ABCMdb

ABCG2 p.Pro269Ser

Predicted by SNAP2:	A: N (57%), C: D (63%), D: D (71%), E: D (71%), F: D (75%), G: D (71%), H: D (71%), I: D (71%), K: D (71%), L: D (71%), M: D (66%), N: D (66%), Q: D (63%), R: D (71%), S: D (59%), T: D (63%), V: D (71%), W: D (80%), Y: D (75%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Functional analysis of SNPs variants of BCRP/ABCG2... Pharm Res. 2004 Oct;21(10):1895-903. Kondo C, Suzuki H, Itoda M, Ozawa S, Sawada J, Kobayashi D, Ieiri I, Mine K, Ohtsubo K, Sugiyama Y
Functional analysis of SNPs variants of BCRP/ABCG2.
Pharm Res. 2004 Oct;21(10):1895-903., [PMID:15553238]

Abstract [show]
PURPOSE: The aim of the current study was to identify the effect of single nucleotide polymorphisms (SNPs) in breast cancer resistance protein (BCRP/ABCG2) on its localization, expression level, and transport activity. METHODS: The cellular localization was identified using the wild type and seven different SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP) after transfection of their cDNAs in plasmid vector to LLC-PK1 cells. Their expression levels and transport activities were determined using the membrane vesicles from HEK293 cells infected with the recombinant adenoviruses containing these kinds of BCRP cDNAs. RESULTS: Wild type and six different SNP variants of BCRP other than S441N BCRP were expressed on the apical membrane, whereas S441N BCRP showed intracellular localization. The expression levels of Q141K and S441N BCRP proteins were significantly lower compared with the wild type and the other five variants. Furthermore, the transport activity of E1S, DHEAS, MTX, and PAH normalized by the expression level of BCRP protein was almost the same for the wild type, V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP. CONCLUSIONS: These results suggest that Q141K SNPs may associate with a lower expression level, and S441N SNPs may affect both the expression level and cellular localization. It is possible that subjects with these polymorphisms may have lower expression level of BCRP protein and, consequently, a reduced ability to export these substrates.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 The cellular localization was identified using the wild type and seven different SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP) after transfection of their cDNAs in plasmid vector to LLC-PK1 cells. Login to comment
8 Furthermore, the transport activity of E1S, DHEAS, MTX, and PAH normalized by the expression level of BCRP protein was almost the same for the wild type, V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP. Login to comment
27 The allele frequencies of these SNPs are 18, 1, 36, 1, 0.5, 0.5, and 0.5%, respectively. In the 84 cell lines, 7 kinds of SNPs were identified and their frequency for G34A (V12M), C376T (Q126Stop), C421A (Q141K), G445C (A149P), G488A (R163K), C805T (P269S), and G1098A (E366E) are 22, 3, 29, 1, 0.6, 0.6 and 2%, respectively. Login to comment
29 We constructed expression systems for the wild type and SNPs variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, S441N BCRP) and examined whether these SNPs variants of BCRP alter its localization, expression level, and transport activity. Login to comment
42 Using site-directed mutagenesis, SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S and S441N BCRP) were constructed on pcDNA3.1 vector (SNPs type BCRP/pcDNA3.1). Login to comment
48 P269S BCRP was amplified with 5Ј-GACTTATGTTCCACGGGTCTGCT- CAGGAGGCCTTGGG-3Ј and 5Ј-CCCAAGGCCTCCT- GAGCAGACCCGTGGAACATAAGTC-3Ј. Login to comment
52 For SNPs type BCRPs, viruses were prepared in the same way, resulting in the production of pAd-SNPs BCRP (pAd-V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP). Login to comment
110 Except for two SNP variants of BCRP (Q141K and S441N BCRP), the ATP-dependent uptakes per mg membrane protein of SNP variants (V12M, A149P, R163K, Q166E, P269S BCRP) were similar to that of the wild-type BCRP (Fig. 3a). Login to comment
114 As shown in Fig. 3b, the transport activity of other SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP) was almost identical to that of the wild-type BCRP. Login to comment
120 Figure 5a shows the ATP-dependent uptake of DHEAS, PAH, and MTX per mg membrane protein for the wild-type and SNPs BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP). Login to comment
162 For these compounds, our results indicated that the transport activity per BCRP molecule for 6 kinds of SNP variants (V12M, A149P, R163K, Q166E, P269S, and also Q141K BCRP) is almost the same as that of the wild type BCRP (Figs. Login to comment

[hide] Linkage disequilibrium and haplotype architecture ... Ann Hum Genet. 2004 Nov;68(Pt 6):563-73. Wang H, Hao B, Zhou K, Chen X, Wu S, Zhou G, Zhu Y, He F
Linkage disequilibrium and haplotype architecture for two ABC transporter genes (ABCC1 and ABCG2) in Chinese population: implications for pharmacogenomic association studies.
Ann Hum Genet. 2004 Nov;68(Pt 6):563-73., [PMID:15598215]

Abstract [show]
Information about linkage disequilibrium (LD) patterns and haplotype structures for candidate genes is instructive for the design and analysis of genetic association studies for complex diseases and drug response. ABCC1 and ABCG2 are genes coding for two multidrug resistance (MDR) associated transporters; they are also related to some pathophysiological traits. To pinpoint the LD profiles of these MDR genes in Chinese, we systemically screened 27 unrelated individuals for single nucleotide polymorphisms (SNPs) in the coding and regulatory regions of these genes, and thereby characterized their haplotype structures. Despite marked variations in haplotype diversity, LD pattern and intragenic recombination intensity between the two genes, both loci could be partitioned into several LD blocks, in which a modest number of haplotypes accounted for a high fraction of the sampled chromosomes. We concluded that each locus has its own genomic LD profile, but that they still share a common segmental LD architecture with low haplotype diversity. Our data will benefit genetic association studies of complex traits and drug response possibly related to these genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 SNP Nucleotide sequence Minor allele dbSNP ID effect position (major/minor) frequency (%) ABCC1 1 5`FR/-1862 gacccG/Aggcca 44.4 2 5`FR/-1830 atcctA/Gtctac 1.9 3 5`FR/-1680 gaggaG/Aaaaag 1.9 4 5`FR/-471 cggatA/Gctgtc 7.4 5 E2/218 caaaaC/Tcaaaa 3.7 Thr73Ile 6 I2/-26 gttgtG/Aggggg 1.9 rs8187842 7 I3/-66 ctgggT/Cgacaa 37.0 rs4148337 8 I7/+54 ccactC/Actgtg 9.3 rs903880 9 I7/+64 ggcctC/Gaatcc 48.1 rs246232 10 E8/816 cagccG/Agtgaa 1.9 wobble 11 E8/825 aaggtT/Cgtgta 38.9 rs246221 wobble 12 E9/1062 gtgaaT/Cgacac 35.2 rs35587 wobble 13 I9/+8 aggggA/Gcgctg 37.0 rs35588 14 I12/-37 cactcA/Ggggca 20.4 rs35604 15 E13/1684 tggccT/Ctgtgc 20.4 rs35605 wobble 16 I13/+105 ccggtC/Tgggct 20.4 rs35606 17 I14/+105 ccagcC/Tgcttg 1.9 18 I15/+627 gctgtA/Gtttta 25.8 rs35628 19 I15/+669 aatctG/Ttagaa 7.4* rs4148353 20 I15/-967 ctttcT/Ggctgt 37.0 rs152029 21 E16/2007 atcccC/Tgaagg 3.7 rs2301666 wobble 22 E17/2168 tctccG/Aagaaa 5.6 rs4148356 Arg723Gln 23 I18/-30 gcactG/Cacgtg 16.7 rs2074087 24 I22/+62 aattaT/Ctccct 27.8 rs3887893 25 I22/-43 gtcagC/Ttccct 3.7 26 E27/3915 gaggaC/Tctgga 1.9 wobble 27 E28/4002 aagtcG/Atccct 11.1 rs2239330 wobble 28 I28/-35 tcagcA/Gtgaca 27.8 rs212087 29 I30/+30 gcacaG/Atggcc 29.6 rs212088 30 3`UTR/+801 accccC/Gactcc 33.3 rs129081 noncoding 31 3`UTR/+866 tactgT/Atccca 14.8 rs212090 noncoding 32 3`FR/+1513 gttctT/Ctaagg 27.8 ABCG2 1 5`UTR/-407 cgcagC/Tgcctc 1.9 2 5`UTR/-376 ggggaG/Acgctc 1.9 3 E2/34 tcccaG/Atgtca 20.4 rs2231137 Val12Met 4 I2/+36 ttttaA/Gtttac 25.9 rs4148152 5 I3/+10 gtataA/Ggagag 20.4 rs2231138 6 E5/421 acttaC/Agttct 22.2 rs2231142 Gln141Lys 7 E7/805 acgggC/Tctgct 3.7 Pro269Ser 8 I9/-126 agccaT/Gtgagt 7.4 9 I11/+20 gttctA/Gggaac 31.5 rs2231153 10 I12/+49 cctatG/Tggtga 16.7 rs2231156 11 I13/+40 tgtttT/Ctttcc 24.1 rs2231157 12 I13/-21 tgactC/Tttagt 29.6 rs2231162 13 I14/-46 ttcttG/Aaaatt 48.1 rs2725267 SNPs in specific regions, i.e. 5`flanking region (5`FR), 5`untranslated region (5`UTR), intron (I), exon (E), 3`UTR, and 3`FR, are presented as region/+(-): for 5`FR and 5`UTR, n nucleotides upstream (-) from the translation initiation site; for 3`UTR and 3`FR, n nt downstream (+) from the third base of stop codon; for coding regions, n corresponds to positions of their cDNA with the first base of start codon set to 1; and for introns, n nt upstream (-) from 3` site or downstream (+) from 5` site of introns. Login to comment

