ABCMdb

ABCG2 p.Phe208Ser

Predicted by SNAP2:	A: D (85%), C: D (85%), D: D (95%), E: D (95%), G: D (95%), H: D (95%), I: D (80%), K: D (95%), L: D (85%), M: D (80%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (91%), T: D (91%), V: D (85%), W: D (95%), Y: D (91%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Natural allelic variants of breast cancer resistan... Pharmacogenetics. 2003 Jan;13(1):19-28. Zamber CP, Lamba JK, Yasuda K, Farnum J, Thummel K, Schuetz JD, Schuetz EG
Natural allelic variants of breast cancer resistance protein (BCRP) and their relationship to BCRP expression in human intestine.
Pharmacogenetics. 2003 Jan;13(1):19-28., [PMID:12544509]

Abstract [show]
The aim of this study was to identify the extent of genetic variability in breast cancer resistance protein (BCRP) in humans. We first analysed the sequence of BCRP cDNA from human livers and from human intestines phenotyped for expression of intestinal BCRP. We then determined the frequency of all known coding single nucleotide polymorphisms (cSNPs) using DNA from individuals representing 11 different ethnic populations. Nine SNPs including four non-synonymous and three synonymous cSNPs and two intronic SNPs were identified. Of the missense mutations, exon 2 SNP (G34A) resulted in a V12M change; exon 5 SNP (C421A) resulted in a Q141K substitution; exon 6 SNP (A616C) resulted in an I206L amino acid substitution; and exon 15 SNP (A1768T) resulted in a N590Y change in the BCRP protein. The two most frequent polymorphisms identified in the human population studied were the G34A and C421A transitions. There was marked variation in BCRP genotypes and allele frequencies in the different populations. BCRP mRNA was phenotyped in human small bowel intestinal samples by real-time polymerase chain reaction and BCRP protein was analysed on immunoblots of tissue from the same individuals. There was a 78-fold variation in expression of BCRP mRNA and significant variation in BCRP protein expression in human intestine. Expression of intestinal BCRP mRNA and protein was not different between persons expressing the common Gln141 allele compared to the Lys141 allele. Thus, common natural allelic variants of BCRP have been identified, and did not influence interindividual variation in expression of BCRP mRNA in human intestine, but remain to be tested for their effect on BCRP function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 Unauthorized reproduction of this article is prohibited. G34A V12M Exon 2 C71T1 A24V Exon 2 623C1 F208S Exon 6 A616C I206L Exon 6 C496G1 Q166E Exon 5 C421A Q141K Exon 5 A1444G2 R482G Exon 12 G1445C3 R482T Exon 12 A1768T N590Y Exon 15 Walker A motif: amino acids 80-89 Walker B motif: amino acids 206-210 SNPs found in human samples in this study Reported in ABCP1 Drug selected variants, MXR2 and BCRP3 MXR BCRP Fig. 1 BCRP protein topology and the positions of the identified SNPs resulting in missense mutations. Login to comment

[hide] Irinotecan pathway genotype analysis to predict ph... Clin Cancer Res. 2003 Aug 15;9(9):3246-53. Mathijssen RH, Marsh S, Karlsson MO, Xie R, Baker SD, Verweij J, Sparreboom A, McLeod HL
Irinotecan pathway genotype analysis to predict pharmacokinetics.
Clin Cancer Res. 2003 Aug 15;9(9):3246-53., 2003-08-15 [PMID:12960109]

Abstract [show]
PURPOSE: The purpose was to explore the relationships between irinotecan disposition and allelic variants of genes coding for adenosine triphosphate binding cassette transporters and enzymes of putative relevance for irinotecan. EXPERIMENTAL DESIGN: Irinotecan was administered to 65 cancer patients as a 90-min infusion (dose, 200-350 mg/m(2)), and pharmacokinetic data were obtained during the first cycle. All patients were genotyped for variants in genes encoding MDR1 P-glycoprotein (ABCB1), multidrug resistance-associated proteins MRP-1 (ABCC1) and MRP-2 (canalicular multispecific organic anion transporter; ABCC2), breast cancer resistance protein (ABCG2), carboxylesterases (CES1, CES2), cytochrome p450 isozymes (CYP3A4, CYP3A5), UDP glucuronosyltransferase (UGT1A1), and a DNA-repair enzyme (XRCC1), which was included as a nonmechanistic control. RESULTS: Eighteen genetic variants were found in nine genes of putative importance for irinotecan disposition. The homozygous T allele of the ABCB1 1236C>T polymorphism was associated with significantly increased exposure to irinotecan (P = 0.038) and its active metabolite SN-38 (P = 0.031). Pharmacokinetic parameters were not related to any of the other multiple variant genotypes, possibly because of the low allele frequency. The extent of SN-38 glucuronidation was slightly impaired in homozygous variants of UGT1A1*28, although differences were not statistically significant (P = 0.22). CONCLUSIONS: It is concluded that genotyping for ABCB1 1236C>T may be one of the factors assisting with dose optimization of irinotecan chemotherapy in cancer patients. Additional investigation is required to confirm these findings in a larger population and to assess relationships between irinotecan disposition and the rare variant genotypes, especially in other ethnic groups.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
132 Table 4 Genotype and Allele frequencies for the studied genes Polymorphisma Nomenclature Descriptionb Genotype frequenciesc Allele frequencies (95% CI)d Wt Het Var p q r ABCB1 1236 CϾT n/ae G411G 23 15 8 0.66 (0.52-0.78) 0.34 (0.22-0.48) ABCB1 3435 CϾT n/a E1143E 16 35 8 0.57 (0.44-0.69) 0.43 (0.31-0.56) ABCB1 2677 GϾT/A n/a A893S or T 12 23/4 13/1 0.48 (0.35-0.61) 0.47 (0.34-0.60) 0.05 (0.02-0.14) ABCC1 14008 GϾA n/a intron 27 32 27 5 0.71 (0.59-0.81) 0.29 (0.19-0.41) ABCC1 462 CϾT n/a P154P 65 0 0 1.00 0.00 ABCC1 34215 CϾG n/a intron 18 0 20 40 0.17 (0.1-0.28) 0.83 (0.72-0.90) ABCC2 156231 AϾG n/a intron 3 65 0 0 1.00 0.00 ABCG2 623TϾC n/a F208S 63 0 0 1.00 0.00 CES1 1440 AϾT n/a L480F 64 0 0 1.00 0.00 CES1 1525 AϾC n/a N509H 60 1 0 0.99 (0.92-1) 0.01 (0-0.08) CES2 1647 CϾT n/a L549L 56 1 0 0.99 (0.92-1) 0.01 (0-0.08) CYP3A4 -392 AϾG CYP3A4*1B Promoter 46 3 0 0.97 (0.88-0.99) 0.03 (0.01-0.12) CYP3A4 15713 TϾC CYP3A4*2 S222P 39 0 0 1.00 0.00 CYP3A4 23172 TϾC CYP3A4*3 M445T 62 2 0 0.98 (0.91-1) 0.02 (0-0.09) CYP3A5 22893 GϾA CYP3A5*3C Splice variant 56 8 0 0.94 (0.85-0.98) 0.06 (0.02-0.15) CYP3A5 30597 GϾA CYP3A5*6 Splice variant 63 0 0 1.00 0.00 UGT1A1 (TA)n f UGT1A1*28 Promoter 34 22 2 0.78 (0.66-0.87) 0.22 (0.13-0.34) UGT1A1 1456 TϾG UGT1A1*7 Y486D 62 0 0 1.00 0.00 XRCC1 26304 CϾT n/a R194W 35 8 0 0.91 (0.79-0.96) 0.09 (0.04-0.21) XRCC1 27466 GϾA n/a R280H 60 2 0 0.98 (0.91-1) 0.02 (0-0.09) XRCC1 28152 GϾA n/a R399Q 25 27 5 0.68 (0.55-0.79) 0.32 (0.21-0.45) a Number represents position in nucleotide sequence. Login to comment
136 Table 4 Genotype and Allele frequencies for the studied genes Polymorphisma Nomenclature Descriptionb Genotype frequenciesc Allele frequencies (95% CI)d Wt Het Var p q r ABCB1 1236 CϾT n/ae G411G 23 15 8 0.66 (0.52-0.78) 0.34 (0.22-0.48) ABCB1 3435 CϾT n/a E1143E 16 35 8 0.57 (0.44-0.69) 0.43 (0.31-0.56) ABCB1 2677 GϾT/A n/a A893S or T 12 23/4 13/1 0.48 (0.35-0.61) 0.47 (0.34-0.60) 0.05 (0.02-0.14) ABCC1 14008 GϾA n/a intron 27 32 27 5 0.71 (0.59-0.81) 0.29 (0.19-0.41) ABCC1 462 CϾT n/a P154P 65 0 0 1.00 0.00 ABCC1 34215 CϾG n/a intron 18 0 20 40 0.17 (0.1-0.28) 0.83 (0.72-0.90) ABCC2 156231 AϾG n/a intron 3 65 0 0 1.00 0.00 ABCG2 623TϾC n/a F208S 63 0 0 1.00 0.00 CES1 1440 AϾT n/a L480F 64 0 0 1.00 0.00 CES1 1525 AϾC n/a N509H 60 1 0 0.99 (0.92-1) 0.01 (0-0.08) CES2 1647 CϾT n/a L549L 56 1 0 0.99 (0.92-1) 0.01 (0-0.08) CYP3A4 -392 AϾG CYP3A4*1B Promoter 46 3 0 0.97 (0.88-0.99) 0.03 (0.01-0.12) CYP3A4 15713 TϾC CYP3A4*2 S222P 39 0 0 1.00 0.00 CYP3A4 23172 TϾC CYP3A4*3 M445T 62 2 0 0.98 (0.91-1) 0.02 (0-0.09) CYP3A5 22893 GϾA CYP3A5*3C Splice variant 56 8 0 0.94 (0.85-0.98) 0.06 (0.02-0.15) CYP3A5 30597 GϾA CYP3A5*6 Splice variant 63 0 0 1.00 0.00 UGT1A1 (TA)n f UGT1A1*28 Promoter 34 22 2 0.78 (0.66-0.87) 0.22 (0.13-0.34) UGT1A1 1456 TϾG UGT1A1*7 Y486D 62 0 0 1.00 0.00 XRCC1 26304 CϾT n/a R194W 35 8 0 0.91 (0.79-0.96) 0.09 (0.04-0.21) XRCC1 27466 GϾA n/a R280H 60 2 0 0.98 (0.91-1) 0.02 (0-0.09) XRCC1 28152 GϾA n/a R399Q 25 27 5 0.68 (0.55-0.79) 0.32 (0.21-0.45) a Number represents position in nucleotide sequence. Login to comment

[hide] Mechanisms of resistance to anticancer drugs: the ... Pharmacogenomics. 2005 Mar;6(2):115-38. Lepper ER, Nooter K, Verweij J, Acharya MR, Figg WD, Sparreboom A
Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2.
Pharmacogenomics. 2005 Mar;6(2):115-38., [PMID:15882131]

Abstract [show]
ATP-binding cassette (ABC) genes play a role in the resistance of malignant cells to anticancer agents. The ABC gene products, including ABCB1 (P-glycoprotein) and ABCG2 (breast cancer-resistance protein [BCRP], mitoxantrone-resistance protein [MXR], or ABC transporter in placenta [ABCP]), are also known to influence oral absorption and disposition of a wide variety of drugs. As a result, the expression levels of these proteins in humans have important consequences for an individual's susceptibility to certain drug-induced side effects, interactions, and treatment efficacy. Naturally occurring variants in ABC transporter genes have been identified that might affect the function and expression of the protein. This review focuses on recent advances in the pharmacogenetics of the ABC transporters ABCB1 and ABCG2, and discusses potential implications of genetic variants for the chemotherapeutic treatment of cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
157 Position in gene* Nucleotide‡ Region Wild-type allele Variant allele Amino acid Change -19572 to -19569 5`-Flanking region CTCA - CTCA deletion -19202 5` UTR G C -18845 5` UTR T C -18604 5` UTR A - Deletion -18482 -113 Exon 1 C T Non-coding -18398 -29 Exon 1 A G Non-coding 34 34 Exon 2 G A 12 Val to Met 71 71 Exon 2 C T 24 Ala to Val 114 114 Exon 2 T C 38 Synonymous 239 Intron 2 A G 7268 Intron 2 T C 7420 Intron 3 - T Insertion 8007 Intron 3 G A 8184 369 Exon 4 C T 123 Synonymous 8191 376 Exon 4 C T 126 Gln to Term 8825 421 Exon 5 C A 141 Gln to Lys 8862 458 Exon 5 C T 153 Thr to Met 8878 474 Exon 5 C T 158 Synonymous 8900 496 Exon 5 C G 166 Gln to Glu 18186 Intron 5 A G 18286 616 Exon 6 A C 206 Ile to Leu 18293 623 Exon 6 T C 208 Phe to Ser 21530 Intron 6 C T 21718 Intron 6 A G 21903 Intron 7 A G 24618 Intron 7 T A 26297 1098 Exon 9 G A 366 Synonymous 38389 1291 Exon 11 T C 431 Phe to Leu 38485 Intron 11 A G 40111 Intron 11 G A 40303 1425 Exon 12 A G 475 Synonymous 40322 1444 Exon 12 A G 482 Arg to Gly 40323 1445 Exon 12 G C 482 Arg to Thr 40343 1465 Exon 12 T C 489 Phe to Leu 40419 Intron 12 G T 42314 Intron 13 T G 44997 Intron 14 A G 45022 Intron 14 C T 45073 1768 Exon 15 A T 590 Asn to Tyr 47355 1858 Exon 16 G A 620 Asp to Asn 47734 2237 Exon 16 G T Non-coding 47890 2393 Exon 16 G T Non-coding 47891 2394 Exon 16 C A Non-coding ABC: ATP-binding cassette; UTR: Untranslated region. Login to comment

[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins. Login to comment

[hide] Functional SNPs of the breast cancer resistance pr... Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21. Yanase K, Tsukahara S, Mitsuhashi J, Sugimoto Y
Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development.
Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21., 2006-03-08 [PMID:16303243]

Abstract [show]
Breast cancer resistance protein (BCRP) is a half-molecule ATP-binding cassette transporter that pumps out various anticancer agents such as 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. We have previously identified three polymorphisms within the BCRP gene, G34A (substituting Met for Val-12), C376T (substituting a stop codon for Gln-126) and C421A (substituting Lys for Gln-141). C421A BCRP-transfected murine fibroblast PA317 cells showed markedly decreased protein expression and low-level drug resistance when compared with wild-type BCRP-transfected cells. In contrast, G34A BCRP-transfected PA317 cells showed a similar protein expression and drug resistance profile to wild-type. The C376T polymorphism would be expected to have a considerable impact as active BCRP protein will not be expressed from a T376 allele. Hence, people with C376T and/or C421A polymorphisms may express low levels of BCRP, resulting in hypersensitivity of normal cells to BCRP-substrate anticancer agents. Estrogens, estrone and 17beta-estradiol, were previously found to restore drug sensitivity levels in BCRP-transduced cells by increasing the cellular accumulation of anticancer agents. BCRP transports sulfated estrogens but not free estrogens and in a series of screening experiments for synthesized and natural estrogenic compounds, several tamoxifen derivatives and phytoestrogens/flavonoids were identified that effectively circumvent BCRP-mediated drug resistance. The kinase inhibitors gefitinib and imatinib mesylate also interact with BCRP. Gefitinib, an inhibitor of epidermal growth factor receptor-tyrosine kinase, inhibits its transporter function and reverses BCRP-mediated drug resistance both in vitro and in vivo. BCRP-transfected human epidermoid carcinoma A431 cells and BCRP-transfected human non-small cell lung cancer PC-9 cells show gefitinib resistance. Imatinib, an inhibitor of BCR-ABL tyrosine kinase, also inhibits BCRP-mediated drug transport. Hence, both functional SNPs and inhibitors of BCRP reduce its transporter function and thus modulate substrate pharmacokinetics and pharmacodynamics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

[hide] The role of the human ABCG2 multidrug transporter ... Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7. Cervenak J, Andrikovics H, Ozvegy-Laczka C, Tordai A, Nemet K, Varadi A, Sarkadi B
The role of the human ABCG2 multidrug transporter and its variants in cancer therapy and toxicology.
Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7., 2006-03-08 [PMID:16337740]

Abstract [show]
The human multidrug resistance ABC transporters provide a protective function in our body against a large number of toxic compounds. These proteins, residing in the plasma membrane, perform an active, ATP-dependent extrusion of such xenobiotics. However, the same proteins are also used by the tumor cells to fight various anticancer agents. ABCG2 is an important member of the multidrug resistance proteins, an 'ABC half transporter', which functions as a homodimer in the cell membrane. In this review, we provide a basic overview of ABCG2 function in physiology and drug metabolism, but concentrate on the discussion of mutations and polymorphisms discovered in this protein. Interestingly, a single nucleotide mutation, changing amino acid 482 from arginine to threonine or glycine in ABCG2, results in a major increase in the catalytic activity and a wider drug recognition by this protein. Still, this mutation proved to be an in vitro artifact, produced only in heavily drug-selected cell lines. In contrast, at least two, but possibly more polymorphic variants of ABCG2 were found to be present in large human populations with different ethnic background. However, currently available experimental data regarding the cellular expression, localization and function of these ABCG2 variants are strongly contradictory. Since, the proteins produced by these variant alleles may differently modulate cancer treatment, general drug absorption and toxicity, may represent risk factors in fetal toxicity, or alter the differentiation of stem cells, their exact characterization is a major challenge in this field.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 According to the first cloning studies, the ABCG2 cDNA obtained from normal human placenta [8] showed the following sequence alterations, as compared to the database reference sequence: c.71COT (A24V), c.496COG (Q166E) and c.623TOC (F208S). Login to comment

[hide] Functional validation of the genetic polymorphisms... Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11. Tamura A, Watanabe M, Saito H, Nakagawa H, Kamachi T, Okura I, Ishikawa T
Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport.
Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11., [PMID:16608919]

