ABCMdb

ABCG2 p.Phe431Leu

Predicted by SNAP2:	A: D (91%), C: D (80%), D: D (95%), E: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (91%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (85%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Eight novel single nucleotide polymorphisms in ABC... Drug Metab Pharmacokinet. 2003;18(3):212-7. Itoda M, Saito Y, Shirao K, Minami H, Ohtsu A, Yoshida T, Saijo N, Suzuki H, Sugiyama Y, Ozawa S, Sawada J
Eight novel single nucleotide polymorphisms in ABCG2/BCRP in Japanese cancer patients administered irinotacan.
Drug Metab Pharmacokinet. 2003;18(3):212-7., [PMID:15618737]

Abstract [show]
Eight novel single nucleotide polymorphisms (SNPs) were found in the gene encoding the ATP-binding cassette transporter, ABCG2/BCRP, from 60 Japanese individuals administered the anti-cancer drug irinotecan. The detected SNPs were as follows: 1) SNP, MPJ6_AG2005 (IVS2-93T>C); Gene Name, ABCG2; Accession Number, NT_006204; 2) SNP, MPJ6_AG2007 (IVS3+71_72 insT); Gene Name, ABCG2; Accession Number, NT_006204; 3) SNP, MPJ6_AG2012 (IVS6-204C>T); Gene Name, ABCG2; Accession Number, NT_006204; 4) SNP, MPJ6_AG2015 (at nucleotide 1098G>A (exon 9) from the A of the translation initiation codon); Gene Name, ABCG2; Accession Number, NT_006204; 5) SNP, MPJ6_AG2017 (1291T>C (exon 11)); Gene Name, ABCG2; Accession Number, NT_006204; 6) SNP, MPJ6_AG2019 (IVS11-135G>A); Gene Name, ABCG2; Accession Number, NT_006204; 7) SNP, MPJ6_AG2020 (1465T>C (exon 12)); Gene Name, ABCG2; Accession Number, NT_006204; 8) SNP, MPJ6_AG2023 (IVS13+65T>G); Gene Name, ABCG2; Accession Number, NT_006204.MPJ6_AG2015 was a synonymous SNP (E366E). MPJ6_AG2017 and MPJ6_AG2020 resulted in amino acid alterations, F431L and F489L, respectively.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 MPJ6äAG2017 and MPJ6äAG2020 resulted in amino acid alterations, F431L and F489L, respectively. Login to comment
98 Novel SNPs in the ABCG2 gene found in Japanese individuals SNP name AG2005 AG2007 AG2012 AG2015 AG2017 AG2019 AG2020 AG2023 Intron 2 Intron 3 Intron 6 Exon 9 Exon 11 Intron 11 Exon 12 Intron 13 Position (cDNA) IVS2－93a IVS3＋71ä72 insTb IVS6－204 1098 1291 IVS11－135 1465 IVS13＋65 Nucleotide TÀC -ÀT CÀT GÀA TÀC GÀA TÀC TÀG Amino acid E366E F431L F489L Frequency, z T:97.5 -:99.2 C:96.7 G:99.2 T:99.2 G:98.3 T:99.2 G:99.2 C:2.5 T:0.8 T:3.3 A:0.8 C:0.8 A:1.7 C:0.8 A:0.8 a Numbers following IVS (intervening sequence) represents number of the preceding exon. In the case of end of the intron, the SNP position is expressed by a minus sign and the bases upstream of the next exon. Login to comment
107 Of these SNPs, two SNPs, MPJ6äAG2017 and 020, that were each found in 1 subject, introduced nonsynonymous amino acid changes (F431L and F489L), respectively. Login to comment
119 (E) Homozygous wild-type and wild-typeW1291TÀC (F431L) (MPJ6äG2017). Login to comment

[hide] Mechanisms of resistance to anticancer drugs: the ... Pharmacogenomics. 2005 Mar;6(2):115-38. Lepper ER, Nooter K, Verweij J, Acharya MR, Figg WD, Sparreboom A
Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2.
Pharmacogenomics. 2005 Mar;6(2):115-38., [PMID:15882131]

Abstract [show]
ATP-binding cassette (ABC) genes play a role in the resistance of malignant cells to anticancer agents. The ABC gene products, including ABCB1 (P-glycoprotein) and ABCG2 (breast cancer-resistance protein [BCRP], mitoxantrone-resistance protein [MXR], or ABC transporter in placenta [ABCP]), are also known to influence oral absorption and disposition of a wide variety of drugs. As a result, the expression levels of these proteins in humans have important consequences for an individual's susceptibility to certain drug-induced side effects, interactions, and treatment efficacy. Naturally occurring variants in ABC transporter genes have been identified that might affect the function and expression of the protein. This review focuses on recent advances in the pharmacogenetics of the ABC transporters ABCB1 and ABCG2, and discusses potential implications of genetic variants for the chemotherapeutic treatment of cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
157 Position in gene* Nucleotide‡ Region Wild-type allele Variant allele Amino acid Change -19572 to -19569 5`-Flanking region CTCA - CTCA deletion -19202 5` UTR G C -18845 5` UTR T C -18604 5` UTR A - Deletion -18482 -113 Exon 1 C T Non-coding -18398 -29 Exon 1 A G Non-coding 34 34 Exon 2 G A 12 Val to Met 71 71 Exon 2 C T 24 Ala to Val 114 114 Exon 2 T C 38 Synonymous 239 Intron 2 A G 7268 Intron 2 T C 7420 Intron 3 - T Insertion 8007 Intron 3 G A 8184 369 Exon 4 C T 123 Synonymous 8191 376 Exon 4 C T 126 Gln to Term 8825 421 Exon 5 C A 141 Gln to Lys 8862 458 Exon 5 C T 153 Thr to Met 8878 474 Exon 5 C T 158 Synonymous 8900 496 Exon 5 C G 166 Gln to Glu 18186 Intron 5 A G 18286 616 Exon 6 A C 206 Ile to Leu 18293 623 Exon 6 T C 208 Phe to Ser 21530 Intron 6 C T 21718 Intron 6 A G 21903 Intron 7 A G 24618 Intron 7 T A 26297 1098 Exon 9 G A 366 Synonymous 38389 1291 Exon 11 T C 431 Phe to Leu 38485 Intron 11 A G 40111 Intron 11 G A 40303 1425 Exon 12 A G 475 Synonymous 40322 1444 Exon 12 A G 482 Arg to Gly 40323 1445 Exon 12 G C 482 Arg to Thr 40343 1465 Exon 12 T C 489 Phe to Leu 40419 Intron 12 G T 42314 Intron 13 T G 44997 Intron 14 A G 45022 Intron 14 C T 45073 1768 Exon 15 A T 590 Asn to Tyr 47355 1858 Exon 16 G A 620 Asp to Asn 47734 2237 Exon 16 G T Non-coding 47890 2393 Exon 16 G T Non-coding 47891 2394 Exon 16 C A Non-coding ABC: ATP-binding cassette; UTR: Untranslated region. Login to comment

[hide] Pharmacogenomics of the human ABC transporter ABCG... Naturwissenschaften. 2005 Oct;92(10):451-63. Ishikawa T, Tamura A, Saito H, Wakabayashi K, Nakagawa H
Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design.
Naturwissenschaften. 2005 Oct;92(10):451-63., [PMID:16160819]

Abstract [show]
In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 These contradictory expression and localization data for ABCG2 variants indicate that differences in transfection conditions (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably Table 2 Frequencies of ABCG2 alleles in different ethnic groups Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) V12M c.34G>A Japanese 29 9 1 19.0 Imai et al. (2002) Japanese 10 - - 15.0 Zamber et al. (2003) Japanese 220 61 8 17.5 Kobayashi et al. (2005) Chinese 10 - - 20.0 Zamber et al. (2003) Southeast Asians 10 - - 45.0 Zamber et al. (2003) Pacific Islanders 7 - - 64.0 Zamber et al. (2003) Swedish 60 2 0 1.7 B¨ackstr¨om et al. (2003) Dutch 100 11 1 6.5 Bosch et al. (2005) Caucasian 86 - - 2.0 Zamber et al. (2003) Caucasian 150 27 2 10.3 Mizuarai et al. (2004) Caucasian 150 11 0 3.7 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 10.0 Zamber et al. (2003) Middle Eastern 20 - - 5.0 Zamber et al. (2003) Africans North of Sahara 7 - - 14.0 Zamber et al. (2003) African American 150 17 1 6.3 Kobayashi et al. (2005) Mexicans 10 - - 10.0 Zamber et al. (2003) Hispanic Livers 5 - - 40.0 Zamber et al. (2003) Mexican Indians 5 - - 90.0 Zamber et al. (2003) Q126Stop c.376C>T Japanese 124 3 0 1.2 Imai et al. (2002) Japanese 60 2 0 1.7 Itoda et al. (2003) Japanese 220 4 0 0.9 Kobayashi et al. (2005) Caucasian 150 0 0 0.0 Mizuarai et al. (2004) Caucasian 150 0 0 0.0 Kobayashi et al. (2005) African American 150 0 0 0.0 Kobayashi et al. (2005) Q141K c.421C>A Japanese 124 48 9 26.6 Imai et al. (2002) Japanese 10 - - 35.0 Zamber et al. (2003) Japanese 220 90 27 32.7 Kobayashi et al. (2005) Chinese 95 43 11 34.2 de Jong et al. (2004) Chinese 10 - - 35.0 Zamber et al. (2003) Southeast Asians 10 - - 15.0 Zamber et al. (2003) Pacific Islanders 7 - - 14.0 Zamber et al. (2003) Swedish 60 10 1 10.0 B¨ackstr¨om et al. (2003) Dutch 100 20 2 12.0 Bosch et al. (2005) Caucasian 85 - - 14.0 Zamber et al. (2003) Caucasian 172 33 3 11.3 de Jong et al. (2004) Caucasian 150 22 2 8.7 Mizuarai et al. (2004) Caucasian 150 25 4 11.0 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 5.0 Zamber et al. (2003) Middle Eastern 20 - - 13.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African, Sub-Saharan 938 14 1 0.9 de Jong et al. (2004) African American 24 - - 0.0 Zamber et al. (2003) African American 150 5 1 2.3 Kobayashi et al. (2005) African American 94 8 1 5.3 de Jong et al. (2004) Mexicans 10 - - 5.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 10.0 Zamber et al. (2003) R160Q c.479G>A Dutch 100 1 0 0.5 Bosch et al. (2005) I206L c.616A>C Japanese 10 - - 0.0 Zamber et al. (2003) Chinese 10 - - 0.0 Zamber et al. (2003) Southeast Asians 10 - - 0.0 Zamber et al. (2003) Pacific Islanders 7 - - 0.0 Zamber et al. (2003) Caucasian 65 - - 0.0 Zamber et al. (2003) Table 2 Continued Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) Ashkenazi Jewish 10 - - 0.0 Zamber et al. (2003) Middle Eastern 20 - - 0.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African American 15 - - 0.0 Zamber et al. (2003) Mexicans 10 - - 0.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 0.0 Zamber et al. (2003) F431L c.1291T>C Japanese 60 1 0 0.8 Itoda et al. (2003) S441N c.1322G>A Japanese 100 1 0 0.5 Kobayashi et al. (2005) F489L c.1465T>C Japanese 60 1 0 0.8 Itoda et al. (2003) Japanese 100 1 0 0.5 Kobayashi et al. (2005) R575Stop c.1723C>T Dutch 100 1 0 0.5 Bosch et al. (2005) N590Y c.1768A>T Caucasian 65 - - 1.0 Zamber et al. (2003) Caucasian 150 1 0 0.3 Mizuarai et al. (2004) African Americans 15 - - 0.0 Zamber et al. (2003) D620N c.1858G>A Dutch 100 1 0 0.5 Bosch et al. (2005) affect the cellular processing and sorting of these proteins. Login to comment

[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
210 In different ethnic groups, seven naturally-occurring non-synonymous SNPs have been reported: V12M, Q126Stop, Q141K, I206L, F431L, S441N, F489L, N590Y and D620N. Login to comment
213 Some of the above sequence variations showed an allele frequency of ~ 1% in distinct populations, Q126stop and F489L in the Japanese and N590Y in the Caucasian population [129-131,134,135], whereas most of the mutations were only detected in single individuals (e.g., I206L, F431L, S441N, D620N). Login to comment
225 Location Position Allele Amino acid Allele frequency in Caucasian populations Allele frequency in Japanese populatins Allele frequency in African populations n % n % n % Exon 2 34 G A 12 Val 12 Met 546 94.4 5.6 259 82.4 17.6 181 93.7 6.3 Exon 4 376 C T 126 Gln 126 stop 300 100 0 404 98.9 1.1 150 100 0 Exon 5 421 C A 141 Gln 141 Lys 717 89.0 11.0 354 69.4 30.6 1213 98.6 1.4 Exon 5 479 G A 160 Arg 160 Gln 100 99.5 0.5 ND ND ND ND ND ND Exon 11 1291 T C 431 Phe 431 Leu ND ND ND 60 99.2 0.8 ND ND ND Exon 11 1322 G A 441 Ser 441 Asn ND ND ND 100 99.5 0.5 ND ND ND Exon 12 1465 T C 489 Phe 489 Leu ND ND ND 160 99.4 0.6 ND ND ND Exon 14 1723 C T 575 Arg 575 stop 100 99.5 0.5 ND ND ND ND ND ND Exon 15 1768 A T 590 Asn 590 Tyr 215 99.5 0.5 ND ND ND 15 100 0 Exon 16 1858 T A 620 Asp 620 Asp 100 99.5 0.5 ND ND ND ND ND ND Data are from [129-135,137]. Login to comment
250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins. Login to comment