[hide] Functional analysis of the human variants of breas... Drug Metab Dispos. 2005 Jun;33(6):697-705. Epub 2005 Mar 2. Vethanayagam RR, Wang H, Gupta A, Zhang Y, Lewis F, Unadkat JD, Mao Q
Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N.
Drug Metab Dispos. 2005 Jun;33(6):697-705. Epub 2005 Mar 2., [PMID:15743976]

Abstract [show]
Previous studies have shown that the V12M and Q141K variants of breast cancer resistance protein (BCRP) can affect expression and function of the transporter. In this study, the effects of the I206L, N590Y, and D620N variants on protein expression, plasma membrane localization, and transport activity of BCRP were investigated. Wild-type BCRP and the three variants were stably expressed in human embryonic kidney (HEK) cells. Confocal microscopy analysis showed that the three variants were predominantly routed to the plasma membrane of HEK cells. The expression level of I206L in the plasma membrane was approximately 45% of that of wild-type protein, whereas the N590Y and D620N levels were increased approximately 3.6-fold and 2.4-fold, respectively, as determined by immunoblotting. All three variants transported mitoxantrone, pheophorbide a, and BODIPY FL-prazosin. After normalization for differences in BCRP expression, I206L, N590Y, and D620N exhibited approximately 2-fold, 0.3-fold, and 0.5-fold wild-type efflux activities, respectively. The variants also conferred resistance to mitoxantrone and topotecan. Mitoxantrone and topotecan resistance by I206L and N590Y was approximately 2-fold and 0.3-fold of the wild-type BCRP resistance levels, respectively. Although D620N conferred a topotecan resistance similar to that of the wild-type protein, its level of mitoxantrone resistance was decreased by 50%. After normalization to BCRP expression levels, ATPase activities of I206L were not significantly different from those of wild-type protein, whereas N590Y and D620N exhibited approximately 30% and 50% of wild-type ATPase activities, respectively. These results suggest that I206L has the lowest protein expression and the highest activity, whereas N590Y and D620N display higher expression and lower activity, relative to wild-type BCRP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
220 Several other BCRP variants occurring at much lower allele frequencies (0.5-1%) such as A149P, R163K, Q166E, P269S, and S441N have also been characterized (Kondo et al., 2004). Login to comment

[hide] The role of the human ABCG2 multidrug transporter ... Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7. Cervenak J, Andrikovics H, Ozvegy-Laczka C, Tordai A, Nemet K, Varadi A, Sarkadi B
The role of the human ABCG2 multidrug transporter and its variants in cancer therapy and toxicology.
Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7., 2006-03-08 [PMID:16337740]

Abstract [show]
The human multidrug resistance ABC transporters provide a protective function in our body against a large number of toxic compounds. These proteins, residing in the plasma membrane, perform an active, ATP-dependent extrusion of such xenobiotics. However, the same proteins are also used by the tumor cells to fight various anticancer agents. ABCG2 is an important member of the multidrug resistance proteins, an 'ABC half transporter', which functions as a homodimer in the cell membrane. In this review, we provide a basic overview of ABCG2 function in physiology and drug metabolism, but concentrate on the discussion of mutations and polymorphisms discovered in this protein. Interestingly, a single nucleotide mutation, changing amino acid 482 from arginine to threonine or glycine in ABCG2, results in a major increase in the catalytic activity and a wider drug recognition by this protein. Still, this mutation proved to be an in vitro artifact, produced only in heavily drug-selected cell lines. In contrast, at least two, but possibly more polymorphic variants of ABCG2 were found to be present in large human populations with different ethnic background. However, currently available experimental data regarding the cellular expression, localization and function of these ABCG2 variants are strongly contradictory. Since, the proteins produced by these variant alleles may differently modulate cancer treatment, general drug absorption and toxicity, may represent risk factors in fetal toxicity, or alter the differentiation of stem cells, their exact characterization is a major challenge in this field.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
94 In addition to the aa 482 ABCG2 mutations, several other variants [c.445GOC (A149P), c.458COT (T153M), c.488GOA (R163K), c.805COT (P269S)] leading to coding sequence changes were identified in different cell lines that were also not detected in healthy individuals [47,55]. Login to comment
147 In a recent study, similarly LLC-PKI cells where used to express the V12M and Q141K variants and additionally five other polymorphisms (A149P, R163K, Q166E, P269S and S441N [55]). Login to comment

[hide] Genetic variation and haplotype structure of the A... Drug Metab Pharmacokinet. 2006 Apr;21(2):109-21. Maekawa K, Itoda M, Sai K, Saito Y, Kaniwa N, Shirao K, Hamaguchi T, Kunitoh H, Yamamoto N, Tamura T, Minami H, Kubota K, Ohtsu A, Yoshida T, Saijo N, Kamatani N, Ozawa S, Sawada J
Genetic variation and haplotype structure of the ABC transporter gene ABCG2 in a Japanese population.
Drug Metab Pharmacokinet. 2006 Apr;21(2):109-21., [PMID:16702730]

Abstract [show]
The ATP-binding cassette transporter, ABCG2, which is expressed at high levels in the intestine and liver, functions as an efflux transporter for many drugs, including clinically used anticancer agents such as topotecan and the active metabolite of irinotecan (SN-38). In this study, to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCG2, we have comprehensively searched for genetic variations in the putative promoter region, all the exons, and their flanking introns of ABCG2 from 177 Japanese cancer patients treated with irinotecan. Forty-three genetic variations, including 11 novel ones, were found: 5 in the 5'-flanking region, 13 in the coding exons, and 25 in the introns. In addition to 9 previously reported nonsynonymous single nucleotide polymorphisms (SNPs), 2 novel nonsynonymous SNPs, 38C>T (Ser13Leu) and 1060G>A (Gly354Arg), were found with minor allele frequencies of 0.3%. Based on the LD profiles between the SNPs and the estimated past recombination events, the region analyzed was divided into three blocks (Block -1, 1, and 2), each of which spans at least 0.2 kb, 46 kb, and 13 kb and contains 2, 24, and 17 variations, respectively. The two, eight, and five common haplotypes detected in 10 or more patients accounted for most (>90%) of the haplotypes inferred in Block -1, Block 1, and Block 2, respectively. The SNP and haplotype distributions in Japanese were different from those reported previously in Caucasians. This study provides fundamental information for the pharmacogenetic studies investigating the relationship between the genetic variations in ABCG2 and pharmacokinetic/pharmacodynamic parameters.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 On the other hand, several nonsynonymous SNPs reported in other ethnic groups were not detected: 805CÀT (Pro269Ser) found in Chinese at a 0.037 frequency,20) 1858GÀA (Asp620Asn) in undened (combined) ethnicities14) (0.011) and in a Dutch population21) (0.005), 616AÀC (Ile206Leu) in Hispanics (0.100), and 1768AÀT (Asn590Tyr) in Caucasians (0.010).18) Thus, these SNPs are either ethnic-specic or rare. Login to comment

