38.2) 1.04 0.86-1.27 0.692 0.89 0.71-1.11 0.281 ABCG2 (C421A) CC 404 (79.8) Referent Referent CA+AA 102 (20.2) 0.75 0.59-0.96 0.022 0.88 0.67-1.15 0.356 Hazard ratio (HR) with 95% confidence interval (CI) estimated from Cox model adjusted for cell type, stage/residual disease status, and treatment regimen. Login to comment
89 ABCC2 Polymorphism The G1249A polymorphism in ABCC2 was not associated with patient characteristics including race (data not shown). Login to comment
92 The G1249A variant in ABCC2 was not associated with OS (Table 2). Login to comment
103 Kaplan-Meier estimates of progression-free survival (PFS) by the G2677T/A polymorphorism in ABCB1 (a), the C3435T polymorphorism in ABCB1 (b), or the G1249A polymorphorism in ABCC2 (c). Login to comment
143 The G1249A polymorphism encodes Val417Ile, and one study reported that this polymorphism was associated with a higher activity of the intestinal transporter [50]. Login to comment
144 Our study did not demonstrate that the GA+AA genotypes vs GG genotype in the ABGCC2 G1249A polymorphism was associated with worse PFS or OS. Login to comment
146 The G1249A polymorphism was also studied in the ovarian cancer SCOTROC1 trial and found no association with PFS [47]. Login to comment
148 In summary, the present study analyzed common polymorphisms in ABCB1 (G2677T/A; C3435T), ABCC2 (G1249A) and ABCG2 (C421A) in relation to PFS and OS. Login to comment

PMID: 17060857 [PubMed] Naesens M et al: "Multidrug resistance protein 2 genetic polymorphisms influence mycophenolic acid exposure in renal allograft recipients."

No. Sentence Comment

45 The similarly frequent G1249A (exon 10) variant of MRP2 (allelic frequency 12.5-22%), which leads to an amino acid alteration from Val to Ile at position 417, has been associated with a reduced expression of MRP2 in preterm placentas (37). Login to comment
82 150 ␮L of GeneAmp௡ 10ϫ PCR buffer and GeneAmp MgCl2 (Applied Biosystems) were added to the PCR mixture, to a MgCl2 concentration of 1.5 mmol/L for C-24T and G1249A and of 2.0 mmol/L for the other MRP2 SNPs. Login to comment
83 Then 10 ␮L of PCR mixture was added to 5 ␮L of 10 ng/␮L DNA to a final PCR reaction volume of 15 ␮L. PCR conditions were as follows: 12 min at 95°C; 35 cycles of 30 sec at 93°C, 35 sec at 55°C, 30 sec at 72°C; and finally five min at 72°C for the C-24TSNP and 12 min at 95°C. Annealing temperature was respectively 56°C, 60°C, 60°C, 63°C, 58°C, and 58°C for the G-1549A, G-1023A, A-1019G, G1249A, C3972T and G4544A SNP. Login to comment
89 Primers and restriction enzymes used for restriction fragment length polymorphism analysis of MRP2 and UGT1A9 single nucleotide polymorphisms Gene Polymorphism Primers Restriction enzymes MRP2 A-1549G FW 5Ј tgacttgtgaagttgattcagttg 3Ј AccI REV 5Ј aactgatgaagagttaatatccacag 3Ј G-1023A FW 5Ј agcaatttaagtgacagtacaaaagg 3Ј StyI REV 5Ј gtctcaaactccaggcttcaacaatcat 3Ј A-1019G FW 5Ј agcaatttaagtgacagtacaaaagg 3Ј BstF5I REV 5Ј gtctcaaactccaggcttcaacaatcat 3Ј C-24T FW 5Ј ctgttccactttctttgatga 3Ј BbsI REV 5Ј tcttgttggtgaccaccctaa 3Ј G1249A FW 5Ј gggcaaagaagtgtgtggat 3Ј NcoI REV 5Ј acatcaggttcactgtttctccca 3Ј C3972T FW 5Ј aacttacttctcatcttgtctccttgc 3Ј ClaI REV 5Ј ctccacctaccttctccatgctatc 3Ј G4544A FW 5Ј gtaaaacgacggccagtggcctagacttgagatgctgct 3Ј RsAI REV 5Ј aacagctatgaccatgttcacttatccttttttaaaacgtaca 3Ј UGT1A9 C-2152T FW 5Ј ttgagacagagtcgtgctgttt 3Ј MseI REV 5Ј aggtcaaggtgggcgtatc 3Ј T-275A FW 5Ј tcagtgctaagggccttgtt 3Ј XbaI REV 5Ј cctgtgctgcaatgttaagtcta 3Ј T98C FW 5Ј gttctctgatggcttgcaca 3Ј StyI REV 5Ј atgccccctgagaatgagtt 3Ј were compared by the chi-square test for association. Login to comment
107 Testing the influence of the G-1549A, G-1023A, A-1019G, G1249A and G4544A SNP on dose-corrected MPA pharmacokinetics, no significant effect was noted at seven days after transplantation. Login to comment
125 Also similarly to the C-24T SNP, there was no differential effect of liver dysfunction on MPA exposure parameters in patients carrying the C3972T SNP (nϭ49) (MPA AUC0-12/dose 73.9Ϯ50.8 vs. 73.9Ϯ27.6 mg.hr/L.g;PϭNS).Therewerenodifferentialeffectsoftheother MRP2 SNPs (G-1549A, G-1023A, A-1019G, G1249A, G4544A) on MPA pharmacokinetics in patients with or without liver dysfunction (data not shown). Login to comment
137 The other MRP2 SNPs (G-1549A, G-1023A, A-1019 and G1249A) were not associated with differences in MPA pharmacokinetics at these later time points. Login to comment

PMID: 15821043 [PubMed] Meyer zu Schwabedissen HE et al: "Variable expression of MRP2 (ABCC2) in human placenta: influence of gestational age and cellular differentiation."

No. Sentence Comment

288 In the present paper, we studied the effect of three single nucleotide polymorphisms on the mRNA expression in human placenta, namely, the C-24T, G1249A, and C3972T. Login to comment
293 We found, however, a significant influence of the G1249A missense mutation on mRNA level in the present study. Login to comment

PMID: 12406647 [PubMed] Suzuki H et al: "Single nucleotide polymorphisms in multidrug resistance associated protein 2 (MRP2/ABCC2): its impact on drug disposition."

