ABCMdb

ABCG2 p.Ser248Pro

Predicted by SNAP2:	A: D (80%), C: D (91%), D: D (91%), E: D (91%), F: D (91%), G: D (91%), H: D (91%), I: D (95%), K: D (91%), L: D (95%), M: D (85%), N: D (85%), P: D (95%), Q: D (91%), R: D (91%), T: D (91%), V: D (91%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins. Login to comment

[hide] Functional SNPs of the breast cancer resistance pr... Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21. Yanase K, Tsukahara S, Mitsuhashi J, Sugimoto Y
Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development.
Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21., 2006-03-08 [PMID:16303243]

Abstract [show]
Breast cancer resistance protein (BCRP) is a half-molecule ATP-binding cassette transporter that pumps out various anticancer agents such as 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. We have previously identified three polymorphisms within the BCRP gene, G34A (substituting Met for Val-12), C376T (substituting a stop codon for Gln-126) and C421A (substituting Lys for Gln-141). C421A BCRP-transfected murine fibroblast PA317 cells showed markedly decreased protein expression and low-level drug resistance when compared with wild-type BCRP-transfected cells. In contrast, G34A BCRP-transfected PA317 cells showed a similar protein expression and drug resistance profile to wild-type. The C376T polymorphism would be expected to have a considerable impact as active BCRP protein will not be expressed from a T376 allele. Hence, people with C376T and/or C421A polymorphisms may express low levels of BCRP, resulting in hypersensitivity of normal cells to BCRP-substrate anticancer agents. Estrogens, estrone and 17beta-estradiol, were previously found to restore drug sensitivity levels in BCRP-transduced cells by increasing the cellular accumulation of anticancer agents. BCRP transports sulfated estrogens but not free estrogens and in a series of screening experiments for synthesized and natural estrogenic compounds, several tamoxifen derivatives and phytoestrogens/flavonoids were identified that effectively circumvent BCRP-mediated drug resistance. The kinase inhibitors gefitinib and imatinib mesylate also interact with BCRP. Gefitinib, an inhibitor of epidermal growth factor receptor-tyrosine kinase, inhibits its transporter function and reverses BCRP-mediated drug resistance both in vitro and in vivo. BCRP-transfected human epidermoid carcinoma A431 cells and BCRP-transfected human non-small cell lung cancer PC-9 cells show gefitinib resistance. Imatinib, an inhibitor of BCR-ABL tyrosine kinase, also inhibits BCRP-mediated drug transport. Hence, both functional SNPs and inhibitors of BCRP reduce its transporter function and thus modulate substrate pharmacokinetics and pharmacodynamics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

[hide] Functional validation of the genetic polymorphisms... Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11. Tamura A, Watanabe M, Saito H, Nakagawa H, Kamachi T, Okura I, Ishikawa T
Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport.
Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11., [PMID:16608919]

Abstract [show]
The ATP-binding cassette (ABC) transporter ABCG2 has been implicated to play a significant role in the response of patients to medication and/or the risk of diseases. To clarify the possible physiological or pathological relevance of ABCG2 polymorphisms, we have functionally validated single nucleotide polymorphisms (SNP) of ABCG2. In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Because porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the porphyrin transport activity of those variant forms in vitro. We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Furthermore, Flp-In-293 cells expressing those variants were photosensitive. Thus, among those genetic polymorphisms of ABCG2, at least the hitherto validated alleles of Q126stop, S441N, and F489L are suggested to be of clinical importance related to the potential risk of porphyria.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
4 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Login to comment
36 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins, suggesting that those genetic polymorphisms in the ABCG2 gene may be related to the risk of certain diseases resulting from disruption of porphyrin homeostasis. Login to comment
82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan). Login to comment
144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis. Login to comment
164 It is important to note that the variants Q126stop, F208S, S248P, E334stop, and S441N substantially lack transport activity for both hematoporphyrin and methotrexate. Login to comment
177 as the variants F208S, S248P, S441N, F431L, and F489L were expressed in Flp-In 293 cells. Login to comment
180 Similar results were observed with the variants of F208S and S248P (data not shown). Login to comment
214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
215 We provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin (Fig. 5). Login to comment
217 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a. Thus, it is likely that humans with these alleles may be more susceptible to porphyrin-induced phototoxicity. Login to comment
224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein. Login to comment
235 In contrast, F208S, S248P and E334stop alleles are registered in the National Center for Biotechnology Information dbSNP database, but their allele frequencies are not available. Login to comment
236 The most recent version of National Center for Biotechnology Information dbSNP does not seem to have validation for Q166E, F208S, S248P, and E334stop (Table 2) as bona fide SNPs. Login to comment
237 Thus, the clinical significance of F208S, S248P and E334stop alleles in porphyrin-induced phototoxicity remains to be elucidated. Login to comment

[hide] Human ABC transporter ABCG2 in xenobiotic protecti... Drug Metab Rev. 2006;38(3):371-91. Wakabayashi K, Tamura A, Saito H, Onishi Y, Ishikawa T
Human ABC transporter ABCG2 in xenobiotic protection and redox biology.
Drug Metab Rev. 2006;38(3):371-91., [PMID:16877258]

Abstract [show]
Human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR/ABCP) is regarded as a member of the phase III system of xenobiotic metabolism. This efflux pump is suggested to be responsible for protecting the body from toxic xenobiotics and for removing toxic metabolites. The aim of this review article is to address new aspects of ABCG2 related to redox biology, namely the posttranslational modification (intra- and intermolecular disulfide bond formation) of ABCG2 protein and the transport of porphyrin and chlorophyll metabolites, as well as the high-speed screening and QSAR analysis method to evaluate ABCG2-drug interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells. Login to comment
177 The variants Q126stop, F208S, S248P, E334stop, and S441N were found to be defective in the transport of hematoporphyrin (Tamura et al., 2006) (Table 2). Login to comment
179 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when those cells were treated with pheophorbide a (Tamura et al., 2006). Login to comment

[hide] Genetic polymorphisms of human ABC transporter ABC... J Exp Ther Oncol. 2006;6(1):1-11. Tamura A, Wakabayashi K, Onishi Y, Nakagawa H, Tsuji M, Matsuda Y, Ishikawa T
Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system.
J Exp Ther Oncol. 2006;6(1):1-11., [PMID:17228519]

Abstract [show]
The vector-mediated introduction of cDNA into mammalian cells by calcium phosphate co-precipitation or permeation with lipofectamine is widely used for the integration of cDNA into genomic DNA. However, integration of cDNA into the host's chromosomal DNA occurs randomly at unpredictable sites, and the number of integrated recombinant DNAs is not controllable. To investigate the effect of genetic polymorphisms of ABCG2 on the protein expression and the drug resistance profile, we developed the Flp-In method to integrate one single copy of ABCG2 variant-cDNA into FRT-tagged genomic DNA. More than 20 metaphase spreads were examined for both fluorescence in situ hybridization (FISH) mapping and multicolor-FISH analysis, and it has been revealed that ABCG2 cDNA was incorporated into the telomeric region of the short arm on one of chromosomes 12 in Flp-In-293 cells. Based on the currently available SNP data for human ABCG2, we have created a total of seven variants by site-directed mutagenesis and stably expressed them in Flp-In-293 cells. While mRNAs of those integrated ABCG2 variants and wild type were evenly expressed in Flp-In-293 cells, the protein expression levels of F208S and S441N variants were found to be markedly low. It is suggested that the protein instability due to enhanced degradation resulted in the low levels of their protein expression. Thus, the Flp recombinase system would provide a useful tool to validate the effect of nonsynonymous SNPs on the protein stability and post-translational modification of ABCG2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 3 Plasma Membrane inside outside S S S homodimer A B CH2N COOH V12M Q141K F208S S248P F431L S441N F489L R482G R482T Acquired mutation Figure 1. Login to comment
67 PCR primers and conditions for site-directed mutagenesis to create variants of ABCG2 Variant Forward/Reverse Primer sequence (5` →→ 3`) Primer length % GC Tm (ºC) (F/R) primers (bases) V12M F CGAAGTTTTTATCCCAATGTCACAAGGAAACAC 33 39 55 R GTGTTTCCTTGTGACATTGGGATAAAAACTTCG Q141K F CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT 35 42 55 R AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG F208S F TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA 35 45 55 R TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P F TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT 35 40 55 R AAACAACTTGAAGATGGGATATCGAGGCTGATGAA F431L F AGCTGGGGTTCTCCTCTTCCTGACGACC 28 60 62 R GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N F AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC 34 47 59 R GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L F GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG 46 34 62 R CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC Sites of mutagenesis are indicated by underbars. Login to comment
104 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 0 1 2 RelativemRNAlevel Mock WT V12M Q141K mRNA A ABCG2 GAPDH Mock WT F208S S248P F431L S441N F489L ABCG2 GAPDH 0 1 2 RelativemRNAlevel mRNA B GAPDH ABCG2 Mock WT F208S S248P F431L S441N F489L Protein 0 1 2 Relativeproteinlevel * * * C DProtein GAPDH ABCG2 0 1 2 Relativeproteinlevel * * Mock WT V12M Q141K Figure 3. mRNA and protein expression levels of ABCG2 WT and variants expressed in Flp-In-293 cells. Login to comment
114 Characterization of V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells The mRNA levels of ABCG2 and GAPDH were measured by quantitative PCR, and the ratios of ABCG2 variants vs. GAPDH were plotted. Login to comment
119 Figure 3 demonstrates mRNA and protein levels of ABCG2 WT and V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells. Login to comment
124 The other variants, i.e., V12M, Q141K, S248P, F431L, and F489L, were expressed in plasma membrane as was ABCG2 WT. Login to comment
132 Figure 4 summarizes the characteristics of those Tamura et al. 8 Journal of Experimental Therapeutics and Oncology Vol. 6 2006 Class Class Class Class WT V12M Q141K F431L S248P F489L F208S S441N R482G R482T Protein expression + + + + + + - - + + SN-38 resistance + + + + + / - - - - + + MX resistance + + + + / - - - - - + + Doxorubicin resistance - - - - - - - - + + Daunorubicin resistance - - - - - - - - + + Figure 4. Login to comment
139 On the other hand, S248P, F431L, and F489L appear to form the second class, where those variant proteins are expressed at normal levels but exhibit different profiles of drug resistance. Login to comment
143 Resistance profile (IC50 ) of ABCG2 Compounds IC50 (nM) Mock WT V12M Q141K F208S S248P F431L S441N F489L SN-38 1.0 ± 0.2 49.9 ± 6.0 51.1 ± 13.8 17.7 ± 0.9 0.7 ± 0.0 3.6 ± 0.4 12.1 ± 1.5 0.8 ± 0.0 3.9 ± 0.4 (49.9)* (51.1)* (17.7)* (0.7) (3.6) (12.1)* (0.8) (3.9) Mitoxantorone 7.0 ± 1.1 108.0 ± 4.9 94.0 ± 18.6 46.7 ± 12.7 5.1 ± 1.0 13.4 ± 1.3 15.2 ± 1.4 5.7 ± 0.8 12.1 ± 6.2 (15.4)* (13.4)* (6.7)* (0.7) (1.9) (2.2)* (0.8) (1.7) Doxorubicin 38.8 ± 3.8 105.2 ± 24.9 123.6 ± 35.3 156.8 ± 27.5 19.9 ± 8.7 23.7 ± 6.7 43.5 ± 6.1 39.4 ± 4.1 47.6 ± 3.1 (2.7) (3.2) (4.0) (0.5) (0.6) (1.1) (1.0) (1.2) Daounorubicin 13.0 ± 0.6 32.3 ± 6.5 58.2 ± 5.0 57.7 ± 4.1 14.1 ± 2.3 22.1 ± 4.2 15.9 ± 1.2 13.3 ± 1.1 23.6 ± 1.6 (2.5) (4.5) (4.4) (1.1) (1.7) (1.2) (1.0) (1.8) Etoposide 117.1 ± 16.0 210.2 ± 18.4 297.3 ± 58.5 233.9 ± 54.2 122.9 ± 17.6 137.7 ± 14.8 139.1 ± 12.3 154.3 ± 8.5 186.9 ± 10.1 (1.8) (2.5) (2.0) (1.0) (1.2) (1.2) (1.3) (1.6) Vincristine 1.8 ± 0.2 4.3 ± 0.3 7.1 ± 1.4 5.6 ± 1.6 0.6 ± 0.0 4.3 ± 0.9 1.8 ± 0.3 0.9 ± 0.1 3.0 ± 0.7 (2.4) (3.0) (3.1) (0.3) (2.4) (1.0) (0.5) (1.7) The drug resistance profiles of ABCG2 WT and variants were obtained by incubating Flp-In-293/ABCG2 WT, V12M, Q141K, F208S, S248P, F431L, S441N, or F489L cells in the presence of SN-38, mitoxantrone, doxorubicin, daunorubicin, etoposide, or vincristine at different concentrations as described in Materials and Methods. Login to comment

