ABCG2 p.Asp620Asn
| Predicted by SNAP2: | A: D (75%), C: D (85%), E: D (75%), F: D (85%), G: D (80%), H: D (91%), I: D (91%), K: D (91%), L: D (91%), M: D (91%), N: D (75%), P: D (91%), Q: D (85%), R: D (95%), S: D (75%), T: D (85%), V: D (91%), W: D (91%), Y: D (91%), |
| Predicted by PROVEAN: | A: D, C: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Single-nucleotide polymorphism (SNP) analysis in t... Cancer Biol Ther. 2002 Nov-Dec;1(6):696-702. Honjo Y, Morisaki K, Huff LM, Robey RW, Hung J, Dean M, Bates SE
Single-nucleotide polymorphism (SNP) analysis in the ABC half-transporter ABCG2 (MXR/BCRP/ABCP1).
Cancer Biol Ther. 2002 Nov-Dec;1(6):696-702., [PMID:12642696]
Abstract [show]
Variations in the amino acid sequence of ABC transporters have been shown to impact substrate specificity. We identified two acquired mutations in ABCG2, the ABC half-transporter overexpressed in mitoxantrone-resistant cell lines. These mutations confer differences in substrate specificity and suggest that naturally occurring variants could also affect substrate specificity. To search for the existence of single nucleotide polymorphisms (SNPs) in ABCG2, we sequenced 90 ethnically diverse DNAs from the Single Nucleotide Polymorphism Discovery Resource representing the spectrum of human genotypes. We identified 3 noncoding SNPs in the untranslated regions, 3 nonsynonymous and 2 synonymous SNPs in the coding region and 7 SNPs in the intron sequences adjacent to the sixteen ABCG2 exons. Nonsynonymous SNPs at nucleotide 238 (V12M; exon 2) and nucleotide 625 (Q141K; exon 5) showed a greater frequency of heterozygosity (22.2% and 10%) than the SNP at 2062 (D620N; exon 16). Heterozygous changes at nucleotide 238 are in linkage disequilibrium with an SNP observed 36 bases downstream from the end of exon 2. No polymorphism at amino acid 482 was identified to correspond to the R to G or R to T mutations previously found in two drug resistant cell lines. Among 23 drug resistant sublines for which sequence at position 482 was determined, no additional mutations were found. Heterozygosity at amino acid 12 allowed us to identify overexpression of a single allele in a subset of drug resistant cell lines, a feature that could be exploited clinically in evaluating the significance of ABCG2 expression in malignancy. We conclude that ABCG2 is well conserved and that described amino acid polymorphisms seem unlikely to alter transporter stability or function.
Comments [show]
None has been submitted yet.
No. Sentence Comment
6 Nonsynonymous SNPs at nucleotide 238 (V12M; exon 2) and nucleotide 625 (Q141K; exon 5) showed a greater frequency of heterozygosity (22.2% and 10%) than the SNP at 2062 (D620N; exon 16).
X
ABCG2 p.Asp620Asn 12642696:6:170
status: VERIFIED104 Amplification in the MCF-7 SINGLE-NUCLEOTIDE POLYMORPHISM (SNP) ANALYSIS IN THE ABC HALF-TRANSPORTER ABCG2 (MXR/BCRP/ABCP1) www.landesbioscience.com Cancer Biology & Therapy 699 Table 2 PRIMERS USED IN SEQUENCING 90 DNA SAMPLES Forward Primer (5`-> 3`) Reverse Primer (5`-> 3`) Exon 1 TGCCCACTCAAAAGGTTC CCAACCCACACTTAACACAC Exon 2 TGTCACCTAGTGTTTGCAATC GCCAGTTTCTTGGAAATAGCC Exon 3 AATCCTGCTTTGGTCTCC TCTCCCATTCTTTTTCCTC Exon 4 AGCATGTGTTGGAGGGAAAA ATCAGCCAAAGCACTTACCC Exon 5 GCAGGCTTTGCAGACATCTA TGCTGATCATGATGCTTTCA Exon 6 TCTTACAGGACTGGCACACG CCCCAAGAATATCTGGGACA Exon 7 TCAGGCTGAACTAGAGCAAACA CAAACAGCACTCCTGCAGAC Exon 8 CATGGGAAGAAGAGAGAAAG GTTGACTGGTATCAGAAGAC Exon 9 ACTCCTGACCTCGTAATCC GAAGCAGATGATAACAGAACC Exon 10 TCTAATTGAAACTCTTCCCC AGTTCGAAGCCAGTCTAGC Exon 11 TGAGTTGACTGCGGTGATTT GTAATCCTCCGGATCCCATC Exon 12 GTCTAGCCCTGAGGATGTGG TGCAAAATGGACAGGTGTTT Exon 13 CAGACACAACATTGGAGAC TAAGGGCAAAGAGGAAAG Exon 14 CTGCATGAAATTACTCAAGC CCATCCTCTCATTTACTTCC Exon 15 AAACTGTTTACCTTGCCC GCACCTCACTTCAATCTC Exon 16 GAGTAACATTTGACGGATG CTCTACTCTACCCACAGTTC Table 3 RESULTS OF SNP ANALYSIS OF 16 EXONS ENCODING ABCG2* Wild-type Frequency Frequency Frequency Amino Acid Exon Nucleotide+ allele SNP Wt/Wt Wt/Var Var/Var aa# 1 91 C T 98.9% 1.1% Noncoding 175 A G 97.8% 2.2% Noncoding 2 238 G A 76.7% 22.2% 1.1% 12 Val to Met 5 625 C A 88.9% 10% 1.1% 141 Gln to Lys 9 1302 G A 97.8% 2.2% 366 Glu to Glu 12 1629 A G 98.9% 1.1% 475 Leu to Leu 16 2062 G A 98.9% 1.1% 620 Asp to Asn 2597 C A 98.9% 1.1% Noncoding Intronic Variants 2 +36** A G 76.7% 22.2% 1.1% 6 -16 A G 88.9% 8.9% 2.2% 7 -20 T A 98.9% 1.1% +18 A G 93.3% 5.6% 1.1% 11 +20 A G 63.3% 27.8% 8.9% 12 +49 G T 75.6% 22.2% 2.2% 14 -21 C T 67.8% 28.9% 3.3% *Identified SNPs are recorded in the table with all 16 exons sequenced in 90 DNA samples.
X
ABCG2 p.Asp620Asn 12642696:104:1461
status: VERIFIED[hide] Multidrug resistance in cancer chemotherapy and xe... Curr Med Chem Anticancer Agents. 2004 Jan;4(1):31-42. Han B, Zhang JT
Multidrug resistance in cancer chemotherapy and xenobiotic protection mediated by the half ATP-binding cassette transporter ABCG2.
Curr Med Chem Anticancer Agents. 2004 Jan;4(1):31-42., [PMID:14754410]
Abstract [show]
ABCG2, also termed BCRP/MXR/ABCP, is a half ATP-binding cassette (ABC) transporter expressed on plasma membranes. ABCG2 was independently cloned from placenta as well as cell lines selected for resistance to mitoxantrone or anthracyclines. ABCG2 consists of a nucleotide-binding domain (NBD) at the amino terminus and a transmembrane domain (TMD) at the carboxyl terminus and it is postulated to form a homodimer to perform its biological functions. Over-expression of ABCG2 in cell lines confers resistance on a wide variety of anticancer drugs including mitoxantrone, daunorubicin, doxorubicin, topotecan and epirubicin. The expression of ABCG2 has been implicated in multidrug resistance (MDR) of acute myeloid leukemia and some solid tumors. In addition, ABCG2 can transport several fluorescent dyes or toxins. ABCG2 is found to be expressed in epithelial cells of intestine and colon, liver canaliculi, and renal tubules, where it serves to eliminate the plasma level of orally administered anticancer drugs as well as ingested toxins. ABCG2 is found to be highly expressed in placenta and the luminal surface of microvessel endothelium blood-brain barrier where it may play a role in limiting the penetration of drugs, such as topotecan from the maternal plasma into the fetus and from blood to brain. A variety of inhibitors for ABCG2 including GF120918 may prove useful for sensitizing cancer cells to chemotherapy or altering the distribution of orally administered drug substrates of ABCG2. Interestingly, ABCG2 is also expressed highly in hematopoietic stem cells. However, the function of ABCG2 in stem cells is currently unknown, although it may provide protection to stem cells from a variety of xenobiotics.
Comments [show]
None has been submitted yet.
No. Sentence Comment
108 Nonsynonymous SNPs at nucleotide 238 (Val12 Met; exon 2) and nucleotide 625 (Gln141 Lys; exon 5) showed a greater frequency of heterozygosity (22.2% and 10%, respectively) than the SNP at 2062 (Asp620 Asn; exon 16).
X
ABCG2 p.Asp620Asn 14754410:108:194
status: VERIFIED[hide] Functional analysis of the human variants of breas... Drug Metab Dispos. 2005 Jun;33(6):697-705. Epub 2005 Mar 2. Vethanayagam RR, Wang H, Gupta A, Zhang Y, Lewis F, Unadkat JD, Mao Q
Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N.
Drug Metab Dispos. 2005 Jun;33(6):697-705. Epub 2005 Mar 2., [PMID:15743976]
Abstract [show]
Previous studies have shown that the V12M and Q141K variants of breast cancer resistance protein (BCRP) can affect expression and function of the transporter. In this study, the effects of the I206L, N590Y, and D620N variants on protein expression, plasma membrane localization, and transport activity of BCRP were investigated. Wild-type BCRP and the three variants were stably expressed in human embryonic kidney (HEK) cells. Confocal microscopy analysis showed that the three variants were predominantly routed to the plasma membrane of HEK cells. The expression level of I206L in the plasma membrane was approximately 45% of that of wild-type protein, whereas the N590Y and D620N levels were increased approximately 3.6-fold and 2.4-fold, respectively, as determined by immunoblotting. All three variants transported mitoxantrone, pheophorbide a, and BODIPY FL-prazosin. After normalization for differences in BCRP expression, I206L, N590Y, and D620N exhibited approximately 2-fold, 0.3-fold, and 0.5-fold wild-type efflux activities, respectively. The variants also conferred resistance to mitoxantrone and topotecan. Mitoxantrone and topotecan resistance by I206L and N590Y was approximately 2-fold and 0.3-fold of the wild-type BCRP resistance levels, respectively. Although D620N conferred a topotecan resistance similar to that of the wild-type protein, its level of mitoxantrone resistance was decreased by 50%. After normalization to BCRP expression levels, ATPase activities of I206L were not significantly different from those of wild-type protein, whereas N590Y and D620N exhibited approximately 30% and 50% of wild-type ATPase activities, respectively. These results suggest that I206L has the lowest protein expression and the highest activity, whereas N590Y and D620N display higher expression and lower activity, relative to wild-type BCRP.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 In this study, the effects of the I206L, N590Y, and D620N variants on protein expression, plasma membrane localization, and transport activity of BCRP were investigated.
X
ABCG2 p.Asp620Asn 15743976:1:52
status: VERIFIED4 The expression level of I206L in the plasma membrane was approximately 45% of that of wild-type protein, whereas the N590Y and D620N levels were increased approximately 3.6-fold and 2.4-fold, respectively, as determined by immunoblotting. All three variants transported mitoxantrone, pheophorbide a, and BODIPY FL-prazosin.
X
ABCG2 p.Asp620Asn 15743976:4:127
status: VERIFIED5 After normalization for differences in BCRP expression, I206L, N590Y, and D620N exhibited approximately 2-fold, 0.3-fold, and 0.5-fold wild-type efflux activities, respectively.
X
ABCG2 p.Asp620Asn 15743976:5:74
status: VERIFIED8 Although D620N conferred a topotecan resistance similar to that of the wild-type protein, its level of mitoxantrone resistance was decreased by 50%.
X
ABCG2 p.Asp620Asn 15743976:8:9
status: VERIFIED9 After normalization to BCRP expression levels, ATPase activities of I206L were not significantly different from those of wild-type protein, whereas N590Y and D620N exhibited approximately 30% and 50% of wild-type ATPase activities, respectively.
X
ABCG2 p.Asp620Asn 15743976:9:158
status: VERIFIED10 These results suggest that I206L has the lowest protein expression and the highest activity, whereas N590Y and D620N display higher expression and lower activity, relative to wild-type BCRP.
X
ABCG2 p.Asp620Asn 15743976:10:111
status: VERIFIED21 Other variants such as I206L, N590Y, and D620N are generally much less frequent, with allele frequencies of approximately 1% or less (Honjo et al., 2002; Zamber et al., 2003).
X
ABCG2 p.Asp620Asn 15743976:21:41
status: VERIFIED29 Functional analysis of the I206L, N590Y, and D620N variants of BCRP has not been reported so far.
X
ABCG2 p.Asp620Asn 15743976:29:45
status: VERIFIED30 In the present study, we stably expressed wild-type BCRP and the variants I206L, N590Y, and D620N in HEK cells and analyzed the effects of the variants on BCRP expression, plasma membrane localization, transport, and ATPase activities, as well as drug resistance characteristics.
X
ABCG2 p.Asp620Asn 15743976:30:92
status: VERIFIED45 The variants I206L, N590Y, and D620N were then generated using the QuickChange Site-directed Mutagenesis Kit (Stratagene) and the pBluescript SK(ϩ) plasmid carrying wild-type BCRP cDNA as a template, according to the manufacturer`s instructions.
X
ABCG2 p.Asp620Asn 15743976:45:31
status: VERIFIED47 The primer pairs for I206L were 5Ј-CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG-3Ј and 5ЈCTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG-3Ј; the primer pairs for N590Y were 5Ј-GA- ATTTTTGGGACAATACTTCTGCCCAGGACTC-3Ј and 5Ј-GAGTCCT- GGGCAGAAGTATTGTCCCAAAAATTC-3Ј; and the primer pairs for D620N were 5Ј-GTAAAGCAGGGCATCAATCTCTCACCCTGGGGC-3Ј and 5Ј-GCCCCAGGGTGAGAGATTGATGCCCTGCTTTAC-3Ј.
X
ABCG2 p.Asp620Asn 15743976:47:316
status: VERIFIED128 Results Stable Expression of Wild-Type BCRP and the I206L, N590Y, and D620N Variants in HEK Cells.
X
ABCG2 p.Asp620Asn 15743976:128:70
status: VERIFIED129 To examine the effects of I206L, N590Y, and D620N on protein expression, plasma membrane localization, and function of BCRP, we generated the three variants by site-directed mutagenesis.
X
ABCG2 p.Asp620Asn 15743976:129:44
status: VERIFIED133 Figure 1A shows a typical immunoblot of whole cell lysates prepared from various cell lines (482R-13, 482R-21, I206L-13, I206L-20, N590Y-1, N590Y-13, D620N-9, and D620N-10) that express the highest levels of BCRP.
X
ABCG2 p.Asp620Asn 15743976:133:150
status: VERIFIEDX
ABCG2 p.Asp620Asn 15743976:133:163
status: VERIFIED134 The cell lines 482R-21, I206L-13, N590Y-1, and D620N-9 were used in all subsequent experiments.
