ABCMdb

ABCA1 p.Val771Met

Predicted by SNAP2:	A: D (71%), C: D (71%), D: D (95%), E: D (80%), F: D (59%), G: D (80%), H: D (75%), I: N (87%), K: D (91%), L: N (82%), M: N (78%), N: D (75%), P: D (91%), Q: N (57%), R: D (91%), S: D (75%), T: D (95%), W: D (71%), Y: D (75%),
Predicted by PROVEAN:	A: N, C: D, D: D, E: D, F: N, G: D, H: D, I: N, K: D, L: N, M: N, N: D, P: D, Q: D, R: D, S: D, T: N, W: D, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] A polymorphism of the ABCA1 gene confers susceptib... Prog Neuropsychopharmacol Biol Psychiatry. 2011 Dec 1;35(8):1877-83. Epub 2011 Aug 3. Ota M, Fujii T, Nemoto K, Tatsumi M, Moriguchi Y, Hashimoto R, Sato N, Iwata N, Kunugi H
A polymorphism of the ABCA1 gene confers susceptibility to schizophrenia and related brain changes.
Prog Neuropsychopharmacol Biol Psychiatry. 2011 Dec 1;35(8):1877-83. Epub 2011 Aug 3., [PMID:21839797]

Abstract [show]
OBJECTIVE: The ATP-binding cassette transporter A1 (ABCA1) mediates cellular cholesterol efflux through the transfer of cholesterol from the inner to the outer layer of the cell membrane and regulates extracellular cholesterol levels in the central nervous system. Several lines of evidence have indicated lipid and myelin abnormalities in schizophrenia. METHOD: Initially, we examined the possible association of the polymorphisms of the ABCA1 gene (ABCA1) with susceptibility to schizophrenia in 506 patients with schizophrenia (DSM-IV) and 941 controls. The observed association was then subject to a replication analysis in an independent sample of 511 patients and 539 controls. We further examined the possible effect of the risk allele on gray matter volume assessed with magnetic resonance imaging (MRI) in 86 patients with schizophrenia (49 males) and 139 healthy controls (47 males). RESULTS: In the initial association study, the 1587 K allele (rs2230808) was significantly more common in male patients with schizophrenia than in male controls. Although such a significant difference was not observed in the second sample alone, the increased frequency of the 1587 K allele in male patients remained to be significant in the combined male sample of 556 patients and 594 controls. Male schizophrenia patients carrying the 1587 K allele had a smaller amount of gray matter volume than those who did not carry the allele. CONCLUSION: Our data suggest a male-specific association of the 1587 K allele of ABCA1 with susceptibility to schizophrenia and smaller gray matter volume in schizophrenia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 Previous studies have examined the association between polymorphisms of ABCA1, particularly the non-synonymous single nucleotide polymorphisms (SNPs) of rs2230806 (R219K), rs2066718 (V771M), and rs2230808 (R1587K) and risk for Alzheimer's disease. Login to comment
65 We found only four well-validated SNPs with a heterozygosity value of N0.10 in Asian populations: rs2230806 (R219K), rs2066718 (V771M), rs2066714 (I883M), and rs2230808 (R1587K). Login to comment
123 db SNP ID and aminoacid change Position⁎ Inter-SNP distance (bp) Gender Group N Genotype distribution (frequency) χ2 P Allele count (frequency) χ2 P HWE of Controls (df=1) R/R R/K K/K R K rs2230806 107620867 (-) All Schizophrenia 497 119 (0.24) 241 (0.48) 137 (0.28) 2.77 0.250 479 (0.48) 515 (0.52) 0.01 0.897 χ²=3.73 Arg219Lys exon 7 Controls 932 204 (0.22) 495 (0.53) 233 (0.25) 903 (0.48) 961 (0.52) P=0.053 M Schizophrenia 274 63 (0.23) 137 (0.50) 74 (0.27) 0.47 0.789 263 (0.48) 285 (0.52) 0.45 0.503 χ²=0.05 Controls 330 71 (0.22) 162 (0.49) 97 (0.29) 304 (0.46) 356 (0.54) P=0.827 F Schizophrenia 223 56 (0.25) 104 (0.47) 63 (0.28) 216 (0.48) 230 (0.52) χ²=6.81 Controls 602 133 (0.22) 333 (0.55) 136 (0.23) 599 (0.50) 605 (0.50) P=0.009 V/V V/M M/M V M rs2066718 107589255 31,612 All Schizophrenia 494 438 (0.89) 54 (0.11) 2 (0.00) 1.09 0.580 930 (0.94) 58 (0.06) 0.99 0.319 χ²=0.04 Val771Met exon 16 Controls 936 812 (0.87) 120 (0.13) 4 (0.00) 1744 (0.93) 128 (0.07) P=0.847 M Schizophrenia 273 242 (0.89) 29 (0.11) 2 (0.01) 1.70 0.428 513 (0.94) 33 (0.06) 0.50 0.480 χ²=0.30 Controls 333 287 (0.86) 45 (0.14) 1 (0.00) 619 (0.93) 47 (0.07) P=0.582 F Schizophrenia 221 196 (0.89) 25 (0.11) 0 (0.00) 1.32 0.518 417 (0.94) 25 (0.06) 0.60 0.437 χ²=0.03 Controls 603 525 (0.87) 75 (0.12) 3 (0.00) 1125 (0.93) 81 (0.07) P=0.856 I/I I/M M/M I M rs2066714 107586753 34,114 All Schizophrenia 487 208 (0.43) 212 (0.44) 67 (0.14) 3.86 0.145 628 (0.64) 346 (0.36) 1.75 0.186 χ²=0.91 Ile883Met exon 18 Controls 917 345 (0.38) 446 (0.49) 126 (0.14) 1136 (0.62) 698 (0.38) P=0.339 M Schizophrenia 266 115 (0.43) 116 (0.44) 35 (0.13) 3.23 0.199 346 (0.65) 186 (0.35) 0.87 0.335 χ²=2.40 Controls 330 122 (0.37) 168 (0.51) 40 (0.12) 412 (0.62) 248 (0.38) P=0.122 F Schizophrenia 221 93 (0.42) 96 (0.43) 32 (0.14) 1.23 0.542 282 (0.64) 160 (0.36) 0.62 0.430 χ²=0.002 Controls 587 223 (0.38) 278 (0.47) 86 (0.15) 724 (0.62) 450 (0.38) P=0.966 R/R R/K K/K R K rs2230808 107562804 58,063 All Schizophrenia 491 174 (0.35) 252 (0.51) 65 (0.13) 4.05 0.132 600 (0.61) 382 (0.39) 0.63 0.427 χ²=0.50 Arg1587Lys exon 35 Controls 923 367 (0.40) 422 (0.46) 134 (0.15) 1156 (0.63) 690 (0.37) P=0.478 M Schizophrenia 273 87 (0.32) 148 (0.54) 38 (0.14) 8.51 0.014 322 (0.59) 224 (0.41) 3.68 0.055 χ²=1.17 Controls 327 140 (0.43) 141 (0.43) 46 (0.14) 421 (0.64) 233 (0.36) P=0.278 F Schizophrenia 218 87 (0.40) 104 (0.48) 27 (0.12) 0.79 0.674 278 (0.64) 158 (0.36) 0.60 0.440 χ²=0.01 Controls 596 227 (0.38) 281 (0.47) 88 (0.15) 735 (0.62) 457 (0.38) P=0.945 HWE; Hardy-Weinberg equilibrium. Login to comment
64 We found only four well-validated SNPs with a heterozygosity value of N0.10 in Asian populations: rs2230806 (R219K), rs2066718 (V771M), rs2066714 (I883M), and rs2230808 (R1587K). Login to comment
122 db SNP ID and aminoacid change PositionÌe; Inter-SNP distance (bp) Gender Group N Genotype distribution (frequency) c7;2 P Allele count (frequency) c7;2 P HWE of Controls (df=1) R/R R/K K/K R K rs2230806 107620867 (-) All Schizophrenia 497 119 (0.24) 241 (0.48) 137 (0.28) 2.77 0.250 479 (0.48) 515 (0.52) 0.01 0.897 c7;&#b2;=3.73 Arg219Lys exon 7 Controls 932 204 (0.22) 495 (0.53) 233 (0.25) 903 (0.48) 961 (0.52) P=0.053 M Schizophrenia 274 63 (0.23) 137 (0.50) 74 (0.27) 0.47 0.789 263 (0.48) 285 (0.52) 0.45 0.503 c7;&#b2;=0.05 Controls 330 71 (0.22) 162 (0.49) 97 (0.29) 304 (0.46) 356 (0.54) P=0.827 F Schizophrenia 223 56 (0.25) 104 (0.47) 63 (0.28) 216 (0.48) 230 (0.52) c7;&#b2;=6.81 Controls 602 133 (0.22) 333 (0.55) 136 (0.23) 599 (0.50) 605 (0.50) P=0.009 V/V V/M M/M V M rs2066718 107589255 31,612 All Schizophrenia 494 438 (0.89) 54 (0.11) 2 (0.00) 1.09 0.580 930 (0.94) 58 (0.06) 0.99 0.319 c7;&#b2;=0.04 Val771Met exon 16 Controls 936 812 (0.87) 120 (0.13) 4 (0.00) 1744 (0.93) 128 (0.07) P=0.847 M Schizophrenia 273 242 (0.89) 29 (0.11) 2 (0.01) 1.70 0.428 513 (0.94) 33 (0.06) 0.50 0.480 c7;&#b2;=0.30 Controls 333 287 (0.86) 45 (0.14) 1 (0.00) 619 (0.93) 47 (0.07) P=0.582 F Schizophrenia 221 196 (0.89) 25 (0.11) 0 (0.00) 1.32 0.518 417 (0.94) 25 (0.06) 0.60 0.437 c7;&#b2;=0.03 Controls 603 525 (0.87) 75 (0.12) 3 (0.00) 1125 (0.93) 81 (0.07) P=0.856 I/I I/M M/M I M rs2066714 107586753 34,114 All Schizophrenia 487 208 (0.43) 212 (0.44) 67 (0.14) 3.86 0.145 628 (0.64) 346 (0.36) 1.75 0.186 c7;&#b2;=0.91 Ile883Met exon 18 Controls 917 345 (0.38) 446 (0.49) 126 (0.14) 1136 (0.62) 698 (0.38) P=0.339 M Schizophrenia 266 115 (0.43) 116 (0.44) 35 (0.13) 3.23 0.199 346 (0.65) 186 (0.35) 0.87 0.335 c7;&#b2;=2.40 Controls 330 122 (0.37) 168 (0.51) 40 (0.12) 412 (0.62) 248 (0.38) P=0.122 F Schizophrenia 221 93 (0.42) 96 (0.43) 32 (0.14) 1.23 0.542 282 (0.64) 160 (0.36) 0.62 0.430 c7;&#b2;=0.002 Controls 587 223 (0.38) 278 (0.47) 86 (0.15) 724 (0.62) 450 (0.38) P=0.966 R/R R/K K/K R K rs2230808 107562804 58,063 All Schizophrenia 491 174 (0.35) 252 (0.51) 65 (0.13) 4.05 0.132 600 (0.61) 382 (0.39) 0.63 0.427 c7;&#b2;=0.50 Arg1587Lys exon 35 Controls 923 367 (0.40) 422 (0.46) 134 (0.15) 1156 (0.63) 690 (0.37) P=0.478 M Schizophrenia 273 87 (0.32) 148 (0.54) 38 (0.14) 8.51 0.014 322 (0.59) 224 (0.41) 3.68 0.055 c7;&#b2;=1.17 Controls 327 140 (0.43) 141 (0.43) 46 (0.14) 421 (0.64) 233 (0.36) P=0.278 F Schizophrenia 218 87 (0.40) 104 (0.48) 27 (0.12) 0.79 0.674 278 (0.64) 158 (0.36) 0.60 0.440 c7;&#b2;=0.01 Controls 596 227 (0.38) 281 (0.47) 88 (0.15) 735 (0.62) 457 (0.38) P=0.945 HWE; Hardy-Weinberg equilibrium. Login to comment

[hide] Mutations in APOA-I and ABCA1 in Norwegians with l... Clin Chim Acta. 2010 Dec 14;411(23-24):2019-23. Epub 2010 Aug 25. Berge KE, Leren TP
Mutations in APOA-I and ABCA1 in Norwegians with low levels of HDL cholesterol.
Clin Chim Acta. 2010 Dec 14;411(23-24):2019-23. Epub 2010 Aug 25., [PMID:20800056]

Abstract [show]
BACKGROUND: Epidemiological studies have shown that low levels of plasma high density lipoprotein (HDL) cholesterol are associated with increased risk of ischemic heart disease (IHD), but it appears that genetic forms of low HDL cholesterol levels, as opposed to lifestyle-induced low levels of HDL cholesterol, do not result in increased risk of IHD. Therefore, the etiology of reduced levels of plasma HDL cholesterol may represent a factor that should be considered in risk stratification with respect to primary prevention. Genes encoding proteins involved in HDL metabolism, such as the ATP-binding cassette transporter A1 (ABCA1) and apolipoprotein (apo) A-I genes, are candidate genes for harboring mutations that lead to low HDL cholesterol levels. METHODS: The ABCA1 and apoA-I genes in 56 Norwegian patients, with a mean HDL cholesterol level of 0.53 (+/-0.15) mmol/l, were subjected to DNA sequencing. RESULTS: Several mutations were identified in the ABCA1 gene, and two mutations were identified in the apoA-I gene. A total of 18 patients (32%) were carriers of mutations considered to be pathogenic. Their mean HDL cholesterol level was 0.45 (+/-0.15) mmol/l compared to 0.57 (+/-0.14) mmol/l in noncarriers (p<0.005). CONCLUSION: Mutations in the genes encoding ABCA1 and apoA-I are common in Norwegians, with a markedly decreased HDL cholesterol level.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 of patients (het/hom)a Mutation Nucleotide Exon/Intron (i) PolyPhen prediction (score) SNP rs ID, ref.# ABCA1 Missense 8/3 R219K c.656, GNA 7 Benign (0.489) rs2230806 0/1 R282Q c.845, GNA 9 Benign (0.592) Novel 1/0 V399A c.1196, TNC 11 Benign (0.040) rs9282543 1/0 M636V c.1906, ANG 15 Benign (0.418) Novel 3/0 V771M c.2311, GNA 16 Benign (0.931) rs2066718 2/0 V825I c.2473, GNA 17 Benign (0.440) rs2066715 3/1 I883M c.2649, ANG 18 Benign (0.147) rs2066714 1/0 C887F c.2660, GNT 19 Benign (0.888) Novel 3/0 E1172D c.3516, GNC 24 Benign (0.546) rs33918808 1/0 G1216V c.3647, GNT 25 Prob damb (2.154) Ref. [18] 1/0 L1244Q c.3731, TNA 25 Prob dam (2.269) Novel 1/0 C1477F c.4430, TNA 31 Prob dam (3.688) Ref. [17] 14/1 R1587K c.4760, ANT 35 Benign (0.284) rs2230808 1/0 V1674I c.5020, GNA 37 Benign (0.821) Novel 1/0 R1680Q c.5039, GNA 37 Poss damc (1.926) Ref. [17] 1/0 N1800H c.5398, ANC 40 Poss dam (1.845) Ref. [19] Nonsense/splice 1/0 IVS4+1, GNA c.302+1, GNA i4 - 1/0 C1429X c.4287, CNA 31 - 1/0 IVS32+1, GNA c.4559+1, GNA i32 - APOA-I 7/0 R160L c.551, GNT 4 Prob dam (2.491) Ref. [21] 1/0 del182K del c.616-618 AAG 4 - Novel a Het: heterozygote, hom: homozygote. Login to comment
78 Variants R219K, V399A, V771M, V825I, I883M, E1172D, and R1587K have been reported as single nucleotide polymorphisms (SNPs) (Table 1). Login to comment
80 In addition, R219K, V771M, V825I, I883M, E1172D, and R1587K have been found in similar frequencies in patients with low or high HDL cholesterol levels [18], indicating that these variants do not cause low HDL cholesterol levels. Login to comment

[hide] Associations between common polymorphisms of adeno... Arch Cardiovasc Dis. 2010 Oct;103(10):530-7. Epub 2010 Nov 20. Rejeb J, Omezzine A, Rebhi L, Boumaiza I, Kchock K, Belkahla R, Rejeb NB, Nabli N, Abdelaziz AB, Boughzala E, Bouslama A
Associations between common polymorphisms of adenosine triphosphate-binding cassette transporter A1 and coronary artery disease in a Tunisian population.
Arch Cardiovasc Dis. 2010 Oct;103(10):530-7. Epub 2010 Nov 20., [PMID:21130966]

Abstract [show]
BACKGROUND: The adenosine triphosphate-binding cassette transporter A1 (ABCA1) protein plays an important role in the first step of the reverse cholesterol transport system. AIMS: We studied the association of four polymorphisms in the ABCA1 gene (G1051A, G2706A, G2868A and -565C/T) with lipid profile and coronary artery disease. METHODS: Overall, 316 Tunisian patients underwent coronary angiography. Genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism analysis. Lipid and apolipoprotein concentrations were measured. RESULTS: Only carriers of the G2706A allele were associated with a decreased risk of significant stenosis (odds ratio [OR] 0.66, 95% confidence interval [CI] 0.22-0.92, p = 0.029), without pronounced effects on high-density lipoprotein (HDL) cholesterol. This protective effect was significant in smokers and diabetes. Carriers of the G1051A allele were associated only with increased concentrations of HDL cholesterol (p = 0.032). G2868A and -565C/T did not show any association with lipids or risk of significant stenosis. When ABCA1 polymorphisms were combined in haplotypes possessing G1051A, G2706A, G2868A and -565C/T, (AAGC) seemed to be most protective against significant stenosis (OR 0.5, 95% CI 0.29-0.96, p = 0.048) whereas (GGAT) was probably the most atherogenic (OR 1.26, 95% CI 1.03-1.56, p = 0.025). CONCLUSION: Only the G2706A allele seems to be associated with a reduced risk of significant stenosis without important modification of HDL-cholesterol concentration, and appears to be more protective for smokers and diabetic patients. We found that (AAGC) seems to be a protective haplotype whereas (GGAT) has an atherogenic effect in a Tunisian population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 The genotypes for each ABCA1 polymorphism (G1051A [R219K], G2706A [V771M], G2868A [V825I] and -565C/T [-477C/T]) were determined by polymerase chain reaction-restriction fragment length polymorphism analysis. Login to comment

[hide] Genetic aspects of ischemic stroke: coagulation, h... Crit Rev Clin Lab Sci. 2010 Mar-Apr;47(2):72-123. Stankovic S, Majkic-Singh N
Genetic aspects of ischemic stroke: coagulation, homocysteine, and lipoprotein metabolism as potential risk factors.
Crit Rev Clin Lab Sci. 2010 Mar-Apr;47(2):72-123., [PMID:20590502]

Abstract [show]
Stroke is one of the most common causes of death and long term disability throughout the world. It may be the outcome of a number of monogenic disorders or, more commonly, a polygenic multifactorial disease. Numerous studies have investigated the role of genetics in the pathogenesis of ischemic stroke, with varied and often contradictory results. The candidate 'stroke risk' genes affecting haemostasis (F5, F2, FGA/FGB, F7, F13A1, vWF, F12, SERPINE1, ITGB3/ITGA2B, ITGA2, GP1BA, TPA, TAFI, THBD, PZ, ANX5), homocysteine metabolism (MTHFR, CBS, MTR), and lipid metabolism (apo E, LPL, CETP, ABCA1, apo AI, apo CIII, apo AIV, apo AV, apo B, apo H, apo(a), PON1/2/3, LDLR/LOX-1) are evaluated in this review. By examining meta-analyses and case-control studies, we made a classification of gene/gene polymorphisms according to the degree of association with ischemic stroke risk. The data assembled could be very useful for further meta-analysis and for future clinical applications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
383 A study of 244 Hungarian patients suggested a protective role for the ABCA I -R219K and V771M polymorphisms against IS. Login to comment
401 Authors (reference) Year Polymorphism Methodology Phenotype OR 95% ci Andrikovics et al. (434) 2006 R219K V771M Case-control: 244 cases IS Yamada et al. (135) 2006 Arg219Lys (Ile823Met Case-control: 636 cases, 2010 controls IS (atherothrombotic) N.S. N.S. Pasdar et al. (435) 2007 L158L R219K G316G R1587K Case-control: 400 cases, 487controls IS N.S. N.S. N.S. N.S. Yamada et al. (436) 2008 -14C/T (rs1800977) Case-control: 822 cases, 2070 controls IS (atherothrombotic) Dominant-Recessive 1.21 1.75 1.00-1.45 1.22-2.48 Guan et al.,(448) and Xu et al., (450) which reported a relationship with atherosclerotic stroke, and in the prospective cohort study of Morrison et al.,(341) who described a positive association between S447X and asymptomatic stroke lesions, and in that of Kostulas et al.,(449) in which the protective role of the G-allele of LPL S447X polymorphism had a lower frequency in males. Login to comment

[hide] Genetic variation in the ABCA1 gene, HDL cholester... Atherosclerosis. 2010 Feb;208(2):305-16. Epub 2009 Jun 11. Frikke-Schmidt R
Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population.
Atherosclerosis. 2010 Feb;208(2):305-16. Epub 2009 Jun 11., [PMID:19596329]

Abstract [show]
Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common and rare ABCA1 variants contribute to levels of HDL cholesterol and risk of IHD in the general population. The association between ABCA1 variants and risk of IHD appears, however, to be independent of plasma levels of HDL cholesterol. With the recent identification of the largest number of individuals heterozygous for loss-of-function mutations in ABCA1 worldwide, population studies suggests that genetically low HDL cholesterol per se does not predict an increased risk of IHD, and thus questions the causality of isolated low levels of HDL cholesterol for the development of IHD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2387 Common ABCA1 variants in the general population 5.1. Frequency of common variants in the extreme tails of the HDL distribution Several resequencing studies have identified a number of common non-synonymous variations in ABCA1 [57,58,81-84]: R219K, V771M, V825I, I883M, E1172D and R1587K. Login to comment
2389 In the largest resequencing study to date of Caucasians in the general population, two of the non-synonymous SNPs (V771M and R1587K) and/or their haplotypes differed in frequency between the population extremes of HDL cholesterol levels [52,57]. Login to comment
2395 Frequencies of common variants and association with variation in lipid levels in the general population Frequencies for the most common non-synonymous ABCA1 SNPs (R219K, V825I, I883M, R1587K) are largely similar across studies that partly or as a whole represent general populations [57,58,81,82,86-88], whereas the less common SNPs (V771M, and E1172D) are reported in some [57,58,81,82,86,88], but not in all studies [58,87]. Login to comment
2398 The V771M and V825I SNPs were associated with increases in HDL cholesterol in women, whereas the R1587K SNP was associated with decreased HDL cholesterol levels in both genders. Login to comment
2399 This corresponded well with the findings from the initial screening where V771M and V825I (in women) were overrepresented in the high extreme, and R1587K was overrepresented in the low extreme of HDL cholesterol [57]. Login to comment
2402 The HDL cholesterol and/or apoAI lowering effect of the rare allele of the very common R1587K SNP has now been observed in several different studies [57,81,82], whereas the HDL cholesterol increasing effect of the V771M and V825I/I883M SNPs appears to be confined to specific genders in different populations [57,58,87-89]. Login to comment
2410 Frikke-Schmidt et al. showed for the first time in a large general population sample that three out of six non-synonymous SNPs (V771M, I883M, and E1172D) were independent predictors of IHD risk - risk increases that were not reflected in levels of HDL cholesterol [85]. Login to comment
2411 By stepwise regression, V771M and I883M were shown to be the best predictors in women, whereas I883M and E1172D were most informative in men. Login to comment
2413 Additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs with up to three-fold increases in risk for specific subsets of the genotypes (Fig. 4, lower panels) [85]. Login to comment
2441 For V771M, I883M, and E1172D as single sites, heterozygotes and homozygotes for the variant allele were pooled (heterozygotes and homozygotes in red, wildtype in green). Login to comment
2386 Common ABCA1 variants in the general population 5.1. Frequency of common variants in the extreme tails of the HDL distribution Several resequencing studies have identified a number of common non-synonymous variations in ABCA1 [57,58,81-84]: R219K, V771M, V825I, I883M, E1172D and R1587K. Login to comment
2388 In the largest resequencing study to date of Caucasians in the general population, two of the nonsynonymous SNPs (V771M and R1587K) and/or their haplotypes differed in frequency between the population extremes of HDL cholesterol levels [52,57]. Login to comment
2394 Frequencies of common variants and association with variation in lipid levels in the general population Frequencies for the most common non-synonymous ABCA1 SNPs (R219K, V825I, I883M, R1587K) are largely similar across studies that partly or as a whole represent general populations [57,58,81,82,86-88], whereas the less common SNPs (V771M, and E1172D) are reported in some [57,58,81,82,86,88], but not in all studies [58,87]. Login to comment
2397 The V771M and V825I SNPs were associated with increases in HDL cholesterol in women, whereas the R1587K SNP was associated with decreased HDL cholesterol levels in both genders. Login to comment
2401 The HDL cholesterol and/or apoAI lowering effect of the rare allele of the very common R1587K SNP has now been observed in several different studies [57,81,82], whereas the HDL cholesterol increasing effect of the V771M and V825I/I883M SNPs appears to be confined to specific genders in different populations [57,58,87-89]. Login to comment
2409 Frikke-Schmidt et al. showed for the first time in a large general population sample that three out of six non-synonymous SNPs (V771M, I883M, and E1172D) were independent predictors of IHD risk - risk increases that were not reflected in levels of HDL cholesterol [85]. Login to comment
2412 Additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs with up to three-fold increases in risk for specific subsets of the genotypes (Fig. 4, lower panels) [85]. Login to comment
2440 For V771M, I883M, and E1172D as single sites, heterozygotes and homozygotes for the variant allele were pooled (heterozygotes and homozygotes in red, wildtype in green). Login to comment

[hide] Effect of ABCA1 mutations on risk for myocardial i... Curr Atheroscler Rep. 2008 Oct;10(5):413-26. Iatan I, Alrasadi K, Ruel I, Alwaili K, Genest J
Effect of ABCA1 mutations on risk for myocardial infarction.
Curr Atheroscler Rep. 2008 Oct;10(5):413-26., [PMID:18706283]