Abstract [show]
The ATP-binding cassette (ABC) transporter ABCG2 has been implicated to play a significant role in the response of patients to medication and/or the risk of diseases. To clarify the possible physiological or pathological relevance of ABCG2 polymorphisms, we have functionally validated single nucleotide polymorphisms (SNP) of ABCG2. In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Because porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the porphyrin transport activity of those variant forms in vitro. We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Furthermore, Flp-In-293 cells expressing those variants were photosensitive. Thus, among those genetic polymorphisms of ABCG2, at least the hitherto validated alleles of Q126stop, S441N, and F489L are suggested to be of clinical importance related to the potential risk of porphyria.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
4 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Login to comment
36 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins, suggesting that those genetic polymorphisms in the ABCG2 gene may be related to the risk of certain diseases resulting from disruption of porphyrin homeostasis. Login to comment
82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan). Login to comment
144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis. Login to comment
149 In addition, the expression level of F208S was found to be extremely low. Login to comment
164 It is important to note that the variants Q126stop, F208S, S248P, E334stop, and S441N substantially lack transport activity for both hematoporphyrin and methotrexate. Login to comment
177 as the variants F208S, S248P, S441N, F431L, and F489L were expressed in Flp-In 293 cells. Login to comment
180 Similar results were observed with the variants of F208S and S248P (data not shown). Login to comment
214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
215 We provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin (Fig. 5). Login to comment
217 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a. Thus, it is likely that humans with these alleles may be more susceptible to porphyrin-induced phototoxicity. Login to comment
224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein. Login to comment
235 In contrast, F208S, S248P and E334stop alleles are registered in the National Center for Biotechnology Information dbSNP database, but their allele frequencies are not available. Login to comment
236 The most recent version of National Center for Biotechnology Information dbSNP does not seem to have validation for Q166E, F208S, S248P, and E334stop (Table 2) as bona fide SNPs. Login to comment
237 Thus, the clinical significance of F208S, S248P and E334stop alleles in porphyrin-induced phototoxicity remains to be elucidated. Login to comment

[hide] Human ABC transporter ABCG2 in xenobiotic protecti... Drug Metab Rev. 2006;38(3):371-91. Wakabayashi K, Tamura A, Saito H, Onishi Y, Ishikawa T
Human ABC transporter ABCG2 in xenobiotic protection and redox biology.
Drug Metab Rev. 2006;38(3):371-91., [PMID:16877258]

Abstract [show]
Human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR/ABCP) is regarded as a member of the phase III system of xenobiotic metabolism. This efflux pump is suggested to be responsible for protecting the body from toxic xenobiotics and for removing toxic metabolites. The aim of this review article is to address new aspects of ABCG2 related to redox biology, namely the posttranslational modification (intra- and intermolecular disulfide bond formation) of ABCG2 protein and the transport of porphyrin and chlorophyll metabolites, as well as the high-speed screening and QSAR analysis method to evaluate ABCG2-drug interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells. Login to comment
177 The variants Q126stop, F208S, S248P, E334stop, and S441N were found to be defective in the transport of hematoporphyrin (Tamura et al., 2006) (Table 2). Login to comment
179 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when those cells were treated with pheophorbide a (Tamura et al., 2006). Login to comment

[hide] Human multidrug resistance ABCB and ABCG transport... Physiol Rev. 2006 Oct;86(4):1179-236. Sarkadi B, Homolya L, Szakacs G, Varadi A
Human multidrug resistance ABCB and ABCG transporters: participation in a chemoimmunity defense system.
Physiol Rev. 2006 Oct;86(4):1179-236., [PMID:17015488]

Abstract [show]
In this review we give an overview of the physiological functions of a group of ATP binding cassette (ABC) transporter proteins, which were discovered, and still referred to, as multidrug resistance (MDR) transporters. Although they indeed play an important role in cancer drug resistance, their major physiological function is to provide general protection against hydrophobic xenobiotics. With a highly conserved structure, membrane topology, and mechanism of action, these essential transporters are preserved throughout all living systems, from bacteria to human. We describe the general structural and mechanistic features of the human MDR-ABC transporters and introduce some of the basic methods that can be applied for the analysis of their expression, function, regulation, and modulation. We treat in detail the biochemistry, cell biology, and physiology of the ABCB1 (MDR1/P-glycoprotein) and the ABCG2 (MXR/BCRP) proteins and describe emerging information related to additional ABCB- and ABCG-type transporters with a potential role in drug and xenobiotic resistance. Throughout this review we demonstrate and emphasize the general network characteristics of the MDR-ABC transporters, functioning at the cellular and physiological tissue barriers. In addition, we suggest that multidrug transporters are essential parts of an innate defense system, the "chemoimmunity" network, which has a number of features reminiscent of classical immunology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
827 In the first cloning of the ABCG2 cDNA from human placenta (8), several sequence alterations causing amino acid changes, including A24V, Q166E, and F208S, were recorded, compared with the database reference sequence. Login to comment

[hide] Genetic polymorphisms of human ABC transporter ABC... J Exp Ther Oncol. 2006;6(1):1-11. Tamura A, Wakabayashi K, Onishi Y, Nakagawa H, Tsuji M, Matsuda Y, Ishikawa T
Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system.
J Exp Ther Oncol. 2006;6(1):1-11., [PMID:17228519]

Abstract [show]
The vector-mediated introduction of cDNA into mammalian cells by calcium phosphate co-precipitation or permeation with lipofectamine is widely used for the integration of cDNA into genomic DNA. However, integration of cDNA into the host's chromosomal DNA occurs randomly at unpredictable sites, and the number of integrated recombinant DNAs is not controllable. To investigate the effect of genetic polymorphisms of ABCG2 on the protein expression and the drug resistance profile, we developed the Flp-In method to integrate one single copy of ABCG2 variant-cDNA into FRT-tagged genomic DNA. More than 20 metaphase spreads were examined for both fluorescence in situ hybridization (FISH) mapping and multicolor-FISH analysis, and it has been revealed that ABCG2 cDNA was incorporated into the telomeric region of the short arm on one of chromosomes 12 in Flp-In-293 cells. Based on the currently available SNP data for human ABCG2, we have created a total of seven variants by site-directed mutagenesis and stably expressed them in Flp-In-293 cells. While mRNAs of those integrated ABCG2 variants and wild type were evenly expressed in Flp-In-293 cells, the protein expression levels of F208S and S441N variants were found to be markedly low. It is suggested that the protein instability due to enhanced degradation resulted in the low levels of their protein expression. Thus, the Flp recombinase system would provide a useful tool to validate the effect of nonsynonymous SNPs on the protein stability and post-translational modification of ABCG2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 While mRNAs of those integrated ABCG2 variants and wild type were evenly expressed in Flp-In-293 cells, the protein expression levels of F208S and S441N variants were found to be markedly low. Login to comment
48 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 3 Plasma Membrane inside outside S S S homodimer A B CH2N COOH V12M Q141K F208S S248P F431L S441N F489L R482G R482T Acquired mutation Figure 1. Login to comment
67 PCR primers and conditions for site-directed mutagenesis to create variants of ABCG2 Variant Forward/Reverse Primer sequence (5` →→ 3`) Primer length % GC Tm (ºC) (F/R) primers (bases) V12M F CGAAGTTTTTATCCCAATGTCACAAGGAAACAC 33 39 55 R GTGTTTCCTTGTGACATTGGGATAAAAACTTCG Q141K F CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT 35 42 55 R AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG F208S F TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA 35 45 55 R TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P F TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT 35 40 55 R AAACAACTTGAAGATGGGATATCGAGGCTGATGAA F431L F AGCTGGGGTTCTCCTCTTCCTGACGACC 28 60 62 R GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N F AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC 34 47 59 R GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L F GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG 46 34 62 R CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC Sites of mutagenesis are indicated by underbars. Login to comment
104 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 0 1 2 RelativemRNAlevel Mock WT V12M Q141K mRNA A ABCG2 GAPDH Mock WT F208S S248P F431L S441N F489L ABCG2 GAPDH 0 1 2 RelativemRNAlevel mRNA B GAPDH ABCG2 Mock WT F208S S248P F431L S441N F489L Protein 0 1 2 Relativeproteinlevel * * * C DProtein GAPDH ABCG2 0 1 2 Relativeproteinlevel * * Mock WT V12M Q141K Figure 3. mRNA and protein expression levels of ABCG2 WT and variants expressed in Flp-In-293 cells. Login to comment
114 Characterization of V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells The mRNA levels of ABCG2 and GAPDH were measured by quantitative PCR, and the ratios of ABCG2 variants vs. GAPDH were plotted. Login to comment
119 Figure 3 demonstrates mRNA and protein levels of ABCG2 WT and V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells. Login to comment
122 Interestingly, expression levels of the F208S and S441N variants were markedly low (Fig. 3D). Login to comment
123 The immunofluorescence images of Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells revealed that those variant proteins were not expressed in the plasma membrane (data not shown). Login to comment
126 In fact, when Flp-In-293/ABCG2 (F208S) cells were treated with MG132, a proteasome inhibitor, the protein level recovered up to about 50% of the WT level, suggesting the involvement of proteasomes in degradation of the F208S variant (data not shown). Login to comment
132 Figure 4 summarizes the characteristics of those Tamura et al. 8 Journal of Experimental Therapeutics and Oncology Vol. 6 2006 Class Class Class Class WT V12M Q141K F431L S248P F489L F208S S441N R482G R482T Protein expression + + + + + + - - + + SN-38 resistance + + + + + / - - - - + + MX resistance + + + + / - - - - - + + Doxorubicin resistance - - - - - - - - + + Daunorubicin resistance - - - - - - - - + + Figure 4. Login to comment
140 Both F208S and S441N belong to the third class where protein expression levels were extremely low (Fig. 3D). Login to comment
143 Resistance profile (IC50 ) of ABCG2 Compounds IC50 (nM) Mock WT V12M Q141K F208S S248P F431L S441N F489L SN-38 1.0 ± 0.2 49.9 ± 6.0 51.1 ± 13.8 17.7 ± 0.9 0.7 ± 0.0 3.6 ± 0.4 12.1 ± 1.5 0.8 ± 0.0 3.9 ± 0.4 (49.9)* (51.1)* (17.7)* (0.7) (3.6) (12.1)* (0.8) (3.9) Mitoxantorone 7.0 ± 1.1 108.0 ± 4.9 94.0 ± 18.6 46.7 ± 12.7 5.1 ± 1.0 13.4 ± 1.3 15.2 ± 1.4 5.7 ± 0.8 12.1 ± 6.2 (15.4)* (13.4)* (6.7)* (0.7) (1.9) (2.2)* (0.8) (1.7) Doxorubicin 38.8 ± 3.8 105.2 ± 24.9 123.6 ± 35.3 156.8 ± 27.5 19.9 ± 8.7 23.7 ± 6.7 43.5 ± 6.1 39.4 ± 4.1 47.6 ± 3.1 (2.7) (3.2) (4.0) (0.5) (0.6) (1.1) (1.0) (1.2) Daounorubicin 13.0 ± 0.6 32.3 ± 6.5 58.2 ± 5.0 57.7 ± 4.1 14.1 ± 2.3 22.1 ± 4.2 15.9 ± 1.2 13.3 ± 1.1 23.6 ± 1.6 (2.5) (4.5) (4.4) (1.1) (1.7) (1.2) (1.0) (1.8) Etoposide 117.1 ± 16.0 210.2 ± 18.4 297.3 ± 58.5 233.9 ± 54.2 122.9 ± 17.6 137.7 ± 14.8 139.1 ± 12.3 154.3 ± 8.5 186.9 ± 10.1 (1.8) (2.5) (2.0) (1.0) (1.2) (1.2) (1.3) (1.6) Vincristine 1.8 ± 0.2 4.3 ± 0.3 7.1 ± 1.4 5.6 ± 1.6 0.6 ± 0.0 4.3 ± 0.9 1.8 ± 0.3 0.9 ± 0.1 3.0 ± 0.7 (2.4) (3.0) (3.1) (0.3) (2.4) (1.0) (0.5) (1.7) The drug resistance profiles of ABCG2 WT and variants were obtained by incubating Flp-In-293/ABCG2 WT, V12M, Q141K, F208S, S248P, F431L, S441N, or F489L cells in the presence of SN-38, mitoxantrone, doxorubicin, daunorubicin, etoposide, or vincristine at different concentrations as described in Materials and Methods. Login to comment

[hide] Re-evaluation and functional classification of non... Cancer Sci. 2007 Feb;98(2):231-9. Tamura A, Wakabayashi K, Onishi Y, Takeda M, Ikegami Y, Sawada S, Tsuji M, Matsuda Y, Ishikawa T
Re-evaluation and functional classification of non-synonymous single nucleotide polymorphisms of the human ATP-binding cassette transporter ABCG2.
Cancer Sci. 2007 Feb;98(2):231-9., [PMID:17297656]

Abstract [show]
Impacts of genetic polymorphisms of the ATP-binding cassette (ABC) transporter BCRP/MXR1/ABCP (ABCG2) on drug response have been implicated; however, the hitherto reported data involve some inconsistencies. To re-evaluate the effect of single nucleotide polymorphisms (SNP) of ABCG2 in vitro, we created a total of seven variant cDNAs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) by site-directed mutagenesis and stably expressed each of them in Flp-In-293 cells using the Flp recombinase system. Multicolor fluorescence in situ hybridization mapping analysis revealed that one single copy of ABCG2 cDNA was incorporated into the telomeric region of chromosome 12p. It was proven that mRNAs of those integrated ABCG2 variants were expressed evenly in Flp-In-293 cells. However, the protein expression levels varied among those variants. In particular, expression of the F208S and S441N variants was markedly low, suggesting the instability of these variant proteins. Drug resistance profiles of Flp-In-293 cells expressing two major SNP variants (V12M and Q141K) toward the drug SN-38 demonstrated that the IC50 value (drug concentrations producing a 50% reduction of cell growth) for Q141K was approximately 50% of that for wild type. The contributions of the minor SNP variants (F208S, S248P, F431L, S441N and F489L) to drug resistance toward SN-38, mitoxantrone, doxorubicin, daunorubicin or etoposide were significantly lower than wild type. Based on our functional validation, the above-mentioned non-synonymous polymorphisms as well as acquired mutants (R482G and R482T) of ABCG2 were classified into four groups. Furthermore, new camptothecin analogs synthesized by our research group had potent effects in circumventing ABCG2-mediated drug resistance without any influence from major non-synonymous polymorphisms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 To re-evaluate the effect of single nucleotide polymorphisms (SNP) of ABCG2 in vitro, we created a total of seven variant cDNAs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) by site-directed mutagenesis and stably expressed each of them in Flp-In-293 cells using the Flp recombinase system. Login to comment
6 In particular, expression of the F208S and S441N variants was markedly low, suggesting the instability of these variant proteins. Login to comment
8 The contributions of the minor SNP variants (F208S, S248P, F431L, S441N and F489L) to drug resistance toward SN-38, mitoxantrone, doxorubicin, daunorubicin or etoposide were significantly lower than wild type. Login to comment
137 Characterization of the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells. Login to comment
138 Figure 2C demonstrates the mRNA and protein levels of WT ABCG2 and the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells. Login to comment
139 Whereas mRNA levels were almost the same in WT and those variants, the protein levels of the F208S and S441N variants were markedly low. Login to comment
140 The immunofluorescence images of Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells revealed that those variant proteins were not expressed in the plasma membrane (Fig. 2D). Login to comment
176 Resistance profile (IC50) of ABCG2 Compound IC50 (nM) Mock Wild type V12M Q141K F208S S248P F431L S441N F489L SN-38 0.9 40.0 (44.4) 40.0 (44.4) 17.0 (18.9) 0.6 (0.7) 3.0 (3.3) 10.0 (11.1) 0.7 (0.8) 3.1 (3.4) Mitoxantorone 5.2 >100 (>19) 92.0 (17.7) 45.0 (8.7) 4.5 (0.9) 11.0 (2.1) 21.0 (4.0) 4.6 (0.9) 11.0 (2.1) Doxorubicin 32.0 78.0 (2.4) 100.0 (3.1) 110.0 (3.4) 20.0 (0.6) 20.0 (0.6) 40.0 (1.3) 21.0 (0.7) 45.0 (1.4) Daunorubicin 12.0 30.0 (2.5) 50.0 (4.2) 50.0 (4.2) 12.0 (1.0) 21.0 (1.8) 14.0 (1.2) 12.0 (1.0) 19.0 (1.6) Etoposide 110.0 200.0 (1.8) 220.0 (2.0) 200.0 (1.8) 110.0 (1.0) 120.0 (1.1) 120.0 (1.1) 130.0 (1.2) 170.0 (1.5) Vincristine 1.4 4.0 (2.9) 5.0 (3.6) 4.5 (3.2) 0.6 (0.4) 4.0 (2.9) 1.4 (1.0) 0.8 (0.6) 2.8 (2.0) Relative resistances to mock cells are described in parentheses. Login to comment
192 As clearly demonstrated in this study, the F208S, S248P, F431L, S441N and F489L variants exhibited greatly altered protein expression levels (Fig. 2C) or drug resistance profiles (Fig. 4 and Table 1). Login to comment
193 In particular, expression levels of the F208S and S441N variants were markedly low (Fig. 2C). Login to comment
195 In fact, when Flp-In-293/ ABCG2 (F208S) cells were treated with MG132, a proteasome inhibitor, the protein level recovered up to approximately 50% of the WT level, suggesting the involvement of proteasomes in degradation of the F208S variant (data not shown). Login to comment
199 The most recent version of NCBI dbSNP does not appear to contain validation for F208S and S248P as bona fide SNP. Login to comment
202 As one of the specific aims of the present study, we functionally classified the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity. Login to comment
207 Drug resistance profiles of Flp-In-293 cells expressing the wild-type (WT) BCRP/MXR1/ABCP (ABCG2), F208S, S248P, F431L, S441N or F489L variants toward (A) SN-38 and (B) mitoxantrone. Login to comment
214 (16) Both F208S and S441N belong to the third group where protein expression levels were extremely low (Fig. 2C). Login to comment