X
ABCG2 p.Asp620Asn 15743976:134:47
status: VERIFIED136 Expression levels of wild-type BCRP and its variants I206L, N590Y, and D620N in stably transfected HEK cells.
X
ABCG2 p.Asp620Asn 15743976:136:71
status: VERIFIED143 A typical immunoblot of the plasma membrane preparations showed that I206L, N590Y, and D620N were expressed at levels of approximately 0.45-fold, 3.6-fold, and 2.4-fold those of the wild-type protein (482R), respectively (Fig. 1B).
X
ABCG2 p.Asp620Asn 15743976:143:87
status: VERIFIED148 The I206L, N590Y, and D620N Variants Were Predominantly Routed to the Plasma Membrane.
X
ABCG2 p.Asp620Asn 15743976:148:22
status: VERIFIED149 To explore whether the variants might influence plasma membrane localization of BCRP, the 482R-21, I206L-13, N590Y-1, and D620N-9 cells were examined by immunofluorescent confocal microscopy.
X
ABCG2 p.Asp620Asn 15743976:149:122
status: VERIFIED150 Cells transfected with cDNAs of wild-type BCRP (482R-21) and the three variants (I206L-13, N590Y-1, and D620N-9) showed strong plasma membrane staining (Fig. 2), suggesting that, similar to wild-type BCRP, all three variants were predominantly routed to the plasma membrane.
X
ABCG2 p.Asp620Asn 15743976:150:104
status: VERIFIED153 To further confirm cell surface expression of the variants, the 482R, I206L, N590Y, and D620N cells were incubated with the phycoerythrin-labeled anti-BCRP surface mAb 5D3 and the IgG negative control.
X
ABCG2 p.Asp620Asn 15743976:153:88
status: VERIFIED158 The relative levels of I206L, N590Y, and D620N on the cell surface were calculated from three independent experiments to be approximately 0.79-fold, 3.1-fold, and 1.3-fold those of wild-type BCRP, respectively.
X
ABCG2 p.Asp620Asn 15743976:158:41
status: VERIFIED168 Selected areas of HEK cells expressing wild-type BCRP (482R) and the variants I206L, N590Y, and D620N are shown.
X
ABCG2 p.Asp620Asn 15743976:168:96
status: VERIFIED182 The cells expressing I206L exhibited apparent efflux activities comparable to those of the cells expressing wild-type BCRP for all three fluorescence compounds tested, whereas the cells expressing N590Y and D620N showed higher efflux activities.
X
ABCG2 p.Asp620Asn 15743976:182:207
status: VERIFIED184 After normalization, the efflux activities of I206L were approximately 2to 3-fold those of wild-type BCRP for the three fluorescent substrates, and the efflux activities were reduced by approximately 60 to 70% and 40 to 50% for N590Y and D620N, respectively (Table 1).
X
ABCG2 p.Asp620Asn 15743976:184:238
status: VERIFIED197 MX resistance conferred by D620N was decreased by approximately 50%, whereas its level of topotecan resistance remained essentially unchanged.
X
ABCG2 p.Asp620Asn 15743976:197:27
status: VERIFIED201 A similar pattern of the effects of MX, prazosin, and FTC on the basal ATPase activities of I206L, N590Y, and D620N was observed.
X
ABCG2 p.Asp620Asn 15743976:201:110
status: VERIFIED203 In contrast, N590Y and D620N exhibited basal ATPase activities and ATPase activities in the presence of MX and prazosin that were approximately 30% and 50% of the wild-type activities, respectively.
X
ABCG2 p.Asp620Asn 15743976:203:23
status: VERIFIED204 Moreover, the basal ATPase activities of N590Y and D620N and their prazosin-stimulated ATPase activities were significantly different from the respective activities of wild-type BCRP (Fig. 6).
X
ABCG2 p.Asp620Asn 15743976:204:51
status: VERIFIED223 In the present study, we examined the I206L, N590Y, and D620N TABLE 1 FTC-inhibitable efflux activities of HEK cells expressing wild-type BCRP and its variants The FTC-inhibitable efflux activities of fluorescent compounds are represented by the differences (⌬F) in the median fluorescence between the FTC/efflux histograms and the efflux histograms.
X
ABCG2 p.Asp620Asn 15743976:223:56
status: VERIFIED228 MX PhA BODIPY-Prazosin Rhodamine 123 (⌬F) ⌬F Ratio ⌬F Ratio ⌬F Ratio pcDNA 0 11.4 Ϯ 7.1 0 0 482R-21 42.5 Ϯ 8.4 1.0 121.9 Ϯ 27.5 1.0 127.0 Ϯ 51.5 1.0 0 I206L-13 52.8 Ϯ 3.0 2.76 131.7 Ϯ 17.3 2.40 127.2 Ϯ 80.2 2.23 0 N590Y-1 64.7 Ϯ 4.7* 0.42 149.3 Ϯ 22.2 0.34 147.5 Ϯ 97.1 0.32 0 D620N-9 67.1 Ϯ 7.1* 0.63 168.2 Ϯ 29.8* 0.55 149.1 Ϯ 68.7 0.47 0 * Indicates that the un-normalized ⌬F values for the 482R cells are significantly different (p Ͻ 0.05) from the N590Y or D620N cells as calculated by Student`s t test. variants.
X
ABCG2 p.Asp620Asn 15743976:228:365
status: VERIFIEDX
ABCG2 p.Asp620Asn 15743976:228:581
status: VERIFIED229 I206L, N590Y, and D620N were stably expressed in HEK cells.
X
ABCG2 p.Asp620Asn 15743976:229:18
status: VERIFIED230 The immunoblots of the plasma membranes revealed a markedly lower protein level for I206L compared with wild-type BCRP, whereas the levels of N590Y and D620N were increased (Fig. 1B).
X
ABCG2 p.Asp620Asn 15743976:230:152
status: VERIFIED240 The N590Y and D620N variants are predicted to be in the extracellular loop connecting the fifth and sixth TM segments of BCRP.
X
ABCG2 p.Asp620Asn 15743976:240:14
status: VERIFIED242 The efflux activities of D620N for MX, PhA, and BODIPY-prazosin were also reduced, but to a lesser extent as compared with N590Y (Table 1).
X
ABCG2 p.Asp620Asn 15743976:242:25
status: VERIFIED243 Whereas D620N conferred resistance to MX at a level approximately 50% of that of wild-type BCRP, its resistance to topotecan was essentially unchanged (Table 2).
X
ABCG2 p.Asp620Asn 15743976:243:8
status: VERIFIED244 These data indicate that the naturally occurring N590Y and D620N mutations in the extracellular loop can alter function and substrate selectivity of BCRP without significantly affecting cell surface expression, and that a mutation such as D620N in BCRP could affect recognition of one substrate but not the other, likely due to the existence of different ligand binding sites on BCRP, which has been implicated in previous studies (Nakanishi et al., 2003; Gupta et al., 2004).
X
ABCG2 p.Asp620Asn 15743976:244:59
status: VERIFIEDX
ABCG2 p.Asp620Asn 15743976:244:239
status: VERIFIED247 The cells expressing wild-type BCRP (Œ), the variants I206L (‚), N590Y (Ⅺ), and D620N (छ), and the vector control cells (F) were exposed to MX (A), topotecan (B), daunorubicin (C), and rhodamine 123 (D) at the various concentrations indicated.
X
ABCG2 p.Asp620Asn 15743976:247:100
status: VERIFIED256 MX Topotecan Daunorubicin Rhodamine 123 IC50 RR Ratio IC50 RR Ratio IC50 RR IC50 RR nM nM nM nM pcDNA 32.5 Ϯ 3.1 8.5 Ϯ 1.0 34.2 Ϯ 4.1 5797.9 Ϯ 1209.4 482R-21 226.3 Ϯ 27.4 7.0 1.0 122.8 Ϯ 23.3 14.4 1.0 40.0 Ϯ 1.7 1.2 10281.0 Ϯ 1445.4 1.7 I206L-13 209.7 Ϯ 19.5 6.5 2.06 124.9 Ϯ 17.1 14.7 2.25 25.6 Ϯ 2.8 0.7 8829.4 Ϯ 1454.8 1.5 N590Y-1 287.9 Ϯ 24.0* 8.9 0.35 130.5 Ϯ 17.8 15.4 0.30 19.9 Ϯ 2.3 0.6 7867.9 Ϯ 3691.1 1.3 D620N-9 271.9 Ϯ 33.3* 8.4 0.48 278.3 Ϯ 18.9* 32.7 0.91 31.6 Ϯ 1.8 0.9 15469.3 Ϯ 1762.5 2.6 * Indicates that the un-normalized IC50 values of the 482R cells are significantly different (p Ͻ 0.05) from the N590Y or D620N cells as calculated by Student`s t test. ATPase activities of both N590Y and D620N were also decreased to approximately 30 to 50% of the wild-type activities (Fig. 6).
X
ABCG2 p.Asp620Asn 15743976:256:511
status: VERIFIEDX
ABCG2 p.Asp620Asn 15743976:256:754
status: VERIFIEDX
ABCG2 p.Asp620Asn 15743976:256:838
status: VERIFIED261 Our data, demonstrating that the efflux activities and drug resistance capabilities of N590Y and D620N, except for the topotecan resistance, are decreased, indicate that amino acid changes in the extracellular loop of BCRP can selectively affect function of the transporter.
X
ABCG2 p.Asp620Asn 15743976:261:97
status: VERIFIED265 However, the immunoblots of both whole cell lysates and the plasma membranes did not illustrate any reduction or increase in molecular weight of N590Y and D620N compared with wild-type protein (Fig. 1).
X
ABCG2 p.Asp620Asn 15743976:265:155
status: VERIFIED266 These results rule out the possibility that N590Y and D620N would be involved in N-glycosylation.
X
ABCG2 p.Asp620Asn 15743976:266:54
status: VERIFIED267 Interestingly, ATPase activities of N590Y and D620N were coincidentally impaired as the transport activities, even though the two mutations are not within the NBD.
X
ABCG2 p.Asp620Asn 15743976:267:46
status: VERIFIED269 These data suggest that, whereas ATPase activities of BCRP could be affected by mutations in the NBD (e.g., Q141K and I206L), mutations in other regions including the TM segments (e.g., G406L/G410L) and extracellular loops (e.g., N590Y and D620N) can also influence ATP hydrolysis.
X
ABCG2 p.Asp620Asn 15743976:269:240
status: VERIFIED272 The D620N variant was detected in 1.1% of all DNA samples examined with unknown genetic origin (Honjo et al., 2002).
X
ABCG2 p.Asp620Asn 15743976:272:4
status: VERIFIED273 The in vitro analysis in this study revealed that, after normalization to the BCRP expression levels, the specific activities of I206L, N590Y, and D620N were significantly altered as compared with wild-type BCRP; however, the overall efflux activities and drug resistance profiles of the cells expressing these variants remained essentially unchanged.
X
ABCG2 p.Asp620Asn 15743976:273:147
status: VERIFIED[hide] Single nucleotide polymorphisms modify the transpo... Cancer Chemother Pharmacol. 2005 Aug;56(2):161-72. Epub 2005 Apr 19. Morisaki K, Robey RW, Ozvegy-Laczka C, Honjo Y, Polgar O, Steadman K, Sarkadi B, Bates SE
Single nucleotide polymorphisms modify the transporter activity of ABCG2.
Cancer Chemother Pharmacol. 2005 Aug;56(2):161-72. Epub 2005 Apr 19., [PMID:15838659]
Abstract [show]
Single nucleotide polymorphism (SNP) analyses of the ABCG2 gene have revealed three nonsynonymous SNPs resulting in the amino acid changes at V12M, Q141K and D620N. To determine whether the SNPs have an effect on drug transport, human embryonic kidney cells (HEK-293) were stably transfected with full length ABCG2 coding wild-type or SNP variants of ABCG2. In 4-day cytotoxicity assays with mitoxantrone, topotecan, SN-38 or diflomotecan, cells transfected with wild-type R482 ABCG2 showed IC50 values up to 1.2-fold to 5-fold higher than cells expressing comparable levels of Q141K ABCG2, suggesting that the Q141K SNP affects drug transport. FTC-inhibitable mitoxantrone efflux normalized to ABCG2 surface expression as assayed by the anti-ABCG2 antibody 5D3 was significantly lower in cells transfected with Q141K ABCG2 than in those transfected with wild-type R482 ABCG2 (P = 0.0048). Values for V12M and D620N ABCG2 were comparable to those for wild-type R482 ABCG2. The vanadate-sensitive ATPase activity of ABCG2 was assayed in Sf9 insect cells infected with wild-type or SNP variants of ABCG2. Basal ATPase activity in cells transfected with Q141K ABCG2 was 1.8-fold lower than in cells transfected with wild-type ABCG2, but was comparable among cells expressing wild-type, V12M or D620N ABCG2. Confocal studies of ABCG2 localization revealed higher intracellular staining in the Q141K transfectants than in cells transfected with wild-type or V12M ABCG2. Decreased transport of Hoechst 33342 was observed in Sf9 cells expressing V12M ABCG2; however, this was not true in HEK-293 cells expressing V12M ABCG2. These results suggest that the Q141K SNP affects the transport efficiency of ABCG2 and may result in altered pharmacokinetics or drug-resistance profiles in clinical oncology.
Comments [show]
None has been submitted yet.
No. Sentence Comment
0 ORIGINAL ARTICLE Kuniaki Morisaki Æ Robert W. Robey Csilla O¨ zvegy-Laczka Æ Yasumasa Honjo Orsolya Polgar Æ Kenneth Steadman Bala´ zs Sarkadi Æ Susan E. Bates Single nucleotide polymorphisms modify the transporter activity of ABCG2 Received: 21 July 2004 / Accepted: 1 October 2004 / Published online: 19 April 2005 Ó Springer-Verlag 2005 Abstract Single nucleotide polymorphism (SNP) analyses of the ABCG2 gene have revealed three nonsynonymous SNPs resulting in the amino acid changes at V12M, Q141K and D620N.
X
ABCG2 p.Asp620Asn 15838659:0:542
status: VERIFIED4 Values for V12M and D620N ABCG2 were comparable to those for wild-type R482 ABCG2.
X
ABCG2 p.Asp620Asn 15838659:4:20
status: VERIFIED6 Basal ATPase activity in cells transfected with Q141K ABCG2 was 1.8-fold lower than in cells transfected with wild-type ABCG2, but was comparable among cells expressing wild-type, V12M or D620N ABCG2.
X
ABCG2 p.Asp620Asn 15838659:6:188
status: VERIFIED30 We previously sequenced the ABCG2 gene in 90 genomic DNA samples representing a global genetic diversity and identified three nonsynonymous SNPs -34G fi A, substituting a valine for methionine (V12M); 421C fi A, substituting a glutamine for lysine (Q141K); and 1858C fi A, substituting an aspartic acid for asparagine (D620N)-in the coding region of ABCG2 [18].