[hide] Re-evaluation and functional classification of non... Cancer Sci. 2007 Feb;98(2):231-9. Tamura A, Wakabayashi K, Onishi Y, Takeda M, Ikegami Y, Sawada S, Tsuji M, Matsuda Y, Ishikawa T
Re-evaluation and functional classification of non-synonymous single nucleotide polymorphisms of the human ATP-binding cassette transporter ABCG2.
Cancer Sci. 2007 Feb;98(2):231-9., [PMID:17297656]

Abstract [show]
Impacts of genetic polymorphisms of the ATP-binding cassette (ABC) transporter BCRP/MXR1/ABCP (ABCG2) on drug response have been implicated; however, the hitherto reported data involve some inconsistencies. To re-evaluate the effect of single nucleotide polymorphisms (SNP) of ABCG2 in vitro, we created a total of seven variant cDNAs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) by site-directed mutagenesis and stably expressed each of them in Flp-In-293 cells using the Flp recombinase system. Multicolor fluorescence in situ hybridization mapping analysis revealed that one single copy of ABCG2 cDNA was incorporated into the telomeric region of chromosome 12p. It was proven that mRNAs of those integrated ABCG2 variants were expressed evenly in Flp-In-293 cells. However, the protein expression levels varied among those variants. In particular, expression of the F208S and S441N variants was markedly low, suggesting the instability of these variant proteins. Drug resistance profiles of Flp-In-293 cells expressing two major SNP variants (V12M and Q141K) toward the drug SN-38 demonstrated that the IC50 value (drug concentrations producing a 50% reduction of cell growth) for Q141K was approximately 50% of that for wild type. The contributions of the minor SNP variants (F208S, S248P, F431L, S441N and F489L) to drug resistance toward SN-38, mitoxantrone, doxorubicin, daunorubicin or etoposide were significantly lower than wild type. Based on our functional validation, the above-mentioned non-synonymous polymorphisms as well as acquired mutants (R482G and R482T) of ABCG2 were classified into four groups. Furthermore, new camptothecin analogs synthesized by our research group had potent effects in circumventing ABCG2-mediated drug resistance without any influence from major non-synonymous polymorphisms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 To re-evaluate the effect of single nucleotide polymorphisms (SNP) of ABCG2 in vitro, we created a total of seven variant cDNAs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) by site-directed mutagenesis and stably expressed each of them in Flp-In-293 cells using the Flp recombinase system. Login to comment
8 The contributions of the minor SNP variants (F208S, S248P, F431L, S441N and F489L) to drug resistance toward SN-38, mitoxantrone, doxorubicin, daunorubicin or etoposide were significantly lower than wild type. Login to comment
137 Characterization of the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells. Login to comment
138 Figure 2C demonstrates the mRNA and protein levels of WT ABCG2 and the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells. Login to comment
142 The other variants (S248P, F431L and F489L) were expressed in the plasma membrane, as was WT ABCG2. Login to comment
146 On the contrary, the S248P, F431L and F489L variants contributed drug resistance; however, their contribution was not so large as that of WT. Login to comment
155 For this purpose, we expressed WT ABCG2, V12M, Q141K, S248P, F431L, F489L, R482G and R482T in Sf9 insect cells and prepared plasma membranes as described previously,(16,35) as the plasma membrane of Sf9 cells has lower endogenous background ATPase activity than Flp-In-293 cells. Login to comment
176 Resistance profile (IC50) of ABCG2 Compound IC50 (nM) Mock Wild type V12M Q141K F208S S248P F431L S441N F489L SN-38 0.9 40.0 (44.4) 40.0 (44.4) 17.0 (18.9) 0.6 (0.7) 3.0 (3.3) 10.0 (11.1) 0.7 (0.8) 3.1 (3.4) Mitoxantorone 5.2 >100 (>19) 92.0 (17.7) 45.0 (8.7) 4.5 (0.9) 11.0 (2.1) 21.0 (4.0) 4.6 (0.9) 11.0 (2.1) Doxorubicin 32.0 78.0 (2.4) 100.0 (3.1) 110.0 (3.4) 20.0 (0.6) 20.0 (0.6) 40.0 (1.3) 21.0 (0.7) 45.0 (1.4) Daunorubicin 12.0 30.0 (2.5) 50.0 (4.2) 50.0 (4.2) 12.0 (1.0) 21.0 (1.8) 14.0 (1.2) 12.0 (1.0) 19.0 (1.6) Etoposide 110.0 200.0 (1.8) 220.0 (2.0) 200.0 (1.8) 110.0 (1.0) 120.0 (1.1) 120.0 (1.1) 130.0 (1.2) 170.0 (1.5) Vincristine 1.4 4.0 (2.9) 5.0 (3.6) 4.5 (3.2) 0.6 (0.4) 4.0 (2.9) 1.4 (1.0) 0.8 (0.6) 2.8 (2.0) Relative resistances to mock cells are described in parentheses. Login to comment
192 As clearly demonstrated in this study, the F208S, S248P, F431L, S441N and F489L variants exhibited greatly altered protein expression levels (Fig. 2C) or drug resistance profiles (Fig. 4 and Table 1). Login to comment
199 The most recent version of NCBI dbSNP does not appear to contain validation for F208S and S248P as bona fide SNP. Login to comment
202 As one of the specific aims of the present study, we functionally classified the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity. Login to comment
207 Drug resistance profiles of Flp-In-293 cells expressing the wild-type (WT) BCRP/MXR1/ABCP (ABCG2), F208S, S248P, F431L, S441N or F489L variants toward (A) SN-38 and (B) mitoxantrone. Login to comment
216 Finally, S248P, F431L and F489L appear to form the fourth heterogeneous group, where those variant proteins are expressed at normal levels but exhibit different profiles of drug resistance and transport activity. Login to comment

[hide] The identification of two germ-line mutations in t... Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21. Yoshioka S, Katayama K, Okawa C, Takahashi S, Tsukahara S, Mitsuhashi J, Sugimoto Y
The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein.
Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21., [PMID:17373578]