[hide] Functional SNPs of the breast cancer resistance pr... Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21. Yanase K, Tsukahara S, Mitsuhashi J, Sugimoto Y
Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development.
Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21., 2006-03-08 [PMID:16303243]

Abstract [show]
Breast cancer resistance protein (BCRP) is a half-molecule ATP-binding cassette transporter that pumps out various anticancer agents such as 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. We have previously identified three polymorphisms within the BCRP gene, G34A (substituting Met for Val-12), C376T (substituting a stop codon for Gln-126) and C421A (substituting Lys for Gln-141). C421A BCRP-transfected murine fibroblast PA317 cells showed markedly decreased protein expression and low-level drug resistance when compared with wild-type BCRP-transfected cells. In contrast, G34A BCRP-transfected PA317 cells showed a similar protein expression and drug resistance profile to wild-type. The C376T polymorphism would be expected to have a considerable impact as active BCRP protein will not be expressed from a T376 allele. Hence, people with C376T and/or C421A polymorphisms may express low levels of BCRP, resulting in hypersensitivity of normal cells to BCRP-substrate anticancer agents. Estrogens, estrone and 17beta-estradiol, were previously found to restore drug sensitivity levels in BCRP-transduced cells by increasing the cellular accumulation of anticancer agents. BCRP transports sulfated estrogens but not free estrogens and in a series of screening experiments for synthesized and natural estrogenic compounds, several tamoxifen derivatives and phytoestrogens/flavonoids were identified that effectively circumvent BCRP-mediated drug resistance. The kinase inhibitors gefitinib and imatinib mesylate also interact with BCRP. Gefitinib, an inhibitor of epidermal growth factor receptor-tyrosine kinase, inhibits its transporter function and reverses BCRP-mediated drug resistance both in vitro and in vivo. BCRP-transfected human epidermoid carcinoma A431 cells and BCRP-transfected human non-small cell lung cancer PC-9 cells show gefitinib resistance. Imatinib, an inhibitor of BCR-ABL tyrosine kinase, also inhibits BCRP-mediated drug transport. Hence, both functional SNPs and inhibitors of BCRP reduce its transporter function and thus modulate substrate pharmacokinetics and pharmacodynamics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

[hide] The role of the human ABCG2 multidrug transporter ... Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7. Cervenak J, Andrikovics H, Ozvegy-Laczka C, Tordai A, Nemet K, Varadi A, Sarkadi B
The role of the human ABCG2 multidrug transporter and its variants in cancer therapy and toxicology.
Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7., 2006-03-08 [PMID:16337740]

Abstract [show]
The human multidrug resistance ABC transporters provide a protective function in our body against a large number of toxic compounds. These proteins, residing in the plasma membrane, perform an active, ATP-dependent extrusion of such xenobiotics. However, the same proteins are also used by the tumor cells to fight various anticancer agents. ABCG2 is an important member of the multidrug resistance proteins, an 'ABC half transporter', which functions as a homodimer in the cell membrane. In this review, we provide a basic overview of ABCG2 function in physiology and drug metabolism, but concentrate on the discussion of mutations and polymorphisms discovered in this protein. Interestingly, a single nucleotide mutation, changing amino acid 482 from arginine to threonine or glycine in ABCG2, results in a major increase in the catalytic activity and a wider drug recognition by this protein. Still, this mutation proved to be an in vitro artifact, produced only in heavily drug-selected cell lines. In contrast, at least two, but possibly more polymorphic variants of ABCG2 were found to be present in large human populations with different ethnic background. However, currently available experimental data regarding the cellular expression, localization and function of these ABCG2 variants are strongly contradictory. Since, the proteins produced by these variant alleles may differently modulate cancer treatment, general drug absorption and toxicity, may represent risk factors in fetal toxicity, or alter the differentiation of stem cells, their exact characterization is a major challenge in this field.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 To date, altogether eight non-synonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c.114TOC, c.369COT, c.474COT, c.1098GOA, c.1425AOG) missense mutations, one nonsense (Q126X), and one frameshift (c.1515delC) mutations were identified in the coding region of ABCG2 in healthy individuals or in patients [43-46,49,63-65]. Login to comment
112 Some of the above sequence variations showed an allele frequency of about 1% in distinct populations (Q126X, F489L in the Japanese and N590Y in the Caucasian population [45-47,49,64]), while most of the mutations were only detected in single individuals (missense mutations: I206L, F431L, S441N, D620N, and a frameshift mutation: c.1515delC [44-46,49]). Login to comment

[hide] Role of ABCG2/BCRP in biology and medicine. Annu Rev Pharmacol Toxicol. 2006;46:381-410. Krishnamurthy P, Schuetz JD
Role of ABCG2/BCRP in biology and medicine.
Annu Rev Pharmacol Toxicol. 2006;46:381-410., [PMID:16402910]

Abstract [show]
The protein variously named ABCG2/BCRP/MXR/ABCP is a recently described ATP-binding cassette (ABC) transporter originally identified by its ability to confer drug resistance that is independent of Mrp1 (multidrug-resistance protein 1) and Pgp (P-glycoprotein). Unlike Mrp1 and Pgp, ABCG2 is a half-transporter that must homodimerize to acquire transport activity. ABCG2 is found in a variety of stem cells and may protect them from exogenous and endogenous toxins. ABCG2 expression is upregulated under low-oxygen conditions, consistent with its high expression in tissues exposed to low-oxygen environments. ABCG2 interacts with heme and other porphyrins and protects cells and/or tissues from protoporphyrin accumulation under hypoxic conditions. Individuals who carry ABCG2 alleles that have impaired function may be more susceptible to porphyrin-induced toxicity. Abcg2 knock-out models have allowed in vivo studies of Abcg2 function in host and cellular defense. In combination with immunohistochemical analyses, these studies have revealed how ABCG2 influences the absorption, distribution, and excretion of drugs and cytotoxins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
301 Three of these resulted in the amino acid substitutions F431L, F489L, and S441N. Login to comment

[hide] Functional validation of the genetic polymorphisms... Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11. Tamura A, Watanabe M, Saito H, Nakagawa H, Kamachi T, Okura I, Ishikawa T
Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport.
Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11., [PMID:16608919]

Abstract [show]
The ATP-binding cassette (ABC) transporter ABCG2 has been implicated to play a significant role in the response of patients to medication and/or the risk of diseases. To clarify the possible physiological or pathological relevance of ABCG2 polymorphisms, we have functionally validated single nucleotide polymorphisms (SNP) of ABCG2. In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Because porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the porphyrin transport activity of those variant forms in vitro. We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Furthermore, Flp-In-293 cells expressing those variants were photosensitive. Thus, among those genetic polymorphisms of ABCG2, at least the hitherto validated alleles of Q126stop, S441N, and F489L are suggested to be of clinical importance related to the potential risk of porphyria.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan). Login to comment
144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis. Login to comment
166 The F431L variant as well as the acquired mutants R482G and R482T transported hematoporphyrin (Fig. 5, top), although they did not transport methotrexate (Fig. 5, bottom). Login to comment
177 as the variants F208S, S248P, S441N, F431L, and F489L were expressed in Flp-In 293 cells. Login to comment
182 The F431L variant that was active in porphyrin transport conferred Flp-In-293 cells resistance to light as did the ABCG2 WT (Fig. 6). Login to comment
184 To gain more insight into the association of ABCG2 variants with cellular resistance to anticancer drugs, we incubated Flp-In-293 cells expressing ABCG2 WT, F431L, S441N, or F489L in the presence of SN-38, mitoxantrone, doxorubicin, or daunorubicin at different concentrations as described under Materials and Methods. Table 3 summarizes the drug resistance profile of those variants-expressing cells. Login to comment
185 Both Flp-In-293/ABCG2 (WT) and Flp-In-293/ABCG2 (F431L) cells were resistant toward SN-38 and mitoxantrone, whereas the resistance ratio of Flp-In-293/ABCG2 (S441N) and Flp-In-293/ABCG2 (F489L) cells were much lower, being close to that of Flp-In-293/Mock cells. Login to comment
186 None of the SNP variants of F431L, S441N, and F489L conferred Flp-In-293 cells resistance to doxorubicin or daunorubicin (Table 3), being different from the acquired mutants of R482G and R482T (Yoshikawa et al., 2004). Login to comment
203 Photosensitivity of Flp-In-293 cells expressing ABCG2 WT, F431L, S441N, or F489L. Login to comment
214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein. Login to comment
227 TABLE 3 Drug resistance profiles of ABCG2 WT and variants The drug resistance profiles of ABCG2 WT and variants were obtained by incubating Flp-In-293/ABCG2 WT, F431L, S441N, or F489L cells in the presence of SN-38, mitoxantrone, doxorubicin, or daunorubicin at different concentrations (0-100 ␮M) as described under Materials and Methods. Login to comment
233 Anticancer Drug IC50 and Drug Resistance Ratio Mock WT F431L S441N F489L nM (-fold) SN-38 0.9 Ϯ 0.1 (1.0) 42.1 Ϯ 3.1 (46.8)* 11.5 Ϯ 0.9 (12.7)* 0.7 Ϯ 0.1 (0.8) 3.1 Ϯ 0.3 (3.4) Mitoxantrone 5.2 Ϯ 0.3 (1.0) 99.8 Ϯ 4.5 (19.2)* 20.3 Ϯ 1.9 (4.4)* 4.6 Ϯ 0.5 (0.9) 11.5 Ϯ 0.4 (2.2) Doxorubicin 32.0 Ϯ 0.6 (1.0) 48.1 Ϯ 2.0 (1.5) 39.0 Ϯ 3.5 (1.2) 20.3 Ϯ 1.9 (0.6) 44.6 Ϯ 3.9 (1.4) Daunorubicin 9.5 Ϯ 1.2 (1.0) 17.8 Ϯ 3.9 (1.8) 14.1 Ϯ 0.5 (1.5) 12.1 Ϯ 0.2 (1.3) 16.3 Ϯ 0.9 (1.7) *P Ͻ 0.01. Login to comment
246 The F431L variant lacks the activity of methotrexate transport; however, it seems to be normal in terms of hematoporphyrin transport (Fig. 5). Login to comment

[hide] Genetic variation and haplotype structure of the A... Drug Metab Pharmacokinet. 2006 Apr;21(2):109-21. Maekawa K, Itoda M, Sai K, Saito Y, Kaniwa N, Shirao K, Hamaguchi T, Kunitoh H, Yamamoto N, Tamura T, Minami H, Kubota K, Ohtsu A, Yoshida T, Saijo N, Kamatani N, Ozawa S, Sawada J
Genetic variation and haplotype structure of the ABC transporter gene ABCG2 in a Japanese population.
Drug Metab Pharmacokinet. 2006 Apr;21(2):109-21., [PMID:16702730]

Abstract [show]
The ATP-binding cassette transporter, ABCG2, which is expressed at high levels in the intestine and liver, functions as an efflux transporter for many drugs, including clinically used anticancer agents such as topotecan and the active metabolite of irinotecan (SN-38). In this study, to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCG2, we have comprehensively searched for genetic variations in the putative promoter region, all the exons, and their flanking introns of ABCG2 from 177 Japanese cancer patients treated with irinotecan. Forty-three genetic variations, including 11 novel ones, were found: 5 in the 5'-flanking region, 13 in the coding exons, and 25 in the introns. In addition to 9 previously reported nonsynonymous single nucleotide polymorphisms (SNPs), 2 novel nonsynonymous SNPs, 38C>T (Ser13Leu) and 1060G>A (Gly354Arg), were found with minor allele frequencies of 0.3%. Based on the LD profiles between the SNPs and the estimated past recombination events, the region analyzed was divided into three blocks (Block -1, 1, and 2), each of which spans at least 0.2 kb, 46 kb, and 13 kb and contains 2, 24, and 17 variations, respectively. The two, eight, and five common haplotypes detected in 10 or more patients accounted for most (>90%) of the haplotypes inferred in Block -1, Block 1, and Block 2, respectively. The SNP and haplotype distributions in Japanese were different from those reported previously in Caucasians. This study provides fundamental information for the pharmacogenetic studies investigating the relationship between the genetic variations in ABCG2 and pharmacokinetic/pharmacodynamic parameters.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 115Haplotype Structure in Human ABCG2 (from |1836 to |1175 bp upstream of the translational start site) of the basal promoter,30) and was suggested to inuence irinotecan pharmacokinetics.31) The frequencies of two well-known nonsynonymous SNPs, 34GÀA (Val12Met) and 421CÀA (Gln141Lys), were 0.192 and 0.319 in our study, which were comparable to those in Chinese (0.204 and 0.2220.350, respectively).20,27) However, the frequencies were much higher than those in Caucasians (0.020.065 and 0.080.15), African-Americans (00.09 and 00.05), and a Swedish population (0.02 and 0.1).18,19,21,23,27) Of other relatively rare nonsynonymous SNPs, 376CÀT (Gln126X), 1291TÀC (Phe431Leu), 1322GÀA (Ser441Asn), 1465TÀC (Phe489Leu), and 1515delC (Phe506SerfsX4) were already detected in a Japanese population by Itoda et al.17) andWor Kobayashi et al.,23) but not found in other ethnic groups. Login to comment
141 The thick lines represent the combinations with frequencies over 10z, and the thin lines represent the combinations with frequencies of 1.0 to 9.9z. 118 Keiko MAEKAWA et al. haplotype harboring nonsynonymous SNPs, 1465TÀC (Phe489Leu) (*2), 1291TÀC (Phe431Leu) (*3), 1322GÀA (Ser441Asn)W1515delC (Phe506SerfsX) (*4), and 1723CÀT (Arg575X) (*5), respectively. Login to comment
158 The functional eects of the other ve nonsynonymous SNPs (Ser13Leu, Arg160Gln, Gly354Arg, Phe431Leu, and Phe489Leu) have not yet been characterized. Login to comment