X
ABCG2 p.Asp620Asn 15838659:30:319
status: VERIFIED37 containing full-length ABCG2 encoding wild-type (R482), mutant (R482T, R482G), or SNP variants (V12M, Q141K, or D620N) of ABCG2.
X
ABCG2 p.Asp620Asn 15838659:37:112
status: VERIFIED98 Clones were initially screened using the anti-ABCG2 antibody 5D3 and, from the positive clones obtained, 12 clones transfected with V12M, Q141K, D620N, or 1_11delV12M were selected for further study: V12M-12, -13 and -14; Q141K-5, -8, -13 and -16; D620N-2, -3 and -23; and 1_11delV12M-2 and -8.
X
ABCG2 p.Asp620Asn 15838659:98:145
status: VERIFIEDX
ABCG2 p.Asp620Asn 15838659:98:248
status: VERIFIED100 By Northern blot and immunoblot analysis, D620N- 3 and D620N-23 showed relatively low expression levels (Fig. 1a, b).
X
ABCG2 p.Asp620Asn 15838659:100:42
status: VERIFIEDX
ABCG2 p.Asp620Asn 15838659:100:55
status: VERIFIED108 a Northern blot analysis of ABCG2 expression in representative HEK-293 cells transfected with wild-type, V12M, Q141K, or D620N ABCG2.
X
ABCG2 p.Asp620Asn 15838659:108:121
status: VERIFIED122 Representative results are shown clones each of ABCG2-transfected cells expressing R482, R482T, R482G, V12M, Q141K or D620N ABCG2.
X
ABCG2 p.Asp620Asn 15838659:122:120
status: VERIFIED133 Efflux and expression values for cells transfected with V12M and D620N ABCG2 fell close to the line, while values for cells transfected with Q141K ABCG2 fell predominantly below the line.
X
ABCG2 p.Asp620Asn 15838659:133:65
status: VERIFIED135 Among the transfectants, Q141K variants showed significantly lower values compared to the transfectants with wild-type ABCG2 and the other SNP variants, V12M and D620N (P=0.0048, 0.0005, and 0.0126, respectively), suggesting that Q141K ABCG2 transports mitoxantrone less efficiently than wild-type ABCG2.
X
ABCG2 p.Asp620Asn 15838659:135:162
status: VERIFIED136 Although V12M and D620N variants showed somewhat higher efficiency of mitoxantrone transport than 482R, no statistically significant difference was found.
X
ABCG2 p.Asp620Asn 15838659:136:18
status: VERIFIED140 We next examined the ATPase activity of V12M, Q141K, and D620N variants using this system.
X
ABCG2 p.Asp620Asn 15838659:140:57
status: VERIFIED163 To examine whether the nonsynonymous SNPs in ABCG2 affect the transport of this compound, Hoechst 33342 dye transport was measured in intact Sf9 cells expressing wild-type, V12M, Q141K, or D620N ABCG2, as well as the nonfunctional mutant, R482G/K86M.
X
ABCG2 p.Asp620Asn 15838659:163:189
status: VERIFIED164 Immunoblot analysis of protein obtained from the infected cells is shown in Fig. 7a. Hoechst 33342 transport was comparable in cells expressing wild-type, Q141K or D620N ABCG2.
X
ABCG2 p.Asp620Asn 15838659:164:164
status: VERIFIED172 Representative histograms for 482R-9, 482G-1, V12M-13, D620N-2, Q141K-5, and 1_11delV12M-8 are shown substrate-free medium for 60 min continuing with or without FTC.
X
ABCG2 p.Asp620Asn 15838659:172:55
status: VERIFIED178 Discussion We and others have recently identified several polymorphisms in ABCG2, including three nonsynonymous SNPs resulting in amino acid substitution in the coding region of ABCG2: V12M, Q141K, D620N [4, 19, 20, 50].
X
ABCG2 p.Asp620Asn 15838659:178:198
status: VERIFIED189 Values from the experiment in a were obtained for ABCG2-transfected HEK-293 clones expressing varying levels of 482R, R482G, R482T, V12M, Q141K, and D620N ABCG2 and a box plot was generated.
X
ABCG2 p.Asp620Asn 15838659:189:149
status: VERIFIED205 a Immunoblot detection of human wild-type, D620N, Q141K and V12M ABCG2 expressed in Sf9 insect cells.
X
ABCG2 p.Asp620Asn 15838659:205:43
status: VERIFIED206 Membranes of Sf9 cells (1.5 lg total protein from V12M/Sf9, Q141K/Sf9 and D620N/Sf9, 1.0 lg from wild-type ABCG2/Sf9, and 1.2 lg from b-galactosidase/Sf9) dissolved in disaggregation buffer were subjected to electrophoresis on 7.5% Laemmli-type gels and blotted onto PVDF membranes, followed by immunodetection with the BXP-21 antibody. b ATPase activity measured in membranes of Sf9 cells expressing the wild-type, V12M, Q141K, and D620N variants of human ABCG2.
X
ABCG2 p.Asp620Asn 15838659:206:74
status: VERIFIEDX
ABCG2 p.Asp620Asn 15838659:206:433
status: VERIFIED212 When surface ABCG2 expression was used to normalize the FTC-inhibitable mitoxantrone efflux, we found that HEK-293 cells expressing Q141K ABCG2 transported mitoxantrone less efficiently than cells expressing wild-type, V12M or D620N ABCG2.
X
ABCG2 p.Asp620Asn 15838659:212:227
status: VERIFIED[hide] Mechanisms of resistance to anticancer drugs: the ... Pharmacogenomics. 2005 Mar;6(2):115-38. Lepper ER, Nooter K, Verweij J, Acharya MR, Figg WD, Sparreboom A
Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2.
Pharmacogenomics. 2005 Mar;6(2):115-38., [PMID:15882131]
Abstract [show]
ATP-binding cassette (ABC) genes play a role in the resistance of malignant cells to anticancer agents. The ABC gene products, including ABCB1 (P-glycoprotein) and ABCG2 (breast cancer-resistance protein [BCRP], mitoxantrone-resistance protein [MXR], or ABC transporter in placenta [ABCP]), are also known to influence oral absorption and disposition of a wide variety of drugs. As a result, the expression levels of these proteins in humans have important consequences for an individual's susceptibility to certain drug-induced side effects, interactions, and treatment efficacy. Naturally occurring variants in ABC transporter genes have been identified that might affect the function and expression of the protein. This review focuses on recent advances in the pharmacogenetics of the ABC transporters ABCB1 and ABCG2, and discusses potential implications of genetic variants for the chemotherapeutic treatment of cancer.
Comments [show]
None has been submitted yet.
No. Sentence Comment
157 Position in gene* Nucleotide‡ Region Wild-type allele Variant allele Amino acid Change -19572 to -19569 5`-Flanking region CTCA - CTCA deletion -19202 5` UTR G C -18845 5` UTR T C -18604 5` UTR A - Deletion -18482 -113 Exon 1 C T Non-coding -18398 -29 Exon 1 A G Non-coding 34 34 Exon 2 G A 12 Val to Met 71 71 Exon 2 C T 24 Ala to Val 114 114 Exon 2 T C 38 Synonymous 239 Intron 2 A G 7268 Intron 2 T C 7420 Intron 3 - T Insertion 8007 Intron 3 G A 8184 369 Exon 4 C T 123 Synonymous 8191 376 Exon 4 C T 126 Gln to Term 8825 421 Exon 5 C A 141 Gln to Lys 8862 458 Exon 5 C T 153 Thr to Met 8878 474 Exon 5 C T 158 Synonymous 8900 496 Exon 5 C G 166 Gln to Glu 18186 Intron 5 A G 18286 616 Exon 6 A C 206 Ile to Leu 18293 623 Exon 6 T C 208 Phe to Ser 21530 Intron 6 C T 21718 Intron 6 A G 21903 Intron 7 A G 24618 Intron 7 T A 26297 1098 Exon 9 G A 366 Synonymous 38389 1291 Exon 11 T C 431 Phe to Leu 38485 Intron 11 A G 40111 Intron 11 G A 40303 1425 Exon 12 A G 475 Synonymous 40322 1444 Exon 12 A G 482 Arg to Gly 40323 1445 Exon 12 G C 482 Arg to Thr 40343 1465 Exon 12 T C 489 Phe to Leu 40419 Intron 12 G T 42314 Intron 13 T G 44997 Intron 14 A G 45022 Intron 14 C T 45073 1768 Exon 15 A T 590 Asn to Tyr 47355 1858 Exon 16 G A 620 Asp to Asn 47734 2237 Exon 16 G T Non-coding 47890 2393 Exon 16 G T Non-coding 47891 2394 Exon 16 C A Non-coding ABC: ATP-binding cassette; UTR: Untranslated region.
X
ABCG2 p.Asp620Asn 15882131:157:1243
status: NEW[hide] Role of the breast cancer resistance protein (ABCG... AAPS J. 2005 May 11;7(1):E118-33. Mao Q, Unadkat JD
Role of the breast cancer resistance protein (ABCG2) in drug transport.
AAPS J. 2005 May 11;7(1):E118-33., [PMID:16146333]
Abstract [show]
The 72-kDa breast cancer resistance protein (BCRP) is the second member of the subfamily G of the human ATP binding cassette (ABC) transporter superfamily and thus also designated as ABCG2. Unlike P-glycoprotein and MRP1, which are arranged in 2 repeated halves, BCRP is a half-transporter consisting of only 1 nucleotide binding domain followed by 1 membrane-spanning domain. Current experimental evidence suggests that BCRP may function as a homodimer or homotetramer. Overexpression of BCRP is associated with high levels of resistance to a variety of anticancer agents, including anthracyclines, mitoxantrone, and the camptothecins, by enhancing drug efflux. BCRP expression has been detected in a large number of hematological malignancies and solid tumors, indicating that this transporter may play an important role in clinical drug resistance of cancers. In addition to its role to confer resistance against chemotherapeutic agents, BCRP actively transports structurally diverse organic molecules, conjugated or unconjugated, such as estrone-3-sulfate, 17beta-estradiol 17-(beta-D-glucuronide), and methotrexate. BCRP is highly expressed in the placental syncytiotrophoblasts, in the apical membrane of the epithelium in the small intestine, in the liver canalicular membrane, and at the luminal surface of the endothelial cells of human brain microvessels. This strategic and substantial tissue localization indicates that BCRP also plays an important role in absorption, distribution, and elimination of drugs that are BCRP substrates. This review summarizes current knowledge of BCRP and its relevance to multidrug resistance and drug disposition.
Comments [show]
None has been submitted yet.
No. Sentence Comment
161 For example, in a Japanese population studied, 39% to 50% are heterozygous and 7% are homozygous for the variant Q141K.95,96 In a Chinese population, 60% are heterozygous for Q141K.95 Several other variants such as I206L, N590Y, and D620N are much less frequent with allele frequencies of ~1%.95,97 For instance, N590Y is present in ~1.5% of Caucasians.95 I206L is found only in Hispanic populations so far.95 D620N is detected in 1.1% of all DNA samples examined with unknown genetic origin.97 In addition, a polymorphism in exon 4 that results in a substitution of stop codon for Gln at position 126 has also been identified.96 Amino acid changes at position 482 that were found in some drug-selected resistant cell lines have so far not been identified in normal populations or in DNA samples from cancer patients.49 In vitro functional characterization of the variants V12M and Q141K produced contradicting results.
X
ABCG2 p.Asp620Asn 16146333:161:233
status: NEWX
ABCG2 p.Asp620Asn 16146333:161:410
status: NEW[hide] Pharmacogenomics of the human ABC transporter ABCG... Naturwissenschaften. 2005 Oct;92(10):451-63. Ishikawa T, Tamura A, Saito H, Wakabayashi K, Nakagawa H
Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design.
Naturwissenschaften. 2005 Oct;92(10):451-63., [PMID:16160819]
Abstract [show]
In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.
Comments [show]
None has been submitted yet.
No. Sentence Comment
88 These SNPs showed higher allele frequencies than does the SNP D620N (Table 2).
X
ABCG2 p.Asp620Asn 16160819:88:62
status: VERIFIED113 These contradictory expression and localization data for ABCG2 variants indicate that differences in transfection conditions (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably Table 2 Frequencies of ABCG2 alleles in different ethnic groups Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) V12M c.34G>A Japanese 29 9 1 19.0 Imai et al. (2002) Japanese 10 - - 15.0 Zamber et al. (2003) Japanese 220 61 8 17.5 Kobayashi et al. (2005) Chinese 10 - - 20.0 Zamber et al. (2003) Southeast Asians 10 - - 45.0 Zamber et al. (2003) Pacific Islanders 7 - - 64.0 Zamber et al. (2003) Swedish 60 2 0 1.7 B¨ackstr¨om et al. (2003) Dutch 100 11 1 6.5 Bosch et al. (2005) Caucasian 86 - - 2.0 Zamber et al. (2003) Caucasian 150 27 2 10.3 Mizuarai et al. (2004) Caucasian 150 11 0 3.7 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 10.0 Zamber et al. (2003) Middle Eastern 20 - - 5.0 Zamber et al. (2003) Africans North of Sahara 7 - - 14.0 Zamber et al. (2003) African American 150 17 1 6.3 Kobayashi et al. (2005) Mexicans 10 - - 10.0 Zamber et al. (2003) Hispanic Livers 5 - - 40.0 Zamber et al. (2003) Mexican Indians 5 - - 90.0 Zamber et al. (2003) Q126Stop c.376C>T Japanese 124 3 0 1.2 Imai et al. (2002) Japanese 60 2 0 1.7 Itoda et al. (2003) Japanese 220 4 0 0.9 Kobayashi et al. (2005) Caucasian 150 0 0 0.0 Mizuarai et al. (2004) Caucasian 150 0 0 0.0 Kobayashi et al. (2005) African American 150 0 0 0.0 Kobayashi et al. (2005) Q141K c.421C>A Japanese 124 48 9 26.6 Imai et al. (2002) Japanese 10 - - 35.0 Zamber et al. (2003) Japanese 220 90 27 32.7 Kobayashi et al. (2005) Chinese 95 43 11 34.2 de Jong et al. (2004) Chinese 10 - - 35.0 Zamber et al. (2003) Southeast Asians 10 - - 15.0 Zamber et al. (2003) Pacific Islanders 7 - - 14.0 Zamber et al. (2003) Swedish 60 10 1 10.0 B¨ackstr¨om et al. (2003) Dutch 100 20 2 12.0 Bosch et al. (2005) Caucasian 85 - - 14.0 Zamber et al. (2003) Caucasian 172 33 3 11.3 de Jong et al. (2004) Caucasian 150 22 2 8.7 Mizuarai et al. (2004) Caucasian 150 25 4 11.0 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 5.0 Zamber et al. (2003) Middle Eastern 20 - - 13.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African, Sub-Saharan 938 14 1 0.9 de Jong et al. (2004) African American 24 - - 0.0 Zamber et al. (2003) African American 150 5 1 2.3 Kobayashi et al. (2005) African American 94 8 1 5.3 de Jong et al. (2004) Mexicans 10 - - 5.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 10.0 Zamber et al. (2003) R160Q c.479G>A Dutch 100 1 0 0.5 Bosch et al. (2005) I206L c.616A>C Japanese 10 - - 0.0 Zamber et al. (2003) Chinese 10 - - 0.0 Zamber et al. (2003) Southeast Asians 10 - - 0.0 Zamber et al. (2003) Pacific Islanders 7 - - 0.0 Zamber et al. (2003) Caucasian 65 - - 0.0 Zamber et al. (2003) Table 2 Continued Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) Ashkenazi Jewish 10 - - 0.0 Zamber et al. (2003) Middle Eastern 20 - - 0.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African American 15 - - 0.0 Zamber et al. (2003) Mexicans 10 - - 0.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 0.0 Zamber et al. (2003) F431L c.1291T>C Japanese 60 1 0 0.8 Itoda et al. (2003) S441N c.1322G>A Japanese 100 1 0 0.5 Kobayashi et al. (2005) F489L c.1465T>C Japanese 60 1 0 0.8 Itoda et al. (2003) Japanese 100 1 0 0.5 Kobayashi et al. (2005) R575Stop c.1723C>T Dutch 100 1 0 0.5 Bosch et al. (2005) N590Y c.1768A>T Caucasian 65 - - 1.0 Zamber et al. (2003) Caucasian 150 1 0 0.3 Mizuarai et al. (2004) African Americans 15 - - 0.0 Zamber et al. (2003) D620N c.1858G>A Dutch 100 1 0 0.5 Bosch et al. (2005) affect the cellular processing and sorting of these proteins.
