ABCC7 p.Arg347His
[switch to full view]Comments [show]
PMID: 16442101
[PubMed]
Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."
No.
Sentence
Comment
415
Clain et al. [201] showed that R347H was associated with mild defective ClÀ channel activity and that D979A defect led to misprocessing.
X
ABCC7 p.Arg347His 16442101:415:31
status: NEW
PMID: 10026154
[PubMed]
Cotten JF et al: "Cystic fibrosis-associated mutations at arginine 347 alter the pore architecture of CFTR. Evidence for disruption of a salt bridge."
No.
Sentence
Comment
1
To better understand the function of Arg-347 and to learn how mutations at this site disrupt channel activity, we mutated Arg-347 to Asp, Cys, Glu, His, Leu, or Lys and examined single-channel function.
X
ABCC7 p.Arg347His 10026154:1:122
status: NEW12 At least four CF-associated mutations have been identified at position 347 in M6: R347C, R347H, R347L, and R347P, suggesting that Arg-347 is important for CFTR structure and function (13-15).2 Early studies by Sheppard et al. (7) showed that mutation of Arg-347 to proline significantly decreased single-channel conductance with little effect on CFTR trafficking to the plasma membrane.
X
ABCC7 p.Arg347His 10026154:12:89
status: NEW14 Interestingly, mutation of Arg-347 to a histidine (R347H) produced a channel that displayed pH-dependent conductance and anomalous mole-fraction behavior (8).
X
ABCC7 p.Arg347His 10026154:14:27
status: NEWX
ABCC7 p.Arg347His 10026154:14:51
status: NEW18 For example, mutation of this site could lead to a change in MSD conformation and loss of an anion-binding site(s) elsewhere; protonation of His-347 might then rescue the conformation of the R347H mutant.
X
ABCC7 p.Arg347His 10026154:18:191
status: NEW25 We examined the cytosolic pH (pHc)-dependent behavior of CFTR-R347H and that of the other residue 347 mutants both with (R347C, R347D, R347E, and R347K) and without (R347L) a pHc-titratable residue.
X
ABCC7 p.Arg347His 10026154:25:62
status: NEW26 The conductance of CFTR-R347H is pHc-dependent.
X
ABCC7 p.Arg347His 10026154:26:24
status: NEW37 9, Issue of February 26, pp. 5429-5435, 1999 (c) 1999 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. This paper is available on line at http://www.jbc.org tion may exist in one of two states, either protonated or deprotonated, we tested the hypothesis that CFTR-R347H may display two pHc-dependent conductance states, which it did.
X
ABCC7 p.Arg347His 10026154:37:304
status: NEW40 Moreover, like CFTR-R347H, all the other residue 347 mutants, except R347K, displayed two pHc-dependent conductance states over a similar pHc range.
X
ABCC7 p.Arg347His 10026154:40:20
status: NEW69 RESULTS pHc-dependent Conductance of Residue 347 Mutants-To determine whether R347H exhibits two discrete conductance states, we studied single channels in excised, inside-out patches.
X
ABCC7 p.Arg347His 10026154:69:78
status: NEW74 from R347H displaying two pHc-dependent conductance states, OL and OB.
X
ABCC7 p.Arg347His 10026154:74:5
status: NEW86 Visual inspection suggested that the lifetimes of OL and OB states were also influenced by the nature of the residue at position 347: R347E and R347H tended to have longer dwell times in the OL and OB states, whereas R347L, R347C, and R347D tended to display shorter dwell times.
X
ABCC7 p.Arg347His 10026154:86:144
status: NEW91 Single-channel Conductance of Residue 347 Mutants-To determine whether the residue at position 347 affects single-channel conductance and not merely the conductance state of the channel, we examined the I-V relationship and slope conductance of the mutants with slower pHc-dependent kinetics, R347H and R347E, as well as R347K.
X
ABCC7 p.Arg347His 10026154:91:293
status: NEW94 The single-channel conductance at pHc 6.0 of wild-type CFTR, R347K, and the OB state of R347E and R347H were all very similar (in pS): 7.7 Ϯ 0.4, 8.3 Ϯ 0.6, 7.4 Ϯ 0.4, and 6.9 Ϯ 0.2, respectively (n ϭ 3 for each).