[hide] The identification of two germ-line mutations in t... Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21. Yoshioka S, Katayama K, Okawa C, Takahashi S, Tsukahara S, Mitsuhashi J, Sugimoto Y
The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein.
Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21., [PMID:17373578]

Abstract [show]
PURPOSE: We examined the effects of the nine nonsynonymous germ-line mutations/SNPs in the breast cancer resistance protein (BCRP/ABCG2) gene on the expression and function of the protein. MATERIALS AND METHODS: We generated cDNAs for each of these mutants (G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP) and compared the effects of their exogenous expression in PA317 cells with a wild-type control. RESULTS: PA/F208S cells (T623C BCRP-transfectants) expressed marginal levels of a BCRP protein species (65kDa), which is slightly smaller than wild-type (70kDa), but this mutant did not appear on the cell surface or confer drug resistance. PA/F431L cells (T1291C BCRP-transfectants) were found to express both 70 kDa and 65 kDa BCRP protein products. In addition, although PA/F431L cells expressed 70 kDa BCRP at comparable levels to PA/WT cells, they showed only marginal resistance to SN-38. PA/T153M cells (C458T BCRP-transfectants) and PA/D620N cells (G1858A BCRP-transfectants) expressed lower amounts of BCRP and showed lower levels of resistance to SN-38 compared with PA/WT cells. CONCLUSIONS: We have shown that T623C BCRP encodes a non-functional BCRP and that T1291C BCRP encodes a low-functional BCRP. Hence, these mutations may affect the pharmacokinetics of BCRP substrates in patients harboring these alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 PA/F208S cells (T623C BCRP-transfectants) expressed marginal levels of a BCRP protein species (65 kDa), which is slightly smaller than wild-type (70 kDa), but this mutant did not appear on the cell surface or confer drug resistance. Login to comment
42 The cells were selected with 120 ng/mL of methotrexate, and the resulting mixed populations of resistant cells were designated as PA/WT, PA/V12M, PA/ G51C, PA/Q141K, PA/T153M, PA/I206L, PA/F208S, PA/ S248P, PA/F431L, PA/N590Y and PA/D620N, respectively. The PA/F208S clones and PA/F431L clones were obtained by limiting dilution. Login to comment
43 Cell Growth Inhibition Assay Anticancer agent resistance levels in both the parental PA317 cells and in the various BCRP transfectants were Table I. Frequencies of Germ-line Mutations/SNPs Within The BCRP Gene Variation Frequency (%) Number Population Reference Nucleotide Amino acid G34A V12M 19 29 Japanese 17 G151T G51C 0.1a 350 Japanese C376T Q126Stop 1.2 124 Japanese 17 C421A Q141K 26.6 124 Japanese 17 C458T T153M 3.3 30 Cell line 32 C496G Q166E 0.3a 200 Japanese A616C I206L 20 10 Hispanic 33 T623C F208S 0.3a 200 Japanese T742C S248P 0.5a 200 Japanese T1291C F431L 0.6b 260 Japanese 34 A1768T N590Y 1.1 88 Caucasians 33 G1858A D620N 1.1 90 unknown 35 a Determined in this study. Login to comment
45 V12M Q141K D620N N590Y F431L S248P F208S I206L T153M G51C Q166E OUT MEMBRANE IN Fig. 1. Login to comment
70 The BCRP (824 bp) and GAPDH (551 bp) transcripts were amplified by RT-PCR from 0.3 mg of total RNA. c, Western blot analysis of BCRP in PA317, PA/WT, PA/F431L, and PA/F208S cells as described above. Login to comment
75 SN-38 Resistance Levels of PA317 Transfectantsa Cell type IC50 (nmol/L) Degree of resistance PA317 11 T 0.2 1 PA/WT 550 T 16 50 PA/V12M 490 T 13 45 PA/Q141K 110 T 5.9 10 PA/T153M 260 T 15 24 PA/Q166E 680 T 40 62 PA/F208S 10 T 0.7 1 PA/F431L 34 T 0.9 3 PA/D620N 190 T 5.7 17 a Cells were cultured for 5 days with various concentrations of SN-38. Login to comment
80 RESULTS Expression of BCRP in PA317 Transfectants The germ-line mutations and resulting amino acid substitutions examined in this study were as follows; G151T (G51C), C458T (T153M), C496G (Q166E), A616C (I206L), T623C (F208S), T742C (S248P), T1291C (F431L), A1768T (N590Y) and G1858A (D620N). Login to comment
81 G51C, T153M, Q166E, I206L, F208S and S248P are located in the intracellular domain of the protein (Fig. 1 and Table I). Login to comment
86 Among the 11 mutant BCRP transfectants under study, PA/F208S cells were found to express the lowest levels of BCRP, corresponding to a 65-kDa protein (Fig. 2a and c). Login to comment
93 Cell Surface BCRP Expression in the Mutant BCRP Transfectants The expression levels of BCRP on the cell surfaces of each of the transfectants were examined by FACS and were undetectable in either the PA/F208S or parental PA317 cells (Fig. 2d). Login to comment
100 PA/F208S cells showed a similar level of SN-38 sensitivity to PA317 cells (Table II). Login to comment
105 Analyses of PA/F208S Subclones We isolated two independent clones from the population of PA/F208S cells, (PA/F208S-cl.1 and -cl.4) that expressed higher levels of 65-kDa BCRP protein than PA/F208S cells by western blot (Fig. 3a), but the cell surface expression of BCRP were not detectable in these clones by FACS analysis (Fig. 3c). Login to comment
113 BCRP protein and mRNA expression in PA/F208S clones. Login to comment
116 b, Semi-quantitative RT-PCR analysis of BCRP mRNA in the indicated PA/F208S clones. Login to comment
117 The BCRP (824 bp) and GAPDH (551 bp) transcripts were amplified by RT-PCR from 0.3 mg of total RNA. c, BCRP cell surface expression analysis of PA/F208S clones by FACS as described for Fig. 2d. Login to comment
118 d, Drug resistance levels for the PA/F208S clones. PA317 (open circle), PA/WT (closed circle), PA/F208S (closed triangle), PA/F208S clone 1 (closed lozenge), and clone 4 (closed square) cells were cultured for 5 days with various concentrations of SN-38. Login to comment
128 DISCUSSION In our current study, we have examined the effect of the nine germ-line mutations/SNPs, G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP, resulting in the amino acid changes G51C, T153M, Q166E, I206L, F208S, S248P, F431L, N590Y, D620N, respectively, on BCRP protein expression and function. Login to comment
130 The resulting mixed populations of cells were designated a PA/WT, PA/V12M, PA/G51C, PA/Q141K, PA/ T153M, PA/I206L, PA/F208S, PA/S248P, PA/F431L, PA/ N590Y and PA/D620N. Login to comment
131 PA/F208S cells were found to express marginal levels of BCRP (65-kDa) (Figs. 2a and 3a), which were slightly lower than wild-type BCRP, but did not appear on the cell surface (Figs. 2d and 3c). Login to comment
132 Moreover, PA/ F208S cells did not show any drug resistance (Fig. 3c and Table II). Login to comment
143 G51C, T153M, Q166E, I206L, F208S, and S248P are located in the intracellular domain, and F431L, N590Y, and D620N reside in the transmembrane domain. Login to comment
145 The I206L BCRP and F208S BCRP mutants harbor amino acid substitutions within the Walker B region, which is likely to have a significant impact upon the functioning of the ATP binding site. Login to comment
146 PA/F208S cells express a marginal amount of a smaller BCRP protein species(65 kDa), which is not expressed on the cell surface (Figs. 2a, c, d, 3a and c). Login to comment
147 Moreover, PA/F208S cells do not show any drug resistant properties. Login to comment
148 Considering no expression of F208S BCRP mutant on the cell surface of PA/F208S, the lack of drug resistance property in the transfectant is probably due to the absence of cell surface transporter. Login to comment
150 Further studies are ongoing to evaluate the ATP-binding and -hydrolyzing activity of I206L BCRP and F208S BCRP mutants. Login to comment
153 These results are very similar to our current data for the T623C (F208S) BCRP germ-line mutation. Login to comment
154 Surprisingly, both the Ile residue of I1196Y P-gp and the Phe of F208S BCRP occupy the amino acid positions in the Walker B motifs of P-gp and BCRP, respectively. A number of ongoing studies in our laboratory are therefore currently focused on the mechanisms underlying the maturation and stability of mutant ABC transporters as this may have a significant impact upon the effectiveness of cancer chemotherapy regimens. Login to comment
165 The 65-kDa F431L BCRP product has the same molecular weight as F208S BCRP by SDS-PAGE (Fig. 2a and c). Login to comment
178 CONCLUSION We have characterized two important BCRP germ-line mutations, T623C (F208S) and T1291C (F431L). Login to comment

[hide] ABC multidrug transporters: structure, function an... Pharmacogenomics. 2008 Jan;9(1):105-27. Sharom FJ
ABC multidrug transporters: structure, function and role in chemoresistance.
Pharmacogenomics. 2008 Jan;9(1):105-27., [PMID:18154452]

Abstract [show]
Three ATP-binding cassette (ABC)-superfamily multidrug efflux pumps are known to be responsible for chemoresistance; P-glycoprotein (ABCB1), MRP1 (ABCC1) and ABCG2 (BCRP). These transporters play an important role in normal physiology by protecting tissues from toxic xenobiotics and endogenous metabolites. Hydrophobic amphipathic compounds, including many clinically used drugs, interact with the substrate-binding pocket of these proteins via flexible hydrophobic and H-bonding interactions. These efflux pumps are expressed in many human tumors, where they likely contribute to resistance to chemotherapy treatment. However, the use of efflux-pump modulators in clinical cancer treatment has proved disappointing. Single nucleotide polymorphisms in ABC drug-efflux pumps may play a role in responses to drug therapy and disease susceptibility. The effect of various genotypes and haplotypes on the expression and function of these proteins is not yet clear, and their true impact remains controversial.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
368 A recent study characterized the activity of 18 ABCG2 variants, and concluded that Q126stop, F208S, S248P, E334stop, S441N and F489L are defective in hematoporphyrin transport [170], which may increase the risk of disease in individuals carrying these polymorphisms. Login to comment

[hide] In vitro evaluation of photosensitivity risk relat... Drug Metab Pharmacokinet. 2007 Dec;22(6):428-40. Tamura A, Onishi Y, An R, Koshiba S, Wakabayashi K, Hoshijima K, Priebe W, Yoshida T, Kometani S, Matsubara T, Mikuriya K, Ishikawa T
In vitro evaluation of photosensitivity risk related to genetic polymorphisms of human ABC transporter ABCG2 and inhibition by drugs.
Drug Metab Pharmacokinet. 2007 Dec;22(6):428-40., [PMID:18159130]

Abstract [show]
Since porphyrins are regarded as endogenous substrates for the ATP-binding cassette (ABC) transporter ABCG2, it is hypothesized that functional impairment owing to genetic polymorphisms or inhibition of ABCG2 by drugs may result in a disruption of cellular porphyrin homeostasis. In the present study, we expressed ABCG2 genetic variants, i.e., V12M, Q141K, S441N, and F489L, as well as the wild type (WT) in Flp-In-293 cells to examine the hypothesis. Cells expressing S441N and F489L variants exhibited high levels of both cellularly accumulated pheophorbide a and photosensitivity, when those cells were incubated with pheophorbide a and irradiated with visible light. To further elucidate the significance of ABCG2 in cellular porphyrin homeostasis, we observed cellular accumulation and compartmentation of porphyrin and pheophorbide a by means of a new fluorescence microscopy technology, and found that accumulation of porphyrin and pheophorbide a in the cytoplasm compartment was maintained at low levels in Flp-In-293 cells expressing ABCG2 WT, V12M, or Q141K. When ABCG2 was inhibited by imatinib or novobiocin, however, those cells became sensitive to light. Based on these results, it is strongly suggested that certain genetic polymorphisms and/or inhibition of ABCG2 by drugs can enhance the potential risk of photosensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 By using plasma membrane vesicles and a high-speed screening system, we precisely evaluated functional changes associated with genetic polymorphisms in vitro.24) Since porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the transport of porphyrins with a total of 18 variant forms of human ABCG2 in the plasma membrane vesicle system.4) As a result, we found that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins. Login to comment
199 Indeed, we reported that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin.4) The F489L variant showed impaired transport activity. Login to comment
200 As demonstrated in the present study, as well as in our previous one,4) Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a. Thus, it is likely that humans with these alleles may be more susceptible to porphyrin-induced phototoxicity. Login to comment

[hide] Ubiquitin-mediated proteasomal degradation of non-... Biochem J. 2008 May 1;411(3):623-31. Nakagawa H, Tamura A, Wakabayashi K, Hoshijima K, Komada M, Yoshida T, Kometani S, Matsubara T, Mikuriya K, Ishikawa T
Ubiquitin-mediated proteasomal degradation of non-synonymous SNP variants of human ABC transporter ABCG2.
Biochem J. 2008 May 1;411(3):623-31., 2008-05-01 [PMID:18237272]