[hide] Human multidrug resistance ABCB and ABCG transport... Physiol Rev. 2006 Oct;86(4):1179-236. Sarkadi B, Homolya L, Szakacs G, Varadi A
Human multidrug resistance ABCB and ABCG transporters: participation in a chemoimmunity defense system.
Physiol Rev. 2006 Oct;86(4):1179-236., [PMID:17015488]

Abstract [show]
In this review we give an overview of the physiological functions of a group of ATP binding cassette (ABC) transporter proteins, which were discovered, and still referred to, as multidrug resistance (MDR) transporters. Although they indeed play an important role in cancer drug resistance, their major physiological function is to provide general protection against hydrophobic xenobiotics. With a highly conserved structure, membrane topology, and mechanism of action, these essential transporters are preserved throughout all living systems, from bacteria to human. We describe the general structural and mechanistic features of the human MDR-ABC transporters and introduce some of the basic methods that can be applied for the analysis of their expression, function, regulation, and modulation. We treat in detail the biochemistry, cell biology, and physiology of the ABCB1 (MDR1/P-glycoprotein) and the ABCG2 (MXR/BCRP) proteins and describe emerging information related to additional ABCB- and ABCG-type transporters with a potential role in drug and xenobiotic resistance. Throughout this review we demonstrate and emphasize the general network characteristics of the MDR-ABC transporters, functioning at the cellular and physiological tissue barriers. In addition, we suggest that multidrug transporters are essential parts of an innate defense system, the "chemoimmunity" network, which has a number of features reminiscent of classical immunology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
824 It is worth noting that in addition to the amino acid 482 ABCG2 mutations, several other variants, A149P, T153M, R163K, and P269S, were identified in different cell lines that were also not detected in healthy individuals (188, 247) (Fig. 11). Login to comment

[hide] Genetic polymorphisms of human ABC transporter ABC... J Exp Ther Oncol. 2006;6(1):1-11. Tamura A, Wakabayashi K, Onishi Y, Nakagawa H, Tsuji M, Matsuda Y, Ishikawa T
Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system.
J Exp Ther Oncol. 2006;6(1):1-11., [PMID:17228519]

Abstract [show]
The vector-mediated introduction of cDNA into mammalian cells by calcium phosphate co-precipitation or permeation with lipofectamine is widely used for the integration of cDNA into genomic DNA. However, integration of cDNA into the host's chromosomal DNA occurs randomly at unpredictable sites, and the number of integrated recombinant DNAs is not controllable. To investigate the effect of genetic polymorphisms of ABCG2 on the protein expression and the drug resistance profile, we developed the Flp-In method to integrate one single copy of ABCG2 variant-cDNA into FRT-tagged genomic DNA. More than 20 metaphase spreads were examined for both fluorescence in situ hybridization (FISH) mapping and multicolor-FISH analysis, and it has been revealed that ABCG2 cDNA was incorporated into the telomeric region of the short arm on one of chromosomes 12 in Flp-In-293 cells. Based on the currently available SNP data for human ABCG2, we have created a total of seven variants by site-directed mutagenesis and stably expressed them in Flp-In-293 cells. While mRNAs of those integrated ABCG2 variants and wild type were evenly expressed in Flp-In-293 cells, the protein expression levels of F208S and S441N variants were found to be markedly low. It is suggested that the protein instability due to enhanced degradation resulted in the low levels of their protein expression. Thus, the Flp recombinase system would provide a useful tool to validate the effect of nonsynonymous SNPs on the protein stability and post-translational modification of ABCG2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
142 Finally, the acquired mutants R482G and R482T form another group, which is characteristic Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 9 Table 3 Remarks mRNA Protein Author Ref Host cell Vector Expression SNP expression expression Imai et al. (15) PA317 pHaL-IRES-DHFR bicistronic Stable V12M Similar to WT Similar to WT - - retrovirus vector plasmid - Q141K Similar to WT Lower than WT Mizuarai et al. (18) LLC-PK1 pcDNA3.1(+) Stable V12M Similar to WT N.D. - - - - Q141K Similar to WT N.D. Morisaki et al. (25) HEK293 pcDNA3.1 Stable V12M Vary among clones Vary among clones - - - - Q141K Vary among clones Vary among clones - - - - D620N Vary among clones Vary among clones Kondo et al. (26) LLC-PK1/ pcDNA3.1/ Stable/ V12M N.D. Similar to WT - HEK293 Adenovirus Transient Q141K N.D. 30 - 40% of WT - - - - A149P N.D. Similar to WT - - - - R163K N.D. Similar to WT - - - - Q166E N.D. Similar to WT - - - - P269S N.D. Similar to WT - - - - S441N N.D. Lower than WT Vethanayagam (27) HEK293 pcDNA3.1/myc-His(-) Stable I206L N.D. Vary among clones et al. - - - - N590Y N.D. Vary among clones - - - - D620N N.D. Vary among clones N.D.: No data Table 2. Login to comment

[hide] Identification and functional assessment of BCRP p... Drug Metab Dispos. 2007 Apr;35(4):623-32. Epub 2007 Jan 19. Lee SS, Jeong HE, Yi JM, Jung HJ, Jang JE, Kim EY, Lee SJ, Shin JG
Identification and functional assessment of BCRP polymorphisms in a Korean population.
Drug Metab Dispos. 2007 Apr;35(4):623-32. Epub 2007 Jan 19., [PMID:17237154]