No. Sentence Comment

134 G1249A is to the PDZ-interacting domain characterized by the associated with amino acid alterations from Val to Ile carboxy-terminal amino acid sequence Ser/Thr-Xat 417, whereas C3972T is the 'silent` mutation at hydrophobic residue, where X represents any amino 1324 (Ile1324Ile) (Fig. 3) [118]. Login to comment
145 The frequently observed SNPs in Japanese amino acid sequence in this region may be involved subjects (C-24T, G1249A and C3972T) were also in the apical targeting, stabilization, and/or in main- found very often in the established cell lines. Login to comment
152 Therefore, it is possible that some SNP them, C-24T (promoter), G1249A (exon 10) and mutations observed at a lower frequency are associ- Fig. 3. Login to comment

PMID: 17412754 [PubMed] Wang Z et al: "Signatures of recent positive selection at the ATP-binding cassette drug transporter superfamily gene loci."

No. Sentence Comment

96 Ala rs497692 G - - LRH - 0.55 0.95 1.25 ABCC1 50 FR/G-260C 50 FR - rs504348 G - - LRH - - - - ABCC2 E1/C-24T Exon 1 - rs717620 T - - LRH - 20.54 2 1.14 21.46 E10/G1249A Exon 10 Val/Ile rs2273697 A - - LRH - 20.20 2 1.67 -1.32 I19/C-2133T Intron 19 - rs2002042 T - - - LRH 20.80 1.02 2 1.36 I23/G-752A Intron 23 - rs7898096 A - - - MTC - - 2 1.36 E25/G3542T Exon 25 Arg/Leu rs8187692 T - - - MTC 0.22 - 2 2.64 I26/T154C Intron 26 - rs3758395 C LRH - - - 2 1.24 20.57 20.36 I29/A154G Intron 29 - rs3740065 G LRH - - - 2.09 - 0.24 ABCC3 I1/C-3695G Intron 1 - rs719717 C MTC - - - 1.81 0.36 0.52 I30/A-1022C Intron 30 - rs3785911 C MTC - - - 0.96 0.71 0.29 ABCC4 I4/C4542Tc Intron 4 - rs17189481 T - - LRH - - - - ABCC5 I17/T20G Intron 17 - rs4148584 G LRH - - - 2 1.59 20.59 0.83 ABCC6 I30/A-31G Intron 30 - rs212097 A - - LRH - 0.76 0.17 1.02 ABCC7 I10/G377T Intron 10 - rs10487371 T - - - MTC - - 2 3.43 ABCC8 I16/A2575G Intron 16 - rs2237984 G MTC - - - 2.07 1.44 0.27 ABCC9 I27/C-1020G Intron 27 - rs704176 C - - - MTC 0.39 0.09 2.51 I37/C533G Intron 37 - rs829060 C - - - MTC 20.63 20.16 2 2.68 ABCC10 I1/G7A Intron 1 - rs9394952 A MTC - - - 0.90 1.24 1.19 ABCC11 I1/T1541G Intron 1 - rs13332304 T - - LRH LRH - - - I14/A473C Intron14 - rs7206909 A - - LRH LRH - 0.91 1.15 E19/C2436T Exon 19 Phe/Phe rs11866251 C - - MTC - - 1.37 1.15 I23/T-570C Intron 23 - rs11861031 T - - - LRH - 0.54 1.05 ABCC12 I2/C759A Intron 2 - rs8049005 C - - LRH - - 1.19 - ABCC13 50 FR/A-59G 50 FR - rs2822520 G LRH - - - 2 0.36 22.14 20.18 I1/A953C Intron 1 - rs2822522 C LRH - - - 2 1.21 20.90 21.04 ABCG2 E5/C421A Exon 5 Gln/Lys rs2231142 A MTC - - - 2 1.34 20.08 - a LRH represents SNPs that passed the modified long-range-haplotype test only if not corrected for multiple testing; MTC represents SNPs that passed both the modified LRH test and subsequent multiple test correction. Login to comment
192 Two ABCC2 SNPs (e1/C-24T and e10/G1249A) that exhibited RPS when Type I error reduction was not performed (Table 2) have been previously examined in some studies. Login to comment
196 The exonic SNP e10/G1249A, which involves a conservative amino acid change (V471I), was reported to result in decreased ABCC2 mRNA expression in preterm babies (56). Login to comment

PMID: 23007012 [PubMed] Oh ES et al: "Impact of ABCC2, ABCG2 and SLCO1B1 polymorphisms on the pharmacokinetics of pitavastatin in humans."

No. Sentence Comment

100 The insignificant results of G1249A, C3972T, and G1549A associated with pitavastatin PK could be introduced by the same reason. Login to comment
106 The C-24T polymorphism is located in the 5`-untranslated region (UTR),36) but this variant combined with the G1549A decreased MRP2 promoter activity by 39% in a functional molecular study.20) In a recent report, the genetic variants C-24T, G1249A, and C3972T appeared to influence transport capacity as a haplotype,37) and C3972T is highly linked with C-24T in all ethnic populations.6) Even though G1249A, C3927T, and G1549A did not influence the PK of pitavastatin in our results (Table1), 1249AA group showed about 2.5-fold higher Cmax and systemic exposure compared to the GG or GA. Login to comment

PMID: 23056078 [PubMed] Zhai X et al: "Gene polymorphisms of ABC transporters are associated with clinical outcomes in children with acute lymphoblastic leukemia."