Abstract [show]
PURPOSE: We examined the effects of the nine nonsynonymous germ-line mutations/SNPs in the breast cancer resistance protein (BCRP/ABCG2) gene on the expression and function of the protein. MATERIALS AND METHODS: We generated cDNAs for each of these mutants (G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP) and compared the effects of their exogenous expression in PA317 cells with a wild-type control. RESULTS: PA/F208S cells (T623C BCRP-transfectants) expressed marginal levels of a BCRP protein species (65kDa), which is slightly smaller than wild-type (70kDa), but this mutant did not appear on the cell surface or confer drug resistance. PA/F431L cells (T1291C BCRP-transfectants) were found to express both 70 kDa and 65 kDa BCRP protein products. In addition, although PA/F431L cells expressed 70 kDa BCRP at comparable levels to PA/WT cells, they showed only marginal resistance to SN-38. PA/T153M cells (C458T BCRP-transfectants) and PA/D620N cells (G1858A BCRP-transfectants) expressed lower amounts of BCRP and showed lower levels of resistance to SN-38 compared with PA/WT cells. CONCLUSIONS: We have shown that T623C BCRP encodes a non-functional BCRP and that T1291C BCRP encodes a low-functional BCRP. Hence, these mutations may affect the pharmacokinetics of BCRP substrates in patients harboring these alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The cells were selected with 120 ng/mL of methotrexate, and the resulting mixed populations of resistant cells were designated as PA/WT, PA/V12M, PA/ G51C, PA/Q141K, PA/T153M, PA/I206L, PA/F208S, PA/ S248P, PA/F431L, PA/N590Y and PA/D620N, respectively. The PA/F208S clones and PA/F431L clones were obtained by limiting dilution. Login to comment
43 Cell Growth Inhibition Assay Anticancer agent resistance levels in both the parental PA317 cells and in the various BCRP transfectants were Table I. Frequencies of Germ-line Mutations/SNPs Within The BCRP Gene Variation Frequency (%) Number Population Reference Nucleotide Amino acid G34A V12M 19 29 Japanese 17 G151T G51C 0.1a 350 Japanese C376T Q126Stop 1.2 124 Japanese 17 C421A Q141K 26.6 124 Japanese 17 C458T T153M 3.3 30 Cell line 32 C496G Q166E 0.3a 200 Japanese A616C I206L 20 10 Hispanic 33 T623C F208S 0.3a 200 Japanese T742C S248P 0.5a 200 Japanese T1291C F431L 0.6b 260 Japanese 34 A1768T N590Y 1.1 88 Caucasians 33 G1858A D620N 1.1 90 unknown 35 a Determined in this study. Login to comment
45 V12M Q141K D620N N590Y F431L S248P F208S I206L T153M G51C Q166E OUT MEMBRANE IN Fig. 1. Login to comment
80 RESULTS Expression of BCRP in PA317 Transfectants The germ-line mutations and resulting amino acid substitutions examined in this study were as follows; G151T (G51C), C458T (T153M), C496G (Q166E), A616C (I206L), T623C (F208S), T742C (S248P), T1291C (F431L), A1768T (N590Y) and G1858A (D620N). Login to comment
81 G51C, T153M, Q166E, I206L, F208S and S248P are located in the intracellular domain of the protein (Fig. 1 and Table I). Login to comment
90 The remaining transfectants PA/G51C, PA/ I206L, PA/S248P, and PA/N590Y expressed BCRP at levels that were comparable to PA/WT cells (Fig. 2a). Login to comment
97 Each of the other transfectants (PA/G51C, PA/I206L, PA/S248P, PA/F431L, and PA/N590Y cells) showed similar cell surface BCRP expression levels to PA/WT (Fig. 2d). Login to comment
104 Additional transfectants (PA/G51C, PA/Q166E, PA/I206L, PA/S248P, and PA/N590Y cells) showed no change in their drug resistance profiles to SN-38 compared with PA/WT cells (Table II). Login to comment
128 DISCUSSION In our current study, we have examined the effect of the nine germ-line mutations/SNPs, G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP, resulting in the amino acid changes G51C, T153M, Q166E, I206L, F208S, S248P, F431L, N590Y, D620N, respectively, on BCRP protein expression and function. Login to comment
130 The resulting mixed populations of cells were designated a PA/WT, PA/V12M, PA/G51C, PA/Q141K, PA/ T153M, PA/I206L, PA/F208S, PA/S248P, PA/F431L, PA/ N590Y and PA/D620N. Login to comment
143 G51C, T153M, Q166E, I206L, F208S, and S248P are located in the intracellular domain, and F431L, N590Y, and D620N reside in the transmembrane domain. Login to comment

[hide] ABC multidrug transporters: structure, function an... Pharmacogenomics. 2008 Jan;9(1):105-27. Sharom FJ
ABC multidrug transporters: structure, function and role in chemoresistance.
Pharmacogenomics. 2008 Jan;9(1):105-27., [PMID:18154452]

Abstract [show]
Three ATP-binding cassette (ABC)-superfamily multidrug efflux pumps are known to be responsible for chemoresistance; P-glycoprotein (ABCB1), MRP1 (ABCC1) and ABCG2 (BCRP). These transporters play an important role in normal physiology by protecting tissues from toxic xenobiotics and endogenous metabolites. Hydrophobic amphipathic compounds, including many clinically used drugs, interact with the substrate-binding pocket of these proteins via flexible hydrophobic and H-bonding interactions. These efflux pumps are expressed in many human tumors, where they likely contribute to resistance to chemotherapy treatment. However, the use of efflux-pump modulators in clinical cancer treatment has proved disappointing. Single nucleotide polymorphisms in ABC drug-efflux pumps may play a role in responses to drug therapy and disease susceptibility. The effect of various genotypes and haplotypes on the expression and function of these proteins is not yet clear, and their true impact remains controversial.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
368 A recent study characterized the activity of 18 ABCG2 variants, and concluded that Q126stop, F208S, S248P, E334stop, S441N and F489L are defective in hematoporphyrin transport [170], which may increase the risk of disease in individuals carrying these polymorphisms. Login to comment

[hide] In vitro evaluation of photosensitivity risk relat... Drug Metab Pharmacokinet. 2007 Dec;22(6):428-40. Tamura A, Onishi Y, An R, Koshiba S, Wakabayashi K, Hoshijima K, Priebe W, Yoshida T, Kometani S, Matsubara T, Mikuriya K, Ishikawa T
In vitro evaluation of photosensitivity risk related to genetic polymorphisms of human ABC transporter ABCG2 and inhibition by drugs.
Drug Metab Pharmacokinet. 2007 Dec;22(6):428-40., [PMID:18159130]

Abstract [show]
Since porphyrins are regarded as endogenous substrates for the ATP-binding cassette (ABC) transporter ABCG2, it is hypothesized that functional impairment owing to genetic polymorphisms or inhibition of ABCG2 by drugs may result in a disruption of cellular porphyrin homeostasis. In the present study, we expressed ABCG2 genetic variants, i.e., V12M, Q141K, S441N, and F489L, as well as the wild type (WT) in Flp-In-293 cells to examine the hypothesis. Cells expressing S441N and F489L variants exhibited high levels of both cellularly accumulated pheophorbide a and photosensitivity, when those cells were incubated with pheophorbide a and irradiated with visible light. To further elucidate the significance of ABCG2 in cellular porphyrin homeostasis, we observed cellular accumulation and compartmentation of porphyrin and pheophorbide a by means of a new fluorescence microscopy technology, and found that accumulation of porphyrin and pheophorbide a in the cytoplasm compartment was maintained at low levels in Flp-In-293 cells expressing ABCG2 WT, V12M, or Q141K. When ABCG2 was inhibited by imatinib or novobiocin, however, those cells became sensitive to light. Based on these results, it is strongly suggested that certain genetic polymorphisms and/or inhibition of ABCG2 by drugs can enhance the potential risk of photosensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 By using plasma membrane vesicles and a high-speed screening system, we precisely evaluated functional changes associated with genetic polymorphisms in vitro.24) Since porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the transport of porphyrins with a total of 18 variant forms of human ABCG2 in the plasma membrane vesicle system.4) As a result, we found that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins. Login to comment
199 Indeed, we reported that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin.4) The F489L variant showed impaired transport activity. Login to comment
200 As demonstrated in the present study, as well as in our previous one,4) Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a. Thus, it is likely that humans with these alleles may be more susceptible to porphyrin-induced phototoxicity. Login to comment

[hide] Ubiquitin-mediated proteasomal degradation of non-... Biochem J. 2008 May 1;411(3):623-31. Nakagawa H, Tamura A, Wakabayashi K, Hoshijima K, Komada M, Yoshida T, Kometani S, Matsubara T, Mikuriya K, Ishikawa T
Ubiquitin-mediated proteasomal degradation of non-synonymous SNP variants of human ABC transporter ABCG2.
Biochem J. 2008 May 1;411(3):623-31., 2008-05-01 [PMID:18237272]

Abstract [show]
Clinical relevance is implicated between the genetic polymorphisms of the ABC (ATP-binding cassette) transporter ABCG2 (ABC subfamily G, member 2) and the individual differences in drug response. We expressed a total of seven non-synonymous SNP (single nucleotide polymorphism) variants in Flp-In-293 cells by using the Flp (flippase) recombinase system. Of these, ABCG2 F208S and S441N variants were found to be expressed at markedly low levels, whereas their mRNA levels were equal to those of the other SNP variants and ABCG2 WT (wild-type). Interestingly, protein expression levels of the ABCG2 F208S and S441N variants increased 6- to 12-fold when Flp-In-293 cells were treated with MG132, a proteasome inhibitor. Immunoprecipitation followed by immunoblot analysis showed that the ABCG2 F208S and S441N variant proteins were endogenously ubiquitinated in Flp-In-293 cells, and treatment with MG132 significantly enhanced the level of these ubiquitinated variants. Immunofluorescence microscopy demonstrated that MG132 greatly affected the ABCG2 F208S and S441N variants in terms of both protein levels and intracellular distribution. Immunoblot analysis revealed that those variants were N-glycosylated; however, their oligosaccharides were immature compared with those present on ABCG2 WT. The ABCG2 F208S and S441N variant proteins do not appear to be processed in the Golgi apparatus, but undergo ubiquitin-mediated protein degradation in proteasomes, whereas ABCG2 WT is sorted to the plasma membrane and then degraded via the lysosomal pathway. The present study provides the first evidence that certain genetic polymorphisms can affect the protein stability of ABCG2. Control of proteasomal degradation of ABCG2 would provide a novel approach in cancer chemotherapy to circumvent multidrug resistance of human cancers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 The ABCG2 non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N and F489L were defective in the active transport of methotrexate and haematoporphyrin [18]. Login to comment
27 Furthermore, the F208S, S248P, F431L, S441N, and F489L ABCG2 variants exhibited greatly altered protein expression levels and drug Abbreviations used: ABC, ATP-binding cassette; ABCG2, ABC subfamily G, member 2; BMA, bafilomycin A1; CPT, camptothecin; DMEM, Dulbecco`s modified Eagle`s medium; endo H, endoglycosidase H; ER, endoplasmic reticulum; ERAD, ER-associated degradation; FCS, fetal calf serum; Flp, flippase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HRP, horseradish peroxidase; ME, 2-mercaptoethanol; PNGase F, peptide N-glycosidase F; RT-PCR, reverse transcription-PCR; SN-38, 7-ethyl-10-hydroxycamptothecin; SNP, single nucleotide polymorphism; TBS, Tris-buffered saline; WT, wild-type. Login to comment
208 In a previous study using the Flp recombinase system [33], we functionally characterized the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity. Login to comment

