ABCMdb

PMID: 14767869

Yamakawa-Kobayashi K, Yanagi H, Yu Y, Endo K, Arinami T, Hamaguchi H
Associations between serum high-density lipoprotein cholesterol or apolipoprotein AI levels and common genetic variants of the ABCA1 gene in Japanese school-aged children.
Metabolism. 2004 Feb;53(2):182-6., [PubMed]

Sentences

No. Mutations Sentence Comment

2 ABCA1 p.Val771Met In the present study, we analyzed the relationships between 5 single nucleotide polymorphisms (SNPs) and 2 insertion/deletion polymorphisms in the 5؅ flanking region and 5 missense polymorphisms of the ABCA1 gene and serum lipid levels in healthy school-aged children. We detected significant associations between the K219R and V771M polymorphisms, and HDL-C or apoAI levels. Login to comment 39 ABCA1 p.Val825Ile ABCA1 p.Val771Met Missense Polymorphisms in the Coding Region To date, in the coding region of the ABCA1 gene, 9 SNPs inducing amino acid changes have been reported in the dbSNP database; we have ascertained that at least 5 of these missense mutations (K219R, V771M, V825I, M883I, and R1587K) are polymorphic in Japanese populations. Login to comment 40 ABCA1 p.Val825Ile ABCA1 p.Val771Met Tight linkage disequilib- liums were observed between the V771M polymorphism and the M883I polymorphism, and the V825I polymorphism and the M883I polymorphism (data not shown). Login to comment 46 ABCA1 p.Val771Met ABCA1 p.Val771Met PCR Primers, Annealing Temperatures, Sizes of Amplified Fragments, and Restriction Enzymes Used for Genotyping of Each Polymorphism Forward Primer Reverse Primer Annealing Temp (°C) Size of Amplified Fragment (bp) Restriction Enzyme 5Ј-flanking region -937 to -936delAT F: CCTCTTCTACGGGTCTGTCCTG R: CAGCCTCCCTGTGATAAAAACA 64 321, 323 NlaIII -707G3A F: TGGAGGTCTGGAGTGGCTACAT R: CACAGAACAATATGGACCAGGCC 60 156 StuI -675 to -674ins GTTTGTTTT or insGTTTT F: CTGGTCCATATTGTTCTGTGTT R: CATAAATTGAGAGGAAGGAGGC 58 76, 81, 85 - -477C3T F: CGCCTATCAAAAATCAAAGTCC R: TCCGCGGTCTGCGTCCCCTTCC 60 371 AciI -320G3C F: AAAAAATTGCGGAAAGTA R: GCCGCAGACTCTCTAGTCCA 56 86 RsaI -191G3C F: CAAATTCCACTGGTGCCCTTGG R: TGTCTTAGGGTCCGCGGTCTGGGT 60 140 AvaII -17G3C F: ACCCCCACCCCACCCACCTCCC R: GTGCTCTCCCTCCTCCCCGCCGC 62 158 BstUI Coding region K219R F: TGACAAGTCTGTGCAATGGA R: GGCTTAAACTCAGCCACACC 58 379 StyI V771M F: AGTGCTTGGGATTGTTGAGG R: CACTGAAGAAAGGCCAGAGG 58 300 BsaAI V8251 F: CTGCTGTCTCCTGTGGCTTT R: GCTGCCTGTCCTTGGACTAT 58 349 Bsm AI M883I F: ACCCTGGTTCCAACCAGAAGAGGAT R: TTTAGAAAGGCAGGAGACATCG 58 125 EcoRV R1587K F: AGATTTATGACAGGACTGGACATCA R: CTGCCAACTTTACCATGAGTTG 55 129 Hpy188I NOTE. Mismatch nucleotides in primers are underlined. Login to comment 50 ABCA1 p.Val771Met Significant associations between the K219R polymorphism and serum HDL-C or apoAI levels, and between the V771M polymorphism and apoAI levels, were observed in multiple linear regression analysis with sex, age, and BMI as covariates. Login to comment 51 ABCA1 p.Val771Met Significant associations between the K219R polymorphism and serum HDL-C or apoAI levels, and between the V771M polymorphism and apoAI levels, were observed in multiple linear regression analysis with sex, age, and BMI as covariates. Login to comment 54 ABCA1 p.Val825Ile ABCA1 p.Val771Met *Statistical tests for TG levels were calculated on log-transformed values. Table 4. Relations Between Genotypes of Missense Polymorphisms and the Serum Levels of HDL-C, TG, and apoAI Genotype n HDL-C (mg/dL) P