Abstract [show]
Clinical relevance is implicated between the genetic polymorphisms of the ABC (ATP-binding cassette) transporter ABCG2 (ABC subfamily G, member 2) and the individual differences in drug response. We expressed a total of seven non-synonymous SNP (single nucleotide polymorphism) variants in Flp-In-293 cells by using the Flp (flippase) recombinase system. Of these, ABCG2 F208S and S441N variants were found to be expressed at markedly low levels, whereas their mRNA levels were equal to those of the other SNP variants and ABCG2 WT (wild-type). Interestingly, protein expression levels of the ABCG2 F208S and S441N variants increased 6- to 12-fold when Flp-In-293 cells were treated with MG132, a proteasome inhibitor. Immunoprecipitation followed by immunoblot analysis showed that the ABCG2 F208S and S441N variant proteins were endogenously ubiquitinated in Flp-In-293 cells, and treatment with MG132 significantly enhanced the level of these ubiquitinated variants. Immunofluorescence microscopy demonstrated that MG132 greatly affected the ABCG2 F208S and S441N variants in terms of both protein levels and intracellular distribution. Immunoblot analysis revealed that those variants were N-glycosylated; however, their oligosaccharides were immature compared with those present on ABCG2 WT. The ABCG2 F208S and S441N variant proteins do not appear to be processed in the Golgi apparatus, but undergo ubiquitin-mediated protein degradation in proteasomes, whereas ABCG2 WT is sorted to the plasma membrane and then degraded via the lysosomal pathway. The present study provides the first evidence that certain genetic polymorphisms can affect the protein stability of ABCG2. Control of proteasomal degradation of ABCG2 would provide a novel approach in cancer chemotherapy to circumvent multidrug resistance of human cancers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Of these, ABCG2 F208S and S441N variants were found to be expressed at markedly low levels, whereas their mRNA levels were equal to those of the other SNP variants and ABCG2 WT (wild-type). Login to comment
3 Interestingly, protein expression levels of the ABCG2 F208S and S441N variants increased 6to 12-fold when Flp-In-293 cells were treated with MG132, a proteasome inhibitor. Login to comment
4 Immunoprecipitation followed by immunoblot analysis showed that the ABCG2 F208S and S441N variant proteins were endogenously ubiquitinated in Flp-In-293 cells, and treatment with MG132 significantly enhanced the level of these ubiquitinated variants. Login to comment
5 Immunofluorescence microscopy demonstrated that MG132 greatly affected the ABCG2 F208S and S441N variants in terms of both protein levels and intracellular distribution. Login to comment
7 The ABCG2 F208S and S441N variant proteins do not appear to be processed in the Golgi apparatus, but undergo ubiquitin-mediated protein degradation in proteasomes, whereas ABCG2 WT is sorted to the plasma membrane and then degraded via the lysosomal pathway. Login to comment
26 The ABCG2 non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N and F489L were defective in the active transport of methotrexate and haematoporphyrin [18]. Login to comment
27 Furthermore, the F208S, S248P, F431L, S441N, and F489L ABCG2 variants exhibited greatly altered protein expression levels and drug Abbreviations used: ABC, ATP-binding cassette; ABCG2, ABC subfamily G, member 2; BMA, bafilomycin A1; CPT, camptothecin; DMEM, Dulbecco`s modified Eagle`s medium; endo H, endoglycosidase H; ER, endoplasmic reticulum; ERAD, ER-associated degradation; FCS, fetal calf serum; Flp, flippase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HRP, horseradish peroxidase; ME, 2-mercaptoethanol; PNGase F, peptide N-glycosidase F; RT-PCR, reverse transcription-PCR; SN-38, 7-ethyl-10-hydroxycamptothecin; SNP, single nucleotide polymorphism; TBS, Tris-buffered saline; WT, wild-type. Login to comment
30 In particular, the expression levels of the F208S and S441N ABCG2 variant proteins were markedly low. Login to comment
32 Nevertheless, the mechanism underlying the low expression levels of those ABCG2 variants (i.e. F208S and S441N) has not yet been elucidated. Login to comment
39 We provide direct evidence that ABCG2 non-synonymous SNP variants, i.e., F208S and S441N, undergo ubiquitin-mediated protein degradation in proteasomes. Login to comment
45 Flp-In-293 cells expressing ABCG2 WT (wild-type), F208S or S441N Flp-In-293 cells expressing ABCG2 WT, F208S or S441N, named Flp-In-293/ABCG2 (WT), Flp-In-293/ABCG2 (F208S) or Flp-In-293/ABCG2 (S441N) respectively, were prepared as described previously [8,33]. Login to comment
88 To analyse quantitatively the distribution of the ABCG2 protein localized on the plasma membrane or in the cytosol, the immunofluorescence images captured by the confocal fluorescence microscopy system were processed by means of originally-developed computer software, Figure 1 Schematic illustration of human ABCG2 and expression of ABCG2 WT, F208S and S441N in Flp-In-293 cells at the transcription and protein levels (A) Arrows indicate the positions of amino acid substitutions in the non-synonymous SNP variants of ABCG2 F208S and S441N. Login to comment
93 (B) The mRNA level was analysed by RT-PCR with total RNA extracted from Flp-In-293 cells expressing ABCG2 WT (WT), F208S or S441N. Login to comment
94 For comparison of the protein levels, the cell lysates of Flp-In-209 cells expressing ABCG2 WT (WT), F208S or S441N were analysed by immunoblotting with the ABCG2-specific monoclonal antibody (BXP-21, top panel) or the GAPDH-specific antibody after PNGase F treatment. Login to comment
102 RESULTS Protein expression levels of ABCG2 WT, F208S, and S441N in Flp-In-293 cells Figure 1(A) depicts a schematic illustration of the human ABCG2 protein in order to show the sites of amino acid alteration in the ABCG2 SNP variants F208S and S441N. Login to comment
103 WT, F208S and S441N ABCG2 were individually expressed in Flp-In-293 cells by using the Flp (flippase) recombinase system [8,33]. Login to comment
104 As shown in Figure 1(B), mRNA levels of ABCG2 WT, as well as F208S and S441N variants, were evenly represented in Flp-In-293 cells, where the mRNA levels of ABCG2 and GAPDH were determined by RT-PCR. Login to comment
105 WT, F208S and S441N ABCG2, as well as GAPDH, were also detected by immunoblotting, and their expression levels were quantified. Login to comment
109 Although mRNA levels were almost identical in ABCG2 WT and the SNP variants (F208S and S441N), the protein levels of those SNP variants were markedly low (Figure 1B). Login to comment
111 Characterization of F208S and S441N variants expressed in Flp-In-293 cells To gain insight into the molecular nature of ABCG2 WT and the two SNP variants (F208S and S441N), we performed immunoblot analysis experiments with cell lysate samples under reduced or non-reduced conditions. Login to comment
112 Figure 2(A) shows the effect of ME treatment on the migration of ABCG2 WT, F208S and S441N proteins on SDS/PAGE. Login to comment
115 These results suggest that the ABCG2 F208S and S441N proteins form homodimers through a cysteinyl disulfide bond, as observed for the WT ABCG2 protein. Login to comment
119 In the case of the ABCG2 F208S variant, one faint band was detected at an apparent molecular mass of 74 kDa by the same sample processing and immunoblotting experiment. Login to comment
122 Although the 81 kDa major band of ABCG2 WT was not at all affected by endo H treatment, the apparent molecular masses of the smaller protein bands of ABCG2 F208S (74 kDa) and S441N (78 kDa) decreased after endo H treatment. Login to comment
124 Among ABCG2 WT and the SNP variants Figure 2 Immunoblot detection of ABCG2 WT, F208S and S441N proteins expressed in Flp-In-293 cells (A) Effect of ME on the homodimer or monomer form of ABCG2 WT and the SNP variants. Login to comment
125 Cell lysate samples (20 µg of protein) were subjected to SDS/PAGE after treatment with [ME (+)] or without [ME(-)] ME. ABCG2 WT, F208S and S441N proteins were then detected by immunoblotting with the BXP-21 antibody as described in the Materials and methods section. Login to comment
126 After ME treatment ABCG2 WT, F208S and S441N proteins were converted from homodimers into monomers. Login to comment
131 ABCG2 WT, F208S and S441N proteins in the resulting samples were analysed by immunoblotting with the BXP-21 antibody. Login to comment
136 F208S and S441N, their N-linked oligosaccharide structures appear to be different. Login to comment
137 The mature N-linked oligosaccharide of ABCG2 WT may have a structure which is resistant to endo H, whereas the immature N-linked oligosaccharides of the F208S and S441N variant proteins are susceptible to this endoglycosidase. Login to comment
138 Effect of MG132 and BMA on the protein expression levels of F208S and S441N variants We hypothesize that the low protein expression levels of the F208S and S441N variants are due to rapid degradation of those proteins through ubiquitin-mediated proteasomal proteolysis. Login to comment
140 Flp-In-293 cells expressing ABCG2 F208S or S441N were incubated in the presence of 0, 0.4 or 2.0 µM MG132 for 24 h, and then cell lysate samples were immediately prepared. Login to comment
141 Protein expression levels of the F208S and S441N variants were determined by immunoblotting after PNGase F treatment as described above. Login to comment
144 After 24 h treatment with 2 µM MG132, ABCG2 F208S and S441N Figure 3 Effects of MG132 on the glycosylation status and protein levels of ABCG2 F208S and S441N variants expressed in Flp-In-293 cells (A) Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were incubated with MG132 at concentrations of 0, 0.4 and 2 µM for 24 h at 37◦C. Cell lysate samples (20 µg of protein) were prepared in the presence of ME. ABCG2 F208S and S441N variant proteins were either analysed directly or treated with PNGase F for 10 min at 37◦C before immunoblotting with the ABCG2-specific monoclonal antibody (BXP-21). Login to comment
145 The signal intensity of the non-glycosylated form of the ABCG2 F208S or S441N variant was measured after PNGase F treatment. Login to comment
150 (B) Detection of aggregated forms (>200 kDa) of ABCG2 F208S and S441N variants. Login to comment
151 Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were incubated with MG132 at concentrations of 0, 0.4 and 2 µM for 24 h at 37◦C. Cell lysate samples (20 µg of protein) were prepared in the presence of ME. ABCG2 F208S and S441N variant proteins were prepared from MG132-treated cells as described above and analysed by immunoblotting with the BXP-21 antibody in the absence of PNGase F treatment. Login to comment
152 The aggregated forms of ABCG2 F208S and S441N are indicated (arrowheads). Login to comment
160 It is of interest to note that MG132 treatments enhanced the levels of the non-glycosylated form (72 kDa) for both the F208S and S441N variants when those cell lysate samples were not treated with PNGase F (Figure 3A). Login to comment
161 More importantly, on immunoblot analysis without PNGase F treatment, aggregated forms (arrowheads in Figure 3B) of both the ABCG2 F208S and S441N variants were detected in the high-molecular-mass range (over 200 kDa). Login to comment
163 The protein level of ABCG2 WT increased more than 2.5-fold when cells were treated with BMA, which inhibits lysosomal degradation, whereas the ABCG2 F208S and S441N variant proteins were minimally affected by the same treatment. Login to comment
166 Effect of MG132 on the ubiquitination states of F208S and S441N variants To investigate the effect of MG132 on the ubiquitination states of the ABCG2 F208S and S441N variant proteins, Flp-In-293 cells expressing those SNP variants were incubated in the presence or absence of 2 µM MG132 for 24 h. Login to comment
167 As shown in Figure 4, significant increases in the ubiquitinated forms of the F208S and S441N variant proteins were detected by immunoblotting with mouse monoclonal anti-ubiquitin antibody after immunoprecipitation with anti-ABCG2 antibody (BXP-21). Login to comment
170 The corresponding results are presented in Figures 4(B) and 4(D), where ubiquitinated forms (arrowheads) appeared to be more prominent than with the monoclonal anti-ubiquitin antibody Figure 4 Effect of MG132 on ubiquitination of ABCG2 F208S and S441N Afterincubationinthepresenceorabsenceof2 µMMG132for24 hat37◦C,celllysatesamples were prepared from Flp-In-293/ABCG2 (F208S) (A, B) and Flp-In-293/ABCG2 (S441N) (C, D) cells. Login to comment
177 Effect of MG132 on the cellular localization of F208S and S441N variants It is of interest to know how inhibition of proteasomal protein degradation by MG132 affects the cellular localization of the ABCG2 F208S and S441N variant proteins. Login to comment
178 Figure 5 shows immunofluorescence images of Flp-In-293 cells expressing ABCG2 WT, F208S or S441N proteins that has been incubated in the presence or absence of 2 µM MG132 for 24 h. Login to comment
185 On the other hand, immunofluorescence of the ABCG2 F208S variant was extremely weak at the plasma membrane as well as within intracellular compartments (Figures 5e and 5g). Login to comment
186 After Figure 5 Immunocytochemical staining of Flp-In-293 cells expressing ABCG2 WT, F208S or S441N proteins Cells were incubated in the presence (+MG132) or absence (none) of 2 µM MG132 for 24 h at 37◦C. ABCG2 proteins were detected by using a mouse monoclonal ABCG2 antibody (either BXP-21 or 5D3) and Alexa Fluor® 488 (green fluorescence). Login to comment
195 Remarkable differences were observed after MG132 treatment in terms of the cellular localization and/or the quantity of the F208S or S441N variant ABCG2 proteins as shown in Figure 6(A). Login to comment
196 It is noteworthy that protein levels of the F208S and S441N variants were clearly enhanced in intracellular compartments after MG132 treatment, as observed with the BXP-21 antibody. Login to comment
198 However, no plasma membrane localization was detected in the case of the F208S variant ABCG2 protein (Figure 6A). Login to comment
201 Figure 6 Analysis of the effects of MG132 on the cellular localization of ABCG2 WT, F208S or S441N proteins in Flp-In-293 cells (A) Cells were incubated in the presence or the absence (None) of 2 µM MG132 for 24 h at 37◦C. ABCG2 proteins in cells were detected using an ABCG2-specific monoclonal antibody [either BXP-21 (BXP21) or 5D3] as described in the Materials and methods section. Login to comment
208 In a previous study using the Flp recombinase system [33], we functionally characterized the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity. Login to comment
210 In particular, the expression levels of the F208S and S441N variant proteins were markedly low (Figure 1), consistent with the recent report of Yoshioka et al. [37]. Login to comment
212 Ubiquitin-mediated proteasomal degradation of F208S and S441N variants In the present study, we undertook the biochemical analysis of the molecular mechanisms underlying the low expression levels of the ABCG2 F208S and S441N variants. Login to comment
216 On the basis of those recent findings, we have examined the contribution of ubiquitin-mediated proteasomal degradation to the low-level expression of F208S and S441N ABCG2 variants by testing the effect of MG132. Login to comment
217 The presence of MG132 increased both the protein levels (Figure 3) and the ubiquitinated forms (Figure 4) of the F208S and S441N variant proteins. Login to comment
219 Misfolded proteins (e.g. ABCG2 F208S and S441N variants) are considered to be removed from the ER by retrotranslocation to the cytosol and then degraded by the ubiquitin-proteasome system by a process known as ERAD [38,39]. Login to comment
223 N-linked oligosaccharides of ABCG2 F208S and S441N variants During de novo synthesis in the ER, oligosaccharides are added to asparagine (N-glycosylation) or serine residues (O-glycosylation) of glycoproteins. Login to comment
231 Their findings were confirmed by recent experiments in which Asn596 of the ABCG2 protein was changed to glutamine and expressed in Flp-In-293 cells by using the Flp recombinase system (H. Nakagawa, Scheme 1 Schematic illustration of plausible pathways for protein processing and degradation of ABCG2 WT and SNP variants (F208S and S441N) We have provided evidence that ABCG2 WT and the variants undergo degradation by different pathways. Login to comment
236 It is important to note that N-linked oligosaccharide processing was greatly impaired in the ABCG2 F208S and S441N SNP variants. Login to comment
240 It is likely, however, that the ABCG2 F208S and S441N variant proteins did not undergo Golgi-apparatus-mediated glycoprocessing, but were passed through the so-called ERAD pathway. Login to comment
241 The immature and non-glycosylated forms of ABCG2 F208S and S441N were detected when Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were treated with MG132 for 24 h (Figure 3A), suggesting that those variant proteins were ubiquitinated in both pre-and post-N-glycosylation reactions and then readily degraded in proteasomes. Login to comment
244 While we have demonstrated here the ubiquitination and proteasomal degradation of the ABCG2 F208S or S441N variant homodimers, it will be important to study the fate of heterodimers (WT/SNP variant) in the future. Login to comment
251 As exemplified by the ABCG2 F208S and S441N variants, it is likely that several other SNP variants may undergo degradation via the ERAD pathway. Login to comment

[hide] Homology modeling of breast cancer resistance prot... J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15. Hazai E, Bikadi Z
Homology modeling of breast cancer resistance protein (ABCG2).
J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15., [PMID:18249138]

Abstract [show]
BCRP (also known as ABCG2, MXR, and ABC-P) is a member of the ABC family that transports a wide variety of substrates. BCRP is known to play a key role as a xenobiotic transporter. Since discovering its role in multidrug resistance, considerable efforts have been made in order to gain deeper understanding of BCRP structure and function. The recent study was aimed at predicting BCRP structure by creating a homology model. Based on sequence similarity with known structures of full-length, NB and TM domain of ABC transporters, TM, NB, and linker regions of BCRP were defined. The NB domain of BCRP was modeled using MalK as a template. Based on secondary structure prediction of BCRP and comparison of the transmembrane connecting regions of known structures of ABC transporters, the TM domain arrangement of BCRP was established and was found to resemble to that of the recently published crystal structure of Sav1866. Thus, an initial alignment of TM domain of BCRP was established using Sav1866 as a template. This alignment was subsequently refined using constrains derived from secondary structure and TM predictions and the final model was built. Finally, the complete homodimer ABCG2 model was generated using Sav1866 as template. Furthermore, known ligands of BCRP were docked to our model in order to define possible binding sites. The results of molecular dockings of known BCRP substrates to the BCRP model were in agreement with recently published experimental data indicating multiple binding sites in BCRP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand. Login to comment

[hide] Drug-induced phototoxicity evoked by inhibition of... Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72. Tamura A, An R, Hagiya Y, Hoshijima K, Yoshida T, Mikuriya K, Ishikawa T
Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems.
Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72., [PMID:18363541]

Abstract [show]
BACKGROUND: Photosensitivity depends on both genetic and environmental factors. Pheophorbide a, present in various plant-derived foods and food supplements, can be absorbed by the small intestine. Accumulation of pheophorbide a and porphyrins in the systemic blood circulation can result in phototoxic lesions on light-exposed skin. OBJECTIVE: As the human ATP-binding cassette (ABC) transporter ABCG2 has been suggested to be critically involved in porphyrin-mediated photosensitivity, we aimed to develop in vitro screening systems for drug-induced phototoxicity. CONCLUSION: Functional impairment owing to inhibition of ABCG2 by drugs or its genetic polymorphisms can lead to the disruption of porphyrin homeostasis. This review article provides an overview on drug-induced photosensitivity, as well as our hypothesis on a potential role of ABCG2 in phototoxicity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A. Login to comment
231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids. Login to comment
245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
246 The variants Q126stop, F208S, S248P, E334stop, and S441N were defective in the transport of hematoporphyrin (Figure 9). Login to comment
248 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a [87,88]. Login to comment
252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative). Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
250 It should be noted that many xeno- and endobiotic BCRP Figure 5 Predicted membrance topology of BCRP (ABCG2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 5 for allele frequencies and description of funtional consequences. NH2 COOH NBD Val12Met Gly51Cys Gln126* Ala149Pro Gln141Lys Thr153Met Arg160Gln Arg163Lys Gln166Glu Phe506Ser Phe507Leu Val508Leu Met509* Phe489Leu Ser441Asn Phe431Leu Glu334* Ile206Leu Ala315del Thr316del Phe208Ser Asp296His Ser248Pro Pro269Ser Phe571Ile Arg575* Asn590Tyr Asp620Asn in out Membrane BCRP (ABCG2) NBD Val12Met NBDNBD Val12Met substrates are also transported by other efflux transporters, especially P-glycoprotein, thus extrapolating BCRP related in vitro data to the in vivo situation may be difficult. Login to comment
315 22.Itoda,M.,etal.EightnovelsinglenucleotidepolymorphismsinABCG2/BCRPinJapanesecancerpatientsadministeredirinotacan.DrugMetabPharmacokinet.2003; 18(3):212-217. decreased MTX and porphyrin transport in cells transfected with variant cDNA in comparison to wild-type cDNA has also been reported for the following variants Phe208Ser, Ser248Pro, and Phe431Leu (Tamura et al., 2006). Login to comment
316 But only in the case of Phe208Ser could the altered function be attributed to lower protein expression levels (Tamura et al., 2006) or impaired membrane localization (Tamura et al., 2007). Login to comment

[hide] Human ABC transporters ABCG2 (BCRP) and ABCG4. Xenobiotica. 2008 Jul;38(7-8):863-88. Koshiba S, An R, Saito H, Wakabayashi K, Tamura A, Ishikawa T
Human ABC transporters ABCG2 (BCRP) and ABCG4.
Xenobiotica. 2008 Jul;38(7-8):863-88., [PMID:18668433]

Abstract [show]
1. The human ABC transporter ABCG2 is regarded as a member of the phase III system for xenobiotic metabolism, and it has been suggested that this efflux pump is responsible for protecting the body from toxic xenobiotics and for removing metabolites. 2. This review paper will address the new aspects of ABCG2 in terms of post-translational modifications (i.e., disulfide bond formation, ubiquitination, and endoplasmic reticulum-associated degradation) of ABCG2 protein, high-speed screening, and quantitative structure-activity relationship (QSAR) analysis to evaluate ABCG2-drug interactions, and genetic polymorphisms potentially associated with photosensitivity. 3. In addition, new aspects of human ABCG4 and mouse Abcg4 are presented with respect to their molecular properties and potential physiological roles. Considering a high sequence similarity between ABCG1 and ABCG4, both Abcg4 and ABCG4 may be involved in the transport of cholesterol from neurons and astrocytes. Furthermore, high expression of the mouse Abcg4 protein in the testis implicates its involvement in transport of certain sex hormones.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007). Login to comment
232 S. Koshiba et al. variants Q126stop, F208S, S248P, E334stop, and S441N substantially lack transport activity for both haematoporphyrin and methotrexate. Login to comment
235 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when those cells were treated with pheophorbide a (Tamura et al. 2007). Login to comment
237 It has most recently revealed that F208S and S441N variant proteins were ubiquitinated and readily degraded in proteasomes in Flp-In-293 cells (Nakagawa et al. 2008). Login to comment

[hide] Pharmacogenetics of intestinal absorption. Curr Drug Deliv. 2008 Jul;5(3):153-69. Nakamura T, Yamamori M, Sakaeda T
Pharmacogenetics of intestinal absorption.
Curr Drug Deliv. 2008 Jul;5(3):153-69., [PMID:18673259]