[hide] Homology modeling of breast cancer resistance prot... J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15. Hazai E, Bikadi Z
Homology modeling of breast cancer resistance protein (ABCG2).
J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15., [PMID:18249138]

Abstract [show]
BCRP (also known as ABCG2, MXR, and ABC-P) is a member of the ABC family that transports a wide variety of substrates. BCRP is known to play a key role as a xenobiotic transporter. Since discovering its role in multidrug resistance, considerable efforts have been made in order to gain deeper understanding of BCRP structure and function. The recent study was aimed at predicting BCRP structure by creating a homology model. Based on sequence similarity with known structures of full-length, NB and TM domain of ABC transporters, TM, NB, and linker regions of BCRP were defined. The NB domain of BCRP was modeled using MalK as a template. Based on secondary structure prediction of BCRP and comparison of the transmembrane connecting regions of known structures of ABC transporters, the TM domain arrangement of BCRP was established and was found to resemble to that of the recently published crystal structure of Sav1866. Thus, an initial alignment of TM domain of BCRP was established using Sav1866 as a template. This alignment was subsequently refined using constrains derived from secondary structure and TM predictions and the final model was built. Finally, the complete homodimer ABCG2 model was generated using Sav1866 as template. Furthermore, known ligands of BCRP were docked to our model in order to define possible binding sites. The results of molecular dockings of known BCRP substrates to the BCRP model were in agreement with recently published experimental data indicating multiple binding sites in BCRP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand. Login to comment

[hide] Drug-induced phototoxicity evoked by inhibition of... Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72. Tamura A, An R, Hagiya Y, Hoshijima K, Yoshida T, Mikuriya K, Ishikawa T
Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems.
Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72., [PMID:18363541]

Abstract [show]
BACKGROUND: Photosensitivity depends on both genetic and environmental factors. Pheophorbide a, present in various plant-derived foods and food supplements, can be absorbed by the small intestine. Accumulation of pheophorbide a and porphyrins in the systemic blood circulation can result in phototoxic lesions on light-exposed skin. OBJECTIVE: As the human ATP-binding cassette (ABC) transporter ABCG2 has been suggested to be critically involved in porphyrin-mediated photosensitivity, we aimed to develop in vitro screening systems for drug-induced phototoxicity. CONCLUSION: Functional impairment owing to inhibition of ABCG2 by drugs or its genetic polymorphisms can lead to the disruption of porphyrin homeostasis. This review article provides an overview on drug-induced photosensitivity, as well as our hypothesis on a potential role of ABCG2 in phototoxicity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A. Login to comment
231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids. Login to comment
245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
246 The variants Q126stop, F208S, S248P, E334stop, and S441N were defective in the transport of hematoporphyrin (Figure 9). Login to comment
248 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a [87,88]. Login to comment
252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative). Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
250 It should be noted that many xeno- and endobiotic BCRP Figure 5 Predicted membrance topology of BCRP (ABCG2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 5 for allele frequencies and description of funtional consequences. NH2 COOH NBD Val12Met Gly51Cys Gln126* Ala149Pro Gln141Lys Thr153Met Arg160Gln Arg163Lys Gln166Glu Phe506Ser Phe507Leu Val508Leu Met509* Phe489Leu Ser441Asn Phe431Leu Glu334* Ile206Leu Ala315del Thr316del Phe208Ser Asp296His Ser248Pro Pro269Ser Phe571Ile Arg575* Asn590Tyr Asp620Asn in out Membrane BCRP (ABCG2) NBD Val12Met NBDNBD Val12Met substrates are also transported by other efflux transporters, especially P-glycoprotein, thus extrapolating BCRP related in vitro data to the in vivo situation may be difficult. Login to comment
315 22.Itoda,M.,etal.EightnovelsinglenucleotidepolymorphismsinABCG2/BCRPinJapanesecancerpatientsadministeredirinotacan.DrugMetabPharmacokinet.2003; 18(3):212-217. decreased MTX and porphyrin transport in cells transfected with variant cDNA in comparison to wild-type cDNA has also been reported for the following variants Phe208Ser, Ser248Pro, and Phe431Leu (Tamura et al., 2006). Login to comment

[hide] Human ABC transporters ABCG2 (BCRP) and ABCG4. Xenobiotica. 2008 Jul;38(7-8):863-88. Koshiba S, An R, Saito H, Wakabayashi K, Tamura A, Ishikawa T
Human ABC transporters ABCG2 (BCRP) and ABCG4.
Xenobiotica. 2008 Jul;38(7-8):863-88., [PMID:18668433]

Abstract [show]
1. The human ABC transporter ABCG2 is regarded as a member of the phase III system for xenobiotic metabolism, and it has been suggested that this efflux pump is responsible for protecting the body from toxic xenobiotics and for removing metabolites. 2. This review paper will address the new aspects of ABCG2 in terms of post-translational modifications (i.e., disulfide bond formation, ubiquitination, and endoplasmic reticulum-associated degradation) of ABCG2 protein, high-speed screening, and quantitative structure-activity relationship (QSAR) analysis to evaluate ABCG2-drug interactions, and genetic polymorphisms potentially associated with photosensitivity. 3. In addition, new aspects of human ABCG4 and mouse Abcg4 are presented with respect to their molecular properties and potential physiological roles. Considering a high sequence similarity between ABCG1 and ABCG4, both Abcg4 and ABCG4 may be involved in the transport of cholesterol from neurons and astrocytes. Furthermore, high expression of the mouse Abcg4 protein in the testis implicates its involvement in transport of certain sex hormones.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007). Login to comment
232 S. Koshiba et al. variants Q126stop, F208S, S248P, E334stop, and S441N substantially lack transport activity for both haematoporphyrin and methotrexate. Login to comment
235 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when those cells were treated with pheophorbide a (Tamura et al. 2007). Login to comment

[hide] Pharmacogenetics of intestinal absorption. Curr Drug Deliv. 2008 Jul;5(3):153-69. Nakamura T, Yamamori M, Sakaeda T
Pharmacogenetics of intestinal absorption.
Curr Drug Deliv. 2008 Jul;5(3):153-69., [PMID:18673259]

Abstract [show]
The small intestine is the primary site of absorption for many drugs administered orally and so is the target tissue for pharmacotherapeutic strategies to control the oral absorption of drugs. Drug transporters, including the ATP-binding cassette (ABC) superfamily and the solute carrier (SLC) superfamily, have been considered to play a physiological role in regulating the absorption of xenobiotics, and variations in their expression level and function in the small intestine cause intra- and inter-individual variation in the oral absorption of drugs. Recent advances in molecular biology have suggested that genetic polymorphisms are associated with the expression level and function, and thereby inter-individual variation. In this review, the pharmacogenetics of these transporters is summarized, and their future significance in the clinical setting is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Exon Polymorphism Effect dbSNP Cell Expression Function Reference mRNA ( ) Protein (n.s.) Membrane localization (n.s.) Drug sensitivity (n.s.) Mitoxantrone efflux (n.s.) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity (n.s.) Mizuarai et al. [88] Sf9 Protein ( ) ATPase activity (n.s.) Hoechst 33342 efflux ( ) Morisaki et al. [92] Exon 2 114T>C synonymous rs12721640 Exon 4 369C>T synonymous rs2231139 PA317 mRNA (n.s.) Protein ( ) Drug sensitivity ( ) Intracellular uptake ( ) Imai et al. [85] mRNA (n.s.) Protein (n.s.) Apical localization (n.s.) Drug sensitivity ( ) Indolocarbazole uptake ( ) Indolocarbazole efflux ( ) Mizuarai et al. [88] LLC-PK1 Apical localization (n.s.) Kondo et al. [94] mRNA ( ) Protein (n.s.) Membrane localization (impaired) Drug sensitivity ( ) Mitoxantrone efflux ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein ( ) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity ( ) Mizuarai et al. [88] 421C>A Gln141Lys rs2231142 Sf9 Protein (n.s.) ATPase activity ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] LLC-PK1 Apical localization (n.s.) Exon 5 496C>G Gln166Glu rs1061017 HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 HEK293 Protein ( or n.s.) Membrane localization (n.s.) Efflux activity ( ) Drug sensitivity ( ) ATPase activity (n.s.) Vethanayagam et al. [95] 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334stop rs3201997 Exon 14 2204T>A Phe571Ile rs9282571 SLC15A1 CHO Cephalexin uptake (n.s.)61G>A Val21Ile rs8187818 Cos7 Cephalexin uptake (n.s.) Substrate selectivity (n.s.) CHO Cephalexin uptake ( ) Cos7 Cephalexin uptake ( ) Substrate selectivity (VAC inhibition?) Login to comment
94 Exon Polymorphism Effect dbSNP Subject Expression Function Reference 114T>C synonymous rs12721640 369C>T synonymous rs2231139 421C>A Gln141Lys rs2231142 Patient (Caucasian) 9-nitrocamptotecin PK (CC CA) 9-aminocamptotecin PK [AUC/Dose] (CC<CA) Zamboni et al. [55] Nasopharyngeal cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) Zhou et al. [56] HIV patient (Caucasian) Nelfinavir intracellular AUC (CC CA AA) Colombo et al. [58] Cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) de Jong et al. [90] Patient (Japanese) Placental mRNA (CC CA AA) Placental protein (CC>CA>AA) Kobayashi et al. [91] Cancer patient Diflomotecan PK [AUC, Cmax] (CC<CA), [F] (CC>CA) Sparreboom et al. [96] Healthy (Chinese) Rosuvastatin PK [AUC, Cmax] (CC<CA+AA), [CL/F] (CC>CA+AA), [T1/2, Tmax] (CC CA+AA) Zhang et al. [97] Exon 4 496C>G Gln166Glu rs1061017 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334Stop rs3201997 Exon 14 1711T>A Phe571Ile rs9282571 SLC15A1 61G>A Val21Ile rs8187818Exon 3 83T>A Phe28Tyr rs8187817 258G>A synonymous rs8187823 330C>T synonymous rs8187822 350G>A Ser117Asn rs2297322 351C>A Ser117Arg rs8187821 Exon 5 364G>A Val122Met rs8187820 Exon 7 501C>T synonymous rs3737087 Exon 11 843G>A synonymous r8187812 Exon 15 1147G>A Asp383Asn rs1782674 1179C>T synonymous rs8187836Exon 16 1256G>C Gly419Ara rs4646227 1347T>C synonymous rs1339067 Allelic mRNA imbalance (2030%) Anderle et al. [101] 1348G>A Val450Ile rs2274828 1352C>A Thr451Asn rs8187838 Exon 17 1375C>T Arg459Cys rs2274827 Exon 18 1446A>G synonymous rs8187828 (Table 3) contd…. Login to comment