X
ABCG2 p.Asp620Asn 16160819:113:3847
status: VERIFIED118 For this purpose, we have created variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) by site-directed mutagenesis.
X
ABCG2 p.Asp620Asn 16160819:118:125
status: VERIFIED130 After the normalization of expression levels, the V12M and T153M variants showed increased levels of MTX transport activity, whereas the I206L, N590Y, and D620N variants had lower transport activities.
X
ABCG2 p.Asp620Asn 16160819:130:155
status: VERIFIED[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]
Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
210 In different ethnic groups, seven naturally-occurring non-synonymous SNPs have been reported: V12M, Q126Stop, Q141K, I206L, F431L, S441N, F489L, N590Y and D620N.
X
ABCG2 p.Asp620Asn 16259577:210:155
status: VERIFIED213 Some of the above sequence variations showed an allele frequency of ~ 1% in distinct populations, Q126stop and F489L in the Japanese and N590Y in the Caucasian population [129-131,134,135], whereas most of the mutations were only detected in single individuals (e.g., I206L, F431L, S441N, D620N).
X
ABCG2 p.Asp620Asn 16259577:213:289
status: VERIFIED216 These SNPs showed a greater frequency of heterozygosity (22.2 and 10%) than did the SNP at nucleotide 2062 (D620N, exon 16).
X
ABCG2 p.Asp620Asn 16259577:216:108
status: VERIFIED250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins.
X
ABCG2 p.Asp620Asn 16259577:250:91
status: VERIFIED255 For this purpose, variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G and R482T) were created by site-directed mutagenesis (Figure 3).
X
ABCG2 p.Asp620Asn 16259577:255:109
status: VERIFIED267 The V12M and T153M variants showed increased levels of MTX transport activity, whereas the I206L, N590Y and D620N variants had lower transport activities.
X
ABCG2 p.Asp620Asn 16259577:267:108
status: VERIFIED[hide] Functional SNPs of the breast cancer resistance pr... Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21. Yanase K, Tsukahara S, Mitsuhashi J, Sugimoto Y
Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development.
Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21., 2006-03-08 [PMID:16303243]
Abstract [show]
Breast cancer resistance protein (BCRP) is a half-molecule ATP-binding cassette transporter that pumps out various anticancer agents such as 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. We have previously identified three polymorphisms within the BCRP gene, G34A (substituting Met for Val-12), C376T (substituting a stop codon for Gln-126) and C421A (substituting Lys for Gln-141). C421A BCRP-transfected murine fibroblast PA317 cells showed markedly decreased protein expression and low-level drug resistance when compared with wild-type BCRP-transfected cells. In contrast, G34A BCRP-transfected PA317 cells showed a similar protein expression and drug resistance profile to wild-type. The C376T polymorphism would be expected to have a considerable impact as active BCRP protein will not be expressed from a T376 allele. Hence, people with C376T and/or C421A polymorphisms may express low levels of BCRP, resulting in hypersensitivity of normal cells to BCRP-substrate anticancer agents. Estrogens, estrone and 17beta-estradiol, were previously found to restore drug sensitivity levels in BCRP-transduced cells by increasing the cellular accumulation of anticancer agents. BCRP transports sulfated estrogens but not free estrogens and in a series of screening experiments for synthesized and natural estrogenic compounds, several tamoxifen derivatives and phytoestrogens/flavonoids were identified that effectively circumvent BCRP-mediated drug resistance. The kinase inhibitors gefitinib and imatinib mesylate also interact with BCRP. Gefitinib, an inhibitor of epidermal growth factor receptor-tyrosine kinase, inhibits its transporter function and reverses BCRP-mediated drug resistance both in vitro and in vivo. BCRP-transfected human epidermoid carcinoma A431 cells and BCRP-transfected human non-small cell lung cancer PC-9 cells show gefitinib resistance. Imatinib, an inhibitor of BCR-ABL tyrosine kinase, also inhibits BCRP-mediated drug transport. Hence, both functional SNPs and inhibitors of BCRP reduce its transporter function and thus modulate substrate pharmacokinetics and pharmacodynamics.
Comments [show]
None has been submitted yet.
No. Sentence Comment
92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain.
X
ABCG2 p.Asp620Asn 16303243:92:814
status: NEW[hide] The role of the human ABCG2 multidrug transporter ... Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7. Cervenak J, Andrikovics H, Ozvegy-Laczka C, Tordai A, Nemet K, Varadi A, Sarkadi B
The role of the human ABCG2 multidrug transporter and its variants in cancer therapy and toxicology.
Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7., 2006-03-08 [PMID:16337740]
Abstract [show]
The human multidrug resistance ABC transporters provide a protective function in our body against a large number of toxic compounds. These proteins, residing in the plasma membrane, perform an active, ATP-dependent extrusion of such xenobiotics. However, the same proteins are also used by the tumor cells to fight various anticancer agents. ABCG2 is an important member of the multidrug resistance proteins, an 'ABC half transporter', which functions as a homodimer in the cell membrane. In this review, we provide a basic overview of ABCG2 function in physiology and drug metabolism, but concentrate on the discussion of mutations and polymorphisms discovered in this protein. Interestingly, a single nucleotide mutation, changing amino acid 482 from arginine to threonine or glycine in ABCG2, results in a major increase in the catalytic activity and a wider drug recognition by this protein. Still, this mutation proved to be an in vitro artifact, produced only in heavily drug-selected cell lines. In contrast, at least two, but possibly more polymorphic variants of ABCG2 were found to be present in large human populations with different ethnic background. However, currently available experimental data regarding the cellular expression, localization and function of these ABCG2 variants are strongly contradictory. Since, the proteins produced by these variant alleles may differently modulate cancer treatment, general drug absorption and toxicity, may represent risk factors in fetal toxicity, or alter the differentiation of stem cells, their exact characterization is a major challenge in this field.
Comments [show]
None has been submitted yet.
No. Sentence Comment
109 To date, altogether eight non-synonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c.114TOC, c.369COT, c.474COT, c.1098GOA, c.1425AOG) missense mutations, one nonsense (Q126X), and one frameshift (c.1515delC) mutations were identified in the coding region of ABCG2 in healthy individuals or in patients [43-46,49,63-65].
X
ABCG2 p.Asp620Asn 16337740:109:90
status: VERIFIED112 Some of the above sequence variations showed an allele frequency of about 1% in distinct populations (Q126X, F489L in the Japanese and N590Y in the Caucasian population [45-47,49,64]), while most of the mutations were only detected in single individuals (missense mutations: I206L, F431L, S441N, D620N, and a frameshift mutation: c.1515delC [44-46,49]).
X
ABCG2 p.Asp620Asn 16337740:112:296
status: VERIFIED164 On the other hand, the V12M (and D620N) ABCG2 showed a similar ATPase activity as the wild-type protein.
X
ABCG2 p.Asp620Asn 16337740:164:33
status: VERIFIED[hide] High-speed screening of human ATP-binding cassette... Methods Enzymol. 2005;400:485-510. Ishikawa T, Sakurai A, Kanamori Y, Nagakura M, Hirano H, Takarada Y, Yamada K, Fukushima K, Kitajima M
High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics.
Methods Enzymol. 2005;400:485-510., [PMID:16399366]
Abstract [show]
Drug transporters represent an important mechanism in cellular uptake and efflux of drugs and their metabolites. Hitherto a variety of drug transporter genes have been cloned and classified into either solute carriers or ATP-binding cassette (ABC) transporters. Such drug transporters are expressed in various tissues such as the intestine, brain, liver, kidney, and, importantly, cancer cells, where they play critical roles in the absorption, distribution, and excretion of drugs. We developed high-speed functional screening and quantitative structure-activity relationship analysis methods to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. Furthermore, we demonstrate a new "SNP array" method to detect genetic polymorphisms of ABC transporters in human samples.
Comments [show]
None has been submitted yet.
No. Sentence Comment
115 For this purpose, variant forms (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) have been created by site‐ directed mutagenesis with the QuikChange site‐directed mutagensis kit (Stratagene, La Jolla, CA).
X
ABCG2 p.Asp620Asn 16399366:115:100
status: NEW[hide] Topotecan is a substrate for multidrug resistance ... Curr Drug Metab. 2006 Jan;7(1):105-18. Tian Q, Zhang J, Chan SY, Tan TM, Duan W, Huang M, Zhu YZ, Chan E, Yu Q, Nie YQ, Ho PC, Li Q, Ng KY, Yang HY, Wei H, Bian JS, Zhou SF
Topotecan is a substrate for multidrug resistance associated protein 4.
Curr Drug Metab. 2006 Jan;7(1):105-18., [PMID:16454695]
Abstract [show]
Topotecan (TPT) is a semisynthetic water-soluble derivative of camptothecin (CPT) used as second-line therapy in patients with metastatic ovarian carcinoma, small cell lung cancer, and other malignancies. However, both dose-limiting toxicity and tumor resistance hinder the clinical use of TPT. The mechanisms for resistance to TPT are not fully defined, but increased efflux of the drug by multiple drug transporters including P-glycoprotein (PgP), multidrug resistance associated protein 1 (MRP1) and breast cancer resistance protein (BCRP) from tumor cells has been highly implicated. This study aimed to investigate whether overexpression of human MRP4 rendered resistance to TPT by examining the cytotoxicity profiles using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazonium bromide (MTT) assay and cellular accumulation of TPT in HepG2 cells stably overexpressing MRP4. Two kinds of cell lines, HepG2 with insertion of an empty vector plasmid (V/HepG2), HepG2 cells stably expressing MRP4 (MRP4/HepG2), were exposed to TPT for 4 or 48 hr in the absence or presence of various MRP4 inhibitors including DL-buthionine-(S,R)-sulphoximine (BSO), diclofenac, celecoxib, or MK-571. The intracellular accumulation of TPT and paclitaxel (a PgP substrate) by V/HepG2 and MRP4/HepG2 cells was determined by incubation of TPT with the cells and the amounts of the drug in cells were determined by validated HPLC methods. The study demonstrated that MRP4 conferred a 12.03- and 6.86-fold resistance to TPT in the 4- and 48-hr drug-exposure MTT assay, respectively. BSO, MK-571, celecoxib, or diclofenac sensitised MRP4/HepG2 cells to TPT cytotoxicity and partially reversed MRP4-mediated resistance to TPT. In addition, the accumulation of TPT was significantly reduced in MRP4/HepG2 cells compared to V/HepG2 cells, and one-binding site model was found the best fit for the MRP4-mediated efflux of TPT, with an estimated K(m) of 1.66 microM and V(max) of 0.341 ng/min/106 cells. Preincubation of MRP4/HepG2 cells with BSO (200 microM) for 24 hr, celecoxib (50 microM), or MK-571 (100 microM) for 2 hr significantly increased the accumulation of TPT over 10 min in MRP4/HepG2 cells by 28.0%, 37.3% and 32.5% (P < 0.05), respectively. By contrast, there was no significant difference in intracellular accumulation of paclitaxel in V/HepG2 and MRP4/HepG2 cells over 120 min. MRP4 also rendered resistance to adefovir dipivoxil (bis-POM-PMEA) and methotrexate, two reported MRP4 substrates. MRP4 did not exhibit any significant resistance to other model drugs including vinblastine, vincristine, etoposide, carboplatin, cyclosporine and paclitaxel in both long (48 hr) and short (4 hr) drug-exposure MTT assays. These findings indicate that MRP4 confers resistance to TPT and TPT is the substrate for MRP4. Further studies are needed to explore the role of MRP4 in resistance to, toxicity and pharmacokinetics of TPT in cancer patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
47 However, resistance levels of TPT are inconsistent in different BCRP overexpressing cell lines [51-59], probably due to the existence of three mutant variants of BCRP resulting in the amino acid changes at V12M, Q141K and D620N [63-67].
X
ABCG2 p.Asp620Asn 16454695:47:222
status: VERIFIED[hide] Functional validation of the genetic polymorphisms... Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11. Tamura A, Watanabe M, Saito H, Nakagawa H, Kamachi T, Okura I, Ishikawa T
Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport.
Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11., [PMID:16608919]
Abstract [show]
The ATP-binding cassette (ABC) transporter ABCG2 has been implicated to play a significant role in the response of patients to medication and/or the risk of diseases. To clarify the possible physiological or pathological relevance of ABCG2 polymorphisms, we have functionally validated single nucleotide polymorphisms (SNP) of ABCG2. In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Because porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the porphyrin transport activity of those variant forms in vitro. We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Furthermore, Flp-In-293 cells expressing those variants were photosensitive. Thus, among those genetic polymorphisms of ABCG2, at least the hitherto validated alleles of Q126stop, S441N, and F489L are suggested to be of clinical importance related to the potential risk of porphyria.
Comments [show]
None has been submitted yet.
No. Sentence Comment
2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Asp620Asn 16608919:2:273
status: NEW82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan).
X
ABCG2 p.Asp620Asn 16608919:82:1848
status: NEW144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis.
X
ABCG2 p.Asp620Asn 16608919:144:249
status: NEW214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Asp620Asn 16608919:214:273
status: NEW224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein.
X
ABCG2 p.Asp620Asn 16608919:224:1052
status: NEW[hide] Genetic variation and haplotype structure of the A... Drug Metab Pharmacokinet. 2006 Apr;21(2):109-21. Maekawa K, Itoda M, Sai K, Saito Y, Kaniwa N, Shirao K, Hamaguchi T, Kunitoh H, Yamamoto N, Tamura T, Minami H, Kubota K, Ohtsu A, Yoshida T, Saijo N, Kamatani N, Ozawa S, Sawada J
Genetic variation and haplotype structure of the ABC transporter gene ABCG2 in a Japanese population.
