ABCMdb

ABCG2 p.Gln166Glu

Predicted by SNAP2:	A: D (59%), C: D (80%), D: D (75%), E: N (53%), F: D (91%), G: D (80%), H: D (80%), I: D (75%), K: D (53%), L: D (75%), M: D (80%), N: D (63%), P: D (85%), R: D (66%), S: D (63%), T: D (63%), V: D (71%), W: D (91%), Y: D (71%),
Predicted by PROVEAN:	A: N, C: D, D: N, E: N, F: D, G: D, H: N, I: D, K: N, L: D, M: D, N: N, P: D, R: N, S: N, T: N, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Natural allelic variants of breast cancer resistan... Pharmacogenetics. 2003 Jan;13(1):19-28. Zamber CP, Lamba JK, Yasuda K, Farnum J, Thummel K, Schuetz JD, Schuetz EG
Natural allelic variants of breast cancer resistance protein (BCRP) and their relationship to BCRP expression in human intestine.
Pharmacogenetics. 2003 Jan;13(1):19-28., [PMID:12544509]

Abstract [show]
The aim of this study was to identify the extent of genetic variability in breast cancer resistance protein (BCRP) in humans. We first analysed the sequence of BCRP cDNA from human livers and from human intestines phenotyped for expression of intestinal BCRP. We then determined the frequency of all known coding single nucleotide polymorphisms (cSNPs) using DNA from individuals representing 11 different ethnic populations. Nine SNPs including four non-synonymous and three synonymous cSNPs and two intronic SNPs were identified. Of the missense mutations, exon 2 SNP (G34A) resulted in a V12M change; exon 5 SNP (C421A) resulted in a Q141K substitution; exon 6 SNP (A616C) resulted in an I206L amino acid substitution; and exon 15 SNP (A1768T) resulted in a N590Y change in the BCRP protein. The two most frequent polymorphisms identified in the human population studied were the G34A and C421A transitions. There was marked variation in BCRP genotypes and allele frequencies in the different populations. BCRP mRNA was phenotyped in human small bowel intestinal samples by real-time polymerase chain reaction and BCRP protein was analysed on immunoblots of tissue from the same individuals. There was a 78-fold variation in expression of BCRP mRNA and significant variation in BCRP protein expression in human intestine. Expression of intestinal BCRP mRNA and protein was not different between persons expressing the common Gln141 allele compared to the Lys141 allele. Thus, common natural allelic variants of BCRP have been identified, and did not influence interindividual variation in expression of BCRP mRNA in human intestine, but remain to be tested for their effect on BCRP function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 Unauthorized reproduction of this article is prohibited. G34A V12M Exon 2 C71T1 A24V Exon 2 623C1 F208S Exon 6 A616C I206L Exon 6 C496G1 Q166E Exon 5 C421A Q141K Exon 5 A1444G2 R482G Exon 12 G1445C3 R482T Exon 12 A1768T N590Y Exon 15 Walker A motif: amino acids 80-89 Walker B motif: amino acids 206-210 SNPs found in human samples in this study Reported in ABCP1 Drug selected variants, MXR2 and BCRP3 MXR BCRP Fig. 1 BCRP protein topology and the positions of the identified SNPs resulting in missense mutations. Login to comment

[hide] Functional analysis of SNPs variants of BCRP/ABCG2... Pharm Res. 2004 Oct;21(10):1895-903. Kondo C, Suzuki H, Itoda M, Ozawa S, Sawada J, Kobayashi D, Ieiri I, Mine K, Ohtsubo K, Sugiyama Y
Functional analysis of SNPs variants of BCRP/ABCG2.
Pharm Res. 2004 Oct;21(10):1895-903., [PMID:15553238]

Abstract [show]
PURPOSE: The aim of the current study was to identify the effect of single nucleotide polymorphisms (SNPs) in breast cancer resistance protein (BCRP/ABCG2) on its localization, expression level, and transport activity. METHODS: The cellular localization was identified using the wild type and seven different SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP) after transfection of their cDNAs in plasmid vector to LLC-PK1 cells. Their expression levels and transport activities were determined using the membrane vesicles from HEK293 cells infected with the recombinant adenoviruses containing these kinds of BCRP cDNAs. RESULTS: Wild type and six different SNP variants of BCRP other than S441N BCRP were expressed on the apical membrane, whereas S441N BCRP showed intracellular localization. The expression levels of Q141K and S441N BCRP proteins were significantly lower compared with the wild type and the other five variants. Furthermore, the transport activity of E1S, DHEAS, MTX, and PAH normalized by the expression level of BCRP protein was almost the same for the wild type, V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP. CONCLUSIONS: These results suggest that Q141K SNPs may associate with a lower expression level, and S441N SNPs may affect both the expression level and cellular localization. It is possible that subjects with these polymorphisms may have lower expression level of BCRP protein and, consequently, a reduced ability to export these substrates.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 The cellular localization was identified using the wild type and seven different SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP) after transfection of their cDNAs in plasmid vector to LLC-PK1 cells. Login to comment
8 Furthermore, the transport activity of E1S, DHEAS, MTX, and PAH normalized by the expression level of BCRP protein was almost the same for the wild type, V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP. Login to comment
29 We constructed expression systems for the wild type and SNPs variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, S441N BCRP) and examined whether these SNPs variants of BCRP alter its localization, expression level, and transport activity. Login to comment
42 Using site-directed mutagenesis, SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S and S441N BCRP) were constructed on pcDNA3.1 vector (SNPs type BCRP/pcDNA3.1). Login to comment
47 Q166E BCRP was amplified with 5Ј-GATTAACAGGGTCATT- GAAGAGTTAGGTCT-3Ј and 5Ј-CCAGACCTA- ACTCTTCAATGACCCTGTTAA-3Ј. Login to comment
52 For SNPs type BCRPs, viruses were prepared in the same way, resulting in the production of pAd-SNPs BCRP (pAd-V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP). Login to comment
110 Except for two SNP variants of BCRP (Q141K and S441N BCRP), the ATP-dependent uptakes per mg membrane protein of SNP variants (V12M, A149P, R163K, Q166E, P269S BCRP) were similar to that of the wild-type BCRP (Fig. 3a). Login to comment
114 As shown in Fig. 3b, the transport activity of other SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP) was almost identical to that of the wild-type BCRP. Login to comment
120 Figure 5a shows the ATP-dependent uptake of DHEAS, PAH, and MTX per mg membrane protein for the wild-type and SNPs BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP). Login to comment
162 For these compounds, our results indicated that the transport activity per BCRP molecule for 6 kinds of SNP variants (V12M, A149P, R163K, Q166E, P269S, and also Q141K BCRP) is almost the same as that of the wild type BCRP (Figs. Login to comment

[hide] Functional analysis of the human variants of breas... Drug Metab Dispos. 2005 Jun;33(6):697-705. Epub 2005 Mar 2. Vethanayagam RR, Wang H, Gupta A, Zhang Y, Lewis F, Unadkat JD, Mao Q
Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N.
Drug Metab Dispos. 2005 Jun;33(6):697-705. Epub 2005 Mar 2., [PMID:15743976]

Abstract [show]
Previous studies have shown that the V12M and Q141K variants of breast cancer resistance protein (BCRP) can affect expression and function of the transporter. In this study, the effects of the I206L, N590Y, and D620N variants on protein expression, plasma membrane localization, and transport activity of BCRP were investigated. Wild-type BCRP and the three variants were stably expressed in human embryonic kidney (HEK) cells. Confocal microscopy analysis showed that the three variants were predominantly routed to the plasma membrane of HEK cells. The expression level of I206L in the plasma membrane was approximately 45% of that of wild-type protein, whereas the N590Y and D620N levels were increased approximately 3.6-fold and 2.4-fold, respectively, as determined by immunoblotting. All three variants transported mitoxantrone, pheophorbide a, and BODIPY FL-prazosin. After normalization for differences in BCRP expression, I206L, N590Y, and D620N exhibited approximately 2-fold, 0.3-fold, and 0.5-fold wild-type efflux activities, respectively. The variants also conferred resistance to mitoxantrone and topotecan. Mitoxantrone and topotecan resistance by I206L and N590Y was approximately 2-fold and 0.3-fold of the wild-type BCRP resistance levels, respectively. Although D620N conferred a topotecan resistance similar to that of the wild-type protein, its level of mitoxantrone resistance was decreased by 50%. After normalization to BCRP expression levels, ATPase activities of I206L were not significantly different from those of wild-type protein, whereas N590Y and D620N exhibited approximately 30% and 50% of wild-type ATPase activities, respectively. These results suggest that I206L has the lowest protein expression and the highest activity, whereas N590Y and D620N display higher expression and lower activity, relative to wild-type BCRP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
220 Several other BCRP variants occurring at much lower allele frequencies (0.5-1%) such as A149P, R163K, Q166E, P269S, and S441N have also been characterized (Kondo et al., 2004). Login to comment

[hide] Mechanisms of resistance to anticancer drugs: the ... Pharmacogenomics. 2005 Mar;6(2):115-38. Lepper ER, Nooter K, Verweij J, Acharya MR, Figg WD, Sparreboom A
Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2.
Pharmacogenomics. 2005 Mar;6(2):115-38., [PMID:15882131]