[hide] Clinical pharmacogenetics and potential applicatio... Curr Drug Metab. 2008 Oct;9(8):738-84. Zhou SF, Di YM, Chan E, Du YM, Chow VD, Xue CC, Lai X, Wang JC, Li CG, Tian M, Duan W
Clinical pharmacogenetics and potential application in personalized medicine.
Curr Drug Metab. 2008 Oct;9(8):738-84., [PMID:18855611]

Abstract [show]
The current 'fixed-dosage strategy' approach to medicine, means there is much inter-individual variation in drug response. Pharmacogenetics is the study of how inter-individual variations in the DNA sequence of specific genes affect drug responses. This article will highlight current pharmacogenetic knowledge on important drug metabolizing enzymes, drug transporters and drug targets to understand interindividual variability in drug clearance and responses in clinical practice and potential use in personalized medicine. Polymorphisms in the cytochrome P450 (CYP) family may have had the most impact on the fate of pharmaceutical drugs. CYP2D6, CYP2C19 and CYP2C9 gene polymorphisms and gene duplications account for the most frequent variations in phase I metabolism of drugs since nearly 80% of drugs in use today are metabolised by these enzymes. Approximately 5% of Europeans and 1% of Asians lack CYP2D6 activity, and these individuals are known as poor metabolizers. CYP2C9 is another clinically significant drug metabolising enzyme that demonstrates genetic variants. Studies into CYP2C9 polymorphism have highlighted the importance of the CYP2C9*2 and CYP2C9*3 alleles. Extensive polymorphism also occurs in a majority of Phase II drug metabolizing enzymes. One of the most important polymorphisms is thiopurine S-methyl transferases (TPMT) that catalyzes the S-methylation of thiopurine drugs. With respect to drug transport polymorphism, the most extensively studied drug transporter is P-glycoprotein (P-gp/MDR1), but the current data on the clinical impact is limited. Polymorphisms in drug transporters may change drug's distribution, excretion and response. Recent advances in molecular research have revealed many of the genes that encode drug targets demonstrate genetic polymorphism. These variations, in many cases, have altered the targets sensitivity to the specific drug molecule and thus have a profound effect on drug efficacy and toxicity. For example, the beta (2)-adrenoreceptor, which is encoded by the ADRB2 gene, illustrates a clinically significant genetic variation in drug targets. The variable number tandem repeat polymorphisms in serotonin transporter (SERT/SLC6A4) gene are associated with response to antidepressants. The distribution of the common variant alleles of genes that encode drug metabolizing enzymes, drug transporters and drug targets has been found to vary among different populations. The promise of pharmacogenetics lies in its potential to identify the right drug at the right dose for the right individual. Drugs with a narrow therapeutic index are thought to benefit more from pharmacogenetic studies. For example, warfarin serves as a good practical example of how pharmacogenetics can be utilized prior to commencement of therapy in order to achieve maximum efficacy and minimum toxicity. As such, pharmacogenetics has the potential to achieve optimal quality use of medicines, and to improve the efficacy and safety of both prospective and licensed drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
618 Only a small portion of them are non-synonymous (V12M, Q141K, Q166E, I206L, F208S, S248P, D296H, L525R, A528T, F571I, and Y590N) and there is one frameshift (1515delC) mutation observed in the coding region of ABCG2. Login to comment

[hide] Major SNP (Q141K) variant of human ABC transporter... Pharm Res. 2009 Feb;26(2):469-79. Epub 2008 Oct 29. Furukawa T, Wakabayashi K, Tamura A, Nakagawa H, Morishima Y, Osawa Y, Ishikawa T
Major SNP (Q141K) variant of human ABC transporter ABCG2 undergoes lysosomal and proteasomal degradations.
Pharm Res. 2009 Feb;26(2):469-79. Epub 2008 Oct 29., [PMID:18958403]

Abstract [show]
PURPOSE: Single nucleotide polymorphisms (SNPs) of the ATP-binding cassette (ABC) transporter ABCG2 gene have been suggested to be a significant factor in patients' responses to medication and/or the risk of diseases. We aimed to evaluate the impact of the major non-synonymous SNP Q141K on lysosomal and proteasomal degradations. METHODS: ABCG2 WT and the Q141K variant were expressed in Flp-In-293 cells by using the Flp recombinase system. Their expression levels and cellular localization was measured by immunoblotting and immunofluorescence microscopy, respectively. RESULTS: The protein level of the Q141K variant expressed in Flp-In-293 cells was about half that of ABCG2 WT, while their mRNA levels were equal. The protein expression level of the Q141K variant increased about two-fold when Flp-In-293 cells were treated with MG132. In contrast, the protein level of ABCG2 WT was little affected by the same treatment. After treatment with bafilomycin A1, the protein levels of ABCG2 WT and Q141K increased 5- and 2-fold in Flp-In-293 cells, respectively. CONCLUSIONS: The results strongly suggest that the major non-synonymous SNP Q141K affects the stability of the ABCG2 protein in the endoplasmic reticulum and enhances its susceptibility to ubiquitin-mediated proteasomal degradation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
129 Protein expression levels of the WT and the Q141K variant were determined by immunoblotting after PNGase F treatment in the same way as described above. Login to comment
130 As shown in Fig. 3A, the protein level of the Q141K variant was approximately two-fold enhanced by treatment with the proteasome inhibitor MG132. Login to comment
174 The nonsynonymous SNP variants of Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin (42). Login to comment
175 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles (18). Login to comment

[hide] Functions of the breast cancer resistance protein ... Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3. Noguchi K, Katayama K, Mitsuhashi J, Sugimoto Y
Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy.
Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3., 2009-01-31 [PMID:19111841]

Abstract [show]
The breast cancer resistance protein, BCRP/ABCG2, is a half-molecule ATP-binding cassette transporter that facilitates the efflux of various anticancer agents from the cell, including 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. The expression of BCRP can thus confer a multidrug resistance phenotype in cancer cells, and its transporter activity is involved in the in vivo efficacy of chemotherapeutic agents. Thus, the elucidation of the substrate preferences and structural relationships of BCRP is essential to understanding its in vivo functions during chemotherapeutic treatments. Single nucleotide polymorphisms (SNPs) have also been found to be key factors in determining the efficacy of chemotherapeutics, and those therapeutics that inhibit BCRP activity, such as the SNP that results in a C421A mutant, may result in unexpected side effects of the BCRP- anticancer drugs interaction even at normal dosages. In order to modulate the BCRP activity during chemotherapy, various compounds have been tested as inhibitors of this protein. Estrogenic compounds including estrone, several tamoxifen derivatives in addition to phytoestrogens and flavonoids have been shown to reverse BCRP-mediated drug resistance. Intriguingly, recently developed molecular targeted cancer drugs, such as the tyrosine kinase inhibitors imatinib mesylate, gefitinib and others, can also interact with BCRP. Since both functional SNPs and inhibitory agents of BCRP modulate the in vivo pharmacokinetics and pharmacodynamics of its substrate drugs, BCRP activity is an important consideration in the development of molecular targeted chemotherapeutics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

[hide] Quality control of human ABCG2 protein in the endo... Adv Drug Deliv Rev. 2009 Jan 31;61(1):66-72. Epub 2008 Dec 11. Wakabayashi-Nakao K, Tamura A, Furukawa T, Nakagawa H, Ishikawa T
Quality control of human ABCG2 protein in the endoplasmic reticulum: ubiquitination and proteasomal degradation.
Adv Drug Deliv Rev. 2009 Jan 31;61(1):66-72. Epub 2008 Dec 11., 2009-01-31 [PMID:19111842]

Abstract [show]
Human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR/ABCP) is a plasma membrane protein carrying intra- and inter-molecular disulfide bonds and an N-linked glycan. Both disulfide bond formation and N-glycosylation are critical check points determining the stability and degradation fate of ABCG2 protein in the endoplasmic reticulum (ER). Misfolded ABCG2 protein without those post-translational modifications is removed from the ER by retrotranslocation to the cytosol compartment, ubiquitination by ubiquitin ligase, and finally degradation by proteasomes. Certain non-synonymous SNP variants of ABCG2 undergo such ER-associated degradation (ERAD).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
950 The non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin [54]. Login to comment
951 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles [34]. Login to comment

[hide] Intracellular trafficking of MDR transporters and ... Curr Top Med Chem. 2009;9(2):197-208. Porcelli L, Lemos C, Peters GJ, Paradiso A, Azzariti A
Intracellular trafficking of MDR transporters and relevance of SNPs.
Curr Top Med Chem. 2009;9(2):197-208., [PMID:19200005]

Abstract [show]
Multi-drug resistance (MDR) frequently contributes to the failure of chemotherapeutic treatments in cancer patients. Mechanisms underlying the development of MDR have been extensively studied and are considered multifactorial. Among them, the ATP-Binding Cassette (ABC) family of proteins plays a pivotal role. Processes of cellular distribution and subcellular localization of MDR-ABC proteins are not yet well explored and to enlighten these topics could be crucial to understand cellular drug uptake and retention. In this review, we analysed literature data concerning i) intracellular trafficking of MDR-ABC proteins (BCRP, P-gp and MRP1) and ii) mechanisms altering their cellular localization and trafficking. Moreover, we describe single nucleotide polymorphisms (SNP) that have been reported for some multidrug resistance (MDR) transporters, such as BCRP and P-gp, emphasizing their ability to affect the expression, function and localization of the transporters, with implications on drug resistance phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
206 The polymorphisms T623C (F208S), T742C (S248P), T1291C (F431L) and T1465C (F489L) were studied by Tamura et al. Login to comment

[hide] Identification of compounds that correlate with AB... Mol Pharmacol. 2009 Nov;76(5):946-56. Epub 2009 Jul 24. Deeken JF, Robey RW, Shukla S, Steadman K, Chakraborty AR, Poonkuzhali B, Schuetz EG, Holbeck S, Ambudkar SV, Bates SE
Identification of compounds that correlate with ABCG2 transporter function in the National Cancer Institute Anticancer Drug Screen.
Mol Pharmacol. 2009 Nov;76(5):946-56. Epub 2009 Jul 24., [PMID:19633067]