Abstract [show]
The breast cancer resistance protein (BCRP) is a member of the ATP-binding cassette transporters. The aim of the present study was to identify genetic variants of BCRP in Koreans and to assess the functional consequences of BCRP polymorphisms. Twenty single nucleotide polymorphisms (SNP), including four nonsynonymous SNP, were identified by DNA sequencing of the BCRP gene in 92 Korean subjects. BCRP V12M, Q141K, P269S, and Q126Stop were detected at frequencies of 23, 28, 0.2, and 1.9%, respectively. These four coding variants were also screened in Chinese and Vietnamese subjects; the allelic frequencies among the three populations were compared; and predictions were made as to the potential frequency of each variant. In vitro functional analyses of the P269S protein and the promoter SNP -19031C>T (mutated in the hypoxia-inducible factor-1alpha binding site) were performed and compared with those of the wild type. P269S exhibited a 35 to 40% decrease in vesicular uptake of [(3)H]estrone-3-sulfate and [(3)H]methotrexate compared with the wild type. The promoter SNP -19031C>T did not affect BCRP promoter activity in either the presence or absence of chemical-induced hypoxic stress. Our results suggest that the P269S variant could be a functionally altered variant. Genotyping of this variant in clinical studies is needed to address its phenotypic role. Genetic polymorphisms of BCRP were found to be very common in Koreans, as well as in other ethnic groups. Comparative analyses among three Asian populations revealed different frequencies for the four functional BCRP variants.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 BCRP V12M, Q141K, P269S, and Q126Stop were detected at frequencies of 23, 28, 0.2, and 1.9%, respectively. These four coding variants were also screened in Chinese and Vietnamese subjects; the allelic frequencies among the three populations were compared; and predictions were made as to the potential frequency of each variant. Login to comment
4 In vitro functional analyses of the P269S protein and the promoter SNP -19031C>T (mutated in the hypoxia-inducible factor-1␣ binding site) were performed and compared with those of the wild type. Login to comment
5 P269S exhibited a 35 to 40% decrease in vesicular uptake of [3 H]estrone-3-sulfate and [3 H]methotrexate compared with the wild type. Login to comment
7 Our results suggest that the P269S variant could be a functionally altered variant. Login to comment
33 Therefore, we investigated, for the first time, genetic polymorphisms of the BCRP gene in a Korean population and performed in vitro functional characterization of a novel regulatory SNP and a coding SNP (P269S). Login to comment
34 The functional capability of the P269S variant to take up [3 H]estrone-3-sulfate (ES) and [3 H]MTX has been reported as being comparable with that of the wild-type protein TABLE 1 Primer sequences used for the amplification of the BCRP gene fragment and the annealing temperatures used in the PCR Name Region Primer Sequence (5Ј33Ј) Size PCR Condition base pair Tm; °C BCRP1P Promoter F: AACCCAGCTAGGTCAGACGA 557 60.0 R: TTTGAGTGGGCACAGCAC BCRP2P Promoter F: TTCCTAGGGTAGATGCAGCAG 509 60.0 R: CAGGGACAAGCCAAACACTC BCRP3P Promoter F: GTAGAGGCAGGGTTTCACCA 559 60.0 R: AAGTGATTGCGCATGTTCAG BCRP4P Promoter F: CGTGCCTGGCCTCTATGTAT 572 60.0 R: CTGACGCAGGCAGATCACT BCRP5P Promoter F: GCCACCACACCCAGTGTAAT 518 64.7 R: TGCAAAGTAAAAACAAATCAAAACC BCRP1E Exon 1 F: AGCTCGTCCCCTGGATGT 516 54.0 R: CCACCAACCTTTCCAGACAC BCRP2E Exon 2 F: CTGCTCATTGCCACACATTT 400 54.0 R: GCCAAAACCTGTGAGGTTCA BCRP3E Exon 3 F: GTCTCAAACTCCTGGCCTCA 403 54.0 R: GCGTTGCAAATGCTCAATAA BCRP4E Exon 4 F: TGGATTCAAAGTAGCCATGAGA 402 54.0 R: ATTCTCCCTGCCTTTTCACA BCRP5E Exon 5 F: GGTTCATCATTAGCTAGAACTTTACC 403 54.0 R: TGGAAAGCAACCATTTTTGA BCRP6E Exon 6 F: TCTTACAGGACTGGCACACG 426 54.0 R: CCTTCCCTACATTCTTACCTGCT BCRP7E Exon 7 F: TCAGGCTGAACTAGAGCAAACA 387 60.0 R: AGCACCAAATGGAACAAACA BCRP8E Exon 8 F: CATGGGAAGAAGAGAGAAAGAAA 412 60.0 R: CAAAAACACCAACAGCACTCA BCRP9E Exon 9 F: GGTGTTAGGGAAGCATCCAA 413 54.0 R: TGAAGCAGATGATAACAGAACCA BCRP10E Exon 10 F: GCCAAGCCATTGAGTGTTTA 386 60.0 R: TGGGCAACAGAGCATGAC BCRP11E Exon 11 F: CCACAACAATCCAAGACTGTG 423 60.0 R: GTAATCCTCCGGATCCCATC BCRP12E Exon 12 F: GGTCTAGCCCTGAGGATGTG 403 64.7 R: GAGTGCAAAATGGACAGGTG BCRP13E Exon 13 F: AGGGTGGTTGGAGAGTGGAT 412 60.0 R: AGCAGAGCCCCATTTACAGA BCRP14E Exon 14 F: TGAGTGTCTTGAGTAAGTGGAGAGA 420 54.0 R: GACTCCCCAGCCTTGTGTTA BCRP15E Exon 15 F: TCTTGATTGCCAGGGAAAAT 404 60.0 R: CGCGCACAACTCACTTTATG BCRP16E Exon 16 F: TGACGGATGCTAGGAATGAA 430 64.7 R: CCCATGGTTACTGTCTGAGGA TABLE 2 Primer sequences used for the pyrosequencing-based genotyping of functional BCRP variants SNPa Variant Primer Sequence (5Ј33Ј) Size PCR Condition base pair Tm; °C 34GϾA V12M 5Ј-Biotin-CTCTCCAGATGTCTTCCAGTAATG-3Ј 278 54.0 5Ј-GCCAAAACCTGTGAGGTTCA-3Ј For sequencing: 5Ј-AGTGTTCCTTTGTGGTTAC-3Ј 8191CϾT Q126Stop 5Ј-Biotin-ACTATCAGCCAAAGCACTTACCC-3Ј 174 54.5 5Ј-GTCTTAGCTGCAAGGAAAGATCCA-3Ј For sequencing: 5Ј-AATGTAATTCAGGTTACGTG-3Ј 8825CϾA Q141K 5Ј-Biotin-GTTGCAAGCCGAAGAGCTG-3Ј 69 54.0 5Ј-TGATGTTGTGATGGGCACTC-3Ј For sequencing: 5Ј-GACGGTGAGAGAAAACTT-3Ј 21850CϾT P269S 5Ј-Biotin-TAGCACCAAATGGAACAAACAC-3Ј 236 54.0 5Ј- TGTTTGATAGCCTCACCTTATTGG-3Ј For sequencing: 5Ј-GAAGACTTATGTTCCACG-3Ј a Position is indicated with respect to the start codon (ATG) of the BCRP gene; the A in the ATG triplet is designated as ϩ1, and the next base toward the 5Ј-end is designated as -1. Login to comment
36 However, in the present study, BCRP P269S from human blood samples (not from cell lines) was used for the first time. Login to comment
37 Functional information on P269S is sparse, as compared with the amount of information that has been collected for other coding variants, such as V12M, Q141K, and the null allele Q126Stop. Login to comment
38 Because proline is known to be a helix breaker, the three-dimensional structure of the BCRP protein may be affected in the P269S variant. Login to comment
39 Therefore, we performed a functional study of the P269S variant among the four variants identified in the study (V12M, Q141K, P269S, and Q126Stop). Login to comment
65 All the subjects were screened for BCRP V12M, Q126Stop, Q141K, and P269S. Login to comment
83 The BCRP R482-P269S and G482-P269S variants were generated by an overlap extension procedure using specific primers that introduced amino acid substitutions: 5Ј-AGGCCTCCT- GAGCAGACCCGTGGAACATAAG-3Ј and 5Ј-CTTATGTTCCACGGGTC- TGCTCAGGAGGCCT-3Ј. Login to comment
105 SNP and Positionb Position Relative to Transcription Start Site Location Effect N Allelic Frequency % 1 -20296AϾG -1379 Promoter 92 13 2 -19855CϾT -938 Promoter 92 0.5 3 -19605AϾG -688 Promoter 92 0.5 4 -19031CϾT -114 Promoter 92 1.6 5 -18631CϾT ϩ286 5ЈUTR 92 2.2 6 34GϾA Exon 2 V12M 275 23 7 238AϾG Intron 2 92 25 8 7430AϾG Intron 3 92 9.8 9 8191CϾT Exon 4 Q126Stop 375 1.9 10 8825CϾA Exon 5 Q141K 275 28 11 21850CϾT Exon 7 P269S 674 0.2 12 26297GϾA Exon 9 92 1.1 13 38485AϾG Intron 11 92 24 14 40086insA Intron 12 92 0.5 15 40110GϾT Intron 12 92 22 16 42288CϾT Intron 13 92 67.4 17 42313TϾG Intron 13 92 2.2 18 44072CϾT Intron 13 92 23.4 19 44997AϾG Intron 14 92 49.5 20 45235CϾT Intron 15 92 20.1 a The reference sequence used has GenBank accession no. Login to comment
149 The four coding SNP were 34GϾA coding for V12M, 8191CϾT coding for Q126Stop, 8825CϾA coding for Q141K, and 21850CϾT coding for P269S. Login to comment
150 For more extensive evaluation of the allelic frequencies of the four BCRP variants found in the Korean population, the remaining 183 subjects were screened by pyrosequencing for the presence of V12M, Q126Stop, Q141K, and P269S. Login to comment
153 Q126Stop and P269S were found in 1.9 and 0.2% of Koreans, respectively. Login to comment
155 Recently, Kondo et al. (2004) reported the identification of several BCRP variants, which include A149P, R163K, Q166E, P269S, and S441N, in human cell lines. Login to comment
156 With the exception of the BCRP P269S variant, these variants were not observed in this study. Login to comment
163 The BCRP haplotypes for 11 common SNP with frequencies Ͼ5% were analyzed )A( WT P269S Mock 0 05 001 051 002 052 003 053 [3 H]MTXuptake(pmol/min/mgprotein) TW S962P * [3 H]ESuptake(pmol/min/mgprotein) )B( )C( 0 52 05 57 001 521 TW S962P * FIG. 3. Login to comment
164 In vitro functional characterization of the BCRP P269S variant. Login to comment
165 A, vesicular uptake of [3 H]MTX in membranes obtained from Sf9 cells that express the wild-type BCRP protein or the BCRP P269S variant protein. Login to comment
167 BCRP P269S exhibited significantly decreased activity compared with the wild type in a two-tailed Student`s t test; ‫,ء‬ p Ͻ 0.05. Login to comment
168 B, vesicular uptake of [3 H]ES membranes obtained from Sf9 cells that express the wild-type BCRP protein or the BCRP P269S variant protein. Login to comment
190 Transporter Activity of the P269S Variant. Login to comment
191 Two different comparisons of the wild-type and P269S variant proteins were performed. Login to comment
192 Vesicular uptake of [3 H]MTX and [3 H]ES into the microsomal fraction was measured for the BCRP wild-type and P269S proteins expressed in Sf9 cells. Login to comment
193 BCRP P269S-expressing microsomes showed about 35 to 40% decrease in [3 H]MTX and [3 H]ES uptake compared with microsomes that expressed the wild-type BCRP (Fig. 3, A and B). Login to comment
194 The expression levels of the wild-type and P269S BCRP proteins were similar, as confirmed by immunoblotting (Fig. 3C). Login to comment
195 To investigate whether the decreased functionality of BCRP P269S was derived from the modulation of substrate-dependent ATPase activity, prazosin-induced ATPase activity was measured in the wild-type and P269S-expressing microsomes from Sf9 cells. Login to comment
197 The BCRP ATPase activity in the presence of prazosin of the P269S variant was also the same as that of the wild-type protein, which indicates that the decreased activity of P269S is not related to ATPase activity. Login to comment
200 From the screening of four nonsynonymous variants in other ethnic groups, the allelic frequencies of V12M, Q126Stop, Q141K, and P269S were obtained (Table 4). Login to comment
203 The P269S variant was not observed in 100 Caucasians and 100 African-Americans, which suggests that this variant is a rare variant that is found only in Asians. Login to comment
209 Prazosin-dependent ATPase activity of the BCRP P269S variant. Login to comment
210 A, ATPase activities of Sf9 cells that express the wild-type BCRP protein or the BCRP P269S variant protein. Login to comment
223 P269S was observed exclusively in Koreans and Vietnamese and not in the Caucasian, African-American, and Chinese populations. Login to comment
234 Our results on BCRP haplotypes in the Korean population TABLE 4 Haplotype distribution of BCRP gene in Koreans PNS 69202- G>A 43 A>G 832 G>A 0347 G>A 5288 A>C 58483 G>A 01104 T>G 88224 T>C 27044 T>C 79944 G>A 53254 T>C ycneuqerF )%( egnahcAA K141QM21V 4.621 2 9.91 3 8.7 4 6.7 5 4.7 6 9.5 7 7.4 8 9.2 9 5.2 01 8.1 11 7.1 21 4.1 31 1.1 Haplotype 41 1.1 TABLE 5 Expected allelic frequencies of BCRP V12M, Q126Stop, Q141K, and P269S variants in different Asian populations Population No. Login to comment
235 of Subjects Allelic Frequency (95% CI) V12M Q126Stop Q141K P269S % % % % Korean 275-674a 23 (19.6-26.6) 1.9 (0.9-2.9) 28 (23.8-31.2) 0.2 (0-0.4) Chinese 191 33b (28.5-37.9) 0.5 (0-1.2) 29 (24.3-33.3) 0 (0-0.1) Vietnamese 140 36b (30.8-42.0) 0.4 (0-1.1) 31 (25.7-36.5) 0.7 (0-1.7) a The numbers of subjects genotyped for the V12M, Q126Stop, Q141K, and P269S variants were 275, 375, 275, and 674, respectively. Login to comment
250 In the present study, we have described the allele frequencies for BCRP variants in a Korean population and analyzed the function of the P269S coding variant. Login to comment
251 Kondo et al. (2004) have reported that the P269S variant has activity similar to that of the wild-type protein. Login to comment
252 However, in at least three repeated experiments, we showed that P269S shows altered ES and MTX uptake as compared with the wild type. Login to comment
253 Both the previous study and our current study show similar protein levels of P269S variant and wild-type protein expression in the systems used. Login to comment
257 Therefore, the possibility that P269S variation may not change the BCRP activity in mammalian cells cannot be ruled out. Login to comment