Drug Metab Pharmacokinet. 2006 Apr;21(2):109-21., [PMID:16702730]
Abstract [show]
The ATP-binding cassette transporter, ABCG2, which is expressed at high levels in the intestine and liver, functions as an efflux transporter for many drugs, including clinically used anticancer agents such as topotecan and the active metabolite of irinotecan (SN-38). In this study, to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCG2, we have comprehensively searched for genetic variations in the putative promoter region, all the exons, and their flanking introns of ABCG2 from 177 Japanese cancer patients treated with irinotecan. Forty-three genetic variations, including 11 novel ones, were found: 5 in the 5'-flanking region, 13 in the coding exons, and 25 in the introns. In addition to 9 previously reported nonsynonymous single nucleotide polymorphisms (SNPs), 2 novel nonsynonymous SNPs, 38C>T (Ser13Leu) and 1060G>A (Gly354Arg), were found with minor allele frequencies of 0.3%. Based on the LD profiles between the SNPs and the estimated past recombination events, the region analyzed was divided into three blocks (Block -1, 1, and 2), each of which spans at least 0.2 kb, 46 kb, and 13 kb and contains 2, 24, and 17 variations, respectively. The two, eight, and five common haplotypes detected in 10 or more patients accounted for most (>90%) of the haplotypes inferred in Block -1, Block 1, and Block 2, respectively. The SNP and haplotype distributions in Japanese were different from those reported previously in Caucasians. This study provides fundamental information for the pharmacogenetic studies investigating the relationship between the genetic variations in ABCG2 and pharmacokinetic/pharmacodynamic parameters.
Comments [show]
None has been submitted yet.
No. Sentence Comment
89 On the other hand, several nonsynonymous SNPs reported in other ethnic groups were not detected: 805CÀT (Pro269Ser) found in Chinese at a 0.037 frequency,20) 1858GÀA (Asp620Asn) in undened (combined) ethnicities14) (0.011) and in a Dutch population21) (0.005), 616AÀC (Ile206Leu) in Hispanics (0.100), and 1768AÀT (Asn590Tyr) in Caucasians (0.010).18) Thus, these SNPs are either ethnic-specic or rare.
X
ABCG2 p.Asp620Asn 16702730:89:177
status: VERIFIED[hide] Human ABC transporter ABCG2 in xenobiotic protecti... Drug Metab Rev. 2006;38(3):371-91. Wakabayashi K, Tamura A, Saito H, Onishi Y, Ishikawa T
Human ABC transporter ABCG2 in xenobiotic protection and redox biology.
Drug Metab Rev. 2006;38(3):371-91., [PMID:16877258]
Abstract [show]
Human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR/ABCP) is regarded as a member of the phase III system of xenobiotic metabolism. This efflux pump is suggested to be responsible for protecting the body from toxic xenobiotics and for removing toxic metabolites. The aim of this review article is to address new aspects of ABCG2 related to redox biology, namely the posttranslational modification (intra- and intermolecular disulfide bond formation) of ABCG2 protein and the transport of porphyrin and chlorophyll metabolites, as well as the high-speed screening and QSAR analysis method to evaluate ABCG2-drug interactions.
Comments [show]
None has been submitted yet.
No. Sentence Comment
176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells.
X
ABCG2 p.Asp620Asn 16877258:176:251
status: NEW[hide] Human multidrug resistance ABCB and ABCG transport... Physiol Rev. 2006 Oct;86(4):1179-236. Sarkadi B, Homolya L, Szakacs G, Varadi A
Human multidrug resistance ABCB and ABCG transporters: participation in a chemoimmunity defense system.
Physiol Rev. 2006 Oct;86(4):1179-236., [PMID:17015488]
Abstract [show]
In this review we give an overview of the physiological functions of a group of ATP binding cassette (ABC) transporter proteins, which were discovered, and still referred to, as multidrug resistance (MDR) transporters. Although they indeed play an important role in cancer drug resistance, their major physiological function is to provide general protection against hydrophobic xenobiotics. With a highly conserved structure, membrane topology, and mechanism of action, these essential transporters are preserved throughout all living systems, from bacteria to human. We describe the general structural and mechanistic features of the human MDR-ABC transporters and introduce some of the basic methods that can be applied for the analysis of their expression, function, regulation, and modulation. We treat in detail the biochemistry, cell biology, and physiology of the ABCB1 (MDR1/P-glycoprotein) and the ABCG2 (MXR/BCRP) proteins and describe emerging information related to additional ABCB- and ABCG-type transporters with a potential role in drug and xenobiotic resistance. Throughout this review we demonstrate and emphasize the general network characteristics of the MDR-ABC transporters, functioning at the cellular and physiological tissue barriers. In addition, we suggest that multidrug transporters are essential parts of an innate defense system, the "chemoimmunity" network, which has a number of features reminiscent of classical immunology.
Comments [show]
None has been submitted yet.
No. Sentence Comment
997 In healthy individuals or patients, altogether eight nonsynonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c.
X
ABCG2 p.Asp620Asn 17015488:997:116
status: VERIFIED[hide] Towards understanding the mechanism of action of t... J Mol Graph Model. 2007 Mar;25(6):837-51. Epub 2006 Aug 30. Li YF, Polgar O, Okada M, Esser L, Bates SE, Xia D
Towards understanding the mechanism of action of the multidrug resistance-linked half-ABC transporter ABCG2: a molecular modeling study.
J Mol Graph Model. 2007 Mar;25(6):837-51. Epub 2006 Aug 30., [PMID:17027309]
Abstract [show]
The ATP-binding cassette protein ABCG2 is a member of a broad family of ABC transporters with potential clinical importance as a mediator of multidrug resistance. We carried out a homology and knowledge-based, and mutationally improved molecular modeling study to establish a much needed structural framework for the protein, which could serve as guidance for further genetic, biochemical, and structural analyses. Based on homology with known structures of both full-length and nucleotide-binding domains (NBD) of ABC transporters and structural knowledge of integral membrane proteins, an initial model of ABCG2 was established. Subsequent refinement to conform to the lipophilic index distributions in the transmembrane domain (TMD) and to the results of site-directed mutagenesis experiments led to an improved model. The complete ABCG2 model consists of two identical subunits facing each other in a closed conformation. The dimeric interface in the nucleotide-binding domain (NBD) involves a characteristic nucleotide sandwich and the interface in the TMD consists of the TM helices 1-3 of one subunit and the helices 5 and 6 of the other. The interface between the NBD and the TMD is bridged by the conserved structural motif between TM2 and TM3, the intracellular domain 1 (ICD1), and the terminal beta-strand (S6) of the central beta-sheet in the NBD. The apparent flexibility of the ICD1 may play a role in transmitting conformational changes from the NBD to the TMD or from the TMD to the NBD.
Comments [show]
None has been submitted yet.
No. Sentence Comment
182 In sf9 cell, it is expressed on cell surface, but with no ATPase activity [56] L554P TM5 Lowered drug resistance [42] N557D,E TM5 Functional [21] S566Aa ECL (between TM5 and 6) Lowered drug resistance for the cell line [42] N596Q Between TM5 and 6 N-glycosylation site [65] Y605Ca Loop between TM5 and 6 Lowered drug resistance for the cell line [42] D620N Loop between TM5 and 6 SNP polymorphism [22] H630E,L TM6 Functional [21] A632Va TM Lowered drug resistance for the cell line [42] a Mutants not well characterized.
X
ABCG2 p.Asp620Asn 17027309:182:351
status: VERIFIED[hide] Genetic polymorphisms of human ABC transporter ABC... J Exp Ther Oncol. 2006;6(1):1-11. Tamura A, Wakabayashi K, Onishi Y, Nakagawa H, Tsuji M, Matsuda Y, Ishikawa T
Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system.
J Exp Ther Oncol. 2006;6(1):1-11., [PMID:17228519]
Abstract [show]
The vector-mediated introduction of cDNA into mammalian cells by calcium phosphate co-precipitation or permeation with lipofectamine is widely used for the integration of cDNA into genomic DNA. However, integration of cDNA into the host's chromosomal DNA occurs randomly at unpredictable sites, and the number of integrated recombinant DNAs is not controllable. To investigate the effect of genetic polymorphisms of ABCG2 on the protein expression and the drug resistance profile, we developed the Flp-In method to integrate one single copy of ABCG2 variant-cDNA into FRT-tagged genomic DNA. More than 20 metaphase spreads were examined for both fluorescence in situ hybridization (FISH) mapping and multicolor-FISH analysis, and it has been revealed that ABCG2 cDNA was incorporated into the telomeric region of the short arm on one of chromosomes 12 in Flp-In-293 cells. Based on the currently available SNP data for human ABCG2, we have created a total of seven variants by site-directed mutagenesis and stably expressed them in Flp-In-293 cells. While mRNAs of those integrated ABCG2 variants and wild type were evenly expressed in Flp-In-293 cells, the protein expression levels of F208S and S441N variants were found to be markedly low. It is suggested that the protein instability due to enhanced degradation resulted in the low levels of their protein expression. Thus, the Flp recombinase system would provide a useful tool to validate the effect of nonsynonymous SNPs on the protein stability and post-translational modification of ABCG2.
Comments [show]
None has been submitted yet.
No. Sentence Comment
142 Finally, the acquired mutants R482G and R482T form another group, which is characteristic Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 9 Table 3 Remarks mRNA Protein Author Ref Host cell Vector Expression SNP expression expression Imai et al. (15) PA317 pHaL-IRES-DHFR bicistronic Stable V12M Similar to WT Similar to WT - - retrovirus vector plasmid - Q141K Similar to WT Lower than WT Mizuarai et al. (18) LLC-PK1 pcDNA3.1(+) Stable V12M Similar to WT N.D. - - - - Q141K Similar to WT N.D. Morisaki et al. (25) HEK293 pcDNA3.1 Stable V12M Vary among clones Vary among clones - - - - Q141K Vary among clones Vary among clones - - - - D620N Vary among clones Vary among clones Kondo et al. (26) LLC-PK1/ pcDNA3.1/ Stable/ V12M N.D. Similar to WT - HEK293 Adenovirus Transient Q141K N.D. 30 - 40% of WT - - - - A149P N.D. Similar to WT - - - - R163K N.D. Similar to WT - - - - Q166E N.D. Similar to WT - - - - P269S N.D. Similar to WT - - - - S441N N.D. Lower than WT Vethanayagam (27) HEK293 pcDNA3.1/myc-His(-) Stable I206L N.D. Vary among clones et al. - - - - N590Y N.D. Vary among clones - - - - D620N N.D. Vary among clones N.D.: No data Table 2.
X
ABCG2 p.Asp620Asn 17228519:142:708
status: VERIFIEDX
ABCG2 p.Asp620Asn 17228519:142:1173
status: VERIFIED[hide] The identification of two germ-line mutations in t... Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21. Yoshioka S, Katayama K, Okawa C, Takahashi S, Tsukahara S, Mitsuhashi J, Sugimoto Y
The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein.
Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21., [PMID:17373578]
Abstract [show]
PURPOSE: We examined the effects of the nine nonsynonymous germ-line mutations/SNPs in the breast cancer resistance protein (BCRP/ABCG2) gene on the expression and function of the protein. MATERIALS AND METHODS: We generated cDNAs for each of these mutants (G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP) and compared the effects of their exogenous expression in PA317 cells with a wild-type control. RESULTS: PA/F208S cells (T623C BCRP-transfectants) expressed marginal levels of a BCRP protein species (65kDa), which is slightly smaller than wild-type (70kDa), but this mutant did not appear on the cell surface or confer drug resistance. PA/F431L cells (T1291C BCRP-transfectants) were found to express both 70 kDa and 65 kDa BCRP protein products. In addition, although PA/F431L cells expressed 70 kDa BCRP at comparable levels to PA/WT cells, they showed only marginal resistance to SN-38. PA/T153M cells (C458T BCRP-transfectants) and PA/D620N cells (G1858A BCRP-transfectants) expressed lower amounts of BCRP and showed lower levels of resistance to SN-38 compared with PA/WT cells. CONCLUSIONS: We have shown that T623C BCRP encodes a non-functional BCRP and that T1291C BCRP encodes a low-functional BCRP. Hence, these mutations may affect the pharmacokinetics of BCRP substrates in patients harboring these alleles.
Comments [show]
None has been submitted yet.
No. Sentence Comment
8 PA/T153M cells (C458T BCRP-transfectants) and PA/D620N cells (G1858A BCRP-transfectants) expressed lower amounts of BCRP and showed lower levels of resistance to SN-38 compared with PA/WT cells.
X
ABCG2 p.Asp620Asn 17373578:8:49
status: VERIFIED42 The cells were selected with 120 ng/mL of methotrexate, and the resulting mixed populations of resistant cells were designated as PA/WT, PA/V12M, PA/ G51C, PA/Q141K, PA/T153M, PA/I206L, PA/F208S, PA/ S248P, PA/F431L, PA/N590Y and PA/D620N, respectively. The PA/F208S clones and PA/F431L clones were obtained by limiting dilution.
X
ABCG2 p.Asp620Asn 17373578:42:233
status: VERIFIED43 Cell Growth Inhibition Assay Anticancer agent resistance levels in both the parental PA317 cells and in the various BCRP transfectants were Table I. Frequencies of Germ-line Mutations/SNPs Within The BCRP Gene Variation Frequency (%) Number Population Reference Nucleotide Amino acid G34A V12M 19 29 Japanese 17 G151T G51C 0.1a 350 Japanese C376T Q126Stop 1.2 124 Japanese 17 C421A Q141K 26.6 124 Japanese 17 C458T T153M 3.3 30 Cell line 32 C496G Q166E 0.3a 200 Japanese A616C I206L 20 10 Hispanic 33 T623C F208S 0.3a 200 Japanese T742C S248P 0.5a 200 Japanese T1291C F431L 0.6b 260 Japanese 34 A1768T N590Y 1.1 88 Caucasians 33 G1858A D620N 1.1 90 unknown 35 a Determined in this study.
X
ABCG2 p.Asp620Asn 17373578:43:636
status: VERIFIED45 V12M Q141K D620N N590Y F431L S248P F208S I206L T153M G51C Q166E OUT MEMBRANE IN Fig. 1.
X
ABCG2 p.Asp620Asn 17373578:45:11
status: VERIFIED75 SN-38 Resistance Levels of PA317 Transfectantsa Cell type IC50 (nmol/L) Degree of resistance PA317 11 T 0.2 1 PA/WT 550 T 16 50 PA/V12M 490 T 13 45 PA/Q141K 110 T 5.9 10 PA/T153M 260 T 15 24 PA/Q166E 680 T 40 62 PA/F208S 10 T 0.7 1 PA/F431L 34 T 0.9 3 PA/D620N 190 T 5.7 17 a Cells were cultured for 5 days with various concentrations of SN-38.