Abstract [show]
The adenosine triphosphate-binding cassette A1 (ABCA1) gene codes for a cellular phospholipid and cholesterol transporter that mediates the initial and essential step in high-density lipoprotein (HDL) biogenesis: the formation of nascent HDL particles. Mutations at the ABCA1 gene locus cause severe familial HDL deficiency and, in the homozygous form, cause Tangier disease. Several studies have investigated the influence of ABCA1 variation on lipid metabolism and coronary heart disease, but they have resulted in controversial and inconsistent results. Genetic variability at the ABCA1 gene has also been associated with increased risk of myocardial infarction. In one study, this association was independent of HDL cholesterol levels, raising the possibility that the measurement of HDL cholesterol levels may not provide adequate information on the functional roles of HDL particles. Nevertheless, genomic screening for complex diseases, such as coronary heart disease, and HDL deficiency in particular, may not add additional information to that gained from conventional global cardiovascular risk stratification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 To date, the largest study examining ABCA1 single nucleotide polymorphisms (SNPs) and HDL-C is the Copenhagen City Heart Study [24], in which the relationship between six ABCA1 nonsynonymous common SNPs (R219K, V771M, M825I, I883M, E1172D, and R1587K) and HDL-C was analyzed. Login to comment
112 Additional insights into the effects of ABCA1 on MI have recently been described by Frikke-Schmidt et al. [35•] in a study where six nonsynonymous ABCA1 SNPs, R219K, V771M, V825I, I883M, E1172D, and R1587K (identified by resequencing ABCA1 in 190 individuals of Danish ancestry [24]), were genotyped in 9259 individuals from the Copenhagen City Heart Study to assess their risk of CHD (Table 2). Login to comment
115 In addition, to determine which ABCA1 SNPs were independent predictors of CHD and not caused by linkage disequilibrium among SNPs, a stepwise Cox regression approach was performed identifying V771M, I883M, and E1172D as the most important for the final IHD prediction model. Login to comment
116 Additive effects on CHD risk were also observed for the V771M/I883M and I883M/E1172D pairs. Login to comment
149 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Andrikovics et al. [45] / 2006 Hungarian patients with ischemic stroke ( n = 244) NA R219K † , V771M † , I883M A higher frequency of R219K and V771M was observed in controls than in Hungarian stroke patients, suggesting a protective role against CHD Hungarian patients with CHD ( n = 150) Controls (n = 193) Benton et al. [46] / 2007 Subgroup of Multi-Ethnic Study of Atherosclerosis study group ( n = 969) R219K genotype: C-565T, R219K † The R219K polymorphism was associated with a 28% lower prevalence of coronary calcifi cation, a measure of subclinical atherosclerosis, and slightly higher HDL-C level RR: 1.34 ± 0.38 RK: 1.29 ± 0.35 KK: 1.37 ± 0.39 Tsai et al. [47] / 2007 Taiwanese patients with CHD ( n = 205) and controls ( n = 201) Cases: 1.04 ± 0.25 I823M The M823 allele was associated with higher HDL-C. Login to comment
152 Cases: 1.70 (1.5-2.0) Ctl: 1.30 (1.1-1.6) Pasdar et al. [49] / 2007 White ischemic stroke patients ( n = 400) Cases: 1.20 ± 0.40 L158L, R219K, G316G, R1587K The ABCA1 gene was not found to be associated with ischemic stroke, but R219K had the greatest impact on lipid profi le, especially on LDL and TG White controls ( n = 487) Ctl: 1.40 ± 0.40 Nebel et al. [50] / 2007 German patients with CHD ( n = 1090) and controls ( n = 728) NA R219K, V771M, I883M † , E1172D, R1587K Only the I883M polymorphism was signifi cantly associated with CHD *Studies reporting the initial molecular and biochemical characterization of fewer than 5 probands with an ABCA1 gene defect and their families were not included in Table 2. Login to comment
155 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Frikke-Schmidt et al. [35••] / 2008 Copenhagen City Heart Study: Women: R219K, V771M † , V825I † , I883M † , E1172D † , R1587K † Common genetic variation at the ABCA1 locus predicts IHD risk independently of plasma HDL-C levels. Login to comment
156 The V771M, I883M, and E1172D polymorphisms signifi cantly predicted IHD risk, but their association was not related to HDL-C. Login to comment
161 Taken together, the findings of this study show that three of the six nonsynonymous SNPs (V771M, I883M, and E1172D) in ABCA1 predict risk of IHD in the general population, and that ABCA1 may have proatherosclerosis effects independent of HDL-C levels [35•]. Login to comment

[hide] Investigation of ABCA1 C69T and G-191C polymorphis... In Vivo. 2008 Mar-Apr;22(2):187-90. Ergen A, Isbir S, Tekeli A, Isbir T
Investigation of ABCA1 C69T and G-191C polymorphisms in coronary artery disease.
In Vivo. 2008 Mar-Apr;22(2):187-90., [PMID:18468402]

Abstract [show]
BACKGROUND: Defects of lipoprotein metabolism are common risk factors for coronary artery disease. The ATP binding cassette transporter 1 (ABCA1) plays an important role in carrying cholesterol from peripheral tissues to the liver. The role of ABCA1 C69T and G-191C gene polymorphisms on plasma lipid levels of patients with coronary artery disease was investigated. PATIENTS AND METHODS: Seventy-seven patients with coronary artery disease and fifty healthy controls were studied. Gene polymorphisms were determined by polymerase chain reaction-restriction fragment length polymorphism method. RESULTS: No differences in the distribution of C69T and G-191C polymorphisms were observed in the study groups. Plasma triacylglycerol and VLDL-cholesterol levels were shown to be higher in the patient group with the C69T CC genotype compared to these patients with the CT genotype. The C69T polymorphism was associated with HDL-cholesterol levels, which insignificantly increased in the order of the CC>CT>TT genotypes in our study. No association was found between G-191C genotype and lipid levels. CONCLUSION: The results of our study suggested that polymorphisms of ABCA1 C69T polymorphism may be associated with plasma triacylglycerol and VLDL-cholesterol levels in coronary artery patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 They found that the rare alleles of C-14T(C69T) and V771M polymorphisms were associated with higher HDL-C levels in men and, in combination with the rare alleles of R219K and I883M, respectively, with higher HDL-C in both sexes. Login to comment

[hide] Novel rare mutations and promoter haplotypes in AB... Clin Genet. 2008 Feb;73(2):179-84. Slatter TL, Jones GT, Williams MJ, van Rij AM, McCormick SP
Novel rare mutations and promoter haplotypes in ABCA1 contribute to low-HDL-C levels.
Clin Genet. 2008 Feb;73(2):179-84., [PMID:18199144]

Abstract [show]
The ATP-binding cassette A1 (ABCA1) protein regulates plasma high-density lipoprotein (HDL) levels. Mutations in ABCA1 can cause HDL deficiency and increase the risk of premature coronary artery disease. Single nucleotide polymorphisms (SNPs) in ABCA1 are associated with variation in plasma HDL levels. We investigated the prevalence of mutations and common SNPs in ABCA1 in 154 low-HDL individuals and 102 high-HDL individuals. Mutations were identified in five of the low-HDL subjects, three having novel variants (I659V, R2004K, and A2028V) and two with a previously identified variant (R1068H). Analysis of four SNPs in the ABCA1 gene promoter (C-564T, G-407C, G-278C, and C-14T) identified the C-14T SNP and the TCCT haplotype to be over-represented in low-HDL individuals. The R1587K SNP was over-represented in low-HDL individuals, and the V825I and I883M SNPs over-represented in high-HDL individuals. We conclude that sequence variation in ABCA1 contributes significantly to variation in HDL levels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 The C-14T promoter SNP (17), and the R1587K coding SNP (9) have been associated with low HDL-C, while the V771M (9), V825I (9, 10) and I883M (10, 18) coding SNPs have been associated with elevated HDL-C. Login to comment
41 Genotyping of ABCA1 SNPs by RFLP Fourteen SNPs including five promoter SNPs (C-564T, G-407C, G-278C, G-99C, and C-14T), one 5#-UTR SNP [-76(-75) insG], six non-synonymous coding SNPs (R219K, V771M, V825I, I883M, E1172D, and R1587K) and two 3#-UTR SNPs [A-960G -383(-381)delGTT] were genotyped in the low-, mid-, and high-HDL-C groups by restriction fragment length polymorphism (RFLP) analysis. Login to comment
55 Six of the non-synonymous variants were previously reported SNPs (R219K, V771M, V825I, I883M, E1172D and R1587K). Login to comment
105 a Coding haplotypes were derived from the following six non-synonymous SNPs (left to right): R219K (G.A), V771M (G.A), V825I (G.A), I883M (A.G), E1172D (G.C), and R1587K (G.A). Login to comment

[hide] Genetic variation in ABCA1 predicts ischemic heart... Arterioscler Thromb Vasc Biol. 2008 Jan;28(1):180-6. Epub 2007 Oct 19. Frikke-Schmidt R, Nordestgaard BG, Jensen GB, Steffensen R, Tybjaerg-Hansen A
Genetic variation in ABCA1 predicts ischemic heart disease in the general population.
Arterioscler Thromb Vasc Biol. 2008 Jan;28(1):180-6. Epub 2007 Oct 19., [PMID:17951323]

Abstract [show]
OBJECTIVE: We tested the hypothesis that 6 nonsynonymous single nucleotide polymorphisms (SNPs) in ATP-Binding-Cassette transporter A1 (ABCA1) affect risk of ischemic heart disease (IHD) in the general population. METHODS AND RESULTS: We genotyped 9259 individuals from the Danish general population followed for 25 years. Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD. Similar results were obtained in a verification sample with 932 IHD cases versus 7999 controls. A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs. CONCLUSIONS: We show that 3 of 6 nonsynonymous SNPs in ABCA1 predict risk of IHD in the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Login to comment
8 Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD. Login to comment
10 A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs. Login to comment
16 In the present study we included 9259 individuals from the 1991 to 1994 examination, whom we genotyped for all nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals of Danish ancestry.8 Information on diagnosis of IHD (nϭ1170; World Health Organization; International Classification of Diseases, 8th edition: codes 410 to 414; 10th edition: codes I20-I25) was collected and verified until 31st December 2000 by reviewing all hospital admissions and diagnoses entered in the national Danish Patient Registry, all causes of death entered in the national Danish Causes of Death Registry, and medical records from hospitals and general practitioners. Login to comment
29 The cohort was participants in The Copenhagen City Heart Study who attended the 1991 to 1994 examination, and for whom combined genotypes for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) were available as well as all clinical and biochemical data (nϭ9028 out of nϭ9259; Table 1). Login to comment
38 SNP Genotyping The ABI PRISM 7900HT Sequence Detection System (Applied Biosystem Inc) was used to genotype for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals, as previously described.8 Biochemical Analyses Colorimetric and turbidimetric assays (Hitachi autoanalyzer) were used to measure plasma levels of total cholesterol, HDL-C, triglycerides, and apolipoproteins B and -AI (all Boehringer Mannheim GmbH). Login to comment
55 Frikke-Schmidt et al ABCA1 and Ischemic Heart Disease 181 the entire ABCA1 gene in 190 individuals of Danish descent were: 0.26 (R219K), 0.03 (V771M), 0.03 (E1172D), 0.06 (V825I), 0.12 (I883M), and 0.24 (R1587K).8 Similar allele frequencies have been reported for other White populations.14 Please see Data Supplements, Expanded Results for description of Hardy-Weinberg equilibrium. Login to comment
57 A strong positive DЈ was present for R219K/V771M, M825I/I883M, and E1172D/ R1587K (DЈϾ0.9), whereas a strong negative DЈ was present for R219K/V825I, V771M/V825I, and V771M/I883M (DЈϽ-0.9). Login to comment
60 Risk of IHD Prospective Study The cumulative incidence of IHD as a function of age was increased for V771M (GAϩAA versus GG, borderline Pϭ0.06), V825I (GAϩAA versus GG; Pϭ0.02), I883M (AGϩGG versus AA, Pϭ0.01), E1172D (GCϩCC versus GG, Pϭ0.03), and for R1587K (AA versus GG, borderline Pϭ0.06), but not for R219K (Figure 2). Login to comment
61 The age adjusted hazard ratios (HRs) for IHD were: V771M (GAϩAA versus GG) 1.2 (95% confidence interval [CI] 1.0 to 1.5), V825I (GAϩAA versus GG) 1.2 (1.0 to 1.5), I883M (AGϩGG versus AA) 1.2 (1.0 to 1.4), E1172D (GCϩCC versus GG) 1.3 (1.0 to 1.6) and R1587K (AA versus GG) 1.2 (1.0 to 1.6), respectively (Table 2). Login to comment
68 Probability values are for overall log-rank tests. For V771M, V825I, I883M, and E1172D, heterozygotes and homozygotes for the variant allele were pooled (combined genotype in red, common genotype in green). Login to comment
71 There was evidence for a statistically significant interaction between gender and V771M (Pϭ0.04) in the prediction of IHD, whereas the remaining 5 SNPs did not interact with gender (all probability values Ͼ0.52). Login to comment
74 The age-adjusted odds ratios (ORs) were: V771M (GAϩAA versus GG) 1.2 (0.9 to 1.5), V825I (GAϩAA versus GG) 1.2 (0.9 to 1.4), I883M (AGϩGG versus AA) 1.2 (1.0 to 1.4), E1172D (GCϩCC versus GG) 1.1 (0.8 to 1.4), and R1587K (GA versus GG) 1.2 (1.0 to 1.4). Login to comment
77 The final prediction model included the 3 noncorrelated SNPs, V771M, I883M, and E1172D (HRs: V771M, 1.2 [1.0 to 1.6]; I883M, 1.2 [1.0 to 1.4]; E1172D, 1.2 [1.0 to 1.6]). Login to comment
78 Performing gender specific stepwise regression, V771M and I883M were the best predictors in women (HRs: V771M, 1.6 [1.2 to 2.3]; I883M, 1.3 [1.1 to 1.6]), whereas I883M and E1172D were best in men (HRs: I883M, 1.1 (1.0 to 1.4); E1172D, 1.3 (1.0 to 1.7). Login to comment
81 ABCA1 SNPs and HDL-C Levels In genders combined, V771M and V825I were associated with increases in HDL-C of 0.04 and 0.05 mmol/L, respectively (Figure 3, upper panel). Login to comment
85 Risk of Ischemic Heart Disease as a Function of ABCA1 Genotype in the Prospective Study n, % Number of Events Incidence Rate (95% CI) per 10 000 Person-Years Hazard Ratio (95% CI) Observed Expected Age Adjusted HDL-C Adjusted Multifactorially Adjusted R219K GG 4863 (54) 603 603 64 (59-70) 1 1 1 GA 3461 (39) 429 426 64 (58-71) 1.0 (0.9-1.1) 1.0 (0.9-1.1) 1.0 (0.9-1.2) AA 641 (7) 75 79 64 (50-80) 1.0 (0.8-1.2) 1.0 (0.8-1.2) 1.0 (0.8-1.3) V771M GG 8379 (93) 1023 1040 64 (60-68) 1 1 1 GAϩAA 586 (7) 84 69 75 (60-93)* 1.2 (1.0-1.5) 1.3 (1.0-1.6) 1.2 (1.0-1.5) M825I GG 7959 (89) 962 988 63 (59-67) 1 1 1 GAϩAA 1006 (11) 145 122 76 (64-89)† 1.2 (1.0-1.5) 1.2 (1.0-1.5) 1.2 (1.0-1.4) I883M AA 6934 (77) 827 864 62 (58-66) 1 1 1 AGϩGG 2031 (23) 280 245 72 (64-81)† 1.2 (1.0-1.4) 1.2 (1.1-1.4) 1.2 (1.1-1.4) E1172D GG 8469 (94) 1026 1045 63 (59-67) 1 1 1 GCϩCC 496 (6) 81 64 86 (68-106)† 1.3 (1.0-1.6) 1.3 (1.0-1.6) 1.3 (1.0-1.6) R1587K GG 5216 (58) 626 645 62 (58-67) 1 1 1 GA 3213 (36) 399 396 65 (58-71) 1.0 (0.9-1.2) 1.0 (0.9-1.2) 1.0 (0.9-1.2) AA 536 (6) 82 68 82 (65-102)* 1.2 (1.0-1.6) 1.2 (1.0-1.5) 1.3 (1.0-1.6) Nonincident cases (nϭ63) were excluded, leaving 8965 individuals for the survival analyses and Cox regression. Login to comment
89 Rs numbers: R219K (rs2230806); V771M (rs2066718); V825I (rs2066715); I883M (rs4149313); E1172D (rs33918808); R1587K (rs2230808). Login to comment
102 The fact that the stepwise regression approach identified the V771M, I883M, and E1172D SNPs, which have very weak association between rare alleles (low r2 or negative DЈ), as important for the final IHD prediction model, supports that the observed findings for these 3 SNPs are not caused by LD. Login to comment
1 Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Login to comment
2 Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD. Login to comment
4 A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs. Login to comment
23 The cohort was participants in The Copenhagen City Heart Study who attended the 1991 to 1994 examination, and for whom combined genotypes for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) were available as well as all clinical and biochemical data (nafd;9028 out of nafd;9259; Table 1). Login to comment
32 SNP Genotyping The ABI PRISM 7900HT Sequence Detection System (Applied Biosystem Inc) was used to genotype for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals, as previously described.8 Biochemical Analyses Colorimetric and turbidimetric assays (Hitachi autoanalyzer) were used to measure plasma levels of total cholesterol, HDL-C, triglycerides, and apolipoproteins B and -AI (all Boehringer Mannheim GmbH). Login to comment
49 Frikke-Schmidt et al ABCA1 and Ischemic Heart Disease 181 at Semmelweis University (Egyetem) on December 3, 2015 http://atvb.ahajournals.org/ Downloaded from the entire ABCA1 gene in 190 individuals of Danish descent were: 0.26 (R219K), 0.03 (V771M), 0.03 (E1172D), 0.06 (V825I), 0.12 (I883M), and 0.24 (R1587K).8 Similar allele frequencies have been reported for other White populations.14 Please see Data Supplements, Expanded Results for description of Hardy-Weinberg equilibrium. Login to comment
51 A strong positive Db18; was present for R219K/V771M, M825I/I883M, and E1172D/ R1587K (Db18;b0e;0.9), whereas a strong negative Db18; was present for R219K/V825I, V771M/V825I, and V771M/I883M (Db18;b0d;afa;0.9). Login to comment
54 Risk of IHD Prospective Study The cumulative incidence of IHD as a function of age was increased for V771M (GAaf9;AA versus GG, borderline Pafd;0.06), V825I (GAaf9;AA versus GG; Pafd;0.02), I883M (AGaf9;GG versus AA, Pafd;0.01), E1172D (GCaf9;CC versus GG, Pafd;0.03), and for R1587K (AA versus GG, borderline Pafd;0.06), but not for R219K (Figure 2). Login to comment
62 Probability values are for overall log-rank tests. For V771M, V825I, I883M, and E1172D, heterozygotes and homozygotes for the variant allele were pooled (combined genotype in red, common genotype in green). Login to comment
65 There was evidence for a statistically significant interaction between gender and V771M (Pafd;0.04) in the prediction of IHD, whereas the remaining 5 SNPs did not interact with gender (all probability values b0e;0.52). Login to comment
72 Performing gender specific stepwise regression, V771M and I883M were the best predictors in women (HRs: V771M, 1.6 [1.2 to 2.3]; I883M, 1.3 [1.1 to 1.6]), whereas I883M and E1172D were best in men (HRs: I883M, 1.1 (1.0 to 1.4); E1172D, 1.3 (1.0 to 1.7). Login to comment
75 ABCA1 SNPs and HDL-C Levels In genders combined, V771M and V825I were associated with increases in HDL-C of 0.04 and 0.05 mmol/L, respectively (Figure 3, upper panel). Login to comment
79 Risk of Ischemic Heart Disease as a Function of ABCA1 Genotype in the Prospective Study n, % Number of Events Incidence Rate (95% CI) per 10 000 Person-Years Hazard Ratio (95% CI) Observed Expected Age Adjusted HDL-C Adjusted Multifactorially Adjusted R219K GG 4863 (54) 603 603 64 (59-70) 1 1 1 GA 3461 (39) 429 426 64 (58-71) 1.0 (0.9-1.1) 1.0 (0.9-1.1) 1.0 (0.9-1.2) AA 641 (7) 75 79 64 (50-80) 1.0 (0.8-1.2) 1.0 (0.8-1.2) 1.0 (0.8-1.3) V771M GG 8379 (93) 1023 1040 64 (60-68) 1 1 1 GAaf9;AA 586 (7) 84 69 75 (60-93)* 1.2 (1.0-1.5) 1.3 (1.0-1.6) 1.2 (1.0-1.5) M825I GG 7959 (89) 962 988 63 (59-67) 1 1 1 GAaf9;AA 1006 (11) 145 122 76 (64-89)ߤ 1.2 (1.0-1.5) 1.2 (1.0-1.5) 1.2 (1.0-1.4) I883M AA 6934 (77) 827 864 62 (58-66) 1 1 1 AGaf9;GG 2031 (23) 280 245 72 (64-81)ߤ 1.2 (1.0-1.4) 1.2 (1.1-1.4) 1.2 (1.1-1.4) E1172D GG 8469 (94) 1026 1045 63 (59-67) 1 1 1 GCaf9;CC 496 (6) 81 64 86 (68-106)ߤ 1.3 (1.0-1.6) 1.3 (1.0-1.6) 1.3 (1.0-1.6) R1587K GG 5216 (58) 626 645 62 (58-67) 1 1 1 GA 3213 (36) 399 396 65 (58-71) 1.0 (0.9-1.2) 1.0 (0.9-1.2) 1.0 (0.9-1.2) AA 536 (6) 82 68 82 (65-102)* 1.2 (1.0-1.6) 1.2 (1.0-1.5) 1.3 (1.0-1.6) Nonincident cases (nafd;63) were excluded, leaving 8965 individuals for the survival analyses and Cox regression. Login to comment
83 Rs numbers: R219K (rs2230806); V771M (rs2066718); V825I (rs2066715); I883M (rs4149313); E1172D (rs33918808); R1587K (rs2230808). Login to comment
96 The fact that the stepwise regression approach identified the V771M, I883M, and E1172D SNPs, which have very weak association between rare alleles (low r2 or negative Db18;), as important for the final IHD prediction model, supports that the observed findings for these 3 SNPs are not caused by LD. Login to comment

[hide] Common coding polymorphisms in the ABCA1 gene and ... Atherosclerosis. 2007 Aug;193(2):458-60. Epub 2006 Oct 27. Nebel A, Croucher PJ, El Mokhtari NE, Flachsbart F, Schreiber S
Common coding polymorphisms in the ABCA1 gene and risk of early-onset coronary heart disease in northern Germany.
Atherosclerosis. 2007 Aug;193(2):458-60. Epub 2006 Oct 27., [PMID:17070530]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 In the present study, we have examined the potential association between the five known coding polymorphisms R219K, V771M, I883M, E1172D and R1587K in the ABCA1 gene and early-onset CHD in a large ethnically homogeneous sample from the northernmost province in Germany. Login to comment
25 We examined the five known ABCA1 polymorphisms R219K, V771M, I883M, E1172D and R1587K in early-onset 0021-9150/$ - see front matter (c) 2006 Elsevier Ireland Ltd. Login to comment
27 doi:10.1016/j.atherosclerosis.2006.09.022 Letter to the Editor / Atherosclerosis 193 (2007) 458-460 Table 1 Summary association statistics for common ABCA1 coding SNPs in German CHD patients and controls ABCA1 variant MAFa CHD MAFa control Pallele Pgenotype Pcarrier b ORcarrier c 95% CIcarrier d R219K (rs2230806)e 0.265 0.258 0.656 0.582 0.438 1.08 0.89-1.30 V771M (rs2066718)e 0.026 0.034 0.188 0.255 0.222 0.78 0.53-1.16 I883M (rs4149313)e 0.138 0.112 0.023 0.068 0.021 1.31 1.04-1.64 E1172D (hCV25924149)e 0.025 0.025 0.914 0.714 0.983 1.00 0.65-1.55 R1587K (rs2230808)e 0.261 0.234 0.067 0.197 0.097 1.18 0.97-1.42 a MAF, minor allele frequency. Login to comment
31 e R219K, V771M, I883M, E1172D and R1587K were typed using TaqMan® SNP Assays (Applied Biosystems, Foster City, USA). Login to comment
36 However, additional studies have indicated no relevant effects for the I883M genotype on CHD or HDH-C levels [8,10,11]. Login to comment
37 The other four SNPs R219K, V771M, E1172D and R1587K exhibited no clear effects in the German CHD samples investigated here. Login to comment
46 Table 2 Logistic regression analysis for five coding SNPs in the ABCA1 gene in German CHD patients and controls Predictora ORb 95% CIc P Gender 1.05 0.81-1.36 0.721 R219K 1.20 0.99-1.47 0.066 V771M 0.90 0.57-1.41 0.645 I883M 1.28 1.02-1.61 0.034 E1172D 0.78 0.52-1.19 0.253 R1587K 1.10 0.90-1.34 0.361 a Each marker binary classified for carriership of rare allele, gender was included as a predictive variable, logistic regression analysis was performed with the R-package [14]. Login to comment
26 doi:10.1016/j.atherosclerosis.2006.09.022 Letter to the Editor / Atherosclerosis 193 (2007) 458-460 Table 1 Summary association statistics for common ABCA1 coding SNPs in German CHD patients and controls ABCA1 variant MAFa CHD MAFa control Pallele Pgenotype Pcarrier b ORcarrier c 95% CIcarrier d R219K (rs2230806)e 0.265 0.258 0.656 0.582 0.438 1.08 0.89-1.30 V771M (rs2066718)e 0.026 0.034 0.188 0.255 0.222 0.78 0.53-1.16 I883M (rs4149313)e 0.138 0.112 0.023 0.068 0.021 1.31 1.04-1.64 E1172D (hCV25924149)e 0.025 0.025 0.914 0.714 0.983 1.00 0.65-1.55 R1587K (rs2230808)e 0.261 0.234 0.067 0.197 0.097 1.18 0.97-1.42 a MAF, minor allele frequency. Login to comment
30 e R219K, V771M, I883M, E1172D and R1587K were typed using TaqMan&#ae; SNP Assays (Applied Biosystems, Foster City, USA). Login to comment
45 Table 2 Logistic regression analysis for five coding SNPs in the ABCA1 gene in German CHD patients and controls Predictora ORb 95% CIc P Gender 1.05 0.81-1.36 0.721 R219K 1.20 0.99-1.47 0.066 V771M 0.90 0.57-1.41 0.645 I883M 1.28 1.02-1.61 0.034 E1172D 0.78 0.52-1.19 0.253 R1587K 1.10 0.90-1.34 0.361 a Each marker binary classified for carriership of rare allele, gender was included as a predictive variable, logistic regression analysis was performed with the R-package [14]. Login to comment

[hide] Genetic determinants of HDL: monogenic disorders a... Curr Opin Cardiol. 2007 Jul;22(4):344-51. Klos KL, Kullo IJ
Genetic determinants of HDL: monogenic disorders and contributions to variation.
Curr Opin Cardiol. 2007 Jul;22(4):344-51., [PMID:17556888]

Abstract [show]
PURPOSE OF REVIEW: This review focuses on recent progress towards the characterization of genetic variations that contribute to interindividual variation in plasma high-density lipoprotein cholesterol levels in the general population. RECENT FINDINGS: Many of the genes that harbor rare mutations leading to extreme high-density lipoprotein cholesterol levels contain common variation that influences plasma high-density lipoprotein cholesterol in several study populations. Candidate gene association studies provide evidence that some of these variations have an effect on high-density lipoprotein cholesterol, dependent on epistatic interactions or environmental context. Both rare and common variations contribute to interindividual high-density lipoprotein cholesterol variation. Recent comparisons of candidate gene sequences between individuals in the tails of the high-density lipoprotein cholesterol distributions (the upper or lower 1-5%) of several study populations indicate that as many as 20% of individuals with low high-density lipoprotein cholesterol harbor a rare mutation in an investigated gene. For example, the ABCA1 gene region harbors rare mutations and common variants that contribute to interindividual high-density lipoprotein cholesterol variation in the general population. SUMMARY: The genetic control of high-density lipoprotein cholesterol level is complex. Maximizing the utility of genetic knowledge for predicting an individual's high-density lipoprotein cholesterol level or response to intervention will require a better understanding of the action of combinations of genetic variants and environmental exposures.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Sequence analyses, most notably of the ABCA1 region, suggest that both common variants and rare mutations contribute to interindividual variation in Genetic determinants of HDL Klos and Kullo 347 Table1Commonpolymorphisms(minorallelefrequency>5%)reportedtobeassociatedwithplasmaHDL-Cinmorethanonestudy;thereporteddirectionofeffectoftheless commonallele,andtheircontributionstocovariate-adjustedHDL-Cvariationaloneandincombinationwithotherpolymorphismsofthesamegene GenesymbolGenenamePolymorphismEffecta Single-sitevariationMultisitevariation ABCA1ATP-bindingcassette,sub-familyA (ABC1),member1 596G>A"HDL-C[52,53]4%[52] R219K"HDL-C[28,29 ,30 ]6%[54] V771M"HDL-C[30 ,33] V825I/V825L"HDL-C[30 ];#HDL-C[32 ] APOA5ApolipoproteinA-VÀ1131T>C#HDL-C[55-57] APOC3ApolipoproteinC-III482C>T#HDL-C[55,58 ]0.2-1.4%[58 ]1-6%[58 ,59] SstIS2allelewith#HDL-C[60,61] APOEApolipoproteinEÀ219G>T#HDL-C[27 ,62] e2/e3/e40.8-6.5%[63,64 ]8.3-15.3%[65] ARAndrogenreceptorEx1CAGrepeat"HDL-Cwithlength[66] CETPCholesterol-estertransferproteinÀ1946VNTR"HDL-Cwiththeshortallele[36,67] À629C>A"HDL-C[36,38,39,67-69]4.6-5.2%[39,64 ]5.5-9.8%[39,68] Taq1B"HDL-C[35]3.9%[39]5.5-15%[39,54] MspIin8#HDL-C[36,67] A373P/R451Q#HDL-C[67,68]8%[70] I405V"HDL-C[35] LIPCHepaticlipaseÀ514C>T"HDL-C[45]Upto31%[54] À250G>A"HDL-C[41,43]4.7%[67] LIPGEndotheliallipaseT111I"HDL-C[72,73 ];#HDL-C[74] LPLLipoproteinlipaseHindIII#HDL-CwiththeHþallele[49,75] N291S#HDL-C[50 ] S447X"HDL-C[48,75]0.8%[64 ]3%[35] PON1Paraoxonase1À107T>C"HDL-C[76-78] Q192R"HDL-C[77,79 ];#HDL-C[79 ] PPARDPeroxisomeproliferatorsactivatedreceptordelta294T>C#HDL-C[80] PPARGPeroxisomeproliferatorsactivatedreceptorgammaPro12Ala"HDL-C[81,82] SCARB1ScavengerreceptorclassB,member1A350A"HDL-C[64 ,83]1.3%[64 ] IVS5/A350A(/IVS10)haplotype#HDL-C[84 ] a Citationsrepresentaselectionofavailablestudiesprioritizedbasedonmeta-analysesofassociationresultsinnumerousstudygroups,andrecentstudiescontainingcomprehensivereviewsofpreviously reportedassociations. Login to comment