X
ABCC7 p.Arg347His 10026154:94:98
status: NEW95 The single-channel conductance of the OL states of R347E and R347H at pHc 6.0 were also very similar (in pS): 1.5 Ϯ 0.1 and 1.6 Ϯ 0.1, respectively (n ϭ 3 and 4 for each).
X
ABCC7 p.Arg347His 10026154:95:61
status: NEW107 Dwell-time Analysis of OL and OB States-We performed a dwell-time analysis of the lifetimes of the OL and OB states of R347E and R347H to enable more quantitative comparisons between them and to better understand their pHc dependence.
X
ABCC7 p.Arg347His 10026154:107:129
status: NEW113 The observable pK (0 mV) for the equilibrium between OL and OB of R347E and R347H were 6.4 and 6.3, respectively. The faster kinetics of R347D, R347C, and R347L made dwell-time analysis for these mutants less reliable.
X
ABCC7 p.Arg347His 10026154:113:76
status: NEW119 Single-channel I-V relationships for R347E (OL and OB states), R347H (OL and OB states), R347K, R347D/D924R, and wild-type CFTR at pHc 6.0. n ϭ 2-4 at each data point.
X
ABCC7 p.Arg347His 10026154:119:63
status: NEW125 Fig. 4B shows quantitatively that at pHc 6.0 the OL and OB states for R347E and R347H were both influenced by the transmembrane voltage.
X
ABCC7 p.Arg347His 10026154:125:80
status: NEW128 The degree of voltage dependence was similar for both mutants despite the charge differences at residue 347 and yielded a z of 0.25 and 0.21 for R347E and R347H, respectively. The voltage dependence was asymmetrically disposed between the rate of entry into the OB state and the rate of exit from OB (Fig. 4B).
X
ABCC7 p.Arg347His 10026154:128:163
status: NEW130 The rate of exit from the OB state (B -1 ) was more voltage-dependent than the rate of exit from the OL state (L -1 ) for both mutants (␦ ϭ 0.8 versus 1 - ␦ ϭ 0.2 for R347E and ␦ ϭ 0.7 versus 1 - ␦ ϭ 0.3 for R347H).
X
ABCC7 p.Arg347His 10026154:130:276
status: NEW134 A, dwell-time analysis in the OL and OB conductance states versus pHc for R347E and R347H.
X
ABCC7 p.Arg347His 10026154:134:84
status: NEW144 B, dwell times (pHc 6.0) in the OL state (closed symbols) or OB state (open symbols) versus voltage for R347E (left, circles) and R347H (right, squares).
X
ABCC7 p.Arg347His 10026154:144:130
status: NEW147 arises from charge movement through a voltage field and since R347E and R347H displayed similar voltage dependences and carry different charges at position 347, residue 347 is not likely moving through a transmembrane potential during interchange between OL and OB states.
X
ABCC7 p.Arg347His 10026154:147:72
status: NEW171 Additionally, the single-channel slope conductances of R347H and R347E were the same in both OB and OL states.
X
ABCC7 p.Arg347His 10026154:171:55
status: NEW210 The Arg-347 residue is targeted by several CF-associated mutations, R347C, R347H, R347L, and R347P (13-15).2 Our data suggest that CF-associated as well as other mutations at residue 347 affect CFTR similarly.
X
ABCC7 p.Arg347His 10026154:210:75
status: NEW
PMID: 10376575
[PubMed]
Mak V et al: "Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia."
No.
Sentence
Comment
28
Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining.
X
ABCC7 p.Arg347His 10376575:28:263
status: NEW
PMID: 10439967
[PubMed]
Liechti-Gallati S et al: "Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease."
No.
Sentence
Comment
20
The distribution of analysed known mutations is similar to that of the total number of mutations in the entire CFTR gene: missense mutations account for 35% (G27E, G85E, R117H, A120T, I148T, H199Y, R334W, T338I, R347P, R347H, A455E, M718K, S5449N, S5449I, G551D, R560T, R560S, S945L, S977P, I1005R, R1066C, R1070Q, M1101K, D1152H, S1235R, R1283M, N1303K, N1303H), followed by 28% of frameshift mutations (175delC, 394delTT, 457TAT- > G, 905delG, 1078delT, I507, F508, 1609delCA, 1677delTA, 2143delT, 2176insC, 218delA, 2184insA, 2869insG, 3659delC, 3732delA, 3821delT, 3905insT, 4016insT, 4172delGC, 4382delA), 21% of nonsense mutations (Q30X, Q39X, Q220X, W401X, Q525X, G542X, Q552X, R553X, V569X, E585X, K710X, R792X, Y1092X, R1162X, S1255X, W1282X, E1371X), and 16% of splice site mutations (621 + 1G- > T, 711 + 1G- > T, 711 + 5G- > A, 1717-1G- > A, 1898 + 1G- > A, 1898 + 5G- > T, 2789 + 5G- > A, 3271 + 1G- > A, 3272-26A- > G, 3601-17T- > C, 3849 + 4A- > G, 3849 + 10kbC- > T, 4374 + 1G- > T).