Abstract [show]
ABCG2 is an ATP-binding cassette transporter that counts multiple anticancer compounds among its substrates and is believed to regulate oral bioavailability as well as serve a protective role in the blood-brain barrier, the maternal-fetal barrier, and hematopoietic stem cells. We sought to determine whether novel compounds that interact with the transporter could be identified through analysis of cytotoxicity profiles recorded in the NCI Anticancer Drug Screen database. A flow cytometric assay was used to measure ABCG2 function in the 60 cell lines and generate a molecular profile for COMPARE analysis. This strategy identified >70 compounds with Pearson correlation coefficients (PCCs) >0.4, where reduced drug sensitivity correlated with ABCG2 expression, as well as >120 compounds with PCCs < -0.4, indicating compounds to which ABCG2 expression conferred greater sensitivity. Despite identification of known single nucleotide polymorphisms in the ABCG2 gene in a number of the cell lines, omission of these lines from the COMPARE analysis did not affect PCCs. Available compounds were subjected to validation studies to confirm interaction with the transporter, including flow cytometry, [(125)I]IAAP binding, and cytotoxicity assays, and interaction was documented in 20 of the 27 compounds studied. Although known substrates of ABCG2 such as mitoxantrone or topotecan were not identified, we characterized three novel substrates-5-hydroxypicolinaldehyde thiosemicarbazone (NSC107392), (E)-N-(1-decylsulfanyl-3-hydroxypropan-2-yl)-3-(6-methyl-2,4-dioxo-1H-pyri midin-5-yl)prop-2-enamide (NSC265473), and 1,2,3,4,7-pentahydroxy-1,3,4,4a,5,11b-hexahydro[1,3]dioxolo[4,5-j]phenanth ridin-6(2H)-one [NSC349156 (pancratistatin)]-and four compounds that inhibited transporter function-2-[methyl(2-pyridin-2-ylethyl)-amino]fluoren-9-one hydroiodide (NSC24048), 5-amino-6-(7-amino-5,8-dihydro-6-methoxy-5,8-dioxo-2-quinolinyl)-4-(2-hydr oxy-3,4-dimethoxyphenyl)-3-methyl-2-pyridinecarboxylic acid, methyl ester (NSC45384), (17beta)-2,4-dibromo-estra-1,3,5(10)-triene-3,17-diol (NSC103054), and methyl N-(pyridine-4-carbonylamino)carbamodithioate (NSC636795). In summary, COMPARE analysis of the NCI drug screen database using the ABCG2 functional profile was able to identify novel substrates and transporter-interacting compounds.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
165 Nucleotide Change Amino Acid Reference Sequence Cell Lines Heterozygote Variants Homozygote Variants Intron 1 rs2622604 MOLT4, HOP-92, HCC2998, SF539, SNB19, SNB75, U251, SKMEL5, OVCAR3, OVCAR8, RXF393, TK10, NCI ADR-RES, MDA-MB-231, HS578T, 786-0 SW620, OVCAR 5, BT549, T47D 914CϾA Q141K rs2231142 A549, COLO205, HCT116, SF295, MALME-3M, SKOV-3, CAKI-1, HOP62, HOP92, MDA-MB-231 LOX IMVI, A498 862CϾT Y123Y rs2231139 None None 989CϾG Q166E rs1061017 None None 1057AϾG G188G rs3116439 None None 1116TϾC F208S rs1061018 None None 1235TϾC S248P rs3116448 None None 1493GϾT E334* rs3201997 None None levels of P-gp or MRP1 did not improve PCCs (data not shown). Login to comment

[hide] Human ABC transporter ABCG2 in cancer chemotherapy... J Exp Ther Oncol. 2009;8(1):5-24. Ishikawa T, Nakagawa H
Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics.
J Exp Ther Oncol. 2009;8(1):5-24., [PMID:19827267]

Abstract [show]
The ability of cancer cells to acquire resistance to multiple anticancer agents, termed multidrug resistance, is often mediated by overexpression of ATP-binding cassette (ABC) transporters that remove drugs out of the cell against a concentration gradient. ABCG2, or breast cancer resistance protein (BCRP), is an ABC transporter that has been the subject of intense study since its discovery a decade ago. While ABCG2 overexpression has been demonstrated in cancer cells after in vitro drug treatment, endogenous ABCG2 expression in certain cancers is considered as a reflection of the differentiated phenotype of the cell of origin and likely contributes to intrinsic drug resistance. Notably, ABCG2 is often expressed in stem cell populations, where it plays a critical role in cellular protection. ABCG2 exhibits a broad range of substrate specificity. New technologies of high-speed screening and quantitative structure-activity-relationship (QSAR) analysis have been developed to analyze the interactions of drugs with ABCG2. As ABCG2 reportedly transports porphyrins, its contribution to photodynamic therapy of human cancer is also implicated. Protein expression levels of ABCG2 in cancer cells are regulated by both transcriptional activation and protein degradation. The ABCG2 protein undergoes endosomal and/or ubiquitin-mediated proteasomal degradations. Furthermore, genetic polymorphisms in the ABCG2 gene are important factors in cancer chemotherapy to circumvent adverse effects and/or to enhance the efficacy of anticancer drugs. The present review article addresses recent advances in molecular pharmacology and pharmacogenomics of ABCG2 and provides novelideas to improve cancer chemotherapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
222 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I OUT IN R160Q R575stop ATP-binding site Figure 7. Continued A 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:50 19 Q141K has been associated with lower levels of protein expression and impaired transport in vitro (Imai et al., 2002; Kobayashi et al., 2005; Misuarai et al., 2004; Zamber et al., 2003; Morisaki et al., 2008; Kondo et al., 2004). Login to comment
227 The non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin (Tamura et al., 2006) (Fig. 7C). Login to comment
228 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles Figure 7. Continued WT V12M Q141K F208S S248P F431L S441N F489L R482G R482T Protein expression + + + - + + - + + + MTX transport + + + - - - - +/ - - Porphyrin transport + + + - - + - +/ + + SN-38 resistance + + + - +/ + - - + + MX resistance + + + - - - - - -- - - - - - - - +/ - - - - - - - - + + Doxorubicin resistance + + Daunorubicin resistance + + ATPase activity (Prazosin) + + WTV12M Q141K F431L F489L S248P F208S S441L R482G R482T ∆1.5 ∆3 ∆3.5 ∆5 ∆4 - - - - - - -- - - B 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:51 20 Journal of Experimental Therapeutics and Oncology Vol. 8 2009 (Tamura et al., 2007b). Login to comment
232 It is known that, in the ER, the N-linked glycans play pivotal roles in protein fold- 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) Methotrexate 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) MethotrexateMethotrexate Porphyrintransport (nmol/min/mgprotein) 0.0 0.1 0.2 0.3 0.4 0.5 0.0 0.1 0.2 0.3 0.4 0.5 Porphyrin Figure 7. Login to comment

[hide] Impact of breast cancer resistance protein on canc... Methods Mol Biol. 2010;596:251-90. Ross DD, Nakanishi T
Impact of breast cancer resistance protein on cancer treatment outcomes.
Methods Mol Biol. 2010;596:251-90., [PMID:19949928]

Abstract [show]
Breast cancer resistance protein (BCRP/ABCG2) was discovered in multidrug resistant breast cancer cells having an ATP-dependent transport-based resistance phenotype. This ABC transporter functions (at least in part) as a xenobiotic protective mechanism for the organism: in the gut and biliary tract, it prevents absorption and enhances elimination of potentially toxic substances. As a placental barrier, it protects the fetus; similarly, it serves as a component of blood-brain and blood-testis barrier; BCRP is expressed in stem cells and may protect them from potentially harmful agents. Therefore, BCRP could influence cancer outcomes by (a) endogenous BCRP affecting the absorption, distribution, metabolism, and elimination of anticancer drugs; (b) BCRP expression in cancer cells may directly cause resistance by active efflux of anticancer drugs; (c) BCRP expression in cancer cells could be a manifestation of the activity of metabolic and signaling pathways that impart multiple mechanisms of drug resistance, self-renewal (stemness), and invasiveness (aggressiveness)--i.e. impart a poor prognosis--to cancers. This chapter presents a synopsis of translational clinical studies relating BCRP expression in leukemias, lymphomas, and a variety of solid tumors with clinical outcome. Data are emerging that expression of BCRP, like P-glycoprotein/ABCB1, is associated with adverse outcomes in a variety of human cancers. Whether this adverse prognostic effect results from resistance imparted to the cancer cells as the direct result of BCRP efflux of anticancer drugs, or whether BCRP expression (and also Pgp expression - coexpression of these transporters is common among poor risk cancers) serves as indicators of the activity of signaling pathways that enhance cancer cellular proliferation, metastases, genomic instability, enhance drug resistance, and oppose programmed cell death mechanisms is yet unknown.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 Tamura et al. used multicolor fluorescence in situ hybridization to assure uniform mRNA expression of cDNAs of seven BCRP SNPs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) transduced into Flp-In-293 cells (87, 88). Login to comment

[hide] Structure and function of the human breast cancer ... Curr Drug Metab. 2010 Sep;11(7):603-17. Ni Z, Bikadi Z, Rosenberg MF, Mao Q
Structure and function of the human breast cancer resistance protein (BCRP/ABCG2).
Curr Drug Metab. 2010 Sep;11(7):603-17., [PMID:20812902]

Abstract [show]
The human breast cancer resistance protein (BCRP/ABCG2) is the second member of the G subfamily of the large ATP-binding cassette (ABC) transporter superfamily. BCRP was initially discovered in multidrug resistant breast cancer cell lines where it confers resistance to chemotherapeutic agents such as mitoxantrone, topotecan and methotrexate by extruding these compounds out of the cell. BCRP is capable of transporting non-chemotherapy drugs and xenobiotiocs as well, including nitrofurantoin, prazosin, glyburide, and 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine. BCRP is frequently detected at high levels in stem cells, likely providing xenobiotic protection. BCRP is also highly expressed in normal human tissues including the small intestine, liver, brain endothelium, and placenta. Therefore, BCRP has been increasingly recognized for its important role in the absorption, elimination, and tissue distribution of drugs and xenobiotics. At present, little is known about the transport mechanism of BCRP, particularly how it recognizes and transports a large number of structurally and chemically unrelated drugs and xenobiotics. Here, we review current knowledge of structure and function of this medically important ABC efflux drug transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
249 A systematic study of 18 natural variants of BCRP expressed in insect cells showed that the variants Q126stop, F208S, S248P, E334stop, and S441N were defective in porphyrin transport, whereas F489L displayed approximately 10% of the transport activity of wild-type BCRP [120]. Login to comment