[hide] The effect of ABCA1 gene polymorphisms on ischaemi... BMC Med Genet. 2007 Jun 6;8:30. Pasdar A, Yadegarfar G, Cumming A, Whalley L, St Clair D, MacLeod MJ
The effect of ABCA1 gene polymorphisms on ischaemic stroke risk and relationship with lipid profile.
BMC Med Genet. 2007 Jun 6;8:30., [PMID:17553166]

Abstract [show]
BACKGROUND: Ischaemic stroke is a common disorder with genetic and environmental components contributing to overall risk. Atherothromboembolic abnormalities, which play a crucial role in the pathogenesis of ischaemic stroke, are often the end result of dysregulation of lipid metabolism. The ATP Binding Cassette Transporter (ABCA1) is a key gene involved in lipid metabolism. It encodes the cholesterol regulatory efflux protein which mediates the transfer of cellular phospholipids and cholesterol to acceptor apolipoproteins such as apolipoprotein A-I (ApoA-I). Common polymorphisms in this gene affect High Density Lipoprotein Cholesterol (HDL-C) and Apolipoprotein A-I levels and so influence the risk of atherosclerosis. This study has assessed the distribution of ABCA1 polymorphisms and haplotype arrangements in patients with ischaemic stroke and compared them to an appropriate control group. It also examined the relationship of these polymorphisms with serum lipid profiles in cases and controls. METHODS: We studied four common polymorphisms in ABCA1 gene: G/A-L158L, G/A-R219K, G/A-G316G and G/A-R1587K in 400 Caucasian ischaemic stroke patients and 487 controls. Dynamic Allele Specific Hybridisation (DASH) was used as the genotyping assay. RESULTS: Genotype and allele frequencies of all polymorphisms were similar in cases and controls, except for a modest difference in the ABCA1 R219K allele frequency (P-value = 0.05). Using the PHASE2 program, haplotype frequencies for the four loci (158, 219, 316, and 1587) were estimated in cases and controls. There was no significant difference in overall haplotypes arrangement in patients group compared to controls (p = 0.27). 2211 and 1211 haplotypes (1 = common allele, 2 = rare allele) were more frequent in cases (p = 0.05). Adjusted ORs indicated 40% and 46% excess risk of stroke for these haplotypes respectively. However, none of the adjusted ORs were statistically significant. Individuals who had R219K "22" genotype had a higher LDL level (p = 0.001). CONCLUSION: Our study does not support a major role for the ABCA1 gene as a risk factor for ischaemic stroke. Some haplotypes may confer a minor amount of increased risk or protection. Polymorphisms in this gene may influence serum lipid profile.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 The only published study in ischaemic stroke on 244 Hungarian patients [25] suggests a protective role for the ABCA1-R219K and V771M polymorphisms. Login to comment

[hide] Genetic etiology of isolated low HDL syndrome: inc... Arterioscler Thromb Vasc Biol. 2007 May;27(5):1139-45. Epub 2007 Feb 15. Kiss RS, Kavaslar N, Okuhira K, Freeman MW, Walter S, Milne RW, McPherson R, Marcel YL
Genetic etiology of isolated low HDL syndrome: incidence and heterogeneity of efflux defects.
Arterioscler Thromb Vasc Biol. 2007 May;27(5):1139-45. Epub 2007 Feb 15., [PMID:17303779]

Abstract [show]
OBJECTIVE: We have used a multitiered approach to identify genetic and cellular contributors to high-density lipoprotein (HDL) deficiency in 124 human subjects. METHODS AND RESULTS: We resequenced 4 candidate genes for HDL regulation and identified several functional nonsynonymous mutations including 2 in apolipoprotein A-I (APOA1), 4 in lecithin:cholesterol acyltransferase (LCAT), 1 in phospholipid transfer protein (PLTP), and 7 in the ATP-binding cassette transporter ABCA1, leaving 88% (110/124) of HDL deficient subjects without a genetic diagnosis. Cholesterol efflux assays performed using cholesterol-loaded monocyte-derived macrophages from the 124 low HDL subjects and 48 control subjects revealed that 33% (41/124) of low HDL subjects had low efflux, despite the fact that the majority of these subjects (34/41) were not carriers of dysfunctional ABCA1 alleles. In contrast, only 2% of control subjects presented with low efflux (1/48). In 3 families without ABCA1 mutations, efflux defects were found to cosegregate with low HDL. CONCLUSIONS: Efflux defects are frequent in low HDL syndromes, but the majority of HDL deficient subjects with cellular cholesterol efflux defects do not harbor ABCA1 mutations, suggesting that novel pathways contribute to this phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N. Login to comment
42 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N. Login to comment

[hide] Apolipoprotein E levels in cerebrospinal fluid and... Mol Neurodegener. 2007 Apr 12;2:7. Wahrle SE, Shah AR, Fagan AM, Smemo S, Kauwe JS, Grupe A, Hinrichs A, Mayo K, Jiang H, Thal LJ, Goate AM, Holtzman DM
Apolipoprotein E levels in cerebrospinal fluid and the effects of ABCA1 polymorphisms.
Mol Neurodegener. 2007 Apr 12;2:7., [PMID:17430597]

Abstract [show]
BACKGROUND: Animal studies suggest that brain apolipoprotein E (apoE) levels influence amyloid-beta (Abeta) deposition and thus risk for Alzheimer's disease (AD). We have previously demonstrated that deletion of the ATP-binding cassette A1 transporter (ABCA1) in mice causes dramatic reductions in brain and cerebrospinal fluid (CSF) apoE levels and lipidation. To examine whether polymorphisms in ABCA1 affect CSF apoE levels in humans, we measured apoE in CSF taken from 168 subjects who were 43 to 91 years old and were either cognitively normal or who had mild AD. We then genotyped the subjects for ten previously identified ABCA1 single nucleotide polymorphisms (SNPs). RESULTS: In all subjects, the mean CSF apoE level was 9.09 microg/ml with a standard deviation of 2.70 microg/ml. Levels of apoE in CSF samples taken from the same individual two weeks apart were strongly correlated (r2 = 0.93, p < 0.01). In contrast, CSF apoE levels in different individuals varied widely (coefficient of variation = 46%). CSF apoE levels did not vary according to AD status, APOE genotype, gender or race. Average apoE levels increased with age by approximately 0.5 microg/ml per 10 years (r2 = 0.05, p = 0.003). We found no significant associations between CSF apoE levels and the ten ABCA1 SNPs we genotyped. Moreover, in a separate sample of 1225 AD cases and 1431 controls, we found no association between the ABCA1 SNP rs2230806 and AD as has been previously reported. CONCLUSION: We found that CSF apoE levels vary widely between individuals, but are stable within individuals over a two-week interval. AD status, APOE genotype, gender and race do not affect CSF apoE levels, but average CSF apoE levels increase with age. Given the lack of association between CSF apoE levels and genotypes for the ABCA1 SNPs we examined, either these SNPs do not affect ABCA1 function or if they do, they do not have strong effects in the CNS. Finally, we find no evidence for an association between the ABCA1 SNP rs2230806 and AD in a large sample set.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 In particular, studies have implicated the following SNPs in affecting levels of plasma HDL-C: rs2230806 (R219K) [33], rs2066718 (V771M) [31,32], rs2066715 (V825I) [31], rs4149313 (I883M) [34], rs2230808 (R1587K) [31]. Login to comment
70 The subjects for whom we had CSF apoE data were genotyped for the following ABCA1 SNPs: rs2230806 (R219K), rs2066718 (V771M), rs2066715 (V825I), rs4149313 (I883M), rs2230808 (R1587K), rs1883025 (intron), rs2275544 (intron), rs2777799 (intron), rs3904999 (intron) and rs6479283 (intron). Login to comment
149 Genotyping The following SNPS in ABCA1 were genotyped in the Washington University sample of 168 subjects: rs2230806 (R219K), rs2066718 (V771M), rs2066715 (V825I), rs4149313 (I883M), rs2230808 (R1587K), rs1883025 (intron), rs2275544 (intron), rs2777799 (intron), rs3904999 (intron) and rs6479283 (intron). Login to comment

[hide] ABCA1 polymorphisms and Alzheimer's disease. Neurosci Lett. 2007 Apr 12;416(2):180-3. Epub 2007 Feb 7. Wavrant-De Vrieze F, Compton D, Womick M, Arepalli S, Adighibe O, Li L, Perez-Tur J, Hardy J
ABCA1 polymorphisms and Alzheimer's disease.
Neurosci Lett. 2007 Apr 12;416(2):180-3. Epub 2007 Feb 7., [PMID:17324514]

Abstract [show]
In our search for genetic factors related to the development of Alzheimer's disease, we have genotyped 332 pedigrees for three coding polymorphisms in the ABCA1 gene, two of which are known to alter plasma cholesterol levels, as well as a non-coding polymorphism within the promoter. We show an apparent weak association of rs2230806 (p-value=0.01) with the disease in a sibpair series of Alzheimer's disease that had shown previously evidence for linkage to the chromosome 9 locus where ABCA1 maps.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 doi:10.1016/j.neulet.2007.02.010 The SNPs used were rs2230806 (also designated as rs2234884) which encodes variant R219K (c.969A > G, numbering according to GenBank reference NM 005502) with a reported ~25% minor allele frequency in Caucasian populations [5,7], rs2066718 which is a V771M (c.2624A > G) variant with a reported ~3% minor allele frequency [5,7], rs2230808 which encodes a R1587K (c.5073A > G) variant with a reported 26% minor allele frequency [5,7] and finally rs2422493 which is a 5 UTR polymorphism located at -477 in the promoter with a reported 46% minor allele frequency [23,25]. Login to comment
41 These previous findings emphasize the Table 1 Genotype frequency of ABCA1 polymorphisms in USA sibpair series SNP ID (function) Total (Nf = 331) ApoE-␧4- (Nf = 76) ApoE-␧4+ (Nf = 227) Fam Freq p-Value Fam Freq p-Value Fam Freq p-Value rs2422493 (promoter) C/C 45 0.266 0.62 5 0.245 N/A 25 0.284 0.62 T/C 79 0.494 0.17 14 0.494 0.29 38 0.489 0.35 T/T 44 0.241 0.02* 10 0.261 0.30 21 0.227 0.08 rs2230806 (R219K) A/A 17 0.095 0.93 2 0.058 N/A 10 0.111 0.86 A/G 66 0.399 0.23 12 0.483 0.01* 31 0.388 0.70 G/G 56 0.507 0.21 11 0.459 0.02* 25 0.500 0.59 rs2066718 (V771M) A/A 0 0 N/A 0 0 N/A 0 0 N/A A/G 14 0.100 0.69 2 0.162 N/A 6 0.102 N/A G/G 14 0.900 0.69 2 0.838 N/A 6 0.898 N/A rs2230808 (R1587K) A/A 15 0.066 0.06 5 0.044 N/A 8 0.064 N/A A/G 62 0.426 0.69 14 0.505 0.64 32 0.420 0.90 G/G 56 0.509 0.55 13 0.451 0.57 29 0.515 0.67 Fam, number of informative families; Freq, frequency; Nf, number of nuclear families; N/A, non-applicable. Login to comment

[hide] Genotypic variation in ATP-binding cassette transp... Transl Res. 2007 Apr;149(4):205-10. Mantaring M, Rhyne J, Ho Hong S, Miller M
Genotypic variation in ATP-binding cassette transporter-1 (ABCA1) as contributors to the high and low high-density lipoprotein-cholesterol (HDL-C) phenotype.
Transl Res. 2007 Apr;149(4):205-10., [PMID:17383594]

Abstract [show]
The ATP-binding cassette transporter-1 (ABCA1) mediates cholesterol efflux and genotypic variation in ABCA1 and may impact reverse cholesterol transport and influence cardiovascular disease (CVD) risk. However, although mutations in ABCA1 have generally been identified with low HDL-C, few have undertaken a comparative evaluation between high and low high-density lipoprotein-cholesterol (HDL-C). Therefore, to evaluate for potential gain-of-function polymorphisms/mutations in ABCA1, 56 consecutive subjects were screened presenting with high (60-99 mg/dL [1.6-2.6 mmol/L]) or very high HDL-C (>100 mg/dL [2.6 mmol/L]) and were compared with subjects with average or low HDL-C (n = 68). Carrier frequencies of common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K were also assessed. All 50 exons and exon-intron boundaries of ABCA1 were screened using single-stranded conformation polymorphism (SSCP). DNA samples with SSCP-shifts or differing band patterns were sequenced. For the 6 common polymorphisms, genotyping was determined by polymerase chain reaction (PCR)-restriction fragment length polymorphism. Overall, 5 novel nonsynonymous mutations were identified, all of which were associated with low HDL-C. Of the 6 common ABCA1 polymorphisms, very high HDL-C was associated with a higher genotype frequency for R219K (P(trend) = 0.04) and higher genotype and allelic frequency for E1172D (P(trend) = 0.0004, P(trend) = 0.0002, respectively) compared with lower HDL-C. These data reaffirm that rare mutations in ABCA1 are associated with low HDL-C. However, at least 1 ABCA1 polymorphism (eg, E1172D) may contribute to the high HDL-C phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Carrier frequencies of common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K were also assessed. Login to comment
36 DNA was PCR amplified and digested using standard methods and the frequency of the 6 common polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K) in ABCA1, which was determined as described by Clee et al.8 Sequencing of PCR-amplified DNA. Login to comment
54 The prevalence of 6 common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K was also evaluated. Login to comment
57 Very high HDL-C was associated with a higher genotype frequency of R219K (RK and KK, 68.2%; Ptrend ϭ 0.04) although allele frequency was not materially different. Login to comment
58 Mild differences in allele frequency were also identified between the highest and lowest HDL-C groups for V771M (23% vs 10%; Ptrend ϭ 0.04) and I883M (36% vs 20%; Ptrend ϭ 0.05). Login to comment
77 Genotype and allele frequencies for 6 common ABCA1 polymorphisms in subgroups with HDL-C defined as very high (n ϭ 22), high (n ϭ 34), average (n ϭ 36), or low (n ϭ 32) R219K Genotype frequencies P value Allele frequencies P valueR/R R/K K/K R K Very high 31.8% 45.5% 22.7% 0.04 0.55 0.45 0.20 High 45.7% 51.4% 2.9% 0.71 0.29 Average 43.2% 56.8% 0.0% 0.72 0.28 Low 50.0% 40.0% 10.0% 0.70 0.30 V771M V/V V/M M/M V M Very high 59.0% 36.0% 4.5% 0.11 0.77 0.23 0.04 High 85.7% 14.3% 0.0% 0.93 0.07 Average 86.1% 13.9% 0.0% 0.93 0.07 Low 80.0% 20.0% 0.0% 0.90 0.10 V825I V/V V/I I/I V I Very high 77.3% 22.7% 0.0% 0.58 0.89 0.11 0.62 High 88.6% 11.4% 0.0% 0.94 0.06 Average 88.9% 11.1% 0.0% 0.94 0.06 Low 82.8% 17.2% 0.0% 0.92 0.08 I883M I/I I/M M/M I M Very high 40.9% 45.5% 13.6% 0.29 0.64 0.36 0.05 High 60.0% 34.3% 5.7% 0.78 0.22 Average 73.0% 24.3% 2.7% 0.85 0.15 Low 66.7% 26.7% 6.7% 0.80 0.20 E1172D E/E E/D D/D E D Very high 68.2% 31.8% 0.0% 0.0004 0.82 0.18 0.0002 High 94.3% 5.7% 0.0% 0.97 0.03 Average 94.6% 5.4% 0.0% 0.97 0.03 Low 100.00% 0.0% 0.0% 1.00 0.00 R1587K R/R R/K K/K R K Very high 31.8% 50.0% 18.2% 0.16 0.57 0.43 0.07 High 65.6% 25.0% 9.4% 0.78 0.22 Average 55.6% 41.7% 2.8% 0.76 0.24 Low 51.9% 33.3% 14.8% 0.69 0.31 of R219K may have a basis for reduced CVD risk as previously suggested.8-11,24 CONCLUSION The data extend previous findings that novel mutations in ABCA1 are associated with the low rather than the high HDL-C (FHA) phenotype. Login to comment
35 DNA was PCR amplified and digested using standard methods and the frequency of the 6 common polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K) in ABCA1, which was determined as described by Clee et al.8 Sequencing of PCR-amplified DNA. Login to comment
53 The prevalence of 6 common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K was also evaluated. Login to comment

[hide] A novel haplotype in ABCA1 gene effects plasma HDL... Int J Cardiol. 2007 Jan 31;115(1):7-13. Epub 2006 Jun 23. Saleheen D, Khanum S, Haider SR, Nazir A, Ahmad U, Khalid H, Hussain I, Shuja F, Shahid K, Habib A, Frossard PM
A novel haplotype in ABCA1 gene effects plasma HDL-C concentration.
Int J Cardiol. 2007 Jan 31;115(1):7-13. Epub 2006 Jun 23., [PMID:16806540]

Abstract [show]
BACKGROUND AND OBJECTIVES: ATP-binding cassette transporter 1 (ABCA1) is a trans-membrane protein responsible for the efflux of cholesterol and phospholipids across the cell membrane, an essential step in the reverse cholesterol transport system. This study investigates the effect of five non-synonymous SNPs of ABCA1 gene on plasma HDL-C levels in Pakistani individuals free of ischemic heart disease and stroke. METHODS: Five non-synonymous SNPs were selected after sequencing ABCA1 gene in patients of Hypoalphalipoproteinemia. The presence of these SNPs was then checked in 200 individuals by using PCR-RFLP. Plasma glucose and lipid fractions were measured in fasting state. Ethical approval was obtained from the Ethical Review Committee, Aga Khan University and informed consent was obtained from all subjects. RESULTS: LL genotype of V825L polymorphism was associated with decreased levels of HDL-C [-0.17 (-0.32 to -0.19); P=0.02] and P774 allele showed a significant increase in HDL-C levels as compared to T774 allele [-0.15 (-0.18 to -0.02); P=0.01]. R219K, A399V and V771M polymorphisms did not show any association with levels of HDL-C, LDL-C, cholesterol and triglycerides. Haplotype analysis between R219K and V825L polymorphisms showed a unique interaction between R219 allele and L825 allele. The RL haplotype was found to be associated with decreased levels of HDL-C [-0.12 (-0.22 to -0.03); P=0.001]. CONCLUSIONS: ABCA1 polymorphisms are associated with varying levels of HDL-C in Pakistani individuals. These results warrant further investigations as ABCA1 polymorphisms may have a major role in the high incidence of cardiovascular disorders in South Asians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 R219K, A399V and V771M polymorphisms did not show any association with levels of HDL-C, LDL-C, cholesterol and triglycerides. Login to comment
50 Subjects were classified as having diabetes mellitus if he or she already Table 1 Methods for restriction fragment length polymorphism for screening of ABCA1 SNPs Variant Forward oligo (5VY3V), reverse oligo (5VY3V) Annealing temperature Enzyme Product (bp), wild-type allele, variant allele R219K (G1051A) ''aaagacttcaaggacccagctt``, ''cctcacattccgaaagcatta`` 62.5 -C EcoNI 309, 184, 125 V399A (T1591C) ''ctcattgtctgtgcttctcctc``, ''gtgaccagaaactcacctctcc`` 64.0 -C HphI 117, 71, 48, 188, 48 V771M (G2706A) ''tacaagtgagtgcttgggattg``, ''cccattggaaaagacaatcatc`` 60.0 -C BsaAI 254, 137, 391 V825L (G2868A) ''ttctgcaccttatgattgatcc``, ''agcacaaagaaaggacatcagc`` 62.5 -C BsaI 265, 127, 392 Polymerase chain reaction (PCR) was carried out using a Perkin Elmer GeneAmp PCR system 2400 (Perkin Elmer Corp., Applied Biosystems Division, USA). Login to comment
77 R219K, V399A and V771M polymorphisms did not show any association with levels of HDL-C, LDL-C, cholesterol and triglycerides. Login to comment
80 R219K, V399A and T774P polymorphisms followed the HWE however V825L and V771M showed a departure from HWE. Login to comment
82 Linkage disequilibrium and haplotype analysis R219K polymorphism was in significant linkage disequilibrium (LD) with V825L and V771M (DV=0.50; P-value<10À3 ). Login to comment
87 D. Saleheen et al. / International Journal of Cardiology 115 (2007) 7-13 9 polymorphism was in complete linkage equilibrium with T774P, V825L and V771M polymorphisms. Login to comment
97 South Asian populations (from Pakistan, India, Bangladesh and Sri Lanka) represent a quarter of the developing world and harbor thirty percent of the global Table 4 Haplotype association analysis of the ABCA1 gene polymorphisms in relation with the HDL-C levels Haplotype Haplotype frequencies Haplotypic additive effects [95% CI] P-value R219K RV 0.47 + V825L RL 0.18 À0.12 [À0.22 to À0.03] 0.001 KV 0.28 À0.04 [À0.10 to 0.01] 0.15 KL 0.06 0.08 [À0.06 to 0.22] 0.25 T774P TV 0.21 0.03 [À0.05 to 0.12] 0.41 V825L TL 0.09 0.10 [À0.06 to 0.27] 0.22 PV 0.47 + PL 0.21 0;0.06 [À0.14 to 0.02] 0.15 R219K RM 0.55 + V771M RV 0.07 À0.13 [À0.45 to 0.19] 0.41 KM 0.34 À0.02 [À0.09 to 0.05] 0.54 KV 0.04 0.07 [À0.12 to 0.27] 0.46 Table 3 Mean HDL-C levels (S.D.) for the genotypes and alleles of the studied polymorphisms Frequencies HDL-C (S.D.) b (95% CI) P-value R219K RR 39.8 1.06 (0.30) À0.02 (À0.16 to 0.13) 0.85 RK 46.0 1.10 (0.28) 0.00 (À0.14 to 0.14) 0.99 KK 14.3 1.10 (0.31) + R 62.7 1.08 (0.26) 0.01 (À0.05 to 0.07) 0.79 K 37.3 1.09 (0.31) V399A AA 6.0 1.01 (0.23) À0.03 (À0.24 to 0.16) 0.70 AV 34.7 1.11 (0.28) 0.10 (À0.04 to 0.16) 0.22 VV 59.3 1.04 (0.31) + A 23.3 1.09 (0.28) À0.03 (À0.10 to 0.05) 0.58 V 76.7 1.04 (0.31) T774P PP 9.6 1.10 (0.31) 0.20 (0.01 to 0.40) 0.03 PT 37.5 1.03 (0.32) 0.13 (À0.03 to 0.20) 0.14 TT 52.9 0.97 (0.28) + P 28.4 1.05 (0.32) À0.15 (À0.18 to À0.02) 0.01 T 71.6 0.99 (0.29) V771M MM 6.1 1.09 (0.30) 0.01 (À0.24 to 0.25) VM 10.1 0.98 (0.24) À0.07 (À0.27 to 0.12) 0.46 VV 83.8 1.07 (0.29) + 0.94 M 11.1 1.04 (0.27) 0.03 (À0.10 to 0.15) 0.71 V 88.9 1.07 (0.29) V825L LL 9.8 0.89 (0.299) À0.17 (À0.32 to À0.19) 0.02 LV 32.8 1.06 (0.265) À0.03 (À0.11 to 0.076) 0.70 VV 57.5 1.07 (0.30) + L 26.1 1.07 (0.29) 0.10 (À0.00 to .13) 0.05 V 73.9 1.00 (0.28) P-values are adjusted for age and gender. Login to comment
115 Similarly, a lack of association of V399A and V771M polymorphisms is consistent with the published literature [28]. Login to comment

[hide] Variations on a gene: rare and common variants in ... Annu Rev Nutr. 2006;26:105-29. Brunham LR, Singaraja RR, Hayden MR
Variations on a gene: rare and common variants in ABCA1 and their impact on HDL cholesterol levels and atherosclerosis.
Annu Rev Nutr. 2006;26:105-29., [PMID:16704350]

Abstract [show]
Cholesterol and its metabolites play a variety of essential roles in living systems. Virtually all animal cells require cholesterol, which they acquire through synthesis or uptake, but only the liver can degrade cholesterol. The ABCA1 gene product regulates the rate-controlling step in the removal of cellular cholesterol: the efflux of cellular cholesterol and phospholipids to an apolipoprotein acceptor. Mutations in ABCA1, as seen in Tangier disease, result in accumulation of cellular cholesterol, reduced plasma high-density lipoprotein cholesterol, and increased risk for coronary artery disease. To date, more than 100 coding variants have been identified in ABCA1, and these variants result in a broad spectrum of biochemical and clinical phenotypes. Here we review genetic variation in ABCA1 and its critical role in cholesterol metabolism and atherosclerosis in the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
605 Many of these variants have been studied in relationship to their association with HDL cholesterol levels and atherosclerosis (11, 15, 22, 27, 28, 38, TABLE 4 Nonsynonymous single-nucleotide polymorphisms (SNPs) in ABCA1 SNP id Nucleotidea Amino acidb Observed heterozygosity rs2230806 G969A R219K 0.488 rs9282541 C1001T R230C 0.029 rs9282543 T1509C V399A 0.020 rs4131108 A1556C M415L - rs13306068 A1949G I546V - rs2066718 G2624A V771M 0.074 rs2472458 G2804A D831N - rs4149313 A2962G I883M - rs2482437 C3326T E1005K - rs13306072 G3473A V1054I - rs13306073 G3599A V1096I - rs1997618 T4977C I1555T - rs2230808 A5073G K1587R 0.480 rs1883024 T5256C L1648P - - C5505G S1731C - a Nucleotide position is with respect to NM 005502. b Amino acid position is with respect to NP 005493. Login to comment
612 The V825I and V771M SNPs were associated with increased HDL cholesterol in one, but not both, genders. Login to comment

[hide] Decreased frequencies of ABCA1 polymorphisms R219K... Cerebrovasc Dis. 2006;21(4):254-9. Epub 2006 Jan 27. Andrikovics H, Pongracz E, Kalina E, Szilvasi A, Aslanidis C, Schmitz G, Tordai A
Decreased frequencies of ABCA1 polymorphisms R219K and V771M in Hungarian patients with cerebrovascular and cardiovascular diseases.
Cerebrovasc Dis. 2006;21(4):254-9. Epub 2006 Jan 27., [PMID:16446539]