No. Sentence Comment

7 The BCRP C421A C/A and C/C genotypes were significantly associated with low pre-treatment WBC counts while MRP2 G1249A G/G was significantly associated with low levels of post-treatment peripheral and bone marrow leukemic cells. Login to comment
8 A combination of C1236T, G1249A and/or G34A SNPs was significantly associated with lower EFS and OS. Login to comment
91 Primer sequences (5'-3') used for PCR Mutation PCR primers Exon MDR1 C3435T F gagcccatcctgtttgactgc 26 rs1045642 R tgtatgttggcctcctttgctg MDR1 G2677T/A F cccatcattgcaatagcaggagt 21 rs2032582 R gcatgaaaaagattgctttgagga MDR1 C1236T F tcagttcctatatcctgtgtctgtgaa 12 rs1128503 R ccacagccactgtttccaacc MRP1 T825C F gtggtagggggctgcatctct 8 rs246221 R aagcctccacctcctcattcg MRP2 C24T F ccagcatgattcctggactgc 1 rs717620 R cgattaaatggttgggatgaaagg MRP2 G1249A F tggctttgtccatgggtccta 10 rs2273697 R gggcatccacagacatcaggt MRP2 C3972T F cactccacctaccttctccatgc 28 rs3740066 R ccagtttaacaactaccaagtgcggta BCRP C421A F gttgtgatgggcactctgacg 5 rs2231142 R tgaccctgttaatccgttcgttt BCRP G34A F ccagatgtcttccagtaatgtcgaa 2 rs2231137 R cgacaaggtagaaagccactcttca leukemia Table III. Login to comment
92 Frequency of SNPs in the patient and control groups Variable Healthy control ALL Value of p (n = 93) (n = 82) T825C exon 8a C/C 21 (24.4%) 24 (32.0%) 0.409 C/T 47 (54.7%) 33 (44.0%) T/T 18 (20.9%) 18 (24.0%) Value of p for HWE 0.382 0.322 C3435T exon 26 C/C 40 (43.0%) 39 (47.6%) 0.775 C/T 40 (43.0%) 34 (41.5%) T/T 13 (14.0%) 9 (11.0%) Value of p for HWE 0.559 0.700 G2677T exon 21a A/A 7 (7.5%) 5 (6.2%) 0.630 G/A 13 (14.0%) 13 (16.0%) G/G 18 (19.4%) 14 (17.3%) G/T 28 (30.1%) 25 (30.9%) T/A 7 (7.5%) 12 (14.8%) T/T 20 (21.5%) 12 (14.8%) Value of p for HWE 0.016 0.883 C1236T exon 12 C/C 18 (19.4%) 16 (19.5%) 0.289 C/T 32 (34.4%) 37 (45.1%) T/T 43 (46.2%) 29 (35.4%) Value of p for HWE 0.013 0.501 C421A exon 5 A/A 8 (8.6%) 8 (9.8%) 0.733 C/A 42 (45.2%) 41 (50.0%) C/C 43 (46.2%) 33 (40.2%) Value of p for HWE 0.614 0.353 G34A exon 2 A/A 11 (11.8%) 4 (4.9%) 0.043* G/A 46 (49.5%) 32 (39.0%) G/G 36 (38.7%) 46 (56.1%) Value of p for HWE 0.523 0.599 C24T exon 1 T/T 6 (6.5%) 3 (3.7%) 0.418 C/T 27 (29.0%) 31 (37.8%) C/C 60 (64.5%) 48 (58.5%) Value of p for HWE 0.232 0.458 G1249A exon 10 A/A 1 (1.1%) 2 (2.4%) 0.823 G/A 17 (18.3%) 15 (18.3%) G/G 75 (80.6%) 65 (79.3%) Value of p for HWE 0.973 0.332 C3972T exon 28 T/T 6 (6.5%) 3 (3.7%) 0.141 C/T 29 (31.2%) 37 (45.1%) C/C 58 (62.4%) 42 (51.2%) Value of p for HWE 0.371 0.132 aThere were 14 values missing (7 for each group) in T825C exon 8, and one value missing in G2677T exon 21 in the patient group. Login to comment
99 Patients with the MRP2 G1249A polymorphism of the A/A genotype had a significantly higher risk of all events and a significantly higher risk of death compared to those with the G/G genotype (hazard ratios of 8.27, p = 0.006, and 13.07, p = 0.001, respectively) (Table IV). Login to comment
100 Effect of SNP combinations on EFS and OS Based on our data showing a significantly higher risk of all events and death in 1) children with MDR1 G2677 T/A (G/G, G/A or A/A genotypes); 2) children with MDR1 C1236T of the C/C genotype; 3) children with MRP-2 G1249A of the A/A genotype; and 4) the association of BCRP G34A of the A/A genotype with ALL, we evaluated the effect of different combinations of these 4 polymorphisms on event-free survival (EFS) and overall survival (OS). Login to comment
109 The MRP2 G1249A SNP was significantly associated with post-treatment peripheral leukemic cell counts and bone marrow leukemic cell counts. Login to comment
112 G2677T/A exon21 G/G+G/A+A/A 3.15 (1.16, 8.57) 0.025* 2.62 (0.85, 8.07) 0.093 G/T+T/T +T/A - - C1236T exon 12 T/T - - C/T 3.04 (0.81, 11.35) 0.099 1.81 (0.45, 7.29) 0.406 C/C 4.63 (1.08, 19.80) 0.039* 3.47 (0.76, 15.76) 0.108 C421A exon 5 C/C - - C/A 0.68 (0.25, 1.89) 0.460 0.97 (0.30, 3.20) 0.963 A/A 1.05 (0.22, 4.96) 0.949 1.71 (0.33, 8.85) 0.520 G34A exon 2 G/G - - G/A 0.86 (0.31, 2.44) 0.781 1.10 (0.33, 3.63) 0.879 A/A 4.19 (0.89, 19.63) 0.069 4.80 (0.96, 23.99) 0.056 C24T exon 1 C/C - - C/T 1.30 (0.50, 3.36) 0.592 0.61 (0.19, 2.00) 0.419 T/T NA NA G1249A exon 10 G/G - - G/A NA NA A/A 8.27 (1.82, 37.59) 0.006* 13.07 (2.68, 63.64) 0.001* C3972T exon 28 C/C - - C/T 0.94 (0.36, 2.43) 0.894 0.45 (0.14, 1.47) 0.188 T/T NA NA Post-treatment characteristics D8 peripheral ≤ 1000 - - leukemic cells [/μl] > 1000 3.30 (0.75, 14.54) 0.115 5.12 (1.11, 23.49) 0.036* D15 bone marrow < 5 - - leukemic cells [%] 5-25 1.76 (0.48, 6.44) 0.390 1.76 (0.36, 8.52) 0.482 > 25 3.57 (1.12, 11.38) 0.032* 5.20 (1.52, 17.82) 0.009* D33 bone marrow < 5 - - leukemic cells [%] 5-25 27.17 (2.82, 261.57) 0.004* 41.55 (3.76, 459.28) 0.002* > 25 3.03 (0.38, 23.90) 0.293 4.11 (0.51, 33.27) 0.185 Variable Risk of all events Risk of death HR (95% CI) Value of p HR (95% CI) Value of p NA - the corresponding odds ratio was not applicable due to zero or small count. Login to comment
114 Both children with G1249A in A/A had over 25% bone marrow leukemic cells on day 15 after treatment. Login to comment
115 Four of the 15 children (26.7%) with G1249A in G/A had over 5% bone marrow leukemic cells on day 15 after treatment, while only 12 of the 65 (18.5%) children with the G/G genotype had over 5% bone marrow leukemic cells on day 15 after treatment (p = 0.023). Login to comment