[hide] Evaluation of drug-transporter interactions using ... Curr Drug Metab. 2007 May;8(4):341-63. Xia CQ, Milton MN, Gan LS
Evaluation of drug-transporter interactions using in vitro and in vivo models.
Curr Drug Metab. 2007 May;8(4):341-63., [PMID:17504223]

Abstract [show]
Drug transporters, including efflux transporters (the ATP binding cassette (ABC) proteins) and uptake transporters (the solute carrier proteins (SLC)), have an important impact on drug disposition, efficacy, drug-drug interactions and toxicity. Identification of the interactions of chemical scaffolds with transporters at the early stages of drug development can assist in the optimization and selection of new drug candidates. In this review, we discuss current in vitro and in vivo models used to investigate the interactions between drugs and transporters such as P-gp, MRP, BCRP, BSEP, OAT, OATP, OCT, NTCP, PEPT1/2 and NT. In vitro models including cell-based, cell-free, and yeast systems as well as in vivo models such as genetic knockout, gene deficient and chemical knockout animals are discussed and compared. The applications, throughput, advantages and limitations of each model are also addressed in this review.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
119 The function of seven single nucleotide polymorphisms (SNPs) in BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP) was determined using membrane vesicles from HEK293 cells infected with the recombinant adenoviruses containing the corresponding BCRP cDNAs [45]. Login to comment
121 Furthermore, the transport rate of estrone sulfate, dehydroepiandrosterone sulfate (DHEAS), methotrexate, and p-aminohippurate was almost the same for the wild type, V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP variants when it is normalized by the expression levels of BCRP protein. Login to comment

[hide] Drug-induced phototoxicity evoked by inhibition of... Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72. Tamura A, An R, Hagiya Y, Hoshijima K, Yoshida T, Mikuriya K, Ishikawa T
Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems.
Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72., [PMID:18363541]

Abstract [show]
BACKGROUND: Photosensitivity depends on both genetic and environmental factors. Pheophorbide a, present in various plant-derived foods and food supplements, can be absorbed by the small intestine. Accumulation of pheophorbide a and porphyrins in the systemic blood circulation can result in phototoxic lesions on light-exposed skin. OBJECTIVE: As the human ATP-binding cassette (ABC) transporter ABCG2 has been suggested to be critically involved in porphyrin-mediated photosensitivity, we aimed to develop in vitro screening systems for drug-induced phototoxicity. CONCLUSION: Functional impairment owing to inhibition of ABCG2 by drugs or its genetic polymorphisms can lead to the disruption of porphyrin homeostasis. This review article provides an overview on drug-induced photosensitivity, as well as our hypothesis on a potential role of ABCG2 in phototoxicity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A. Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
250 It should be noted that many xeno- and endobiotic BCRP Figure 5 Predicted membrance topology of BCRP (ABCG2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 5 for allele frequencies and description of funtional consequences. NH2 COOH NBD Val12Met Gly51Cys Gln126* Ala149Pro Gln141Lys Thr153Met Arg160Gln Arg163Lys Gln166Glu Phe506Ser Phe507Leu Val508Leu Met509* Phe489Leu Ser441Asn Phe431Leu Glu334* Ile206Leu Ala315del Thr316del Phe208Ser Asp296His Ser248Pro Pro269Ser Phe571Ile Arg575* Asn590Tyr Asp620Asn in out Membrane BCRP (ABCG2) NBD Val12Met NBDNBD Val12Met substrates are also transported by other efflux transporters, especially P-glycoprotein, thus extrapolating BCRP related in vitro data to the in vivo situation may be difficult. Login to comment

[hide] Clinical pharmacogenetics and potential applicatio... Curr Drug Metab. 2008 Oct;9(8):738-84. Zhou SF, Di YM, Chan E, Du YM, Chow VD, Xue CC, Lai X, Wang JC, Li CG, Tian M, Duan W
Clinical pharmacogenetics and potential application in personalized medicine.
Curr Drug Metab. 2008 Oct;9(8):738-84., [PMID:18855611]