Abstract [show]
ATP-binding cassette (ABC) genes play a role in the resistance of malignant cells to anticancer agents. The ABC gene products, including ABCB1 (P-glycoprotein) and ABCG2 (breast cancer-resistance protein [BCRP], mitoxantrone-resistance protein [MXR], or ABC transporter in placenta [ABCP]), are also known to influence oral absorption and disposition of a wide variety of drugs. As a result, the expression levels of these proteins in humans have important consequences for an individual's susceptibility to certain drug-induced side effects, interactions, and treatment efficacy. Naturally occurring variants in ABC transporter genes have been identified that might affect the function and expression of the protein. This review focuses on recent advances in the pharmacogenetics of the ABC transporters ABCB1 and ABCG2, and discusses potential implications of genetic variants for the chemotherapeutic treatment of cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
157 Position in gene* Nucleotide‡ Region Wild-type allele Variant allele Amino acid Change -19572 to -19569 5`-Flanking region CTCA - CTCA deletion -19202 5` UTR G C -18845 5` UTR T C -18604 5` UTR A - Deletion -18482 -113 Exon 1 C T Non-coding -18398 -29 Exon 1 A G Non-coding 34 34 Exon 2 G A 12 Val to Met 71 71 Exon 2 C T 24 Ala to Val 114 114 Exon 2 T C 38 Synonymous 239 Intron 2 A G 7268 Intron 2 T C 7420 Intron 3 - T Insertion 8007 Intron 3 G A 8184 369 Exon 4 C T 123 Synonymous 8191 376 Exon 4 C T 126 Gln to Term 8825 421 Exon 5 C A 141 Gln to Lys 8862 458 Exon 5 C T 153 Thr to Met 8878 474 Exon 5 C T 158 Synonymous 8900 496 Exon 5 C G 166 Gln to Glu 18186 Intron 5 A G 18286 616 Exon 6 A C 206 Ile to Leu 18293 623 Exon 6 T C 208 Phe to Ser 21530 Intron 6 C T 21718 Intron 6 A G 21903 Intron 7 A G 24618 Intron 7 T A 26297 1098 Exon 9 G A 366 Synonymous 38389 1291 Exon 11 T C 431 Phe to Leu 38485 Intron 11 A G 40111 Intron 11 G A 40303 1425 Exon 12 A G 475 Synonymous 40322 1444 Exon 12 A G 482 Arg to Gly 40323 1445 Exon 12 G C 482 Arg to Thr 40343 1465 Exon 12 T C 489 Phe to Leu 40419 Intron 12 G T 42314 Intron 13 T G 44997 Intron 14 A G 45022 Intron 14 C T 45073 1768 Exon 15 A T 590 Asn to Tyr 47355 1858 Exon 16 G A 620 Asp to Asn 47734 2237 Exon 16 G T Non-coding 47890 2393 Exon 16 G T Non-coding 47891 2394 Exon 16 C A Non-coding ABC: ATP-binding cassette; UTR: Untranslated region. Login to comment

[hide] Pharmacogenomics of the human ABC transporter ABCG... Naturwissenschaften. 2005 Oct;92(10):451-63. Ishikawa T, Tamura A, Saito H, Wakabayashi K, Nakagawa H
Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design.
Naturwissenschaften. 2005 Oct;92(10):451-63., [PMID:16160819]

Abstract [show]
In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 For this purpose, we have created variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) by site-directed mutagenesis. Login to comment

[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins. Login to comment
255 For this purpose, variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G and R482T) were created by site-directed mutagenesis (Figure 3). Login to comment

[hide] Functional SNPs of the breast cancer resistance pr... Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21. Yanase K, Tsukahara S, Mitsuhashi J, Sugimoto Y
Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development.
Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21., 2006-03-08 [PMID:16303243]

Abstract [show]
Breast cancer resistance protein (BCRP) is a half-molecule ATP-binding cassette transporter that pumps out various anticancer agents such as 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. We have previously identified three polymorphisms within the BCRP gene, G34A (substituting Met for Val-12), C376T (substituting a stop codon for Gln-126) and C421A (substituting Lys for Gln-141). C421A BCRP-transfected murine fibroblast PA317 cells showed markedly decreased protein expression and low-level drug resistance when compared with wild-type BCRP-transfected cells. In contrast, G34A BCRP-transfected PA317 cells showed a similar protein expression and drug resistance profile to wild-type. The C376T polymorphism would be expected to have a considerable impact as active BCRP protein will not be expressed from a T376 allele. Hence, people with C376T and/or C421A polymorphisms may express low levels of BCRP, resulting in hypersensitivity of normal cells to BCRP-substrate anticancer agents. Estrogens, estrone and 17beta-estradiol, were previously found to restore drug sensitivity levels in BCRP-transduced cells by increasing the cellular accumulation of anticancer agents. BCRP transports sulfated estrogens but not free estrogens and in a series of screening experiments for synthesized and natural estrogenic compounds, several tamoxifen derivatives and phytoestrogens/flavonoids were identified that effectively circumvent BCRP-mediated drug resistance. The kinase inhibitors gefitinib and imatinib mesylate also interact with BCRP. Gefitinib, an inhibitor of epidermal growth factor receptor-tyrosine kinase, inhibits its transporter function and reverses BCRP-mediated drug resistance both in vitro and in vivo. BCRP-transfected human epidermoid carcinoma A431 cells and BCRP-transfected human non-small cell lung cancer PC-9 cells show gefitinib resistance. Imatinib, an inhibitor of BCR-ABL tyrosine kinase, also inhibits BCRP-mediated drug transport. Hence, both functional SNPs and inhibitors of BCRP reduce its transporter function and thus modulate substrate pharmacokinetics and pharmacodynamics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

[hide] The role of the human ABCG2 multidrug transporter ... Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7. Cervenak J, Andrikovics H, Ozvegy-Laczka C, Tordai A, Nemet K, Varadi A, Sarkadi B
The role of the human ABCG2 multidrug transporter and its variants in cancer therapy and toxicology.
Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7., 2006-03-08 [PMID:16337740]

Abstract [show]
The human multidrug resistance ABC transporters provide a protective function in our body against a large number of toxic compounds. These proteins, residing in the plasma membrane, perform an active, ATP-dependent extrusion of such xenobiotics. However, the same proteins are also used by the tumor cells to fight various anticancer agents. ABCG2 is an important member of the multidrug resistance proteins, an 'ABC half transporter', which functions as a homodimer in the cell membrane. In this review, we provide a basic overview of ABCG2 function in physiology and drug metabolism, but concentrate on the discussion of mutations and polymorphisms discovered in this protein. Interestingly, a single nucleotide mutation, changing amino acid 482 from arginine to threonine or glycine in ABCG2, results in a major increase in the catalytic activity and a wider drug recognition by this protein. Still, this mutation proved to be an in vitro artifact, produced only in heavily drug-selected cell lines. In contrast, at least two, but possibly more polymorphic variants of ABCG2 were found to be present in large human populations with different ethnic background. However, currently available experimental data regarding the cellular expression, localization and function of these ABCG2 variants are strongly contradictory. Since, the proteins produced by these variant alleles may differently modulate cancer treatment, general drug absorption and toxicity, may represent risk factors in fetal toxicity, or alter the differentiation of stem cells, their exact characterization is a major challenge in this field.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 According to the first cloning studies, the ABCG2 cDNA obtained from normal human placenta [8] showed the following sequence alterations, as compared to the database reference sequence: c.71COT (A24V), c.496COG (Q166E) and c.623TOC (F208S). Login to comment
147 In a recent study, similarly LLC-PKI cells where used to express the V12M and Q141K variants and additionally five other polymorphisms (A149P, R163K, Q166E, P269S and S441N [55]). Login to comment

[hide] High-speed screening of human ATP-binding cassette... Methods Enzymol. 2005;400:485-510. Ishikawa T, Sakurai A, Kanamori Y, Nagakura M, Hirano H, Takarada Y, Yamada K, Fukushima K, Kitajima M
High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics.
Methods Enzymol. 2005;400:485-510., [PMID:16399366]

Abstract [show]
Drug transporters represent an important mechanism in cellular uptake and efflux of drugs and their metabolites. Hitherto a variety of drug transporter genes have been cloned and classified into either solute carriers or ATP-binding cassette (ABC) transporters. Such drug transporters are expressed in various tissues such as the intestine, brain, liver, kidney, and, importantly, cancer cells, where they play critical roles in the absorption, distribution, and excretion of drugs. We developed high-speed functional screening and quantitative structure-activity relationship analysis methods to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. Furthermore, we demonstrate a new "SNP array" method to detect genetic polymorphisms of ABC transporters in human samples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
115 For this purpose, variant forms (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) have been created by site‐ directed mutagenesis with the QuikChange site‐directed mutagensis kit (Stratagene, La Jolla, CA). Login to comment

[hide] Functional validation of the genetic polymorphisms... Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11. Tamura A, Watanabe M, Saito H, Nakagawa H, Kamachi T, Okura I, Ishikawa T
Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport.
Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11., [PMID:16608919]

Abstract [show]
The ATP-binding cassette (ABC) transporter ABCG2 has been implicated to play a significant role in the response of patients to medication and/or the risk of diseases. To clarify the possible physiological or pathological relevance of ABCG2 polymorphisms, we have functionally validated single nucleotide polymorphisms (SNP) of ABCG2. In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Because porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the porphyrin transport activity of those variant forms in vitro. We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Furthermore, Flp-In-293 cells expressing those variants were photosensitive. Thus, among those genetic polymorphisms of ABCG2, at least the hitherto validated alleles of Q126stop, S441N, and F489L are suggested to be of clinical importance related to the potential risk of porphyria.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan). Login to comment
144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis. Login to comment
214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein. Login to comment
236 The most recent version of National Center for Biotechnology Information dbSNP does not seem to have validation for Q166E, F208S, S248P, and E334stop (Table 2) as bona fide SNPs. Login to comment