[hide] Key Role of Human ABC Transporter ABCG2 in Photody... Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8. Ishikawa T, Nakagawa H, Hagiya Y, Nonoguchi N, Miyatake S, Kuroiwa T
Key Role of Human ABC Transporter ABCG2 in Photodynamic Therapy and Photodynamic Diagnosis.
Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8., [PMID:21188243]

Abstract [show]
Accumulating evidence indicates that ATP-binding cassette (ABC) transporter ABCG2 plays a key role in regulating the cellular accumulation of porphyrin derivatives in cancer cells and thereby affects the efficacy of photodynamic therapy and photodynamic diagnosis. The activity of porphyrin efflux can be affected by genetic polymorphisms in the ABCG2 gene. On the other hand, Nrf2, an NF-E2-related transcription factor, has been shown to be involved in oxidative stress-mediated induction of the ABCG2 gene. Since patients have demonstrated individual differences in their response to photodynamic therapy, transcriptional activation and/or genetic polymorphisms of the ABCG2 gene in cancer cells may affect patients' responses to photodynamic therapy. Protein kinase inhibitors, including imatinib mesylate and gefitinib, are suggested to potentially enhance the efficacy of photodynamic therapy by blocking ABCG2-mediated porphyrin efflux from cancer cells. This review article provides an overview on the role of human ABC transporter ABCG2 in photodynamic therapy and photodynamic diagnosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
167 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells [41, 90]. Login to comment
168 The variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin (Figure 4(b)). Login to comment
170 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a. Login to comment
177 Gefitinib and imatinib are new anticancer drugs Outside Plasma membrane Inside H2N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S ATP-binding cassette (a) 0 0.1 0.3 0.4 0.2 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrin transport(nmol/min/mgprotein) (b) Figure 4: (a) Schematic illustration of human ABCG2 and its nonsynonymous polymorphisms. Login to comment

[hide] CXCR6, a newly defined biomarker of tissue-specifi... PLoS One. 2010 Dec 22;5(12):e15183. Taghizadeh R, Noh M, Huh YH, Ciusani E, Sigalotti L, Maio M, Arosio B, Nicotra MR, Natali P, Sherley JL, La Porta CA
CXCR6, a newly defined biomarker of tissue-specific stem cell asymmetric self-renewal, identifies more aggressive human melanoma cancer stem cells.
PLoS One. 2010 Dec 22;5(12):e15183., [PMID:21203549]

Abstract [show]
BACKGROUND: A fundamental problem in cancer research is identifying the cell type that is capable of sustaining neoplastic growth and its origin from normal tissue cells. Recent investigations of a variety of tumor types have shown that phenotypically identifiable and isolable subfractions of cells possess the tumor-forming ability. In the present paper, using two lineage-related human melanoma cell lines, primary melanoma line IGR39 and its metastatic derivative line IGR37, two main observations are reported. The first one is the first phenotypic evidence to support the origin of melanoma cancer stem cells (CSCs) from mutated tissue-specific stem cells; and the second one is the identification of a more aggressive subpopulation of CSCs in melanoma that are CXCR6+. METHODS/FINDINGS: We defined CXCR6 as a new biomarker for tissue-specific stem cell asymmetric self-renewal. Thus, the relationship between melanoma formation and ABCG2 and CXCR6 expression was investigated. Consistent with their non-metastatic character, unsorted IGR39 cells formed significantly smaller tumors than unsorted IGR37 cells. In addition, ABCG2+ cells produced tumors that had a 2-fold greater mass than tumors produced by unsorted cells or ABCG2- cells. CXCR6+ cells produced more aggressive tumors. CXCR6 identifies a more discrete subpopulation of cultured human melanoma cells with a more aggressive MCSC phenotype than cells selected on the basis of the ABCG2+ phenotype alone. CONCLUSIONS/SIGNIFICANCE: The association of a more aggressive tumor phenotype with asymmetric self-renewal phenotype reveals a previously unrecognized aspect of tumor cell physiology. Namely, the retention of some tissue-specific stem cell attributes, like the ability to asymmetrically self-renew, impacts the natural history of human tumor development. Knowledge of this new aspect of tumor development and progression may provide new targets for cancer prevention and treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 Moreover, F208S and S248P polymorphisms were associated with defective active transport of methotrexate and haematoporphyrin [24]; and, in particular, F208S variant proteins (both-glycosylated and immature forms) are recognized as misfolded proteins by putative ''check point`` systems and readily undergo ubiquination and protein degradation in proteasomes [25]. Login to comment
103 Cells 421 C.A (C/A) S248P (C/T) F208S (C/T) IGR37 CA CT CT IGR39 CA CT CT ABCG2+ IGR37 CA CT CT ABCG2- IGR37 CA CT CT ABCG2+ IGR39 CA CT CT ABCG2- IGR39 CA CT CT doi:10.1371/journal.pone.0015183.t001 unsorted IGR37 cells (0.13 grams vs. 1.4 grams, respectively; p,0.01) 2 months after the injection of the cells (Table 1). Login to comment
297 SNP analysis DNA was extracted from cells using a salting-out method [28] Genotyping for ABCG2 421 C.A (assay ID: C__15854163_70), S248P (assay ID: C__27458615_40) and F208S (assay ID: C__8826940_10) single nucleotide polymorphisms (SNPs) were performed using Validated TaqMan Genotyping Assay (Applied Biosystems). Login to comment

[hide] Ubiquitin-mediated proteasomal degradation of ABC ... J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12. Nakagawa H, Toyoda Y, Wakabayashi-Nakao K, Tamaki H, Osumi M, Ishikawa T
Ubiquitin-mediated proteasomal degradation of ABC transporters: a new aspect of genetic polymorphisms and clinical impacts.
J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12., [PMID:21567408]

Abstract [show]
The interindividual variation in the rate of drug metabolism and disposition has been known for many years. Pharmacogenomics dealing with heredity and response to drugs is a part of science that attempts to explain variability of drug responses and to search for the genetic basis of such variations or differences. Genetic polymorphisms of drug metabolizing enzymes and drug transporters have been found to play a significant role in the patients' responses to medication. Accumulating evidence demonstrates that certain nonsynonymous polymorphisms have great impacts on the protein stability and degradation, as well as the function of drug metabolizing enzymes and transporters. The aim of this review article is to address a new aspect of protein quality control in the endoplasmic reticulum and to present examples regarding the impact of nonsynonymous single-nucleotide polymorphisms on the protein stability of thiopurine S-methyltransferase as well as ATP-binding cassette (ABC) transporters including ABCC4, cystic fibrosis transmembrane conductance regulator (CFTR, ABCC7), ABCC11, and ABCG2. Furthermore, we will discuss the molecular mechanisms underlying posttranslational modifications (intramolecular and intermolecular disulfide bond formation and N-linked glycosylation) and ubiquitin-mediated proteasomal degradation of ABCG2, one of the major drug transporter proteins in humans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 Impact of SNPs on Protein Stability and ERAD of ABCG2 By functional validation in vitro, the above-mentioned 17 nonsynonymous polymorphisms of ABCG2 were classified into four groups.99 The nonsynonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin.100 The F208S, S248P, F431L, S441N, and F489L variants, on the contrary, exhibited greatly reduced protein expression levels and drug resistance profiles.99 In particular, expression levels of the F208S and S441N variant proteins were markedly low.99 These variant proteins do not undergo Golgi apparatus-mediated glycoprocessing but are passed through the ERAD pathway.78 The immature and nonglycosylated forms of F208S and S441N (Fig. 6a) were detected. Login to comment

[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]

Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6589 Absent C421A Q141K 2 Normal/reduced G445C A149P ↔ Normal G448A R163K ↔ Normal C496G Q166E ↔ Normal/reduced A616C I206L 2↔ Normal T623C F208S N.D. Reduced T742C S248P N.D. Normal C805T P269S 2↔ Normal T1291C F431L 2 Normal/reduced G1322A S441N 2 Reduced T1465C F489L 2↔ Normal/reduced A1768T N590Y 2↔ Increased G1858A D620N 2↔ Normal 2, reduced function; ↔, no change in function; N.D. not determined. Login to comment

[hide] Impact of genetic variability in the ABCG2 gene on... Biochem Biophys Res Commun. 2014 Jan 24;443(4):1211-7. doi: 10.1016/j.bbrc.2013.12.119. Epub 2014 Jan 3. Deppe S, Ripperger A, Weiss J, Ergun S, Benndorf RA
Impact of genetic variability in the ABCG2 gene on ABCG2 expression, function, and interaction with AT1 receptor antagonist telmisartan.
Biochem Biophys Res Commun. 2014 Jan 24;443(4):1211-7. doi: 10.1016/j.bbrc.2013.12.119. Epub 2014 Jan 3., [PMID:24388985]