TG (mg/dL)* P apoAI (mg/dL) P K219R KK 97 56.9 Ϯ 11.3 .016 74.3 Ϯ 36.6 .43 136.0 Ϯ 18.8 .012 KR 160 52.2 Ϯ 10.3 77.2 Ϯ 32.3 128.7 Ϯ 17.3 RR 70 54.3 Ϯ 9.7 71.8 Ϯ 31.9 131.2 Ϯ 15.7 V771M VV 265 53.4 Ϯ 10.5 .13 74.4 Ϯ 32.3 .76 130.1 Ϯ 17.5 .035 VM 59 56.8 Ϯ 10.5 79.3 Ϯ 39.2 137.5 Ϯ 17.3 MM 3 57.7 Ϯ 18.2 71.0 Ϯ 14.0 133.3 Ϯ 23.5 V825I VV 134 53.2 Ϯ 10.9 .53 76.3 Ϯ 35.3 .77 130.7 Ϯ 18.3 .54 VI 156 54.9 Ϯ 10.3 74.8 Ϯ 31.6 132.5 Ϯ 17.2 II 37 53.8 Ϯ 11.2 73.1 Ϯ 35.4 129.5 Ϯ 17.4 M8831 MM 120 53.9 Ϯ 11.4 .73 75.3 Ϯ 35.1 .24 131.2 Ϯ 18.0 .90 MI 162 53.8 Ϯ 10.2 76.5 Ϯ 32.3 131.1 Ϯ 18.1 II 45 55.3 Ϯ 10.6 70.6 Ϯ 33.7 133.0 Ϯ 15.7 R1587K RR 114 54.5 Ϯ 10.7 .52 75.2 Ϯ 34.8 .063 131.7 Ϯ 16.9 .49 RK 154 54.0 Ϯ 10.3 78.1 Ϯ 34.3 131.9 Ϯ 17.5 KK 59 53.4 Ϯ 11.7 67.7 Ϯ 27.7 129.5 Ϯ 19.7 NOTE. Values are shown as mean Ϯ SD. P values were calculated by multiple linear regression analyses incorporating sex, age, and BMI as covariates. Login to comment 55 ABCA1 p.Val825Ile ABCA1 p.Val771Met *Statistical tests for TG levels were calculated on log-transformed values. Table 4. Relations Between Genotypes of Missense Polymorphisms and the Serum Levels of HDL-C, TG, and apoAI Genotype n HDL-C (mg/dL) P TG (mg/dL)* P apoAI (mg/dL) P K219R KK 97 56.9 afe; 11.3 .016 74.3 afe; 36.6 .43 136.0 afe; 18.8 .012 KR 160 52.2 afe; 10.3 77.2 afe; 32.3 128.7 afe; 17.3 RR 70 54.3 afe; 9.7 71.8 afe; 31.9 131.2 afe; 15.7 V771M VV 265 53.4 afe; 10.5 .13 74.4 afe; 32.3 .76 130.1 afe; 17.5 .035 VM 59 56.8 afe; 10.5 79.3 afe; 39.2 137.5 afe; 17.3 MM 3 57.7 afe; 18.2 71.0 afe; 14.0 133.3 afe; 23.5 V825I VV 134 53.2 afe; 10.9 .53 76.3 afe; 35.3 .77 130.7 afe; 18.3 .54 VI 156 54.9 afe; 10.3 74.8 afe; 31.6 132.5 afe; 17.2 II 37 53.8 afe; 11.2 73.1 afe; 35.4 129.5 afe; 17.4 M8831 MM 120 53.9 afe; 11.4 .73 75.3 afe; 35.1 .24 131.2 afe; 18.0 .90 MI 162 53.8 afe; 10.2 76.5 afe; 32.3 131.1 afe; 18.1 II 45 55.3 afe; 10.6 70.6 afe; 33.7 133.0 afe; 15.7 R1587K RR 114 54.5 afe; 10.7 .52 75.2 afe; 34.8 .063 131.7 afe; 16.9 .49 RK 154 54.0 afe; 10.3 78.1 afe; 34.3 131.9 afe; 17.5 KK 59 53.4 afe; 11.7 67.7 afe; 27.7 129.5 afe; 19.7 NOTE. Values are shown as mean afe; SD. P values were calculated by multiple linear regression analyses incorporating sex, age, and BMI as covariates. Login to comment 59 ABCA1 p.Val825Ile However, no significant associations were observed between the remaining 3 missense polymorphisms (V825I, M883I, and R1587K) and serum HDL-C, TG, and apoAI levels (Table 4). Login to comment 60 ABCA1 p.Val825Ile However, no significant associations were observed between the remaining 3 missense polymorphisms (V825I, M883I, and R1587K) and serum HDL-C, TG, and apoAI levels (Table 4). Login to comment 64 ABCA1 p.Val771Met We analyzed the relationships between five SNPs and 2 insertion/deletion polymorphisms in the 5Ј flanking region and 5 missense polymorphisms of the ABCA1 gene and serum lipid levels in healthy school-aged Japanese children. We detected significant associations between the K219R and V771M polymorphisms, and HDL-C or apoAI levels. Login to comment 65 ABCA1 p.Val771Met We analyzed the relationships between five SNPs and 2 insertion/deletion polymorphisms in the 5b18; flanking region and 5 missense polymorphisms of the ABCA1 gene and serum lipid levels in healthy school-aged Japanese children. We detected significant associations between the K219R and V771M polymorphisms, and HDL-C or apoAI levels. Login to comment