Abstract [show]
The small intestine is the primary site of absorption for many drugs administered orally and so is the target tissue for pharmacotherapeutic strategies to control the oral absorption of drugs. Drug transporters, including the ATP-binding cassette (ABC) superfamily and the solute carrier (SLC) superfamily, have been considered to play a physiological role in regulating the absorption of xenobiotics, and variations in their expression level and function in the small intestine cause intra- and inter-individual variation in the oral absorption of drugs. Recent advances in molecular biology have suggested that genetic polymorphisms are associated with the expression level and function, and thereby inter-individual variation. In this review, the pharmacogenetics of these transporters is summarized, and their future significance in the clinical setting is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Exon Polymorphism Effect dbSNP Cell Expression Function Reference mRNA ( ) Protein (n.s.) Membrane localization (n.s.) Drug sensitivity (n.s.) Mitoxantrone efflux (n.s.) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity (n.s.) Mizuarai et al. [88] Sf9 Protein ( ) ATPase activity (n.s.) Hoechst 33342 efflux ( ) Morisaki et al. [92] Exon 2 114T>C synonymous rs12721640 Exon 4 369C>T synonymous rs2231139 PA317 mRNA (n.s.) Protein ( ) Drug sensitivity ( ) Intracellular uptake ( ) Imai et al. [85] mRNA (n.s.) Protein (n.s.) Apical localization (n.s.) Drug sensitivity ( ) Indolocarbazole uptake ( ) Indolocarbazole efflux ( ) Mizuarai et al. [88] LLC-PK1 Apical localization (n.s.) Kondo et al. [94] mRNA ( ) Protein (n.s.) Membrane localization (impaired) Drug sensitivity ( ) Mitoxantrone efflux ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein ( ) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity ( ) Mizuarai et al. [88] 421C>A Gln141Lys rs2231142 Sf9 Protein (n.s.) ATPase activity ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] LLC-PK1 Apical localization (n.s.) Exon 5 496C>G Gln166Glu rs1061017 HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 HEK293 Protein ( or n.s.) Membrane localization (n.s.) Efflux activity ( ) Drug sensitivity ( ) ATPase activity (n.s.) Vethanayagam et al. [95] 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334stop rs3201997 Exon 14 2204T>A Phe571Ile rs9282571 SLC15A1 CHO Cephalexin uptake (n.s.)61G>A Val21Ile rs8187818 Cos7 Cephalexin uptake (n.s.) Substrate selectivity (n.s.) CHO Cephalexin uptake ( ) Cos7 Cephalexin uptake ( ) Substrate selectivity (VAC inhibition?) Login to comment
94 Exon Polymorphism Effect dbSNP Subject Expression Function Reference 114T>C synonymous rs12721640 369C>T synonymous rs2231139 421C>A Gln141Lys rs2231142 Patient (Caucasian) 9-nitrocamptotecin PK (CC CA) 9-aminocamptotecin PK [AUC/Dose] (CC<CA) Zamboni et al. [55] Nasopharyngeal cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) Zhou et al. [56] HIV patient (Caucasian) Nelfinavir intracellular AUC (CC CA AA) Colombo et al. [58] Cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) de Jong et al. [90] Patient (Japanese) Placental mRNA (CC CA AA) Placental protein (CC>CA>AA) Kobayashi et al. [91] Cancer patient Diflomotecan PK [AUC, Cmax] (CC<CA), [F] (CC>CA) Sparreboom et al. [96] Healthy (Chinese) Rosuvastatin PK [AUC, Cmax] (CC<CA+AA), [CL/F] (CC>CA+AA), [T1/2, Tmax] (CC CA+AA) Zhang et al. [97] Exon 4 496C>G Gln166Glu rs1061017 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334Stop rs3201997 Exon 14 1711T>A Phe571Ile rs9282571 SLC15A1 61G>A Val21Ile rs8187818Exon 3 83T>A Phe28Tyr rs8187817 258G>A synonymous rs8187823 330C>T synonymous rs8187822 350G>A Ser117Asn rs2297322 351C>A Ser117Arg rs8187821 Exon 5 364G>A Val122Met rs8187820 Exon 7 501C>T synonymous rs3737087 Exon 11 843G>A synonymous r8187812 Exon 15 1147G>A Asp383Asn rs1782674 1179C>T synonymous rs8187836Exon 16 1256G>C Gly419Ara rs4646227 1347T>C synonymous rs1339067 Allelic mRNA imbalance (2030%) Anderle et al. [101] 1348G>A Val450Ile rs2274828 1352C>A Thr451Asn rs8187838 Exon 17 1375C>T Arg459Cys rs2274827 Exon 18 1446A>G synonymous rs8187828 (Table 3) contd…. Login to comment

[hide] Clinical pharmacogenetics and potential applicatio... Curr Drug Metab. 2008 Oct;9(8):738-84. Zhou SF, Di YM, Chan E, Du YM, Chow VD, Xue CC, Lai X, Wang JC, Li CG, Tian M, Duan W
Clinical pharmacogenetics and potential application in personalized medicine.
Curr Drug Metab. 2008 Oct;9(8):738-84., [PMID:18855611]

Abstract [show]
The current 'fixed-dosage strategy' approach to medicine, means there is much inter-individual variation in drug response. Pharmacogenetics is the study of how inter-individual variations in the DNA sequence of specific genes affect drug responses. This article will highlight current pharmacogenetic knowledge on important drug metabolizing enzymes, drug transporters and drug targets to understand interindividual variability in drug clearance and responses in clinical practice and potential use in personalized medicine. Polymorphisms in the cytochrome P450 (CYP) family may have had the most impact on the fate of pharmaceutical drugs. CYP2D6, CYP2C19 and CYP2C9 gene polymorphisms and gene duplications account for the most frequent variations in phase I metabolism of drugs since nearly 80% of drugs in use today are metabolised by these enzymes. Approximately 5% of Europeans and 1% of Asians lack CYP2D6 activity, and these individuals are known as poor metabolizers. CYP2C9 is another clinically significant drug metabolising enzyme that demonstrates genetic variants. Studies into CYP2C9 polymorphism have highlighted the importance of the CYP2C9*2 and CYP2C9*3 alleles. Extensive polymorphism also occurs in a majority of Phase II drug metabolizing enzymes. One of the most important polymorphisms is thiopurine S-methyl transferases (TPMT) that catalyzes the S-methylation of thiopurine drugs. With respect to drug transport polymorphism, the most extensively studied drug transporter is P-glycoprotein (P-gp/MDR1), but the current data on the clinical impact is limited. Polymorphisms in drug transporters may change drug's distribution, excretion and response. Recent advances in molecular research have revealed many of the genes that encode drug targets demonstrate genetic polymorphism. These variations, in many cases, have altered the targets sensitivity to the specific drug molecule and thus have a profound effect on drug efficacy and toxicity. For example, the beta (2)-adrenoreceptor, which is encoded by the ADRB2 gene, illustrates a clinically significant genetic variation in drug targets. The variable number tandem repeat polymorphisms in serotonin transporter (SERT/SLC6A4) gene are associated with response to antidepressants. The distribution of the common variant alleles of genes that encode drug metabolizing enzymes, drug transporters and drug targets has been found to vary among different populations. The promise of pharmacogenetics lies in its potential to identify the right drug at the right dose for the right individual. Drugs with a narrow therapeutic index are thought to benefit more from pharmacogenetic studies. For example, warfarin serves as a good practical example of how pharmacogenetics can be utilized prior to commencement of therapy in order to achieve maximum efficacy and minimum toxicity. As such, pharmacogenetics has the potential to achieve optimal quality use of medicines, and to improve the efficacy and safety of both prospective and licensed drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
618 Only a small portion of them are non-synonymous (V12M, Q141K, Q166E, I206L, F208S, S248P, D296H, L525R, A528T, F571I, and Y590N) and there is one frameshift (1515delC) mutation observed in the coding region of ABCG2. Login to comment

[hide] Major SNP (Q141K) variant of human ABC transporter... Pharm Res. 2009 Feb;26(2):469-79. Epub 2008 Oct 29. Furukawa T, Wakabayashi K, Tamura A, Nakagawa H, Morishima Y, Osawa Y, Ishikawa T
Major SNP (Q141K) variant of human ABC transporter ABCG2 undergoes lysosomal and proteasomal degradations.
Pharm Res. 2009 Feb;26(2):469-79. Epub 2008 Oct 29., [PMID:18958403]

Abstract [show]
PURPOSE: Single nucleotide polymorphisms (SNPs) of the ATP-binding cassette (ABC) transporter ABCG2 gene have been suggested to be a significant factor in patients' responses to medication and/or the risk of diseases. We aimed to evaluate the impact of the major non-synonymous SNP Q141K on lysosomal and proteasomal degradations. METHODS: ABCG2 WT and the Q141K variant were expressed in Flp-In-293 cells by using the Flp recombinase system. Their expression levels and cellular localization was measured by immunoblotting and immunofluorescence microscopy, respectively. RESULTS: The protein level of the Q141K variant expressed in Flp-In-293 cells was about half that of ABCG2 WT, while their mRNA levels were equal. The protein expression level of the Q141K variant increased about two-fold when Flp-In-293 cells were treated with MG132. In contrast, the protein level of ABCG2 WT was little affected by the same treatment. After treatment with bafilomycin A1, the protein levels of ABCG2 WT and Q141K increased 5- and 2-fold in Flp-In-293 cells, respectively. CONCLUSIONS: The results strongly suggest that the major non-synonymous SNP Q141K affects the stability of the ABCG2 protein in the endoplasmic reticulum and enhances its susceptibility to ubiquitin-mediated proteasomal degradation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Furthermore, the Q141K SNP was reportedly associated with a higher incidence of diarrhea in non-small cell lung cancer patients treated with gefitinib (22). Login to comment
35 Furthermore, certain SNPs, such as F208S and S441N, were found to greatly affect the stability of ABCG2 in the endoplasmic reticulum (ER) and to enhance the protein degradation rate via ubiquitination and proteasomal proteolysis (32). Login to comment
60 The sites of three non-synonymous SNPs, Q141K, F208S and S441N, are indicated. Login to comment
129 Protein expression levels of the WT and the Q141K variant were determined by immunoblotting after PNGase F treatment in the same way as described above. Login to comment
130 As shown in Fig. 3A, the protein level of the Q141K variant was approximately two-fold enhanced by treatment with the proteasome inhibitor MG132. Login to comment
174 The nonsynonymous SNP variants of Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin (42). Login to comment
175 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles (18). Login to comment
176 In particular, expression levels of the F208S and S441N variant proteins were markedly low. Login to comment
131 In particular, expression levels of the F208S and S441N variant proteins were markedly low. Login to comment
344 The sites of three nonsynonymous SNPs, Q141K, F208S and S441N, are indicated. Login to comment

[hide] Functions of the breast cancer resistance protein ... Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3. Noguchi K, Katayama K, Mitsuhashi J, Sugimoto Y
Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy.
Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3., 2009-01-31 [PMID:19111841]

Abstract [show]
The breast cancer resistance protein, BCRP/ABCG2, is a half-molecule ATP-binding cassette transporter that facilitates the efflux of various anticancer agents from the cell, including 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. The expression of BCRP can thus confer a multidrug resistance phenotype in cancer cells, and its transporter activity is involved in the in vivo efficacy of chemotherapeutic agents. Thus, the elucidation of the substrate preferences and structural relationships of BCRP is essential to understanding its in vivo functions during chemotherapeutic treatments. Single nucleotide polymorphisms (SNPs) have also been found to be key factors in determining the efficacy of chemotherapeutics, and those therapeutics that inhibit BCRP activity, such as the SNP that results in a C421A mutant, may result in unexpected side effects of the BCRP- anticancer drugs interaction even at normal dosages. In order to modulate the BCRP activity during chemotherapy, various compounds have been tested as inhibitors of this protein. Estrogenic compounds including estrone, several tamoxifen derivatives in addition to phytoestrogens and flavonoids have been shown to reverse BCRP-mediated drug resistance. Intriguingly, recently developed molecular targeted cancer drugs, such as the tyrosine kinase inhibitors imatinib mesylate, gefitinib and others, can also interact with BCRP. Since both functional SNPs and inhibitory agents of BCRP modulate the in vivo pharmacokinetics and pharmacodynamics of its substrate drugs, BCRP activity is an important consideration in the development of molecular targeted chemotherapeutics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

[hide] Quality control of human ABCG2 protein in the endo... Adv Drug Deliv Rev. 2009 Jan 31;61(1):66-72. Epub 2008 Dec 11. Wakabayashi-Nakao K, Tamura A, Furukawa T, Nakagawa H, Ishikawa T
Quality control of human ABCG2 protein in the endoplasmic reticulum: ubiquitination and proteasomal degradation.
Adv Drug Deliv Rev. 2009 Jan 31;61(1):66-72. Epub 2008 Dec 11., 2009-01-31 [PMID:19111842]

Abstract [show]
Human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR/ABCP) is a plasma membrane protein carrying intra- and inter-molecular disulfide bonds and an N-linked glycan. Both disulfide bond formation and N-glycosylation are critical check points determining the stability and degradation fate of ABCG2 protein in the endoplasmic reticulum (ER). Misfolded ABCG2 protein without those post-translational modifications is removed from the ER by retrotranslocation to the cytosol compartment, ubiquitination by ubiquitin ligase, and finally degradation by proteasomes. Certain non-synonymous SNP variants of ABCG2 undergo such ER-associated degradation (ERAD).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
813 Furthermore, certain non-synonymous single nucleotide polymorphisms (SNPs), such as Q141K, F208S, and S441N, were also found to greatly affect the stability of ABCG2 in the endoplasmic reticulum (ER) and to enhance the protein degradation rate via ubiquitination and proteasomal proteolysis [9a,b]. Login to comment
950 The non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin [54]. Login to comment
951 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles [34]. Login to comment
952 In particular, expression levels of the F208S and S441N variant proteins were markedly low [9a,34]. Login to comment
953 5.2. Impact of SNPs on protein stability and function of ABCG2 Our recent study provided evidence that F208S and S441N variant proteins did not undergo Golgi apparatus-mediated glycoprocessing but were passed through the so-called "ERAD" pathway. Login to comment
954 The immature and non-glycosylated forms of F208S and S441N were detected when Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were treated with MG132 for 24 h, suggesting that those variant proteins were ubiquitinated in both pre and post N-glycosylation reactions and then readily degraded in proteasomes. Login to comment

[hide] Intracellular trafficking of MDR transporters and ... Curr Top Med Chem. 2009;9(2):197-208. Porcelli L, Lemos C, Peters GJ, Paradiso A, Azzariti A
Intracellular trafficking of MDR transporters and relevance of SNPs.
Curr Top Med Chem. 2009;9(2):197-208., [PMID:19200005]

Abstract [show]
Multi-drug resistance (MDR) frequently contributes to the failure of chemotherapeutic treatments in cancer patients. Mechanisms underlying the development of MDR have been extensively studied and are considered multifactorial. Among them, the ATP-Binding Cassette (ABC) family of proteins plays a pivotal role. Processes of cellular distribution and subcellular localization of MDR-ABC proteins are not yet well explored and to enlighten these topics could be crucial to understand cellular drug uptake and retention. In this review, we analysed literature data concerning i) intracellular trafficking of MDR-ABC proteins (BCRP, P-gp and MRP1) and ii) mechanisms altering their cellular localization and trafficking. Moreover, we describe single nucleotide polymorphisms (SNP) that have been reported for some multidrug resistance (MDR) transporters, such as BCRP and P-gp, emphasizing their ability to affect the expression, function and localization of the transporters, with implications on drug resistance phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
206 The polymorphisms T623C (F208S), T742C (S248P), T1291C (F431L) and T1465C (F489L) were studied by Tamura et al. Login to comment
207 [98], who showed that, with the exception of the F208S variant, all SNPs exhibited similar levels of protein expression and similar cellular localization as the wild-type ABCG2, on the plasma membrane of Flp-In-293 cells. Login to comment
209 The F208S variant exhibited markedly lower levels of protein expression and drug resistance compared with the wild-type ABCG2 and it was not expressed in the plasma membrane of the Flp-In-293 cells [98]. Login to comment

[hide] Human ABC transporter ABCG2 in cancer chemotherapy... J Exp Ther Oncol. 2009;8(1):5-24. Ishikawa T, Nakagawa H
Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics.
J Exp Ther Oncol. 2009;8(1):5-24., [PMID:19827267]

Abstract [show]
The ability of cancer cells to acquire resistance to multiple anticancer agents, termed multidrug resistance, is often mediated by overexpression of ATP-binding cassette (ABC) transporters that remove drugs out of the cell against a concentration gradient. ABCG2, or breast cancer resistance protein (BCRP), is an ABC transporter that has been the subject of intense study since its discovery a decade ago. While ABCG2 overexpression has been demonstrated in cancer cells after in vitro drug treatment, endogenous ABCG2 expression in certain cancers is considered as a reflection of the differentiated phenotype of the cell of origin and likely contributes to intrinsic drug resistance. Notably, ABCG2 is often expressed in stem cell populations, where it plays a critical role in cellular protection. ABCG2 exhibits a broad range of substrate specificity. New technologies of high-speed screening and quantitative structure-activity-relationship (QSAR) analysis have been developed to analyze the interactions of drugs with ABCG2. As ABCG2 reportedly transports porphyrins, its contribution to photodynamic therapy of human cancer is also implicated. Protein expression levels of ABCG2 in cancer cells are regulated by both transcriptional activation and protein degradation. The ABCG2 protein undergoes endosomal and/or ubiquitin-mediated proteasomal degradations. Furthermore, genetic polymorphisms in the ABCG2 gene are important factors in cancer chemotherapy to circumvent adverse effects and/or to enhance the efficacy of anticancer drugs. The present review article addresses recent advances in molecular pharmacology and pharmacogenomics of ABCG2 and provides novelideas to improve cancer chemotherapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
222 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I OUT IN R160Q R575stop ATP-binding site Figure 7. Continued A 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:50 19 Q141K has been associated with lower levels of protein expression and impaired transport in vitro (Imai et al., 2002; Kobayashi et al., 2005; Misuarai et al., 2004; Zamber et al., 2003; Morisaki et al., 2008; Kondo et al., 2004). Login to comment
227 The non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin (Tamura et al., 2006) (Fig. 7C). Login to comment
228 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles Figure 7. Continued WT V12M Q141K F208S S248P F431L S441N F489L R482G R482T Protein expression + + + - + + - + + + MTX transport + + + - - - - +/ - - Porphyrin transport + + + - - + - +/ + + SN-38 resistance + + + - +/ + - - + + MX resistance + + + - - - - - -- - - - - - - - +/ - - - - - - - - + + Doxorubicin resistance + + Daunorubicin resistance + + ATPase activity (Prazosin) + + WTV12M Q141K F431L F489L S248P F208S S441L R482G R482T ∆1.5 ∆3 ∆3.5 ∆5 ∆4 - - - - - - -- - - B 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:51 20 Journal of Experimental Therapeutics and Oncology Vol. 8 2009 (Tamura et al., 2007b). Login to comment
229 In particular, expression levels of the F208S and S441N variant proteins were markedly low (Tamura et al., 2007b). Login to comment
230 We have recently shown that F208S and S441N variant proteins do not undergo Golgi apparatus-mediated glycoprocessing but are passed through the so-called "ERAD" pathway. Login to comment
231 The immature and non-glycosylated forms of F208S and S441N were detected when Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were treated with MG132 for 24 h, suggesting that those variant proteins were ubiquitinated in both pre and post N-glycosylation reactions and then readily degraded in proteasomes. Login to comment
232 It is known that, in the ER, the N-linked glycans play pivotal roles in protein fold- 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) Methotrexate 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) MethotrexateMethotrexate Porphyrintransport (nmol/min/mgprotein) 0.0 0.1 0.2 0.3 0.4 0.5 0.0 0.1 0.2 0.3 0.4 0.5 Porphyrin Figure 7. Login to comment