[hide] Human ABC transporter ABCG2 in xenobiotic protecti... Drug Metab Rev. 2006;38(3):371-91. Wakabayashi K, Tamura A, Saito H, Onishi Y, Ishikawa T
Human ABC transporter ABCG2 in xenobiotic protection and redox biology.
Drug Metab Rev. 2006;38(3):371-91., [PMID:16877258]

Abstract [show]
Human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR/ABCP) is regarded as a member of the phase III system of xenobiotic metabolism. This efflux pump is suggested to be responsible for protecting the body from toxic xenobiotics and for removing toxic metabolites. The aim of this review article is to address new aspects of ABCG2 related to redox biology, namely the posttranslational modification (intra- and intermolecular disulfide bond formation) of ABCG2 protein and the transport of porphyrin and chlorophyll metabolites, as well as the high-speed screening and QSAR analysis method to evaluate ABCG2-drug interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells. Login to comment

[hide] Human multidrug resistance ABCB and ABCG transport... Physiol Rev. 2006 Oct;86(4):1179-236. Sarkadi B, Homolya L, Szakacs G, Varadi A
Human multidrug resistance ABCB and ABCG transporters: participation in a chemoimmunity defense system.
Physiol Rev. 2006 Oct;86(4):1179-236., [PMID:17015488]

Abstract [show]
In this review we give an overview of the physiological functions of a group of ATP binding cassette (ABC) transporter proteins, which were discovered, and still referred to, as multidrug resistance (MDR) transporters. Although they indeed play an important role in cancer drug resistance, their major physiological function is to provide general protection against hydrophobic xenobiotics. With a highly conserved structure, membrane topology, and mechanism of action, these essential transporters are preserved throughout all living systems, from bacteria to human. We describe the general structural and mechanistic features of the human MDR-ABC transporters and introduce some of the basic methods that can be applied for the analysis of their expression, function, regulation, and modulation. We treat in detail the biochemistry, cell biology, and physiology of the ABCB1 (MDR1/P-glycoprotein) and the ABCG2 (MXR/BCRP) proteins and describe emerging information related to additional ABCB- and ABCG-type transporters with a potential role in drug and xenobiotic resistance. Throughout this review we demonstrate and emphasize the general network characteristics of the MDR-ABC transporters, functioning at the cellular and physiological tissue barriers. In addition, we suggest that multidrug transporters are essential parts of an innate defense system, the "chemoimmunity" network, which has a number of features reminiscent of classical immunology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
827 In the first cloning of the ABCG2 cDNA from human placenta (8), several sequence alterations causing amino acid changes, including A24V, Q166E, and F208S, were recorded, compared with the database reference sequence. Login to comment

[hide] Genetic polymorphisms of human ABC transporter ABC... J Exp Ther Oncol. 2006;6(1):1-11. Tamura A, Wakabayashi K, Onishi Y, Nakagawa H, Tsuji M, Matsuda Y, Ishikawa T
Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system.
J Exp Ther Oncol. 2006;6(1):1-11., [PMID:17228519]

Abstract [show]
The vector-mediated introduction of cDNA into mammalian cells by calcium phosphate co-precipitation or permeation with lipofectamine is widely used for the integration of cDNA into genomic DNA. However, integration of cDNA into the host's chromosomal DNA occurs randomly at unpredictable sites, and the number of integrated recombinant DNAs is not controllable. To investigate the effect of genetic polymorphisms of ABCG2 on the protein expression and the drug resistance profile, we developed the Flp-In method to integrate one single copy of ABCG2 variant-cDNA into FRT-tagged genomic DNA. More than 20 metaphase spreads were examined for both fluorescence in situ hybridization (FISH) mapping and multicolor-FISH analysis, and it has been revealed that ABCG2 cDNA was incorporated into the telomeric region of the short arm on one of chromosomes 12 in Flp-In-293 cells. Based on the currently available SNP data for human ABCG2, we have created a total of seven variants by site-directed mutagenesis and stably expressed them in Flp-In-293 cells. While mRNAs of those integrated ABCG2 variants and wild type were evenly expressed in Flp-In-293 cells, the protein expression levels of F208S and S441N variants were found to be markedly low. It is suggested that the protein instability due to enhanced degradation resulted in the low levels of their protein expression. Thus, the Flp recombinase system would provide a useful tool to validate the effect of nonsynonymous SNPs on the protein stability and post-translational modification of ABCG2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
142 Finally, the acquired mutants R482G and R482T form another group, which is characteristic Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 9 Table 3 Remarks mRNA Protein Author Ref Host cell Vector Expression SNP expression expression Imai et al. (15) PA317 pHaL-IRES-DHFR bicistronic Stable V12M Similar to WT Similar to WT - - retrovirus vector plasmid - Q141K Similar to WT Lower than WT Mizuarai et al. (18) LLC-PK1 pcDNA3.1(+) Stable V12M Similar to WT N.D. - - - - Q141K Similar to WT N.D. Morisaki et al. (25) HEK293 pcDNA3.1 Stable V12M Vary among clones Vary among clones - - - - Q141K Vary among clones Vary among clones - - - - D620N Vary among clones Vary among clones Kondo et al. (26) LLC-PK1/ pcDNA3.1/ Stable/ V12M N.D. Similar to WT - HEK293 Adenovirus Transient Q141K N.D. 30 - 40% of WT - - - - A149P N.D. Similar to WT - - - - R163K N.D. Similar to WT - - - - Q166E N.D. Similar to WT - - - - P269S N.D. Similar to WT - - - - S441N N.D. Lower than WT Vethanayagam (27) HEK293 pcDNA3.1/myc-His(-) Stable I206L N.D. Vary among clones et al. - - - - N590Y N.D. Vary among clones - - - - D620N N.D. Vary among clones N.D.: No data Table 2. Login to comment

[hide] Identification and functional assessment of BCRP p... Drug Metab Dispos. 2007 Apr;35(4):623-32. Epub 2007 Jan 19. Lee SS, Jeong HE, Yi JM, Jung HJ, Jang JE, Kim EY, Lee SJ, Shin JG
Identification and functional assessment of BCRP polymorphisms in a Korean population.
Drug Metab Dispos. 2007 Apr;35(4):623-32. Epub 2007 Jan 19., [PMID:17237154]

Abstract [show]
The breast cancer resistance protein (BCRP) is a member of the ATP-binding cassette transporters. The aim of the present study was to identify genetic variants of BCRP in Koreans and to assess the functional consequences of BCRP polymorphisms. Twenty single nucleotide polymorphisms (SNP), including four nonsynonymous SNP, were identified by DNA sequencing of the BCRP gene in 92 Korean subjects. BCRP V12M, Q141K, P269S, and Q126Stop were detected at frequencies of 23, 28, 0.2, and 1.9%, respectively. These four coding variants were also screened in Chinese and Vietnamese subjects; the allelic frequencies among the three populations were compared; and predictions were made as to the potential frequency of each variant. In vitro functional analyses of the P269S protein and the promoter SNP -19031C>T (mutated in the hypoxia-inducible factor-1alpha binding site) were performed and compared with those of the wild type. P269S exhibited a 35 to 40% decrease in vesicular uptake of [(3)H]estrone-3-sulfate and [(3)H]methotrexate compared with the wild type. The promoter SNP -19031C>T did not affect BCRP promoter activity in either the presence or absence of chemical-induced hypoxic stress. Our results suggest that the P269S variant could be a functionally altered variant. Genotyping of this variant in clinical studies is needed to address its phenotypic role. Genetic polymorphisms of BCRP were found to be very common in Koreans, as well as in other ethnic groups. Comparative analyses among three Asian populations revealed different frequencies for the four functional BCRP variants.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
155 Recently, Kondo et al. (2004) reported the identification of several BCRP variants, which include A149P, R163K, Q166E, P269S, and S441N, in human cell lines. Login to comment

[hide] The identification of two germ-line mutations in t... Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21. Yoshioka S, Katayama K, Okawa C, Takahashi S, Tsukahara S, Mitsuhashi J, Sugimoto Y
The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein.
Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21., [PMID:17373578]