X
ABCG2 p.Asp620Asn 17373578:75:255
status: VERIFIED80 RESULTS Expression of BCRP in PA317 Transfectants The germ-line mutations and resulting amino acid substitutions examined in this study were as follows; G151T (G51C), C458T (T153M), C496G (Q166E), A616C (I206L), T623C (F208S), T742C (S248P), T1291C (F431L), A1768T (N590Y) and G1858A (D620N).
X
ABCG2 p.Asp620Asn 17373578:80:285
status: VERIFIED82 F431L, N590Y and D620N are located within the transmembrane domain (Fig. 1 and Table I).
X
ABCG2 p.Asp620Asn 17373578:82:17
status: VERIFIED88 PA/T153M and PA/D620N transfectants expressed lower amounts of BCRP than PA/WT cells, but these levels were higher than those in the PA/Q141K cells (Fig. 2a).
X
ABCG2 p.Asp620Asn 17373578:88:16
status: VERIFIED94 PA/Q141K, PA/T153M and PA/D620N cells expressed lower amounts of BCRP on their cell surfaces than PA/WT cells (Fig. 2d).
X
ABCG2 p.Asp620Asn 17373578:94:26
status: VERIFIED102 PA/Q141K, PA/ T153M, and PA/D620N cells showed 10Y24-fold higher resistance levels to SN-38 compared with the parental cells (Table II).
X
ABCG2 p.Asp620Asn 17373578:102:28
status: VERIFIED128 DISCUSSION In our current study, we have examined the effect of the nine germ-line mutations/SNPs, G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP, resulting in the amino acid changes G51C, T153M, Q166E, I206L, F208S, S248P, F431L, N590Y, D620N, respectively, on BCRP protein expression and function.
X
ABCG2 p.Asp620Asn 17373578:128:265
status: VERIFIED130 The resulting mixed populations of cells were designated a PA/WT, PA/V12M, PA/G51C, PA/Q141K, PA/ T153M, PA/I206L, PA/F208S, PA/S248P, PA/F431L, PA/ N590Y and PA/D620N.
X
ABCG2 p.Asp620Asn 17373578:130:162
status: VERIFIED135 PA/ T153M and PA/D620N cells expressed lower levels of BCRP and also showed lower resistance to SN-38, compared with PA/WT cells (Fig. 2a and Table II).
X
ABCG2 p.Asp620Asn 17373578:135:17
status: VERIFIED143 G51C, T153M, Q166E, I206L, F208S, and S248P are located in the intracellular domain, and F431L, N590Y, and D620N reside in the transmembrane domain.
X
ABCG2 p.Asp620Asn 17373578:143:107
status: VERIFIED168 Although PA/F431L cells express higher quantities of 70-kDa BCRP compared with PA/Q141K, PA/T153M, and PA/D620N cells (Fig. 2a) these cells in fact show a lower resistance to SN-38 than these other three transfectants (Table II).
X
ABCG2 p.Asp620Asn 17373578:168:106
status: VERIFIED171 PA/T153M and PA/D620N cells showed low-levels of BCRP expression and drug resistance to SN-38 compared with PA/WT cells (Fig. 2a and Table II).
X
ABCG2 p.Asp620Asn 17373578:171:16
status: VERIFIED173 Similar results were obtained using NIIH3T3/T153M and NIH3T3/D620N cells (date not shown).
X
ABCG2 p.Asp620Asn 17373578:173:61
status: VERIFIED[hide] ABC multidrug transporters: structure, function an... Pharmacogenomics. 2008 Jan;9(1):105-27. Sharom FJ
ABC multidrug transporters: structure, function and role in chemoresistance.
Pharmacogenomics. 2008 Jan;9(1):105-27., [PMID:18154452]
Abstract [show]
Three ATP-binding cassette (ABC)-superfamily multidrug efflux pumps are known to be responsible for chemoresistance; P-glycoprotein (ABCB1), MRP1 (ABCC1) and ABCG2 (BCRP). These transporters play an important role in normal physiology by protecting tissues from toxic xenobiotics and endogenous metabolites. Hydrophobic amphipathic compounds, including many clinically used drugs, interact with the substrate-binding pocket of these proteins via flexible hydrophobic and H-bonding interactions. These efflux pumps are expressed in many human tumors, where they likely contribute to resistance to chemotherapy treatment. However, the use of efflux-pump modulators in clinical cancer treatment has proved disappointing. Single nucleotide polymorphisms in ABC drug-efflux pumps may play a role in responses to drug therapy and disease susceptibility. The effect of various genotypes and haplotypes on the expression and function of these proteins is not yet clear, and their true impact remains controversial.
Comments [show]
None has been submitted yet.
No. Sentence Comment
359 Compared with wild-type ABCG2, the Q141K variant displayed lower ATPase activity and lower mitoxantrone efflux when expressed in HEK-293 cells, whereas the V12M and D620N proteins showed little change [172].
X
ABCG2 p.Asp620Asn 18154452:359:165
status: NEW[hide] Homology modeling of breast cancer resistance prot... J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15. Hazai E, Bikadi Z
Homology modeling of breast cancer resistance protein (ABCG2).
J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15., [PMID:18249138]
Abstract [show]
BCRP (also known as ABCG2, MXR, and ABC-P) is a member of the ABC family that transports a wide variety of substrates. BCRP is known to play a key role as a xenobiotic transporter. Since discovering its role in multidrug resistance, considerable efforts have been made in order to gain deeper understanding of BCRP structure and function. The recent study was aimed at predicting BCRP structure by creating a homology model. Based on sequence similarity with known structures of full-length, NB and TM domain of ABC transporters, TM, NB, and linker regions of BCRP were defined. The NB domain of BCRP was modeled using MalK as a template. Based on secondary structure prediction of BCRP and comparison of the transmembrane connecting regions of known structures of ABC transporters, the TM domain arrangement of BCRP was established and was found to resemble to that of the recently published crystal structure of Sav1866. Thus, an initial alignment of TM domain of BCRP was established using Sav1866 as a template. This alignment was subsequently refined using constrains derived from secondary structure and TM predictions and the final model was built. Finally, the complete homodimer ABCG2 model was generated using Sav1866 as template. Furthermore, known ligands of BCRP were docked to our model in order to define possible binding sites. The results of molecular dockings of known BCRP substrates to the BCRP model were in agreement with recently published experimental data indicating multiple binding sites in BCRP.
Comments [show]
None has been submitted yet.
No. Sentence Comment
245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand.
X
ABCG2 p.Asp620Asn 18249138:245:2930
status: NEW[hide] Drug-induced phototoxicity evoked by inhibition of... Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72. Tamura A, An R, Hagiya Y, Hoshijima K, Yoshida T, Mikuriya K, Ishikawa T
Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems.
Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72., [PMID:18363541]
Abstract [show]
BACKGROUND: Photosensitivity depends on both genetic and environmental factors. Pheophorbide a, present in various plant-derived foods and food supplements, can be absorbed by the small intestine. Accumulation of pheophorbide a and porphyrins in the systemic blood circulation can result in phototoxic lesions on light-exposed skin. OBJECTIVE: As the human ATP-binding cassette (ABC) transporter ABCG2 has been suggested to be critically involved in porphyrin-mediated photosensitivity, we aimed to develop in vitro screening systems for drug-induced phototoxicity. CONCLUSION: Functional impairment owing to inhibition of ABCG2 by drugs or its genetic polymorphisms can lead to the disruption of porphyrin homeostasis. This review article provides an overview on drug-induced photosensitivity, as well as our hypothesis on a potential role of ABCG2 in phototoxicity.
Comments [show]
None has been submitted yet.
No. Sentence Comment
230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A.
X
ABCG2 p.Asp620Asn 18363541:230:183
status: NEW231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids.
X
ABCG2 p.Asp620Asn 18363541:231:126
status: NEW245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Asp620Asn 18363541:245:251
status: NEW252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative).
X
ABCG2 p.Asp620Asn 18363541:252:555
status: NEW[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]
Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
250 It should be noted that many xeno- and endobiotic BCRP Figure 5 Predicted membrance topology of BCRP (ABCG2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 5 for allele frequencies and description of funtional consequences. NH2 COOH NBD Val12Met Gly51Cys Gln126* Ala149Pro Gln141Lys Thr153Met Arg160Gln Arg163Lys Gln166Glu Phe506Ser Phe507Leu Val508Leu Met509* Phe489Leu Ser441Asn Phe431Leu Glu334* Ile206Leu Ala315del Thr316del Phe208Ser Asp296His Ser248Pro Pro269Ser Phe571Ile Arg575* Asn590Tyr Asp620Asn in out Membrane BCRP (ABCG2) NBD Val12Met NBDNBD Val12Met substrates are also transported by other efflux transporters, especially P-glycoprotein, thus extrapolating BCRP related in vitro data to the in vivo situation may be difficult.
X
ABCG2 p.Asp620Asn 18464048:250:567
status: VERIFIED[hide] Modulation of breast cancer resistance protein (BC... Eur J Pharm Sci. 2008 Sep 2;35(1-2):30-41. Epub 2008 Jun 11. Han Y, Riwanto M, Go ML, Ee PL
Modulation of breast cancer resistance protein (BCRP/ABCG2) by non-basic chalcone analogues.
Eur J Pharm Sci. 2008 Sep 2;35(1-2):30-41. Epub 2008 Jun 11., 2008-09-02 [PMID:18598762]
Abstract [show]
Chalcones are biosynthetic precursors of flavonoids found to possess cytotoxic and chemopreventive activities. In this study, 17 non-basic chalcone analogues were synthesized and evaluated for their ability to modulate the function of either the human wild-type (482R) or mutant (482T) breast cancer resistance protein (BCRP/ABCG2) stably expressed in breast cancer MDA-MB-231 cells. At 5microM, chalcones with 2,4-dimethoxy groups or 2,4-dihydroxyl groups on ring A were found to increase mitoxantrone accumulation to a greater extent than an established BCRP inhibitor, fumitremorgin C. At the same time, these chalcones had negligible effect on calcein accumulation in P-glycoprotein overexpressing MDCKII cells, indicating their potential as selective BCRP inhibitors. Functionally, these compounds were able to increase the sensitivity of BCRP-overexpressing cancer cells to mitoxantrone by 2-5-fold. The effect of chalcone compounds on both wild-type and mutant BCRP ATPase activity was also examined and variable effects were observed. A stimulatory effect was mostly observed with chalcones with 2,4-dimethoxy substitution on ring A which were earmarked as good BCRP inhibitors in the MX accumulation and cytotoxicity assays. These findings underscore the potential of methoxylated and hydroxylated chalcones as selective and potent inhibitors of BCRP whose mode of action may not involve the inhibition of ATPase activity.
Comments [show]
None has been submitted yet.
No. Sentence Comment
378 Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N.
X
ABCG2 p.Asp620Asn 18598762:378:97
status: NEW[hide] Human ABC transporters ABCG2 (BCRP) and ABCG4. Xenobiotica. 2008 Jul;38(7-8):863-88. Koshiba S, An R, Saito H, Wakabayashi K, Tamura A, Ishikawa T
Human ABC transporters ABCG2 (BCRP) and ABCG4.
Xenobiotica. 2008 Jul;38(7-8):863-88., [PMID:18668433]
Abstract [show]
1. The human ABC transporter ABCG2 is regarded as a member of the phase III system for xenobiotic metabolism, and it has been suggested that this efflux pump is responsible for protecting the body from toxic xenobiotics and for removing metabolites. 2. This review paper will address the new aspects of ABCG2 in terms of post-translational modifications (i.e., disulfide bond formation, ubiquitination, and endoplasmic reticulum-associated degradation) of ABCG2 protein, high-speed screening, and quantitative structure-activity relationship (QSAR) analysis to evaluate ABCG2-drug interactions, and genetic polymorphisms potentially associated with photosensitivity. 3. In addition, new aspects of human ABCG4 and mouse Abcg4 are presented with respect to their molecular properties and potential physiological roles. Considering a high sequence similarity between ABCG1 and ABCG4, both Abcg4 and ABCG4 may be involved in the transport of cholesterol from neurons and astrocytes. Furthermore, high expression of the mouse Abcg4 protein in the testis implicates its involvement in transport of certain sex hormones.
Comments [show]
None has been submitted yet.
No. Sentence Comment
225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007).
X
ABCG2 p.Asp620Asn 18668433:225:235
status: NEW[hide] Natural allelic variants of bovine ATP-binding cas... Drug Metab Dispos. 2009 Jan;37(1):5-9. Epub 2008 Sep 29. Merino G, Real R, Baro MF, Gonzalez-Lobato L, Prieto JG, Alvarez AI, Marques MM
Natural allelic variants of bovine ATP-binding cassette transporter ABCG2: increased activity of the Ser581 variant and development of tools for the discovery of new ABCG2 inhibitors.
Drug Metab Dispos. 2009 Jan;37(1):5-9. Epub 2008 Sep 29., [PMID:18824523]
Abstract [show]
ATP-binding cassette transporter ABCG2 [breast cancer resistance protein (BCRP)] is a member of the ABC transporter superfamily that actively extrudes xenotoxins from cells and is a major determinant of the bioavailability of many compounds. ABCG2 expression is strongly induced during lactation in the mammary gland and is related to the active secretion of drugs into the milk. The presence of drug residues and environmental pollutants in milk is an outstanding problem for human milk consumption and milk industrial processes, involving important risks to public health and the dairy industry. In cows, a single nucleotide polymorphism (SNP) in this protein has been described previously (Tyr581) and is associated with higher fat and protein percentages and lower milk yield. However, whether this amino acid substitution affects ABCG2-mediated drug transport in cows, including milk secretion, required further exploration. We cloned the two variants of bovine ABCG2 and evaluated the effect of this SNP on mitoxantrone accumulation assays performed in ovine primary fibroblasts transiently expressing either of the variants. It is interesting to note that statistically significant differences in activity between both variants were observed, and the Ser581 variant was related with an increased efflux activity. In addition, we demonstrated that genistein is a very good inhibitor of bovine ABCG2 and identified new inhibitors of the transporter, such as the macrocyclic lactones, ivermectin, and selamectin. Moreover, the inhibitory effect of these compounds on human and murine ABCG2 homologs was confirmed using transduced Marbin-Dabin canine kidney II cells. These findings may have important implications regarding the presence of drug residues in milk and drug interactions affecting the pharmacological behavior of ABCG2 substrates.
Comments [show]
None has been submitted yet.
No. Sentence Comment
218 Vethanayagam RR, Wang H, Gupta A, Zhang Y, Lewis F, Unadkat JD, and Mao Q (2005) Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N.
X
ABCG2 p.Asp620Asn 18824523:218:178
status: NEW[hide] Clinical pharmacogenetics and potential applicatio... Curr Drug Metab. 2008 Oct;9(8):738-84. Zhou SF, Di YM, Chan E, Du YM, Chow VD, Xue CC, Lai X, Wang JC, Li CG, Tian M, Duan W
Clinical pharmacogenetics and potential application in personalized medicine.