124 However, the BCRP C421A C/A and C/C genotypes were significantly associated with low pre-treatment WBC counts (< 20 × 109/l), while the MRP2 G1249A G/G genotype was significantly associated with low levels of post-treatment day 8 peripheral leukemic cells and day 15 and day 33 bone marrow leukemic cells. Login to comment
126 Importantly, our data also suggest that a combination of MDR1 C1236T, MRP2 G1249A and/or BCRP G34A SNPs was significantly associated with lower EFS and OS. Login to comment
147 To the best of our knowledge, we are the first to analyze combinations of SNPs and to show that a combination of MDR1 (C1236T), MRP2 (G1249A) and/or the BRCP (G34A) SNPs was associated with a significantly lower EFS and OS in pediatric ALL patients. Login to comment
156 We would like to evaluate the association between the MDR1 C1236T, MRP2 G1249A and/or BCRP G34A SNPs and response to specific chemotherapy regimens in our pediatric ALL patient population. Login to comment
90 Primer sequences (5'-3') used for PCR Mutation PCR primers Exon MDR1 C3435T F gagcccatcctgtttgactgc 26 rs1045642 R tgtatgttggcctcctttgctg MDR1 G2677T/A F cccatcattgcaatagcaggagt 21 rs2032582 R gcatgaaaaagattgctttgagga MDR1 C1236T F tcagttcctatatcctgtgtctgtgaa 12 rs1128503 R ccacagccactgtttccaacc MRP1 T825C F gtggtagggggctgcatctct 8 rs246221 R aagcctccacctcctcattcg MRP2 C24T F ccagcatgattcctggactgc 1 rs717620 R cgattaaatggttgggatgaaagg MRP2 G1249A F tggctttgtccatgggtccta 10 rs2273697 R gggcatccacagacatcaggt MRP2 C3972T F cactccacctaccttctccatgc 28 rs3740066 R ccagtttaacaactaccaagtgcggta BCRP C421A F gttgtgatgggcactctgacg 5 rs2231142 R tgaccctgttaatccgttcgttt BCRP G34A F ccagatgtcttccagtaatgtcgaa 2 rs2231137 R cgacaaggtagaaagccactcttca Table III. Login to comment
98 Patients with the MRP2 G1249A polymorphism of the A/A genotype had a significantly higher risk of all events and a significantly higher risk of death compared to those with the G/G genotype (hazard ratios of 8.27, p = 0.006, and 13.07, p = 0.001, respectively) (Table IV). Login to comment
108 The MRP2 G1249A SNP was significantly associated with post-treatment peripheral leukemic cell counts and bone marrow leukemic cell counts. Login to comment
111 G2677T/A exon21 G/G+G/A+A/A 3.15 (1.16, 8.57) 0.025* 2.62 (0.85, 8.07) 0.093 G/T+T/T +T/A - - C1236T exon 12 T/T - - C/T 3.04 (0.81, 11.35) 0.099 1.81 (0.45, 7.29) 0.406 C/C 4.63 (1.08, 19.80) 0.039* 3.47 (0.76, 15.76) 0.108 C421A exon 5 C/C - - C/A 0.68 (0.25, 1.89) 0.460 0.97 (0.30, 3.20) 0.963 A/A 1.05 (0.22, 4.96) 0.949 1.71 (0.33, 8.85) 0.520 G34A exon 2 G/G - - G/A 0.86 (0.31, 2.44) 0.781 1.10 (0.33, 3.63) 0.879 A/A 4.19 (0.89, 19.63) 0.069 4.80 (0.96, 23.99) 0.056 C24T exon 1 C/C - - C/T 1.30 (0.50, 3.36) 0.592 0.61 (0.19, 2.00) 0.419 T/T NA NA G1249A exon 10 G/G - - G/A NA NA A/A 8.27 (1.82, 37.59) 0.006* 13.07 (2.68, 63.64) 0.001* C3972T exon 28 C/C - - C/T 0.94 (0.36, 2.43) 0.894 0.45 (0.14, 1.47) 0.188 T/T NA NA Post-treatment characteristics D8 peripheral ࣘ 1000 - - leukemic cells [/bc;l] > 1000 3.30 (0.75, 14.54) 0.115 5.12 (1.11, 23.49) 0.036* D15 bone marrow < 5 - - leukemic cells [%] 5-25 1.76 (0.48, 6.44) 0.390 1.76 (0.36, 8.52) 0.482 > 25 3.57 (1.12, 11.38) 0.032* 5.20 (1.52, 17.82) 0.009* D33 bone marrow < 5 - - leukemic cells [%] 5-25 27.17 (2.82, 261.57) 0.004* 41.55 (3.76, 459.28) 0.002* > 25 3.03 (0.38, 23.90) 0.293 4.11 (0.51, 33.27) 0.185 Variable Risk of all events Risk of death HR (95% CI) Value of p HR (95% CI) Value of p NA - the corresponding odds ratio was not applicable due to zero or small count. Login to comment
127 Table VII. The associations between MRP2 SNPs: C24T exon 1, G1249A exon 10, and C3972T exon 28 and pre-treatment WBC counts in day 8 peripheral leukemic cells and in day 15 and day 33 bone marrow leukemic cells Variable C24T exon 1 Value of p G1249A exon 10 Value of p C3972T exon 28 Value of p T/T C/T C/C A/A G/A G/G T/T C/T C/C Pretreatment < 20 1 (33.3%) 20 (64.5%) 33 (68.8%) 0.265 1 (50.0%) 13 (86.7%) 40 (61.5%) 0.109 1 (33.3%) 24 (64.9%) 29 (69.0%) 0.386 WBC [10 9 /l] 20-100 1 (33.3%) 10 (32.3%) 11 (22.9%) 0 (0.0%) 2 (13.3%) 20 (30.8%) 1 (33.3%) 11 (29.7%) 10 (23.8%) > 100 1 (33.3%) 1 (3.2%) 4 (8.3%) 1 (50.0%) 0 (0.0%) 5 (7.7%) 1 (33.3%) 2 (5.4%) 3 (7.1%) Post-treatment D8 peripheral ࣘ 1000 3 (100.0%) 31 (100.0%) 44 (91.7%) 0.270 0 (0.0%) 13 (86.7%) 65 (100.0%) < 0.001 3 (100.0%) 37 (100.0%) 38 (90.5%) 0.243 leukemic cells [/bc;l] > 1000 0 (0.0%) 0 (0.0%) 4 (8.3%) 2 (100.0%) 2 (13.3%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 4 (9.5%) D15 bone marrow < 5 3 (100.0%) 24 (77.4%) 37 (77.1%) 0.845 0 (0.0%) 11 (73.3%) 53 (81.5%) 0.023 3 (100.0%) 30 (81.1%) 31 (73.8%) 0.782 leukemic cells [%] 5-25 0 (0.0%) 3 (9.7%) 7 (14.6%) 0 (0.0%) 3 (20.0%) 7 (10.8%) 0 (0.0%) 3 (8.1%) 7 (16.7%) > 25 0 (0.0%) 4 (12.9%) 4 (8.3%) 2 (100.0%) 1 (6.7%) 5 (7.7%) 0 (0.0%) 4 (10.8%) 4 (9.5%) D33 bone marrow < 5 3 (100.0%) 30 (96.8%) 47 (97.9%) 0.660 1 (50.0%) 15 (100.0%) 64 (98.5%) 0.048 3 (100.0%) 36 (97.3%) 41 (97.6%) 0.741 leukemic cells (%) 5-25 0 (0.0%) 0 (0.0%) 1 (2.1%) 1 (50.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 1 (2.4%) > 25 0 (0.0%) 1 (3.2%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 1 (1.5%) 0 (0.0%) 1 (2.7%) 0 (0.0%) Gene expression profiles have been shown to correlate with morphology, immunophenotype and response to therapy and drug resistance in childhood ALL patients [5, 31].The genetic polymorphisms in MDR1 are thought to influence the expression levels of the P-gp protein, thereby influencing the development of ALL [32]. Login to comment