X
ABCC7 p.Arg347His 10439967:20:219
status: NEW44 Three mutations (R1066C, M1101K, E1371X) could only be identified after restriction enzyme digestion of the amplification product, and five mutations (711 + 1G- > T, R347H, T338I, Y1092X, S1255X) were discovered in the uncut, but not in the digested, PCR product.
X
ABCC7 p.Arg347His 10439967:44:166
status: NEW
PMID: 10444722
[PubMed]
Gasparini P et al: "Analysis of 31 CFTR mutations by polymerase chain reaction/oligonucleotide ligation assay in a pilot screening of 4476 newborns for cystic fibrosis."
No.
Sentence
Comment
46
Table 1 Mutations analysed in the CFTR gene using polymerase chain reaction/oligonucleotide litigation assay/sequence coded separation Mutation Location Nucleotide Result F508 Exon 10 3 bp deletion Deletion of Phe-508 I507 Exon 10 3 bp deletion Deletion of Ile-507 (or -506) Q493X Exon 10 C-1609 →→ T Gln-493 → Stop V520F Exon 10 G-1690 → T Val-520 → Phe 1717-1G → A Intron 10 G-1717-1 → A 3`-splice site mutation G542X Exon 11 G-1756 → T Gly-542 → Stop G551D Exon 11 G-1784 → A Gly-551 → Asp R553X Exon 11 C-1789 → T Arg-553 → Stop R560T Exon 11 G-1811 → C Arg-560 → Thr S549R Exon 11 T-1779 → G Ser-549 → Arg S549N Exon 11 G-1778 → A Ser-549 → Asn 3849+10 kb C → T Intron 19 C-3849+10 kb → T Splice mutation 3849+4A → G Intron 19 A-3849+4 → G Splice mutation R1162X Exon 19 C-3616 → T Arg-1162 → Stop 3659delC Exon 19 1 bp deletion Frameshift W1282X Exon 20 G-3978 → A Trp-1282 → Stop 3905insT Exon 20 1 bp insertion Frameshift N1303K Exon 21 C-4041 → G Asn-1303 → Lys G85E Exon 3 G-386 → A Gly-85 → Glu 621+1G → T Intron 4 G-621+1 → T 5`-splice site mutation R117H Exon 4 G-482 → A Arg-117 → His Y122X Exon 4 T-498 → A Tyr-122 → Stop 711+1G → T Intron 5 G-711+1 → T 5`-splice site mutation 1078delT Exon 7 1 bp deletion Frameshift R347P Exon 7 G-1172 → C Arg-347 → Pro R347H Exon 7 G-1172 → A Arg-347 → His R334W Exon 7 C-1132 → T Arg-334 → Trp A455E Exon 9 C-1496 → A Ala-455 → Glu 1898+1G → A Intron 12 G-1898+1 → A 5`-splice site mutation 2184delA Exon 13 Deletion A-2184; A-2183 → G Frameshift 2789+5G → A Intron 14B G-2789+5 → A Splice mutation Table 2 Summary of cystic fibrosis screening results No of samples analysed Normal subjects Carriers Carrier frequency Turin 1574 1521 53 1/29.7 Pavia 1341 1299 42 1/31.9 San Giovanni Rotondo 1561 1512 49 1/31.8 Total 4476 4332 144 1/31.1 Table 3 Detailed list of mutations detected in the Italian population Centre F508 G542X R347P 2183-AG N1303K 711+1GT 1717-1A R347H R117H 1898+1G 2789+5G W1282X R1162X I507 Other TO 33 2 1 1 5 1 1 2 3 2 2 - - - PV 27 - - 1 2 - 1 - 5 - 1 2 1 1 SGR 30 14 2 1 1 1 - - - - - - - - TO, Dipartimento di Patologia Clinica, Ospedale Infantile "Regina Margherita, Torino; PV, Istituto di Anatomia Patologica, Sezione di Anatomia Patologica, Università di Pavia, Pavia; SGR, Servizio di Genetica Medica and Divisione di Neonatologia, IRCCS Casa Sollievo della SoVerenza, San Giovanni Rotondo, Foggia.