Abstract [show]
PURPOSE: We examined the effects of the nine nonsynonymous germ-line mutations/SNPs in the breast cancer resistance protein (BCRP/ABCG2) gene on the expression and function of the protein. MATERIALS AND METHODS: We generated cDNAs for each of these mutants (G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP) and compared the effects of their exogenous expression in PA317 cells with a wild-type control. RESULTS: PA/F208S cells (T623C BCRP-transfectants) expressed marginal levels of a BCRP protein species (65kDa), which is slightly smaller than wild-type (70kDa), but this mutant did not appear on the cell surface or confer drug resistance. PA/F431L cells (T1291C BCRP-transfectants) were found to express both 70 kDa and 65 kDa BCRP protein products. In addition, although PA/F431L cells expressed 70 kDa BCRP at comparable levels to PA/WT cells, they showed only marginal resistance to SN-38. PA/T153M cells (C458T BCRP-transfectants) and PA/D620N cells (G1858A BCRP-transfectants) expressed lower amounts of BCRP and showed lower levels of resistance to SN-38 compared with PA/WT cells. CONCLUSIONS: We have shown that T623C BCRP encodes a non-functional BCRP and that T1291C BCRP encodes a low-functional BCRP. Hence, these mutations may affect the pharmacokinetics of BCRP substrates in patients harboring these alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Cell Growth Inhibition Assay Anticancer agent resistance levels in both the parental PA317 cells and in the various BCRP transfectants were Table I. Frequencies of Germ-line Mutations/SNPs Within The BCRP Gene Variation Frequency (%) Number Population Reference Nucleotide Amino acid G34A V12M 19 29 Japanese 17 G151T G51C 0.1a 350 Japanese C376T Q126Stop 1.2 124 Japanese 17 C421A Q141K 26.6 124 Japanese 17 C458T T153M 3.3 30 Cell line 32 C496G Q166E 0.3a 200 Japanese A616C I206L 20 10 Hispanic 33 T623C F208S 0.3a 200 Japanese T742C S248P 0.5a 200 Japanese T1291C F431L 0.6b 260 Japanese 34 A1768T N590Y 1.1 88 Caucasians 33 G1858A D620N 1.1 90 unknown 35 a Determined in this study. Login to comment
45 V12M Q141K D620N N590Y F431L S248P F208S I206L T153M G51C Q166E OUT MEMBRANE IN Fig. 1. Login to comment
75 SN-38 Resistance Levels of PA317 Transfectantsa Cell type IC50 (nmol/L) Degree of resistance PA317 11 T 0.2 1 PA/WT 550 T 16 50 PA/V12M 490 T 13 45 PA/Q141K 110 T 5.9 10 PA/T153M 260 T 15 24 PA/Q166E 680 T 40 62 PA/F208S 10 T 0.7 1 PA/F431L 34 T 0.9 3 PA/D620N 190 T 5.7 17 a Cells were cultured for 5 days with various concentrations of SN-38. Login to comment
80 RESULTS Expression of BCRP in PA317 Transfectants The germ-line mutations and resulting amino acid substitutions examined in this study were as follows; G151T (G51C), C458T (T153M), C496G (Q166E), A616C (I206L), T623C (F208S), T742C (S248P), T1291C (F431L), A1768T (N590Y) and G1858A (D620N). Login to comment
81 G51C, T153M, Q166E, I206L, F208S and S248P are located in the intracellular domain of the protein (Fig. 1 and Table I). Login to comment
89 PA/Q166E cells expressed higher amounts of BCRP (70-kDa) than PA/WT cells (Fig. 2a). Login to comment
96 The cell surface expression of BCRP in PA/Q166E cells was slightly higher compared with PA/WT cells (Fig. 2d). Login to comment
104 Additional transfectants (PA/G51C, PA/Q166E, PA/I206L, PA/S248P, and PA/N590Y cells) showed no change in their drug resistance profiles to SN-38 compared with PA/WT cells (Table II). Login to comment
128 DISCUSSION In our current study, we have examined the effect of the nine germ-line mutations/SNPs, G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP, resulting in the amino acid changes G51C, T153M, Q166E, I206L, F208S, S248P, F431L, N590Y, D620N, respectively, on BCRP protein expression and function. Login to comment
143 G51C, T153M, Q166E, I206L, F208S, and S248P are located in the intracellular domain, and F431L, N590Y, and D620N reside in the transmembrane domain. Login to comment

[hide] Evaluation of drug-transporter interactions using ... Curr Drug Metab. 2007 May;8(4):341-63. Xia CQ, Milton MN, Gan LS
Evaluation of drug-transporter interactions using in vitro and in vivo models.
Curr Drug Metab. 2007 May;8(4):341-63., [PMID:17504223]

Abstract [show]
Drug transporters, including efflux transporters (the ATP binding cassette (ABC) proteins) and uptake transporters (the solute carrier proteins (SLC)), have an important impact on drug disposition, efficacy, drug-drug interactions and toxicity. Identification of the interactions of chemical scaffolds with transporters at the early stages of drug development can assist in the optimization and selection of new drug candidates. In this review, we discuss current in vitro and in vivo models used to investigate the interactions between drugs and transporters such as P-gp, MRP, BCRP, BSEP, OAT, OATP, OCT, NTCP, PEPT1/2 and NT. In vitro models including cell-based, cell-free, and yeast systems as well as in vivo models such as genetic knockout, gene deficient and chemical knockout animals are discussed and compared. The applications, throughput, advantages and limitations of each model are also addressed in this review.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
119 The function of seven single nucleotide polymorphisms (SNPs) in BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP) was determined using membrane vesicles from HEK293 cells infected with the recombinant adenoviruses containing the corresponding BCRP cDNAs [45]. Login to comment
121 Furthermore, the transport rate of estrone sulfate, dehydroepiandrosterone sulfate (DHEAS), methotrexate, and p-aminohippurate was almost the same for the wild type, V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP variants when it is normalized by the expression levels of BCRP protein. Login to comment

[hide] Homology modeling of breast cancer resistance prot... J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15. Hazai E, Bikadi Z
Homology modeling of breast cancer resistance protein (ABCG2).
J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15., [PMID:18249138]

Abstract [show]
BCRP (also known as ABCG2, MXR, and ABC-P) is a member of the ABC family that transports a wide variety of substrates. BCRP is known to play a key role as a xenobiotic transporter. Since discovering its role in multidrug resistance, considerable efforts have been made in order to gain deeper understanding of BCRP structure and function. The recent study was aimed at predicting BCRP structure by creating a homology model. Based on sequence similarity with known structures of full-length, NB and TM domain of ABC transporters, TM, NB, and linker regions of BCRP were defined. The NB domain of BCRP was modeled using MalK as a template. Based on secondary structure prediction of BCRP and comparison of the transmembrane connecting regions of known structures of ABC transporters, the TM domain arrangement of BCRP was established and was found to resemble to that of the recently published crystal structure of Sav1866. Thus, an initial alignment of TM domain of BCRP was established using Sav1866 as a template. This alignment was subsequently refined using constrains derived from secondary structure and TM predictions and the final model was built. Finally, the complete homodimer ABCG2 model was generated using Sav1866 as template. Furthermore, known ligands of BCRP were docked to our model in order to define possible binding sites. The results of molecular dockings of known BCRP substrates to the BCRP model were in agreement with recently published experimental data indicating multiple binding sites in BCRP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand. Login to comment

[hide] Drug-induced phototoxicity evoked by inhibition of... Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72. Tamura A, An R, Hagiya Y, Hoshijima K, Yoshida T, Mikuriya K, Ishikawa T
Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems.
Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72., [PMID:18363541]

Abstract [show]
BACKGROUND: Photosensitivity depends on both genetic and environmental factors. Pheophorbide a, present in various plant-derived foods and food supplements, can be absorbed by the small intestine. Accumulation of pheophorbide a and porphyrins in the systemic blood circulation can result in phototoxic lesions on light-exposed skin. OBJECTIVE: As the human ATP-binding cassette (ABC) transporter ABCG2 has been suggested to be critically involved in porphyrin-mediated photosensitivity, we aimed to develop in vitro screening systems for drug-induced phototoxicity. CONCLUSION: Functional impairment owing to inhibition of ABCG2 by drugs or its genetic polymorphisms can lead to the disruption of porphyrin homeostasis. This review article provides an overview on drug-induced photosensitivity, as well as our hypothesis on a potential role of ABCG2 in phototoxicity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A. Login to comment
231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids. Login to comment
245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative). Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
250 It should be noted that many xeno- and endobiotic BCRP Figure 5 Predicted membrance topology of BCRP (ABCG2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 5 for allele frequencies and description of funtional consequences. NH2 COOH NBD Val12Met Gly51Cys Gln126* Ala149Pro Gln141Lys Thr153Met Arg160Gln Arg163Lys Gln166Glu Phe506Ser Phe507Leu Val508Leu Met509* Phe489Leu Ser441Asn Phe431Leu Glu334* Ile206Leu Ala315del Thr316del Phe208Ser Asp296His Ser248Pro Pro269Ser Phe571Ile Arg575* Asn590Tyr Asp620Asn in out Membrane BCRP (ABCG2) NBD Val12Met NBDNBD Val12Met substrates are also transported by other efflux transporters, especially P-glycoprotein, thus extrapolating BCRP related in vitro data to the in vivo situation may be difficult. Login to comment

[hide] Human ABC transporters ABCG2 (BCRP) and ABCG4. Xenobiotica. 2008 Jul;38(7-8):863-88. Koshiba S, An R, Saito H, Wakabayashi K, Tamura A, Ishikawa T
Human ABC transporters ABCG2 (BCRP) and ABCG4.
Xenobiotica. 2008 Jul;38(7-8):863-88., [PMID:18668433]