[hide] Human ABC transporter ABCG2 in xenobiotic protecti... Drug Metab Rev. 2006;38(3):371-91. Wakabayashi K, Tamura A, Saito H, Onishi Y, Ishikawa T
Human ABC transporter ABCG2 in xenobiotic protection and redox biology.
Drug Metab Rev. 2006;38(3):371-91., [PMID:16877258]

Abstract [show]
Human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR/ABCP) is regarded as a member of the phase III system of xenobiotic metabolism. This efflux pump is suggested to be responsible for protecting the body from toxic xenobiotics and for removing toxic metabolites. The aim of this review article is to address new aspects of ABCG2 related to redox biology, namely the posttranslational modification (intra- and intermolecular disulfide bond formation) of ABCG2 protein and the transport of porphyrin and chlorophyll metabolites, as well as the high-speed screening and QSAR analysis method to evaluate ABCG2-drug interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells. Login to comment

[hide] Human multidrug resistance ABCB and ABCG transport... Physiol Rev. 2006 Oct;86(4):1179-236. Sarkadi B, Homolya L, Szakacs G, Varadi A
Human multidrug resistance ABCB and ABCG transporters: participation in a chemoimmunity defense system.
Physiol Rev. 2006 Oct;86(4):1179-236., [PMID:17015488]

Abstract [show]
In this review we give an overview of the physiological functions of a group of ATP binding cassette (ABC) transporter proteins, which were discovered, and still referred to, as multidrug resistance (MDR) transporters. Although they indeed play an important role in cancer drug resistance, their major physiological function is to provide general protection against hydrophobic xenobiotics. With a highly conserved structure, membrane topology, and mechanism of action, these essential transporters are preserved throughout all living systems, from bacteria to human. We describe the general structural and mechanistic features of the human MDR-ABC transporters and introduce some of the basic methods that can be applied for the analysis of their expression, function, regulation, and modulation. We treat in detail the biochemistry, cell biology, and physiology of the ABCB1 (MDR1/P-glycoprotein) and the ABCG2 (MXR/BCRP) proteins and describe emerging information related to additional ABCB- and ABCG-type transporters with a potential role in drug and xenobiotic resistance. Throughout this review we demonstrate and emphasize the general network characteristics of the MDR-ABC transporters, functioning at the cellular and physiological tissue barriers. In addition, we suggest that multidrug transporters are essential parts of an innate defense system, the "chemoimmunity" network, which has a number of features reminiscent of classical immunology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
997 In healthy individuals or patients, altogether eight nonsynonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c. Login to comment

[hide] Genetic polymorphisms of human ABC transporter ABC... J Exp Ther Oncol. 2006;6(1):1-11. Tamura A, Wakabayashi K, Onishi Y, Nakagawa H, Tsuji M, Matsuda Y, Ishikawa T
Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system.
J Exp Ther Oncol. 2006;6(1):1-11., [PMID:17228519]

Abstract [show]
The vector-mediated introduction of cDNA into mammalian cells by calcium phosphate co-precipitation or permeation with lipofectamine is widely used for the integration of cDNA into genomic DNA. However, integration of cDNA into the host's chromosomal DNA occurs randomly at unpredictable sites, and the number of integrated recombinant DNAs is not controllable. To investigate the effect of genetic polymorphisms of ABCG2 on the protein expression and the drug resistance profile, we developed the Flp-In method to integrate one single copy of ABCG2 variant-cDNA into FRT-tagged genomic DNA. More than 20 metaphase spreads were examined for both fluorescence in situ hybridization (FISH) mapping and multicolor-FISH analysis, and it has been revealed that ABCG2 cDNA was incorporated into the telomeric region of the short arm on one of chromosomes 12 in Flp-In-293 cells. Based on the currently available SNP data for human ABCG2, we have created a total of seven variants by site-directed mutagenesis and stably expressed them in Flp-In-293 cells. While mRNAs of those integrated ABCG2 variants and wild type were evenly expressed in Flp-In-293 cells, the protein expression levels of F208S and S441N variants were found to be markedly low. It is suggested that the protein instability due to enhanced degradation resulted in the low levels of their protein expression. Thus, the Flp recombinase system would provide a useful tool to validate the effect of nonsynonymous SNPs on the protein stability and post-translational modification of ABCG2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 3 Plasma Membrane inside outside S S S homodimer A B CH2N COOH V12M Q141K F208S S248P F431L S441N F489L R482G R482T Acquired mutation Figure 1. Login to comment
67 PCR primers and conditions for site-directed mutagenesis to create variants of ABCG2 Variant Forward/Reverse Primer sequence (5` →→ 3`) Primer length % GC Tm (ºC) (F/R) primers (bases) V12M F CGAAGTTTTTATCCCAATGTCACAAGGAAACAC 33 39 55 R GTGTTTCCTTGTGACATTGGGATAAAAACTTCG Q141K F CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT 35 42 55 R AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG F208S F TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA 35 45 55 R TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P F TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT 35 40 55 R AAACAACTTGAAGATGGGATATCGAGGCTGATGAA F431L F AGCTGGGGTTCTCCTCTTCCTGACGACC 28 60 62 R GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N F AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC 34 47 59 R GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L F GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG 46 34 62 R CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC Sites of mutagenesis are indicated by underbars. Login to comment
104 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 0 1 2 RelativemRNAlevel Mock WT V12M Q141K mRNA A ABCG2 GAPDH Mock WT F208S S248P F431L S441N F489L ABCG2 GAPDH 0 1 2 RelativemRNAlevel mRNA B GAPDH ABCG2 Mock WT F208S S248P F431L S441N F489L Protein 0 1 2 Relativeproteinlevel * * * C DProtein GAPDH ABCG2 0 1 2 Relativeproteinlevel * * Mock WT V12M Q141K Figure 3. mRNA and protein expression levels of ABCG2 WT and variants expressed in Flp-In-293 cells. Login to comment
114 Characterization of V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells The mRNA levels of ABCG2 and GAPDH were measured by quantitative PCR, and the ratios of ABCG2 variants vs. GAPDH were plotted. Login to comment
119 Figure 3 demonstrates mRNA and protein levels of ABCG2 WT and V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells. Login to comment
124 The other variants, i.e., V12M, Q141K, S248P, F431L, and F489L, were expressed in plasma membrane as was ABCG2 WT. Login to comment
132 Figure 4 summarizes the characteristics of those Tamura et al. 8 Journal of Experimental Therapeutics and Oncology Vol. 6 2006 Class Class Class Class WT V12M Q141K F431L S248P F489L F208S S441N R482G R482T Protein expression + + + + + + - - + + SN-38 resistance + + + + + / - - - - + + MX resistance + + + + / - - - - - + + Doxorubicin resistance - - - - - - - - + + Daunorubicin resistance - - - - - - - - + + Figure 4. Login to comment
139 On the other hand, S248P, F431L, and F489L appear to form the second class, where those variant proteins are expressed at normal levels but exhibit different profiles of drug resistance. Login to comment
143 Resistance profile (IC50 ) of ABCG2 Compounds IC50 (nM) Mock WT V12M Q141K F208S S248P F431L S441N F489L SN-38 1.0 ± 0.2 49.9 ± 6.0 51.1 ± 13.8 17.7 ± 0.9 0.7 ± 0.0 3.6 ± 0.4 12.1 ± 1.5 0.8 ± 0.0 3.9 ± 0.4 (49.9)* (51.1)* (17.7)* (0.7) (3.6) (12.1)* (0.8) (3.9) Mitoxantorone 7.0 ± 1.1 108.0 ± 4.9 94.0 ± 18.6 46.7 ± 12.7 5.1 ± 1.0 13.4 ± 1.3 15.2 ± 1.4 5.7 ± 0.8 12.1 ± 6.2 (15.4)* (13.4)* (6.7)* (0.7) (1.9) (2.2)* (0.8) (1.7) Doxorubicin 38.8 ± 3.8 105.2 ± 24.9 123.6 ± 35.3 156.8 ± 27.5 19.9 ± 8.7 23.7 ± 6.7 43.5 ± 6.1 39.4 ± 4.1 47.6 ± 3.1 (2.7) (3.2) (4.0) (0.5) (0.6) (1.1) (1.0) (1.2) Daounorubicin 13.0 ± 0.6 32.3 ± 6.5 58.2 ± 5.0 57.7 ± 4.1 14.1 ± 2.3 22.1 ± 4.2 15.9 ± 1.2 13.3 ± 1.1 23.6 ± 1.6 (2.5) (4.5) (4.4) (1.1) (1.7) (1.2) (1.0) (1.8) Etoposide 117.1 ± 16.0 210.2 ± 18.4 297.3 ± 58.5 233.9 ± 54.2 122.9 ± 17.6 137.7 ± 14.8 139.1 ± 12.3 154.3 ± 8.5 186.9 ± 10.1 (1.8) (2.5) (2.0) (1.0) (1.2) (1.2) (1.3) (1.6) Vincristine 1.8 ± 0.2 4.3 ± 0.3 7.1 ± 1.4 5.6 ± 1.6 0.6 ± 0.0 4.3 ± 0.9 1.8 ± 0.3 0.9 ± 0.1 3.0 ± 0.7 (2.4) (3.0) (3.1) (0.3) (2.4) (1.0) (0.5) (1.7) The drug resistance profiles of ABCG2 WT and variants were obtained by incubating Flp-In-293/ABCG2 WT, V12M, Q141K, F208S, S248P, F431L, S441N, or F489L cells in the presence of SN-38, mitoxantrone, doxorubicin, daunorubicin, etoposide, or vincristine at different concentrations as described in Materials and Methods. Login to comment

[hide] Re-evaluation and functional classification of non... Cancer Sci. 2007 Feb;98(2):231-9. Tamura A, Wakabayashi K, Onishi Y, Takeda M, Ikegami Y, Sawada S, Tsuji M, Matsuda Y, Ishikawa T
Re-evaluation and functional classification of non-synonymous single nucleotide polymorphisms of the human ATP-binding cassette transporter ABCG2.
Cancer Sci. 2007 Feb;98(2):231-9., [PMID:17297656]

Abstract [show]
Impacts of genetic polymorphisms of the ATP-binding cassette (ABC) transporter BCRP/MXR1/ABCP (ABCG2) on drug response have been implicated; however, the hitherto reported data involve some inconsistencies. To re-evaluate the effect of single nucleotide polymorphisms (SNP) of ABCG2 in vitro, we created a total of seven variant cDNAs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) by site-directed mutagenesis and stably expressed each of them in Flp-In-293 cells using the Flp recombinase system. Multicolor fluorescence in situ hybridization mapping analysis revealed that one single copy of ABCG2 cDNA was incorporated into the telomeric region of chromosome 12p. It was proven that mRNAs of those integrated ABCG2 variants were expressed evenly in Flp-In-293 cells. However, the protein expression levels varied among those variants. In particular, expression of the F208S and S441N variants was markedly low, suggesting the instability of these variant proteins. Drug resistance profiles of Flp-In-293 cells expressing two major SNP variants (V12M and Q141K) toward the drug SN-38 demonstrated that the IC50 value (drug concentrations producing a 50% reduction of cell growth) for Q141K was approximately 50% of that for wild type. The contributions of the minor SNP variants (F208S, S248P, F431L, S441N and F489L) to drug resistance toward SN-38, mitoxantrone, doxorubicin, daunorubicin or etoposide were significantly lower than wild type. Based on our functional validation, the above-mentioned non-synonymous polymorphisms as well as acquired mutants (R482G and R482T) of ABCG2 were classified into four groups. Furthermore, new camptothecin analogs synthesized by our research group had potent effects in circumventing ABCG2-mediated drug resistance without any influence from major non-synonymous polymorphisms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 To re-evaluate the effect of single nucleotide polymorphisms (SNP) of ABCG2 in vitro, we created a total of seven variant cDNAs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) by site-directed mutagenesis and stably expressed each of them in Flp-In-293 cells using the Flp recombinase system. Login to comment
8 The contributions of the minor SNP variants (F208S, S248P, F431L, S441N and F489L) to drug resistance toward SN-38, mitoxantrone, doxorubicin, daunorubicin or etoposide were significantly lower than wild type. Login to comment
137 Characterization of the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells. Login to comment
138 Figure 2C demonstrates the mRNA and protein levels of WT ABCG2 and the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells. Login to comment
142 The other variants (S248P, F431L and F489L) were expressed in the plasma membrane, as was WT ABCG2. Login to comment
146 On the contrary, the S248P, F431L and F489L variants contributed drug resistance; however, their contribution was not so large as that of WT. Login to comment
155 For this purpose, we expressed WT ABCG2, V12M, Q141K, S248P, F431L, F489L, R482G and R482T in Sf9 insect cells and prepared plasma membranes as described previously,(16,35) as the plasma membrane of Sf9 cells has lower endogenous background ATPase activity than Flp-In-293 cells. Login to comment
176 Resistance profile (IC50) of ABCG2 Compound IC50 (nM) Mock Wild type V12M Q141K F208S S248P F431L S441N F489L SN-38 0.9 40.0 (44.4) 40.0 (44.4) 17.0 (18.9) 0.6 (0.7) 3.0 (3.3) 10.0 (11.1) 0.7 (0.8) 3.1 (3.4) Mitoxantorone 5.2 >100 (>19) 92.0 (17.7) 45.0 (8.7) 4.5 (0.9) 11.0 (2.1) 21.0 (4.0) 4.6 (0.9) 11.0 (2.1) Doxorubicin 32.0 78.0 (2.4) 100.0 (3.1) 110.0 (3.4) 20.0 (0.6) 20.0 (0.6) 40.0 (1.3) 21.0 (0.7) 45.0 (1.4) Daunorubicin 12.0 30.0 (2.5) 50.0 (4.2) 50.0 (4.2) 12.0 (1.0) 21.0 (1.8) 14.0 (1.2) 12.0 (1.0) 19.0 (1.6) Etoposide 110.0 200.0 (1.8) 220.0 (2.0) 200.0 (1.8) 110.0 (1.0) 120.0 (1.1) 120.0 (1.1) 130.0 (1.2) 170.0 (1.5) Vincristine 1.4 4.0 (2.9) 5.0 (3.6) 4.5 (3.2) 0.6 (0.4) 4.0 (2.9) 1.4 (1.0) 0.8 (0.6) 2.8 (2.0) Relative resistances to mock cells are described in parentheses. Login to comment
192 As clearly demonstrated in this study, the F208S, S248P, F431L, S441N and F489L variants exhibited greatly altered protein expression levels (Fig. 2C) or drug resistance profiles (Fig. 4 and Table 1). Login to comment
202 As one of the specific aims of the present study, we functionally classified the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity. Login to comment
207 Drug resistance profiles of Flp-In-293 cells expressing the wild-type (WT) BCRP/MXR1/ABCP (ABCG2), F208S, S248P, F431L, S441N or F489L variants toward (A) SN-38 and (B) mitoxantrone. Login to comment
216 Finally, S248P, F431L and F489L appear to form the fourth heterogeneous group, where those variant proteins are expressed at normal levels but exhibit different profiles of drug resistance and transport activity. Login to comment