X
ABCC7 p.Arg347His 10444722:46:1559
status: NEWX
ABCC7 p.Arg347His 10444722:46:2281
status: NEW
No.
Sentence
Comment
84
CFTR mutations and male fertility Disorder Number of Proportion of Most frequent mutations (%) patients mutated alleles (%) Ethnic origin Reference CBAVD 17 20.6* DF508 (20.6) French Dumur et al. (1990b) CBAVD 25 38.0 DF508 (26.0) Northern European Anguiano et al. (1992) CBAVD 12 41.7 DF508 (20.8) French Culard et al. (1994) CBAVD 49 45.9 DF508 (32.6), R117H (6.1) Caucasians Oates & Amos (1994) CBAVD 47 21.3 DF508 (8.5), D1152H (3.2) Mostly Askenazim Augarten et al. (1994) CBAVD 30 41.7 DF508 (15.0), G542X (6.7), R117H (3.3) Spanish Casals et al. (1994) CBAVD 67 44.8 DF508 (20.9), R117H (4.5), W1282X (3.7) French Mercier et al. (1995) CBAVD 102 65.7+a DF508 (21.6), 5T (21.1), R347H (2.4) Caucasians Chillon et al. (1995) CBAVD 45 75.6+b DF508 (25.6), 5T (25.6), R117H (3.3), W1282X (3.3) French Costes et al. (1995) CBAVD 25 52.0+c 5T (26.0), DF508 (12.0), R117H (6.0) Caucasian Jarvi et al. (1995) CBAVD 70 68.6+d 5T (25.7), DF508 (19.3), W1282X (7.9) Mostly Caucasian Zielenski et al. (1995) CBAVD 101 79.2+e DF508 (26.2), R117H (11.4), 5T (12.9) Mostly German Do¨rk et al. (1997) CUAVD 10 5.0 DF508 (5.0) Spanish Casals et al. (1995) CUAVD 21 19.0 DF508 (9.5), R117H (4.8) Caucasian Mickle et al. (1995) BEDO 7 78.6 DF508 (28.5), 5T (21.4), R117H (14.3) Mostly German Meschede et al. (1997) IASV 16 3.1 I1139V (3.1) Mostly German Meschede et al. (1997) Azoospermia† 17 23.5+c 5T (14.7), R117H (5.9) DF508 (2.9) Caucasian Jarvi et al. (1995) Azoospermia 21 9.5 DF508 (2.4), G551D (2.4), R117H (2.4), G542X (2.4) Caucasian van der Ven et al. (1996) Spermatogenic failure 18 5.5+c G542X (2.8), 5T (2.8) Caucasian Jarvi et al. (1995) Spermatogenic failure 80 8.7 G542X (4.4), DF508 (3.1) Caucasian van der Ven et al. (1996) Spermatogenic failure 75 2.7+f DF508 (1.3), R117H (0.6), 5T (0.6) Dutch Tuerlings et al. (1998) *Testing only for DF508; +testing included the 5T allele; a-f, frequency of the 5T allele in the general population: a5.2%, n=498; b5.3%, n=131; c,dnot determined; e4.8%, n=186; f3.7%, n=212; †azoospermia with normal vas deferens and bilateral epididymal obstruction.
X
ABCC7 p.Arg347His 10755189:84:685
status: NEW
PMID: 10875876
[PubMed]
Viville S et al: "Histological and genetic analysis and risk assessment for chromosomal aberration after ICSI for patients presenting with CBAVD."
No.
Sentence
Comment
49
These samples were at least one mutation, three patients (27%) presented only washed once in phosphate-buffered saline (PBS) and placed in an the ∆F508 mutation and five (45%) presented compound area previously delimited with a diamond pen on superfrosted slides heterozygosity for ∆F508/R347H, ∆F508/R117C, ∆F508/5T, (CML, France).