PMID: 15975613 [PubMed] Brandon EF et al: "Validation of in vitro cell models used in drug metabolism and transport studies; genotyping of cytochrome P450, phase II enzymes and drug transporter polymorphisms in the human hepatoma (HepG2), ovarian carcinoma (IGROV-1) and colon carcinoma (CaCo-2, LS180) cell lines."

No. Sentence Comment

215 DJS W H H W G1249A ? Login to comment
212 DJS W H H W G1249A ? Login to comment

PMID: 25346718 [PubMed] Escalante-Santiago D et al: "MDR-1 and MRP2 Gene Polymorphisms in Mexican Epileptic Pediatric Patients with Complex Partial Seizures."

No. Sentence Comment

27 The MRP2 transporter protein recognizes CBZ, LTG, and FBM; its most relevant polymorphisms are rs2273697 (G1249A) and rs3740066 (C3972T). Login to comment

PMID: 23443032 [PubMed] Omoumi A et al: "Fetal polymorphisms at the ABCB1-transporter gene locus are associated with susceptibility to non-syndromic oral cleft malformations."

No. Sentence Comment

49 Description Association with function or disease phenotype Reference numbers e12/C1236T rs1128503 G412G Increased exposure to irinotecan in cancer patients Altered ABCB1 expression in 3t3 isogenic fibroblasts Lower ABCB1 expression 36 33 34 ABCB1 e21/G2677T e21/G2677A rs2032582 A893S A893T Less placental trophoblast ABCB1 expression in T and A carriers 29 e26/C3435T rs1045642 I1145I Alteration in the rate of translation Lower ABCB1 expression Affects mRNA stability 37 34 38 ABCC1 5`FR/G-260C rs504348 50 UTR Evidence of recent positive selection in European-Americans 39 ABCC2 e1/C-24T rs717620 24C4T Influenced ABCC2 mRNA expression in normal kidney cortex and liver samples but not placenta Evidence of recent positive selection 22,30,39 39 e10/G1249A rs2273697 V471I Decreased ABCC2 mRNA levels in preterm placentas Evidence of recent positive selection 22 39 ABCG2 e5/C421A rs2231142 Q141K Reduced ABCG2 activity Decreased ABCG2 protein level in placenta Evidence of recent positive selection Substrate recognition and/or transport of drugs 40 41 39 42 e2/G34A rs2231137 V12M Reduced ABCG2 activity Substrate recognition and/or transport of drugs 40 42 I9/T-357C rs2054576 Intron Alteration of pre-mRNA splicing 43 volume of 10ml containing 1 ng of genomic DNA, 5 ml 2 PCR master mix buffer (Qiagen), and 0.5 mM of each primer (information of PCR primers are available in Supplementary Table S3). Login to comment
73 n1 n2 Not-transmitted Observed Correcteda OR 95% CI ABCB1 e12/C1236T rs1128503 150 108 T: 92/45 C: 45/92 5.1 10-5 4.6 104 2.04 1.45-2.99 e21/G2677T e21/G2677A rs2032582 150 111 G: 78/91 T: 96/64 A: 23/42 0.008 0.072 1.50b 1.08-2.09 e26/C3435T rs1045642 150 110 C: 56/87 T: 87/56 0.009 0.081 1.55 1.10-2.21 ABCC1 5`FR/G-260C rs504348 150 7 G: 03/04 C: 04/03 0.705 1.33 0.23-9.10 ABCC2 e1/C-24T rs717620 150 76 C: 41/50 T: 50/41 0.345 1.24 0.811.93 e10/G1249A rs2273697 150 53 G: 34/22 A: 22/34 0.107 1.55 0.88-2.77 e5/C421A rs2231142 150 110 C: 70/62 A: 62/70 0.486 1.13 0.79-1.62 ABCG2 e2/G34A rs2231137 150 105 G: 54/71 A: 71/54 0.127 1.32 0.91-1.91 I9/T-357C rs2054576 150 91 T: 59/51 C: 51/59 0.445 1.16 0.78-1.72 Abbreviations: CI, confidence Interval; OR, odds ratio; n1, number of family samples which were successfully genotyped; n2, number families with at least one heterozygote parent. Login to comment

PMID: 23588565 [PubMed] Kim IW et al: "Population pharmacokinetics analysis of cyclophosphamide with genetic effects in patients undergoing hematopoietic stem cell transplantation."

No. Sentence Comment

143 We found that CLUI was associated with the ABCC2 G1249A genotype. ABCC2 has been reported to mediate biliary transport of 4-glutathionylcyclophosphamide [42] but has not been reported to transport CY itself. Login to comment
145 In another study, patients carrying the heterozygous variant alleles of ABCC2 G1249A exhibited higher exposure of acyl mycophenolate phenolic glucuronide than those with the wild-type genotype [43]. Login to comment
177 We demonstrated that carriers of at least one ABCC2 G1249A allele had a decreased CLUI. Login to comment

PMID: 23717663 [PubMed] Subenthiran S et al: "Linkage disequilibrium between polymorphisms of ABCB1 and ABCC2 to predict the treatment outcome of Malaysians with complex partial seizures on treatment with carbamazepine mono-therapy at the Kuala Lumpur Hospital."