[hide] The identification of two germ-line mutations in t... Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21. Yoshioka S, Katayama K, Okawa C, Takahashi S, Tsukahara S, Mitsuhashi J, Sugimoto Y
The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein.
Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21., [PMID:17373578]

Abstract [show]
PURPOSE: We examined the effects of the nine nonsynonymous germ-line mutations/SNPs in the breast cancer resistance protein (BCRP/ABCG2) gene on the expression and function of the protein. MATERIALS AND METHODS: We generated cDNAs for each of these mutants (G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP) and compared the effects of their exogenous expression in PA317 cells with a wild-type control. RESULTS: PA/F208S cells (T623C BCRP-transfectants) expressed marginal levels of a BCRP protein species (65kDa), which is slightly smaller than wild-type (70kDa), but this mutant did not appear on the cell surface or confer drug resistance. PA/F431L cells (T1291C BCRP-transfectants) were found to express both 70 kDa and 65 kDa BCRP protein products. In addition, although PA/F431L cells expressed 70 kDa BCRP at comparable levels to PA/WT cells, they showed only marginal resistance to SN-38. PA/T153M cells (C458T BCRP-transfectants) and PA/D620N cells (G1858A BCRP-transfectants) expressed lower amounts of BCRP and showed lower levels of resistance to SN-38 compared with PA/WT cells. CONCLUSIONS: We have shown that T623C BCRP encodes a non-functional BCRP and that T1291C BCRP encodes a low-functional BCRP. Hence, these mutations may affect the pharmacokinetics of BCRP substrates in patients harboring these alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 PA/F431L cells (T1291C BCRP-transfectants) were found to express both 70 kDa and 65 kDa BCRP protein products. Login to comment
7 In addition, although PA/F431L cells expressed 70 kDa BCRP at comparable levels to PA/WT cells, they showed only marginal resistance to SN-38. Login to comment
42 The cells were selected with 120 ng/mL of methotrexate, and the resulting mixed populations of resistant cells were designated as PA/WT, PA/V12M, PA/ G51C, PA/Q141K, PA/T153M, PA/I206L, PA/F208S, PA/ S248P, PA/F431L, PA/N590Y and PA/D620N, respectively. The PA/F208S clones and PA/F431L clones were obtained by limiting dilution. Login to comment
43 Cell Growth Inhibition Assay Anticancer agent resistance levels in both the parental PA317 cells and in the various BCRP transfectants were Table I. Frequencies of Germ-line Mutations/SNPs Within The BCRP Gene Variation Frequency (%) Number Population Reference Nucleotide Amino acid G34A V12M 19 29 Japanese 17 G151T G51C 0.1a 350 Japanese C376T Q126Stop 1.2 124 Japanese 17 C421A Q141K 26.6 124 Japanese 17 C458T T153M 3.3 30 Cell line 32 C496G Q166E 0.3a 200 Japanese A616C I206L 20 10 Hispanic 33 T623C F208S 0.3a 200 Japanese T742C S248P 0.5a 200 Japanese T1291C F431L 0.6b 260 Japanese 34 A1768T N590Y 1.1 88 Caucasians 33 G1858A D620N 1.1 90 unknown 35 a Determined in this study. Login to comment
45 V12M Q141K D620N N590Y F431L S248P F208S I206L T153M G51C Q166E OUT MEMBRANE IN Fig. 1. Login to comment
70 The BCRP (824 bp) and GAPDH (551 bp) transcripts were amplified by RT-PCR from 0.3 mg of total RNA. c, Western blot analysis of BCRP in PA317, PA/WT, PA/F431L, and PA/F208S cells as described above. Login to comment
75 SN-38 Resistance Levels of PA317 Transfectantsa Cell type IC50 (nmol/L) Degree of resistance PA317 11 T 0.2 1 PA/WT 550 T 16 50 PA/V12M 490 T 13 45 PA/Q141K 110 T 5.9 10 PA/T153M 260 T 15 24 PA/Q166E 680 T 40 62 PA/F208S 10 T 0.7 1 PA/F431L 34 T 0.9 3 PA/D620N 190 T 5.7 17 a Cells were cultured for 5 days with various concentrations of SN-38. Login to comment
80 RESULTS Expression of BCRP in PA317 Transfectants The germ-line mutations and resulting amino acid substitutions examined in this study were as follows; G151T (G51C), C458T (T153M), C496G (Q166E), A616C (I206L), T623C (F208S), T742C (S248P), T1291C (F431L), A1768T (N590Y) and G1858A (D620N). Login to comment
82 F431L, N590Y and D620N are located within the transmembrane domain (Fig. 1 and Table I). Login to comment
87 PA/F431L expressed BCRP products of two distinct molecular sizes, 70-kDa and 65-kDa (Fig. 2a and c). Login to comment
97 Each of the other transfectants (PA/G51C, PA/I206L, PA/S248P, PA/F431L, and PA/N590Y cells) showed similar cell surface BCRP expression levels to PA/WT (Fig. 2d). Login to comment
101 PA/F431L cells showed 3-fold higher resistance to SN-38 than PA317 cells but PA/F431L cells were found to be 15-fold more sensitive to this agent than PA/WT cells (Table II). Login to comment
107 Analyses of PA/F431L Clones PA/F431L cells expressed two species of BCRP of molecular weights 70- and 65-kDa (Fig. 2a). Login to comment
108 To confirm whether these two versions of the protein were derived from a single gene, we isolated independent PA/F431L subclones, PA/F431L-cl.6 and -cl.15. Login to comment
109 As shown in Fig. 4a, both of these clones simultaneously expressed the 70- and 65-kDa BCRP species, similar to the original mass population of PA/F431L cells. Login to comment
110 FACS analysis further revealed that these clones also showed similar BCRP expression levels on their cell surfaces to PA/WT and PA/F431L cells (Fig. 4c). Login to comment
111 Moreover, these clones showed no change in their exogenous BCRP mRNA levels compared with PA/WT and PA/F431L (Fig. 4b) but showed only marginal resistance to SN-38 treatment (Fig. 4d). Login to comment
128 DISCUSSION In our current study, we have examined the effect of the nine germ-line mutations/SNPs, G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP, resulting in the amino acid changes G51C, T153M, Q166E, I206L, F208S, S248P, F431L, N590Y, D620N, respectively, on BCRP protein expression and function. Login to comment
130 The resulting mixed populations of cells were designated a PA/WT, PA/V12M, PA/G51C, PA/Q141K, PA/ T153M, PA/I206L, PA/F208S, PA/S248P, PA/F431L, PA/ N590Y and PA/D620N. Login to comment
133 PA/F431L cells expressed a 65-kDa and 70-kDa species of BCRP (Figs. 2a and 4a). Login to comment
134 In addition, although PA/ F431L cells expressed BCRP at cell surface levels that were similar to PA/WT cells (Figs. 2d and 4c), they showed only marginal resistance to SN-38 (Fig. 4d and Table II). Login to comment
143 G51C, T153M, Q166E, I206L, F208S, and S248P are located in the intracellular domain, and F431L, N590Y, and D620N reside in the transmembrane domain. Login to comment
158 BCRP protein and mRNA expression in PA/F431L clones as described in Figs. 2 and 3. a, Western blot analysis of BCRP in PA/ F431L clones b, Semi-quantitative RT-PCR of BCRP mRNA in PA/ F431L clones. Login to comment
159 c, BCRP cell surface expression analysis of PA/F431L clones by FACS. Login to comment
160 d, Drug resistance levels in the PA/F431L clones. PA317 (open circle), PA/WT (closed circle), PA/F431L (closed triangle), PA/F431L clone 6 (closed lozenge), and PA/F431L clone 15 (closed square) cells were cultured for 5 days with various concentrations of SN-38 and assayed as described in Fig. 3d. Login to comment
164 The F431L residue is located in the second transmembrane domain (Fig. 1) and PA/F431L cells express two species of BCRP of 70-kDa and 65-kDa in size. Login to comment
165 The 65-kDa F431L BCRP product has the same molecular weight as F208S BCRP by SDS-PAGE (Fig. 2a and c). Login to comment
166 From the results of our analysis of PA/F431L clones, these two products seemed to be generated from a single cDNA species (Fig. 4b). Login to comment
167 The 70-kDa BCRP expression levels in PA/F431L cells were also much higher than the 65-kDa BCRP protein in the same cells (Figs. 2c and 4c). Login to comment
168 Although PA/F431L cells express higher quantities of 70-kDa BCRP compared with PA/Q141K, PA/T153M, and PA/D620N cells (Fig. 2a) these cells in fact show a lower resistance to SN-38 than these other three transfectants (Table II). Login to comment
169 From these results, we speculate that this residue might in fact be important in the recognition of SN-38, and that the F431L substitution may result in lower transporter function than the wild-type protein. Login to comment
178 CONCLUSION We have characterized two important BCRP germ-line mutations, T623C (F208S) and T1291C (F431L). Login to comment

[hide] Ubiquitin-mediated proteasomal degradation of non-... Biochem J. 2008 May 1;411(3):623-31. Nakagawa H, Tamura A, Wakabayashi K, Hoshijima K, Komada M, Yoshida T, Kometani S, Matsubara T, Mikuriya K, Ishikawa T
Ubiquitin-mediated proteasomal degradation of non-synonymous SNP variants of human ABC transporter ABCG2.
Biochem J. 2008 May 1;411(3):623-31., 2008-05-01 [PMID:18237272]

Abstract [show]
Clinical relevance is implicated between the genetic polymorphisms of the ABC (ATP-binding cassette) transporter ABCG2 (ABC subfamily G, member 2) and the individual differences in drug response. We expressed a total of seven non-synonymous SNP (single nucleotide polymorphism) variants in Flp-In-293 cells by using the Flp (flippase) recombinase system. Of these, ABCG2 F208S and S441N variants were found to be expressed at markedly low levels, whereas their mRNA levels were equal to those of the other SNP variants and ABCG2 WT (wild-type). Interestingly, protein expression levels of the ABCG2 F208S and S441N variants increased 6- to 12-fold when Flp-In-293 cells were treated with MG132, a proteasome inhibitor. Immunoprecipitation followed by immunoblot analysis showed that the ABCG2 F208S and S441N variant proteins were endogenously ubiquitinated in Flp-In-293 cells, and treatment with MG132 significantly enhanced the level of these ubiquitinated variants. Immunofluorescence microscopy demonstrated that MG132 greatly affected the ABCG2 F208S and S441N variants in terms of both protein levels and intracellular distribution. Immunoblot analysis revealed that those variants were N-glycosylated; however, their oligosaccharides were immature compared with those present on ABCG2 WT. The ABCG2 F208S and S441N variant proteins do not appear to be processed in the Golgi apparatus, but undergo ubiquitin-mediated protein degradation in proteasomes, whereas ABCG2 WT is sorted to the plasma membrane and then degraded via the lysosomal pathway. The present study provides the first evidence that certain genetic polymorphisms can affect the protein stability of ABCG2. Control of proteasomal degradation of ABCG2 would provide a novel approach in cancer chemotherapy to circumvent multidrug resistance of human cancers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 Furthermore, the F208S, S248P, F431L, S441N, and F489L ABCG2 variants exhibited greatly altered protein expression levels and drug Abbreviations used: ABC, ATP-binding cassette; ABCG2, ABC subfamily G, member 2; BMA, bafilomycin A1; CPT, camptothecin; DMEM, Dulbecco`s modified Eagle`s medium; endo H, endoglycosidase H; ER, endoplasmic reticulum; ERAD, ER-associated degradation; FCS, fetal calf serum; Flp, flippase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HRP, horseradish peroxidase; ME, 2-mercaptoethanol; PNGase F, peptide N-glycosidase F; RT-PCR, reverse transcription-PCR; SN-38, 7-ethyl-10-hydroxycamptothecin; SNP, single nucleotide polymorphism; TBS, Tris-buffered saline; WT, wild-type. Login to comment
208 In a previous study using the Flp recombinase system [33], we functionally characterized the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity. Login to comment

[hide] Homology modeling of breast cancer resistance prot... J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15. Hazai E, Bikadi Z
Homology modeling of breast cancer resistance protein (ABCG2).
J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15., [PMID:18249138]