[hide] Disruption of N-linked glycosylation enhances ubiq... FEBS J. 2009 Dec;276(24):7237-52. Epub . Nakagawa H, Wakabayashi-Nakao K, Tamura A, Toyoda Y, Koshiba S, Ishikawa T
Disruption of N-linked glycosylation enhances ubiquitin-mediated proteasomal degradation of the human ATP-binding cassette transporter ABCG2.
FEBS J. 2009 Dec;276(24):7237-52. Epub ., [PMID:19909340]

Abstract [show]
The human ATP-binding cassette (ABC) transporter, ABCG2 (BCRP/MXR/ABCP), is a plasma membrane protein containing intramolecular and intermolecular disulfide bonds and an N-linked glycan at Asn596. We have recently reported that the intramolecular disulfide bond is a critical checkpoint for determining the degradation fates of ABCG2. In the present study, we aimed to analyze quantitatively the impact of the N-linked glycan on the protein stability of ABCG2. For this purpose, we incorporated one single copy of ABCG2 cDNA into a designated site of genomic DNA in Flp-In-293 cells to stably express ABCG2 or its variant proteins. When ABCG2 wild type-expressing cells were incubated with various N-linked glycosylation inhibitors, tunicamycin profoundly suppressed the protein expression level of ABCG2 and, accordingly, reduced the ABCG2-mediated cellular resistance to the cancer chemotherapeutic SN-38. When Asn596 was converted to Gln596, the resulting variant protein was not glycosylated, and its protein level was about one-third of the wild type level in Flp-In-293 cells. Treatment with MG132, a proteasome inhibitor, increased the level of the variant protein. Immunoblotting with anti-ubiquitin IgG1k after immunoprecipitation of ABCG2 revealed that the N596Q protein was ubiquitinated at levels that were significantly enhanced by treatment with MG132. Immunofluorescence microscopy demonstrated that treatment with MG132 increased the level of ABCG2 N596Q protein both in intracellular compartments and in the plasma membrane. In conclusion, we propose that the N-linked glycan at Asn596 is important for stabilizing de novo-synthesized ABCG2 and that disruption of this linkage results in protein destabilization and enhanced ubiquitin-mediated proteasomal degradation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 In fact, the protein expression levels of ABCG2 SNP variants (Q141K, F208S and S441N) were significantly lower than that of the wild-type (WT) ABCG2 [23]. Login to comment

[hide] Impact of breast cancer resistance protein on canc... Methods Mol Biol. 2010;596:251-90. Ross DD, Nakanishi T
Impact of breast cancer resistance protein on cancer treatment outcomes.
Methods Mol Biol. 2010;596:251-90., [PMID:19949928]

Abstract [show]
Breast cancer resistance protein (BCRP/ABCG2) was discovered in multidrug resistant breast cancer cells having an ATP-dependent transport-based resistance phenotype. This ABC transporter functions (at least in part) as a xenobiotic protective mechanism for the organism: in the gut and biliary tract, it prevents absorption and enhances elimination of potentially toxic substances. As a placental barrier, it protects the fetus; similarly, it serves as a component of blood-brain and blood-testis barrier; BCRP is expressed in stem cells and may protect them from potentially harmful agents. Therefore, BCRP could influence cancer outcomes by (a) endogenous BCRP affecting the absorption, distribution, metabolism, and elimination of anticancer drugs; (b) BCRP expression in cancer cells may directly cause resistance by active efflux of anticancer drugs; (c) BCRP expression in cancer cells could be a manifestation of the activity of metabolic and signaling pathways that impart multiple mechanisms of drug resistance, self-renewal (stemness), and invasiveness (aggressiveness)--i.e. impart a poor prognosis--to cancers. This chapter presents a synopsis of translational clinical studies relating BCRP expression in leukemias, lymphomas, and a variety of solid tumors with clinical outcome. Data are emerging that expression of BCRP, like P-glycoprotein/ABCB1, is associated with adverse outcomes in a variety of human cancers. Whether this adverse prognostic effect results from resistance imparted to the cancer cells as the direct result of BCRP efflux of anticancer drugs, or whether BCRP expression (and also Pgp expression - coexpression of these transporters is common among poor risk cancers) serves as indicators of the activity of signaling pathways that enhance cancer cellular proliferation, metastases, genomic instability, enhance drug resistance, and oppose programmed cell death mechanisms is yet unknown.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 Tamura et al. used multicolor fluorescence in situ hybridization to assure uniform mRNA expression of cDNAs of seven BCRP SNPs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) transduced into Flp-In-293 cells (87, 88). Login to comment
94 Protein expression from the F208S and S441N variants was found to be low; the V12M and Q141K alleles had IC50 s for SN-38 that were approximately half that of the wild-type; all the other alleles examined had significantly lower IC50 values for SN-38, mitoxantrone, doxorubicin, daunorubicin and etoposide when compared with wild type alleles (88). Login to comment

[hide] BCRP/ABCG2 confers anticancer drug resistance with... Cancer Sci. 2010 Aug;101(8):1813-21. Epub 2010 Apr 28. Shigeta J, Katayama K, Mitsuhashi J, Noguchi K, Sugimoto Y
BCRP/ABCG2 confers anticancer drug resistance without covalent dimerization.
Cancer Sci. 2010 Aug;101(8):1813-21. Epub 2010 Apr 28., [PMID:20518788]

Abstract [show]
In previous studies, we demonstrated that the breast cancer resistance protein (BCRP, ABCG2) forms an S-S homodimer. The BCRP-C603S mutant substituting Ser for Cys-603 in the third extracellular domain formed both a 70-75-kDa monomer and 140-150-kDa dimer, suggesting that Cys-603 is an important residue in the covalent bridge. These results also suggested the involvement of other Cys residues in dimer formation. In the present study, we examined the possible involvement of the other extracellular Cys residues, Cys-592 and Cys-608, in the dimerization and transporter functions of BCRP using double and triple Cys-mutant BCRP transfectants. In SDS-PAGE under non-reducing conditions, BCRP-C592S.C603S and BCRP-C592S.C608S were detected as dimers whereas BCRP-C603S.C608S and BCRP-C592S.C603S.C608S were found only as monomers. This finding indicated that no Cys residues other than the three extracellular Cys are responsible for the dimer formation. The formation of BCRP-C592S.C603S dimer suggested the involvement of Cys-608 in the covalent linkage of this mutant BCRP. PA/C592S.C603S.C608S-cl.7 cells showed a significant level of multiple drug resistance and low-level accumulation of mitoxantrone. These results clearly demonstrate that BCRP functions as a drug resistance protein without covalent dimerization. Among drug-resistant Cys-mutant BCRP transfectants, PA/C603S, PA/C592S.C608S, and PA/C592S.C603S.C608S were found to be more resistant to the reversal effects of fumitremorgin C than PA/WT, suggesting some alteration in the substrate recognition in Cys-mutant BCRPs. In conclusion, Cys-mediated covalent dimerization is not required for BCRP to function as a transporter. In addition to Cys-603, Cys-608 may also be involved in BCRP dimer formation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
260 We have also reported that two germ line mutations of BCRP in our laboratory, namely 623T>C (F208S) and 1291T>C (F431L), also resulted in the loss of function or severely reduced the function of BCRP. Login to comment

[hide] Production of cells with targeted integration of g... Methods Mol Biol. 2010;648:139-59. Wakabayashi-Nakao K, Tamura A, Koshiba S, Toyoda Y, Nakagawa H, Ishikawa T
Production of cells with targeted integration of gene variants of human ABC transporter for stable and regulated expression using the Flp recombinase system.
Methods Mol Biol. 2010;648:139-59., [PMID:20700710]

Abstract [show]
The vector-mediated introduction of cDNA into mammalian cells by calcium phosphate co-precipitation or permeation with lipofectamine is widely used for the integration of cDNA into genomic DNA. Such integration, however, of cDNA occurs randomly at unpredictable sites in the host's chromosomal DNA, and the number of integrated recombinant DNAs is not controllable. To overcome this problem, we developed the Flp-In method to integrate one single copy of cDNA encoding the human ABC transporter ABCG2 into FRT-tagged genomic DNA. Examination of more than 20 metaphase spreads for both fluorescence in situ hybridization (FISH) mapping and multicolor-FISH analysis revealed that ABCG2 cDNA was incorporated into the telomeric region of the short arm on one of chromosomes 12 in Flp-In-293 cells. By using those cells, we investigated the effect of genetic polymorphisms and post-translational modifications of human ABC transporter ABCG2 on the protein expression and degradation. On the basis of our experience, it has been concluded that the Flp recombinase system provides a useful tool to quantitatively analyze the protein stability and endoplasmic reticulum (ER)-associated degradation of proteins like the ABC transporter. This system is also applicable for similar studies of the biogenesis of other proteins using the secretory pathway as well as proteins with other cellular localizations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Furthermore, certain non-synonymous single nucleotide polymorphisms (SNPs), such as Q141K, F208S, and S441N, were also found to greatly affect the stability of ABCG2 in the ER and to enhance the protein degradation rate via ubiquitination and proteasomal proteolysis in Flp-In-293 cells (22-27) (Fig. 1). Login to comment
226 It was of great interest to know how the inhibition of proteasomal protein degradation by MG132 affects the cellular localization of the F208S and S441N variant proteins (see Notes 5 and 6). Login to comment
245 Figure 3a depicts a schematic illustration of the human ABCG2 protein to indicate the sites of amino acid alteration in the SNP variants of F208S and S441N. Login to comment
247 Notes F208S, and S441N were individually expressed in Flp-In-293 cells by using the Flp recombinase system. Login to comment
248 As shown in Fig. 3b, mRNA levels of ABCG2 WT as well as F208S and S441N were evenly represented in Flp-In-293 cells, where the mRNA levels of ABCG2 and GAPDH were measured by RT-PCR. Login to comment
249 On the other hand, ABCG2 WT, F208S, and S441N as well as GAPDH proteins were detected by immunoblotting, and their expression levels were quantified. Login to comment
253 Schematic illustration of human ABCG2 as well as the expression of ABCG2 WT, F208S, and S441N in Flp-In-293 cells at the mRNA and protein levels. Login to comment
254 (a) Arrows indicate the positions of amino acid substitutions (Phe208Ser and Ser441Asn) in the non-synonymous SNP variants of F208S and S441N. Login to comment
259 (b) The mRNA level was analyzed by RT-PCR with total RNA extracted from Flp-In-293 cells expressing ABCG2 WT, F208S, or S441N. Login to comment
265 Although mRNA levels were almost the same in the WT and SNP variants (F208S and S441N), protein levels of those variants were markedly decreased (Fig. 3d). Login to comment
268 Figure 4a shows the effect of ME treatments on the SDS-PAGE migration of ABCG2 WT, F208S, and S441N proteins. Login to comment
270 Immunoblot detection of ABCG2 WT, F208S, and S441N proteins expressed in Flp-In-293 cells. Login to comment
271 (a) Effect of mercaptoethanol (ME) on the status (homodimer or monomer) of ABCG2 WT and the SNP variants. Cell lysate samples (20 mg of protein) were subjected to SDS-PAGE after treatments with or without ME; and, thereafter, ABCG2 WT, F208S, and S441N proteins were detected by immunoblotting with the BXP-21 antibody, as described in Subheading 3.3.3. Login to comment
272 By ME treatments, ABCG2 WT, F208S, and S441N proteins were changed from homodimers to monomers. Login to comment
273 (b) Effect of Endo H or PNGase F treatments on the glycosylated status of ABCG2 WT and the SNP variants. Cell lysate samples (20 mg of protein) were treated with Endo H or PNGase F, as described in Subheading 3.3.3.ABCG2 WT, F208S, and S441N proteins in the resulting samples were analyzed by immunoblotting with the BXP-21 antibody.The apparent molecular weights of mature and non-glycosylated ABCG2 WT were 81,000 and 72,000, respectively. Login to comment
280 These results provide evidence that F208S and S441N proteins form homodimers through a cysteinyl disulfide bond as does the ABCG2 WT protein. Login to comment
285 In the case of the F208S variant, one faint band was detected at the apparent molecular weight of 74,000 by the same sample processing and immunoblotting experiment. Login to comment
289 Although the major band (M.W. = 81,000) of ABCG2 WT was not at all affected by the Endo H treatment, the apparent molecular weights of the smaller protein bands of F208S (M.W. = 74,000) and S441N (M.W. = 78,000) decreased after the Endo H treatment. Login to comment
292 The matured N-linked oligosaccharide of ABCG2 WT may have a structure resistant to Endo H, whereas the immature N-linked oligosaccharides of the F208S and S441N variant proteins are susceptible to this endoglycosidase. Login to comment
295 Flp-In-293 cells expressing F208S or S441N were incubated in the presence of MG132 at different concentrations (0, 0.4, 2.0 mM) for 24 h, and then cell lysate samples were immediately prepared. Login to comment
296 Protein expression levels of the F208S and S441N variants were determined by immunoblotting after PNGase F treatments in the same way as described above. Login to comment
299 After the 24-h treatment with 2 mM MG132, F208S and S441N protein levels were increased 12-and 6-fold, respectively. Login to comment
301 Effects of MG132 on the glycosylation status and protein levels of ABCG2 F208S and S441N variants expressed in Flp-In-293 cells. Login to comment
302 (a) Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were incubated with MG132 at concentrations of 0, 0.4, 2 mM for 24 h. Login to comment
304 ABCG2 F208S and S441N variant proteins were analyzed by immunoblotting with the ABCG2-specific monoclonal antibody (BXP-21) either directly or after PNGase F treatment.The signal intensity of the non-glycosylated form of the ABCG2 F208S or S441N variant was measured after PNGase F treatment.The intensities are represented as ratios relative to the ABCG2 level in MG132-untreated cells. Login to comment
308 (b) Detection of aggregated forms (M.W. > 200,000) of ABCG2 F208S and S441N variants. Login to comment
309 Flp-In-293/ABCG2 (F208S) and Flp-In-293/ ABCG2 (S441N) cells were incubated with MG132 at concentrations of 0, 0.4, 2 mM for 24 h. Login to comment
310 Cell lysate samples (20 mg of protein) were prepared in the presence of ME.ABCG2 F208S and S441N variant proteins were prepared from MG132-treated cells as described above and analyzed by immunoblotting with the BXP-21 antibody without PNGase F treatment. Login to comment
311 The aggregated forms of ABCG2 F208S and S441N are indicated by arrowheads. Login to comment
315 non-glycosylated form (M.W. = 72,000) for both F208S and S441N variants, where those cell lysate samples were not treated with PNGase F (Fig. 5a). Login to comment
316 More importantly, upon the immunoblot analysis without PNGase F treatments, aggregated forms (indicated by arrowheads in Fig. 5b) of both F208S and S441N variants were detected in the high molecular weight range of over 200,000. Login to comment
318 It was of great interest to know how the inhibition of proteasomal protein degradation by MG132 affects the cellular localization of the F208S and S441N variant proteins. Login to comment
323 Immunocytochemical staining of Flp-In-293 cells expressing ABCG2 S441N protein (a) and immunoelectron microscopic image of Flp-In-293 cells expressing ABCG2 F208S protein (b). Login to comment

[hide] Structure and function of the human breast cancer ... Curr Drug Metab. 2010 Sep;11(7):603-17. Ni Z, Bikadi Z, Rosenberg MF, Mao Q
Structure and function of the human breast cancer resistance protein (BCRP/ABCG2).
Curr Drug Metab. 2010 Sep;11(7):603-17., [PMID:20812902]

Abstract [show]
The human breast cancer resistance protein (BCRP/ABCG2) is the second member of the G subfamily of the large ATP-binding cassette (ABC) transporter superfamily. BCRP was initially discovered in multidrug resistant breast cancer cell lines where it confers resistance to chemotherapeutic agents such as mitoxantrone, topotecan and methotrexate by extruding these compounds out of the cell. BCRP is capable of transporting non-chemotherapy drugs and xenobiotiocs as well, including nitrofurantoin, prazosin, glyburide, and 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine. BCRP is frequently detected at high levels in stem cells, likely providing xenobiotic protection. BCRP is also highly expressed in normal human tissues including the small intestine, liver, brain endothelium, and placenta. Therefore, BCRP has been increasingly recognized for its important role in the absorption, elimination, and tissue distribution of drugs and xenobiotics. At present, little is known about the transport mechanism of BCRP, particularly how it recognizes and transports a large number of structurally and chemically unrelated drugs and xenobiotics. Here, we review current knowledge of structure and function of this medically important ABC efflux drug transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
249 A systematic study of 18 natural variants of BCRP expressed in insect cells showed that the variants Q126stop, F208S, S248P, E334stop, and S441N were defective in porphyrin transport, whereas F489L displayed approximately 10% of the transport activity of wild-type BCRP [120]. Login to comment