No. Sentence Comment

5 Our study is aimed at determining the correlation between patients` response to CBZ mono-therapy to Single Nucleotide Polymorphisms G2677T and C3435T of the ABCB1 gene as well as G1249A and 224C.T of the ABCC2 gene. Login to comment
11 Results: Resistance to treatment with CBZ mono-therapy was significantly associated with the 2677TT and the 3435TT genotypes while it was not significantly associated with the G1249A and 224C.T polymorphisms. Login to comment
136 Genotype frequency (%) *Permuted *Permuted SNP / Genotype Responder Non-responder x2 p ABCB1/ C3435T C/C 35(0.22) 51(0.34) 12.06 0.007 T/T 68(0.42) 36(0.24) C/T 59(0.36) 65(0.43) ABCB1/ G2677T G/G 59(0.36) 144(0.75) 61.70 ,0.001 T/T 57(0.35) 25(0.16) G/T 46(0.28) 13(0.09) ABCC2/ G1249A G/G 120(0.74) 124(0.82) 2.23 0.511 A/A 0(0.00) 1(0.01) G/A 42(0.26) 27(0.18) ABCC2/ 224C.T C/C 110(0.68) 102(0.67) 0.14 0.986 T/T 4(0.03) 6(0.04) C/T 48(0.30) 44(0.29) *1000 permutation applied. Login to comment
140 We found no correlation between the G1249A of the ABCC2 gene and the outcome of treatment of patients with CPS on CBZ monotherapy. This is similar to the findings of the study conducted on German patients [30] and Chinese patients [31]. Login to comment

PMID: 23940561 [PubMed] Chen WQ et al: "Polymorphism of ORM1 is associated with the pharmacokinetics of telmisartan."

No. Sentence Comment

39 ABCC2 was highly polymorphic, and it was reported that three common SNPs C-24T, G1249A and C3972T [19,25] were in linkage disequilibrium and likes to decrease the transporter function probably by a posttranscriptional modification on transporter protein expression [19,20]. Login to comment
77 The genotypes of ABCC2 C3972T, ABCC2 G1249A, and, SLCO1B3 T334G were determined by a PCR-RFLP procedure as described in previous reports. Login to comment
79 The primers for ABCC2 G1249A were 59-GGGCAAAGAAGTGTGTGGAT-39 (Forward) and 59-TGGGATTACAAGCACCATCA-39 (Reversed) and the endonuclease enzyme was NcoI. Login to comment
81 The Linkage Disequilibrium Analysis The linkage disequilibrium analysis of the ABCC2 variants (C-24T, G1249A and C3972T) was constructed using the online software SHEsis (http://analysis2.bio-x.cn/my Analysis.php). Login to comment
107 The linkage disequilibrium among the ABCC2 single nucleotide polymorphisms (SNPs) was analyzed, and the results showed that the alleles of ABCC2 C3972T was mostly in a linkage with ABCC2 C-24T (D9 = 0.997, r2 = 0.031), and the D9 value was 0.793 and r2 = 0.606 when the analysis tested between the SNPs of ABCC2 G1249A and C-24T. Login to comment
123 In this study, the polymorphisms of ABCC2(G1249A), ABCB1 (C3435T), SLCO1B3 (T334G) and ABCG2 (C421A) had no significant influence on the PKs of telmisartan and the BP change(%) from the baseline after taking telmisartan (Table 3, 4, 5). Login to comment
139 Nucleotide substitution Location Amino Acids MAFa (CHB) MAFa (ASW) MAFa (CEU) MAFb (CHB) ORM1 rs17650 A113G Exon Gln/Arg 0.275[37] N/A N/A 0.208 ABCC2 rs717620 C-24T 59UTR - 0.201 0.035 0.181 0.281 rs3740066 C3972T Exon Ile/Ile 0.267 0.331 N/A 0.250 rs2273697 G1249A Exon Val/Ile 0.106 0.243 0.132 0.083 ABCB1 rs1045642 C3435T Exon Ile/Ile 0.374 0.205 0.571 0.375 SLCO1B3 rs4149117 T334G Exon Ala/Ser 0.266 0.518 0.143 0.354 ABCG2 rs2231142 C421A Exon Gln/Lys 0.292 0.044 0.111 0.219 a data published on hapmap; b, data calculated in this study, N = 48; N/A, no data found in hapmap. Login to comment
153 On the one hand, as ABCC2 C-24T, C3972T, and G1249A SNPs were in a strong linkage disequilibrium, thus the other two SNPs might interfere with C3972T to affect the variability of PKs/PDs. Login to comment
177 Gene SNPs Genotype AUC(0-48)(ng?h/ml) AUC(0-') (ng?h/ml) Cmax(ng/ml) CL/F(l/h) T1/2 (h) ORM1 A113G AA (28) 1,549.186859.84 1,753.1361,060.60 246.876156.93 32.38621.43 15.6365.09 AG (20) 2,313.5461,257.71 2,686.9061,401.87 293.006184.06 18.6368.74 20.01612.81 P VALUE 0.033* 0.016* 0.289 0.355 0.113 ABCC2 C3972T CC (26) 1,871.186817.89 2,090.836952.69 313.326172.05 18.80610.32 15.8364.11 CT (20) 1,289.896506.60 1,526.476626.97 176.486106.47 10.5966.39 20.09613.27 TT (2) 1,973.906135.44 2,057.50697.27 548.22612.93 32.8960.78 12.2663.11 P VALUE 0.031* 0.105 0.001** 0.001** 0.321 CC vs. CT 0.035* 0.105 0.005** 0.008** 0.476 CC vs.TT 0.896 0.964 0.243 0.083 0.237 CT vs. TT 0.311 0.526 0.014* 0.004** 0.147 ABCC2 C-24T CC (24) 1,809.426843.05 2,017.046976.09 306.166182.01 18.37610.92 15.6164.19 CT (21) 1,348.936525.05 1,588.646637.52 191.526112.96 25.10610.75 19.98612.95 TT (3) 2,214.176427.04 2,411.886617.65 467.576139.99 17.2463.89 14.6264.65 P VALUE 0.060 0.161 0.008** 0.005** 0.523 ABCC2 G1249A GG(41) 1597.796667.24 1832.016790.09 256.456156.87 15.3969.41 18.0169.84 GA(6)+AA(1) 1998.4461108.08 1232.576992.12 355.016236.12 21.30614.17 14.0964.01 P VALUE 0.285 0.417 0.296 0.296 0.614 ABCG2 C421A CC (30) 1,579.226713.71 1,800.866797.05 258.146165.95 15.4969.96 17.69610.97 CA (15) 1,679.296719.04 1,840.076798.27 297.906170.29 17.87610.22 16.34611.36 AA (3) 1,943.436921.94 2,459.6861,394.14 186.586133.13 19.5768.94 20.7565.44 P Value 0.669 0.573 0.481 0.540 0.265 ABCB1 C3435T CC (20) 1,606.836646.33 1,791.716814.66 237.236126.55 14.2367.59 15.4865.05 CT (20) 1,673.536789.53 1,920.076849.29 291.526206.17 17.49612.37 18.95612.29 TT (8) 1,598.626913.64 1,846.3061,026.48 274.706165.31 16.4869.92 18.6768.88 P VALUE 0.587 0.317 0.951 0.984 0.076 SLCO1B3 T334G GG (18) 1,702.256740.60 1,877.336806.34 298.076204.22 17.88612.25 15.9064.08 GT (26) 1,574.476755.06 1,829.076896.92 232.816132.75 13.9767.97 18.56611.78 TT (4) 1,704.896797.20 1,914.586939.86 338.566196.27 25.38613.32 17.3168.43 P VALUE 0.793 0.929 0.424 0.307 0.994 Data were shown as mean6SD; *P,0.05; **P,0.01. Login to comment
181 SBP change (%) from the baseline DBP change (%) from the baseline Mauchly`s Time Time*genotype genotype Mauchly`s Time Time*genotype genotype ORM1 A113G 0.004 0.000 0.748 0.770 0.000 0.000 0.258 0.096 ABCC2 C3972T 0.006 0.000 0.262 0.162 0.000 0.000 0.067 0.018* ABCC2 G1249A 0.005 0.000 0.795 0.370 0.000 0.030 0.975 0.144 SLCO1B3 T334G 0.001 0.000 0.842 0.995 0.000 0.000 0.431 0.634 ABCG2 C421A 0.001 0.000 0.300 0.255 0.000 0.000 0.451 0.896 ABCB1 C3435T 0.001 0.000 0.369 0.375 0.000 0.000 0.372 0.241 *P,0.05; ORM1, orosomucoid 1; ABCC2, ATP-binding cassette, sub-family C, member 2; SBP, systolic blood pressure; DBP, diastolic blood pressure; Time, the time point in this study including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 24, 48 h after taking telmisartan. Login to comment
185 As shown in Table 2, the MAF of ABCC2 C3972T and G1249A, ABCB1 C3435T, SLCO1B3 T334G almost be similar in three main populations. Login to comment