Abstract [show]
BCRP (also known as ABCG2, MXR, and ABC-P) is a member of the ABC family that transports a wide variety of substrates. BCRP is known to play a key role as a xenobiotic transporter. Since discovering its role in multidrug resistance, considerable efforts have been made in order to gain deeper understanding of BCRP structure and function. The recent study was aimed at predicting BCRP structure by creating a homology model. Based on sequence similarity with known structures of full-length, NB and TM domain of ABC transporters, TM, NB, and linker regions of BCRP were defined. The NB domain of BCRP was modeled using MalK as a template. Based on secondary structure prediction of BCRP and comparison of the transmembrane connecting regions of known structures of ABC transporters, the TM domain arrangement of BCRP was established and was found to resemble to that of the recently published crystal structure of Sav1866. Thus, an initial alignment of TM domain of BCRP was established using Sav1866 as a template. This alignment was subsequently refined using constrains derived from secondary structure and TM predictions and the final model was built. Finally, the complete homodimer ABCG2 model was generated using Sav1866 as template. Furthermore, known ligands of BCRP were docked to our model in order to define possible binding sites. The results of molecular dockings of known BCRP substrates to the BCRP model were in agreement with recently published experimental data indicating multiple binding sites in BCRP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand. Login to comment

[hide] Drug-induced phototoxicity evoked by inhibition of... Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72. Tamura A, An R, Hagiya Y, Hoshijima K, Yoshida T, Mikuriya K, Ishikawa T
Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems.
Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72., [PMID:18363541]

Abstract [show]
BACKGROUND: Photosensitivity depends on both genetic and environmental factors. Pheophorbide a, present in various plant-derived foods and food supplements, can be absorbed by the small intestine. Accumulation of pheophorbide a and porphyrins in the systemic blood circulation can result in phototoxic lesions on light-exposed skin. OBJECTIVE: As the human ATP-binding cassette (ABC) transporter ABCG2 has been suggested to be critically involved in porphyrin-mediated photosensitivity, we aimed to develop in vitro screening systems for drug-induced phototoxicity. CONCLUSION: Functional impairment owing to inhibition of ABCG2 by drugs or its genetic polymorphisms can lead to the disruption of porphyrin homeostasis. This review article provides an overview on drug-induced photosensitivity, as well as our hypothesis on a potential role of ABCG2 in phototoxicity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A. Login to comment
231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids. Login to comment
245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative). Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
250 It should be noted that many xeno- and endobiotic BCRP Figure 5 Predicted membrance topology of BCRP (ABCG2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 5 for allele frequencies and description of funtional consequences. NH2 COOH NBD Val12Met Gly51Cys Gln126* Ala149Pro Gln141Lys Thr153Met Arg160Gln Arg163Lys Gln166Glu Phe506Ser Phe507Leu Val508Leu Met509* Phe489Leu Ser441Asn Phe431Leu Glu334* Ile206Leu Ala315del Thr316del Phe208Ser Asp296His Ser248Pro Pro269Ser Phe571Ile Arg575* Asn590Tyr Asp620Asn in out Membrane BCRP (ABCG2) NBD Val12Met NBDNBD Val12Met substrates are also transported by other efflux transporters, especially P-glycoprotein, thus extrapolating BCRP related in vitro data to the in vivo situation may be difficult. Login to comment
315 22.Itoda,M.,etal.EightnovelsinglenucleotidepolymorphismsinABCG2/BCRPinJapanesecancerpatientsadministeredirinotacan.DrugMetabPharmacokinet.2003; 18(3):212-217. decreased MTX and porphyrin transport in cells transfected with variant cDNA in comparison to wild-type cDNA has also been reported for the following variants Phe208Ser, Ser248Pro, and Phe431Leu (Tamura et al., 2006). Login to comment

[hide] Human ABC transporters ABCG2 (BCRP) and ABCG4. Xenobiotica. 2008 Jul;38(7-8):863-88. Koshiba S, An R, Saito H, Wakabayashi K, Tamura A, Ishikawa T
Human ABC transporters ABCG2 (BCRP) and ABCG4.
Xenobiotica. 2008 Jul;38(7-8):863-88., [PMID:18668433]

Abstract [show]
1. The human ABC transporter ABCG2 is regarded as a member of the phase III system for xenobiotic metabolism, and it has been suggested that this efflux pump is responsible for protecting the body from toxic xenobiotics and for removing metabolites. 2. This review paper will address the new aspects of ABCG2 in terms of post-translational modifications (i.e., disulfide bond formation, ubiquitination, and endoplasmic reticulum-associated degradation) of ABCG2 protein, high-speed screening, and quantitative structure-activity relationship (QSAR) analysis to evaluate ABCG2-drug interactions, and genetic polymorphisms potentially associated with photosensitivity. 3. In addition, new aspects of human ABCG4 and mouse Abcg4 are presented with respect to their molecular properties and potential physiological roles. Considering a high sequence similarity between ABCG1 and ABCG4, both Abcg4 and ABCG4 may be involved in the transport of cholesterol from neurons and astrocytes. Furthermore, high expression of the mouse Abcg4 protein in the testis implicates its involvement in transport of certain sex hormones.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007). Login to comment
234 The F431L variant as well as the acquired mutants R482G and R482T transported haematoporphyrin (Figure 9a), although they did not transport methotrexate (Figure 9b). Login to comment

[hide] Major SNP (Q141K) variant of human ABC transporter... Pharm Res. 2009 Feb;26(2):469-79. Epub 2008 Oct 29. Furukawa T, Wakabayashi K, Tamura A, Nakagawa H, Morishima Y, Osawa Y, Ishikawa T
Major SNP (Q141K) variant of human ABC transporter ABCG2 undergoes lysosomal and proteasomal degradations.
Pharm Res. 2009 Feb;26(2):469-79. Epub 2008 Oct 29., [PMID:18958403]

Abstract [show]
PURPOSE: Single nucleotide polymorphisms (SNPs) of the ATP-binding cassette (ABC) transporter ABCG2 gene have been suggested to be a significant factor in patients' responses to medication and/or the risk of diseases. We aimed to evaluate the impact of the major non-synonymous SNP Q141K on lysosomal and proteasomal degradations. METHODS: ABCG2 WT and the Q141K variant were expressed in Flp-In-293 cells by using the Flp recombinase system. Their expression levels and cellular localization was measured by immunoblotting and immunofluorescence microscopy, respectively. RESULTS: The protein level of the Q141K variant expressed in Flp-In-293 cells was about half that of ABCG2 WT, while their mRNA levels were equal. The protein expression level of the Q141K variant increased about two-fold when Flp-In-293 cells were treated with MG132. In contrast, the protein level of ABCG2 WT was little affected by the same treatment. After treatment with bafilomycin A1, the protein levels of ABCG2 WT and Q141K increased 5- and 2-fold in Flp-In-293 cells, respectively. CONCLUSIONS: The results strongly suggest that the major non-synonymous SNP Q141K affects the stability of the ABCG2 protein in the endoplasmic reticulum and enhances its susceptibility to ubiquitin-mediated proteasomal degradation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
130 As shown in Fig. 3A, the protein level of the Q141K variant was approximately two-fold enhanced by treatment with the proteasome inhibitor MG132. Login to comment
175 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles (18). Login to comment

[hide] Functions of the breast cancer resistance protein ... Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3. Noguchi K, Katayama K, Mitsuhashi J, Sugimoto Y
Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy.
Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3., 2009-01-31 [PMID:19111841]

Abstract [show]
The breast cancer resistance protein, BCRP/ABCG2, is a half-molecule ATP-binding cassette transporter that facilitates the efflux of various anticancer agents from the cell, including 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. The expression of BCRP can thus confer a multidrug resistance phenotype in cancer cells, and its transporter activity is involved in the in vivo efficacy of chemotherapeutic agents. Thus, the elucidation of the substrate preferences and structural relationships of BCRP is essential to understanding its in vivo functions during chemotherapeutic treatments. Single nucleotide polymorphisms (SNPs) have also been found to be key factors in determining the efficacy of chemotherapeutics, and those therapeutics that inhibit BCRP activity, such as the SNP that results in a C421A mutant, may result in unexpected side effects of the BCRP- anticancer drugs interaction even at normal dosages. In order to modulate the BCRP activity during chemotherapy, various compounds have been tested as inhibitors of this protein. Estrogenic compounds including estrone, several tamoxifen derivatives in addition to phytoestrogens and flavonoids have been shown to reverse BCRP-mediated drug resistance. Intriguingly, recently developed molecular targeted cancer drugs, such as the tyrosine kinase inhibitors imatinib mesylate, gefitinib and others, can also interact with BCRP. Since both functional SNPs and inhibitory agents of BCRP modulate the in vivo pharmacokinetics and pharmacodynamics of its substrate drugs, BCRP activity is an important consideration in the development of molecular targeted chemotherapeutics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

[hide] Quality control of human ABCG2 protein in the endo... Adv Drug Deliv Rev. 2009 Jan 31;61(1):66-72. Epub 2008 Dec 11. Wakabayashi-Nakao K, Tamura A, Furukawa T, Nakagawa H, Ishikawa T
Quality control of human ABCG2 protein in the endoplasmic reticulum: ubiquitination and proteasomal degradation.
Adv Drug Deliv Rev. 2009 Jan 31;61(1):66-72. Epub 2008 Dec 11., 2009-01-31 [PMID:19111842]

Abstract [show]
Human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR/ABCP) is a plasma membrane protein carrying intra- and inter-molecular disulfide bonds and an N-linked glycan. Both disulfide bond formation and N-glycosylation are critical check points determining the stability and degradation fate of ABCG2 protein in the endoplasmic reticulum (ER). Misfolded ABCG2 protein without those post-translational modifications is removed from the ER by retrotranslocation to the cytosol compartment, ubiquitination by ubiquitin ligase, and finally degradation by proteasomes. Certain non-synonymous SNP variants of ABCG2 undergo such ER-associated degradation (ERAD).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
951 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles [34]. Login to comment

[hide] Intracellular trafficking of MDR transporters and ... Curr Top Med Chem. 2009;9(2):197-208. Porcelli L, Lemos C, Peters GJ, Paradiso A, Azzariti A
Intracellular trafficking of MDR transporters and relevance of SNPs.
Curr Top Med Chem. 2009;9(2):197-208., [PMID:19200005]

Abstract [show]
Multi-drug resistance (MDR) frequently contributes to the failure of chemotherapeutic treatments in cancer patients. Mechanisms underlying the development of MDR have been extensively studied and are considered multifactorial. Among them, the ATP-Binding Cassette (ABC) family of proteins plays a pivotal role. Processes of cellular distribution and subcellular localization of MDR-ABC proteins are not yet well explored and to enlighten these topics could be crucial to understand cellular drug uptake and retention. In this review, we analysed literature data concerning i) intracellular trafficking of MDR-ABC proteins (BCRP, P-gp and MRP1) and ii) mechanisms altering their cellular localization and trafficking. Moreover, we describe single nucleotide polymorphisms (SNP) that have been reported for some multidrug resistance (MDR) transporters, such as BCRP and P-gp, emphasizing their ability to affect the expression, function and localization of the transporters, with implications on drug resistance phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
206 The polymorphisms T623C (F208S), T742C (S248P), T1291C (F431L) and T1465C (F489L) were studied by Tamura et al. Login to comment

[hide] Human ABC transporter ABCG2 in cancer chemotherapy... J Exp Ther Oncol. 2009;8(1):5-24. Ishikawa T, Nakagawa H
Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics.
J Exp Ther Oncol. 2009;8(1):5-24., [PMID:19827267]

Abstract [show]
The ability of cancer cells to acquire resistance to multiple anticancer agents, termed multidrug resistance, is often mediated by overexpression of ATP-binding cassette (ABC) transporters that remove drugs out of the cell against a concentration gradient. ABCG2, or breast cancer resistance protein (BCRP), is an ABC transporter that has been the subject of intense study since its discovery a decade ago. While ABCG2 overexpression has been demonstrated in cancer cells after in vitro drug treatment, endogenous ABCG2 expression in certain cancers is considered as a reflection of the differentiated phenotype of the cell of origin and likely contributes to intrinsic drug resistance. Notably, ABCG2 is often expressed in stem cell populations, where it plays a critical role in cellular protection. ABCG2 exhibits a broad range of substrate specificity. New technologies of high-speed screening and quantitative structure-activity-relationship (QSAR) analysis have been developed to analyze the interactions of drugs with ABCG2. As ABCG2 reportedly transports porphyrins, its contribution to photodynamic therapy of human cancer is also implicated. Protein expression levels of ABCG2 in cancer cells are regulated by both transcriptional activation and protein degradation. The ABCG2 protein undergoes endosomal and/or ubiquitin-mediated proteasomal degradations. Furthermore, genetic polymorphisms in the ABCG2 gene are important factors in cancer chemotherapy to circumvent adverse effects and/or to enhance the efficacy of anticancer drugs. The present review article addresses recent advances in molecular pharmacology and pharmacogenomics of ABCG2 and provides novelideas to improve cancer chemotherapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
222 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I OUT IN R160Q R575stop ATP-binding site Figure 7. Continued A 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:50 19 Q141K has been associated with lower levels of protein expression and impaired transport in vitro (Imai et al., 2002; Kobayashi et al., 2005; Misuarai et al., 2004; Zamber et al., 2003; Morisaki et al., 2008; Kondo et al., 2004). Login to comment
228 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles Figure 7. Continued WT V12M Q141K F208S S248P F431L S441N F489L R482G R482T Protein expression + + + - + + - + + + MTX transport + + + - - - - +/ - - Porphyrin transport + + + - - + - +/ + + SN-38 resistance + + + - +/ + - - + + MX resistance + + + - - - - - -- - - - - - - - +/ - - - - - - - - + + Doxorubicin resistance + + Daunorubicin resistance + + ATPase activity (Prazosin) + + WTV12M Q141K F431L F489L S248P F208S S441L R482G R482T ∆1.5 ∆3 ∆3.5 ∆5 ∆4 - - - - - - -- - - B 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:51 20 Journal of Experimental Therapeutics and Oncology Vol. 8 2009 (Tamura et al., 2007b). Login to comment
232 It is known that, in the ER, the N-linked glycans play pivotal roles in protein fold- 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) Methotrexate 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) MethotrexateMethotrexate Porphyrintransport (nmol/min/mgprotein) 0.0 0.1 0.2 0.3 0.4 0.5 0.0 0.1 0.2 0.3 0.4 0.5 Porphyrin Figure 7. Login to comment