Abstract [show]
BACKGROUND AND PURPOSE: Genetic polymorphisms in ABC transporter A1 (ABCA1) may alter the regulation of plasma high-density lipoprotein (HDL), promoting or protecting from vascular diseases. METHODS: We investigated 244 unrelated, consecutively enrolled patients with ischemic stroke, 150 patients with coronary heart disease (CHD) and 193 blood donors for allele frequencies (AFs) of three common ABCA1 polymorphisms (R219K, V771M and I883M). RESULTS: Compared to controls (30.8 +/- 4.7 and 4.9 +/- 2.2%, respectively), decreased AFs were found in both patient groups for R219K and V771M (28.7 +/- 4.1 and 3.1 +/- 1.6% in stroke, and 25.7 +/- 5.0%; 1.3 +/- 1.3% in CHD patients, respectively). In a subset of stroke patients younger than 50, both variants occurred in significantly lower frequencies (22.4 +/- 5.5 and 1.8 +/- 1.7%, respectively). Similarly, among CHD patients younger than 60, AFs of R219K and V771M (22.6 +/- 7.5 and 0 +/- 1.6%, respectively) were decreased. V771M was almost exclusively (35/36) found in individuals carrying the R219K allele. CONCLUSIONS: Our data confirm earlier observations that ABCA1 R219K and V771M polymorphisms may be associated with a protective role against CHD and extend those to another important pathologic condition, namely stroke.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Fax +41 61 306 12 34 E-Mail karger@karger.ch www.karger.com Original Paper Cerebrovasc Dis 2006;21:254-259 DOI: 10.1159/000091223 Decreased Frequencies of ABCA1 Polymorphisms R219K and V771M in Hungarian Patients with Cerebrovascular and Cardiovascular Diseases Hajnalka Andrikovicsa Endre Pongráczb Ákos Kalinac Anikó Szilvásia Charalampos Aslanidisd Gerd Schmitzd Attila Tordaia a Department of Molecular Genetics, National Medical Center, b Neurology Department, Central Hospital, Ministry of Interior, and c Hospital of the National Railways, Budapest, Hungary; d Institute for Clinical Chemistry and Laboratory Medicine, University of Regensburg, Germany and 0 8 1.6%, respectively) were decreased. Login to comment
1 V771M was almost exclusively (35/36) found in individuals carrying the R219K allele. Login to comment
2 Conclusions: Our data confirm earlier observations that ABCA1 R219K and V771M polymorphisms may be associated with a protective role against CHD and extend those to another important pathologic condition, namely stroke. Login to comment
7 Methods: We investigated 244 unrelated, consecutively enrolled patients with ischemic stroke, 150 patients with coronary heart disease (CHD) and 193 blood donors for allele frequencies (AFs) of three common ABCA1 polymorphisms (R219K, V771M and I883M). Login to comment
8 Results: Compared to controls (30.8 8 4.7 and 4.9 8 2.2%, respectively), decreased AFs were found in both patient groups for R219K and V771M (28.7 8 4.1 and 3.1 8 1.6% in stroke, and 25.7 8 5.0%; 1.3 8 1.3% in CHD patients, respectively). Login to comment
10 Similarly, among CHD patients younger than 60, AFs of R219K and V771M (22.6 8 7.5 Received: July 25, 2005 Accepted: October 12, 2005 Published online: January 27, 2006 Attila Tordai Department of Molecular Genetics National Medical Center, Diószegi út 64 HU-1113 Budapest (Hungary) Tel./Fax +36 1 385 2255, E-Mail tordai@biomembrane.hu (c) 2006 S. Karger AG, Basel 1015-9770/06/0214-$23.50/0 Accessible online at: www.karger.com/ced To date, the ABCA1 gene proved to be highly polymorphic with large numbers of sequence variations leading to amino acid changes or affecting the putative promoter region [8] (see also http://www.abca1 mutants.all.at). Login to comment
28 DNA Isolation and Detection of ABCA1 R219K, V771M and I883M Alleles with LightCycler Hybridization Probe Technique DNA isolation was performed from anticoagulated peripheral blood with the standard 'salting-out` procedure. Login to comment
29 The following ABCA1sequencevariantswerestudied:R219K(exon7,c.969A]G, substitution of Arg219 by Lys); V771M (exon 16, c.2624G]A, substitution of Val771 by Met), and I883M (exon 18, c.2962A]G, substitution of Ile883 by Met). Login to comment
53 2006;21:254-259256 Results Genotyping for R219K, V771M and I883M ABCA1 Allelic Variants Using genomic DNA samples, simultaneous genotyping was carried out in the control blood donor and the stroke- and CHD-affected patient groups by PCR and fluorescent allelic discrimination techniques. Login to comment
55 In the control group, AF figures (30.8 8 4.7, 4.9 8 2.2 and 12.4 8 4.5%) were found in the expected range for R219K, V771M and I883M, respectively. Login to comment
56 Decreased AFs were found in both patient groups for R219K and V771M variants (28.9 8 4.1 and 3.3 8 1.6% in stroke, and 25.7 8 5.0% and 1.3 8 1.3% in CHD, respectively). Login to comment
57 In the CHD group, the decrease in V771M AF was significant (p = 0.009) by univariate analyses. Login to comment
59 In a subset of stroke patients with disease onset before 50 (n = 114), both variants occurred in significantly lower frequencies compared to the control group [R219K: 22.4 8 5.5%, p = 0.013, crude OR = 0.55 (0.34-0.88); V771M: 1.8 8 1.7%, p = 0.045, crude OR = 0.33 (0.111.00)]. Login to comment
60 A similar tendency was observed in the CHD group in a subset of patients younger than 60 (n = 62) for R219K and V771M, but only the V771M AF decrease was significant [22.6 8 3.6%, p 1 0.05; and 0 8 1.6%, p = 0.005, crude OR = 0.07 (0.004-1.2)]. Login to comment
62 Figure 1 further illustrates the tendency of R219K and V771M AF decreases following stratification of the patient groups by age at onset. Login to comment
63 Multivariate analyses (logistic regression) also showed that the R219K and V771M variants are protective factors against stroke, independently from age and sex [R219K: p = 0.032, adjusted OR: 0.68 (0.48-0.97); V771M: p = 0.017, adjusted OR: 0.34 (0.14-0.82)]. Login to comment
64 In the CHD group, only V771M proved to be a significant independent protective factor [p = 0.027, adjusted OR: 0.08 (0.01-0.75), table 1]. Login to comment
66 Similarly to results of the entire stroke group, R219K AF reduction was 27.4 8 4.9%, p = 0.015, adjusted OR: 0.59 (0.39-0.91), and V771M AF reduction was 3.3 8 2.0%, p = 0.042, adjusted OR: 0.36 (0.13-0.97) compared to control. Login to comment
67 We also observed significant R219K and V771M AF reduction in patients with CT-proven ischemic stroke [n = 124; R219K: 24.6 8 5.5%, p = 0.049, adjusted OR: 0.64 (0.41-0.99), and V771M: 1.2 8 1.4%, p = 0.021, adjusted OR: 0.19 (0.05-0.78)] compared to control. Login to comment
70 Genotyping results and statistical analyses for three common ABCA1 polymorphisms (R219K, V771M and I883M) in the control and patient groups Polymorphism AF % (895% CI) Heterozygous individuals n (%) Homozygous individuals n (%) p value Adjusted OR (95% CI) R219K Controls (n = 193) 30.8 (4.7) 73 (37.8) 23 (11.9) Patients with stroke (n = 244) 28.9 (4.1) 84 (34.1) 29 (11.8) 0.032 0.68 (0.48-0.97) Patients with CHD (n = 150) 25.7 (5.0) 55 (36.7) 11 (7.3) NS NS V771M Controls (n = 193) 4.9 (2.2) 19 (9.8) 0 Patients with stroke (n = 244) 3.3 (1.6) 14 (5.7) 1 (0.4) 0.017 0.34 (0.14-0.82) Patients with CHD (n = 150) 1.3 (1.3) 4 (2.7) 0 0.027 0.08 (0.01-0.75) I883M Controls (n = 105) 12.4 (4.5) 24 (22.9) 1 (1.0) Patients with stroke (n = 244) 15.2 (3.2) 61 (24.8) 7 (2.9) NS NS Patients with CHD (n = 150) 12.3 (3.8) 29 (19.3) 4 (2.6) NS NS AF = Allele frequency; CI = confidence interval; NS = nonsignificant. Login to comment
72 showed that R219K and V771M variants also play a protective role against stroke independently from age and sex in the stroke patient subgroup without ischemic heart disease [R219K: p = 0.040, adjusted OR: 0.69 (0.48-0.98), and V771M: p = 0.034, adjusted OR: 0.39 (0.16-0.93)]. Login to comment
73 These results indicate that the protective role of R219K and V771M in the stroke group cannot be explained with the frequent coexistence of CHD. Login to comment
78 We observed lower R219K and V771M AFs in the low-risk group (R219K: 27.4 8 5.2 vs. 30.6 8 6.6%, and V771M: 2.1 8 1.7 vs. 4.6 8 3.0%, respectively), but the differences were not significant. Login to comment
84 The V771M allele was almost exclusively found in individuals carrying the R219K allele (36/37 V771M carriers were positive for R219K). Login to comment
86 0.0005 by the Arlequin software) was observed between V771M and R219K. Login to comment
92 No significant linkage disequilibrium was observed between V771M and I883M. Login to comment
94 Comparisons of AFs of the ABCA1 R219K and V771M variants in the control and patient groups. Login to comment
96 AF values and 95% CIs (bars) are presented for the R219K (a) and V771M (b) variants. Login to comment
103 However, V771M carriers of the stroke group (n = 9) had higher plasma HDL levels than non-carriers [n = 104; 1.00 (0.90-1.30) vs. 1.60 (1.05-1.80) mM; p = 0.053]. Login to comment
116 Although we could only demonstrate significant AF decreases for the V771M variant comparing the entire CHD-affected group to the blood donor group, a trend toward an AF decrease could be demonstrated for both SNPs in both patient groups. Login to comment
119 However, upon subgroup analyses, among patients affected by both diseases with younger ages at onset, both variants R219K and V771M showed significantly decreased AFs (fig. 1). Login to comment
120 Clee et al. [9] reported that the ABCA1 V771M variant also plays a protective role against CHD. Login to comment
121 They explained this observation with the linkage disequilibrium between the R219K and V771M variants. Login to comment
122 In our study, the V771M variant, or compound heterozygosity for V771M and R219K, showed significant AF reduction in the patient groups, in spite of the fact that our controls were relatively younger than our patients with stroke or CHD. Login to comment
128 Our data confirm earlier observations that ABCA1 R219K and V771M polymorphisms may play a protective role against CHD and extend those to another frequently occurring pathologic condition, namely stroke. Login to comment

[hide] Quantitative trait loci in ABCA1 modify cerebrospi... J Hum Genet. 2006;51(3):171-9. Epub 2005 Dec 22. Katzov H, Bennet AM, Hoglund K, Wiman B, Lutjohann D, Brookes AJ, Andreasen N, Blennow K, De Faire U, Prince JA
Quantitative trait loci in ABCA1 modify cerebrospinal fluid amyloid-beta 1-42 and plasma apolipoprotein levels.
J Hum Genet. 2006;51(3):171-9. Epub 2005 Dec 22., [PMID:16372134]

Abstract [show]
The ATP-binding cassette transporter A1 encoded by ABCA1 plays an integral role in the efflux of cellular cholesterol and phospholipids, but may also be a central mediator of beta-amyloid (Abeta) processing. Here, genetic association of the common R219K variant of ABCA1 is shown with cerebrospinal fluid (CSF) Abeta 1-42 levels, reinforcing emerging evidence of a connection between lipid and Abeta metabolism. In support of this finding we demonstrate for the first time that CSF cholesterol and Abeta 1-42 are correlated. To affirm the plausible impact of ABCA1 variation on cholesterol and related traits as well as to empower a survey of possible interactions (e.g. age, gender, and smoking), a large Swedish population consisting of over 2,700 individuals was enlisted and extensive measures of plasma lipid parameters carried out. These analyses revealed that R219K has a strong effect on apolipoprotein B (APOB) and LDL-cholesterol (LDL-C) among smokers (P = 0.000055 and P = 0.00059, respectively), but not among non-smokers. In contrast, no effect was evident with apolipoprotein A (APOA1) or HDL-cholesterol (HDL-C) levels. Plasma APOB and LDL-C, but not APOA1 and HDL-C, were shown to be markedly elevated in smokers versus non-smokers, affirming that smoking may selectively impact the former pathway. No other genetic markers in ABCA1 exhibit effects as large as R219K, although a modest independent effect of R1587K was observed. Our data illuminate a possible genetic link between Abeta and cholesterol metabolism, but also provide an intriguing example of an environmental exposure that may modify a genotype-phenotype relationship.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 The number of individuals in each category is shown in parenthesis. Comparisons were performed by ANOVATC total cholesterol, LDL-C low density lipoprotein cholesterol Traits KK RK RR F value P value APOA1a (g/l) 1.46±0.02 (157) 1.48±0.01 (966) 1.47±0.01 (1,439) 0.23 0.79 APOB (g/l) 1.64±0.03 (157) 1.53±0.01 (966) 1.55±0.01 (1,439) 5.4 0.0046 HDL-C (mmol/l) 1.16±0.26 (156) 1.20±0.01 (961) 1.20±0.01 (1,427) 1.1 0.34 LDL-C (mmol/l) 4.26±0.86 (154) 4.08±0.03 (951) 4.05±0.03 (1,415) 0.26 0.038 TC (mmol/l) 6.24±0.09 (157) 6.04±0.04 (969) 6.01±0.03 (1,439) 3.02 0.049 TGa (mmol/l) 1.87±0.11 (157) 1.71±0.04 (969) 1.72±0.03 (1,441) 1.38 0.25 a Log-transformed traits k.embl-heidelberg.de/PolyPhen/) (Ramensky et al. 2002) for five coding SNPs (cSNPs) in ABCA1 (R219K rs2230806; V771M rs2066718; V825I rs4149312; I883M rs2066714; R1587K rs2230808) (Frikke-Schmidt et al. 2004). Login to comment
129 The number of individuals in each category is shown in parenthesis. Comparisons were performed by ANOVATC total cholesterol, LDL-C low density lipoprotein cholesterol Traits KK RK RR F value P value APOA1a (g/l) 1.46&#b1;0.02 (157) 1.48&#b1;0.01 (966) 1.47&#b1;0.01 (1,439) 0.23 0.79 APOB (g/l) 1.64&#b1;0.03 (157) 1.53&#b1;0.01 (966) 1.55&#b1;0.01 (1,439) 5.4 0.0046 HDL-C (mmol/l) 1.16&#b1;0.26 (156) 1.20&#b1;0.01 (961) 1.20&#b1;0.01 (1,427) 1.1 0.34 LDL-C (mmol/l) 4.26&#b1;0.86 (154) 4.08&#b1;0.03 (951) 4.05&#b1;0.03 (1,415) 0.26 0.038 TC (mmol/l) 6.24&#b1;0.09 (157) 6.04&#b1;0.04 (969) 6.01&#b1;0.03 (1,439) 3.02 0.049 TGa (mmol/l) 1.87&#b1;0.11 (157) 1.71&#b1;0.04 (969) 1.72&#b1;0.03 (1,441) 1.38 0.25 a Log-transformed traits k.embl-heidelberg.de/PolyPhen/) (Ramensky et al. 2002) for five coding SNPs (cSNPs) in ABCA1 (R219K rs2230806; V771M rs2066718; V825I rs4149312; I883M rs2066714; R1587K rs2230808) (Frikke-Schmidt et al. 2004). Login to comment

[hide] The absence of ABCA1 decreases soluble ApoE levels... J Biol Chem. 2005 Dec 30;280(52):43243-56. Epub 2005 Oct 5. Hirsch-Reinshagen V, Maia LF, Burgess BL, Blain JF, Naus KE, McIsaac SA, Parkinson PF, Chan JY, Tansley GH, Hayden MR, Poirier J, Van Nostrand W, Wellington CL
The absence of ABCA1 decreases soluble ApoE levels but does not diminish amyloid deposition in two murine models of Alzheimer disease.
J Biol Chem. 2005 Dec 30;280(52):43243-56. Epub 2005 Oct 5., [PMID:16207707]

Abstract [show]
ABCA1, a cholesterol transporter expressed in the brain, has been shown recently to be required to maintain normal apoE levels and lipidation in the central nervous system. In addition, ABCA1 has been reported to modulate beta-amyloid (Abeta) production in vitro. These observations raise the possibility that ABCA1 may play a role in the pathogenesis of Alzheimer disease. Here we report that the deficiency of ABCA1 does not affect soluble or guanidine-extractable Abeta levels in Tg-SwDI/B or amyloid precursor protein/presenilin 1 (APP/PS1) mice, but rather is associated with a dramatic reduction in soluble apoE levels in brain. Although this reduction in apoE was expected to reduce the amyloid burden in vivo, we observed that the parenchymal and vascular amyloid load was increased in Tg-SwDI/B animals and was not diminished in APP/PS1 mice. Furthermore, we observed an increase in the proportion of apoE retained in the insoluble fraction, particularly in the APP/PS1 model. These data suggested that ABCA1-mediated effects on apoE levels and lipidation influenced amyloidogenesis in vivo.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
336 Katzov et al. (75) reported significant associations with the R219K, R1587K, and V771M on AD in single marker and haplotype analyses conducted on European subjects. Login to comment
337 Katzov et al. (75) reported significant associations with the R219K, R1587K, and V771M on AD in single marker and haplotype analyses conducted on European subjects. Login to comment

[hide] Common polymorphisms of ATP binding cassette trans... Atherosclerosis. 2005 Dec;183(2):199-212. Epub 2005 Jun 2. Hodoglugil U, Williamson DW, Huang Y, Mahley RW
Common polymorphisms of ATP binding cassette transporter A1, including a functional promoter polymorphism, associated with plasma high density lipoprotein cholesterol levels in Turks.
Atherosclerosis. 2005 Dec;183(2):199-212. Epub 2005 Jun 2., [PMID:15935359]