PMID: 25491747 [PubMed] Andersen V et al: "Interactions between meat intake and genetic variation in relation to colorectal cancer."

No. Sentence Comment

60 PRISMA 2009 Flow Diagram Records idenfied through database search (n = 239 ) Screening Included Eligibility Idenficaon Addional records idenfied through other sources (n = 19 ) Records aer removal of duplicates (n = 239 ) Records screened (n = 239) Records excluded (n = 193) Full-text arcles assessed for eligibility (n = 46) Full-text arcles excluded, for various reasons (n = 13) Studies included in qualitave synthesis (n = 33) Fig. 2 Preferred reporting items for systematic reviews and meta-analyses (PRISMA) flow diagram of the retrieved studies Table 1 Interactions between meat intake and polymorphisms in relation to the risk of colorectal cancer in prospective cohorts Gene rs-number d N cases N sub-cohort IRR/OR (95 % CI) a P int b Comments c First author Year References Cooking carcinogens and mutagens NAT1 Slow 120 123 4 Chen 1998 Chen et al. (1998) NAT*10 allele Rapid 92 98 0.19 4 Chen et al. (1998) NAT2 Slow 131 125 4 Chen et al. (1998) Rapid 81 96 0.56 4 Chen et al. (1998) NAT2 Slow 107 267 5 Chan 2005 Chan et al. (2005) Rapid 76 476 0.07 5 Chan et al. (2005) NAT1 Slow 0.99 (0.94-1.04) 2, 3, 6 Sorensen 2008 Sorensen et al. (2008) Fast 0.98 (0.90-1.05) [0.40 2, 3, 6 Sorensen et al. (2008) NAT2 Slow 1.00 (0.95-1.06) 2, 3, 6 Sorensen et al. (2008) Fast 0.96 (0.90-1.03) [0.40 2, 3, 6 Sorensen et al. (2008) NAT1 No*10 362 527 7 Nothlings 2009 Nothlings et al. (2009) *10 482 818 0.77 7 Nothlings et al. (2009) NAT2 Slow/med 750 1149 7 Nothlings et al. (2009) Rapid 242 344 0.44 7 Nothlings et al. (2009) NAT1 No*10 362 527 8 Nothlings et al. (2009) *10 482 818 0.93 8 Nothlings et al. (2009) NAT2 Slow/med 750 1,149 8 Nothlings et al. (2009) Rapid 242 344 0.13 8 Nothlings et al. (2009) AHR rs2066853 364 394 0.07 12 Gilsing 2012 Gilsing et al. (2012) UGT1A rs6714486 364 394 0.06 12 Gilsing et al. (2012) rs17868299 364 394 0.05 12 Gilsing et al. (2012) UGT1A rs2011404 364 394 0.08 12 Gilsing et al. (2012) CYP2E1 rs915908 364 394 0.05 12 Gilsing et al. (2012) UGT1A rs6717546 364 394 0.04 12 Gilsing et al. (2012) UGT1A rs12466997 364 394 0.08 12 Gilsing et al. (2012) Arachidonic acid pathway PTGS2 (COX-2) rs689566 A-1195G AA-AG 900 1,686 1.02 (0.98-1.05) 1, 2, 3 Andersen 2013 Andersen et al. (2013b) GG 47 61 1.06 (0.87-1.29) 0.54 1, 2, 3 Andersen et al. (2013b) rs20417 G-765C GG 701 1,256 0.99 (0.95-1.03) 1, 2, 3 Andersen et al. (2013b) GC-CC 235 478 1.08 (1.01-1.15) 0.006 1, 2, 3 Andersen et al. (2013b) rs5275 T8473C TT 430 720 1.04 (0.99-1.09) 1, 2, 3 Andersen et al. (2013b) TC-CC 501 1,018 1.01 (0.96-1.05) 0.29 1, 2, 3 Andersen et al. (2013b) Transport proteins Table 1 continued Gene rs-number d N cases N sub-cohort IRR/OR (95 % CI) a P int b Comments c First author Year References ABCB1 (MDR1) rs1045642 3435 CC 73 118 1.08 (1.00-1.16) 1, 2, 3 Andersen 2009 Andersen et al. (2009) CT-TT 286 647 1.00 (0.95-1.06) 0.02 1, 2, 3 Andersen et al. (2009) rs3789243 Intron 3 GG 81 224 0.95 (0.89-1.02) 1, 2, 3 Andersen et al. (2009) GA-AA 278 541 1.03 (0.98-1.09) 0.01 1, 2, 3 Andersen et al. (2009) ABCG2 (BCRP) rs2231142 C421A CC 296 592 1.02 (0.97-1.08) 1, 2, 3 Andersen et al. (2009) CA-AA 63 173 0.99 (0.91-1.08) 0.40 1, 2, 3 Andersen et al. (2009) ABCC2 (MRP2) rs717620 C-24T CC 260 508 1.02 (0.97-1.07) 1, 2, 3 Andersen 2012 Andersen et al. (2012b) CT-TT 129 280 1.03 (0.95-1.12) 0.72 1, 2, 3 Andersen et al. (2012b) rs2273697 G1249A GG 238 480 1.05 (0.99-1.11) 1, 2, 3 Andersen et al. (2012b) AG-AA 151 308 0.98 (0.91-1.05) 0.10 1, 2, 3 Andersen et al. (2012b) rs3740066 C3972T CC 143 301 1.01 (0.96-1.08) 1, 2, 3 Andersen et al. (2012b) CT-TT 246 487 1.03 (0.97-1.10) 0.69 1, 2, 3 Andersen et al. (2012b) Cytokines IL10 rs1800872 