Abstract [show]
1. The human ABC transporter ABCG2 is regarded as a member of the phase III system for xenobiotic metabolism, and it has been suggested that this efflux pump is responsible for protecting the body from toxic xenobiotics and for removing metabolites. 2. This review paper will address the new aspects of ABCG2 in terms of post-translational modifications (i.e., disulfide bond formation, ubiquitination, and endoplasmic reticulum-associated degradation) of ABCG2 protein, high-speed screening, and quantitative structure-activity relationship (QSAR) analysis to evaluate ABCG2-drug interactions, and genetic polymorphisms potentially associated with photosensitivity. 3. In addition, new aspects of human ABCG4 and mouse Abcg4 are presented with respect to their molecular properties and potential physiological roles. Considering a high sequence similarity between ABCG1 and ABCG4, both Abcg4 and ABCG4 may be involved in the transport of cholesterol from neurons and astrocytes. Furthermore, high expression of the mouse Abcg4 protein in the testis implicates its involvement in transport of certain sex hormones.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007). Login to comment

[hide] Pharmacogenetics of intestinal absorption. Curr Drug Deliv. 2008 Jul;5(3):153-69. Nakamura T, Yamamori M, Sakaeda T
Pharmacogenetics of intestinal absorption.
Curr Drug Deliv. 2008 Jul;5(3):153-69., [PMID:18673259]

Abstract [show]
The small intestine is the primary site of absorption for many drugs administered orally and so is the target tissue for pharmacotherapeutic strategies to control the oral absorption of drugs. Drug transporters, including the ATP-binding cassette (ABC) superfamily and the solute carrier (SLC) superfamily, have been considered to play a physiological role in regulating the absorption of xenobiotics, and variations in their expression level and function in the small intestine cause intra- and inter-individual variation in the oral absorption of drugs. Recent advances in molecular biology have suggested that genetic polymorphisms are associated with the expression level and function, and thereby inter-individual variation. In this review, the pharmacogenetics of these transporters is summarized, and their future significance in the clinical setting is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Exon Polymorphism Effect dbSNP Cell Expression Function Reference mRNA ( ) Protein (n.s.) Membrane localization (n.s.) Drug sensitivity (n.s.) Mitoxantrone efflux (n.s.) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity (n.s.) Mizuarai et al. [88] Sf9 Protein ( ) ATPase activity (n.s.) Hoechst 33342 efflux ( ) Morisaki et al. [92] Exon 2 114T>C synonymous rs12721640 Exon 4 369C>T synonymous rs2231139 PA317 mRNA (n.s.) Protein ( ) Drug sensitivity ( ) Intracellular uptake ( ) Imai et al. [85] mRNA (n.s.) Protein (n.s.) Apical localization (n.s.) Drug sensitivity ( ) Indolocarbazole uptake ( ) Indolocarbazole efflux ( ) Mizuarai et al. [88] LLC-PK1 Apical localization (n.s.) Kondo et al. [94] mRNA ( ) Protein (n.s.) Membrane localization (impaired) Drug sensitivity ( ) Mitoxantrone efflux ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein ( ) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity ( ) Mizuarai et al. [88] 421C>A Gln141Lys rs2231142 Sf9 Protein (n.s.) ATPase activity ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] LLC-PK1 Apical localization (n.s.) Exon 5 496C>G Gln166Glu rs1061017 HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 HEK293 Protein ( or n.s.) Membrane localization (n.s.) Efflux activity ( ) Drug sensitivity ( ) ATPase activity (n.s.) Vethanayagam et al. [95] 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334stop rs3201997 Exon 14 2204T>A Phe571Ile rs9282571 SLC15A1 CHO Cephalexin uptake (n.s.)61G>A Val21Ile rs8187818 Cos7 Cephalexin uptake (n.s.) Substrate selectivity (n.s.) CHO Cephalexin uptake ( ) Cos7 Cephalexin uptake ( ) Substrate selectivity (VAC inhibition?) Login to comment
94 Exon Polymorphism Effect dbSNP Subject Expression Function Reference 114T>C synonymous rs12721640 369C>T synonymous rs2231139 421C>A Gln141Lys rs2231142 Patient (Caucasian) 9-nitrocamptotecin PK (CC CA) 9-aminocamptotecin PK [AUC/Dose] (CC<CA) Zamboni et al. [55] Nasopharyngeal cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) Zhou et al. [56] HIV patient (Caucasian) Nelfinavir intracellular AUC (CC CA AA) Colombo et al. [58] Cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) de Jong et al. [90] Patient (Japanese) Placental mRNA (CC CA AA) Placental protein (CC>CA>AA) Kobayashi et al. [91] Cancer patient Diflomotecan PK [AUC, Cmax] (CC<CA), [F] (CC>CA) Sparreboom et al. [96] Healthy (Chinese) Rosuvastatin PK [AUC, Cmax] (CC<CA+AA), [CL/F] (CC>CA+AA), [T1/2, Tmax] (CC CA+AA) Zhang et al. [97] Exon 4 496C>G Gln166Glu rs1061017 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334Stop rs3201997 Exon 14 1711T>A Phe571Ile rs9282571 SLC15A1 61G>A Val21Ile rs8187818Exon 3 83T>A Phe28Tyr rs8187817 258G>A synonymous rs8187823 330C>T synonymous rs8187822 350G>A Ser117Asn rs2297322 351C>A Ser117Arg rs8187821 Exon 5 364G>A Val122Met rs8187820 Exon 7 501C>T synonymous rs3737087 Exon 11 843G>A synonymous r8187812 Exon 15 1147G>A Asp383Asn rs1782674 1179C>T synonymous rs8187836Exon 16 1256G>C Gly419Ara rs4646227 1347T>C synonymous rs1339067 Allelic mRNA imbalance (2030%) Anderle et al. [101] 1348G>A Val450Ile rs2274828 1352C>A Thr451Asn rs8187838 Exon 17 1375C>T Arg459Cys rs2274827 Exon 18 1446A>G synonymous rs8187828 (Table 3) contd…. Login to comment

[hide] Clinical pharmacogenetics and potential applicatio... Curr Drug Metab. 2008 Oct;9(8):738-84. Zhou SF, Di YM, Chan E, Du YM, Chow VD, Xue CC, Lai X, Wang JC, Li CG, Tian M, Duan W
Clinical pharmacogenetics and potential application in personalized medicine.
Curr Drug Metab. 2008 Oct;9(8):738-84., [PMID:18855611]

Abstract [show]
The current 'fixed-dosage strategy' approach to medicine, means there is much inter-individual variation in drug response. Pharmacogenetics is the study of how inter-individual variations in the DNA sequence of specific genes affect drug responses. This article will highlight current pharmacogenetic knowledge on important drug metabolizing enzymes, drug transporters and drug targets to understand interindividual variability in drug clearance and responses in clinical practice and potential use in personalized medicine. Polymorphisms in the cytochrome P450 (CYP) family may have had the most impact on the fate of pharmaceutical drugs. CYP2D6, CYP2C19 and CYP2C9 gene polymorphisms and gene duplications account for the most frequent variations in phase I metabolism of drugs since nearly 80% of drugs in use today are metabolised by these enzymes. Approximately 5% of Europeans and 1% of Asians lack CYP2D6 activity, and these individuals are known as poor metabolizers. CYP2C9 is another clinically significant drug metabolising enzyme that demonstrates genetic variants. Studies into CYP2C9 polymorphism have highlighted the importance of the CYP2C9*2 and CYP2C9*3 alleles. Extensive polymorphism also occurs in a majority of Phase II drug metabolizing enzymes. One of the most important polymorphisms is thiopurine S-methyl transferases (TPMT) that catalyzes the S-methylation of thiopurine drugs. With respect to drug transport polymorphism, the most extensively studied drug transporter is P-glycoprotein (P-gp/MDR1), but the current data on the clinical impact is limited. Polymorphisms in drug transporters may change drug's distribution, excretion and response. Recent advances in molecular research have revealed many of the genes that encode drug targets demonstrate genetic polymorphism. These variations, in many cases, have altered the targets sensitivity to the specific drug molecule and thus have a profound effect on drug efficacy and toxicity. For example, the beta (2)-adrenoreceptor, which is encoded by the ADRB2 gene, illustrates a clinically significant genetic variation in drug targets. The variable number tandem repeat polymorphisms in serotonin transporter (SERT/SLC6A4) gene are associated with response to antidepressants. The distribution of the common variant alleles of genes that encode drug metabolizing enzymes, drug transporters and drug targets has been found to vary among different populations. The promise of pharmacogenetics lies in its potential to identify the right drug at the right dose for the right individual. Drugs with a narrow therapeutic index are thought to benefit more from pharmacogenetic studies. For example, warfarin serves as a good practical example of how pharmacogenetics can be utilized prior to commencement of therapy in order to achieve maximum efficacy and minimum toxicity. As such, pharmacogenetics has the potential to achieve optimal quality use of medicines, and to improve the efficacy and safety of both prospective and licensed drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
618 Only a small portion of them are non-synonymous (V12M, Q141K, Q166E, I206L, F208S, S248P, D296H, L525R, A528T, F571I, and Y590N) and there is one frameshift (1515delC) mutation observed in the coding region of ABCG2. Login to comment
636 The localization of other variants including V12M, A149P, R163K, Q166E, P269S and S441N was also examined. Login to comment

[hide] Functions of the breast cancer resistance protein ... Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3. Noguchi K, Katayama K, Mitsuhashi J, Sugimoto Y
Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy.
Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3., 2009-01-31 [PMID:19111841]