Abstract [show]
The current 'fixed-dosage strategy' approach to medicine, means there is much inter-individual variation in drug response. Pharmacogenetics is the study of how inter-individual variations in the DNA sequence of specific genes affect drug responses. This article will highlight current pharmacogenetic knowledge on important drug metabolizing enzymes, drug transporters and drug targets to understand interindividual variability in drug clearance and responses in clinical practice and potential use in personalized medicine. Polymorphisms in the cytochrome P450 (CYP) family may have had the most impact on the fate of pharmaceutical drugs. CYP2D6, CYP2C19 and CYP2C9 gene polymorphisms and gene duplications account for the most frequent variations in phase I metabolism of drugs since nearly 80% of drugs in use today are metabolised by these enzymes. Approximately 5% of Europeans and 1% of Asians lack CYP2D6 activity, and these individuals are known as poor metabolizers. CYP2C9 is another clinically significant drug metabolising enzyme that demonstrates genetic variants. Studies into CYP2C9 polymorphism have highlighted the importance of the CYP2C9*2 and CYP2C9*3 alleles. Extensive polymorphism also occurs in a majority of Phase II drug metabolizing enzymes. One of the most important polymorphisms is thiopurine S-methyl transferases (TPMT) that catalyzes the S-methylation of thiopurine drugs. With respect to drug transport polymorphism, the most extensively studied drug transporter is P-glycoprotein (P-gp/MDR1), but the current data on the clinical impact is limited. Polymorphisms in drug transporters may change drug's distribution, excretion and response. Recent advances in molecular research have revealed many of the genes that encode drug targets demonstrate genetic polymorphism. These variations, in many cases, have altered the targets sensitivity to the specific drug molecule and thus have a profound effect on drug efficacy and toxicity. For example, the beta (2)-adrenoreceptor, which is encoded by the ADRB2 gene, illustrates a clinically significant genetic variation in drug targets. The variable number tandem repeat polymorphisms in serotonin transporter (SERT/SLC6A4) gene are associated with response to antidepressants. The distribution of the common variant alleles of genes that encode drug metabolizing enzymes, drug transporters and drug targets has been found to vary among different populations. The promise of pharmacogenetics lies in its potential to identify the right drug at the right dose for the right individual. Drugs with a narrow therapeutic index are thought to benefit more from pharmacogenetic studies. For example, warfarin serves as a good practical example of how pharmacogenetics can be utilized prior to commencement of therapy in order to achieve maximum efficacy and minimum toxicity. As such, pharmacogenetics has the potential to achieve optimal quality use of medicines, and to improve the efficacy and safety of both prospective and licensed drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
636 The localization of other variants including V12M, A149P, R163K, Q166E, P269S and S441N was also examined. Login to comment

[hide] Intracellular trafficking of MDR transporters and ... Curr Top Med Chem. 2009;9(2):197-208. Porcelli L, Lemos C, Peters GJ, Paradiso A, Azzariti A
Intracellular trafficking of MDR transporters and relevance of SNPs.
Curr Top Med Chem. 2009;9(2):197-208., [PMID:19200005]

Abstract [show]
Multi-drug resistance (MDR) frequently contributes to the failure of chemotherapeutic treatments in cancer patients. Mechanisms underlying the development of MDR have been extensively studied and are considered multifactorial. Among them, the ATP-Binding Cassette (ABC) family of proteins plays a pivotal role. Processes of cellular distribution and subcellular localization of MDR-ABC proteins are not yet well explored and to enlighten these topics could be crucial to understand cellular drug uptake and retention. In this review, we analysed literature data concerning i) intracellular trafficking of MDR-ABC proteins (BCRP, P-gp and MRP1) and ii) mechanisms altering their cellular localization and trafficking. Moreover, we describe single nucleotide polymorphisms (SNP) that have been reported for some multidrug resistance (MDR) transporters, such as BCRP and P-gp, emphasizing their ability to affect the expression, function and localization of the transporters, with implications on drug resistance phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
201 Along with the above mentioned G34A, C421A and G1322A ABCG2 variants, the authors also studied the G445C (A149P), G488A (R163K), C496G (Q166E) and C805T (P269S) polymorphisms. Login to comment
204 [106] also reported similar protein levels of P269S variant and wild-type ABCG2. Login to comment
205 However, they showed that membrane vesicles obtained from Sf9 cells expressing the P269S variant displayed about 35 to 40% decrease in [3 H]methotrexate and [3 H]estrone-3-sulfate uptake compared with the ones expressing wild-type ABCG2, suggesting a decreased functionality of ABCG2 P269S. Login to comment

[hide] Impact of breast cancer resistance protein on canc... Methods Mol Biol. 2010;596:251-90. Ross DD, Nakanishi T
Impact of breast cancer resistance protein on cancer treatment outcomes.
Methods Mol Biol. 2010;596:251-90., [PMID:19949928]

Abstract [show]
Breast cancer resistance protein (BCRP/ABCG2) was discovered in multidrug resistant breast cancer cells having an ATP-dependent transport-based resistance phenotype. This ABC transporter functions (at least in part) as a xenobiotic protective mechanism for the organism: in the gut and biliary tract, it prevents absorption and enhances elimination of potentially toxic substances. As a placental barrier, it protects the fetus; similarly, it serves as a component of blood-brain and blood-testis barrier; BCRP is expressed in stem cells and may protect them from potentially harmful agents. Therefore, BCRP could influence cancer outcomes by (a) endogenous BCRP affecting the absorption, distribution, metabolism, and elimination of anticancer drugs; (b) BCRP expression in cancer cells may directly cause resistance by active efflux of anticancer drugs; (c) BCRP expression in cancer cells could be a manifestation of the activity of metabolic and signaling pathways that impart multiple mechanisms of drug resistance, self-renewal (stemness), and invasiveness (aggressiveness)--i.e. impart a poor prognosis--to cancers. This chapter presents a synopsis of translational clinical studies relating BCRP expression in leukemias, lymphomas, and a variety of solid tumors with clinical outcome. Data are emerging that expression of BCRP, like P-glycoprotein/ABCB1, is associated with adverse outcomes in a variety of human cancers. Whether this adverse prognostic effect results from resistance imparted to the cancer cells as the direct result of BCRP efflux of anticancer drugs, or whether BCRP expression (and also Pgp expression - coexpression of these transporters is common among poor risk cancers) serves as indicators of the activity of signaling pathways that enhance cancer cellular proliferation, metastases, genomic instability, enhance drug resistance, and oppose programmed cell death mechanisms is yet unknown.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
90 found four nonsynonymous coding region SNPs among 92 Korean subjects (V12M, Q141K, P269S, Q126Stop), and four SNPs in the BCRP promoter region, one of which was in the HIF-1 response element (C-19031T) (86). Login to comment

[hide] In vitro and in vivo evidence for the importance o... Handb Exp Pharmacol. 2011;(201):325-71. Meyer zu Schwabedissen HE, Kroemer HK
In vitro and in vivo evidence for the importance of breast cancer resistance protein transporters (BCRP/MXR/ABCP/ABCG2).
Handb Exp Pharmacol. 2011;(201):325-71., [PMID:21103975]

Abstract [show]
The breast cancer resistance protein (BCRP/ABCG2) is a member of the G-subfamiliy of the ATP-binding cassette (ABC)-transporter superfamily. This half-transporter is assumed to function as an important mechanism limiting cellular accumulation of various compounds. In context of its tissue distribution with localization in the sinusoidal membrane of hepatocytes, and in the apical membrane of enterocytes ABCG2 is assumed to function as an important mechanism facilitating hepatobiliary excretion and limiting oral bioavailability, respectively. Indeed functional assessment performing mouse studies with genetic deletion or chemical inhibition of the transporter, or performing pharmacogenetic studies in humans support this assumption. Furthermore the efflux function of ABCG2 has been linked to sanctuary blood tissue barriers as described for placenta and the central nervous system. However, in lactating mammary glands ABCG2 increases the transfer of substrates into milk thereby increasing the exposure to potential noxes of a breastfed newborn. With regard to its broad substrate spectrum including various anticancer drugs and environmental carcinogens the function of ABCG2 has been associated with multidrug resistance and tumor development/progression. In terms of cancer biology current research is focusing on the expression and function of ABCG2 in immature stem cells. Recent findings support the notion that the physiological function of ABCG2 is involved in the elimination of uric acid resulting in higher risk for developing gout in male patients harboring genetic variants. Taken together ABCG2 is implicated in various pathophysiological and pharmacological processes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
257 No effect on the in vitro transport activity was seen for the missense mutations c.445G>C (p.A149P; AF 0.01), c.458C>T (p.T153M; AF 0.033) c.496C>G (p.Q166E, AF not determined) c.616A>C (I206L AF not determined), c.488G>A (p.R163K AF 0.006), c.805C>T (p.P269S AF 0.006), and c.1711T>A (p.F571L, AF 0.005) (Kondo et al. 2004; Tamura et al. 2006). Login to comment