[hide] Impact of breast cancer resistance protein on canc... Methods Mol Biol. 2010;596:251-90. Ross DD, Nakanishi T
Impact of breast cancer resistance protein on cancer treatment outcomes.
Methods Mol Biol. 2010;596:251-90., [PMID:19949928]

Abstract [show]
Breast cancer resistance protein (BCRP/ABCG2) was discovered in multidrug resistant breast cancer cells having an ATP-dependent transport-based resistance phenotype. This ABC transporter functions (at least in part) as a xenobiotic protective mechanism for the organism: in the gut and biliary tract, it prevents absorption and enhances elimination of potentially toxic substances. As a placental barrier, it protects the fetus; similarly, it serves as a component of blood-brain and blood-testis barrier; BCRP is expressed in stem cells and may protect them from potentially harmful agents. Therefore, BCRP could influence cancer outcomes by (a) endogenous BCRP affecting the absorption, distribution, metabolism, and elimination of anticancer drugs; (b) BCRP expression in cancer cells may directly cause resistance by active efflux of anticancer drugs; (c) BCRP expression in cancer cells could be a manifestation of the activity of metabolic and signaling pathways that impart multiple mechanisms of drug resistance, self-renewal (stemness), and invasiveness (aggressiveness)--i.e. impart a poor prognosis--to cancers. This chapter presents a synopsis of translational clinical studies relating BCRP expression in leukemias, lymphomas, and a variety of solid tumors with clinical outcome. Data are emerging that expression of BCRP, like P-glycoprotein/ABCB1, is associated with adverse outcomes in a variety of human cancers. Whether this adverse prognostic effect results from resistance imparted to the cancer cells as the direct result of BCRP efflux of anticancer drugs, or whether BCRP expression (and also Pgp expression - coexpression of these transporters is common among poor risk cancers) serves as indicators of the activity of signaling pathways that enhance cancer cellular proliferation, metastases, genomic instability, enhance drug resistance, and oppose programmed cell death mechanisms is yet unknown.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 Tamura et al. used multicolor fluorescence in situ hybridization to assure uniform mRNA expression of cDNAs of seven BCRP SNPs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) transduced into Flp-In-293 cells (87, 88). Login to comment

[hide] Pharmacological interaction with sunitinib is abol... Cancer Sci. 2010 Jun;101(6):1493-500. Epub 2010 Feb 22. Kawahara H, Noguchi K, Katayama K, Mitsuhashi J, Sugimoto Y
Pharmacological interaction with sunitinib is abolished by a germ-line mutation (1291T>C) of BCRP/ABCG2 gene.
Cancer Sci. 2010 Jun;101(6):1493-500. Epub 2010 Feb 22., [PMID:20345483]

Abstract [show]
Sunitinib malate (Sutent, SU11248) is a small-molecule multitargeted tyrosine kinase inhibitor (TKI) used for the treatment of renal cell carcinoma and imatinib-resistant gastrointestinal stromal tumors. Some TKIs can overcome multidrug resistance conferred by ATP-binding cassette transporter, P-glycoprotein (P-gp)/ABCB1, multidrug resistance-associated protein 1 (MRP1)/ABCC1, and breast cancer resistance protein (BCRP)/ABCG2. Here, we analyzed the effects of sunitinib on P-gp and on wild-type and germ-line mutant BCRPs. Sunitinib remarkably reversed BCRP-mediated and partially reversed P-gp-mediated drug resistance in the respective transfectants. The in vitro vesicle transport assay indicated that sunitinib competitively inhibited BCRP-mediated estrone 3-sulfate transport and P-gp-mediated vincristine transport. These inhibitory effects of sunitinib were further analyzed in Q141K-, R482G-, R482S-, and F431L-variant BCRPs. Intriguingly, the F431L-variant BCRP, which is expressed by a germ-line mutant allele 1291T>C, was almost insensitive to both sunitinib- and fumitremorgin C (FTC)-mediated inhibition in a cell proliferation assay. Sunitinib and FTC did not inhibit (125)I-iodoarylazidoprazosin-binding to F431L-BCRP. Thus, residue Phe-431 of BCRP is important for the pharmacological interaction with sunitinib and FTC. Collectively, this is the first report showing a differential effect of a germ-line variation of the BCRP/ABCG2 gene on the pharmacological interaction between small-molecule TKIs and BCRP. These findings would be useful for improving our understanding of the pharmaceutical effects of sunitinib in personalized chemotherapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 These inhibitory effects of sunitinib were further analyzed in Q141K-, R482G-, R482S-, and F431L-variant BCRPs. Login to comment
6 Intriguingly, the F431L-variant BCRP, which is expressed by a germ-line mutant allele 1291T>C, was almost insensitive to both sunitinib- and fumitremorgin C (FTC)-mediated inhibition in a cell proliferation assay. Login to comment
7 Sunitinib and FTC did not inhibit 125 I-iodoarylazidoprazosin-binding to F431L-BCRP. Login to comment
21 (16) In addition, we reported that a germ-line mutant allele 1291T>C expresses the F431L variant of BCRP with lower functional resistance to SN-38. Login to comment
22 (17) This suggests that amino acid substitution F431L may affect substrate recognition of SN-38. Login to comment
37 Moreover, we show for the first time that this inhibitory effect of sunitinib on BCRP is cancelled by a germ-line mutation of BCRP gene (1291T>C) that causes a single amino acid substitution of F431L. Login to comment
45 (17,21) To establish K562 /F431L cells, parental K562 cells were transduced with a HaBCRP retrovirus- harboring Myc-tagged human BCRP (F431L) cDNA in the Ha retrovirus vector as previously described. Login to comment
46 (17) After limiting dilution without any selective drugs and screening of over 700 clones, we selected two F431L-BCRP-expressing K562 cell clones K562/F431L-1 and -3. Login to comment
109 (13,35-37) The Q141K variant, a widespread SNP in Japanese individuals, is associated with the low protein expression of BCRP,(15) and the F431L variant, also a germ-line mutation of BCRP, shows a low level of resistance to SN-38. Login to comment
126 marginal ability to overcome SN-38 resistance in the F431L-BCRP variant, even though the other BCRP variants were all sensitive to sunitinib with comparable efficacy. Login to comment
127 To confirm these observations, we also tested the effect of sunitinib on F431L-BCRP in different cell lines. Login to comment
128 The F431L BCRP-expressing K562 cell clones K562/F431L-1 and -3 were established without the drug selection process. Login to comment
129 FACS analysis showed that the protein expression of F431L-BCRP in K562 cells was relatively low (1/8-1 /4-fold compared with wild-type BCRP-expressing K562 cells) (Fig. 5a). Login to comment
130 The reason for the lower protein expression of F431L-BCRP in K562 cells is unknown, but we could not isolate K562 /F431L clones expressing high levels of F431L-BCRP protein, even after the screening of over 700 clones. Login to comment
131 These additional experiments also revealed that sunitinib could not overcome SN-38 resistance conferred by F431L-BCRP (Fig. 5b). Login to comment
132 We also examined the inhibition of the F431L-BCRP variant by the typical BCRP inhibitor FTC and found that the F431L-BCRP variant was also resistant to FTC-mediated inhibition (Fig. 5c). Login to comment
134 Effects of sunitinib on IAAP binding to F431L-BCRP. Login to comment
135 We next examined the effect of sunitinib on photoaffinity labeling of wild-type and F431L-BCRP with [I125 ]IAAP-binding to investigate the direct competition between the substrate IAAP and sunitinib on the F431L variant. Login to comment
136 Because F431L-BCRP protein expression was lower than wild-type BCRP in K562 cell lines (Fig. 6a), [I125 ]IAAP-binding to the membrane vesicles prepared from these K562/F431L cells was weaker than that from wild-type BCRP-expressing membrane vesicles. Login to comment
137 Consistent with other reports, sunitinib (10 lmol /L) and FTC (10 lmol /L) inhibited [I125 ]IAAP-binding to wild-type BCRP, whereas [I125 ]IAAP-binding to the F431L variant was apparently resistant to sunitinib- and FTC-mediated inhibition (Fig. 6b,c). Login to comment
138 These data clearly showed that the F431L variant has decreased affinity for physical interactions with sunitinib and FTC. Login to comment
173 Reversal ratios are shown for wild-type (gray circles), and Q141K (open squares), F431L (filled circles), R482S (open diamonds), and R482G (open triangles) BCRP variant-expressing cells. Login to comment
175 Moreover, the germ-line BCRP variant F431L showed decreased affinity for sunitinib and therefore would be irrelevant to the pharmacological and physical interaction between BCRP and sunitinib. Login to comment
180 Second, we investigated the effect of sunitinib on mutants of BCRP, and found that the F431L variant conferred resistance to sunitinib-mediated suppression. Login to comment
188 Sunitinib failed to overcome F431L-breast cancer resistance protein (BCRP)-mediated drug resistance in K562 cells. Login to comment
189 Protein expression of BCRP in K562 / F431L cells was analyzed by flow cytometry (a). Login to comment
190 The F431L-BCRP-expressing K562 cell lines K562 / F431L-1 and -3 were cultured for 5 days with SN-38 and sunitinib (b) or fumitremorgin C (FTC) (c). Login to comment
193 Effect of sunitinib on photoaffinity labeling of wild-type and F431L-breast cancer resistance protein (BCRP) with [125 I]IAAP. Login to comment
194 Protein expression of BCRP was analyzed by western blotting (a) in F431L-BCRP-transduced K562 cells. Login to comment
195 Membrane vesicles (90 lg / mL) from K562 / BCRP and K562 / F431L-3 cells were pre-incubated for 5 min with sunitinib or fumitremorgin C (FTC) (10 lmol / L each) and then 10 nmol / L of [125 I]IAAP was added for a further 10 min. Login to comment
202 The germ-line mutant F431L-BCRP was previously shown to have low ability to confer drug-resistance to SN-38. Login to comment
203 (34) Our present study also showed that the F431L mutation in BCRP compromised the pharmacological and physical interactions with sunitinib and FTC. Login to comment
206 (26) Thus F431L substitution may reduce substrate /inhibitor-recognition efficacy or may be an important amino acid residue involved in the functional transporter activity of BCRP. Login to comment
210 Our observations also indicate that the F431L-BCRP protein forms a dimer (data not shown), but our data appeared to be inconsistent with their conclusion because the F431L-BCRP variant showed reduced sensitivity to FTC. Login to comment
211 Unfortunately, we failed to confirm the inhibitory effects of sunitinib and FTC on F431L-BCRP-mediated drug transport using the in vitro vesicle transport assay because the membrane vesicles prepared from K562 /F431L cells did not show good transport activity in vitro (data not shown). Login to comment
212 However, we also monitored anti-BCRP antibody 5D3 reactivity to F431L-BCRP in the presence or absence of FTC because the direct interaction between FTC and BCRP is thought to stimulate the binding efficacy of the anti-BCRP antibody 5D3 by inducing a conformational change in BCRP. Login to comment
213 (46) In this 5D3 reactivity test, the fluorescence intensity associated with 5D3 antibody binding was changed by FTC treatment in K562 /BCRP cells, but not in K562/F431L cells (Fig. S3, Supporting information). Login to comment
214 This experiment suggested that F431L-BCRP is resistant to the FTC-induced conformational change required for 5D3 antibody-binding to BCRP. Login to comment
215 Overall, we suspect that the F431L variant shows compromised physical interaction with FTC and sunitinib, or altered conformational dynamics that are required for substrate recognition and transport cycling by BCRP. Login to comment
217 (31) Although F431L-BCRP had lower transporter activity than wild-type BCRP, this mutant BCRP still conferred significant drug-resistance in both PA317 and K562 cells, so that we should pay attention to functional relevance between drug-drug interaction and this mutant BCRP. Login to comment
218 Importantly, our findings demonstrate that germ-line mutations of the BCRP /ABCG2 gene 1291T>C (F431L), affect its pharmacological interaction with sunitinib. Login to comment
221 In future personalized medicine, functional analysis of germ-line mutation affecting efficacy of drug-drug interactions such as F431L-BCRP with sunitinib would contribute to design for the evidence-based optimized chemotherapy regimen in each patient. Login to comment

[hide] BCRP/ABCG2 confers anticancer drug resistance with... Cancer Sci. 2010 Aug;101(8):1813-21. Epub 2010 Apr 28. Shigeta J, Katayama K, Mitsuhashi J, Noguchi K, Sugimoto Y
BCRP/ABCG2 confers anticancer drug resistance without covalent dimerization.
Cancer Sci. 2010 Aug;101(8):1813-21. Epub 2010 Apr 28., [PMID:20518788]