C-592A CC 238 470 1.02 (0.97-1.07) 1, 2, 3, 9 Andersen 2012 Andersen et al. (2012b) AC-AA 140 305 1.02 (0.95-1.11) 0.92 1, 2, 3, 9 Andersen et al. (2012b) rs3024505 CC 268 553 1.02 (0.96-1.08) 1, 2, 3, 9 Andersen et al. (2012b) CT-TT 110 222 1.03 (0.96-1.10) 0.78 1, 2, 3, 9 Andersen et al. (2012b) IL10 rs1800872 C-592A CC 596 1072 1.02 (0.98-1.06) 1, 2, 3 Andersen 2013 Andersen et al. (2013b) AC-AA 353 676 1.00 (0.95-1.06) 0.46 1, 2, 3 Andersen et al. (2013b) rs3024505 CC 648 1,200 1.00 (0.96-1.04) 1, 2, 3 Andersen et al. (2013b) CT-TT 297 565 1.06 (1.00-1.11) 0.04 1, 2, 3 Andersen et al. (2013b) IL1B rs4848306 C-3737T CC 336 560 1.01 (0.96-1.07) 1, 2, 3 Andersen et al. (2013b) CT-TT 605 1,186 1.02 (0.98-1.06) 0.65 1, 2, 3 Andersen et al. (2013b) rs1143623 G-1464C GG 454 925 1.02 (0.97-1.06) 1, 2, 3 Andersen et al. (2013b) GC-CC 492 824 1.02 (0.97-1.07) 0.94 1, 2, 3 Andersen et al. (2013b) rs1143627 T-31C TT 389 773 1.00 (0.96-1.05) 1, 2, 3 Andersen et al. (2013b) TC-CC 557 983 1.03 (0.98-1.07) 0.40 1, 2, 3 Andersen et al. (2013b) Transcription factors NFKB1 rs28362491 -94 ins/del II 122 307 0.96 (0.90-1.04) 1, 2, 3 Andersen 2010 Andersen et al. (2010) ID-DD 261 456 1.03 (0.97-1.08) 0.03 1, 2, 3 Andersen et al. (2010) NR1I2 (PXR) rs1523127 A-24381C AA 131 261 1.04 (0.97-1.12) 1, 2, 3 Andersen et al. (2010) AC-CC 252 502 1.01 (0.95-1.06) 0.20 1, 2, 3 Andersen et al. (2010) rs2276707 C8055T CC 237 448 1.02 (0.96-1.08) 1, 2, 3 Andersen et al. (2010) CT-TT 146 315 1.01 (0.95-1.08) 0.74 1, 2, 3 Andersen et al. (2010) rs6785049 A7635G AA 137 264 1.01 (0.95-1.07) 1, 2, 3 Andersen et al. (2010) Table 1 continued Gene rs-number d N cases N sub-cohort IRR/OR (95 % CI) a P int b Comments c First author Year References AG-GG 246 499 1.02 (0.96-1.08) 0.60 1, 2, 3 Andersen et al. (2010) NR1H2 (LXR) rs1405655 CC 40 76 1.01 (0.93-1.10) 1, 2, 3 Andersen et al. (2010) CT-TT 343 687 1.02 (0.96-1.07) 0.94 1, 2, 3 Andersen et al. (2010) rs2695121 TT 117 227 1.03 (0.96-1.11) 1, 2, 3 Andersen et al. (2010) CT-CC 266 536 1.01 (0.96-1.07) 0.43 1, 2, 3 Andersen et al. (2010) Heme oxygenase Andersen et al. (2011a) HMOX1 (HO-1) rs2071746 A-413T AA 118 260 1.00 (0.93-1.08) 1, 2, 3 Andersen 2011 Andersen et al. (2011a, b) AT-TT 265 503 1.02 (0.97-1.08) 0.55 1, 2, 3 Andersen et al. (2011a, b) DNA repair MSH3 rs184967 R940Q RR 127 8, 10 Berndt 2007 Berndt et al. (2007) RQ-QQ 65 0.08 8, 10 Berndt et al. (2007) MSH3 rs26279 T1036A TT 85 8, 10 Berndt et al. (2007) TA-AA 102 0.002 8, 10 Berndt et al. (2007) MSH6 rs1042821 G39E GG 118 8, 10 Berndt et al. (2007) GE-EE 54 0.29 8, 10 Berndt et al. (2007) MLH1 rs1799977 I219V II 84 8, 10 Berndt et al. (2007) IV-VV 101 0.40 8, 10 Berndt et al. (2007) XPC Rs2228001 d Lys939Gln AA 141 307 1.17 (0.71-1.92) 7, 11 Hansen 2007 Hansen et al. (2007) AC 204 392 1.11 (0.70-1.75) 7, 11 Hansen et al. (2007) CC 50 98 3.70 (1.70-8.04) 0.01 7, 11 Hansen et al. (2007) XPA A23G GG 176 339 1.30 (0.78-2.17) 7, 11 Hansen et al. (2007) AG 187 359 1.41 (0.87-2.26) 7, 11 Hansen et al. (2007) AA 31 90 0.76 (0.34-1.66) 0.37 7, 11 Hansen et al. (2007) ERCC2 (XPD) Rs1799793 d Asp312Asn GG 159 333 1.25 (0.69-2.26) 7, 11 Hansen et al. (2007) AG 191 354 1.25 (0.83-1.87) 7, 11 Hansen et al. (2007) AA 46 108 1.22 (0.61-2.45) 1.00 7, 11 Hansen et al. (2007) XPC Rs2228001 d Lys939Gln AA 141 307 0.63 (0.23-1.69) 8, 11 Hansen et al. (2007) AC 204 392 0.94 (0.41-2.15) 8, 11 Hansen et al. (2007) CC 50 98 3.78 (0.64-22.29) 0.20 8, 11 Hansen et al. (2007) XPA A23G GG 176 339 0.58 (0.23-1.48) 8, 11 Hansen et al. (2007) AG 187 359 1.87 (0.73-4.83) 8, 11 Hansen et al. (2007) AA 31 90 0.31 (0.06-1.64) 0.06 8, 11 Hansen et al. (2007) Data from (Chen et al. 1998; Tiemersma et al. 2002; Sorensen et al. 2008; Chan et al. 2011) have been presented in a previous review (Andersen et al. 2013a, b). Login to comment