[hide] Key Role of Human ABC Transporter ABCG2 in Photody... Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8. Ishikawa T, Nakagawa H, Hagiya Y, Nonoguchi N, Miyatake S, Kuroiwa T
Key Role of Human ABC Transporter ABCG2 in Photodynamic Therapy and Photodynamic Diagnosis.
Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8., [PMID:21188243]

Abstract [show]
Accumulating evidence indicates that ATP-binding cassette (ABC) transporter ABCG2 plays a key role in regulating the cellular accumulation of porphyrin derivatives in cancer cells and thereby affects the efficacy of photodynamic therapy and photodynamic diagnosis. The activity of porphyrin efflux can be affected by genetic polymorphisms in the ABCG2 gene. On the other hand, Nrf2, an NF-E2-related transcription factor, has been shown to be involved in oxidative stress-mediated induction of the ABCG2 gene. Since patients have demonstrated individual differences in their response to photodynamic therapy, transcriptional activation and/or genetic polymorphisms of the ABCG2 gene in cancer cells may affect patients' responses to photodynamic therapy. Protein kinase inhibitors, including imatinib mesylate and gefitinib, are suggested to potentially enhance the efficacy of photodynamic therapy by blocking ABCG2-mediated porphyrin efflux from cancer cells. This review article provides an overview on the role of human ABC transporter ABCG2 in photodynamic therapy and photodynamic diagnosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
177 Gefitinib and imatinib are new anticancer drugs Outside Plasma membrane Inside H2N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S ATP-binding cassette (a) 0 0.1 0.3 0.4 0.2 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrin transport(nmol/min/mgprotein) (b) Figure 4: (a) Schematic illustration of human ABCG2 and its nonsynonymous polymorphisms. Login to comment

[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]

Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6589 Absent C421A Q141K 2 Normal/reduced G445C A149P ↔ Normal G448A R163K ↔ Normal C496G Q166E ↔ Normal/reduced A616C I206L 2↔ Normal T623C F208S N.D. Reduced T742C S248P N.D. Normal C805T P269S 2↔ Normal T1291C F431L 2 Normal/reduced G1322A S441N 2 Reduced T1465C F489L 2↔ Normal/reduced A1768T N590Y 2↔ Increased G1858A D620N 2↔ Normal 2, reduced function; ↔, no change in function; N.D. not determined. Login to comment

[hide] Apical/basolateral surface expression of drug tran... Pharm Res. 2005 Oct;22(10):1559-77. Epub 2005 Sep 22. Ito K, Suzuki H, Horie T, Sugiyama Y
Apical/basolateral surface expression of drug transporters and its role in vectorial drug transport.
Pharm Res. 2005 Oct;22(10):1559-77. Epub 2005 Sep 22., [PMID:16180115]

Abstract [show]
It is well known that transporter proteins play a key role in governing drug absorption, distribution, and elimination in the body, and, accordingly, they are now considered as causes of drug-drug interactions and interindividual differences in pharmacokinetic profiles. Polarized tissues directly involved in drug disposition (intestine, kidney, and liver) and restricted distribution to naive sanctuaries (blood-tissue barriers) asymmetrically express a variety of drug transporters on the apical and basolateral sides, resulting in vectorial drug transport. For example, the organic anion transporting polypeptide (OATP) family on the sinusoidal (basolateral) membrane and multidrug resistance-associated protein 2 (MRP2/ABCC2) on the apical bile canalicular membrane of hepatocytes take up and excrete organic anionic compounds from blood to bile. Such vectorial transcellular transport is fundamentally attributable to the asymmetrical distribution of transporter molecules in polarized cells. Besides the apical/basolateral sorting direction, distribution of the transporter protein between the membrane surface (active site) and the intracellular fraction (inactive site) is of practical importance for the quantitative evaluation of drug transport processes. The most characterized drug transporter associated with this issue is MRP2 on the hepatocyte canalicular (apical) membrane, and it is linked to a genetic disease. Dubin-Johnson syndrome is sometimes caused by impaired canalicular surface expression of MRP2 by a single amino acid substitution. Moreover, single nucleotide polymorphisms in OATP-C/SLC21A6 (SLCO1B1) also affect membrane surface expression, and actually lead to the altered pharmacokinetic profile of pravastatin in healthy subjects. In this review article, the asymmetrical transporter distribution and altered surface expression in polarized tissues are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
212 Kondo et al. (119) also examined the cellular localization of a total of seven SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N) in LLC-PK1. Login to comment

[hide] Functional hot spots in human ATP-binding cassette... Protein Sci. 2010 Nov;19(11):2110-21. Kelly L, Fukushima H, Karchin R, Gow JM, Chinn LW, Pieper U, Segal MR, Kroetz DL, Sali A
Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains.
Protein Sci. 2010 Nov;19(11):2110-21., [PMID:20799350]

Abstract [show]
The human ATP-binding cassette (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP binding and hydrolysis to the transport of diverse substrates across cellular membranes. Defects in 18 transporters have been implicated in human disease. In hundreds of cases, disease phenotypes and defects in function can be traced to nonsynonymous single nucleotide polymorphisms (nsSNPs). The functional impact of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine experimental mutational studies with sequence and structural analysis to describe the impact of nsSNPs in human ABC transporters. First, the disease associations of 39 nsSNPs in 10 transporters were rationalized by identifying two conserved loops and a small alpha-helical region that may be involved in interdomain communication necessary for transport of substrates. Second, an approach to discriminate between disease-associated and neutral nsSNPs was developed and tailored to this superfamily. Finally, the functional impact of 40 unannotated nsSNPs in seven ABC transporters identified in 247 ethnically diverse individuals studied by the Pharmacogenetics of Membrane Transporters consortium was predicted. Three predictions were experimentally tested using human embryonic kidney epithelial (HEK) 293 cells stably transfected with the reference multidrug resistance transporter 4 and its variants to examine functional differences in transport of the antiviral drug, tenofovir. The experimental results confirmed two predictions. Our analysis provides a structural and evolutionary framework for rationalizing and predicting the functional effects of nsSNPs in this clinically important membrane transporter superfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 Predictions of the Functional Effects of 40 nsSNPs in ABC Transporters Comon name HUGO name Mutation NBD Prediction BSEP ABCB11 E592Q NBD1 Neutral BSEP ABCB11 N591S NBD1 Neutral BSEP ABCB11 Q558H NBD1 Neutral BSEP ABCB11 V444A NBD1 Neutral BSEP ABCB11 E1186K NBD2 Disease MDR1 ABCB1 P1051A NBD2 Neutral MDR1 ABCB1 S1141T NBD2 Neutral MDR1 ABCB1 T1256K NBD2 Disease MDR1 ABCB1 V1251I NBD2 Neutral MDR1 ABCB1 W1108R NBD2 Disease MRP2 ABCC2 I670T NBD1 Disease MRP2 ABCC2 L849R NBD1 Disease MRP2 ABCC2 C1515Y NBD2 Disease MRP3 ABCC3 D770N NBD1 Neutral MRP3 ABCC3 K718M NBD1 Neutral MRP3 ABCC3 T809M NBD1 Disease MRP3 ABCC3 V765L NBD1 Disease MRP3 ABCC3 Q1365R NBD2 Disease MRP3 ABCC3 R1297H NBD2 Disease MRP3 ABCC3 R1348C NBD2 Disease MRP3 ABCC3 R1381S NBD2 Disease MRP4 ABCC4 G487E NBD1 Disease MRP4 ABCC4 K498E NBD1 Neutral MRP4 ABCC4 R1220Q NBD2 Neutral MRP4 ABCC4 T1142M NBD2 Neutral MRP4 ABCC4 V1071I NBD2 Neutral MRP6 ABCC6 I1330L NBD1 Neutral MRP6 ABCC6 I742V NBD1 Neutral MRP6 ABCC6 P664S NBD1 Neutral MRP6 ABCC6 R724K NBD1 Neutral MRP6 ABCC6 R769K NBD1 Neutral MRP6 ABCC6 A1291T NBD2 Neutral MRP6 ABCC6 E1369K NBD2 Neutral MRP6 ABCC6 G1327E NBD2 Disease MRP6 ABCC6 L1416R NBD2 Disease MRP6 ABCC6 R1268Q NBD2 Disease MRP6 ABCC6 R1461H NBD2 Disease MXR ABCG2 I206L NBD1 Neutral MXR ABCG2 P269S NBD1 Disease MXR ABCG2 Q141K NBD1 Neutral nsSNPs. Login to comment