[hide] In vitro and in vivo evidence for the importance o... Handb Exp Pharmacol. 2011;(201):325-71. Meyer zu Schwabedissen HE, Kroemer HK
In vitro and in vivo evidence for the importance of breast cancer resistance protein transporters (BCRP/MXR/ABCP/ABCG2).
Handb Exp Pharmacol. 2011;(201):325-71., [PMID:21103975]

Abstract [show]
The breast cancer resistance protein (BCRP/ABCG2) is a member of the G-subfamiliy of the ATP-binding cassette (ABC)-transporter superfamily. This half-transporter is assumed to function as an important mechanism limiting cellular accumulation of various compounds. In context of its tissue distribution with localization in the sinusoidal membrane of hepatocytes, and in the apical membrane of enterocytes ABCG2 is assumed to function as an important mechanism facilitating hepatobiliary excretion and limiting oral bioavailability, respectively. Indeed functional assessment performing mouse studies with genetic deletion or chemical inhibition of the transporter, or performing pharmacogenetic studies in humans support this assumption. Furthermore the efflux function of ABCG2 has been linked to sanctuary blood tissue barriers as described for placenta and the central nervous system. However, in lactating mammary glands ABCG2 increases the transfer of substrates into milk thereby increasing the exposure to potential noxes of a breastfed newborn. With regard to its broad substrate spectrum including various anticancer drugs and environmental carcinogens the function of ABCG2 has been associated with multidrug resistance and tumor development/progression. In terms of cancer biology current research is focusing on the expression and function of ABCG2 in immature stem cells. Recent findings support the notion that the physiological function of ABCG2 is involved in the elimination of uric acid resulting in higher risk for developing gout in male patients harboring genetic variants. Taken together ABCG2 is implicated in various pathophysiological and pharmacological processes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
256 Similar results were obtained for the c.623T>C (p.F208S, AF not determined) variant (Nakagawa et al. 2008; Tamura et al. 2006). Login to comment

[hide] Posttranslational negative regulation of glycosyla... Biochem Biophys Res Commun. 2011 Jan 21;404(3):853-8. Epub 2010 Dec 22. Sugiyama T, Shuto T, Suzuki S, Sato T, Koga T, Suico MA, Kusuhara H, Sugiyama Y, Cyr DM, Kai H
Posttranslational negative regulation of glycosylated and non-glycosylated BCRP expression by Derlin-1.
Biochem Biophys Res Commun. 2011 Jan 21;404(3):853-8. Epub 2010 Dec 22., 2011-01-21 [PMID:21184741]

Abstract [show]
Human breast cancer resistance protein (BCRP)/MXR/ABCG2 is a well-recognized ABC half-transporter that is highly expressed at the apical membrane of many normal tissues and cancer cells. BCRP facilitates disposition of endogenous and exogenous harmful xenobiotics to protect cells/tissues from xenobiotic-induced toxicity. Despite the enormous impact of BCRP in the physiological and pathophysiological regulation of the transport of a wide variety of substrates, little is known about the factors that regulate posttranslational expression of BCRP. Here, we identified Derlin-1, a member of a family of proteins that bears homology to yeast Der1p, as a posttranslational regulator of BCRP expression. Overexpression of Derlin-1 suppressed ER to Golgi transport of wild-type (WT) BCRP that is known to be efficiently trafficked to the plasma membrane. On the other hand, protein expression of N596Q variant of BCRP, N-linked glycosylation-deficient mutant that preferentially undergoes ubiquitin-mediated ER-associated degradation (ERAD), was strongly suppressed by the overexpression of Derlin-1, whereas knockdown of Derlin-1 stabilized N596Q protein, suggesting a negative regulatory role of Derlin-1 for N596Q protein expression. Notably, knockdown of Derlin-1 also stabilized the expression of tunicamycin-induced deglycosylated WT BCRP protein, implying the importance of glycosylation state for the recognition of BCRP by Derlin-1. Thus, our data demonstrate that Derlin-1 is a negative regulator for both glycosylated and non-glycosylated BCRP expression and provide a novel posttranslational regulatory mechanism of BCRP by Derlin-1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 Moreover, the certain single nucleotide polymorphism (SNP) variants of BCRP (Q141K, F208S and S441N), which protein expression was markedly low despite the functional expression of mRNA, were also degraded by ERAD [10,11]. Login to comment
162 These include naturally occurring SNPs variants of BCRP such as Q141K, F208S and S441N [10,11]. Login to comment

[hide] Key Role of Human ABC Transporter ABCG2 in Photody... Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8. Ishikawa T, Nakagawa H, Hagiya Y, Nonoguchi N, Miyatake S, Kuroiwa T
Key Role of Human ABC Transporter ABCG2 in Photodynamic Therapy and Photodynamic Diagnosis.
Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8., [PMID:21188243]

Abstract [show]
Accumulating evidence indicates that ATP-binding cassette (ABC) transporter ABCG2 plays a key role in regulating the cellular accumulation of porphyrin derivatives in cancer cells and thereby affects the efficacy of photodynamic therapy and photodynamic diagnosis. The activity of porphyrin efflux can be affected by genetic polymorphisms in the ABCG2 gene. On the other hand, Nrf2, an NF-E2-related transcription factor, has been shown to be involved in oxidative stress-mediated induction of the ABCG2 gene. Since patients have demonstrated individual differences in their response to photodynamic therapy, transcriptional activation and/or genetic polymorphisms of the ABCG2 gene in cancer cells may affect patients' responses to photodynamic therapy. Protein kinase inhibitors, including imatinib mesylate and gefitinib, are suggested to potentially enhance the efficacy of photodynamic therapy by blocking ABCG2-mediated porphyrin efflux from cancer cells. This review article provides an overview on the role of human ABC transporter ABCG2 in photodynamic therapy and photodynamic diagnosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
167 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells [41, 90]. Login to comment
168 The variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin (Figure 4(b)). Login to comment
170 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a. Login to comment
177 Gefitinib and imatinib are new anticancer drugs Outside Plasma membrane Inside H2N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S ATP-binding cassette (a) 0 0.1 0.3 0.4 0.2 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrin transport(nmol/min/mgprotein) (b) Figure 4: (a) Schematic illustration of human ABCG2 and its nonsynonymous polymorphisms. Login to comment

[hide] CXCR6, a newly defined biomarker of tissue-specifi... PLoS One. 2010 Dec 22;5(12):e15183. Taghizadeh R, Noh M, Huh YH, Ciusani E, Sigalotti L, Maio M, Arosio B, Nicotra MR, Natali P, Sherley JL, La Porta CA
CXCR6, a newly defined biomarker of tissue-specific stem cell asymmetric self-renewal, identifies more aggressive human melanoma cancer stem cells.
PLoS One. 2010 Dec 22;5(12):e15183., [PMID:21203549]

Abstract [show]
BACKGROUND: A fundamental problem in cancer research is identifying the cell type that is capable of sustaining neoplastic growth and its origin from normal tissue cells. Recent investigations of a variety of tumor types have shown that phenotypically identifiable and isolable subfractions of cells possess the tumor-forming ability. In the present paper, using two lineage-related human melanoma cell lines, primary melanoma line IGR39 and its metastatic derivative line IGR37, two main observations are reported. The first one is the first phenotypic evidence to support the origin of melanoma cancer stem cells (CSCs) from mutated tissue-specific stem cells; and the second one is the identification of a more aggressive subpopulation of CSCs in melanoma that are CXCR6+. METHODS/FINDINGS: We defined CXCR6 as a new biomarker for tissue-specific stem cell asymmetric self-renewal. Thus, the relationship between melanoma formation and ABCG2 and CXCR6 expression was investigated. Consistent with their non-metastatic character, unsorted IGR39 cells formed significantly smaller tumors than unsorted IGR37 cells. In addition, ABCG2+ cells produced tumors that had a 2-fold greater mass than tumors produced by unsorted cells or ABCG2- cells. CXCR6+ cells produced more aggressive tumors. CXCR6 identifies a more discrete subpopulation of cultured human melanoma cells with a more aggressive MCSC phenotype than cells selected on the basis of the ABCG2+ phenotype alone. CONCLUSIONS/SIGNIFICANCE: The association of a more aggressive tumor phenotype with asymmetric self-renewal phenotype reveals a previously unrecognized aspect of tumor cell physiology. Namely, the retention of some tissue-specific stem cell attributes, like the ability to asymmetrically self-renew, impacts the natural history of human tumor development. Knowledge of this new aspect of tumor development and progression may provide new targets for cancer prevention and treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 First, as shown in Table 1, we analyzed three polymorphisms C/A (421 C.A), C/T (S248T) and C/T (F208S) in the unsorted populations and in the ABCG2+ and ABCG2- sorted subpopulations revealing a heterozygous status of ABCG2 for all the three polymorphisms. Login to comment
83 Moreover, F208S and S248P polymorphisms were associated with defective active transport of methotrexate and haematoporphyrin [24]; and, in particular, F208S variant proteins (both-glycosylated and immature forms) are recognized as misfolded proteins by putative ''check point`` systems and readily undergo ubiquination and protein degradation in proteasomes [25]. Login to comment
103 Cells 421 C.A (C/A) S248P (C/T) F208S (C/T) IGR37 CA CT CT IGR39 CA CT CT ABCG2+ IGR37 CA CT CT ABCG2- IGR37 CA CT CT ABCG2+ IGR39 CA CT CT ABCG2- IGR39 CA CT CT doi:10.1371/journal.pone.0015183.t001 unsorted IGR37 cells (0.13 grams vs. 1.4 grams, respectively; p,0.01) 2 months after the injection of the cells (Table 1). Login to comment
297 SNP analysis DNA was extracted from cells using a salting-out method [28] Genotyping for ABCG2 421 C.A (assay ID: C__15854163_70), S248P (assay ID: C__27458615_40) and F208S (assay ID: C__8826940_10) single nucleotide polymorphisms (SNPs) were performed using Validated TaqMan Genotyping Assay (Applied Biosystems). Login to comment

[hide] Ubiquitin-mediated proteasomal degradation of ABC ... J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12. Nakagawa H, Toyoda Y, Wakabayashi-Nakao K, Tamaki H, Osumi M, Ishikawa T
Ubiquitin-mediated proteasomal degradation of ABC transporters: a new aspect of genetic polymorphisms and clinical impacts.
J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12., [PMID:21567408]

Abstract [show]
The interindividual variation in the rate of drug metabolism and disposition has been known for many years. Pharmacogenomics dealing with heredity and response to drugs is a part of science that attempts to explain variability of drug responses and to search for the genetic basis of such variations or differences. Genetic polymorphisms of drug metabolizing enzymes and drug transporters have been found to play a significant role in the patients' responses to medication. Accumulating evidence demonstrates that certain nonsynonymous polymorphisms have great impacts on the protein stability and degradation, as well as the function of drug metabolizing enzymes and transporters. The aim of this review article is to address a new aspect of protein quality control in the endoplasmic reticulum and to present examples regarding the impact of nonsynonymous single-nucleotide polymorphisms on the protein stability of thiopurine S-methyltransferase as well as ATP-binding cassette (ABC) transporters including ABCC4, cystic fibrosis transmembrane conductance regulator (CFTR, ABCC7), ABCC11, and ABCG2. Furthermore, we will discuss the molecular mechanisms underlying posttranslational modifications (intramolecular and intermolecular disulfide bond formation and N-linked glycosylation) and ubiquitin-mediated proteasomal degradation of ABCG2, one of the major drug transporter proteins in humans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
155 Effect of Mutations and Nonsynonymous SNPs on Protein Trafficking, Maturation, or ERAD of ABC Transporters Protein AA Mutation/SNP Effect on Protein Reference ABCA1 W590S Mutation Functional defect 115 R587W Mutation Impaired glycol processing 115 Q597R Mutation Impaired glycol processing, ERAD 115,116 Y1532C Mutation Altered protein trafficking 117 R1925Q Mutation Altered protein trafficking 118 ABCA3 R43L Mutation Altered protein trafficking 119 L101P Mutation Altered protein trafficking 119 R280C Mutation Altered protein trafficking 119 ABCA4 L541P Mutation Mislocalization 120 R602W Mutation Mislocalization 120 A1038V Mutation Mislocalization 120 C1490Y Mutation Mislocalization 120 ABCB1a G268V Mutation ERAD 121 G341C Mutation ERAD 121 I1196S Mutation Reduced glycosylation 122 ABCB4 I541F Mutation Accumulation in ER 123 ABCB11a E135K Mutation Reduced level of mature protein 124 L198P Mutation Reduced level of mature protein 124 E297G Mutation Reduced level of mature protein 124 L413W Mutation Reduced level of mature protein 124 R432T Mutation Reduced level of mature protein 124 D482G Mutation Immature protein in ER 124,125 N490D Mutation Reduced level of mature protein 124 A570T Mutation Reduced level of mature protein 124 T655I Mutation Reduced level of mature protein 124 Y818F SNP Moderate reduction of protein 124 G982R Mutation Retention in ER 125 R1153C Mutation ERAD 125 R1286Q Mutation Retention in ER 125 ABCC2a R768W Mutation Impaired protein trafficking 126 I1173F Mutation Impaired protein maturation 127 R1392 Mutation Impaired protein maturation 128 M1393 Mutation Impaired protein maturation 129 ABCC4a E757K SNP Altered protein trafficking 23 ABCC7 F508 Mutation Misfolding, ERAD 36-39,130 G85E Mutation Impaired protein maturation 130-132 G91R Mutation Impaired protein maturation 130-132 N1303K Mutation Impaired protein maturation 130-132 ABCC8 WT Wild type Ubiquitin-proteasome degradation 133 A116P Mutation Ubiquitin-proteasome degradation 133 V187D Mutation Ubiquitin-proteasome degradation 133 F1388 Mutation Impaired protein trafficking 134 L1544P Mutation Impaired protein trafficking 135,136 ABCC11a G180R SNP Ubiquitin-proteasome degradation 50 27 Mutation Ubiquitin-proteasome degradation 50 ABCG2a V12M SNP Altered protein localization 96 Q141K SNP Ubiquitin-proteasome degradation 102 F208S SNP Ubiquitin-proteasome degradation 78,99 S441N SNP Ubiquitin-proteasome degradation 78,99 Mutations of ABCA1, ABCA3, ABCA4, ABCB4, ABCB11, ABCC2, ABCC7 (CFTR), and ABCC8 are associated with Tangier disease, fatal surfactant deficiency, Stargardt disease, progressive familial intrahepatic cholestasis type 3 (PFIC-3), progressive familial intrahepatic cholestasis type 2 (PFIC-2), Dubin-Johnson syndrome, cystic fibrosis, and familial hyperinsulinism, respectively. Login to comment
76 Furthermore, the nonsynonymous SNPs of Q141K, F208S, and S441N (Fig. 4) have been found to greatly affect APCG2 protein levels in the plasma membrane. Login to comment
78 Q141K (Gln141Lys), F208S (Phe208Ser), and S441N (Ser441Asn) are nonsynonymous SNPs that cause the reduced expression of ABCG2 protein. Login to comment
118 Impact of SNPs on Protein Stability and ERAD of ABCG2 By functional validation in vitro, the above-mentioned 17 nonsynonymous polymorphisms of ABCG2 were classified into four groups.99 The nonsynonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin.100 The F208S, S248P, F431L, S441N, and F489L variants, on the contrary, exhibited greatly reduced protein expression levels and drug resistance profiles.99 In particular, expression levels of the F208S and S441N variant proteins were markedly low.99 These variant proteins do not undergo Golgi apparatus-mediated glycoprocessing but are passed through the ERAD pathway.78 The immature and nonglycosylated forms of F208S and S441N (Fig. 6a) were detected. Login to comment
119 When Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were treated with MG132 for 24 h, the protein levels of F208S and S441N variants were greatly enhanced (Fig. 6a). Login to comment
121 Immunoelectron microscopy has clearly demonstrated that aggresomes were formed in Flp-In-293/ABCG2 (F208S) cells treated with MG132 (Fig. 6c). Login to comment
128 Effects of MG132 on the glycosylation status and protein levels of ABCG2 F208S, and S441N variants expressed in Flp-In-293 cells. Login to comment
129 (a) Flp-In-293 cells expressing ABCG2 F208S or S441N variants were incubated with MG132 at concentrations of 0, 0.4, and 2 :M for 24 h. Cell lysate samples (20 :g of protein) were prepared in the presence of 2-mercaptethanol (ME). Login to comment
130 ABCG2 F208S, and S441N variant proteins were analyzed by immunoblotting with the ABCG2- specific monoclonal antibody (BXP-21) either directly or after PNGase F treatment. The signal intensity of the nonglycosylated form of the ABCG2 F208S or S441N variant was measured after PNGase F treatment. The intensities are represented as ratios relative to the ABCG2 level in MG132-untreated cells. Data are expressed as mean values ± SD in triplicate experiments (* p < 0.05). Login to comment
133 (b) Detection of aggregated forms (MW > 200,000) of ABCG2 F208S and S441N variants. Login to comment
134 Flp-In-293/ABCG2 (F208S) and Flp-In-293/ ABCG2 (S441N) cells were incubated with MG132 at concentrations of 0, 0.4, and 2 :M for 24 h. Cell lysate samples (20 :g of protein) were prepared in the presence of ME. Login to comment
135 ABCG2 F208S and S441N variant proteins were prepared from MG132-treated cells and analyzed by immunoblotting with the BXP-21 antibody without PNGase F treatment. The aggregated forms of ABCG2 F208S and S441N are indicated by arrowheads. Login to comment
136 (c) Immunoelectron microscopic image of Flp-In-293 cells expressing ABCG2 F208S protein. Login to comment

[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]

Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6589 Absent C421A Q141K 2 Normal/reduced G445C A149P ↔ Normal G448A R163K ↔ Normal C496G Q166E ↔ Normal/reduced A616C I206L 2↔ Normal T623C F208S N.D. Reduced T742C S248P N.D. Normal C805T P269S 2↔ Normal T1291C F431L 2 Normal/reduced G1322A S441N 2 Reduced T1465C F489L 2↔ Normal/reduced A1768T N590Y 2↔ Increased G1858A D620N 2↔ Normal 2, reduced function; ↔, no change in function; N.D. not determined. Login to comment

[hide] Role of breast cancer resistance protein (BCRP/ABC... Biochem Pharmacol. 2012 Apr 15;83(8):1084-103. Epub 2012 Jan 11. Natarajan K, Xie Y, Baer MR, Ross DD
Role of breast cancer resistance protein (BCRP/ABCG2) in cancer drug resistance.
Biochem Pharmacol. 2012 Apr 15;83(8):1084-103. Epub 2012 Jan 11., [PMID:22248732]

Abstract [show]
Since cloning of the ATP-binding cassette (ABC) family member breast cancer resistance protein (BCRP/ABCG2) and its characterization as a multidrug resistance efflux transporter in 1998, BCRP has been the subject of more than two thousand scholarly articles. In normal tissues, BCRP functions as a defense mechanism against toxins and xenobiotics, with expression in the gut, bile canaliculi, placenta, blood-testis and blood-brain barriers facilitating excretion and limiting absorption of potentially toxic substrate molecules, including many cancer chemotherapeutic drugs. BCRP also plays a key role in heme and folate homeostasis, which may help normal cells survive under conditions of hypoxia. BCRP expression appears to be a characteristic of certain normal tissue stem cells termed "side population cells," which are identified on flow cytometric analysis by their ability to exclude Hoechst 33342, a BCRP substrate fluorescent dye. Hence, BCRP expression may contribute to the natural resistance and longevity of these normal stem cells. Malignant tissues can exploit the properties of BCRP to survive hypoxia and to evade exposure to chemotherapeutic drugs. Evidence is mounting that many cancers display subpopulations of stem cells that are responsible for tumor self-renewal. Such stem cells frequently manifest the "side population" phenotype characterized by expression of BCRP and other ABC transporters. Along with other factors, these transporters may contribute to the inherent resistance of these neoplasms and their failure to be cured.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3488 Recently, evidence was presented that polymorphisms resulting in the variants F208S and S441N cause diminished BCRP protein levels by virtue of ubiquitin-mediated proteasomal degradation [100]. Login to comment

[hide] Rosuvastatin blocks hERG current and prolongs card... J Pharm Sci. 2012 Feb;101(2):868-78. doi: 10.1002/jps.22809. Epub 2011 Nov 11. Plante I, Vigneault P, Drolet B, Turgeon J
Rosuvastatin blocks hERG current and prolongs cardiac repolarization.
J Pharm Sci. 2012 Feb;101(2):868-78. doi: 10.1002/jps.22809. Epub 2011 Nov 11., [PMID:22081364]

Abstract [show]
Blocking of the potassium current I(Kr) [human ether-a-go-go related gene (hERG)] is generally associated with an increased risk of long QT syndrome (LQTS). The 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitor, rosuvastatin, is a methanesulfonamide derivative, which shows structural similarities with several I(Kr) blockers. Hence, we assessed the effects of rosuvastatin on cardiac repolarization by using in vitro, ex vivo, and in vivo models. Patch clamp experiments on hERG-transfected human embryonic kidney (HEK) 293 cells established the potency of rosuvastatin to block hERG [half maximal inhibitory concentration (IC(50) ) = 195 nM]. We showed in isolated guinea pig hearts that 195 nM rosuvastatin prolonged (basic cycle length of 250 ms; p < 0.05) the monophasic action potential duration at 90% repolarization (MAPD(90) ) by 11 +/- 1 ms. Finally, rosuvastatin (10 mg/kg, intraperitoneal) prolonged corrected QT interval (QTc) in conscious and unrestrained guinea pigs from 201 +/- 1 to 210 +/- 2 ms (p < 0.05). Thus, rosuvastatin blocks I(Kr) and prolongs cardiac repolarization. In additional experiments, we also show that hERG blockade in HEK 293 cells was modulated by coexpression of efflux [breast cancer resistance protein (BCRP), multidrug resistance gene (MDR1)] and influx [organic anion transporting polypeptide (OATP) 2B1] transporters involved in the disposition and cardiac distribution of the drug. Genetic polymorphisms observed for BCRP, MDR1, and OATP2B1, and IC(50) determined for hERG blocking lead us to propose that some patients may be at risk of rosuvastatin-induced LQTS.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
24 Transfection Procedure In order to evaluate the effects of different transporters on the block of hERG by rosuvastatin, the hERG-stably transfected HEK 293 cells were transiently transfected with 10 :g of a recombinant pIRES2 vector expressing the green fluorescent protein (GFP) and one or the other of the following transporters: efflux transporter BCRP (strong affinity for rosuvastatin), loss of function variants of BCRP (BCRP-F208S, BCRP-S441N, and BCRP-Q141K), the influx transporters OATP2B1 (strong affinity for rosuvastatin), and multidrug resistance gene (MDR1) (an efflux transporter showing weak affinity for rosuvastatin). Login to comment
28 Site-Directed Mutagenesis The three loss-of-function variants of BCRP (BCRP-F208S, BCRP-S441N, and BCRP-Q141K) were Figure 1. Login to comment
88 Then, we performed site-directed mutagenesis on BCRP and produced three variants associated with a loss of function of the protein: C421A (Q141K), T623C (F208S), and G1322A (S441N).34-36 The coexpression of hERG with one or the other of these variants blunted the effects observed with the native efflux transporter BCRP, that is, the block was in the order of 40%. Login to comment
89 Indeed, inhibition of hERG was 40 ± 4 (n = 5), 41 ± 7 (n = 7), and 41 ± 4 (n = 7) for Q141K, F208S, and S441N, respectively (all not different from control, but different from HEK 293-hERG cells with functional transporters; p < 0.05). Login to comment
111 Inhibition of current activity was also determined in cells expressing transporters with a loss of function in BCRP activity due to mutations (BCRP-F208S, BCRP-S441N, and BCRP-Q141K). Login to comment
138 We also tested the effects of rosuvastatin on hERG in the presence of three loss-of-function polymorphisms of BCRP (Q141K, F208S, and S441N) and observed a block comparable to the one found in the control cells (≈42%). Login to comment

[hide] Pharmacological interplay between breast cancer re... Anticancer Res. 2009 Apr;29(4):1059-65. Katayama K, Shibata K, Mitsuhashi J, Noguchi K, Sugimoto Y
Pharmacological interplay between breast cancer resistance protein and gefitinib in epidermal growth factor receptor signaling.
Anticancer Res. 2009 Apr;29(4):1059-65., [PMID:19414346]

Abstract [show]
BACKGROUND: It has been previously shown that gefitinib reverses breast cancer resistance protein (BCRP)-mediated drug resistance. Here, the impact of BCRP on gefitinib-mediated inhibition in epidermal growth factor receptor (EGFR) signaling is evaluated. MATERIALS AND METHODS: Sensitivity to gefitinib was determined by growth inhibition assay, and intracellular gefitinib levels were measured with HPLC. Western blotting was performed to detect EGFR signaling molecules. RESULTS: BCRP reduced intracellular gefitinib levels and attenuated inhibitory activities of gefitinib to EGF-dependent EGFR signalings including downstream MAPK and Akt pathways in gefitinib-sensitive PC-9 cells. However, gefitinib did not inhibit MAPK and Akt signalings in KB-3-1 and HCT-116 cells, and BCRP-mediated gefitinib-resistance shown in PC-9 cells was not observed in gefitinib-insensitive KB-3-1 and HCT-116 cells. CONCLUSION: BCRP transports gefitinib and suppresses its inhibitory effects on EGFR phosphorylation. However, effects of BCRP on gefitinib activity in the EGFR signaling and on gefitinib-resistance were limited in the gefitinib-sensitive cells only.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
150 Cells containing a T623C (F208S) BCRP cDNA express only marginal levels of BCRP protein, and resistance to SN-38 is not observed (27). Login to comment
148 Cells containing a T623C (F208S) BCRP cDNA express only marginal levels of BCRP protein, and resistance to SN-38 is not observed (27). Login to comment

[hide] Structure and function of BCRP, a broad specificit... Arch Toxicol. 2014 Jun;88(6):1205-48. doi: 10.1007/s00204-014-1224-8. Epub 2014 Apr 29. Jani M, Ambrus C, Magnan R, Jakab KT, Beery E, Zolnerciks JK, Krajcsi P
Structure and function of BCRP, a broad specificity transporter of xenobiotics and endobiotics.
Arch Toxicol. 2014 Jun;88(6):1205-48. doi: 10.1007/s00204-014-1224-8. Epub 2014 Apr 29., [PMID:24777822]

Abstract [show]
The discovery and characterization of breast cancer resistance protein (BCRP) as an efflux transporter conferring multidrug resistance has set off a remarkable trajectory in the understanding of its role in physiology and disease. While the relevance in drug resistance and general pharmacokinetic properties quickly became apparent, the lack of a characteristic phenotype in genetically impaired animals and humans cast doubt on the physiological importance of this ATP-binding cassette family member, similarly to fellow multidrug transporters, despite well-known endogenous substrates. Later, high-performance genetic analyses and fine resolution tissue expression data forayed into unexpected territories concerning BCRP relevance, and ultimately, the rise of quantitative proteomics allows putting observed interactions into absolute frameworks for modeling and insight into interindividual and species differences. This overview summarizes existing knowledge on the BCRP transporter on molecular, tissue and system level, both in physiology and disease, and describes a selection of experimental procedures that are the most widely applied for the identification and characterization of substrate and inhibitor-type interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Four variants are found with allele frequencies above 3 % in at least one of the studied population (African American, Asian, and Caucasian): Val12Met (V12M), Gln141Lys (Q141K), Phe208Ser (F208S), and Asp590Tyr (N590Y). Login to comment
89 Mutation F208S, on the other hand, evokes a total loss of transporter activity with no detectable protein expression. Login to comment
90 Allele frequency of F208S is below 4 % in Asian and below 1 % in African populations (Ieiri 2012b; Tamura et al. 2006). Login to comment

[hide] Determinants of the activity and substrate recogni... Drug Metab Rev. 2014 Nov;46(4):459-74. doi: 10.3109/03602532.2014.942037. Epub 2014 Jul 18. Szafraniec MJ, Szczygiel M, Urbanska K, Fiedor L
Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2).
Drug Metab Rev. 2014 Nov;46(4):459-74. doi: 10.3109/03602532.2014.942037. Epub 2014 Jul 18., [PMID:25036722]

Abstract [show]
The xenobiotic transporters are among the most important constituents of detoxification system in living organisms. Breast cancer resistance protein (BCRP/ABCG2) is one of the major transporters involved in the efflux of xenobiotics. To understand its role in chemotherapeutic and multidrug resistance, it is crucial to establish the determinants of its substrate specificity, which obviously is of high relevance for successful therapy of many diseases. This article summarizes the current knowledge about the substrate preferences of BCRP. We overview the factors which determine its activity, inhibition and substrate recognition, focusing on the structural features of the transporter. BCRP substrate specificity is quite low as it interacts with a spectrum of substances with only a few common features: hydrophobic and aromatic regions, possibly a flat conformation and the metal ion-, oxygen- and nitrogen-containing functionalities, most of which may be the donors/acceptors of H-bonds. Several amino acid residues and structural motifs are responsible for BCRP activity and substrate recognition. Thus, the active form of BCRP, at least a dimer or a larger oligomer is maintained by intramolecular disulfide bridge that involves Cys(603) residues. The GXXXG motif in transmembrane helix 1, Cys residues, Arg(482) and Lys(86) are responsible for maintaining the protein structure, which confers transport activity, and the His(457) or Arg(456) residues are directly involved in substrate binding. Arg(482) does not directly bind substrates, but electrostatically interacts with charged molecules, which initiates the conformational changes that transmit the signal from the transmembrane regions to the ABC domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
201 To elucidate the significance of this polymorphism for porphyrin transport, a set of 18 variants of BCRP (Val12 Met, Gly51 Cys, Gln126 stop, Gln141 Lys, Thr153 Met, Gln166 Glu, Ile206 Leu, Phe208 Ser, Ser248 Pro, Glu334 stop, Phe431 Leu, Ser441 Asn, Arg482 Gly, Arg482 Thr, Phe489 Leu, Phe571 Ile, Asn590 Tyr and Asp620 Asn) have been expressed in insect cells. Login to comment
203 A model study on plasma membrane vesicles showed that mutations the Glu126 stop, Phe208 Ser, Ser248 Phe, Glu334 stop and Ser441 Asn lead to an inability to transport hematoporphyrin. Login to comment
206 Moreover, Flp-In-293 cells expressing the variants Phe208 Ser, Ser248 Phe, Ser441 Asn and Phe489 Leu were light sensitive when treated with Pheide. Login to comment
209 Position Type of mutation Effect on the transporter References NBD Lys 86 Met (i) No stimulation of the ATPase activity by prazosin; (ii) no influence on the transport of mitoxantrone Henriksen et al. (2005b) Glu 126 stop, Phe 208 Ser, Ser 248 Phe, Glu 334 stop Inability to transport hematoporphyrin Tamura et al. (2006) Glu 211 Gln Complete abolishment of the ATPase activity and methotrexate transport Hou et al. (2009) Pro 392 Ala Significant reduction in the efflux activity of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Ni et al. (2011) TM1 Gly 406 Ala Gly 410 Ala No influence on the activity of the transporter Polgar et al. (2004) Gly 406 Leu Gly 410 Leu (i) Loss of the ability to transport rhodamine123; (ii) impaired transport of mitoxantrone, Pheide and BODIPY-prazosin Polgar et al. (2004) Extracellular loop 1 Phe 431 Leu (i) Loss of the ability to transport methotrexate; (ii) 10% level of hematoporphyrin transport compared to the WT protein Tamura et al. (2006) Ser 441 Asn Inability to transport hematoporphyrin Tamura et al. (2006) Ser 441 Asn Loss of the ability to transport methotrexate Tamura et al. (2006) TM2 Lys 452 Ala His 457 Ala Increase in transport of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Cai et al. (2010) Lys 453 Ala Arg 465 Ala Decrease in transport of mitoxantrone, BODIPY-prazosin, Hoechst 33342, doxorubicin, SN-38 and rhodamine 123 Cai et al. (2010) TM3 Arg 482 Gly Arg 482 Thr (i) No change in the inhibitory activity of lapatinib; (ii) about two times greater inhibition by ritonavir, saquinavir and nalfinavir than in the WT variant; (iii) gaining the ability to transport rhodamine123 and doxorubicin; (iv) no influence on the transport of mitoxantrone; (v) loss of the ability to transport methotrexate Dai et al. (2008), Gupta et al. (2004), Honjo et al. (2001), Mitomo et al. (2003) Arg 482 Thr (i) Lower IC 50 of cyclosporine A for mutant than for WT variant; (ii) lower elacridar inhibition potency Xia et al. (2007) Arg 482 Lys Complete loss of transport activity Ejendal et al. (2006) Phe 489 Leu Impaired transport of porphyrins, no transport of methotrexate Tamura et al. (2006) Extracellular loop 3 Asn 590 Tyr Over twice reduced transport of mitoxantrone, topotecan, daunorubicin and rhodamine 123 Vethanayagam et al. (2005) Cys 592 Ala/Cys 608 Ala (i) Transport of mitoxantrone almost unchanged; (ii) transport of BODIPY-prazosin significantly impaired Henriksen et al. (2005a) Extracellular loop 3 Cys 603 Ser Cys 592 Ser/Cys 608 Ser Cys 592 Ser/Cys 603 Ser/Cys 608 Ser Diminished susceptibility to the inhibitory activity of fumitremorgin C Shigeta et al. (2010) Cys-less Arg 482 Gly-BCRP Complete loss of the ability to efflux mitoxantrone Liu et al. (2008b) The positions of the amino acid residues refer to the topological model of BCRP proposed by Wang et al. (2009). Login to comment

[hide] Role of the breast cancer resistance protein (BCRP... AAPS J. 2015 Jan;17(1):65-82. doi: 10.1208/s12248-014-9668-6. Epub 2014 Sep 19. Mao Q, Unadkat JD
Role of the breast cancer resistance protein (BCRP/ABCG2) in drug transport--an update.
AAPS J. 2015 Jan;17(1):65-82. doi: 10.1208/s12248-014-9668-6. Epub 2014 Sep 19., [PMID:25236865]

Abstract [show]
The human breast cancer resistance protein (BCRP, gene symbol ABCG2) is an ATP-binding cassette (ABC) efflux transporter. It was so named because it was initially cloned from a multidrug-resistant breast cancer cell line where it was found to confer resistance to chemotherapeutic agents such as mitoxantrone and topotecan. Since its discovery in 1998, the substrates of BCRP have been rapidly expanding to include not only therapeutic agents but also physiological substances such as estrone-3-sulfate, 17beta-estradiol 17-(beta-D-glucuronide) and uric acid. Likewise, at least hundreds of BCRP inhibitors have been identified. Among normal human tissues, BCRP is highly expressed on the apical membranes of the placental syncytiotrophoblasts, the intestinal epithelium, the liver hepatocytes, the endothelial cells of brain microvessels, and the renal proximal tubular cells, contributing to the absorption, distribution, and elimination of drugs and endogenous compounds as well as tissue protection against xenobiotic exposure. As a result, BCRP has now been recognized by the FDA to be one of the key drug transporters involved in clinically relevant drug disposition. We published a highly-accessed review article on BCRP in 2005, and much progress has been made since then. In this review, we provide an update of current knowledge on basic biochemistry and pharmacological functions of BCRP as well as its relevance to drug resistance and drug disposition.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
218 V12M resulting from the 34G>A SNP and other variants (e.g., I206L, F208S, N590Y, and D620N) display expression levels and drug resistance profiles comparable to wild-type BCRP (100,101). Login to comment