Abstract [show]
The role of high levels of high density lipoprotein cholesterol (HDL-C) in protection against development of atherosclerosis is generally attributed to its role in reverse cholesterol transport, and the ATP binding cassette transporter A1 (ABCA1) is a key element of this process. We examined polymorphisms in ABCA1 in Turks, a population characterized by very low HDL-C levels. We discovered 36 variations in ABCA1 and genotyped informative polymorphisms in over 2,300 subjects. The rare alleles of C-14T and V771M polymorphisms were associated with higher HDL-C levels in men and, in combination with the rare alleles of R219K and I883M, respectively, with higher HDL-C in both sexes. Rare alleles of the C-14T and V771M polymorphisms were more frequent in the high HDL-C (>OR=40mg/dl) than in the low HDL-C group (<OR=30mg/dl) in men (P<0.05). Moreover, the T allele of C-14T had more in vitro transcriptional activity than the C allele (20-88%), depending on the cell line (P<0.05), suggesting its functionality. Haplotype construction and haplotype association with phenotype were performed in the promoter and coding region of ABCA1 separately. Analysis of the promoter haplotype block supported the association with the C-14T polymorphism. The C-14T and R219K polymorphisms were on different haplotype blocks. Analysis of the coding region structure revealed that the rare M allele of V771M was distributed predominantly among three common haplotypes, but the sum of their frequencies comprise only two-thirds of the frequency of the M allele. The rare alleles of the V771M and the I883M polymorphisms do not exist together on any of the common haplotypes. In conclusion, we describe a functional promoter polymorphism (C-14T) and a coding sequence variant (V771M) of ABCA1 and their interactions with two other variants (R219K and I883M) on plasma HDL-C levels in Turks.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 The rare alleles of C-14T and V771M polymorphisms were associated with higher HDL-C levels in men and, in combination with the rare alleles of R219K and I883M, respectively, with higher HDL-C in both sexes. Login to comment
4 Rare alleles of the C-14T and V771M polymorphisms were more frequent in the high HDL-C (≥40 mg/dl) than in the low HDL-C group (≤30 mg/dl) in men (P < 0.05). Login to comment
9 Analysis of the coding region structure revealed that the rare M allele of V771M was distributed predominantly among three common haplotypes, but the sum of their frequencies comprise only two-thirds of the frequency of the M allele. Login to comment
10 The rare alleles of the V771M and the I883M polymorphisms do not exist together on any of the common haplotypes. Login to comment
11 In conclusion, we describe a functional promoter polymorphism (C-14T) and a coding sequence variant (V771M) of ABCA1 and their interactions with two other variants (R219K and I883M) on plasma HDL-C levels in Turks. Login to comment
24 Recently, it was shown that some polymorphisms of ABCA1 were associated with increases (V771M and V825I) or decreases (R1587K) in HDL-C in women and with some consistent trends in men in a large random Danish population [17]. Login to comment
104 The G-803A Table 2 ABCA1 polymorphisms Nucleotide changea Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in 5 and promoter regions G-803A ~10 92/141 [19] T-564C 72.7 47.7 728/1268 [18] G-407C 62.5 40.7 220/233 [18] G-99C 42.2 24.2 875/1130 [46] C-14T 61.2 37.7 916/1416 [46] InsG 319 26.6 14.2 848/1288 [46] Nucleotide changed Amino acid change Exon Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in coding sequence Nonsynonymous G(70943)A R219K 7 62.3 38.5 996/1466 db 2230806 G(102555)A V771M 16 10.0 5.1 981/1477 db 2066718 G(103777)A V825I 17 12.3 6.2 960/1145 db 4149312 A(105057)G I883M 18 38.1 21.8 1084/1448 db 4149313 G(112177)C E1172D 24 9.0 4.6 1001/1237 [12,13] A(116887)G Q1328R 28 0.003e 0.0015 172/156 NR G(129004)A R1587K 35 55.1 33.0 937/1351 db 2230808 T(133402)C Y1767H 39 ~1.0e 40/55 NR G(133420)A V1773M 39 ~1.0e 40/55 NR Synonymous C(100538)A I620I 15 ~4.0 40/55 NR C(109469)T V990V 21 ~3.0 87/90 [17] T(109861)G V1053V 22 ~1.0 90/90 [12] C(109868)T L1056L 22 ~5.0 90/90 NR C(109906)T R1068R 22 ~3.0 90/90 NR A(113280)G E1211E 25 ~4.0 40/55 [17] A(116879)G T1325T 28 ~1.0 40/55 NR T(137043)C Y1921Y 43 ~1.0 40/55 NR Nucleotide changed Intron Carrier of rare allele (%) Intronic location nb Referencesc Frequency in noncoding sequence G(23816)A 1 ~1.0 11 bp 5 exon 1b 94 NR G(23819)C 1 42 8 bp 5 exon 1b 94 NR A(22997)T 1 46 90 bp 5 exon 1d 91 NR A(23004)G 1 ~1.0 83 bp 5 exon 1d 91 NR G(23058)C 1 46 29 bp 5 exon 1d 91 NR G(40504)A 3 2.6 26 bp 3 of exon 3 192 NR C(45217)T 4 0.7 64 bp 3 of exon 4 142 NR T(98628)A 14 35-40 24 bp 3 of exon 14 190 db 4743763 C(100332)T 14 4.3 59 bp 5 of exon 15 90 db 2066717 C(108020)T 19 0.7 3 bp 5 of exon 20 144 NR DelTTT(134503-6) 39 7.0 20-23 bp 5 of exon 40 90 NR C(142026)T 46 8.6 34 bp 5 of exon 47 116 NR A(142751)G 48 15.9 13 bp 3 of exon 48 107 NR a Relative to transcriptional start. Login to comment
109 Table 3 ABCA1 polymorphisms and mean plasma HDL-C levels (mg/dl ± S.D.) in a random Turkish population Females Males AAa AB BB AAa AB BB Promoter and 5 region T-564C 40.4 ± 8.4 (205) 41.0 ± 7.9 (365) 39.9 ± 7.6 (158) 35.6 ± 7.4 (339) 35.5 ± 6.5 (635) 34.9 ± 6.5 (294) G-407C 41.3 ± 11.2 (82) 40.7 ± 7.7 (101) 40.7 ± 12.2 (37) 35.7 ± 6.9 (88) 35.3 ± 6.7 (96) 35.4 ± 7.4 (49) G-99C 40.7 ± 7.5 (505) 41.0 ± 7.2 (317) 41.3 ± 8.4 (53) 35.1 ± 6.5 (654) 35.0 ± 6.3 (405) 34.9 ± 6.5 (71) C-14T 41.3 ± 9.0 (361) 41.0 ± 9.0 (417) 41.0 ± 9.4 (138) 34.8 ± 7.0b (547) 35.5 ± 7.5 (675) 36.7 ± 8.1b (194) InsG 319 41.3 ± 8.1 (641) 40.5 ± 7.7 (193) 43.1 ± 8.0 (14) 35.3 ± 6.4 (933) 34.7 ± 6.4 (332) 34.5 ± 6.5 (23) Nonsynonymous R219K 41.2 ± 9.4 (364) 40.8 ± 8.6 (480) 41.2 ± 10 (152) 35.2 ± 7.3 (574) 35.3 ± 7.3 (688) 35.2 ± 7.6 (204) V771M 40.9 ± 9.2 (896) 42.8 ± 9.3 (82) 38.7 ± 10 (3) 35.1 ± 7.2c (1330) 37.1 ± 8.0c (144) 45.7 ± 10.7 (3) V825I 40.6 ± 9.4 (842) 38.9 ± 8.5 (117) 42 (1) 35.8 ± 8.7 (1005) 37.1 ± 9.5 (140) (-) I883M 41.1 ± 9.5 (643) 40.8 ± 8.4 (372) 41.4 ± 9.1 (69) 35.0 ± 7.0 (922) 35.7 ± 8.0 (457) 35.6 ± 7.4 (69) E1172D 40.5 ± 8.8 (907) 40.5 ± 7.6 (93) 29 (1) 34.6 ± 7.3 (1129) 35.4 ± 7.6 (105) 30.7 ± 8.7 (3) R1587K 41.1 ± 9.4 (410) 40.8 ± 9.6 (433) 41.0 ± 10.1 (94) 35.9 ± 8.1 (617) 35.1 ± 7.6 (579) 35.3 ± 8.6 (155) Numbers of subjects are shown in parenthesis. Login to comment
116 Informative associations between HDL-C levels and the R219K, V771M, and I883M polymorphisms will be discussed. Login to comment
149 Of these, only the V771M polymorphism appeared to be associated with altered HDL-C levels in males (Table 3). Login to comment
150 Since the V771M polymorphism was present in the Turkish population with an allelic frequency of 5.1% (n = 2458), the rare 771MM homozygous genotype (BB) occurred infrequently (three males and three females). Login to comment
152 Analysis of covariance revealed that the V771M polymorphism was primarily associated with plasma HDL-C, not with triglycerides, in Turkish males (P < 0.05). Login to comment
154 The V771M polymorphism had no significant effect on HDL-C levels in females (Table 3). Login to comment
155 Further stratification of the V771M polymorphism by age, BMI, smoking, alcohol consumption, and apoE genotype yielded no additional information. Login to comment
156 The association of the V771M polymorphism with HDL-C levels was confirmed in the randomly divided subpopulations of Turkish males (Supplemental Table II). Login to comment
163 Genotypic (left) and allelic (right) frequencies of the ABCA1 V771M polymorphism in males with low (≤30 mg/dl), moderate (30-40 mg/dl), or high (≥40 mg/dl) levels of HDL-C. Login to comment
170 In contrast, the combinations of C-14T with R219K and of V771M with I883M were associated with altered HDL-C levels. Login to comment
177 To assess the combined effect of the V771M and I883M polymorphisms on HDL-C levels, subjects were stratified by the I883M genotype (II, IM, or MM) versus V771M. Login to comment
181 Separate haplotype blocks of ABCA1 In order to assess whether the length of the ABCA1 locus could be treated as a single haplotype block, haplotypes were constructed and significant LDs between polymorphisms were calculated using 10 common ABCA1 polymorphisms Table 4 Interactive effects of ABCA1 polymorphisms on mean plasma HDL-C levels (mg/dl ± S.D.) R219K C-14T Females Males RR CC 41.4 ± 8.5 (128) 34.7 ± 6.7 (207) CT 41.6 ± 9.8 (150) 35.7 ± 7.6 (253) TT 41.3 ± 8.9 (55) 36.3 ± 7.8 (84) RK CC 41.8 ± 8.3 (169) 34.8 ± 7.4 (261) CT 39.9 ± 8.3 (203) 35.5 ± 6.8 (309) TT 39.5 ± 9.0 (60) 36.8 ± 8.5 (84) KK CC 39.8 ± 11.2 (60) 34.0 ± 6.2 (69) CT 41.1 ± 9.0 (60) 35.7 ± 8.4 (102) TT 44.7 ± 9.8a (22) 37.1 ± 7.8a (22) I883M V771M II VV 40.9 ± 9.8 (499) 34.8 ± 6.8 (797) VM 41.4 ± 8.3 (74) 36.7 ± 8.3b (112) IM VV 40.3 ± 8.0 (313) 35.1 ± 8.1 (427) VM 44.2 ± 11.5b (17) 37.3 ± 7.4b (26) MM VV 41.6 ± 9.2 (60) 35.6 ± 7.5 (67) Numbers of subjects are shown in parenthesis. Login to comment
190 Many of the rare single nucleotide polymorphisms, such as V771M, were not well represented on the 26 common haplotypes and therefore existed only on the remaining rare haplotypes. Login to comment
204 However, further analysis Table 5 Allele frequency and significant (P < 0.01) pair-wise linkage disequilibrium coefficients between the ABCA1 polymorphisms in a random Turkish population Position Allele % T-564C G-99C C-14T InsG 319 R219K V771M V825I I883M E1172D R1587K T-564C 52.3/47.7 - G-99C 75.8/24.2 0.36 - C-14T 62.3/37.7 -0.96 -0.98 - InsG 319 85.8/14.2 - - - - R219K 61.5/38.5 - - - - V771M 94.9/5.1 - - - 0.99 - V825I 93.8/6.2 -0.40 -0.69 - - -0.76 - - I883M 78.2/21.8 - -0.42 - - 0.20 -0.79 0.91 - E1172D 95.4/4.6 - - - - - 0.34 - - - R1587K 67.0/33.0 - - -0.23 - - 0.56 - - 0.87 - Table 6 Common haplotypes of promoter and coding regions of ABCA1 gene in a random Turkish population Promoter region haplotypes % T-564C G-99C C-14T InsG 319 1 31.7 0 0 1 0 2 20.1 1 1 0 0 3 19.9 1 0 0 0 4 12.7 0 0 0 0 5 4.6 0 0 1 1 6 4.2 1 1 0 1 7 3.2 1 0 0 1 8 2.5 0 0 0 1 Sum 98.9 Coding region haplotypes % R219K V771M V825I I883M E1172D R1587K 1 39.3 0 0 0 0 0 0 2 12.6 1 0 0 0 0 0 3 12.0 0 0 0 0 0 1 4 8.7 1 0 0 1 0 0 5 8.3 1 0 0 0 0 1 6 4.0 0 0 1 1 0 0 7 3.4 0 0 0 0 1 1 8 1.6 1 0 0 1 0 1 9 1.3 1 1 0 0 0 0 10 1.3 0 1 0 0 1 1 11 1.3 0 0 1 1 0 1 12 1.1 1 1 0 0 0 1 Sum 95.1 0: common allele; 1: rare allele. Login to comment
215 Haplotype structure and haplotype-phenotype association of polymorphisms in the coding region of ABCA1 When the haplotype structure of the coding region was constructed using six polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K; Table 6), 12 haplotypes with a frequency >1% accounted for 95.1% of all haplotypes. Login to comment
219 The rare allele frequency of the V771M polymorphism, which was associated with high HDL-C in males, was 5.1% (Table 2). Login to comment
221 Those remaining must be distributed among the rare (<1%) haplotypes, and this distribution may explain the lack of association for the V771M on haplotype analysis. Login to comment
222 We observed an interaction between the V771M and I883M polymorphisms (Table 4). Login to comment
230 (rare allele in LD with rare allele) was observed between pairs of V771M and InsG 319, V825I and I883M, and R1587K and E1172D. Login to comment
231 There was negative LD (rare allele to common allele) between I883M and V771M as seen in Table 4. Login to comment
232 The R219K, C-14T, and V771M polymorphisms were not in LD in the Turkish population. Login to comment
279 In the analysis of covariance, where the sources of variance on plasma HDL-C levels were examined, introduction of interaction variables (smoking or alcohol consumption) × (C-14T or V771M) to the model showed that neither parameter modulated (P > 0.05) the effect of polymorphisms on HDL-C levels in males or females or when data for both genders were pooled. Login to comment
289 In Turks, the interaction of C-14T and R219K may play a role in altering plasma HDL-C levels and possibly CAD risk. Login to comment
290 In Turkish males but not females, the M allele of the V771M polymorphism was associated with high plasma HDL-C levels. After stratification by HDL-C levels, the M allele was significantly more frequent in the high than in the low HDL-C group, further supporting an association with high plasma HDL-C levels. Login to comment
295 The V771M polymorphism was associated with high HDL-C in females and consistent trends in males [17], whereas male subjects with the 771M allele had decreased focal atherosclerosis without alterations in plasma lipid levels [12]. Login to comment
299 In contrast, the M allele of the I883M polymorphism was associated with increased progression of atherosclerosis [12]. Login to comment
300 The combination of V771M and I883M alone or with other factors may modulate plasma HDL-C levels and CAD risk. Login to comment
304 A functional promoter polymorphism, C-14T, and a coding sequence polymorphism, V771M, in the ABCA1 gene appeared to affect HDL-C levels in Turks and these results could be replicated when our entire data set was randomly divided in two different subsets (Supplemental Table II). Login to comment
305 Two combinations of rare alleles-C-14T with R219K and V771M with I883M-were associated with high HDL-C in both males and females. Login to comment
103 The G-803A Table 2 ABCA1 polymorphisms Nucleotide changea Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in 5 and promoter regions G-803A ~10 92/141 [19] T-564C 72.7 47.7 728/1268 [18] G-407C 62.5 40.7 220/233 [18] G-99C 42.2 24.2 875/1130 [46] C-14T 61.2 37.7 916/1416 [46] InsG 319 26.6 14.2 848/1288 [46] Nucleotide changed Amino acid change Exon Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in coding sequence Nonsynonymous G(70943)A R219K 7 62.3 38.5 996/1466 db 2230806 G(102555)A V771M 16 10.0 5.1 981/1477 db 2066718 G(103777)A V825I 17 12.3 6.2 960/1145 db 4149312 A(105057)G I883M 18 38.1 21.8 1084/1448 db 4149313 G(112177)C E1172D 24 9.0 4.6 1001/1237 [12,13] A(116887)G Q1328R 28 0.003e 0.0015 172/156 NR G(129004)A R1587K 35 55.1 33.0 937/1351 db 2230808 T(133402)C Y1767H 39 ~1.0e 40/55 NR G(133420)A V1773M 39 ~1.0e 40/55 NR Synonymous C(100538)A I620I 15 ~4.0 40/55 NR C(109469)T V990V 21 ~3.0 87/90 [17] T(109861)G V1053V 22 ~1.0 90/90 [12] C(109868)T L1056L 22 ~5.0 90/90 NR C(109906)T R1068R 22 ~3.0 90/90 NR A(113280)G E1211E 25 ~4.0 40/55 [17] A(116879)G T1325T 28 ~1.0 40/55 NR T(137043)C Y1921Y 43 ~1.0 40/55 NR Nucleotide changed Intron Carrier of rare allele (%) Intronic location nb Referencesc Frequency in noncoding sequence G(23816)A 1 ~1.0 11 bp 5 exon 1b 94 NR G(23819)C 1 42 8 bp 5 exon 1b 94 NR A(22997)T 1 46 90 bp 5 exon 1d 91 NR A(23004)G 1 ~1.0 83 bp 5 exon 1d 91 NR G(23058)C 1 46 29 bp 5 exon 1d 91 NR G(40504)A 3 2.6 26 bp 3 of exon 3 192 NR C(45217)T 4 0.7 64 bp 3 of exon 4 142 NR T(98628)A 14 35-40 24 bp 3 of exon 14 190 db 4743763 C(100332)T 14 4.3 59 bp 5 of exon 15 90 db 2066717 C(108020)T 19 0.7 3 bp 5 of exon 20 144 NR DelTTT(134503-6) 39 7.0 20-23 bp 5 of exon 40 90 NR C(142026)T 46 8.6 34 bp 5 of exon 47 116 NR A(142751)G 48 15.9 13 bp 3 of exon 48 107 NR a Relative to transcriptional start. Login to comment
108 Table 3 ABCA1 polymorphisms and mean plasma HDL-C levels (mg/dl &#b1; S.D.) in a random Turkish population Females Males AAa AB BB AAa AB BB Promoter and 5 region T-564C 40.4 &#b1; 8.4 (205) 41.0 &#b1; 7.9 (365) 39.9 &#b1; 7.6 (158) 35.6 &#b1; 7.4 (339) 35.5 &#b1; 6.5 (635) 34.9 &#b1; 6.5 (294) G-407C 41.3 &#b1; 11.2 (82) 40.7 &#b1; 7.7 (101) 40.7 &#b1; 12.2 (37) 35.7 &#b1; 6.9 (88) 35.3 &#b1; 6.7 (96) 35.4 &#b1; 7.4 (49) G-99C 40.7 &#b1; 7.5 (505) 41.0 &#b1; 7.2 (317) 41.3 &#b1; 8.4 (53) 35.1 &#b1; 6.5 (654) 35.0 &#b1; 6.3 (405) 34.9 &#b1; 6.5 (71) C-14T 41.3 &#b1; 9.0 (361) 41.0 &#b1; 9.0 (417) 41.0 &#b1; 9.4 (138) 34.8 &#b1; 7.0b (547) 35.5 &#b1; 7.5 (675) 36.7 &#b1; 8.1b (194) InsG 319 41.3 &#b1; 8.1 (641) 40.5 &#b1; 7.7 (193) 43.1 &#b1; 8.0 (14) 35.3 &#b1; 6.4 (933) 34.7 &#b1; 6.4 (332) 34.5 &#b1; 6.5 (23) Nonsynonymous R219K 41.2 &#b1; 9.4 (364) 40.8 &#b1; 8.6 (480) 41.2 &#b1; 10 (152) 35.2 &#b1; 7.3 (574) 35.3 &#b1; 7.3 (688) 35.2 &#b1; 7.6 (204) V771M 40.9 &#b1; 9.2 (896) 42.8 &#b1; 9.3 (82) 38.7 &#b1; 10 (3) 35.1 &#b1; 7.2c (1330) 37.1 &#b1; 8.0c (144) 45.7 &#b1; 10.7 (3) V825I 40.6 &#b1; 9.4 (842) 38.9 &#b1; 8.5 (117) 42 (1) 35.8 &#b1; 8.7 (1005) 37.1 &#b1; 9.5 (140) (-) I883M 41.1 &#b1; 9.5 (643) 40.8 &#b1; 8.4 (372) 41.4 &#b1; 9.1 (69) 35.0 &#b1; 7.0 (922) 35.7 &#b1; 8.0 (457) 35.6 &#b1; 7.4 (69) E1172D 40.5 &#b1; 8.8 (907) 40.5 &#b1; 7.6 (93) 29 (1) 34.6 &#b1; 7.3 (1129) 35.4 &#b1; 7.6 (105) 30.7 &#b1; 8.7 (3) R1587K 41.1 &#b1; 9.4 (410) 40.8 &#b1; 9.6 (433) 41.0 &#b1; 10.1 (94) 35.9 &#b1; 8.1 (617) 35.1 &#b1; 7.6 (579) 35.3 &#b1; 8.6 (155) Numbers of subjects are shown in parenthesis. Login to comment
115 Informative associations between HDL-C levels and the R219K, V771M, and I883M polymorphisms will be discussed. Login to comment
148 Of these, only the V771M polymorphism appeared to be associated with altered HDL-C levels in males (Table 3). Login to comment
151 Analysis of covariance revealed that the V771M polymorphism was primarily associated with plasma HDL-C, not with triglycerides, in Turkish males (P < 0.05). Login to comment
153 The V771M polymorphism had no significant effect on HDL-C levels in females (Table 3). Login to comment
162 Genotypic (left) and allelic (right) frequencies of the ABCA1 V771M polymorphism in males with low (ࣘ30 mg/dl), moderate (30-40 mg/dl), or high (ࣙ40 mg/dl) levels of HDL-C. Login to comment
169 In contrast, the combinations of C-14T with R219K and of V771M with I883M were associated with altered HDL-C levels. Login to comment
176 To assess the combined effect of the V771M and I883M polymorphisms on HDL-C levels, subjects were stratified by the I883M genotype (II, IM, or MM) versus V771M. Login to comment
180 Separate haplotype blocks of ABCA1 In order to assess whether the length of the ABCA1 locus could be treated as a single haplotype block, haplotypes were constructed and significant LDs between polymorphisms were calculated using 10 common ABCA1 polymorphisms Table 4 Interactive effects of ABCA1 polymorphisms on mean plasma HDL-C levels (mg/dl &#b1; S.D.) R219K C-14T Females Males RR CC 41.4 &#b1; 8.5 (128) 34.7 &#b1; 6.7 (207) CT 41.6 &#b1; 9.8 (150) 35.7 &#b1; 7.6 (253) TT 41.3 &#b1; 8.9 (55) 36.3 &#b1; 7.8 (84) RK CC 41.8 &#b1; 8.3 (169) 34.8 &#b1; 7.4 (261) CT 39.9 &#b1; 8.3 (203) 35.5 &#b1; 6.8 (309) TT 39.5 &#b1; 9.0 (60) 36.8 &#b1; 8.5 (84) KK CC 39.8 &#b1; 11.2 (60) 34.0 &#b1; 6.2 (69) CT 41.1 &#b1; 9.0 (60) 35.7 &#b1; 8.4 (102) TT 44.7 &#b1; 9.8a (22) 37.1 &#b1; 7.8a (22) I883M V771M II VV 40.9 &#b1; 9.8 (499) 34.8 &#b1; 6.8 (797) VM 41.4 &#b1; 8.3 (74) 36.7 &#b1; 8.3b (112) IM VV 40.3 &#b1; 8.0 (313) 35.1 &#b1; 8.1 (427) VM 44.2 &#b1; 11.5b (17) 37.3 &#b1; 7.4b (26) MM VV 41.6 &#b1; 9.2 (60) 35.6 &#b1; 7.5 (67) Numbers of subjects are shown in parenthesis. Login to comment
189 Many of the rare single nucleotide polymorphisms, such as V771M, were not well represented on the 26 common haplotypes and therefore existed only on the remaining rare haplotypes. Login to comment
203 However, further analysis Table 5 Allele frequency and significant (P < 0.01) pair-wise linkage disequilibrium coefficients between the ABCA1 polymorphisms in a random Turkish population Position Allele % T-564C G-99C C-14T InsG 319 R219K V771M V825I I883M E1172D R1587K T-564C 52.3/47.7 - G-99C 75.8/24.2 0.36 - C-14T 62.3/37.7 -0.96 -0.98 - InsG 319 85.8/14.2 - - - - R219K 61.5/38.5 - - - - V771M 94.9/5.1 - - - 0.99 - V825I 93.8/6.2 -0.40 -0.69 - - -0.76 - - I883M 78.2/21.8 - -0.42 - - 0.20 -0.79 0.91 - E1172D 95.4/4.6 - - - - - 0.34 - - - R1587K 67.0/33.0 - - -0.23 - - 0.56 - - 0.87 - Table 6 Common haplotypes of promoter and coding regions of ABCA1 gene in a random Turkish population Promoter region haplotypes % T-564C G-99C C-14T InsG 319 1 31.7 0 0 1 0 2 20.1 1 1 0 0 3 19.9 1 0 0 0 4 12.7 0 0 0 0 5 4.6 0 0 1 1 6 4.2 1 1 0 1 7 3.2 1 0 0 1 8 2.5 0 0 0 1 Sum 98.9 Coding region haplotypes % R219K V771M V825I I883M E1172D R1587K 1 39.3 0 0 0 0 0 0 2 12.6 1 0 0 0 0 0 3 12.0 0 0 0 0 0 1 4 8.7 1 0 0 1 0 0 5 8.3 1 0 0 0 0 1 6 4.0 0 0 1 1 0 0 7 3.4 0 0 0 0 1 1 8 1.6 1 0 0 1 0 1 9 1.3 1 1 0 0 0 0 10 1.3 0 1 0 0 1 1 11 1.3 0 0 1 1 0 1 12 1.1 1 1 0 0 0 1 Sum 95.1 0: common allele; 1: rare allele. Login to comment
214 Haplotype structure and haplotype-phenotype association of polymorphisms in the coding region of ABCA1 When the haplotype structure of the coding region was constructed using six polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K; Table 6), 12 haplotypes with a frequency >1% accounted for 95.1% of all haplotypes. Login to comment
218 The rare allele frequency of the V771M polymorphism, which was associated with high HDL-C in males, was 5.1% (Table 2). Login to comment
220 Those remaining must be distributed among the rare (<1%) haplotypes, and this distribution may explain the lack of association for the V771M on haplotype analysis. Login to comment
229 (rare allele in LD with rare allele) was observed between pairs of V771M and InsG 319, V825I and I883M, and R1587K and E1172D. Login to comment
278 In the analysis of covariance, where the sources of variance on plasma HDL-C levels were examined, introduction of interaction variables (smoking or alcohol consumption) &#d7; (C-14T or V771M) to the model showed that neither parameter modulated (P > 0.05) the effect of polymorphisms on HDL-C levels in males or females or when data for both genders were pooled. Login to comment
294 The V771M polymorphism was associated with high HDL-C in females and consistent trends in males [17], whereas male subjects with the 771M allele had decreased focal atherosclerosis without alterations in plasma lipid levels [12]. Login to comment
303 A functional promoter polymorphism, C-14T, and a coding sequence polymorphism, V771M, in the ABCA1 gene appeared to affect HDL-C levels in Turks and these results could be replicated when our entire data set was randomly divided in two different subsets (Supplemental Table II). Login to comment

[hide] Accurate prediction of the functional significance... PLoS Genet. 2005 Dec;1(6):e83. Epub 2005 Dec 30. Brunham LR, Singaraja RR, Pape TD, Kejariwal A, Thomas PD, Hayden MR
Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene.
PLoS Genet. 2005 Dec;1(6):e83. Epub 2005 Dec 30., [PMID:16429166]

Abstract [show]
The human genome contains an estimated 100,000 to 300,000 DNA variants that alter an amino acid in an encoded protein. However, our ability to predict which of these variants are functionally significant is limited. We used a bioinformatics approach to define the functional significance of genetic variation in the ABCA1 gene, a cholesterol transporter crucial for the metabolism of high density lipoprotein cholesterol. To predict the functional consequence of each coding single nucleotide polymorphism and mutation in this gene, we calculated a substitution position-specific evolutionary conservation score for each variant, which considers site-specific variation among evolutionarily related proteins. To test the bioinformatics predictions experimentally, we evaluated the biochemical consequence of these sequence variants by examining the ability of cell lines stably transfected with the ABCA1 alleles to elicit cholesterol efflux. Our bioinformatics approach correctly predicted the functional impact of greater than 94% of the naturally occurring variants we assessed. The bioinformatics predictions were significantly correlated with the degree of functional impairment of ABCA1 mutations (r2 = 0.62, p = 0.0008). These results have allowed us to define the impact of genetic variation on ABCA1 function and to suggest that the in silico evolutionary approach we used may be a useful tool in general for predicting the effects of DNA variation on gene function. In addition, our data suggest that considering patterns of positive selection, along with patterns of negative selection such as evolutionary conservation, may improve our ability to predict the functional effects of amino acid variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 À3), R219K, V771M, I883M, D1289N, and P2150L, four had cholesterol efflux values that were not statistically different from wild-type ABCA1. Login to comment
46 This included two variants, D1289N and P2150L, that have been previously reported to be disease-causing mutations [4,8,9], as well as two cSNPs, R219K and V771M. Login to comment
48 This SNP has been reported to be associated with decreased HDL cholesterol and increased severity of atherosclerosis in Table 1. subPSEC Scores and Probability of Functional Impairment (Pdeleterious) for ABCA1 Mutations and SNPs Mutations SNPs Variant SubPSEC Pdeleterious Variant subPSEC Pdeleterious P85L À4.62 0.83 R219K À0.57 0.08 H160F À2.79 0.45 V399A À2.26 0.32 R230C À4.27 0.78 V771M À2.86 0.46 A255T À1.81 0.23 T774P À1.99 0.27 E284K À2.34 0.34 K776N À3.53 0.63 Y482C À4.21 0.77 V825I À1.06 0.13 R587W À6.04 0.95 I883M À1.38 0.17 W590S À5.19 0.9 E1172D À1.96 0.26 W590L À4.48 0.82 R1587K À0.58 0.08 Q597R À7.15 0.98 S1731C À4.21 0.77 T929I À4.29 0.78 N935H À8.54 1 N935S À7.53 0.99 A937V À6.6 0.97 A1046D À7.52 0.99 M1091T À3.56 0.64 D1099Y À6.09 0.96 D1289N À2.48 0.37 L1379F À3.81 0.69 C1477R À5.44 0.92 S1506L À5.17 0.9 N1611D À5.69 0.94 R1680W À6.02 0.95 V1704D À3.21 0.55 N1800H À4.23 0.77 R1901S À5.06 0.89 F2009S À2.73 0.43 R2081W À8.08 0.99 P2150L À2.88 0.47 Q2196H À2.74 0.43 DOI: 10.1371/journal.pgen.0010083.t001 PLoS Genetics | www.plosgenetics.org December 2005 | Volume 1 | Issue 6 | e83 0740 Accurate Prediction of ABCA1 Variants Synopsis A major goal of human genetics research is to understand how genetic variation leads to differences in the function of genes. Login to comment
75 Cholesterol Efflux Values for 293 Cells Transfected with ABCA1 Variants and subPSEC and PolyPhen Predictions of the Functional Impact of these Variants Variant Variant Type subPSEC Cholesterol Efflux PolyPhen R2081W Mutation À8.08 21.1 6 21%* Probably damaging N935S Mutation À7.53 29.3 6 13%* Benign A1046D Mutation À7.52 16.8 6 7%* Possibly damaging Q597R Mutation À7.15 17.7 6 14%* Probably damaging R587W Mutation À6.04 31.7 6 33%* Probably damaging C1477R Mutation À5.44 20.5 6 10%* Probably damaging W590S Mutation À5.19 47.1 6 13%* Probably damaging S1506L Mutation À5.17 17.8 6 15%* Probably damaging T929I Mutation À4.29 69.9 6 11%* Possibly damaging N1800H Mutation À4.23 31.3 6 16%* Possibly damaging S1731C SNP À4.21 12.3 6 10%* Possibly damaging M1091T Mutation À3.56 6.9 6 20%* Probably damaging P2150L Mutation À2.88 88.4 6 21% Probably damaging V771M SNP À2.86 145.4 6 33% Benign D1289N Mutation À2.48 137.7 6 86% Benign I883M SNP À1.38 69.1 6 16%* Benign R219K SNP À0.57 103.7 6 21.05 Benign Wild-type - 0.0 100% - *p , 0.01 compared to wild-type ABCA1. Login to comment

[hide] Mutation in ABCA1 predicted risk of ischemic heart... J Am Coll Cardiol. 2005 Oct 18;46(8):1516-20. Epub 2005 Sep 23. Frikke-Schmidt R, Nordestgaard BG, Schnohr P, Steffensen R, Tybjaerg-Hansen A
Mutation in ABCA1 predicted risk of ischemic heart disease in the Copenhagen City Heart Study Population.
J Am Coll Cardiol. 2005 Oct 18;46(8):1516-20. Epub 2005 Sep 23., [PMID:16226177]

Abstract [show]
OBJECTIVES: We tested whether heterozygosity for the K776N mutation (frequency: 0.4%) in ATP-binding cassette transporter A1 (ABCA1) predicted ischemic heart disease (IHD) in the Copenhagen City Heart Study population. BACKGROUND: In a complex trait like IHD, genetic variation is considered to be conferred by common DNA polymorphisms, although rare mutations may have a larger impact. Tangier disease, a rare high-density lipoprotein cholesterol (HDL-C) deficiency syndrome with IHD, is caused by homozygous ABCA1 mutations. METHODS: We analyzed blood samples from a large cohort study of 9,076 Danish individuals followed for 24 years (167,287 person-years), during which 1,033 incident IHD events occurred. The hypothesis was retested in an independent case-control study comparing 562 IHD patients with 3,103 controls. RESULTS: The cumulative incidence of IHD as a function of age was increased in K776N heterozygotes compared with non-carriers (log-rank test: p = 0.005). At the age of 80 years, 48% of heterozygotes and 23% of non-carriers had IHD. Incidence rates in non-carriers and K776N heterozygotes were 61 and 157 per 10,000 person-years. The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5). Adjusting for HDL-C, or for smoking, diabetes, and hypertension did not change the result, suggesting that genotype predicted risk of IHD beyond that offered by HDL-C, and by other conventional risk factors. Similar trends were obtained in an independent case-control study. CONCLUSIONS: Heterozygosity for an ABCA1 mutation (K776N) conferred two- to three-fold risk of IHD in 37 participants in the Copenhagen City Heart study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 A rare single nucleotide polymorphism (SNP) (V771M, allele frequency 0.03) and a muta- Figure 1. Login to comment
95 Although we have recently shown that V771M is associated with increased HDL-C levels (9), effects on risk of IHD have not been documented for either of these variants (14,28). Login to comment
107 However, at the individual level, K776N appears to have a marked impact on risk. Login to comment
109 However, several arguments favor a true observation: 1) the involved amino acid residue is completely conserved between species and relatively conserved between 12 ABCAs with very different transport functions; 2) the amino acid substitution changes the charge of the side-chain, potentially leading to structural alterations of the protein, and consequently to altered protein interactions or transport properties; 3) in the CFTR (or ABCC7), a disease-causing mutation (R347P) has been identified at a site that corresponds to residue 764 in ABCA1 (15), and thus in close vicinity to K776N; 4) the present study is of a large cohort, and therefore includes only incident cases, avoiding the normal pitfalls of case reports and case-control studies (30); 5) we observed a similar trend on risk of IHD in a separate case-control study; 6) we have previously determined effects on lipids and lipoproteins of all non-synonymous SNPs identified in ABCA1 (R219K, V771M, V825I, I883M, E1172D, R1587K). Login to comment
84 A rare single nucleotide polymorphism (SNP) (V771M, allele frequency 0.03) and a muta- Figure 1. Login to comment
93 Although we have recently shown that V771M is associated with increased HDL-C levels (9), effects on risk of IHD have not been documented for either of these variants (14,28). Login to comment

[hide] ATP-binding cassette transporter A1: a cell choles... Physiol Rev. 2005 Oct;85(4):1343-72. Oram JF, Heinecke JW
ATP-binding cassette transporter A1: a cell cholesterol exporter that protects against cardiovascular disease.
Physiol Rev. 2005 Oct;85(4):1343-72., [PMID:16183915]

Abstract [show]
Blood high-density lipoprotein (HDL) levels are inversely related to risk for cardiovascular disease, implying that factors associated with HDL metabolism are atheroprotective. One of these factors is ATP-binding cassette transporter A1 (ABCA1), a cell membrane protein that mediates the transport of cholesterol, phospholipids, and other metabolites from cells to lipid-depleted HDL apolipoproteins. ABCA1 transcription is highly induced by sterols, a major substrate for cellular export, and its expression and activity are regulated posttranscriptionally by diverse processes. Liver ABCA1 initiates formation of HDL particles, and macrophage ABCA1 protects arteries from developing atherosclerotic lesions. ABCA1 mutations can cause a severe HDL deficiency syndrome characterized by cholesterol deposition in tissue macrophages and prevalent atherosclerosis. Genetic manipulations of ABCA1 expression in mice also affect plasma HDL levels and atherogenesis. Metabolites elevated in individuals with the metabolic syndrome and diabetes destabilize ABCA1 protein and decrease cholesterol export from macrophages. Moreover, oxidative modifications of HDL found in patients with cardiovascular disease reduce the ability of apolipoproteins to remove cellular cholesterol by the ABCA1 pathway. These observations raise the possibility that an impaired ABCA1 pathway contributes to the enhanced atherogenesis associated with common inflammatory and metabolic disorders. The ABCA1 pathway has therefore become an important new therapeutic target for treating cardiovascular disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
431 The most studied of these SNPs is the R219K variant, with the K allele being associated with higher levels of HDL (255). Login to comment
432 V771M and V825I SNPs have also been reported to be associated with increased HDL levels, whereas R1587K is associated with low levels of HDL (78, 255). Login to comment