X
ABCC7 p.Arg347His 10875876:49:302
status: NEW60 TMI score Johnsen score CF mutation screening Sweat test Karyotype Family history 1 1 12 NF ND ND No 2 1 12 ∆F508/NF ND Normal No 3 3 11 R117H-7T/5T ND Normal No 4 3 11 NF ND Normal Yes 5 1 11 ∆F508/NF ND Normal No 6 2 11 ∆F508/R347H ND ND Yes 7 4 10 ∆F508/5T ND ND No 8 3 10 ∆F508/NF Neg ND No 9 1 11 NF Pos ND No 10 2 11 ∆F508/R117C Pos ND Yes 11 2 11 ∆F508/D443Y Pos ND No TMI ϭ tubule/membrane/interstitium; CF ϭ cystic fibrosis; ND ϭ not determined; Neg ϭ negative; Pos ϭ positive; NF ϭ not found in 31 screened mutations, including ∆F508, R117H and the variant IVS5T.
X
ABCC7 p.Arg347His 10875876:60:249
status: NEW
PMID: 10950058
[PubMed]
Ockenga J et al: "Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis."
No.
Sentence
Comment
54
Finally, we tested all samples for the presence of mutations or variants R75Q, I336K, R347H, IVS8-5T (5T allele), 1716G3A, 2143delT, 2789ϩ5G3A, Y1092X, 3272-26A3G, D1152H, and CFTRdel2,3 (21kb) by PCR and restriction enzyme digestion with the respective enzymes (for mutation references, see http://www.genet.
X
ABCC7 p.Arg347His 10950058:54:86
status: NEW
PMID: 10952679
[PubMed]
Mall M et al: "Effect of genistein on native epithelial tissue from normal individuals and CF patients and on ion channels expressed in Xenopus oocytes."
No.
Sentence
Comment
30
In all CF patients from whom rectal biopsies were studied DNA analysis was carried out for the following CFTR mutations: DF508; R117H and S108F in exon 4; R347P, R347H, I336K and T338I in exon 7; S549N, G551D, R553X, G542X, Q552X, 1717-1 G?A in exon 11; W1282X and 3905insT in exon 20; N1303K in exon 21 and 3849+10kB C?T in intron 19.
X
ABCC7 p.Arg347His 10952679:30:162
status: NEW
PMID: 10973878
[PubMed]
Costes B et al: "Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19)."
No.
Sentence
Comment
51
The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E.
X
ABCC7 p.Arg347His 10973878:51:128
status: NEW
PMID: 11118444
[PubMed]
Clain J et al: "Two mild cystic fibrosis-associated mutations result in severe cystic fibrosis when combined in cis and reveal a residue important for cystic fibrosis transmembrane conductance regulator processing and function."
No.
Sentence
Comment
1
We investigated the structure-function relationships of a severe cystic fibrosis (CF)-associated double mutant (R347H-D979A) to evaluate the contribution of each mild mutation to the phenotype.
X
ABCC7 p.Arg347His 11118444:1:112
status: NEW3 Our data show that R347H is associated with mild defective Cl-channel activity and that the D979A defect leads to misprocessing.
X
ABCC7 p.Arg347His 11118444:3:19
status: NEW4 The mutant R347H-D979A combines both defects for a dramatic decrease in Cl- cur- rent.
X
ABCC7 p.Arg347His 11118444:4:11
status: NEW13 The recent discovery of severe CF associated with a ⌬F508/ R347H-D979A compound heterozygote genotype in two related patients suffering from pancreatic insufficiency and severe respiratory symptoms suggests that the R347H-D979A mutation has an important influence on CFTR processing and/or function (7).
X
ABCC7 p.Arg347His 11118444:13:66
status: NEWX
ABCC7 p.Arg347His 11118444:13:223
status: NEW14 At least four CF-associated mutations have been identified in isolation at position 347 (R347C, R347H, R347L, and R347P) and two at position 979 (D979A and D979V), suggesting that Arg-347 and Asp-979 are important for CFTR structure and/or function.
X
ABCC7 p.Arg347His 11118444:14:96
status: NEW15 The mutation D979A was found in isolation in a patient with a congenital bilateral absence of the vas deferens (8) and the R347H mutation in CF patients with pancreatic sufficiency, congenital bilateral absence of the vas deferens, and no or mild pulmonary symptoms (7).