Abstract [show]
The breast cancer resistance protein, BCRP/ABCG2, is a half-molecule ATP-binding cassette transporter that facilitates the efflux of various anticancer agents from the cell, including 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. The expression of BCRP can thus confer a multidrug resistance phenotype in cancer cells, and its transporter activity is involved in the in vivo efficacy of chemotherapeutic agents. Thus, the elucidation of the substrate preferences and structural relationships of BCRP is essential to understanding its in vivo functions during chemotherapeutic treatments. Single nucleotide polymorphisms (SNPs) have also been found to be key factors in determining the efficacy of chemotherapeutics, and those therapeutics that inhibit BCRP activity, such as the SNP that results in a C421A mutant, may result in unexpected side effects of the BCRP- anticancer drugs interaction even at normal dosages. In order to modulate the BCRP activity during chemotherapy, various compounds have been tested as inhibitors of this protein. Estrogenic compounds including estrone, several tamoxifen derivatives in addition to phytoestrogens and flavonoids have been shown to reverse BCRP-mediated drug resistance. Intriguingly, recently developed molecular targeted cancer drugs, such as the tyrosine kinase inhibitors imatinib mesylate, gefitinib and others, can also interact with BCRP. Since both functional SNPs and inhibitory agents of BCRP modulate the in vivo pharmacokinetics and pharmacodynamics of its substrate drugs, BCRP activity is an important consideration in the development of molecular targeted chemotherapeutics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

[hide] Intracellular trafficking of MDR transporters and ... Curr Top Med Chem. 2009;9(2):197-208. Porcelli L, Lemos C, Peters GJ, Paradiso A, Azzariti A
Intracellular trafficking of MDR transporters and relevance of SNPs.
Curr Top Med Chem. 2009;9(2):197-208., [PMID:19200005]

Abstract [show]
Multi-drug resistance (MDR) frequently contributes to the failure of chemotherapeutic treatments in cancer patients. Mechanisms underlying the development of MDR have been extensively studied and are considered multifactorial. Among them, the ATP-Binding Cassette (ABC) family of proteins plays a pivotal role. Processes of cellular distribution and subcellular localization of MDR-ABC proteins are not yet well explored and to enlighten these topics could be crucial to understand cellular drug uptake and retention. In this review, we analysed literature data concerning i) intracellular trafficking of MDR-ABC proteins (BCRP, P-gp and MRP1) and ii) mechanisms altering their cellular localization and trafficking. Moreover, we describe single nucleotide polymorphisms (SNP) that have been reported for some multidrug resistance (MDR) transporters, such as BCRP and P-gp, emphasizing their ability to affect the expression, function and localization of the transporters, with implications on drug resistance phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
201 Along with the above mentioned G34A, C421A and G1322A ABCG2 variants, the authors also studied the G445C (A149P), G488A (R163K), C496G (Q166E) and C805T (P269S) polymorphisms. Login to comment

[hide] Identification of compounds that correlate with AB... Mol Pharmacol. 2009 Nov;76(5):946-56. Epub 2009 Jul 24. Deeken JF, Robey RW, Shukla S, Steadman K, Chakraborty AR, Poonkuzhali B, Schuetz EG, Holbeck S, Ambudkar SV, Bates SE
Identification of compounds that correlate with ABCG2 transporter function in the National Cancer Institute Anticancer Drug Screen.
Mol Pharmacol. 2009 Nov;76(5):946-56. Epub 2009 Jul 24., [PMID:19633067]

Abstract [show]
ABCG2 is an ATP-binding cassette transporter that counts multiple anticancer compounds among its substrates and is believed to regulate oral bioavailability as well as serve a protective role in the blood-brain barrier, the maternal-fetal barrier, and hematopoietic stem cells. We sought to determine whether novel compounds that interact with the transporter could be identified through analysis of cytotoxicity profiles recorded in the NCI Anticancer Drug Screen database. A flow cytometric assay was used to measure ABCG2 function in the 60 cell lines and generate a molecular profile for COMPARE analysis. This strategy identified >70 compounds with Pearson correlation coefficients (PCCs) >0.4, where reduced drug sensitivity correlated with ABCG2 expression, as well as >120 compounds with PCCs < -0.4, indicating compounds to which ABCG2 expression conferred greater sensitivity. Despite identification of known single nucleotide polymorphisms in the ABCG2 gene in a number of the cell lines, omission of these lines from the COMPARE analysis did not affect PCCs. Available compounds were subjected to validation studies to confirm interaction with the transporter, including flow cytometry, [(125)I]IAAP binding, and cytotoxicity assays, and interaction was documented in 20 of the 27 compounds studied. Although known substrates of ABCG2 such as mitoxantrone or topotecan were not identified, we characterized three novel substrates-5-hydroxypicolinaldehyde thiosemicarbazone (NSC107392), (E)-N-(1-decylsulfanyl-3-hydroxypropan-2-yl)-3-(6-methyl-2,4-dioxo-1H-pyri midin-5-yl)prop-2-enamide (NSC265473), and 1,2,3,4,7-pentahydroxy-1,3,4,4a,5,11b-hexahydro[1,3]dioxolo[4,5-j]phenanth ridin-6(2H)-one [NSC349156 (pancratistatin)]-and four compounds that inhibited transporter function-2-[methyl(2-pyridin-2-ylethyl)-amino]fluoren-9-one hydroiodide (NSC24048), 5-amino-6-(7-amino-5,8-dihydro-6-methoxy-5,8-dioxo-2-quinolinyl)-4-(2-hydr oxy-3,4-dimethoxyphenyl)-3-methyl-2-pyridinecarboxylic acid, methyl ester (NSC45384), (17beta)-2,4-dibromo-estra-1,3,5(10)-triene-3,17-diol (NSC103054), and methyl N-(pyridine-4-carbonylamino)carbamodithioate (NSC636795). In summary, COMPARE analysis of the NCI drug screen database using the ABCG2 functional profile was able to identify novel substrates and transporter-interacting compounds.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
165 Nucleotide Change Amino Acid Reference Sequence Cell Lines Heterozygote Variants Homozygote Variants Intron 1 rs2622604 MOLT4, HOP-92, HCC2998, SF539, SNB19, SNB75, U251, SKMEL5, OVCAR3, OVCAR8, RXF393, TK10, NCI ADR-RES, MDA-MB-231, HS578T, 786-0 SW620, OVCAR 5, BT549, T47D 914CϾA Q141K rs2231142 A549, COLO205, HCT116, SF295, MALME-3M, SKOV-3, CAKI-1, HOP62, HOP92, MDA-MB-231 LOX IMVI, A498 862CϾT Y123Y rs2231139 None None 989CϾG Q166E rs1061017 None None 1057AϾG G188G rs3116439 None None 1116TϾC F208S rs1061018 None None 1235TϾC S248P rs3116448 None None 1493GϾT E334* rs3201997 None None levels of P-gp or MRP1 did not improve PCCs (data not shown). Login to comment

[hide] Human ABC transporter ABCG2 in cancer chemotherapy... J Exp Ther Oncol. 2009;8(1):5-24. Ishikawa T, Nakagawa H
Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics.
J Exp Ther Oncol. 2009;8(1):5-24., [PMID:19827267]

Abstract [show]
The ability of cancer cells to acquire resistance to multiple anticancer agents, termed multidrug resistance, is often mediated by overexpression of ATP-binding cassette (ABC) transporters that remove drugs out of the cell against a concentration gradient. ABCG2, or breast cancer resistance protein (BCRP), is an ABC transporter that has been the subject of intense study since its discovery a decade ago. While ABCG2 overexpression has been demonstrated in cancer cells after in vitro drug treatment, endogenous ABCG2 expression in certain cancers is considered as a reflection of the differentiated phenotype of the cell of origin and likely contributes to intrinsic drug resistance. Notably, ABCG2 is often expressed in stem cell populations, where it plays a critical role in cellular protection. ABCG2 exhibits a broad range of substrate specificity. New technologies of high-speed screening and quantitative structure-activity-relationship (QSAR) analysis have been developed to analyze the interactions of drugs with ABCG2. As ABCG2 reportedly transports porphyrins, its contribution to photodynamic therapy of human cancer is also implicated. Protein expression levels of ABCG2 in cancer cells are regulated by both transcriptional activation and protein degradation. The ABCG2 protein undergoes endosomal and/or ubiquitin-mediated proteasomal degradations. Furthermore, genetic polymorphisms in the ABCG2 gene are important factors in cancer chemotherapy to circumvent adverse effects and/or to enhance the efficacy of anticancer drugs. The present review article addresses recent advances in molecular pharmacology and pharmacogenomics of ABCG2 and provides novelideas to improve cancer chemotherapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
222 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I OUT IN R160Q R575stop ATP-binding site Figure 7. Continued A 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:50 19 Q141K has been associated with lower levels of protein expression and impaired transport in vitro (Imai et al., 2002; Kobayashi et al., 2005; Misuarai et al., 2004; Zamber et al., 2003; Morisaki et al., 2008; Kondo et al., 2004). Login to comment
232 It is known that, in the ER, the N-linked glycans play pivotal roles in protein fold- 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) Methotrexate 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) MethotrexateMethotrexate Porphyrintransport (nmol/min/mgprotein) 0.0 0.1 0.2 0.3 0.4 0.5 0.0 0.1 0.2 0.3 0.4 0.5 Porphyrin Figure 7. Login to comment

[hide] In vitro and in vivo evidence for the importance o... Handb Exp Pharmacol. 2011;(201):325-71. Meyer zu Schwabedissen HE, Kroemer HK
In vitro and in vivo evidence for the importance of breast cancer resistance protein transporters (BCRP/MXR/ABCP/ABCG2).
Handb Exp Pharmacol. 2011;(201):325-71., [PMID:21103975]