[hide] Screening for functional sequence variations and m... Atherosclerosis. 2004 Aug;175(2):269-79. Probst MC, Thumann H, Aslanidis C, Langmann T, Buechler C, Patsch W, Baralle FE, Dallinga-Thie GM, Geisel J, Keller C, Menys VC, Schmitz G
Screening for functional sequence variations and mutations in ABCA1.
Atherosclerosis. 2004 Aug;175(2):269-79., [PMID:15262183]

Abstract [show]
Mutations in the ATP-binding cassette 1 transporter gene (ABCA1) are responsible for the genetic HDL-deficiency syndromes, which are characterized by severely diminished plasma HDL-C levels and a predisposition to cardiovascular disease and splenomegaly. The ABCA1 gene contains 50 exons and codes for a 2261-amino acid long membrane protein that facilitates phospholipid and cholesterol transport. Several mutations have been identified so far as responsible either for Tangier disease or for reduced HDL levels. We have selectively looked for additional polymorphisms in functionally relevant regions of the gene in cohorts constituted of individuals with altered HDL levels as well as healthy blood donors and octogenarians, and screened for mutations in the complete coding region of selected individuals with extremely aberrant HDL levels. In the promoter region, which is important for regulation of gene expression, we have identified several polymorphisms including one VNTR polymorphism, located at a putative ZNF202 binding site, which displayed different binding of ZNF202 in an electromobility shift assay. Three novel SNPs were discovered in the promoter region (G1047C, C1152T and C1440T). The prevalence of exchange G1047C (G-395C) was found significantly increased in probands with low HDL compared to probands with high HDL. Exchanges C1152T (C-290T) and C1440T (C-7T) were significantly more frequent in the cohort with low HDL compared to healthy blood donors and octogenarians. In the C-terminal part of ABCA1, known to interact with other proteins, two novel sequence variations (F2163S and V2244I) have been found in one phenotype related to cardiovascular disease, but none in the aforementioned cohorts. In one individual with extremely high HDL levels, the V771M polymorphism was found in a homozygous state. In patients with HDL deficiency, three novel mutations have been identified (W590L, W840R and R1068C). To facilitate further research in ABCA1 sequence variations and expand our understanding of their effects, we are introducing a webpage archive (http://www.abca1-mutants.all.at) containing all sequence variations reported in ABCA1 so far. This webpage provides a more recent and detailed summary of sequence variations and mutations in ABCA1 than existing databases and should also be of interest for molecular diagnosis of ABCA1-related HDL deficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
9 In one individual with extremely high HDL levels, the V771M polymorphism was found in a homozygous state. Login to comment
59 19 years 30 years 53 years Chol TG LDL HDL Lp(a) 116 59 82 30 <5.9 Apo E3/E4 GOT 23U/L, GPT 20 U/L, bilirubine (tot.) 1.16 Chol TG LDL HDL Lp(a) 153 94 112 27 22.7 Apo E3/E3 Chol TG LDL HDL Lp(a) 131 50 88 40 10.9 ApoE2/E3 60 years Chol TG LDL HDL Lp(a) 161 107 91 60 <5.9 ApoE3/E4 (TC ∆ ) Exon 23 G6PD deficiency R1068C I-1 I-1 I-2 I-2 dec. 67 years II-1 II-1 II-2 II-2 40 years 31 years 70 years Chol TG LDL HDL ApoAI 309 59 228 70 170 Chol TG LDL HDL ApoAI 283 145 175 54 156 Chol TG LDL HDL ApoAI 304 48 168 125 244 n.d. 60 years 32 years 23 years Chol TG LDL HDL ApoAI 237 100 121 48 110 Chol TG LDL HDL ApoAI 316 24 2 5 Chol TG LDL HDL ApoAI 158 74 109 33 86 68 years Chol TG LDL HDL ApoAI 121 191 33 87 96 49 I-1 I-2 II-1 II-2 V771M (patient A) (patient D) (patient E) A D E Fig. 1. Login to comment
123 These Table 1 Primers and probes for TaqMan analysis of novel polymorphisms in the coding region of ABCA1 W590L (G2082C) TM-W590L-f 5 -AGC TGA CCC CTT TGA GGA CAT-3 TM-W590L-r 5 -CTC CAC CAC ATC CTG CAA GTA G-3 TM-W590-vic 5 -VIC-CCC CCC ¯ AGA CGT A-MGB-NFQ-3 TM-L590-fam 5 -FAM-CCC CCG ¯ AGA CGT A-MGB-NFQ-3 V771M (G2624A) TM-V771M-f 5 -GGC ATC ATC TAC TTC ACG CTG TA-3 TM-V771M-r 5 -CAG AGG TAC TCA CAG CGA AGA TCT T-3 TM-V771-vic 5 -FAM-TGT GAA GCC CAC ¯ GTA G-MGB-NFQ-3 TM-M771-fam 5 -VIC-TGA AGC CCA T ¯ GT AGT C-MGB-NFQ-3 W840R (T2831A) TM-W840R-f 5 -GCT GTT TGA CAC CTT CCT CTA TGG-3 TM-W840R-r 5 -TGT ACC TGG AAA GAC AGC CTC AA-3 TM-W840-vic 5 -VIC-TGT ACC A ¯ GG TCA TCA C-MGB-NFQ-3 TM-R840-fam 5 -FAM-TGT ACC T ¯ GG TCA TCA C-MGB-NFQ-3 P2150L (C6762T) TM-P2150L-f 5 -TTC AGG TTT GGA GAT GGT TAT ACA ATA G-3 TM-P2150L-r 5 -GAA ATG CAA GTC CAA AGA AAT CCT-3 TM-P2150-vic 5 -VIC-CAA CCC ¯ GGA CCT GA-MGB-NFQ-3 TM-L2150-fam 5 -FAM-CAA CCT ¯ GGA CCT GAA-MGB-NFQ-3 F2163S (T6801C) TM-F2163S-f 5 -AAG CCT GTC CAG GAT TTC TTT G-3 TM-F2163S-r 5 -CAT GTT CCG GTG TTT CTC TTT TAG-3 TM-F2163-vic 5 -VIC-CCA GGA A ¯ AT GCA AGT C-MGB-NFQ-3 TM-S2163-fam 5 -FAM-CAG GAG ¯ ATG CAA GTC-MGB-NFQ-3 V2244I (G7043A) TM-V2244I-f 5 -ATG ATG ACC ACT TAA AAG ACC TCT CA-3 TM-V2244I-r 5 -GCT TTC TTT CAC TTT CTC ATC CTG TAG-3 TM-V2244-vic 5 -VIC-TGG ACG ¯ TTG CAG TTC-MGB-NFQ-3 TM-I2244-fam 5 -FAM-AGT AGT GGA CA ¯ T TGC-MGB-NFQ-3 Positions of sequence variations refer to accession number NM005502. Login to comment
181 Table 4 Frequencies of VNTR-SRY in various study groups and mean HDL levels (males only) DONORS High-HDL Low-HDL Total Individuals 50 33 44 221 HDL-C 57 ± 12 93 ± 16 35 ± 7 59 ± 25 Homozygotes wt (%) 2.0 12.1 6.8 6.3 (GTTT) (%) 8.0 3.0 2.3 4.7 (GTTTTGTTT) (%) 18.0 21.2 29.5 22.8 Heterozygotes wt/ (GTTT) (%) 12.0 15.2 11.4 12.6 wt/ (GTTTTGTTT) (%) 24.0 15.2 15.9 18.9 (GTTT)/ (GTTTTGTTT) (%) 34.0 33.3 34.1 33.9 Allele frequencies wt (%) 20.0 27.3 20.5 22.0 (GTTT) (%) 32.0 27.3 25.0 28.3 (GTTTTGTTT) (%) 47.0 45.5 54.5 49.2 P(χ2) - 0.541 0.516 In patient A (individual II-1 in pedigree A, Fig. 1) we identified a G102555A (V771M) polymorphism in a homozygous state. Login to comment
183 The V771M polymorphism was analyzed in the DONORS cohort. Login to comment
192 In addition, patient D was heterozygous for a novel sequence variation in exon 22, Table 5 Sequence variations found in ABCA1 and phenotypes of patients Exon Amino acid Nucleotide Position in DNA (AF275948) Position in mRNA (NM005502) Found in patient with 14 W590L TG ¯ G → TC ¯ G 98481 2082 HDL deficiency (C) 16 V771M G ¯ TG → A ¯ TG 102555 2624 Increased HDL (A) 17 W840R T ¯ GG → A ¯ GG 103822 2831 HDL deficiency (B) 22 R1068C C ¯ GC → T ¯ GC 109904 3515 HDL deficiency (D) 49 F2163S TT ¯ T → TC ¯ T 143483 6801 Low HDL and G6PD deficiency (E) 50 V2244I G ¯ TT → A ¯ TT 144665 7043 A C ABC B S A N ABC B S 44 23 703 681 718 740 769 747 774-794 822 842 1368 1346 1655 1677 1724 1702 1737 1759 1790 1768 1848 1870 642 660 W590L R1068C F2163S P2150L V2244I V771M W840R Fig. 4. Login to comment
237 In lipoprotein metabolism (cholesterol efflux) it is known that methionine oxidation in apo A-I is a key regulatory event in LCAT activation [9], thus the amino acid exchange valine to methionine at codon 771 may affect functionality [10-12]. Login to comment
238 Moreover, V771M is located very close to a putative transmembrane region (Fig. 4) and it is known that mutations in the SUR1 gene that are localized near the transmembrane region impair the interaction of this ABC transporter with Kir6.2 channel [13]. Login to comment
253 Two mutations have been found in a phenotype related to CVD, located in an important domain of ABCA1 (carboxy-terminus) and a rare homozygous polymorphism (V771M) was identified in a proband with extremely high HDL. Login to comment

[hide] Genetic variants of ABCA1 modify Alzheimer disease... Hum Mutat. 2004 Apr;23(4):358-67. Katzov H, Chalmers K, Palmgren J, Andreasen N, Johansson B, Cairns NJ, Gatz M, Wilcock GK, Love S, Pedersen NL, Brookes AJ, Blennow K, Kehoe PG, Prince JA
Genetic variants of ABCA1 modify Alzheimer disease risk and quantitative traits related to beta-amyloid metabolism.
Hum Mutat. 2004 Apr;23(4):358-67., [PMID:15024730]

Abstract [show]
Linkage studies have provided evidence that one or more loci on chromosome 9q influence Alzheimer disease (AD). The gene encoding the ATP-binding cassette A1 transporter (ABCA1) resides within proximity of previously identified linkage peaks and represents a plausible biological candidate for AD due to its central role in cellular lipid homeostasis. Several single nucleotide polymorphisms (SNPs) spanning ABCA1 have been genotyped and haplotype-based association analyses performed in four independent case-control samples, consisting of over 1,750 individuals from three European populations representing both early and late-onset AD. Prominent effects were observed for a common (H2) and rarer haplotype (H5) that were enriched in AD cases across studied populations (odds ratio [OR] 1.59, 95% confidence interval [CI] 1.36-1.82; P<0.00001 and OR 2.90; 95% CI 2.54-3.27; P<0.00001, respectively). Two other common haplotypes in the studied region (H1 and H3) were significantly under-represented in AD cases, suggesting that they may harbor alleles that decrease disease risk (OR 0.79, 95% CI 0.64-0.94; P=0.0065 and OR 0.70, 95% CI 0.46-0.93; P=0.011, respectively). While findings were significant in both early and late-onset samples, haplotype effects were more distinct in early-onset materials. For late-onset samples, ancillary evidence was obtained that both single marker alleles and haplotypes of ABCA1 contribute to variable cerebrospinal fluid tau and beta amyloid (Abeta42) protein levels, and brain Abeta load. Results indicate that variants of ABCA1 may affect the risk of AD, providing further support for a genetic link between AD and cholesterol metabolism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Details of ABCA1 SNPs, and Oligos for PCR and DASHn Variant dbSNP rsID Base change Forward primer sequence (50 ^30 ) Reverse primer sequence (30 ^50 ) Probe sequence (50 ^30 ) p.R219K rs2230806 c.658G4A g.10300705G4A b-TTTCTGAGCTTTGTGGCCTACC GCTCTGCTGCAGCCAGTTTCTC GTTTCTCCCTTGGTAGG p.V771M rs2066718 c.2314G4A g.102969093G4A b-TGTGTGTGGCATGGCAGGACTA GCGAAGATCTTGAGTGTGAAGC GAAGCCCACGTAGTCCT p.V825I rs4149312 c.2476G4A g.102967871G4A b-ATGGCTTCAATCTCACCACTTG GGTGTCAAACAGCATCATGGAG CATGGAGACCCAAGTGG p.I883M rs4149313 c.2650A4G g.102966591A4G b-GAGGTCAACAGCACTTACTTTCT AGAAGAGCCACCCTTGTTCCAA AAGAGAATGTCAGAAAG p.R1587K rs2230808 c.4762G4A g.102942642G4A b-ATTTATGACAGGACTGGACACC AGCGGTTTACCTTGACATTATT CATTATTTCTGGTGTCC n Genotyping of SNPs was performed using dynamic allele speci'c hybridization (DASH) [Prince et al., 2001]. Login to comment
88 While no supporting evidence of association with marker rs2230806 was detected, significant associations were observed for markers rs2230808 (c.4762G4A, p.R1587K) (P=0.016 for genotypes, P=0.013 for alleles) and marker rs2066718 (c.2314G4A, p.V771M) (P=0.029 for genotypes, P=0.031 for alleles) (Table 3). Login to comment
93 Single MarkerAssociations forABCA1and Alzheimer Diseasew p.R219K (rs2230806) G/G G/A A/A P value Set A AD 238 (.62) 125 (.33) 21 (.05) 0.014n Controls 102 (.58) 51 (.29) 22 (.13) Set B AD 58 (.48) 53 (.44) 9 (.08) 0.76 Controls 76 (.53) 59 (.41) 9 (.06) Set C AD 82 (.57) 53 (.37) 8 (.06) 0.66 Controls 183 (.56) 117 (.36) 26 (.08) Set D AD 183 (.56) 122 (.37) 22 (.07) 0.93 Controls 60 (.57) 40 (.38) 6 (.06) p.I883M (rs4149313) C/C C/T T/T Set A AD 2 (.01) 81 (.21) 301 (.78) 0.39 Controls 0 (.00) 31 (.18) 145 (.82) Set B AD 0 (.00) 29 (.24) 91 (.76) 0.27 Controls 3 (.02) 32 (.21) 115 (.77) Set C AD 2 (.01) 27 (.19) 116 (.80) 0.84 Controls 3 (.01) 53 (.17) 256 (.82) Set D AD 3 (.01) 68 (.21) 253 (.78) 0.61 Controls 2 (.02) 19 (.19) 83 (.80) p.R1587K (rs2230808) G/G G/A A/A Set A AD 253 (.66) 114 (.30) 15 (.04) 0.13 Controls 101 (.57) 66 (.38) 9 (.05) Set B AD 56 (.46) 58 (.48) 7 (.06) 0.016n Controls 96 (.64) 48 (.32) 7 (.05) Set C AD 80 (.55) 56 (.39) 9 (.06) 0.70 Controls 189 (.58) 121 (.37) 15 (.05) Det D AD 185 (.57) 118 (.36) 24 (.07) 0.18 Controls 68 (.64) 28 (.26) 10 (.09) p.V771M (rs2066718) G/G G/A A/A Set A AD 365 (.95) 20 (.05) 0 (.00) 0.28 Controls 167 (.95) 7 (.04) 1 (.01) Set B AD 109 (.98) 2 (.02) 0 (.00) 0.029n Controls 126 (.92) 11 (.08) 0 (.00) p.V825I (rs4149312) G/G G/A A/A Set A AD 341 (.93) 20 (.05) 4 (.01) 0.17 Controls 164 (.92) 15 (.08) 0 (.00) w Genotype frequencies for all studied SNPs in ABCA1 are presented. Login to comment

[hide] Associations between serum high-density lipoprotei... Metabolism. 2004 Feb;53(2):182-6. Yamakawa-Kobayashi K, Yanagi H, Yu Y, Endo K, Arinami T, Hamaguchi H
Associations between serum high-density lipoprotein cholesterol or apolipoprotein AI levels and common genetic variants of the ABCA1 gene in Japanese school-aged children.
Metabolism. 2004 Feb;53(2):182-6., [PMID:14767869]

Abstract [show]
ATP-binding cassette transporter A1 (ABCA1) plays an important role in apolipoprotein AI (apoAI)-mediated cholesterol efflux from peripheral cells. The mild changes in ABCA1 activity due to genomic variation might be associated with interindividual variations in serum high-density lipoprotein cholesterol (HDL-C) and apoAI levels, or primary hypoalphalipoproteinemia in the general population. In the present study, we analyzed the relationships between 5 single nucleotide polymorphisms (SNPs) and 2 insertion/deletion polymorphisms in the 5' flanking region and 5 missense polymorphisms of the ABCA1 gene and serum lipid levels in healthy school-aged children. We detected significant associations between the K219R and V771M polymorphisms, and HDL-C or apoAI levels. The present data support the proposition that the K219 allele is an anti-atherogenic allele with increased cholesterol efflux activity. Similarly, the M771 allele appears to be anti-atherogenic, although the frequency of the M771 allele is low.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 In the present study, we analyzed the relationships between 5 single nucleotide polymorphisms (SNPs) and 2 insertion/deletion polymorphisms in the 5؅ flanking region and 5 missense polymorphisms of the ABCA1 gene and serum lipid levels in healthy school-aged children. We detected significant associations between the K219R and V771M polymorphisms, and HDL-C or apoAI levels. Login to comment
39 Missense Polymorphisms in the Coding Region To date, in the coding region of the ABCA1 gene, 9 SNPs inducing amino acid changes have been reported in the dbSNP database; we have ascertained that at least 5 of these missense mutations (K219R, V771M, V825I, M883I, and R1587K) are polymorphic in Japanese populations. Login to comment
40 Tight linkage disequilib- liums were observed between the V771M polymorphism and the M883I polymorphism, and the V825I polymorphism and the M883I polymorphism (data not shown). Login to comment
46 PCR Primers, Annealing Temperatures, Sizes of Amplified Fragments, and Restriction Enzymes Used for Genotyping of Each Polymorphism Forward Primer Reverse Primer Annealing Temp (°C) Size of Amplified Fragment (bp) Restriction Enzyme 5Ј-flanking region -937 to -936delAT F: CCTCTTCTACGGGTCTGTCCTG R: CAGCCTCCCTGTGATAAAAACA 64 321, 323 NlaIII -707G3A F: TGGAGGTCTGGAGTGGCTACAT R: CACAGAACAATATGGACCAGGCC 60 156 StuI -675 to -674ins GTTTGTTTT or insGTTTT F: CTGGTCCATATTGTTCTGTGTT R: CATAAATTGAGAGGAAGGAGGC 58 76, 81, 85 - -477C3T F: CGCCTATCAAAAATCAAAGTCC R: TCCGCGGTCTGCGTCCCCTTCC 60 371 AciI -320G3C F: AAAAAATTGCGGAAAGTA R: GCCGCAGACTCTCTAGTCCA 56 86 RsaI -191G3C F: CAAATTCCACTGGTGCCCTTGG R: TGTCTTAGGGTCCGCGGTCTGGGT 60 140 AvaII -17G3C F: ACCCCCACCCCACCCACCTCCC R: GTGCTCTCCCTCCTCCCCGCCGC 62 158 BstUI Coding region K219R F: TGACAAGTCTGTGCAATGGA R: GGCTTAAACTCAGCCACACC 58 379 StyI V771M F: AGTGCTTGGGATTGTTGAGG R: CACTGAAGAAAGGCCAGAGG 58 300 BsaAI V8251 F: CTGCTGTCTCCTGTGGCTTT R: GCTGCCTGTCCTTGGACTAT 58 349 Bsm AI M883I F: ACCCTGGTTCCAACCAGAAGAGGAT R: TTTAGAAAGGCAGGAGACATCG 58 125 EcoRV R1587K F: AGATTTATGACAGGACTGGACATCA R: CTGCCAACTTTACCATGAGTTG 55 129 Hpy188I NOTE. Mismatch nucleotides in primers are underlined. Login to comment
50 Significant associations between the K219R polymorphism and serum HDL-C or apoAI levels, and between the V771M polymorphism and apoAI levels, were observed in multiple linear regression analysis with sex, age, and BMI as covariates. Login to comment
54 *Statistical tests for TG levels were calculated on log-transformed values. Table 4. Relations Between Genotypes of Missense Polymorphisms and the Serum Levels of HDL-C, TG, and apoAI Genotype n HDL-C (mg/dL) P TG (mg/dL)* P apoAI (mg/dL) P K219R KK 97 56.9 Ϯ 11.3 .016 74.3 Ϯ 36.6 .43 136.0 Ϯ 18.8 .012 KR 160 52.2 Ϯ 10.3 77.2 Ϯ 32.3 128.7 Ϯ 17.3 RR 70 54.3 Ϯ 9.7 71.8 Ϯ 31.9 131.2 Ϯ 15.7 V771M VV 265 53.4 Ϯ 10.5 .13 74.4 Ϯ 32.3 .76 130.1 Ϯ 17.5 .035 VM 59 56.8 Ϯ 10.5 79.3 Ϯ 39.2 137.5 Ϯ 17.3 MM 3 57.7 Ϯ 18.2 71.0 Ϯ 14.0 133.3 Ϯ 23.5 V825I VV 134 53.2 Ϯ 10.9 .53 76.3 Ϯ 35.3 .77 130.7 Ϯ 18.3 .54 VI 156 54.9 Ϯ 10.3 74.8 Ϯ 31.6 132.5 Ϯ 17.2 II 37 53.8 Ϯ 11.2 73.1 Ϯ 35.4 129.5 Ϯ 17.4 M8831 MM 120 53.9 Ϯ 11.4 .73 75.3 Ϯ 35.1 .24 131.2 Ϯ 18.0 .90 MI 162 53.8 Ϯ 10.2 76.5 Ϯ 32.3 131.1 Ϯ 18.1 II 45 55.3 Ϯ 10.6 70.6 Ϯ 33.7 133.0 Ϯ 15.7 R1587K RR 114 54.5 Ϯ 10.7 .52 75.2 Ϯ 34.8 .063 131.7 Ϯ 16.9 .49 RK 154 54.0 Ϯ 10.3 78.1 Ϯ 34.3 131.9 Ϯ 17.5 KK 59 53.4 Ϯ 11.7 67.7 Ϯ 27.7 129.5 Ϯ 19.7 NOTE. Values are shown as mean Ϯ SD. P values were calculated by multiple linear regression analyses incorporating sex, age, and BMI as covariates. Login to comment
64 We analyzed the relationships between five SNPs and 2 insertion/deletion polymorphisms in the 5Ј flanking region and 5 missense polymorphisms of the ABCA1 gene and serum lipid levels in healthy school-aged Japanese children. We detected significant associations between the K219R and V771M polymorphisms, and HDL-C or apoAI levels. Login to comment
51 Significant associations between the K219R polymorphism and serum HDL-C or apoAI levels, and between the V771M polymorphism and apoAI levels, were observed in multiple linear regression analysis with sex, age, and BMI as covariates. Login to comment
55 *Statistical tests for TG levels were calculated on log-transformed values. Table 4. Relations Between Genotypes of Missense Polymorphisms and the Serum Levels of HDL-C, TG, and apoAI Genotype n HDL-C (mg/dL) P TG (mg/dL)* P apoAI (mg/dL) P K219R KK 97 56.9 afe; 11.3 .016 74.3 afe; 36.6 .43 136.0 afe; 18.8 .012 KR 160 52.2 afe; 10.3 77.2 afe; 32.3 128.7 afe; 17.3 RR 70 54.3 afe; 9.7 71.8 afe; 31.9 131.2 afe; 15.7 V771M VV 265 53.4 afe; 10.5 .13 74.4 afe; 32.3 .76 130.1 afe; 17.5 .035 VM 59 56.8 afe; 10.5 79.3 afe; 39.2 137.5 afe; 17.3 MM 3 57.7 afe; 18.2 71.0 afe; 14.0 133.3 afe; 23.5 V825I VV 134 53.2 afe; 10.9 .53 76.3 afe; 35.3 .77 130.7 afe; 18.3 .54 VI 156 54.9 afe; 10.3 74.8 afe; 31.6 132.5 afe; 17.2 II 37 53.8 afe; 11.2 73.1 afe; 35.4 129.5 afe; 17.4 M8831 MM 120 53.9 afe; 11.4 .73 75.3 afe; 35.1 .24 131.2 afe; 18.0 .90 MI 162 53.8 afe; 10.2 76.5 afe; 32.3 131.1 afe; 18.1 II 45 55.3 afe; 10.6 70.6 afe; 33.7 133.0 afe; 15.7 R1587K RR 114 54.5 afe; 10.7 .52 75.2 afe; 34.8 .063 131.7 afe; 16.9 .49 RK 154 54.0 afe; 10.3 78.1 afe; 34.3 131.9 afe; 17.5 KK 59 53.4 afe; 11.7 67.7 afe; 27.7 129.5 afe; 19.7 NOTE. Values are shown as mean afe; SD. P values were calculated by multiple linear regression analyses incorporating sex, age, and BMI as covariates. Login to comment
65 We analyzed the relationships between five SNPs and 2 insertion/deletion polymorphisms in the 5b18; flanking region and 5 missense polymorphisms of the ABCA1 gene and serum lipid levels in healthy school-aged Japanese children. We detected significant associations between the K219R and V771M polymorphisms, and HDL-C or apoAI levels. Login to comment

[hide] Efflux and atherosclerosis: the clinical and bioch... Arterioscler Thromb Vasc Biol. 2003 Aug 1;23(8):1322-32. Epub 2003 May 22. Singaraja RR, Brunham LR, Visscher H, Kastelein JJ, Hayden MR
Efflux and atherosclerosis: the clinical and biochemical impact of variations in the ABCA1 gene.
Arterioscler Thromb Vasc Biol. 2003 Aug 1;23(8):1322-32. Epub 2003 May 22., [PMID:12763760]