Abstract [show]
The ATP-binding cassette transporter ABCG2 plays a prominent role in cardiovascular and cancer pathophysiology, is involved in the pathogenesis of gout, and affects pharmacokinetics of numerous drugs. Telmisartan, a widely used AT1 receptor antagonist, inhibits the transport capacity of ABCG2 and may cause drug-drug interactions, especially in individuals carrying polymorphism that facilitate the telmisartan-ABCG2 interaction. Thus, the aim of this study was to identify ABCG2 polymorphisms and somatic mutations with relevance for the telmisartan-ABCG2 interaction. For this purpose, a cellular system for the conditional expression of ABCG2 was established. ABCG2 variants were generated via site-directed mutagenesis. Interaction of telmisartan with these ABCG2 variants was investigated in HEK293-Tet-On cells using the pheophorbide A efflux assay. Moreover, expression of ABCG2 variants was studied in these cells. Importantly, protein levels of the Q141K and F489L variant were significantly reduced, a phenomenon that was partly reversed by pharmacological proteasome inhibition. Moreover, basal pheophorbide A efflux capacity of S248P, F431L, and F489L variants was significantly impaired. Interestingly, inhibition of ABCG2-mediated pheophorbide A transport by telmisartan was almost abolished in cells expressing the R482G variant, whereas it was largely increased in cells expressing the F489L variant. We conclude that the arginine residue at position 482 of the ABCG2 molecule is of major importance for the interaction of telmisartan with this ABC transporter. Furthermore, individuals carrying the F489L polymorphism may be at increased risk of developing adverse drug reactions in multi-drug regimens involving ABCG2 substrates and telmisartan.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Moreover, basal pheophorbide A efflux capacity of S248P, F431L, and F489L variants was significantly impaired. Login to comment
37 Site-directed mutagenesis Non-synonymous ABCG2 single nucleotide polymorphisms (SNPs) G34A (V12M), C421A (Q141K), T742C (S248P), T1291C (F431L), T1465C (F489L) as well as somatic mutation A1444G (R482G) were inserted into the ABCG2 cDNA sequence in the pTRE-Tight-BI-AcGFP1-ABCG2 plasmid using the QuickChange&#d2; Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Waldbronn, Germany) with specific primers according to the manufacturer`s instructions (Supplemental Fig. 1). Login to comment
91 The average PhA-associated fluorescence in non-induced HEK293-Tet-On cells transiently transfected with the various ABCG2 variants was not significantly different as compared with that observed in HEK293-Tet-On cells transfected with ABCG2 wild-type (wild-type (100 &#b1; 12.1%), V12M (106.7 &#b1; 2.0%), Q141K (97.1 &#b1; 9.3%), S248P (99.1 &#b1; 9.8%), F431L (104.7% &#b1; 10.9%), R482G A B C D Fig. 2. Login to comment
100 However, basal PhA efflux was significantly lower in HEK293- Tet-On cells transfected with the ABCG2 variants S248P (44.2 &#b1; 2.8%; P < 0.01 vs. doxycycline-induced ABCG2 wild-type), F431L (28.4 &#b1; 3.1%; P < 0.01 vs. doxycycline-induced ABCG2 wild-type), and F489L (20.9 &#b1; 2.0%; P < 0.05 vs. doxycycline-induced ABCG2 wild-type), demonstrating that these mutations significantly reduce ABCG2-mediated PhA transport in HEK293-Tet-On cells. Login to comment
104 Inhibitory efficacy of telmisartan was not altered by the ABCG2 polymorphisms V12M and Q141K but tended to be lower in the ABCG2 variants S248P and F431L (Fig. 4A and C). Login to comment
128 Moreover, ABCG2 variants S248P and F431L displayed a significantly reduced PhA transport, although protein expression was similar to that of ABCG2 wild-type. Login to comment
129 These findings are partly in concordance with data from further groups demonstrating an impaired PhA transport in Sf9 membrane vesicles containing the S248P variant [19]. Login to comment

[hide] Structure and function of BCRP, a broad specificit... Arch Toxicol. 2014 Jun;88(6):1205-48. doi: 10.1007/s00204-014-1224-8. Epub 2014 Apr 29. Jani M, Ambrus C, Magnan R, Jakab KT, Beery E, Zolnerciks JK, Krajcsi P
Structure and function of BCRP, a broad specificity transporter of xenobiotics and endobiotics.
Arch Toxicol. 2014 Jun;88(6):1205-48. doi: 10.1007/s00204-014-1224-8. Epub 2014 Apr 29., [PMID:24777822]

Abstract [show]
The discovery and characterization of breast cancer resistance protein (BCRP) as an efflux transporter conferring multidrug resistance has set off a remarkable trajectory in the understanding of its role in physiology and disease. While the relevance in drug resistance and general pharmacokinetic properties quickly became apparent, the lack of a characteristic phenotype in genetically impaired animals and humans cast doubt on the physiological importance of this ATP-binding cassette family member, similarly to fellow multidrug transporters, despite well-known endogenous substrates. Later, high-performance genetic analyses and fine resolution tissue expression data forayed into unexpected territories concerning BCRP relevance, and ultimately, the rise of quantitative proteomics allows putting observed interactions into absolute frameworks for modeling and insight into interindividual and species differences. This overview summarizes existing knowledge on the BCRP transporter on molecular, tissue and system level, both in physiology and disease, and describes a selection of experimental procedures that are the most widely applied for the identification and characterization of substrate and inhibitor-type interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 Histone deacetylase inhibitors rescue newly synthesized transporter proteins and prevent aggresome targeting by disturbing TableÊf;1ߒߙMajor non-synonymous single-nucleotide polymorphisms found in the ABCG2 coding region Allele frequencies presented in this table do not reflect interethnic differences Mutation Position in BCRP Cellular effects of SNP Allele frequency % References 34G>A, V12M (rs2231137) N-terminus Lower expression, no impact on function 0-29.8 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 151G>T, G51C N-terminus Slightly overexpressed, decreased transport activity 0.1 Tamura et al. (2006), Yoshioka et al. (2007) 376C>T, Q126X (rs7255271) NBD No expression, no activity 0-1.7 Tamura et al. (2006), Mizuarai et al. (2004), Itoda et al. (2003), Imai et al. (2002), Kobayashi et al. (2005), Kondo et al. (2004) 421C>A, Q141K (rs2231142) NBD Lower expression, decreased transport activity, substrate specificity altered 0-35.7 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 458C>T, T153 M NBD Slightly lower expression, no impact on function 3.3 Tamura et al. (2006), Mizuarai et al. (2004) 479G>A, R160Q NBD Not determined 0.5 Bosch et al. (2005), Tamura et al. (2006) 496C>G, Q166E (rs1061017) NBD Slightly lower expression, no impact on function 0-1.1 Tamura et al. (2006), Kondo et al. (2004), Yoshioka et al. (2007) 616A>C, I206L (rs12721643) NBD Well expressed, decreased transport activity 0-10.0 Tamura et al. (2006), Zamber et al. (2003), Vethanayagam et al. (2005), Ieiri (2012a) 623T>C, F208 (rs1061018) NBD No expression, no transport activity 0.9-3.9 Tamura et al. (2006) 742T>C, S248P (rs3116448) NBD Well expressed, no transport activity 0.5 Tamura et al. (2006), Yoshioka et al. (2007) 1000G>T, E334X (rs3201997) NBD No expression, no transport activity Not determined Tamura et al. (2006), Ishikawa et al. (2005) 1291T>C F431L ECL1 Lower expression, substrate specificity altered 0.6-0.8 Tamura et al. (2006), Itoda et al. (2003), Yoshioka et al. (2007) 1322G>A, S441 N ECL1 Slightly lower expression, no transport activity 0.5 Tamura et al. (2006), Kobayashi et al. (2005), Kondo et al. (2004) 1465T>C, F489L TM3 Slightly lower expression, no transport activity 0.5-0.8 Tamura et al. (2006), Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F506S TM4 Not determined 0.5 Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F507L 1515delC, V508L 1515delC, M509X 1711T>A, F571I (rs9282571) TM5 Well expressed, substrate specificity altered 0.5 Tamura et al. (2006) 1723C>T, R575X TM5 Not determined 0.5 Tamura et al. (2006) 1768A>T, N590Y (rs34264773) ECL3 Slightly overexpressed, substrate specificity altered 0-9.7 Tamura et al. (2006), Mizuarai et al. (2004), Zamber et al. (2003), Vethanayagam et al. (2005) 1858G>A, D620 N (rs34783571) ECL3 Slightly overexpressed, substrate specificity altered 0-11.1 Tamura et al. (2006), Bosch et al. (2005), Honjo et al. (2002), Vethanayagam et al. (2005) the trafficking along microtubules (Basseville et al. 2012). Login to comment

[hide] Determinants of the activity and substrate recogni... Drug Metab Rev. 2014 Nov;46(4):459-74. doi: 10.3109/03602532.2014.942037. Epub 2014 Jul 18. Szafraniec MJ, Szczygiel M, Urbanska K, Fiedor L
Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2).
Drug Metab Rev. 2014 Nov;46(4):459-74. doi: 10.3109/03602532.2014.942037. Epub 2014 Jul 18., [PMID:25036722]

Abstract [show]
The xenobiotic transporters are among the most important constituents of detoxification system in living organisms. Breast cancer resistance protein (BCRP/ABCG2) is one of the major transporters involved in the efflux of xenobiotics. To understand its role in chemotherapeutic and multidrug resistance, it is crucial to establish the determinants of its substrate specificity, which obviously is of high relevance for successful therapy of many diseases. This article summarizes the current knowledge about the substrate preferences of BCRP. We overview the factors which determine its activity, inhibition and substrate recognition, focusing on the structural features of the transporter. BCRP substrate specificity is quite low as it interacts with a spectrum of substances with only a few common features: hydrophobic and aromatic regions, possibly a flat conformation and the metal ion-, oxygen- and nitrogen-containing functionalities, most of which may be the donors/acceptors of H-bonds. Several amino acid residues and structural motifs are responsible for BCRP activity and substrate recognition. Thus, the active form of BCRP, at least a dimer or a larger oligomer is maintained by intramolecular disulfide bridge that involves Cys(603) residues. The GXXXG motif in transmembrane helix 1, Cys residues, Arg(482) and Lys(86) are responsible for maintaining the protein structure, which confers transport activity, and the His(457) or Arg(456) residues are directly involved in substrate binding. Arg(482) does not directly bind substrates, but electrostatically interacts with charged molecules, which initiates the conformational changes that transmit the signal from the transmembrane regions to the ABC domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
201 To elucidate the significance of this polymorphism for porphyrin transport, a set of 18 variants of BCRP (Val12 Met, Gly51 Cys, Gln126 stop, Gln141 Lys, Thr153 Met, Gln166 Glu, Ile206 Leu, Phe208 Ser, Ser248 Pro, Glu334 stop, Phe431 Leu, Ser441 Asn, Arg482 Gly, Arg482 Thr, Phe489 Leu, Phe571 Ile, Asn590 Tyr and Asp620 Asn) have been expressed in insect cells. Login to comment