Abstract [show]
In previous studies, we demonstrated that the breast cancer resistance protein (BCRP, ABCG2) forms an S-S homodimer. The BCRP-C603S mutant substituting Ser for Cys-603 in the third extracellular domain formed both a 70-75-kDa monomer and 140-150-kDa dimer, suggesting that Cys-603 is an important residue in the covalent bridge. These results also suggested the involvement of other Cys residues in dimer formation. In the present study, we examined the possible involvement of the other extracellular Cys residues, Cys-592 and Cys-608, in the dimerization and transporter functions of BCRP using double and triple Cys-mutant BCRP transfectants. In SDS-PAGE under non-reducing conditions, BCRP-C592S.C603S and BCRP-C592S.C608S were detected as dimers whereas BCRP-C603S.C608S and BCRP-C592S.C603S.C608S were found only as monomers. This finding indicated that no Cys residues other than the three extracellular Cys are responsible for the dimer formation. The formation of BCRP-C592S.C603S dimer suggested the involvement of Cys-608 in the covalent linkage of this mutant BCRP. PA/C592S.C603S.C608S-cl.7 cells showed a significant level of multiple drug resistance and low-level accumulation of mitoxantrone. These results clearly demonstrate that BCRP functions as a drug resistance protein without covalent dimerization. Among drug-resistant Cys-mutant BCRP transfectants, PA/C603S, PA/C592S.C608S, and PA/C592S.C603S.C608S were found to be more resistant to the reversal effects of fumitremorgin C than PA/WT, suggesting some alteration in the substrate recognition in Cys-mutant BCRPs. In conclusion, Cys-mediated covalent dimerization is not required for BCRP to function as a transporter. In addition to Cys-603, Cys-608 may also be involved in BCRP dimer formation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
260 We have also reported that two germ line mutations of BCRP in our laboratory, namely 623T>C (F208S) and 1291T>C (F431L), also resulted in the loss of function or severely reduced the function of BCRP. Login to comment
261 (44) Sunitinib clearly reversed the SN-38 resistance of PA /WT cells but not of BCRP-F431L transfectants. Login to comment
262 In addition, sunitinib did not inhibit [125 I]iodoarylazidoprazosin-binding to BCRP-F431L. Login to comment

[hide] Structure and function of the human breast cancer ... Curr Drug Metab. 2010 Sep;11(7):603-17. Ni Z, Bikadi Z, Rosenberg MF, Mao Q
Structure and function of the human breast cancer resistance protein (BCRP/ABCG2).
Curr Drug Metab. 2010 Sep;11(7):603-17., [PMID:20812902]

Abstract [show]
The human breast cancer resistance protein (BCRP/ABCG2) is the second member of the G subfamily of the large ATP-binding cassette (ABC) transporter superfamily. BCRP was initially discovered in multidrug resistant breast cancer cell lines where it confers resistance to chemotherapeutic agents such as mitoxantrone, topotecan and methotrexate by extruding these compounds out of the cell. BCRP is capable of transporting non-chemotherapy drugs and xenobiotiocs as well, including nitrofurantoin, prazosin, glyburide, and 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine. BCRP is frequently detected at high levels in stem cells, likely providing xenobiotic protection. BCRP is also highly expressed in normal human tissues including the small intestine, liver, brain endothelium, and placenta. Therefore, BCRP has been increasingly recognized for its important role in the absorption, elimination, and tissue distribution of drugs and xenobiotics. At present, little is known about the transport mechanism of BCRP, particularly how it recognizes and transports a large number of structurally and chemically unrelated drugs and xenobiotics. Here, we review current knowledge of structure and function of this medically important ABC efflux drug transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
270 Similarly, Leu substitution of Phe431 retained full transport activity for porphyrin, but not for methotrexate [120]. Login to comment

[hide] In vitro and in vivo evidence for the importance o... Handb Exp Pharmacol. 2011;(201):325-71. Meyer zu Schwabedissen HE, Kroemer HK
In vitro and in vivo evidence for the importance of breast cancer resistance protein transporters (BCRP/MXR/ABCP/ABCG2).
Handb Exp Pharmacol. 2011;(201):325-71., [PMID:21103975]

Abstract [show]
The breast cancer resistance protein (BCRP/ABCG2) is a member of the G-subfamiliy of the ATP-binding cassette (ABC)-transporter superfamily. This half-transporter is assumed to function as an important mechanism limiting cellular accumulation of various compounds. In context of its tissue distribution with localization in the sinusoidal membrane of hepatocytes, and in the apical membrane of enterocytes ABCG2 is assumed to function as an important mechanism facilitating hepatobiliary excretion and limiting oral bioavailability, respectively. Indeed functional assessment performing mouse studies with genetic deletion or chemical inhibition of the transporter, or performing pharmacogenetic studies in humans support this assumption. Furthermore the efflux function of ABCG2 has been linked to sanctuary blood tissue barriers as described for placenta and the central nervous system. However, in lactating mammary glands ABCG2 increases the transfer of substrates into milk thereby increasing the exposure to potential noxes of a breastfed newborn. With regard to its broad substrate spectrum including various anticancer drugs and environmental carcinogens the function of ABCG2 has been associated with multidrug resistance and tumor development/progression. In terms of cancer biology current research is focusing on the expression and function of ABCG2 in immature stem cells. Recent findings support the notion that the physiological function of ABCG2 is involved in the elimination of uric acid resulting in higher risk for developing gout in male patients harboring genetic variants. Taken together ABCG2 is implicated in various pathophysiological and pharmacological processes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
253 SNPs with low AF including the c.1291T>C (p.F431L, AF 0.006 in Japanese populations), or the c.1768A>T (p.N590Y, AF 0.001-0.003 in Caucasian populations) mutation have been studied for their activity in vitro showing reduced resistance toward known substrates such as SN-38, mitoxantrone, or topotecan, respectively (An et al. 2009; Itoda et al. 2003; Mizuarai et al. 2004; Tamura et al. 2006; Vethanayagam et al. 2005; Yoshioka et al. 2007; Zamber et al. 2003). Login to comment

[hide] Key Role of Human ABC Transporter ABCG2 in Photody... Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8. Ishikawa T, Nakagawa H, Hagiya Y, Nonoguchi N, Miyatake S, Kuroiwa T
Key Role of Human ABC Transporter ABCG2 in Photodynamic Therapy and Photodynamic Diagnosis.
Adv Pharmacol Sci. 2010;2010:587306. Epub 2010 Jul 8., [PMID:21188243]

Abstract [show]
Accumulating evidence indicates that ATP-binding cassette (ABC) transporter ABCG2 plays a key role in regulating the cellular accumulation of porphyrin derivatives in cancer cells and thereby affects the efficacy of photodynamic therapy and photodynamic diagnosis. The activity of porphyrin efflux can be affected by genetic polymorphisms in the ABCG2 gene. On the other hand, Nrf2, an NF-E2-related transcription factor, has been shown to be involved in oxidative stress-mediated induction of the ABCG2 gene. Since patients have demonstrated individual differences in their response to photodynamic therapy, transcriptional activation and/or genetic polymorphisms of the ABCG2 gene in cancer cells may affect patients' responses to photodynamic therapy. Protein kinase inhibitors, including imatinib mesylate and gefitinib, are suggested to potentially enhance the efficacy of photodynamic therapy by blocking ABCG2-mediated porphyrin efflux from cancer cells. This review article provides an overview on the role of human ABC transporter ABCG2 in photodynamic therapy and photodynamic diagnosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
167 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells [41, 90]. Login to comment
177 Gefitinib and imatinib are new anticancer drugs Outside Plasma membrane Inside H2N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S ATP-binding cassette (a) 0 0.1 0.3 0.4 0.2 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrin transport(nmol/min/mgprotein) (b) Figure 4: (a) Schematic illustration of human ABCG2 and its nonsynonymous polymorphisms. Login to comment

[hide] Ubiquitin-mediated proteasomal degradation of ABC ... J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12. Nakagawa H, Toyoda Y, Wakabayashi-Nakao K, Tamaki H, Osumi M, Ishikawa T
Ubiquitin-mediated proteasomal degradation of ABC transporters: a new aspect of genetic polymorphisms and clinical impacts.
J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12., [PMID:21567408]

Abstract [show]
The interindividual variation in the rate of drug metabolism and disposition has been known for many years. Pharmacogenomics dealing with heredity and response to drugs is a part of science that attempts to explain variability of drug responses and to search for the genetic basis of such variations or differences. Genetic polymorphisms of drug metabolizing enzymes and drug transporters have been found to play a significant role in the patients' responses to medication. Accumulating evidence demonstrates that certain nonsynonymous polymorphisms have great impacts on the protein stability and degradation, as well as the function of drug metabolizing enzymes and transporters. The aim of this review article is to address a new aspect of protein quality control in the endoplasmic reticulum and to present examples regarding the impact of nonsynonymous single-nucleotide polymorphisms on the protein stability of thiopurine S-methyltransferase as well as ATP-binding cassette (ABC) transporters including ABCC4, cystic fibrosis transmembrane conductance regulator (CFTR, ABCC7), ABCC11, and ABCG2. Furthermore, we will discuss the molecular mechanisms underlying posttranslational modifications (intramolecular and intermolecular disulfide bond formation and N-linked glycosylation) and ubiquitin-mediated proteasomal degradation of ABCG2, one of the major drug transporter proteins in humans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 Impact of SNPs on Protein Stability and ERAD of ABCG2 By functional validation in vitro, the above-mentioned 17 nonsynonymous polymorphisms of ABCG2 were classified into four groups.99 The nonsynonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin.100 The F208S, S248P, F431L, S441N, and F489L variants, on the contrary, exhibited greatly reduced protein expression levels and drug resistance profiles.99 In particular, expression levels of the F208S and S441N variant proteins were markedly low.99 These variant proteins do not undergo Golgi apparatus-mediated glycoprocessing but are passed through the ERAD pathway.78 The immature and nonglycosylated forms of F208S and S441N (Fig. 6a) were detected. Login to comment

[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]

Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6589 Absent C421A Q141K 2 Normal/reduced G445C A149P ↔ Normal G448A R163K ↔ Normal C496G Q166E ↔ Normal/reduced A616C I206L 2↔ Normal T623C F208S N.D. Reduced T742C S248P N.D. Normal C805T P269S 2↔ Normal T1291C F431L 2 Normal/reduced G1322A S441N 2 Reduced T1465C F489L 2↔ Normal/reduced A1768T N590Y 2↔ Increased G1858A D620N 2↔ Normal 2, reduced function; ↔, no change in function; N.D. not determined. Login to comment

[hide] Pharmacological interplay between breast cancer re... Anticancer Res. 2009 Apr;29(4):1059-65. Katayama K, Shibata K, Mitsuhashi J, Noguchi K, Sugimoto Y
Pharmacological interplay between breast cancer resistance protein and gefitinib in epidermal growth factor receptor signaling.
Anticancer Res. 2009 Apr;29(4):1059-65., [PMID:19414346]

Abstract [show]
BACKGROUND: It has been previously shown that gefitinib reverses breast cancer resistance protein (BCRP)-mediated drug resistance. Here, the impact of BCRP on gefitinib-mediated inhibition in epidermal growth factor receptor (EGFR) signaling is evaluated. MATERIALS AND METHODS: Sensitivity to gefitinib was determined by growth inhibition assay, and intracellular gefitinib levels were measured with HPLC. Western blotting was performed to detect EGFR signaling molecules. RESULTS: BCRP reduced intracellular gefitinib levels and attenuated inhibitory activities of gefitinib to EGF-dependent EGFR signalings including downstream MAPK and Akt pathways in gefitinib-sensitive PC-9 cells. However, gefitinib did not inhibit MAPK and Akt signalings in KB-3-1 and HCT-116 cells, and BCRP-mediated gefitinib-resistance shown in PC-9 cells was not observed in gefitinib-insensitive KB-3-1 and HCT-116 cells. CONCLUSION: BCRP transports gefitinib and suppresses its inhibitory effects on EGFR phosphorylation. However, effects of BCRP on gefitinib activity in the EGFR signaling and on gefitinib-resistance were limited in the gefitinib-sensitive cells only.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
149 The expression levels of BCRP gene products harboring a C421A (Q141K) SNP are 5-fold lower than those of the wild-type gene, and the resistance of cells with a C421A BCRP SNP to SN-38 is also 5-fold lower than those with wild-type BCRP (25, 27). Login to comment
151 In addition, T1291C (F431L) BCRP-transfectants express two BCRP products of 65 kDa and 70 kDa, and resistance to SN-38 in these cells is significantly lower than wild-type BCRP-transfectants (27). Login to comment

[hide] Impact of genetic variability in the ABCG2 gene on... Biochem Biophys Res Commun. 2014 Jan 24;443(4):1211-7. doi: 10.1016/j.bbrc.2013.12.119. Epub 2014 Jan 3. Deppe S, Ripperger A, Weiss J, Ergun S, Benndorf RA
Impact of genetic variability in the ABCG2 gene on ABCG2 expression, function, and interaction with AT1 receptor antagonist telmisartan.
Biochem Biophys Res Commun. 2014 Jan 24;443(4):1211-7. doi: 10.1016/j.bbrc.2013.12.119. Epub 2014 Jan 3., [PMID:24388985]