Abstract [show]
Approximately 50 mutations and many single nucleotide polymorphisms have been described in the ABCA1 gene, with mutations leading to Tangier disease and familial hypoalphalipoproteinemia. Homozygotes and heterozygotes for mutations in ABCA1 display a wide range of phenotypes. Identification of ABCA1 as the molecular defect in these diseases has allowed for ascertainment based on genetic status and determination of genotype-phenotype correlations and has permitted us to identify mutations conferring a range of severity of cellular, biochemical, and clinical phenotypes. In this study we review how genetic variation at the ABCA1 locus affects its role in the maintenance of lipid homeostasis and the natural progression of atherosclerosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon -1095A/G Promoter ⅐ ⅐ ⅐ -477C/T Promoter ⅐ ⅐ ⅐ -419A/C Promoter ⅐ ⅐ ⅐ -320G/C Promoter ⅐ ⅐ ⅐ -191G/C Promoter ⅐ ⅐ ⅐ C69T 5ЈUTR 1 C117G 5ЈUTR 1 InsG319 5ЈUTR 2 G378C 5ЈUTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
147 The R219K, V771M, and I883M variants have been recognized as putative antiatherogenic polymorphisms, associated with increased HDL-C and decreased triglyceride levels (K219 and M883) and increased HDL-C and ApoA-I (M771).41,75,82 The E1172D, R1587K cSNPs have been reported to be associated with decreased HDL-C.75 Five promoter SNPs are associated with increased severity of atherosclerosis, including the -191C/-320C/-477T hap- lotype76,78 as well as the G-191C and A-1096G SNPs. Login to comment
148 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ⅐ ⅐ ⅐ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ⅐ ⅐ ⅐ ⅐ ⅐ ⅐ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
160 Clee et al75 reported significant LD between the R219K and the V771M, K776N, I883M, and R1587K cSNPs but found that after carriers of these variants were excluded, R219K remained significantly associated with degree of atherosclerosis and triglyceride levels. Login to comment
162 Functional Effects of cSNPs and Regulatory SNPs in the ABCA1 Gene Nucleotide Amino Acid/Position Lipids CAD/Atherosclerosis Antiatherogenic SNPs C-17G Promoter No change 2 InsG319 5ЈUTR No change 2 G1051A R219K 2 TG, 1 HDL, 1 ApoA-1, 1 ApoB, 1 LDL 2 A3044G I883M 2 TG, 1 HDL 1 Proatherogenic SNPs -191C/-320C/-477T haplotype Promoter No change 1 G-191C Promoter No change 1 A-1095G Promoter No change 1 C117G 5ЈUTR 1 TG No change G2706A V771M No change 1 G2868A V825I No change 1 G3911C E1172D 2 HDL, 2 ApoB 1 G5155A R1587K 2 HDL No change Associations with lipid levels and CAD are shown by arrows to represent the direction of association. Login to comment
171 The noncoding SNPs G-191C, C-69T, C-17G, and InsG319 and the cSNPs R219K, V771M, and V825I have all been found to be associated with differences in severity of atherosclerosis but not with changes in HDL-C levels in at least 1 study. Login to comment
128 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon afa;1095A/G Promoter ዼ ዼ ዼ afa;477C/T Promoter ዼ ዼ ዼ afa;419A/C Promoter ዼ ዼ ዼ afa;320G/C Promoter ዼ ዼ ዼ afa;191G/C Promoter ዼ ዼ ዼ C69T 5b18;UTR 1 C117G 5b18;UTR 1 InsG319 5b18;UTR 2 G378C 5b18;UTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 Singaraja et al Clinical and Biochemical Impact of ABCA1 Variants markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
139 The R219K, V771M, and I883M variants have been recognized as putative antiatherogenic polymorphisms, associated with increased HDL-C and decreased triglyceride levels (K219 and M883) and increased HDL-C and ApoA-I (M771).41,75,82 The E1172D, R1587K cSNPs have been reported to be associated with decreased HDL-C.75 Five promoter SNPs are associated with increased severity of atherosclerosis, including the afa;191C/afa;320C/afa;477T hap- lotype76,78 as well as the G-191C and A-1096G SNPs. Login to comment
140 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ዼ ዼ ዼ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ዼ ዼ ዼ ዼ ዼ ዼ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
152 Clee et al75 reported significant LD between the R219K and the V771M, K776N, I883M, and R1587K cSNPs but found that after carriers of these variants were excluded, R219K remained significantly associated with degree of atherosclerosis and triglyceride levels. Login to comment
154 Functional Effects of cSNPs and Regulatory SNPs in the ABCA1 Gene Nucleotide Amino Acid/Position Lipids CAD/Atherosclerosis Antiatherogenic SNPs C-17G Promoter No change 2 InsG319 5b18;UTR No change 2 G1051A R219K 2 TG, 1 HDL, 1 ApoA-1, 1 ApoB, 1 LDL 2 A3044G I883M 2 TG, 1 HDL 1 Proatherogenic SNPs afa;191C/afa;320C/afa;477T haplotype Promoter No change 1 G-191C Promoter No change 1 A-1095G Promoter No change 1 C117G 5b18;UTR 1 TG No change G2706A V771M No change 1 G2868A V825I No change 1 G3911C E1172D 2 HDL, 2 ApoB 1 G5155A R1587K 2 HDL No change Associations with lipid levels and CAD are shown by arrows to represent the direction of association. Login to comment
163 The noncoding SNPs G-191C, C-69T, C-17G, and InsG319 and the cSNPs R219K, V771M, and V825I have all been found to be associated with differences in severity of atherosclerosis but not with changes in HDL-C levels in at least 1 study. Login to comment

[hide] Genetics of HDL regulation in humans. Curr Opin Lipidol. 2003 Jun;14(3):273-9. Miller M, Rhyne J, Hamlette S, Birnbaum J, Rodriguez A
Genetics of HDL regulation in humans.
Curr Opin Lipidol. 2003 Jun;14(3):273-9., [PMID:12840658]

Abstract [show]
PURPOSE OF REVIEW: To review gene regulation of HDL-cholesterol and discuss molecular abnormalities in HDL candidate genes that may lead to human pathologic states. RECENT FINDINGS: The inverse association between HDL-cholesterol and vascular disease, especially coronary heart disease, has long been recognized, but understanding gene regulation of HDL in humans gained considerable momentum following the identification of ABCA1 as playing a pivotal role in reverse cholesterol transport. Recent data suggest that potentially important targets for upregulating HDL in humans include upregulators of ABCA1 and APOA1 (e.g. peroxisome proliferator activated receptor and liver X receptor agonists) and downregulators of CETP (e.g. JTT-705). A host of other nuclear receptors under investigation in animal models may advance to human testing in the near future. SUMMARY: Disorders affecting HDL metabolism are complex because monogenic disorders causing low HDL do not necessarily correlate with premature vascular disease. To date, pathologic phenotypes have only been deduced among several HDL candidate genes. Understanding the genetic underpinnings associated with variant HDL and reverse cholesterol transport provides an exceptional opportunity to identify novel agents that may optimize this process and reduce vascular event rates beyond currently available LDL lowering therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 TD 1591 T/C 11 V399A extracellular [68] TD 1979 (110bpAlu Ins) 12 truncated truncation [60] TD/FHA 2154 C/T 14 R587W extracellular [67,69] TD 2164 G/C 14 W590S extracellular [61] TD 2185 A/G 14 Q597R extracellular [59,67] TD 2219 G/del 14 truncated, 635X truncated [60,61] FHA 2472-2474 3bp del 15 Del L693 TM domain #3 [59] phosphorylation 2706 G/A 16 V771M extracellular [68] 2715 A/C 16 T774P extracellular [68] 2723 G/C 16 K776N extracellular [68] 2868 G/A 17 V825I TM domain #6 [67,68] TD/FHA 3044 A/G 18 I883M cytoplasmic [68] phosphorylat site FHA 3120 C/T 19 R909X truncation [63,71] TD 3181 C/T 19 T929I cytoplasmic [62] TD 3199 A/G 19 N935S Walker A [61] TD 3205 C/T 19 A937V Walker A [61] TD 3532 C/A 22 A1046D cytoplasmic, Walker A/B [70] FHA 3667 T/C 23 M1091T cytoplasmic [63] 3690 G/T 23 D1099Y cytoplasmic [9] TD 3738 2bp del 23 1145X truncation [66] FHA 3911 G/C 24 E1172D linker/cytoplasmic [68] FHA 4242 4bp del 27 1297X truncated [64] TD 4260 G/A 27 D1289N linker cytoplasm [64,65] TD 4824 T/C 31 C1477R extracellular [59] TD 4912 C/T 32 S1506L extracellular loop #2 [71] TD 5025 ins A 34 A1544S?1552X truncation [70] 5059 T/C 34 I1555T extracellular loop #2 [67] 5155 G/A 35 R1587K extracellular loop #2 [68] FHA 5226 A/G 36 N1611D extracellular loop #2 [75..] 5338 T/C 36 L1648P extracellular loop #2 [67] TD 5443 C/T 37 R1680W cytoplasmic [74.] Login to comment

[hide] The association of the R219K polymorphism in the A... J Mol Med (Berl). 2003 Apr;81(4):264-70. Epub 2003 Mar 26. Evans D, Beil FU
The association of the R219K polymorphism in the ATP-binding cassette transporter 1 ( ABCA1) gene with coronary heart disease and hyperlipidaemia.
J Mol Med (Berl). 2003 Apr;81(4):264-70. Epub 2003 Mar 26., [PMID:12700893]

Abstract [show]
The R219K polymorphism in the ATP-binding cassette transporter 1 gene ( ABCA1) has been associated with reduced severity of atherosclerosis, fewer coronary events, decreased triglycerides and a trend to increased HDL in men with coronary heart disease (CHD). This study examined the frequency and the effect on CHD and plasma lipids of the polymorphism in patients of both sexes attending a lipid out-patient clinic. The overall frequency of the K allele was 0.26. It was lower in patients with CHD (0.21) than in those without (0.27) but this was not statistically significant. Amongst patients with elevated Lp(a) the frequency of the K allele was significantly lower in those with CHD (0.16) than in those without (0.29). There were no statistically significant differences in total cholesterol, LDL, HDL, apoB or apoAI between carriers and non-carriers. When patients with probable secondary hypertriglyceridaemia (triglycerides >1000 mg/dl), type 2 diabetes and carriers of lipoprotein lipase polymorphisms associated with hypertriglyceridaemia were excluded, the K allele was significantly associated with reduced triglycerides but only in patients with apoE 3/3 genotype. In conclusion, we provide additional evidence that the R219K polymorphism in the ABCA1 gene either directly or as a result of linkage disequilibrium with additional functional variant(s), has a protective effect against CHD and is associated with lower plasma triglycerides in sub-groups of patients with hyperlipidaemia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Clee et al. [15] found that the R219K polymorphism was in linkage disequilibrium with two less frequent variants, V771M and K776N; however, excluding patients who were also carriers of these polymorphisms did not alter the results they obtained for the R219K polymorphism. Login to comment

[hide] Common genetic variation in ABCA1 is associated wi... Circulation. 2001 Mar 6;103(9):1198-205. Clee SM, Zwinderman AH, Engert JC, Zwarts KY, Molhuizen HO, Roomp K, Jukema JW, van Wijland M, van Dam M, Hudson TJ, Brooks-Wilson A, Genest J Jr, Kastelein JJ, Hayden MR
Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease.
Circulation. 2001 Mar 6;103(9):1198-205., [PMID:11238261]

Abstract [show]
BACKGROUND: Low plasma HDL cholesterol (HDL-C) is associated with an increased risk of coronary artery disease (CAD). We recently identified the ATP-binding cassette transporter 1 (ABCA1) as the major gene underlying the HDL deficiency associated with reduced cholesterol efflux. Mutations within the ABCA1 gene are associated with decreased HDL-C, increased triglycerides, and an increased risk of CAD. However, the extent to which common variation within this gene influences plasma lipid levels and CAD in the general population is unknown. METHODS AND RESULTS: We examined the phenotypic effects of single nucleotide polymorphisms in the coding region of ABCA1. The R219K variant has a carrier frequency of 46% in Europeans. Carriers have a reduced severity of CAD, decreased focal (minimum obstruction diameter 1.81+/-0.35 versus 1.73+/-0.35 mm in noncarriers, P:=0.001) and diffuse atherosclerosis (mean segment diameter 2.77+/-0.37 versus 2.70+/-0.37 mm, P:=0.005), and fewer coronary events (50% versus 59%, P:=0.02). Atherosclerosis progresses more slowly in carriers of R219K than in noncarriers. Carriers have decreased triglyceride levels (1.42+/-0.49 versus 1.84+/-0.77 mmol/L, P:=0.001) and a trend toward increased HDL-C (0.91+/-0.22 versus 0.88+/-0.20 mmol/L, P:=0.12). Other single nucleotide polymorphisms in the coding region had milder effects on plasma lipids and atherosclerosis. CONCLUSIONS: These data suggest that common variation in ABCA1 significantly influences plasma lipid levels and the severity of CAD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed. Login to comment
48 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
85 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
134 Carriers of the V771M (nϭ37 VM) had decreased focal atherosclerosis (MOD) compared with noncarriers (Table 6) and a trend toward less diffuse atherosclerosis (increased MSD). Login to comment
135 Carriers of V771M had no difference in lipid levels compared with noncarriers. Login to comment
136 However, all but 2 carriers of V771M were also carriers of R219K. Login to comment
140 The presence of this variant in individuals heterozygous for the R2144X ABCA1 mutation was associated with further significantly decreased HDL-C compared with R2144X carriers without this polymorphism (0.16Ϯ0.04 mmol/L, nϭ2, versus 0.64Ϯ0.14 mmol/L, nϭ10; Pϭ0.0009). Login to comment
144 Two rare cSNPs (V771M and K776N) are most commonly found in individuals carrying the R219K K allele. Login to comment
145 If all V771M and K776N carriers are excluded, the results are unaltered, with increased MOD (1.80Ϯ0.35 versus 1.73Ϯ0.35 mm, Pϭ0.006) and MSD (2.76Ϯ0.36 versus 2.70Ϯ0.37 mm, Pϭ0.02) and lower mean TG levels (1.71Ϯ0.75 versus 1.84Ϯ0.77 mmol/L, Pϭ0.02) in carriers of R219K (nϭ329) compared with noncarriers (nϭ422). Login to comment
156 No significant differences in lipid levels or CAD were observed for E1172D carriers compared with R1587K heterozygotes without E1172D. Login to comment
161 ABCA cSNPs in REGRESS MOD, mm MSD, mm HDL-C, mmol/L TG, mmol/L Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P V825I 1.74Ϯ0.37 (107) 1.77Ϯ0.35 (575) 0.39 2.70Ϯ0.38 2.75Ϯ0.38 0.21 0.91Ϯ0.23 0.93Ϯ0.22 0.42 1.86Ϯ0.84 1.80Ϯ0.76 0.49 I883M 1.74Ϯ0.38 (100) 1.75Ϯ0.36 (320) 0.71 2.69Ϯ0.38 2.73Ϯ0.36 0.41 0.91Ϯ0.22 0.91Ϯ0.21 0.97 1.75Ϯ0.77 1.82Ϯ0.75 0.42 R1587K 1.77Ϯ0.34 (346) 1.76Ϯ0.37 (433) 0.75 2.73Ϯ0.39 2.74Ϯ0.36 0.64 0.90Ϯ0.22 0.94Ϯ0.23 0.03 1.79Ϯ0.76 1.81Ϯ0.78 0.77 V399A 1.92Ϯ0.32 (9) 1.73Ϯ0.35 (540) 0.13 2.73Ϯ0.40 2.71Ϯ0.37 0.89 1.03Ϯ0.28 0.92Ϯ0.23 0.15 1.71Ϯ0.63 1.82Ϯ0.78 0.68 V771M 1.89Ϯ0.38 (37) 1.76Ϯ0.35 (598) 0.045 2.83Ϯ0.49 2.73Ϯ0.37 0.13 0.91Ϯ0.20 0.92Ϯ0.22 0.58 1.98Ϯ0.79 1.78Ϯ0.76 0.11 T774P 1.63Ϯ0.31 (4) 1.76Ϯ0.36 (621) 0.47 2.85Ϯ0.34 2.73Ϯ0.37 0.52 0.85Ϯ0.07 0.93Ϯ0.22 0.50 1.90Ϯ1.04 1.82Ϯ0.77 0.84 K776N 1.92Ϯ0.33 (3) 1.78Ϯ0.34 (546) 0.48 2.95Ϯ0.48 2.76Ϯ0.37 0.36 0.94Ϯ0.28 0.93Ϯ0.22 0.93 2.25Ϯ0.94 1.76Ϯ0.76 0.26 E117SD 1.80Ϯ0.39 (34) 1.77Ϯ0.36 (610) 0.67 2.78Ϯ0.35 2.74Ϯ0.37 0.42 0.93Ϯ0.23 0.94Ϯ0.23 0.89 1.80Ϯ0.90 1.77Ϯ0.76 0.80 Values are meanϮSD (n). Login to comment
166 The phenotypic effects of the remaining cSNPs are less striking than those of R219K. Login to comment
171 The lack of obvious differences in HDL-C in carriers of different cSNPs (R219K, V771M, and I883M), together with clear differences in CAD, suggests that stimulating the RCT pathway can increase the net flux of cholesterol toward the liver without altering steady-state plasma HDL-C levels. Login to comment
186 Furthermore, we show that I883M is a common variant that is possibly associated with an increased risk of CAD in the homozygous state, although no differences in HDL-C were evident. Login to comment
191 Similarly, the region containing the V771M, T774P, and K776N variants is unlikely to be critical to ABCA1 function, because a high degree of polymorphism is tolerated without functional effects. Login to comment
39 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed. Login to comment
43 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
80 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
129 Carriers of the V771M (nafd;37 VM) had decreased focal atherosclerosis (MOD) compared with noncarriers (Table 6) and a trend toward less diffuse atherosclerosis (increased MSD). Login to comment
130 Carriers of V771M had no difference in lipid levels compared with noncarriers. Login to comment
131 However, all but 2 carriers of V771M were also carriers of R219K. Login to comment
139 Two rare cSNPs (V771M and K776N) are most commonly found in individuals carrying the R219K K allele. Login to comment

[hide] Is dyslipidemia sustained during remission of neph... Pol Arch Med Wewn. 2009 Jan-Feb;119(1-2):11-6. Ksiazek J, Ciechanowicz A, Wierzbicka A, Syczewska M, Grenda R
Is dyslipidemia sustained during remission of nephrotic syndrome genetically determined? Evaluation of genetic polymorphisms of proteins involved in lipoprotein metabolism in children and adolescents with nephrotic syndrome.
Pol Arch Med Wewn. 2009 Jan-Feb;119(1-2):11-6., [PMID:19341173]

Abstract [show]
INTRODUCTION: In same patients lipid profile disturbances persist during nephrotic syndrome remission. OBJECTIVES: The aim of the study was to evaluate the impact of the genetic polymorphisms of proteins involved in lipoprotein metabolism on persistent abnormal lipid profile in patients with nephrotic syndrome during remission. PATIENTS AND METHODS: 50 patients aged between 5.8 and 16.6 years (mean age 10.45 +/- 3.04) with nephrotic syndrome in remission of at least 8 weeks' duration, including 12 steroid-resistant and 38 steroid-dependent cases, participated in the study. We evalauated associations between lipid profile and genetic polymorphisms, V771M, V8251, and R1587K of the gene encoding the cassette ABCA1 (adenosine triphosphate binding cassette transporter A1) protein synthesis, a E3 polymorphism of the gene encoding the type upsilon of apolipoprotein E (apoE) synthesis and that of the gene encoding the cholesterol ester transfer protein (CETP) synthesis. RESULTS: Dyslipidemia was observed in 10/13 (76.9%) patients with V8251 polymorphism vs. 27/37 (73%) of non-carriers, and in 16/21 (76.2%) patients with R1587K polymorphism vs. 21/29 (72.4%) in the remaining subjects. V771M polymorphism was found only in 2 (4%) patients and one subject had abnormal lipid profile. In the presence of CETP gene polymorphism, hiperlipoproteinemia was detected in 22/31 (71%) vs. 15/19 (78.9%) in the remaining cases. The epsilon3epsilon3 apoE genotype (observed most commonly in the healthy population) was found in the majority (n=35; 70%) of patients. This genotype was also seen in most patients with abnormal serum lipid profile (in 26/37; 70.3%). Analysis of the whole population (ANOVA) did not show significant correlations between parameters of lipid profile and any of the polymorphisms studied. CONCLUSIONS: The study did not confirm associations between genetic polymorphisms of ABCA1 transporter, CETP and apoE and abnormal serum lipid profile during remission of nephrotic syndrome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 We evalauated associations between lipid profile and genetic polymorphisms, V771M, V825I, and R1587K of the gene encoding the cassette ABCA1 (adenosine triphosphate binding cassette transporter A1) protein synthesis, a b5;3 polymorphism of the gene encoding the type b5; of apolipoprotein E (apoE) synthesis and that of the gene encoding the cholesterol ester transfer protein (CETP) synthesis. Login to comment
10 V771M polymorphism was found only in 2 (4%) patients and one subject had abnormal lipid profile. Login to comment
36 Some investigators have suggestߛ ed higher incidence of specific genotypes in paߛ tients with nephritic syndrome and endߛstage Table 1ߓ Characteristics of patients Patients Total Males Females Steroidߛresistant Number (n) % ߗ 50 100 35 70 15 30 12 24 Mean age (years) SD ߗ 10.45 ߗߗ 3.04 10.5 ߗ 3.13 10.35 ߗ 2.82 Duration of treatment (years) SD ߗߗ 7.09 ߗߗ 2.88 ߗ 6.88 ߗ 3.14 ߗ 7.55 ߗ 2.19 Histological diagnosis MCNS ߗ 21 14 ߗ 7 ߗ 1 MPGN ߗ 26 19 ߗ 7 ߗ 9 FSGS ߗߗ 3 ߗ 1 ߗ 2 ߗ 2 Abbreviations: FSGS - focal segmental glomerulosclerosis, MCNS - minimal change nephrotic syndrome, MPGN - mesangial proliferative glomerulonephritis, SD - standard deviation of the ABCA1 gene (V771M, V825I and R1587K), a polymorphism of the CETP gene and polymorߛ phisms of the apoE gene. Login to comment
39 Three single nuߛ cleotide variants of guanine (G) > adenine (A) transition of the ABCA1 gene such as V771M, V825I i R1587K that determine the HDLߛC plasma level were genotyped by the selfߛdevelߛ oped method, using the restriction enzyme Tail for determining polymorphism V771M, the reߛ striction enzyme MboI for polymorphism V825I and the restriction enzyme Bgl II for R1587K polymorphism. Login to comment
56 The results were assessed in comparison with normal reference values coming from the evaluߛ ation of the healthy Warszawa population aged between 6 and 20, published previously by inߛ vestigators from the Children`s Memorial Health Institute.14 In all subjects the following genetic polyߛ morphisms were evaluated: - three nonߛsynonߛ ymous single nucleotide polymorphisms variants Table 2ߓ Median values of lipid profile parameters in patients with dyslipidemia (nߙ=ߙ37) and normolipidemia (nߙ=ߙ13) during remission of nephrotic syndrome Parameter mg/dl nߙ=ߙ13 nߙ=ߙ37 pa TC (mg/dl) 175.8 232 <0.0001 HDLߛC (mg/dl) ߗ 55 ߗ 49 NS LDLߛC (mg/dl) 100.66 163.29 <0.0001 VLDLߛC (mg/dl) ߗ 14.2308 ߗ 21.6 0.0015 TG (mg/dl) ߗ 77.2222 156.25 0.00007 ApoB (g/dl) ߗߗ 0.8067 ߗߗ 1.22 0.000004 ApoA1 (g/dl) ߗߗ 1.52 ߗߗ 1.51 NS OxyߛLDL (mU/ml) 278.28 504.9 0.0022 GPX (u/gHb) ߗ 32.30 ߗ 30.71 0.0016 Lp(a) (mg/dl) ߗ 10.20 ߗ 15.62 0.0184 Albumin (g/l) ߗ 40.73 ߗ 37.52 0.0014 aߓ MannߛWhitney`s test Abbreviations: apoA1 - apolipoprotein A1, apoB - apolipoprotein B, GPX - glutathione peroxidase, HDLߛC - highߛdensity lipoprotein cholesterol, LDLߛC - lowߛdensity lipoprotein cholesterol, Lp (a) - lipoprotein (a), NS - not significant, oxyߛLDLߛC - oxidized LDLߛcholesterol, TC - total cholesterol, TG - triglycerides, VLDLߛC - very lowߛdensity lipoprotein cholesterol Table 3ߓ Number of patients with ABCA1 genetic polymorphisms Patients Polymorphic variants V771M V825I R1587K V825 Iߙ+ߙR1587K GA GA AA GA AA GAߛGA GAߛAA s - d. ns nߙ=ߙ38 2 ߗ 9 1 11 2 5 1 s - r. ns nߙ=ߙ12 - ߗ 3 - ߗ 6 2 2 1 Overall nߙ=ߙ50 2 (4%) 13 (26%) 21 (42%) 9 (18%) Abbreviations: AA, GA, GG - variants of polymorphism of ABCA1 gene, sߛd ns - steroidߛdependent nephrotic syndrome, sߛr ns - steroidߛresistant nephrotic syndrome, in TABLE 3. Login to comment
57 The V771M of ABCA1 gene polymorߛ phism of GA variant was confirmed in 2 (4%) paߛ tients. Login to comment
81 The number and distribution of specific gene polymorphisms of ABCA1 are presented Table 4ߓ Distribution of significant (compared to reference data) lipid abnormalities in subgroups of patients divided with regard to ABCA1 genetic polymorphisms Polymorphism Disturbances V771M nߙ=ߙ2 (4%) V825I nߙ=ߙ13 (26%) R1587K nߙ=ߙ21 (42%) V8251ߙ+ߙR1587K nߙ=ߙ9 (18%) GA nߙ=ߙ2 AA GA nߙ=ߙ12 AA nߙ=ߙ1 GA nߙ=ߙ17 AA nߙ=ߙ4 GAߛGA nߙ=ߙ7 GAߛAA nߙ=ߙ2 ࢏ TC - - 1 - 2 - 1 - ࢏ TCߙ+ߙ࢏ TG 1 - 2 - 3 1 2 2 ࢏TCߙ+ߙ࢏ TGߙ+ߙ࢑ HDLߛC - - 2 - 4 1 1 - ࢏TCߙ+ߙ࢑ HDLߛC - - 1 - - 1 - - ࢏ TGߙ+ߙ࢑ HDLߛC - - 1 - 1 1 - ߙ+ߙ࢑ HDLߛC - - 2 1 2 1 1 - Overall 1 50% - 10 76.9% 16 76.2% 7 77.8% No disturbances 1 50% - 3 23.1% 5 33.8% 2 22.2% Abbreviations: AA, GA, GG - variants of polymorphism of ABCA1 gene, HDLߛC - fraction HDL of cholesterol, TC - total cholesterol, ߓ TG - triglycerides, V771M, V825I, R587K - nonߛsynonymous single nucleotide polymorphisms of ABCA1 cassette gene Table 5ߓ Distribution of significant (compared to reference data) lipid abnormalities in subgroups of patients divided with regard to CETP gene polymorphisms Polymorphism Disturbances GA variant nߙ=ߙ25 (50%) AA variant nߙ=ߙ6 (12%) ࢏ TCߙ+ߙTG 3 2 ࢏TCߙ+ߙTGߙ+ߙ࢑ HDLߛC 3 2 ࢏ TGߙ+ߙ࢑ HDLߛC 1 - ࢏ TCߙ+ߙ࢑ HDLߛC 1 - ࢏ TC 4 1 - ࢑ HDLߛC 4 1 Overall 22/31 71% No lipid disturbances 9/31 29% Abbreviations: AA, GA, GG - variants of polymorphism of the gene, HDLߛC - fraction HDL of cholesterol, TC - total cholesterol, TG - triglycerides was a nonߛsignificant trend (pߙ=ߙ0.067) in terms of association between the triglyceride level and R1587K genotype. Login to comment
100 There Table 6ߓ Distribution of significant (compared to reference data) lipid abnormalities in subgroups of patients divided with regard to apoE gene polymorphisms Lipid disturbances ApoE subtype b5;3b5;3 nߙ=ߙ35 (70%) b5;3b5;4 nߙ=ߙ6 b5;2b5;3 nߙ=ߙ5 b5;2b5;4 nߙ=ߙ1 b5;4b5;4 nߙ=ߙ2 b5;2b5;2 nߙ=ߙ1 ࢏TCߙ+ߙ࢏TGߙ+ߙ࢑ HDLߛC ߗ 4 2 2 1 - - ࢏TGߙ+ߙ࢑HDLߛC ߗ 1 - - - 1 - ࢑ HDLߛC ߗ 5 1 1 - - 1 ࢏TC ߗ 7 1 - - - - ࢏TCߙ+ߙ࢏TG ߗ 7 1 - - - - ࢏TCߙ+ߙ࢑ HDLߛC ߗ 2 - - - - - Overall 26 (74.3%) 5 3 1 1 1 No disturbances ߗ 9 (25.7%) 1 2 - 1 - Abbreviations: apoE - apolipoprotein E, HDLߛC - fraction HDL of cholesterol, TC - total cholesterol, TG - triglycerides Table 7ߓ Distribution of lipid disturbances prevalence in children with and without specific genetic polymorphisms(summary) Polymorphism Number of patients (n) with polymorphisms and lipid abnormalities with no polymorphisms and lipid abnormalities V771M nߙ=ߙ2/50 1/2 (50%) 36/48 (76.6%) V825I nߙ=ߙ13/50 10/13 (76.9%) 27/37 (73%) R1587K nߙ=ߙ21/50 16/21 (76.2%) 21/29 (72.4%) CETP nߙ=ߙ31/50 22/31 (71%) 15/19 (78.9%) apo b5;3b5;3 nߙ=ߙ35/50 26/35 (74.35) - Other types apoE nߙ=ߙ15/50 12/15 (73.3%) - Abbreviations: apoE- polymorphism of apoE gene, CETP - polymorphism of CETP gene, 14ߓ Litwin M, a;ladowska J, Antoniewicz J, et al.: Metabolic abnormalities, insulin resistance and metabolic syndrome in children with primary hyperߛ tension. Login to comment