Curr Drug Metab. 2008 Oct;9(8):738-84., [PMID:18855611]
Abstract [show]
The current 'fixed-dosage strategy' approach to medicine, means there is much inter-individual variation in drug response. Pharmacogenetics is the study of how inter-individual variations in the DNA sequence of specific genes affect drug responses. This article will highlight current pharmacogenetic knowledge on important drug metabolizing enzymes, drug transporters and drug targets to understand interindividual variability in drug clearance and responses in clinical practice and potential use in personalized medicine. Polymorphisms in the cytochrome P450 (CYP) family may have had the most impact on the fate of pharmaceutical drugs. CYP2D6, CYP2C19 and CYP2C9 gene polymorphisms and gene duplications account for the most frequent variations in phase I metabolism of drugs since nearly 80% of drugs in use today are metabolised by these enzymes. Approximately 5% of Europeans and 1% of Asians lack CYP2D6 activity, and these individuals are known as poor metabolizers. CYP2C9 is another clinically significant drug metabolising enzyme that demonstrates genetic variants. Studies into CYP2C9 polymorphism have highlighted the importance of the CYP2C9*2 and CYP2C9*3 alleles. Extensive polymorphism also occurs in a majority of Phase II drug metabolizing enzymes. One of the most important polymorphisms is thiopurine S-methyl transferases (TPMT) that catalyzes the S-methylation of thiopurine drugs. With respect to drug transport polymorphism, the most extensively studied drug transporter is P-glycoprotein (P-gp/MDR1), but the current data on the clinical impact is limited. Polymorphisms in drug transporters may change drug's distribution, excretion and response. Recent advances in molecular research have revealed many of the genes that encode drug targets demonstrate genetic polymorphism. These variations, in many cases, have altered the targets sensitivity to the specific drug molecule and thus have a profound effect on drug efficacy and toxicity. For example, the beta (2)-adrenoreceptor, which is encoded by the ADRB2 gene, illustrates a clinically significant genetic variation in drug targets. The variable number tandem repeat polymorphisms in serotonin transporter (SERT/SLC6A4) gene are associated with response to antidepressants. The distribution of the common variant alleles of genes that encode drug metabolizing enzymes, drug transporters and drug targets has been found to vary among different populations. The promise of pharmacogenetics lies in its potential to identify the right drug at the right dose for the right individual. Drugs with a narrow therapeutic index are thought to benefit more from pharmacogenetic studies. For example, warfarin serves as a good practical example of how pharmacogenetics can be utilized prior to commencement of therapy in order to achieve maximum efficacy and minimum toxicity. As such, pharmacogenetics has the potential to achieve optimal quality use of medicines, and to improve the efficacy and safety of both prospective and licensed drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
628 Several other variants such as I206L, N520Y and D620N are much less frequent with allele frequencies of ~1%.
X
ABCG2 p.Asp620Asn 18855611:628:48
status: VERIFIED647 On the other hand, the V12M (and D620N) ABCG2 displayed a comparable ATPase activity as the wild-type protein.
X
ABCG2 p.Asp620Asn 18855611:647:33
status: VERIFIED[hide] The 315-316 deletion determines the BXP-21 antibod... Mol Cell Biochem. 2009 Feb;322(1-2):63-71. Epub 2008 Nov 11. Polgar O, Deeken JF, Ediriwickrema LS, Tamaki A, Steinberg SM, Robey RW, Bates SE
The 315-316 deletion determines the BXP-21 antibody epitope but has no effect on the function of wild type ABCG2 or the Q141K variant.
Mol Cell Biochem. 2009 Feb;322(1-2):63-71. Epub 2008 Nov 11., [PMID:19002564]
Abstract [show]
ABCG2 is a half-transporter initially described in multidrug-resistant cancer cells and lately identified as an important factor in the pharmacokinetics of its substrates. Q141K is by far the most intensively studied single nucleotide polymorphism of ABCG2 with potential clinical relevance. Here we used stably transfected HEK cells to study the Q141K polymorphism together with the deletion of amino acids 315-316, which were recently reported to coexist in two cancer cell lines (A549 and SK-OV-3). Functional studies confirmed our previous report that when normalized to surface expression, Q141K has impaired transport of mitoxantrone. This result was extended to include the ABCG2-specific substrate pheophorbide a. While we found no functional consequence of deleting amino acids 315 and 316, we did find that the deletion mutant is no longer recognized by the BXP-21 antibody. We conclude that amino acids 315 and 316 form part of the epitope for the BXP-21 antibody.
Comments [show]
None has been submitted yet.
No. Sentence Comment
62 We have previously used the same expression system to study non-synonymous SNPs, such as Q141K, V12M, and D620N, and found that Q141K results in impaired function [13].
X
ABCG2 p.Asp620Asn 19002564:62:106
status: VERIFIED64 We have previously used the same expression system to study non-synonymous SNPs, such as Q141K, V12M, and D620N, and found that Q141K results in impaired function [13].
X
ABCG2 p.Asp620Asn 19002564:64:106
status: NEW[hide] Functions of the breast cancer resistance protein ... Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3. Noguchi K, Katayama K, Mitsuhashi J, Sugimoto Y
Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy.
Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3., 2009-01-31 [PMID:19111841]
Abstract [show]
The breast cancer resistance protein, BCRP/ABCG2, is a half-molecule ATP-binding cassette transporter that facilitates the efflux of various anticancer agents from the cell, including 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. The expression of BCRP can thus confer a multidrug resistance phenotype in cancer cells, and its transporter activity is involved in the in vivo efficacy of chemotherapeutic agents. Thus, the elucidation of the substrate preferences and structural relationships of BCRP is essential to understanding its in vivo functions during chemotherapeutic treatments. Single nucleotide polymorphisms (SNPs) have also been found to be key factors in determining the efficacy of chemotherapeutics, and those therapeutics that inhibit BCRP activity, such as the SNP that results in a C421A mutant, may result in unexpected side effects of the BCRP- anticancer drugs interaction even at normal dosages. In order to modulate the BCRP activity during chemotherapy, various compounds have been tested as inhibitors of this protein. Estrogenic compounds including estrone, several tamoxifen derivatives in addition to phytoestrogens and flavonoids have been shown to reverse BCRP-mediated drug resistance. Intriguingly, recently developed molecular targeted cancer drugs, such as the tyrosine kinase inhibitors imatinib mesylate, gefitinib and others, can also interact with BCRP. Since both functional SNPs and inhibitory agents of BCRP modulate the in vivo pharmacokinetics and pharmacodynamics of its substrate drugs, BCRP activity is an important consideration in the development of molecular targeted chemotherapeutics.
Comments [show]
None has been submitted yet.
No. Sentence Comment
874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain.
X
ABCG2 p.Asp620Asn 19111841:874:608
status: NEW[hide] Synergistic effect of interleukin-6 and endoplasmi... Lab Invest. 2009 Mar;89(3):327-36. Epub 2009 Jan 12. Nakamichi N, Morii E, Ikeda J, Qiu Y, Mamato S, Tian T, Fukuhara S, Aozasa K
Synergistic effect of interleukin-6 and endoplasmic reticulum stress inducers on the high level of ABCG2 expression in plasma cells.
Lab Invest. 2009 Mar;89(3):327-36. Epub 2009 Jan 12., [PMID:19139722]
Abstract [show]
ABCG2 is a transporter preferentially expressed in a primitive subpopulation of cells and recently reported as a surviving factor for trophoblasts. To date, manner of ABCG2 expression in lymphoid tissues is not known. Immunohistochemically, strong ABCG2 expression was found in a small proportion of plasma cells mainly located in the interfollicular space of lymphoid tissues. The number of ABCG2-high plasma cells increased in interleukin-6- (IL-6) rich lesions, such as Castleman's disease of plasma cell type. Plasma cells are subjected to endoplasmic reticulum (ER) stress when excess proteins are synthesized, and IL-6 stimulates protein synthesis. Therefore, the effect of IL-6 and ER stress on ABCG2 expression in plasma cells was examined. The expression level of ABCG2 increased by treatment with either IL-6 or ER stress inducers, and further increased with both. The promoter analysis revealed that the effect of IL-6 and ER stress inducers was mediated through the site overlapping XBP-1 and HIF-1 binding sequences. Knocked-down of ABCG2 by siRNA or ABCG2 inhibitor reduced plasma cell viability under ER stress. These suggest that ABCG2 is a surviving factor for plasma cells. To our knowledge, this is the first study reporting the effect of ER stress on ABCG2 expression.
Comments [show]
None has been submitted yet.
No. Sentence Comment
281 Functional analysis of the human variants of breast cancer resistance protein: I206 L, N590Y, and D620N.
X
ABCG2 p.Asp620Asn 19139722:281:98
status: NEW[hide] Human ABC transporter ABCG2 in cancer chemotherapy... J Exp Ther Oncol. 2009;8(1):5-24. Ishikawa T, Nakagawa H
Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics.
J Exp Ther Oncol. 2009;8(1):5-24., [PMID:19827267]
Abstract [show]
The ability of cancer cells to acquire resistance to multiple anticancer agents, termed multidrug resistance, is often mediated by overexpression of ATP-binding cassette (ABC) transporters that remove drugs out of the cell against a concentration gradient. ABCG2, or breast cancer resistance protein (BCRP), is an ABC transporter that has been the subject of intense study since its discovery a decade ago. While ABCG2 overexpression has been demonstrated in cancer cells after in vitro drug treatment, endogenous ABCG2 expression in certain cancers is considered as a reflection of the differentiated phenotype of the cell of origin and likely contributes to intrinsic drug resistance. Notably, ABCG2 is often expressed in stem cell populations, where it plays a critical role in cellular protection. ABCG2 exhibits a broad range of substrate specificity. New technologies of high-speed screening and quantitative structure-activity-relationship (QSAR) analysis have been developed to analyze the interactions of drugs with ABCG2. As ABCG2 reportedly transports porphyrins, its contribution to photodynamic therapy of human cancer is also implicated. Protein expression levels of ABCG2 in cancer cells are regulated by both transcriptional activation and protein degradation. The ABCG2 protein undergoes endosomal and/or ubiquitin-mediated proteasomal degradations. Furthermore, genetic polymorphisms in the ABCG2 gene are important factors in cancer chemotherapy to circumvent adverse effects and/or to enhance the efficacy of anticancer drugs. The present review article addresses recent advances in molecular pharmacology and pharmacogenomics of ABCG2 and provides novelideas to improve cancer chemotherapy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
222 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I OUT IN R160Q R575stop ATP-binding site Figure 7. Continued A 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:50 19 Q141K has been associated with lower levels of protein expression and impaired transport in vitro (Imai et al., 2002; Kobayashi et al., 2005; Misuarai et al., 2004; Zamber et al., 2003; Morisaki et al., 2008; Kondo et al., 2004).
X
ABCG2 p.Asp620Asn 19827267:222:91
status: NEW232 It is known that, in the ER, the N-linked glycans play pivotal roles in protein fold- 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) Methotrexate 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) MethotrexateMethotrexate Porphyrintransport (nmol/min/mgprotein) 0.0 0.1 0.2 0.3 0.4 0.5 0.0 0.1 0.2 0.3 0.4 0.5 Porphyrin Figure 7.
X
ABCG2 p.Asp620Asn 19827267:232:204
status: NEWX
ABCG2 p.Asp620Asn 19827267:232:412
status: NEW[hide] Flow cytometric evaluation of multidrug resistance... Methods Mol Biol. 2010;596:123-39. Aszalos A, Taylor BJ
Flow cytometric evaluation of multidrug resistance proteins.
Methods Mol Biol. 2010;596:123-39., [PMID:19949923]
Abstract [show]
There are several ways to detect proteins on cells. One quite frequently used method is flow cytometry. This method needs fluorescently labeled antibodies that can attach selectively to the protein to be investigated for flow cytometric detection. Flow cytometry scans individual cells, virtually without their surrounding liquid, and can scan many cells in a very short time. Because of this advantage of flow cytometry, it was adapted to investigate transport proteins on normal and cancerous human cells and cell lines. These transport proteins play important roles in human metabolism. Absorption in the intestine, excretion at the kidney, protection of the CNS compartment and the fetus from xenobiotics, and other vital functions depend on these transporters. However, several transporters are overexpressed in cancer cells. These overexpressed transporters pump out anticancer drugs from the cells and prevent their curative effects. The detection and quantitation of these types of transporters in cancer cells is important for this reason. Here, we review literature on flow cytometric detection of the three most studied transporters: P-glycoprotein, multidrug resistance-associated proteins, and breast cancer resistance protein.
Comments [show]
None has been submitted yet.
No. Sentence Comment
260 Three other variants, I206L, N590Y, and D620N, were studied by Vethanayagam et al.
X
ABCG2 p.Asp620Asn 19949923:260:40
status: NEW[hide] Impact of breast cancer resistance protein on canc... Methods Mol Biol. 2010;596:251-90. Ross DD, Nakanishi T
Impact of breast cancer resistance protein on cancer treatment outcomes.
Methods Mol Biol. 2010;596:251-90., [PMID:19949928]
Abstract [show]
Breast cancer resistance protein (BCRP/ABCG2) was discovered in multidrug resistant breast cancer cells having an ATP-dependent transport-based resistance phenotype. This ABC transporter functions (at least in part) as a xenobiotic protective mechanism for the organism: in the gut and biliary tract, it prevents absorption and enhances elimination of potentially toxic substances. As a placental barrier, it protects the fetus; similarly, it serves as a component of blood-brain and blood-testis barrier; BCRP is expressed in stem cells and may protect them from potentially harmful agents. Therefore, BCRP could influence cancer outcomes by (a) endogenous BCRP affecting the absorption, distribution, metabolism, and elimination of anticancer drugs; (b) BCRP expression in cancer cells may directly cause resistance by active efflux of anticancer drugs; (c) BCRP expression in cancer cells could be a manifestation of the activity of metabolic and signaling pathways that impart multiple mechanisms of drug resistance, self-renewal (stemness), and invasiveness (aggressiveness)--i.e. impart a poor prognosis--to cancers. This chapter presents a synopsis of translational clinical studies relating BCRP expression in leukemias, lymphomas, and a variety of solid tumors with clinical outcome. Data are emerging that expression of BCRP, like P-glycoprotein/ABCB1, is associated with adverse outcomes in a variety of human cancers. Whether this adverse prognostic effect results from resistance imparted to the cancer cells as the direct result of BCRP efflux of anticancer drugs, or whether BCRP expression (and also Pgp expression - coexpression of these transporters is common among poor risk cancers) serves as indicators of the activity of signaling pathways that enhance cancer cellular proliferation, metastases, genomic instability, enhance drug resistance, and oppose programmed cell death mechanisms is yet unknown.
Comments [show]
None has been submitted yet.
No. Sentence Comment
87 found the I206L allele to have high transporter activity but low protein expression when transfected into human embryonic kidney (HEK) cells, whereas the N590L and D620N had higher expression but lower activity (85).