Abstract [show]
The breast cancer resistance protein (BCRP/ABCG2) is a member of the G-subfamiliy of the ATP-binding cassette (ABC)-transporter superfamily. This half-transporter is assumed to function as an important mechanism limiting cellular accumulation of various compounds. In context of its tissue distribution with localization in the sinusoidal membrane of hepatocytes, and in the apical membrane of enterocytes ABCG2 is assumed to function as an important mechanism facilitating hepatobiliary excretion and limiting oral bioavailability, respectively. Indeed functional assessment performing mouse studies with genetic deletion or chemical inhibition of the transporter, or performing pharmacogenetic studies in humans support this assumption. Furthermore the efflux function of ABCG2 has been linked to sanctuary blood tissue barriers as described for placenta and the central nervous system. However, in lactating mammary glands ABCG2 increases the transfer of substrates into milk thereby increasing the exposure to potential noxes of a breastfed newborn. With regard to its broad substrate spectrum including various anticancer drugs and environmental carcinogens the function of ABCG2 has been associated with multidrug resistance and tumor development/progression. In terms of cancer biology current research is focusing on the expression and function of ABCG2 in immature stem cells. Recent findings support the notion that the physiological function of ABCG2 is involved in the elimination of uric acid resulting in higher risk for developing gout in male patients harboring genetic variants. Taken together ABCG2 is implicated in various pathophysiological and pharmacological processes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
257 No effect on the in vitro transport activity was seen for the missense mutations c.445G>C (p.A149P; AF 0.01), c.458C>T (p.T153M; AF 0.033) c.496C>G (p.Q166E, AF not determined) c.616A>C (I206L AF not determined), c.488G>A (p.R163K AF 0.006), c.805C>T (p.P269S AF 0.006), and c.1711T>A (p.F571L, AF 0.005) (Kondo et al. 2004; Tamura et al. 2006). Login to comment

[hide] Key Role of Human ABC Transporter ABCG2 in Photody... Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8. Ishikawa T, Nakagawa H, Hagiya Y, Nonoguchi N, Miyatake S, Kuroiwa T
Key Role of Human ABC Transporter ABCG2 in Photodynamic Therapy and Photodynamic Diagnosis.
Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8., [PMID:21188243]

Abstract [show]
Accumulating evidence indicates that ATP-binding cassette (ABC) transporter ABCG2 plays a key role in regulating the cellular accumulation of porphyrin derivatives in cancer cells and thereby affects the efficacy of photodynamic therapy and photodynamic diagnosis. The activity of porphyrin efflux can be affected by genetic polymorphisms in the ABCG2 gene. On the other hand, Nrf2, an NF-E2-related transcription factor, has been shown to be involved in oxidative stress-mediated induction of the ABCG2 gene. Since patients have demonstrated individual differences in their response to photodynamic therapy, transcriptional activation and/or genetic polymorphisms of the ABCG2 gene in cancer cells may affect patients' responses to photodynamic therapy. Protein kinase inhibitors, including imatinib mesylate and gefitinib, are suggested to potentially enhance the efficacy of photodynamic therapy by blocking ABCG2-mediated porphyrin efflux from cancer cells. This review article provides an overview on the role of human ABC transporter ABCG2 in photodynamic therapy and photodynamic diagnosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
167 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells [41, 90]. Login to comment
177 Gefitinib and imatinib are new anticancer drugs Outside Plasma membrane Inside H2N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S ATP-binding cassette (a) 0 0.1 0.3 0.4 0.2 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrin transport(nmol/min/mgprotein) (b) Figure 4: (a) Schematic illustration of human ABCG2 and its nonsynonymous polymorphisms. Login to comment

[hide] Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplot... Pharmacogenet Genomics. 2005 Sep;15(9):599-608. Colombo S, Soranzo N, Rotger M, Sprenger R, Bleiber G, Furrer H, Buclin T, Goldstein D, Decosterd L, Telenti A
Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo.
Pharmacogenet Genomics. 2005 Sep;15(9):599-608., [PMID:16041239]

Abstract [show]
OBJECTIVES: The human immunodeficiency virus protease inhibitor nelfinavir is substrate of polyspecific drug transporters encoded by ABCB1 (P-glycoprotein), ABCC1 (MRP1) and ABCC2 (MRP2), and an inhibitor of BCRP, encoded by ABCG2. Genetic polymorphism in these genes may be associated with changes in transport function. METHODS: A comprehensive evaluation of single nucleotide polymorphisms (39 SNPs in ABCB1, 7 in ABCC1, 27 in ABCC2, and 16 in ABCG2), and inferred haplotypes was done to assess possible associations of genetic variants with cellular exposure of nelfinavir in vivo. Analysis used peripheral mononuclear cells from individuals receiving nelfinavir (n=28). Key results were re-examined in a larger sample size (n=129) contributing data on plasma drug levels. RESULTS AND CONCLUSIONS: There was no significant association between cellular nelfinavir area under the curve (AUC) and SNPs or haplotypes at ABCC1, ABCC2, ABCG2. There was an association with cellular exposure for two loci in strong linkage disequilibrium: ABCB1 3435C>T; AUCTT>AUCCT>AUCCC (ratio 2.1, 1.4, 1, Ptrend=0.01), and intron 26 +80T>C; AUCCC> AUCCT > AUCTT (ratio 2.4, 1.3, 1, Ptrend=0.006). Haplotypic analysis using tagging SNPs did not improve the single SNP association values.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 - 19346T > A 50 upstream Epidauros bc-v-081 c.19 delG exon 2 p.K7fsX28 Epidauros bc-v-007 c.34G > A exon 2 p.V12M Honjo et al., 2001 bc-v-008 rs2231137 c.71C > T exon 2 p.A24V Epidauros bc-v-009 c.114T > C exon 2 synonymous (p.S38S) Zamber et al., 2003 bc-v-071 rs12721644 IVS 2 + 35 A > G intron 2 Honjo et al., 2001 bc-v-058 rs4148152 IVS 2-12 A > G intron 4 Epidauros bc-v-014 rs2231141 c.421C > A exon 5 p.Q141K Imai et al., 2002 bc-v-015 rs2231142 c.496C > G exon 5 p.Q166E Epidauros bc-v-016 rs1061017 IVS 5 + 14 A > T intron 5 Epidauros bc-v-017 rs2231143 Statistics Association between AUC values and genotypes at single SNP loci was evaluated using a Kruskal-Wallis rank test complemented by a Spearman rank test for trend. Login to comment

[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]

Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6589 Absent C421A Q141K 2 Normal/reduced G445C A149P ↔ Normal G448A R163K ↔ Normal C496G Q166E ↔ Normal/reduced A616C I206L 2↔ Normal T623C F208S N.D. Reduced T742C S248P N.D. Normal C805T P269S 2↔ Normal T1291C F431L 2 Normal/reduced G1322A S441N 2 Reduced T1465C F489L 2↔ Normal/reduced A1768T N590Y 2↔ Increased G1858A D620N 2↔ Normal 2, reduced function; ↔, no change in function; N.D. not determined. Login to comment

[hide] Apical/basolateral surface expression of drug tran... Pharm Res. 2005 Oct;22(10):1559-77. Epub 2005 Sep 22. Ito K, Suzuki H, Horie T, Sugiyama Y
Apical/basolateral surface expression of drug transporters and its role in vectorial drug transport.
Pharm Res. 2005 Oct;22(10):1559-77. Epub 2005 Sep 22., [PMID:16180115]

Abstract [show]
It is well known that transporter proteins play a key role in governing drug absorption, distribution, and elimination in the body, and, accordingly, they are now considered as causes of drug-drug interactions and interindividual differences in pharmacokinetic profiles. Polarized tissues directly involved in drug disposition (intestine, kidney, and liver) and restricted distribution to naive sanctuaries (blood-tissue barriers) asymmetrically express a variety of drug transporters on the apical and basolateral sides, resulting in vectorial drug transport. For example, the organic anion transporting polypeptide (OATP) family on the sinusoidal (basolateral) membrane and multidrug resistance-associated protein 2 (MRP2/ABCC2) on the apical bile canalicular membrane of hepatocytes take up and excrete organic anionic compounds from blood to bile. Such vectorial transcellular transport is fundamentally attributable to the asymmetrical distribution of transporter molecules in polarized cells. Besides the apical/basolateral sorting direction, distribution of the transporter protein between the membrane surface (active site) and the intracellular fraction (inactive site) is of practical importance for the quantitative evaluation of drug transport processes. The most characterized drug transporter associated with this issue is MRP2 on the hepatocyte canalicular (apical) membrane, and it is linked to a genetic disease. Dubin-Johnson syndrome is sometimes caused by impaired canalicular surface expression of MRP2 by a single amino acid substitution. Moreover, single nucleotide polymorphisms in OATP-C/SLC21A6 (SLCO1B1) also affect membrane surface expression, and actually lead to the altered pharmacokinetic profile of pravastatin in healthy subjects. In this review article, the asymmetrical transporter distribution and altered surface expression in polarized tissues are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
212 Kondo et al. (119) also examined the cellular localization of a total of seven SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N) in LLC-PK1. Login to comment