[hide] ABCA1 mutation carriers with low high-density lipo... Eur Heart J. 2013 Jan;34(4):286-91. doi: 10.1093/eurheartj/ehs376. Epub 2012 Nov 7. Bochem AE, van Wijk DF, Holleboom AG, Duivenvoorden R, Motazacker MM, Dallinga-Thie GM, de Groot E, Kastelein JJ, Nederveen AJ, Hovingh GK, Stroes ES
ABCA1 mutation carriers with low high-density lipoprotein cholesterol are characterized by a larger atherosclerotic burden.
Eur Heart J. 2013 Jan;34(4):286-91. doi: 10.1093/eurheartj/ehs376. Epub 2012 Nov 7., [PMID:23136402]

Abstract [show]
AIMS: Low HDL-C is a potent risk factor for cardiovascular disease (CVD). Yet, mutations in ABCA1, a major determinant of circulating HDL-C levels, were previously not associated with CVD risk in cohort studies. To study the consequences of low plasma levels of high-density lipoprotein cholesterol (HDL-C) due to ATP-binding cassette transporter A1 (ABCA1) dysfunction for atherosclerotic vascular disease in the carotid arteries. METHODS AND RESULTS: We performed 3.0 Tesla magnetic resonance imaging (MRI) measurements of the carotid arteries in 36 carriers of high impact functional ABCA1 mutations and 36 normolipidemic controls. Carriers presented with 42% lower HDL-C levels (P < 0.001), a larger mean wall area (18.6 +/- 6.0 vs. 15.8 +/- 4.3 mm(2); P = 0.02), a larger mean wall thickness (0.82 +/- 0.21 vs. 0.70 +/- 0.14 mm; P = 0.005), and a higher normalized wall index (0.37 +/- 0.06 vs. 0.33 +/- 0.04; P = 0.005) compared with controls, retaining significance after adjustment for smoking, alcohol consumption, systolic blood pressure, diabetes, body mass index, history of CVD, LDL-C, and statin use (P = 0.002). CONCLUSION: Carriers of loss of function ABCA1 mutations display a larger atherosclerotic burden compared with age and sex-matched controls, implying a higher risk for CVD. Further studies are needed to elucidate the full function of ABCA1 in the protection against atherosclerosis. These data support the development of strategies to up-regulate ABCA1 in patients with established CVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Efflux measured in fibroblasts from a heterozygous p.Cys1477Arg carrier was used as a positive control since the efflux capacity has consistently been shown to be impaired.19,27 One patient compound heterozygous for mutation p.Arg579Gln and p.Val771Met was included. Login to comment
82 In the view of contradictory statements on functionality of mutation p.Val771Met,31 we assumed that the major part of the efflux impairment of the p.Arg579Gln and p.Val771Met combination is attributable to p.Arg579Gln. Login to comment

[hide] Genetic variants from lipid-related pathways and r... PLoS One. 2013;8(3):e60454. doi: 10.1371/journal.pone.0060454. Epub 2013 Mar 29. Song C, Pedersen NL, Reynolds CA, Sabater-Lleal M, Kanoni S, Willenborg C, Syvanen AC, Watkins H, Hamsten A, Prince JA, Ingelsson E
Genetic variants from lipid-related pathways and risk for incident myocardial infarction.
PLoS One. 2013;8(3):e60454. doi: 10.1371/journal.pone.0060454. Epub 2013 Mar 29., [PMID:23555974]

Abstract [show]
BACKGROUND: Circulating lipids levels, as well as several familial lipid metabolism disorders, are strongly associated with initiation and progression of atherosclerosis and incidence of myocardial infarction (MI). OBJECTIVES: We hypothesized that genetic variants associated with circulating lipid levels would also be associated with MI incidence, and have tested this in three independent samples. SETTING AND SUBJECTS: Using age- and sex-adjusted additive genetic models, we analyzed 554 single nucleotide polymorphisms (SNPs) in 41 candidate gene regions proposed to be involved in lipid-related pathways potentially predisposing to incidence of MI in 2,602 participants of the Swedish Twin Register (STR; 57% women). All associations with nominal P<0.01 were further investigated in the Uppsala Longitudinal Study of Adult Men (ULSAM; N = 1,142). RESULTS: In the present study, we report associations of lipid-related SNPs with incident MI in two community-based longitudinal studies with in silico replication in a meta-analysis of genome-wide association studies. Overall, there were 9 SNPs in STR with nominal P-value <0.01 that were successfully genotyped in ULSAM. rs4149313 located in ABCA1 was associated with MI incidence in both longitudinal study samples with nominal significance (hazard ratio, 1.36 and 1.40; P-value, 0.004 and 0.015 in STR and ULSAM, respectively). In silico replication supported the association of rs4149313 with coronary artery disease in an independent meta-analysis including 173,975 individuals of European descent from the CARDIoGRAMplusC4D consortium (odds ratio, 1.03; P-value, 0.048). CONCLUSIONS: rs4149313 is one of the few amino acid changing variants in ABCA1 known to associate with reduced cholesterol efflux. Our results are suggestive of a weak association between this variant and the development of atherosclerosis and MI.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
225 Andrikovics H, Pongracz E, Kalina E, Szilvasi A, Aslanidis C, et al. (2006) Decreased frequencies of ABCA1 polymorphisms R219K and V771M in Hungarian patients with cerebrovascular and cardiovascular diseases. Login to comment

[hide] Gene-gene combination effect and interactions amon... PLoS One. 2013 Dec 20;8(12):e82046. doi: 10.1371/journal.pone.0082046. eCollection 2013. Nakamura A, Niimura H, Kuwabara K, Takezaki T, Morita E, Wakai K, Hamajima N, Nishida Y, Turin TC, Suzuki S, Ohnaka K, Uemura H, Ozaki E, Hosono S, Mikami H, Kubo M, Tanaka H
Gene-gene combination effect and interactions among ABCA1, APOA1, SR-B1, and CETP polymorphisms for serum high-density lipoprotein-cholesterol in the Japanese population.
PLoS One. 2013 Dec 20;8(12):e82046. doi: 10.1371/journal.pone.0082046. eCollection 2013., [PMID:24376512]

Abstract [show]
BACKGROUND/OBJECTIVE: Gene-gene interactions in the reverse cholesterol transport system for high-density lipoprotein-cholesterol (HDL-C) are poorly understood. The present study observed gene-gene combination effect and interactions between single nucleotide polymorphisms (SNPs) in ABCA1, APOA1, SR-B1, and CETP in serum HDL-C from a cross-sectional study in the Japanese population. METHODS: The study population comprised 1,535 men and 1,515 women aged 35-69 years who were enrolled in the Japan Multi-Institutional Collaborative Cohort (J-MICC) Study. We selected 13 SNPs in the ABCA1, APOA1, CETP, and SR-B1 genes in the reverse cholesterol transport system. The effects of genetic and environmental factors were assessed using general linear and logistic regression models after adjusting for age, sex, and region. PRINCIPAL FINDINGS: Alcohol consumption and daily activity were positively associated with HDL-C levels, whereas smoking had a negative relationship. The T allele of CETP, rs3764261, was correlated with higher HDL-C levels and had the highest coefficient (2.93 mg/dL/allele) among the 13 SNPs, which was statistically significant after applying the Bonferroni correction (p<0.001). Gene-gene combination analysis revealed that CETP rs3764261 was associated with high HDL-C levels with any combination of SNPs from ABCA1, APOA1, and SR-B1, although no gene-gene interaction was apparent. An increasing trend for serum HDL-C was also observed with an increasing number of alleles (p<0.001). CONCLUSIONS: The present study identified a multiplier effect from a polymorphism in CETP with ABCA1, APOA1, and SR-B1, as well as a dose-dependence according to the number of alleles present.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 doi:10.1371/journal.pone.0082046.g001 polymorphisms (SNPs) that have been reported to be associated with HDL-C levels in previous studies [11-17]: ABCA1-565C.T (rs2422493), R1587K (rs2230808), -273G.C (rs1800976), V771M (rs2066718), -17C.G (rs2740483), and V825I (rs2066715); APOA1 A61T (rs12718465); LCAT (rs4986970); CETP Taq1B (rs708272), G/T (rs3764261), I405V (rs5882), and -629C.A (rs1800775); SR-B1 A.G (rs3782287), A350A (rs5888), and V135I (rs5891). Login to comment
146 Gene rs Number Alias Allele MAF ABCA1 rs2422493 2565C.T C.T 0.408 rs2230808 R1587K G.A 0.399 rs1800976 2273G.C G.C 0.409 rs2066718 V771M G.A 0.075 rs2740483 217C.G C.G 0.295 rs2066715 V825I G.A 0.361 APOA1 rs12718465 A61T C.T 0.068 CETP rs708272 Taq1B C.T 0.398 rs3764261 G/T G.T 0.272 rs5882 Ile405Val A.G 0.495 rs1800775 2629C.A A.C 0.445 SR-B1 rs3782287 A.G G.A 0.244 rs5888 A350A C.T 0.220 MAF, minor allele frequency. Login to comment

[hide] ATP-binding cassette transporters, atherosclerosis... Circ Res. 2014 Jan 3;114(1):157-70. doi: 10.1161/CIRCRESAHA.114.300738. Westerterp M, Bochem AE, Yvan-Charvet L, Murphy AJ, Wang N, Tall AR
ATP-binding cassette transporters, atherosclerosis, and inflammation.
Circ Res. 2014 Jan 3;114(1):157-70. doi: 10.1161/CIRCRESAHA.114.300738., [PMID:24385509]

Abstract [show]
Although recent genome-wide association studies have called into question the causal relationship between high-density lipoprotein (HDL) cholesterol levels and cardiovascular disease, ongoing research in animals and cells has produced increasing evidence that cholesterol efflux pathways mediated by ATP-binding cassette (ABC) transporters and HDL suppress atherosclerosis. These differing perspectives may be reconciled by a modified HDL theory that emphasizes the antiatherogenic role of cholesterol flux pathways, initiated in cells by ABC transporters. ABCA1 and ABCG1 control the proliferation of hematopoietic stem and multipotential progenitor cells in the bone marrow and hematopoietic stem and multipotential progenitor cell mobilization and extramedullary hematopoiesis in the spleen. Thus, activation of cholesterol efflux pathways by HDL infusions or liver X receptor activation results in suppression of hematopoietic stem and multipotential progenitor cell mobilization and extramedullary hematopoiesis, leading to decreased production of monocytes and neutrophils and suppression of atherosclerosis. In addition, macrophage-specific knockout of transporters has confirmed their role in suppression of inflammatory responses in the arterial wall. Recent studies have also shown that ABCG4, a close relative of ABCG1, controls platelet production, atherosclerosis, and thrombosis. ABCG4 is highly expressed in megakaryocyte progenitors, where it promotes cholesterol efflux to HDL and controls the proliferative responses to thrombopoietin. Reconstituted HDL infusions act in an ABCG4-dependent fashion to limit hypercholesterolemia-driven excessive platelet production, thrombosis, and atherogenesis, as occurs in human myeloproliferative syndromes. Activation of ABC transporter-dependent cholesterol efflux pathways in macrophages, hematopoietic stem and multipotential progenitor cells, or platelet progenitors by reconstituted HDL infusion or liver X receptor activation remain promising approaches to the treatment of human atherothrombotic diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 In a Mendelian randomization approach in a prospective cohort comprising ࣈ9000 individuals, heterozygosity for the ABCA1 mutation K776N led to a 2-to-3 times higher risk of ischemic heart disease.105 Furthermore, 5 single-nucleotide polymorphisms (SNPs) inABCA1 (V771M,V825I, I883M, E1172D, R1587K) were shown to predict risk of ischemic heart disease in a cohort of 9259 individuals.106 However, the same group reported more recently that heterozygosity for 4 loss-of-function mutations (P1065S, G1216V, N1800H, R2144X) was not associated with a higher risk of ischemic heart disease in 3 prospective cohorts comprising 56ߙ886 individuals.107 It must be noted, however, that only small decreases in HDL, of ࣈ28% as opposed to ࣈ50% in previously reported ABCA1 heterozygotes, were observed.94,101-103,107 Also, the residual cholesterol efflux was substantial (74%-79% for P1065S and G1216V and 48%-49% for N1800H and R2144X for homozygous mutations compared with controls),107 whereas in patients with TD there was only 20% to 30% residual cholesterol efflux.108 In addition, LDL levels were reduced by ࣈ25%, probably offsetting the effects of reduced HDL on CVD.107 Thus, the conflicting results in these studies could be related to inclusion of relatively mild ABCA1 mutations as well as offsetting effects of reduced LDL cholesterol levels.109 In a meta-analysis of genome-wide association studies, SNPs near the ABCA1 gene have been associated with HDL and total cholesterol levels,110,111 but not with cardiovascular risk.112 Although these studies have the benefit of huge statistical power, some caution is merited in the interpretation of findings. Login to comment

[hide] Influence of ATP-binding cassette transporter 1 R2... PLoS One. 2014 Jan 23;9(1):e86480. doi: 10.1371/journal.pone.0086480. eCollection 2014. Yin YW, Li JC, Gao D, Chen YX, Li BH, Wang JZ, Liu Y, Liao SQ, Zhang MJ, Gao CY, Zhang LL
Influence of ATP-binding cassette transporter 1 R219K and M883I polymorphisms on development of atherosclerosis: a meta-analysis of 58 studies.
PLoS One. 2014 Jan 23;9(1):e86480. doi: 10.1371/journal.pone.0086480. eCollection 2014., [PMID:24466114]

Abstract [show]
BACKGROUND: Numerous epidemiological studies have evaluated the associations between ATP-binding cassette transporter 1 (ABCA1) R219K (rs2230806) and M883I (rs4149313) polymorphisms and atherosclerosis (AS), but results remain controversial. The purpose of the present study is to investigate whether these two polymorphisms facilitate the susceptibility to AS using a meta-analysis. METHODS: PubMed, Embase, Web of Science, Medline, Cochrane database, Clinicaltrials.gov, Current Controlled Trials, Chinese Clinical Trial Registry, CBMdisc, CNKI, Google Scholar and Baidu Library were searched to get the genetic association studies. All statistical analyses were done with Stata 11.0. RESULTS: Forty-seven articles involving 58 studies were included in the final meta-analysis. For the ABCA1 R219K polymorphism, 42 studies involving 12,551 AS cases and 19,548 controls were combined showing significant association between this variant and AS risk (for K allele vs. R allele: OR = 0.77, 95% CI = 0.71-0.84, P<0.01; for K/K vs. R/R: OR = 0.60, 95% CI = 0.51-0.71, P<0.01; for K/K vs. R/K+R/R: OR = 0.69, 95% CI = 0.60-0.80, P<0.01; for K/K+R/K vs. R/R: OR = 0.74, 95% CI = 0.66-0.83, P<0.01). For the ABCA1 M883I polymorphism, 16 studies involving 4,224 AS cases and 3,462 controls were combined. There was also significant association between the variant and AS risk (for I allele vs. M allele: OR = 0.85, 95% CI = 0.77-0.95, P<0.01). CONCLUSIONS: The present meta-analysis suggested that the ABCA1 R219K and M883I polymorphisms were associated with the susceptibility to AS. However, due to the high heterogeneity in the meta-analysis, the results should be interpreted with caution.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Recently, a number of molecular epidemiological studies have been done to evaluate the associations between the ABCA1 gene polymorphisms (such as R219K, M883I, C69T, V825I, R1587K, V771M and 2565C/T) and the risk of atherosclerotic diseases [248]. Login to comment

[hide] Genetic association with low concentrations of hig... Atherosclerosis. 2014 Nov;237(1):273-8. doi: 10.1016/j.atherosclerosis.2014.08.043. Epub 2014 Sep 23. Kelishadi R, Haghjooy Javanmard S, Tajadini MH, Mansourian M, Motlagh ME, Ardalan G, Ban M
Genetic association with low concentrations of high density lipoprotein-cholesterol in a pediatric population of the Middle East and North Africa: the CASPIAN-III study.
Atherosclerosis. 2014 Nov;237(1):273-8. doi: 10.1016/j.atherosclerosis.2014.08.043. Epub 2014 Sep 23., [PMID:25286446]

Abstract [show]
OBJECTIVE: Depressed high-density lipoprotein cholesterol (HDL-C) is prevalent the Middle East and North Africa. Some studies have documented associations between HDL-C and several single nucleotide polymorphisms (SNPs) in candidate gene polymorphisms. METHODS: We investigated the associations between SNP genotypes and HDL-C levels in Iranian students, aged 10-18 years. Genotyping was performed in 750 randomly selected participants among those with low HDL-C levels (below 5th percentile), intermediate HDL-C levels (5-95th) and high HDL-C levels (above the 95th percentile). Minor allele frequencies (MAFs) of the SNPs of interest were compared between the three HDL-C groups. RESULTS: The vast majority of pairwise comparisons of MAFs between HDL-C groups were significant. Pairwise comparisons between low and high HDL-C groups showed significant between-group differences in MAFs for all SNPs, except for APOC3 rs5128. Pairwise comparisons between low and intermediate HDL-C groups showed significant between-group differences in MAFs for all SNPs, except for APOC3 rs5128 and APOA1 rs2893157. Pairwise comparisons between intermediate and high HDL-C groups showed significant between-group differences in MAFs for all SNPs, except for ABCA1 APOC3 rs5128 and APOA1 rs2893157. After adjustment for confounding factors, including age, sex, body mass index, low physical activity, consumption of saturated fats, and socioeconomic status, ABCA1 r1587K and CETP A373P significantly increased the risk of depressed HDL-C, and CETP Taq1 had a protective role. CONCLUSION: This study replicated several associations between HDL-C levels and candidate gene SNPs from genome-wide associations with HDL-C in Iranians from the pediatric age group.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 Gene name, polymorphism name and identification number (genotypes and frequencies), minor allele frequency HDL-C < 5th percentile (n &#bc; 250) HDL-C 5e95th percentile (n &#bc; 250) HDL-C > 95th percentile (n &#bc; 250) LPL D9N rs1801177 (AA/AG/GG) 226/24/0 231/19/0 250/0/0 MAF 0.048 0.038 0 LPL HindIII rs320 (GG/GT/TT) 145/102/3 117/120/13 4/121/125 MAF 0.216 0.292 0.742 LPL S447X rs328 (CC/CG/GG) 228/22/0 203/46/1 163/73/14 MAF 0.044 0.096 0.202 ABCAI V771M rs2066718 (GG/GA/AA) 249/1/0 237/13/0 234/16/0 MAF 0.002 0.026 0.032 ABCAI R1587K rs2230808 (AA/AG/GG) 106/106/38 141/93/16 194/56/0 MAF 0.364 0.250 0.112 CETP TaqIB rs708272 (CC/CT/TT) 181/67/2 63/147/40 34/162/54 MAF 0.142 0.454 0.540 CETP A373P rs5880 (CC/CG/GG) 188/58/4 217/33/0 247/3/0 MAF 0.132 0.066 0.006 APOC3 SstI rs5128 (CC/CG/GG) 208/40/2 209/39/2 211/39/0 MAF 0.088 0.086 0.078 APOA1 MspI rs2893157 (GG/GA/AA) 189/59/0 182/63/5 169/73/8 MAF 0.119 0.146 0.178 APOA5 C-1131T rs662799 (CC/CT/TT) 242/3/5 245/2/3 250/0/0 MAF 0.026 0.016 0 MAF, minor allele frequency; HDL-C, high density lipoprotein cholesterol; LPL, gene encoding lipoprotein lipase; ABCA1, gene encoding ATP binding cassette transporter A1; CETP, gene encoding cholesteryl ester transfer protein; APOC3 gene encoding apo C-III; APOA1, gene encoding apolipoprotein (apo) A-I; APOA5, gene encoding apo A-V. Login to comment
122 Another study found that the V771M SNP was associated with higher HDL levels in Turkmen [47]. Login to comment
125 A study among Japanese healthy children, documented significant associations of the ABCA1 K219R and V771M polymorphisms with HDL-C concentrations, and suggested that these alleles have antiatherogenic effects [49]. Login to comment
132 SNP (rs number) Unadjusted Adjusteda Or 95% CI for OR P-value Or 95% CI for OR P-value APOA1 Msp1 1.87 (1.55, 2.21) <0.0001 1.01 (0.67, 1.49) 0.98 ABCA1 r1587K 3.16 (2.54, 3.93) <0.0001 2.43 (1.68, 3.50) <0.0001 ABCA1 V771M 1.89 (1.62, 2.21) <0.0001 0.47 (0.19, 1.52) 0.09 CETP Taq1 0.54 (0.42, 0.67) <0.0001 0.08 (0.05, 0.13) <0.0001 CETP A373P 2.46 (2.08, 2.92) <0.0001 5.79 (3.40, 9.84) <0.0001 APOC3 Sst1 2.02 (1.71, 2.38) <0.0001 1.08 (0.68, 1.72) 0.73 HDL-C, high density lipoprotein cholesterol; SNP, single nucleotide polymorphism; OR, Odds ratio. Login to comment
135 HDL-C < 5th percentile HDL-C 5e95th percentile LPL D9N rs1801177 HDL-C 5e95th percentile NS (0.44) HDL-C>95th percentile <0.0001 <0.0001 LPL HindIII rs320 HDL-C 5e95th percentile 0.0058 HDL-C > 95th percentile <0.0001 <0.0001 LPL S447X rs328 HDL-C 5e95th percentile 0.0013 HDL-C > 95th percentile <0.0001 <0.0001 ABCAI V771M rs2066718 HDL-C 5e95th percentile 0.0012 HDL-C > 95th percentile 0.0002 NS (0.57) ABCAI R1587K rs2230808 HDL-C 5e95th percentile <0.0001 HDL-C > 95th percentile <0.0001 <0.0001 CETP TaqIB rs708272 HDL-C 5e95th percentile <0.0001 HDL-C > 95th percentile <0.0001 0.0065 CETP A373P rs5880 HDL-C 5e95th percentile 0.0005 HDL-C > 95th percentile <0.0001 <0.0001 APOC3 SstI rs5128 HDL-C 5e95th percentile NS (0.91) HDL-C > 95th percentile NS (0.57) NS (0.64) APOA1 MspI rs2893157 HDL-C 5e95th percentile NS (0.36) HDL-C > 95th percentile 0.022 NS (0.17) APOA5 C-1131T rs662799 HDL-C 5e95th percentile NS (0.27) HDL-C > 95th percentile 0.0003 0.0045 HDL-C, high density lipoprotein cholesterol; LPL, gene encoding lipoprotein lipase; ABCA1, gene encoding ATP binding cassette transporter A1; CETP, gene encoding cholesteryl ester transfer protein; APOC3 gene encoding apo C-III; APOA1, gene encoding apolipoprotein (apo) A-I; APOA5, gene encoding apo A-V; NS, not significant. Login to comment

[hide] ATP-binding cassette transporter 1 C69T and V825I ... Thromb Res. 2015 Jan;135(1):130-6. doi: 10.1016/j.thromres.2014.10.022. Epub 2014 Nov 4. Yin YW, Wang Q, Sun QQ, Hu AM, Liu HL
ATP-binding cassette transporter 1 C69T and V825I polymorphisms in the development of atherosclerosis: a meta-analysis of 18,320 subjects.
Thromb Res. 2015 Jan;135(1):130-6. doi: 10.1016/j.thromres.2014.10.022. Epub 2014 Nov 4., [PMID:25527331]

Abstract [show]
INTRODUCTION: ATP-binding cassette transporter 1 (ABCA1), a member of the ATP-binding cassette family, plays a critical role in the development of atherosclerosis (AS). This meta-analysis was performed to assess the associations of ABCA1 C69T and V825I polymorphisms with AS susceptibility. MATERIALS AND METHODS: A comprehensive search was conducted to identify all eligible studies from PubMed, Embase, Web of Science, Cochrane database, CBMdisc, CNKI and Google Scholar. Additionally, hand searching of the references of identified articles was performed. All statistical analyses were done with Review Manager 5.1.4 and Stata 11.0. RESULTS: Eleven articles involving 14 studies were included in the final meta-analysis. For the ABCA1 C69T polymorphism, six studies involving 1854 AS cases and 5744 controls were combined showing significant association between this variant and AS risk (for T allele vs. C allele: OR =1.44, 95% CI =1.04-1.24, p =0.005; for T/T vs. C/C: OR =1.39, 95% CI =1.12-1.73, p =0.003; for T/T vs. C/T+C/C: OR =1.34, 95% CI =1.09-1.65, p =0.006; for T/T+C/T vs. C/C: OR =1.13, 95% CI =1.01-1.27, p =0.040). For the ABCA1 V825I polymorphism, eight studies involving 2026 AS cases and 8696 controls were combined. There was no significant association between the variant and AS risk (for I allele vs. V allele: OR =1.18, 95% CI =0.90-1.53, p =0.230; for I/I vs. V/V: OR =1.29, 95% CI =0.75-2.23, p =0.360; for I/I vs. V/I+V/V: OR =1.40, 95% CI =0.87-2.26, p =0.160; for I/I+V/I vs. V/V: OR =1.15, 95% CI =1.00-1.33, p =0.060). CONCLUSIONS: This meta-analysis suggested that the ABCA1 C69T polymorphism was associated with an increased AS risk. Furthermore, there was no significant association between the ABCA1 V825I polymorphism and AS risk.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
122 So far, at least seven single-nucleotide polymorphisms at the ABCA1 gene promoter have been studied to investigate the associations between these variants and the susceptibility of atherosclerotic diseases, such as R219K, M883I, C69T, V825I, R1587K, V771M and -565C/T. Login to comment

[hide] Functional and Structural Impact of ATP-Binding Ca... Mol Diagn Ther. 2015 Aug;19(4):221-34. doi: 10.1007/s40291-015-0150-7. Fawzy MS, Alhadramy O, Hussein MH, Ismail HM, Ismail NM, Biomy NM, Toraih EA
Functional and Structural Impact of ATP-Binding Cassette Transporter A1 R219K and I883M Gene Polymorphisms in Obese Children and Adolescents.
Mol Diagn Ther. 2015 Aug;19(4):221-34. doi: 10.1007/s40291-015-0150-7., [PMID:26243156]

Abstract [show]
INTRODUCTION: Obesity is a serious medical condition that affects children and adolescents. ATP-binding cassette transporter A1 (ABCA1) protein is known to mediate the transport of intracellular cholesterol and phospholipids across the cell membranes. Thus, we aimed to investigate the association between ABCA1 gene polymorphisms and overweight/obesity risk, and to evaluate their relation to the lipid profile. MATERIALS AND METHODS: The study included in silico analysis of ABCA1 gene and protein. Two genetic variants in ABCA1 gene-R219K (rs2230806; G/A) and I883M (rs2066714; A/G)-were genotyped in 128 normal weight and 128 overweight/obese subjects using polymerase chain reaction-restriction fragment length polymorphism technology. Anthropometric and biochemical assessments were performed. RESULTS: Our findings suggest that the heterozygote GA genotype of R219K polymorphism increased susceptibility to obesity under the heterozygous model (odds ratio 2.75, 95 % CI 1.01-6.12; p = 0.014) compared with the control group. This susceptibility could be gender-specific, with higher risk among females. In addition, the A variant was associated with a higher degree of obesity (p < 0.001). On the other hand, individuals with the G variant of I883M polymorphism showed lower susceptibility to obesity under all genetic models (allelic, homozygote, heterozygote, dominant, and recessive models; p < 0.05), with no observed association with body mass index or degree of obesity. However, both single nucleotide polymorphisms (SNPs) showed significant differences in lipid levels among patients with different genotypes. CONCLUSIONS: The study results suggest that R219K and I883M SNPs of the ABCA1 gene may play a role in susceptibility to obesity in our Egyptian population; the former increases susceptibility and phenotype severity, and the latter is protective. Larger epidemiological studies are needed for validation of the results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
220 Moreover, in the ABCA1 gene, a strong linkage disequilibrium exists between R219K/V771M and M825I/I883M (D0 [ 0.9) [21]. Login to comment
221 The two SNPs (V771M and M825I) were previously found to be associated with increased plasma HDL-c and cholesterol concentration, respectively, thus speculating the probability that R219K and I883M may not be the true associated variants, but could instead reflect the functional impact of other nearby linked gene polymorphisms. Login to comment