[hide] Deletion of abcg2 has differential effects on excr... J Pharmacol Exp Ther. 2012 Nov;343(2):316-24. doi: 10.1124/jpet.112.197046. Epub 2012 Aug 6. Huang L, Be X, Tchaparian EH, Colletti AE, Roberts J, Langley M, Ling Y, Wong BK, Jin L
Deletion of abcg2 has differential effects on excretion and pharmacokinetics of probe substrates in rats.
J Pharmacol Exp Ther. 2012 Nov;343(2):316-24. doi: 10.1124/jpet.112.197046. Epub 2012 Aug 6., [PMID:22869929]

Abstract [show]
This study was designed to characterize breast cancer resistance protein (Bcrp) knockout Abcg2(-/-) rats and assess the effect of ATP-binding cassette subfamily G member 2 (Abcg2) deletion on the excretion and pharmacokinetic properties of probe substrates. Deletion of the target gene in the Abcg2(-/-) rats was confirmed, whereas gene expression was unaffected for most of the other transporters and metabolizing enzymes. Biliary excretion of nitrofurantoin, sulfasalazine, and compound A [2-(5-methoxy-2-((2-methyl-1,3-benzothiazol-6-yl)amino)-4-pyridinyl)-1,5,6,7-tetr ahydro-4H-pyrrolo[3,2-c]pyridin-4-one] accounted for 1.5, 48, and 48% of the dose in the Abcg2(+/+) rats, respectively, whereas it was decreased by 70 to 90% in the Abcg2(-/-) rats. Urinary excretion of nitrofurantoin, a significant elimination pathway, was unaffected in the Abcg2(-/-) rats, whereas renal clearance of sulfasalazine, a minor elimination pathway, was reduced by >90%. Urinary excretion of compound A was minimal. Systemic clearance in the Abcg2(-/-) rats decreased 22, 43 (p < 0.05), and 57%, respectively, for nitrofurantoin, sulfasalazine, and compound A administered at 1 mg/kg and 27% for compound A administered at 5 mg/kg. Oral absorption of nitrofurantoin, a compound with high aqueous solubility and good permeability, was not limited by Bcrp. In contrast, the absence of Bcrp led to a 33- and 11-fold increase in oral exposure of sulfasalazine and compound A, respectively. These data show that Bcrp plays a crucial role in biliary excretion of these probe substrates and has differential effects on systemic clearance and oral absorption in rats depending on clearance mechanisms and compound properties. The Abcg2(-/-) rat is a useful model for understanding the role of Bcrp in elimination and oral absorption.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
24 Several additional SNPs, including V12M, Q126Stop, and P269S, affect expression or activities of the transporter, which may also have clinical implications (Kondo et al., 2004; Mizuarai et al., 2004; Tamura et al., 2006; Lee et al., 2007). Login to comment

[hide] Structure, function, expression, genomic organizat... Int J Toxicol. 2006 Jul-Aug;25(4):231-59. Choudhuri S, Klaassen CD
Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters.
Int J Toxicol. 2006 Jul-Aug;25(4):231-59., [PMID:16815813]

Abstract [show]
The ATP-binding cassette (ABC) transporters constitute a large family of membrane proteins, which transport a variety of compounds through the membrane against a concentration gradient at the cost of ATP hydrolysis. Substrates of the ABC transporters include lipids, bile acids, xenobiotics, and peptides for antigen presentation. As they transport exogenous and endogenous compounds, they reduce the body load of potentially harmful substances. One by-product of such protective function is that they also eliminate various useful drugs from the body, causing drug resistance. This review is a brief summary of the structure, function, and expression of the important drug resistance-conferring members belonging to three subfamilies of the human ABC family; these are ABCB1 (MDR1/P-glycoprotein of subfamily ABCB), subfamily ABCC (MRPs), and ABCG2 (BCRP of subfamily ABCG), which are expressed in various organs. In the text, the transporter symbol that carries the subfamily name (such as ABCB1, ABCC1, etc.) is used interchangeably with the corresponding original names, such as MDR1P-glycoprotein, MRP1, etc., respectively. Both nomenclatures are maintained in the text because both are still used in the transporter literature. This helps readers relate various names that they encounter in the literature. It now appears that P-glycoprotein, MRP1, MRP2, and BCRP can explain the phenomenon of multidrug resistance in all cell lines analyzed thus far. Also discussed are the gene structure, regulation of expression, and various polymorphisms in these genes. Because genetic polymorphism is thought to underlie interindividual differences, including their response to drugs and other xenobiotics, the importance of polymorphism in these genes is also discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
573 Recently, Kondo et al. (2004) reported the effect of single nucleotide polymorphisms (SNPs) in ABCG2 gene on its localization, expression level, and transport activity of the BCRP protein. The cellular localization was identified using the wild-type and seven different SNP variants of BCRP protein (Val12Met, Gln141Lys, Ala149Pro, Arg163Lys, Gln166Glu, Pro269Ser, and Ser441Asn), following their expression in LLC-PK1 cells. Login to comment

[hide] Computational analysis and predictive modeling of ... Chem Cent J. 2013 Feb 4;7(1):23. doi: 10.1186/1752-153X-7-23. Lee Y, Jana S, Acharya G, Lee CH
Computational analysis and predictive modeling of polymorph descriptors.
Chem Cent J. 2013 Feb 4;7(1):23. doi: 10.1186/1752-153X-7-23., [PMID:23379683]

Abstract [show]
BACKGROUND: A computation approach based on integrating high throughput binding affinity comparison and binding descriptor classifications was utilized to establish the correlation among substrate properties and their affinity to Breast Cancer Resistant Protein (BCRP). The uptake rates of Mitoxantrone in the presence of various substrates were evaluated as an in vitro screening index for comparison of their binding affinity to BCRP.The effects of chemical properties of various chemotherapeutics, such as antiviral, antibiotic, calcium channel blockers, anticancer and antifungal agents, on their affinity to BCRP, were evaluated using HEK (human embryonic kidney) cells in which 3 polymorphs, namely 482R (wild type) and two mutants (482G and 482T) of BCRP, have been identified. The quantitative structure activity relationship (QSAR) model was developed using the sequential approaches of Austin Model 1 (AM1), CODESSA program, heuristic method (HM) and multiple linear regression (MLR) to establish the relationship between structural specificity of BCRP substrates and their uptake rates by BCRP polymorphs. RESULTS: The BCRP mutations may induce conformational changes as manifested by the altered uptake rates of Mitoxantrone by BCRP in the presence of other competitive binding substrates that have a varying degree of affinities toward BCRP efflux. This study also revealed that the binding affinity of test substrates to each polymorph was affected by varying descriptors, such as constitutional, topological, geometrical, electrostatic, thermodynamic, and quantum chemical descriptors. CONCLUSION: Descriptors involved with the net surface charge and energy level of substrates seem to be the common integral factors for defining binding specificity of selected substrates to BCRP polymorph. The reproducible outcomes and validation process further supported the accuracy of the computational model in assessing the correlation among descriptors involved with substrate affinity to BCRP polymorph. A quantitative computation approach will provide important structural insight into optimal designing of new chemotherapeutic agents with improved pharmacological efficacies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
126 It has distinctive features including racial differences; for instance, BCRP V12M, Q141K, P269S and Q126Stop were detected in Korean at frequencies of 23, 28, 0.2 and 1.9%, respectively [49]. Login to comment