Abstract [show]
The ATP-binding cassette transporter ABCG2 plays a prominent role in cardiovascular and cancer pathophysiology, is involved in the pathogenesis of gout, and affects pharmacokinetics of numerous drugs. Telmisartan, a widely used AT1 receptor antagonist, inhibits the transport capacity of ABCG2 and may cause drug-drug interactions, especially in individuals carrying polymorphism that facilitate the telmisartan-ABCG2 interaction. Thus, the aim of this study was to identify ABCG2 polymorphisms and somatic mutations with relevance for the telmisartan-ABCG2 interaction. For this purpose, a cellular system for the conditional expression of ABCG2 was established. ABCG2 variants were generated via site-directed mutagenesis. Interaction of telmisartan with these ABCG2 variants was investigated in HEK293-Tet-On cells using the pheophorbide A efflux assay. Moreover, expression of ABCG2 variants was studied in these cells. Importantly, protein levels of the Q141K and F489L variant were significantly reduced, a phenomenon that was partly reversed by pharmacological proteasome inhibition. Moreover, basal pheophorbide A efflux capacity of S248P, F431L, and F489L variants was significantly impaired. Interestingly, inhibition of ABCG2-mediated pheophorbide A transport by telmisartan was almost abolished in cells expressing the R482G variant, whereas it was largely increased in cells expressing the F489L variant. We conclude that the arginine residue at position 482 of the ABCG2 molecule is of major importance for the interaction of telmisartan with this ABC transporter. Furthermore, individuals carrying the F489L polymorphism may be at increased risk of developing adverse drug reactions in multi-drug regimens involving ABCG2 substrates and telmisartan.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Moreover, basal pheophorbide A efflux capacity of S248P, F431L, and F489L variants was significantly impaired. Login to comment
37 Site-directed mutagenesis Non-synonymous ABCG2 single nucleotide polymorphisms (SNPs) G34A (V12M), C421A (Q141K), T742C (S248P), T1291C (F431L), T1465C (F489L) as well as somatic mutation A1444G (R482G) were inserted into the ABCG2 cDNA sequence in the pTRE-Tight-BI-AcGFP1-ABCG2 plasmid using the QuickChange&#d2; Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Waldbronn, Germany) with specific primers according to the manufacturer`s instructions (Supplemental Fig. 1). Login to comment
91 The average PhA-associated fluorescence in non-induced HEK293-Tet-On cells transiently transfected with the various ABCG2 variants was not significantly different as compared with that observed in HEK293-Tet-On cells transfected with ABCG2 wild-type (wild-type (100 &#b1; 12.1%), V12M (106.7 &#b1; 2.0%), Q141K (97.1 &#b1; 9.3%), S248P (99.1 &#b1; 9.8%), F431L (104.7% &#b1; 10.9%), R482G A B C D Fig. 2. Login to comment
100 However, basal PhA efflux was significantly lower in HEK293- Tet-On cells transfected with the ABCG2 variants S248P (44.2 &#b1; 2.8%; P < 0.01 vs. doxycycline-induced ABCG2 wild-type), F431L (28.4 &#b1; 3.1%; P < 0.01 vs. doxycycline-induced ABCG2 wild-type), and F489L (20.9 &#b1; 2.0%; P < 0.05 vs. doxycycline-induced ABCG2 wild-type), demonstrating that these mutations significantly reduce ABCG2-mediated PhA transport in HEK293-Tet-On cells. Login to comment
104 Inhibitory efficacy of telmisartan was not altered by the ABCG2 polymorphisms V12M and Q141K but tended to be lower in the ABCG2 variants S248P and F431L (Fig. 4A and C). Login to comment
128 Moreover, ABCG2 variants S248P and F431L displayed a significantly reduced PhA transport, although protein expression was similar to that of ABCG2 wild-type. Login to comment
130 Moreover, SN-38 and methotrexate transport activity has been shown to be reduced in PA317 cells as well as in Sf9 membrane vesicles expressing the F431L variant [19,23], thereby indicating that substrate transport may be generally reduced by this polymorphism. Login to comment

[hide] Structure and function of BCRP, a broad specificit... Arch Toxicol. 2014 Jun;88(6):1205-48. doi: 10.1007/s00204-014-1224-8. Epub 2014 Apr 29. Jani M, Ambrus C, Magnan R, Jakab KT, Beery E, Zolnerciks JK, Krajcsi P
Structure and function of BCRP, a broad specificity transporter of xenobiotics and endobiotics.
Arch Toxicol. 2014 Jun;88(6):1205-48. doi: 10.1007/s00204-014-1224-8. Epub 2014 Apr 29., [PMID:24777822]

Abstract [show]
The discovery and characterization of breast cancer resistance protein (BCRP) as an efflux transporter conferring multidrug resistance has set off a remarkable trajectory in the understanding of its role in physiology and disease. While the relevance in drug resistance and general pharmacokinetic properties quickly became apparent, the lack of a characteristic phenotype in genetically impaired animals and humans cast doubt on the physiological importance of this ATP-binding cassette family member, similarly to fellow multidrug transporters, despite well-known endogenous substrates. Later, high-performance genetic analyses and fine resolution tissue expression data forayed into unexpected territories concerning BCRP relevance, and ultimately, the rise of quantitative proteomics allows putting observed interactions into absolute frameworks for modeling and insight into interindividual and species differences. This overview summarizes existing knowledge on the BCRP transporter on molecular, tissue and system level, both in physiology and disease, and describes a selection of experimental procedures that are the most widely applied for the identification and characterization of substrate and inhibitor-type interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 Histone deacetylase inhibitors rescue newly synthesized transporter proteins and prevent aggresome targeting by disturbing TableÊf;1ߒߙMajor non-synonymous single-nucleotide polymorphisms found in the ABCG2 coding region Allele frequencies presented in this table do not reflect interethnic differences Mutation Position in BCRP Cellular effects of SNP Allele frequency % References 34G>A, V12M (rs2231137) N-terminus Lower expression, no impact on function 0-29.8 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 151G>T, G51C N-terminus Slightly overexpressed, decreased transport activity 0.1 Tamura et al. (2006), Yoshioka et al. (2007) 376C>T, Q126X (rs7255271) NBD No expression, no activity 0-1.7 Tamura et al. (2006), Mizuarai et al. (2004), Itoda et al. (2003), Imai et al. (2002), Kobayashi et al. (2005), Kondo et al. (2004) 421C>A, Q141K (rs2231142) NBD Lower expression, decreased transport activity, substrate specificity altered 0-35.7 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 458C>T, T153 M NBD Slightly lower expression, no impact on function 3.3 Tamura et al. (2006), Mizuarai et al. (2004) 479G>A, R160Q NBD Not determined 0.5 Bosch et al. (2005), Tamura et al. (2006) 496C>G, Q166E (rs1061017) NBD Slightly lower expression, no impact on function 0-1.1 Tamura et al. (2006), Kondo et al. (2004), Yoshioka et al. (2007) 616A>C, I206L (rs12721643) NBD Well expressed, decreased transport activity 0-10.0 Tamura et al. (2006), Zamber et al. (2003), Vethanayagam et al. (2005), Ieiri (2012a) 623T>C, F208 (rs1061018) NBD No expression, no transport activity 0.9-3.9 Tamura et al. (2006) 742T>C, S248P (rs3116448) NBD Well expressed, no transport activity 0.5 Tamura et al. (2006), Yoshioka et al. (2007) 1000G>T, E334X (rs3201997) NBD No expression, no transport activity Not determined Tamura et al. (2006), Ishikawa et al. (2005) 1291T>C F431L ECL1 Lower expression, substrate specificity altered 0.6-0.8 Tamura et al. (2006), Itoda et al. (2003), Yoshioka et al. (2007) 1322G>A, S441 N ECL1 Slightly lower expression, no transport activity 0.5 Tamura et al. (2006), Kobayashi et al. (2005), Kondo et al. (2004) 1465T>C, F489L TM3 Slightly lower expression, no transport activity 0.5-0.8 Tamura et al. (2006), Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F506S TM4 Not determined 0.5 Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F507L 1515delC, V508L 1515delC, M509X 1711T>A, F571I (rs9282571) TM5 Well expressed, substrate specificity altered 0.5 Tamura et al. (2006) 1723C>T, R575X TM5 Not determined 0.5 Tamura et al. (2006) 1768A>T, N590Y (rs34264773) ECL3 Slightly overexpressed, substrate specificity altered 0-9.7 Tamura et al. (2006), Mizuarai et al. (2004), Zamber et al. (2003), Vethanayagam et al. (2005) 1858G>A, D620 N (rs34783571) ECL3 Slightly overexpressed, substrate specificity altered 0-11.1 Tamura et al. (2006), Bosch et al. (2005), Honjo et al. (2002), Vethanayagam et al. (2005) the trafficking along microtubules (Basseville et al. 2012). Login to comment

[hide] Determinants of the activity and substrate recogni... Drug Metab Rev. 2014 Nov;46(4):459-74. doi: 10.3109/03602532.2014.942037. Epub 2014 Jul 18. Szafraniec MJ, Szczygiel M, Urbanska K, Fiedor L
Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2).
Drug Metab Rev. 2014 Nov;46(4):459-74. doi: 10.3109/03602532.2014.942037. Epub 2014 Jul 18., [PMID:25036722]

Abstract [show]
The xenobiotic transporters are among the most important constituents of detoxification system in living organisms. Breast cancer resistance protein (BCRP/ABCG2) is one of the major transporters involved in the efflux of xenobiotics. To understand its role in chemotherapeutic and multidrug resistance, it is crucial to establish the determinants of its substrate specificity, which obviously is of high relevance for successful therapy of many diseases. This article summarizes the current knowledge about the substrate preferences of BCRP. We overview the factors which determine its activity, inhibition and substrate recognition, focusing on the structural features of the transporter. BCRP substrate specificity is quite low as it interacts with a spectrum of substances with only a few common features: hydrophobic and aromatic regions, possibly a flat conformation and the metal ion-, oxygen- and nitrogen-containing functionalities, most of which may be the donors/acceptors of H-bonds. Several amino acid residues and structural motifs are responsible for BCRP activity and substrate recognition. Thus, the active form of BCRP, at least a dimer or a larger oligomer is maintained by intramolecular disulfide bridge that involves Cys(603) residues. The GXXXG motif in transmembrane helix 1, Cys residues, Arg(482) and Lys(86) are responsible for maintaining the protein structure, which confers transport activity, and the His(457) or Arg(456) residues are directly involved in substrate binding. Arg(482) does not directly bind substrates, but electrostatically interacts with charged molecules, which initiates the conformational changes that transmit the signal from the transmembrane regions to the ABC domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
201 To elucidate the significance of this polymorphism for porphyrin transport, a set of 18 variants of BCRP (Val12 Met, Gly51 Cys, Gln126 stop, Gln141 Lys, Thr153 Met, Gln166 Glu, Ile206 Leu, Phe208 Ser, Ser248 Pro, Glu334 stop, Phe431 Leu, Ser441 Asn, Arg482 Gly, Arg482 Thr, Phe489 Leu, Phe571 Ile, Asn590 Tyr and Asp620 Asn) have been expressed in insect cells. Login to comment
204 In the Phe489 Leu mutant transport was also impaired, while the Ser441 Asn variant lost the ability to transport methotrexate and the Phe431 Leu variant seemed to transport hematoporphyrin normally but showed no transport of methotrexate. Login to comment
209 Position Type of mutation Effect on the transporter References NBD Lys 86 Met (i) No stimulation of the ATPase activity by prazosin; (ii) no influence on the transport of mitoxantrone Henriksen et al. (2005b) Glu 126 stop, Phe 208 Ser, Ser 248 Phe, Glu 334 stop Inability to transport hematoporphyrin Tamura et al. (2006) Glu 211 Gln Complete abolishment of the ATPase activity and methotrexate transport Hou et al. (2009) Pro 392 Ala Significant reduction in the efflux activity of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Ni et al. (2011) TM1 Gly 406 Ala Gly 410 Ala No influence on the activity of the transporter Polgar et al. (2004) Gly 406 Leu Gly 410 Leu (i) Loss of the ability to transport rhodamine123; (ii) impaired transport of mitoxantrone, Pheide and BODIPY-prazosin Polgar et al. (2004) Extracellular loop 1 Phe 431 Leu (i) Loss of the ability to transport methotrexate; (ii) 10% level of hematoporphyrin transport compared to the WT protein Tamura et al. (2006) Ser 441 Asn Inability to transport hematoporphyrin Tamura et al. (2006) Ser 441 Asn Loss of the ability to transport methotrexate Tamura et al. (2006) TM2 Lys 452 Ala His 457 Ala Increase in transport of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Cai et al. (2010) Lys 453 Ala Arg 465 Ala Decrease in transport of mitoxantrone, BODIPY-prazosin, Hoechst 33342, doxorubicin, SN-38 and rhodamine 123 Cai et al. (2010) TM3 Arg 482 Gly Arg 482 Thr (i) No change in the inhibitory activity of lapatinib; (ii) about two times greater inhibition by ritonavir, saquinavir and nalfinavir than in the WT variant; (iii) gaining the ability to transport rhodamine123 and doxorubicin; (iv) no influence on the transport of mitoxantrone; (v) loss of the ability to transport methotrexate Dai et al. (2008), Gupta et al. (2004), Honjo et al. (2001), Mitomo et al. (2003) Arg 482 Thr (i) Lower IC 50 of cyclosporine A for mutant than for WT variant; (ii) lower elacridar inhibition potency Xia et al. (2007) Arg 482 Lys Complete loss of transport activity Ejendal et al. (2006) Phe 489 Leu Impaired transport of porphyrins, no transport of methotrexate Tamura et al. (2006) Extracellular loop 3 Asn 590 Tyr Over twice reduced transport of mitoxantrone, topotecan, daunorubicin and rhodamine 123 Vethanayagam et al. (2005) Cys 592 Ala/Cys 608 Ala (i) Transport of mitoxantrone almost unchanged; (ii) transport of BODIPY-prazosin significantly impaired Henriksen et al. (2005a) Extracellular loop 3 Cys 603 Ser Cys 592 Ser/Cys 608 Ser Cys 592 Ser/Cys 603 Ser/Cys 608 Ser Diminished susceptibility to the inhibitory activity of fumitremorgin C Shigeta et al. (2010) Cys-less Arg 482 Gly-BCRP Complete loss of the ability to efflux mitoxantrone Liu et al. (2008b) The positions of the amino acid residues refer to the topological model of BCRP proposed by Wang et al. (2009). Login to comment