X
ABCG2 p.Asp620Asn 19949928:87:164
status: VERIFIED[hide] In vitro and in vivo evidence for the importance o... Handb Exp Pharmacol. 2011;(201):325-71. Meyer zu Schwabedissen HE, Kroemer HK
In vitro and in vivo evidence for the importance of breast cancer resistance protein transporters (BCRP/MXR/ABCP/ABCG2).
Handb Exp Pharmacol. 2011;(201):325-71., [PMID:21103975]
Abstract [show]
The breast cancer resistance protein (BCRP/ABCG2) is a member of the G-subfamiliy of the ATP-binding cassette (ABC)-transporter superfamily. This half-transporter is assumed to function as an important mechanism limiting cellular accumulation of various compounds. In context of its tissue distribution with localization in the sinusoidal membrane of hepatocytes, and in the apical membrane of enterocytes ABCG2 is assumed to function as an important mechanism facilitating hepatobiliary excretion and limiting oral bioavailability, respectively. Indeed functional assessment performing mouse studies with genetic deletion or chemical inhibition of the transporter, or performing pharmacogenetic studies in humans support this assumption. Furthermore the efflux function of ABCG2 has been linked to sanctuary blood tissue barriers as described for placenta and the central nervous system. However, in lactating mammary glands ABCG2 increases the transfer of substrates into milk thereby increasing the exposure to potential noxes of a breastfed newborn. With regard to its broad substrate spectrum including various anticancer drugs and environmental carcinogens the function of ABCG2 has been associated with multidrug resistance and tumor development/progression. In terms of cancer biology current research is focusing on the expression and function of ABCG2 in immature stem cells. Recent findings support the notion that the physiological function of ABCG2 is involved in the elimination of uric acid resulting in higher risk for developing gout in male patients harboring genetic variants. Taken together ABCG2 is implicated in various pathophysiological and pharmacological processes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
252 There is profound variability in the minor allele frequencies (AF) of those polymorphisms among populations of different ethnicities, and some of the polymorphisms have been described in single individuals only, such as the c.616A>C, p.I206L (Zamber et al. 2003), the c.2062G>A (p.D620N) (Honjo et al. 2002), and the frameshift mutation c.1515delC (p.AFFVM505-509 ASSLstop) (Itoda et al. 2003).
X
ABCG2 p.Asp620Asn 21103975:252:281
status: VERIFIED[hide] Key Role of Human ABC Transporter ABCG2 in Photody... Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8. Ishikawa T, Nakagawa H, Hagiya Y, Nonoguchi N, Miyatake S, Kuroiwa T
Key Role of Human ABC Transporter ABCG2 in Photodynamic Therapy and Photodynamic Diagnosis.
Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8., [PMID:21188243]
Abstract [show]
Accumulating evidence indicates that ATP-binding cassette (ABC) transporter ABCG2 plays a key role in regulating the cellular accumulation of porphyrin derivatives in cancer cells and thereby affects the efficacy of photodynamic therapy and photodynamic diagnosis. The activity of porphyrin efflux can be affected by genetic polymorphisms in the ABCG2 gene. On the other hand, Nrf2, an NF-E2-related transcription factor, has been shown to be involved in oxidative stress-mediated induction of the ABCG2 gene. Since patients have demonstrated individual differences in their response to photodynamic therapy, transcriptional activation and/or genetic polymorphisms of the ABCG2 gene in cancer cells may affect patients' responses to photodynamic therapy. Protein kinase inhibitors, including imatinib mesylate and gefitinib, are suggested to potentially enhance the efficacy of photodynamic therapy by blocking ABCG2-mediated porphyrin efflux from cancer cells. This review article provides an overview on the role of human ABC transporter ABCG2 in photodynamic therapy and photodynamic diagnosis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
167 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells [41, 90].
X
ABCG2 p.Asp620Asn 21188243:167:251
status: NEW177 Gefitinib and imatinib are new anticancer drugs Outside Plasma membrane Inside H2N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S ATP-binding cassette (a) 0 0.1 0.3 0.4 0.2 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrin transport(nmol/min/mgprotein) (b) Figure 4: (a) Schematic illustration of human ABCG2 and its nonsynonymous polymorphisms.
X
ABCG2 p.Asp620Asn 21188243:177:211
status: NEWX
ABCG2 p.Asp620Asn 21188243:177:390
status: NEW[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]
Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.
Comments [show]
None has been submitted yet.
No. Sentence Comment
6589 Absent C421A Q141K 2 Normal/reduced G445C A149P ↔ Normal G448A R163K ↔ Normal C496G Q166E ↔ Normal/reduced A616C I206L 2↔ Normal T623C F208S N.D. Reduced T742C S248P N.D. Normal C805T P269S 2↔ Normal T1291C F431L 2 Normal/reduced G1322A S441N 2 Reduced T1465C F489L 2↔ Normal/reduced A1768T N590Y 2↔ Increased G1858A D620N 2↔ Normal 2, reduced function; ↔, no change in function; N.D. not determined.
X
ABCG2 p.Asp620Asn 20103563:6589:366
status: NEW[hide] Structure, function, expression, genomic organizat... Int J Toxicol. 2006 Jul-Aug;25(4):231-59. Choudhuri S, Klaassen CD
Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters.
Int J Toxicol. 2006 Jul-Aug;25(4):231-59., [PMID:16815813]
Abstract [show]
The ATP-binding cassette (ABC) transporters constitute a large family of membrane proteins, which transport a variety of compounds through the membrane against a concentration gradient at the cost of ATP hydrolysis. Substrates of the ABC transporters include lipids, bile acids, xenobiotics, and peptides for antigen presentation. As they transport exogenous and endogenous compounds, they reduce the body load of potentially harmful substances. One by-product of such protective function is that they also eliminate various useful drugs from the body, causing drug resistance. This review is a brief summary of the structure, function, and expression of the important drug resistance-conferring members belonging to three subfamilies of the human ABC family; these are ABCB1 (MDR1/P-glycoprotein of subfamily ABCB), subfamily ABCC (MRPs), and ABCG2 (BCRP of subfamily ABCG), which are expressed in various organs. In the text, the transporter symbol that carries the subfamily name (such as ABCB1, ABCC1, etc.) is used interchangeably with the corresponding original names, such as MDR1P-glycoprotein, MRP1, etc., respectively. Both nomenclatures are maintained in the text because both are still used in the transporter literature. This helps readers relate various names that they encounter in the literature. It now appears that P-glycoprotein, MRP1, MRP2, and BCRP can explain the phenomenon of multidrug resistance in all cell lines analyzed thus far. Also discussed are the gene structure, regulation of expression, and various polymorphisms in these genes. Because genetic polymorphism is thought to underlie interindividual differences, including their response to drugs and other xenobiotics, the importance of polymorphism in these genes is also discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
583 SNP analyses of the ABCG2 gene by Morisaki et al. (2005) revealed three nonsynonymous SNPs that resulted in amino acid substitution of the BCRP protein; these were Val12Met, Gln141Lys, and Asp620Asn.
X
ABCG2 p.Asp620Asn 16815813:583:189
status: NEW[hide] Analysis of the effect of the bovine adenosine tri... J Anim Sci. 2011 Dec;89(12):4325-38. doi: 10.2527/jas.2011-3841. Epub 2011 Aug 5. Real R, Gonzalez-Lobato L, Baro MF, Valbuena S, de la Fuente A, Prieto JG, Alvarez AI, Marques MM, Merino G
Analysis of the effect of the bovine adenosine triphosphate-binding cassette transporter G2 single nucleotide polymorphism Y581S on transcellular transport of veterinary drugs using new cell culture models.
J Anim Sci. 2011 Dec;89(12):4325-38. doi: 10.2527/jas.2011-3841. Epub 2011 Aug 5., [PMID:21821808]
Abstract [show]
In commercial dairy production, the risk of drug residues and environmental pollutants in milk from ruminants has become an outstanding problem. One of the main determinants of active drug secretion into milk is the ATP-binding cassette transporter G2/breast cancer resistance protein (ABCG2/BCRP). It is located in several organs associated with drug absorption, metabolism, and excretion, and its expression is highly induced during lactation in the mammary gland of ruminants, mice, and humans. As a consequence, potential contamination of milk could expose suckling infants to xenotoxins. In cows, a SNP for this protein affecting quality and quantity of milk production has been described previously (Y581S). In this study, our main purpose was to determine whether this polymorphism has an effect on transcellular transport of veterinary drugs because this could alter substrate pharmacokinetics and milk residues. We stably expressed the wild-type bovine ABCG2 and the Y581S variant in Madin-Darby canine kidney epithelial cells (MDCKII) and MEF3.8 cell lines generating cell models in which the functionality of the bovine transporter could be addressed. Functional studies confirmed the greater functional activity in mitoxantrone accumulation assays for the Y581S variant with a greater relative V(MAX) value (P = 0.040) and showed for the first time that the Y581S variant presents greater transcellular transport of the model ABCG2 substrate nitrofurantoin (P = 0.024) and of 3 veterinary antibiotics, the fluoroquinolone agents enrofloxacin (P = 0.035), danofloxacin (P = 0.001), and difloxacin (P = 0.008), identified as new substrates of the bovine ABCG2. In addition, the inhibitory effect of the macrocyclic lactone ivermectin on the activity of wild-type bovine ABCG2 and the Y581S variant was also confirmed, showing a greater inhibitory potency on the wild-type protein at all the concentrations tested (5 muM, P = 0.017; 10 muM, P = 0.001; 25 muM, P = 0.008; and 50 muM, P = 0.003). Differential transport activity depending on the genotype together with the differential inhibition pattern might have clinical consequences, including changes in substrate pharmacokinetics (and subsequently pharmacodynamics) and more specifically, changes in secretion of ABCG2 substrates into milk, potentially implying important consequences to veterinary therapeutics.
Comments [show]
None has been submitted yet.
No. Sentence Comment
480 Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N.
X
ABCG2 p.Asp620Asn 21821808:480:97
status: NEW[hide] Determinants of the activity and substrate recogni... Drug Metab Rev. 2014 Nov;46(4):459-74. doi: 10.3109/03602532.2014.942037. Epub 2014 Jul 18. Szafraniec MJ, Szczygiel M, Urbanska K, Fiedor L
Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2).
Drug Metab Rev. 2014 Nov;46(4):459-74. doi: 10.3109/03602532.2014.942037. Epub 2014 Jul 18., [PMID:25036722]
Abstract [show]
The xenobiotic transporters are among the most important constituents of detoxification system in living organisms. Breast cancer resistance protein (BCRP/ABCG2) is one of the major transporters involved in the efflux of xenobiotics. To understand its role in chemotherapeutic and multidrug resistance, it is crucial to establish the determinants of its substrate specificity, which obviously is of high relevance for successful therapy of many diseases. This article summarizes the current knowledge about the substrate preferences of BCRP. We overview the factors which determine its activity, inhibition and substrate recognition, focusing on the structural features of the transporter. BCRP substrate specificity is quite low as it interacts with a spectrum of substances with only a few common features: hydrophobic and aromatic regions, possibly a flat conformation and the metal ion-, oxygen- and nitrogen-containing functionalities, most of which may be the donors/acceptors of H-bonds. Several amino acid residues and structural motifs are responsible for BCRP activity and substrate recognition. Thus, the active form of BCRP, at least a dimer or a larger oligomer is maintained by intramolecular disulfide bridge that involves Cys(603) residues. The GXXXG motif in transmembrane helix 1, Cys residues, Arg(482) and Lys(86) are responsible for maintaining the protein structure, which confers transport activity, and the His(457) or Arg(456) residues are directly involved in substrate binding. Arg(482) does not directly bind substrates, but electrostatically interacts with charged molecules, which initiates the conformational changes that transmit the signal from the transmembrane regions to the ABC domain.
Comments [show]
None has been submitted yet.
No. Sentence Comment
201 To elucidate the significance of this polymorphism for porphyrin transport, a set of 18 variants of BCRP (Val12 Met, Gly51 Cys, Gln126 stop, Gln141 Lys, Thr153 Met, Gln166 Glu, Ile206 Leu, Phe208 Ser, Ser248 Pro, Glu334 stop, Phe431 Leu, Ser441 Asn, Arg482 Gly, Arg482 Thr, Phe489 Leu, Phe571 Ile, Asn590 Tyr and Asp620 Asn) have been expressed in insect cells.
X
ABCG2 p.Asp620Asn 25036722:201:313
status: NEW212 The naturally occurring mutations, Asn590 Tyr and Asp620 Asn, predicted to be localized in the extracellular region linking the TM5 and the TM6 domains (Wang et al., 2009), were also analyzed in HEK-293 cells transfected with BCRP bearing these substitutions.
X
ABCG2 p.Asp620Asn 25036722:212:50
status: NEW214 The efflux ability of Asp620 Asn-BCRP was also reduced, but not as much as in Asn590 Tyr BCRP.
X
ABCG2 p.Asp620Asn 25036722:214:22
status: NEW[hide] Role of the breast cancer resistance protein (BCRP... AAPS J. 2015 Jan;17(1):65-82. doi: 10.1208/s12248-014-9668-6. Epub 2014 Sep 19. Mao Q, Unadkat JD
Role of the breast cancer resistance protein (BCRP/ABCG2) in drug transport--an update.
AAPS J. 2015 Jan;17(1):65-82. doi: 10.1208/s12248-014-9668-6. Epub 2014 Sep 19., [PMID:25236865]
Abstract [show]
The human breast cancer resistance protein (BCRP, gene symbol ABCG2) is an ATP-binding cassette (ABC) efflux transporter. It was so named because it was initially cloned from a multidrug-resistant breast cancer cell line where it was found to confer resistance to chemotherapeutic agents such as mitoxantrone and topotecan. Since its discovery in 1998, the substrates of BCRP have been rapidly expanding to include not only therapeutic agents but also physiological substances such as estrone-3-sulfate, 17beta-estradiol 17-(beta-D-glucuronide) and uric acid. Likewise, at least hundreds of BCRP inhibitors have been identified. Among normal human tissues, BCRP is highly expressed on the apical membranes of the placental syncytiotrophoblasts, the intestinal epithelium, the liver hepatocytes, the endothelial cells of brain microvessels, and the renal proximal tubular cells, contributing to the absorption, distribution, and elimination of drugs and endogenous compounds as well as tissue protection against xenobiotic exposure. As a result, BCRP has now been recognized by the FDA to be one of the key drug transporters involved in clinically relevant drug disposition. We published a highly-accessed review article on BCRP in 2005, and much progress has been made since then. In this review, we provide an update of current knowledge on basic biochemistry and pharmacological functions of BCRP as well as its relevance to drug resistance and drug disposition.
Comments [show]
None has been submitted yet.
No. Sentence Comment
218 V12M resulting from the 34G>A SNP and other variants (e.g., I206L, F208S, N590Y, and D620N) display expression levels and drug resistance profiles comparable to wild-type BCRP (100,101).
X
ABCG2 p.Asp620Asn 25236865:218:85
status: NEW