[hide] Structure, function, expression, genomic organizat... Int J Toxicol. 2006 Jul-Aug;25(4):231-59. Choudhuri S, Klaassen CD
Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters.
Int J Toxicol. 2006 Jul-Aug;25(4):231-59., [PMID:16815813]

Abstract [show]
The ATP-binding cassette (ABC) transporters constitute a large family of membrane proteins, which transport a variety of compounds through the membrane against a concentration gradient at the cost of ATP hydrolysis. Substrates of the ABC transporters include lipids, bile acids, xenobiotics, and peptides for antigen presentation. As they transport exogenous and endogenous compounds, they reduce the body load of potentially harmful substances. One by-product of such protective function is that they also eliminate various useful drugs from the body, causing drug resistance. This review is a brief summary of the structure, function, and expression of the important drug resistance-conferring members belonging to three subfamilies of the human ABC family; these are ABCB1 (MDR1/P-glycoprotein of subfamily ABCB), subfamily ABCC (MRPs), and ABCG2 (BCRP of subfamily ABCG), which are expressed in various organs. In the text, the transporter symbol that carries the subfamily name (such as ABCB1, ABCC1, etc.) is used interchangeably with the corresponding original names, such as MDR1P-glycoprotein, MRP1, etc., respectively. Both nomenclatures are maintained in the text because both are still used in the transporter literature. This helps readers relate various names that they encounter in the literature. It now appears that P-glycoprotein, MRP1, MRP2, and BCRP can explain the phenomenon of multidrug resistance in all cell lines analyzed thus far. Also discussed are the gene structure, regulation of expression, and various polymorphisms in these genes. Because genetic polymorphism is thought to underlie interindividual differences, including their response to drugs and other xenobiotics, the importance of polymorphism in these genes is also discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
573 Recently, Kondo et al. (2004) reported the effect of single nucleotide polymorphisms (SNPs) in ABCG2 gene on its localization, expression level, and transport activity of the BCRP protein. The cellular localization was identified using the wild-type and seven different SNP variants of BCRP protein (Val12Met, Gln141Lys, Ala149Pro, Arg163Lys, Gln166Glu, Pro269Ser, and Ser441Asn), following their expression in LLC-PK1 cells. Login to comment

[hide] Structure and function of BCRP, a broad specificit... Arch Toxicol. 2014 Jun;88(6):1205-48. doi: 10.1007/s00204-014-1224-8. Epub 2014 Apr 29. Jani M, Ambrus C, Magnan R, Jakab KT, Beery E, Zolnerciks JK, Krajcsi P
Structure and function of BCRP, a broad specificity transporter of xenobiotics and endobiotics.
Arch Toxicol. 2014 Jun;88(6):1205-48. doi: 10.1007/s00204-014-1224-8. Epub 2014 Apr 29., [PMID:24777822]

Abstract [show]
The discovery and characterization of breast cancer resistance protein (BCRP) as an efflux transporter conferring multidrug resistance has set off a remarkable trajectory in the understanding of its role in physiology and disease. While the relevance in drug resistance and general pharmacokinetic properties quickly became apparent, the lack of a characteristic phenotype in genetically impaired animals and humans cast doubt on the physiological importance of this ATP-binding cassette family member, similarly to fellow multidrug transporters, despite well-known endogenous substrates. Later, high-performance genetic analyses and fine resolution tissue expression data forayed into unexpected territories concerning BCRP relevance, and ultimately, the rise of quantitative proteomics allows putting observed interactions into absolute frameworks for modeling and insight into interindividual and species differences. This overview summarizes existing knowledge on the BCRP transporter on molecular, tissue and system level, both in physiology and disease, and describes a selection of experimental procedures that are the most widely applied for the identification and characterization of substrate and inhibitor-type interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 Histone deacetylase inhibitors rescue newly synthesized transporter proteins and prevent aggresome targeting by disturbing TableÊf;1ߒߙMajor non-synonymous single-nucleotide polymorphisms found in the ABCG2 coding region Allele frequencies presented in this table do not reflect interethnic differences Mutation Position in BCRP Cellular effects of SNP Allele frequency % References 34G>A, V12M (rs2231137) N-terminus Lower expression, no impact on function 0-29.8 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 151G>T, G51C N-terminus Slightly overexpressed, decreased transport activity 0.1 Tamura et al. (2006), Yoshioka et al. (2007) 376C>T, Q126X (rs7255271) NBD No expression, no activity 0-1.7 Tamura et al. (2006), Mizuarai et al. (2004), Itoda et al. (2003), Imai et al. (2002), Kobayashi et al. (2005), Kondo et al. (2004) 421C>A, Q141K (rs2231142) NBD Lower expression, decreased transport activity, substrate specificity altered 0-35.7 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 458C>T, T153 M NBD Slightly lower expression, no impact on function 3.3 Tamura et al. (2006), Mizuarai et al. (2004) 479G>A, R160Q NBD Not determined 0.5 Bosch et al. (2005), Tamura et al. (2006) 496C>G, Q166E (rs1061017) NBD Slightly lower expression, no impact on function 0-1.1 Tamura et al. (2006), Kondo et al. (2004), Yoshioka et al. (2007) 616A>C, I206L (rs12721643) NBD Well expressed, decreased transport activity 0-10.0 Tamura et al. (2006), Zamber et al. (2003), Vethanayagam et al. (2005), Ieiri (2012a) 623T>C, F208 (rs1061018) NBD No expression, no transport activity 0.9-3.9 Tamura et al. (2006) 742T>C, S248P (rs3116448) NBD Well expressed, no transport activity 0.5 Tamura et al. (2006), Yoshioka et al. (2007) 1000G>T, E334X (rs3201997) NBD No expression, no transport activity Not determined Tamura et al. (2006), Ishikawa et al. (2005) 1291T>C F431L ECL1 Lower expression, substrate specificity altered 0.6-0.8 Tamura et al. (2006), Itoda et al. (2003), Yoshioka et al. (2007) 1322G>A, S441 N ECL1 Slightly lower expression, no transport activity 0.5 Tamura et al. (2006), Kobayashi et al. (2005), Kondo et al. (2004) 1465T>C, F489L TM3 Slightly lower expression, no transport activity 0.5-0.8 Tamura et al. (2006), Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F506S TM4 Not determined 0.5 Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F507L 1515delC, V508L 1515delC, M509X 1711T>A, F571I (rs9282571) TM5 Well expressed, substrate specificity altered 0.5 Tamura et al. (2006) 1723C>T, R575X TM5 Not determined 0.5 Tamura et al. (2006) 1768A>T, N590Y (rs34264773) ECL3 Slightly overexpressed, substrate specificity altered 0-9.7 Tamura et al. (2006), Mizuarai et al. (2004), Zamber et al. (2003), Vethanayagam et al. (2005) 1858G>A, D620 N (rs34783571) ECL3 Slightly overexpressed, substrate specificity altered 0-11.1 Tamura et al. (2006), Bosch et al. (2005), Honjo et al. (2002), Vethanayagam et al. (2005) the trafficking along microtubules (Basseville et al. 2012). Login to comment

[hide] Determinants of the activity and substrate recogni... Drug Metab Rev. 2014 Nov;46(4):459-74. doi: 10.3109/03602532.2014.942037. Epub 2014 Jul 18. Szafraniec MJ, Szczygiel M, Urbanska K, Fiedor L
Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2).
Drug Metab Rev. 2014 Nov;46(4):459-74. doi: 10.3109/03602532.2014.942037. Epub 2014 Jul 18., [PMID:25036722]

Abstract [show]
The xenobiotic transporters are among the most important constituents of detoxification system in living organisms. Breast cancer resistance protein (BCRP/ABCG2) is one of the major transporters involved in the efflux of xenobiotics. To understand its role in chemotherapeutic and multidrug resistance, it is crucial to establish the determinants of its substrate specificity, which obviously is of high relevance for successful therapy of many diseases. This article summarizes the current knowledge about the substrate preferences of BCRP. We overview the factors which determine its activity, inhibition and substrate recognition, focusing on the structural features of the transporter. BCRP substrate specificity is quite low as it interacts with a spectrum of substances with only a few common features: hydrophobic and aromatic regions, possibly a flat conformation and the metal ion-, oxygen- and nitrogen-containing functionalities, most of which may be the donors/acceptors of H-bonds. Several amino acid residues and structural motifs are responsible for BCRP activity and substrate recognition. Thus, the active form of BCRP, at least a dimer or a larger oligomer is maintained by intramolecular disulfide bridge that involves Cys(603) residues. The GXXXG motif in transmembrane helix 1, Cys residues, Arg(482) and Lys(86) are responsible for maintaining the protein structure, which confers transport activity, and the His(457) or Arg(456) residues are directly involved in substrate binding. Arg(482) does not directly bind substrates, but electrostatically interacts with charged molecules, which initiates the conformational changes that transmit the signal from the transmembrane regions to the ABC domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
201 To elucidate the significance of this polymorphism for porphyrin transport, a set of 18 variants of BCRP (Val12 Met, Gly51 Cys, Gln126 stop, Gln141 Lys, Thr153 Met, Gln166 Glu, Ile206 Leu, Phe208 Ser, Ser248 Pro, Glu334 stop, Phe431 Leu, Ser441 Asn, Arg482 Gly, Arg482 Thr, Phe489 Leu, Phe571 Ile, Asn590 Tyr and Asp620 Asn) have been expressed in insect cells. Login to comment