X
ABCC7 p.Arg347His 11118444:15:123
status: NEW16 As the R347H mutation is mostly associated with mild CF, it was suggested that the D979A mutation has a significant effect on CFTR function when combined in cis with R347H.
X
ABCC7 p.Arg347His 11118444:16:7
status: NEWX
ABCC7 p.Arg347His 11118444:16:166
status: NEW18 The mutations R347H and D979A replace positively charged (Arg) and negatively charged (Asp) residues with ones that are uncharged (His and Ala, respectively) at physiological pH.
X
ABCC7 p.Arg347His 11118444:18:14
status: NEW19 The present study investigates the structure-function relationships of the R347H-D979A double mutant, and as charged residues are involved in this complex genotype, single and double mutants with different charge combinations at residues 347 and 979 were constructed.
X
ABCC7 p.Arg347His 11118444:19:75
status: NEW21 Our data show that R347H is associated with defective chloride channel activity and that the D979A defect leads to misprocessing.
X
ABCC7 p.Arg347His 11118444:21:19
status: NEW22 The mutant R347H-D979A combines both defects for a dramatic decrease in Cl- current.
X
ABCC7 p.Arg347His 11118444:22:11
status: NEW58 We first studied the maturation of CFTR in HeLa cells to determine why patients with the R347H-D979A-CFTR allele suffered from severe CF.
X
ABCC7 p.Arg347His 11118444:58:89
status: NEW64 Immunoprecipitation experiments show that both wild-type and CF-associated mutants R347H, D979A, and R347H-D979A-CFTR cells produced mature, fully glycosylated protein (Fig. 1A; band C), whereas none of the mock-transfected cells produced CFTR (data not shown).
X
ABCC7 p.Arg347His 11118444:64:83
status: NEWX
ABCC7 p.Arg347His 11118444:64:101
status: NEW65 However, the D979A and R347H-D979A mutants produced significantly less band C (59 and 56% of the total CFTR; ratio C/(BϩC)) than wild-type and R347H-CFTR (92 and 91%; see Fig. 1B).
X
ABCC7 p.Arg347His 11118444:65:23
status: NEWX
ABCC7 p.Arg347His 11118444:65:149
status: NEW66 This indicates that the R347H-D979A mutation caused a misprocessing defect.
X
ABCC7 p.Arg347His 11118444:66:24
status: NEW67 The turnover of immature and mature forms of wild-type and R347H-D979A-CFTR proteins was further investigated by pulse-chase experiments (Fig. 1C).
X
ABCC7 p.Arg347His 11118444:67:59
status: NEW68 The kinetics of wild-type and R347H-D979A core-glycosylated and mature forms of CFTR were identical, whereas the efficiency of conversion to mature band C was lower for the mutant.
X
ABCC7 p.Arg347His 11118444:68:30
status: NEW82 C, pulse-chase experiments showing the turnover of the immature and mature forms of wild-type and R347H-D979A-CFTR (results are representative of two independent experiments).
X
ABCC7 p.Arg347His 11118444:82:98
status: NEW84 Altogether, these results indicate that D979A is responsible for the defective processing of R347H-D979A-CFTR and that a negative charge at 979 residue is necessary for proper CFTR processing.
X
ABCC7 p.Arg347His 11118444:84:93
status: NEW93 We separated the contributions of the R347H and D979A mutations to R347H-D979A-CFTR whole-cell Cl- current production studying both single and double mutants.
X
ABCC7 p.Arg347His 11118444:93:38
status: NEWX
ABCC7 p.Arg347His 11118444:93:67
status: NEW96 Mean changes in cAMP-activated currents recorded at 20 mV from R347H (29.4 Ϯ 12.2 pA/pF; n ϭ 8), D979A (67.9 Ϯ 18.9 pA/pF; n ϭ 5), and R347H-D979A (1.2 Ϯ 0.8 pA/pF; n ϭ 9) mutants were significantly different (p Ͻ 0.05) from wild-type (130.2 Ϯ 34.7 pA/pF; n ϭ 5), corresponding to 23, 52, and 1% of the wild-type Cl- current (Fig. 2D).
X
ABCC7 p.Arg347His 11118444:96:63
status: NEWX
ABCC7 p.Arg347His 11118444:96:159
status: NEW97 R347H, D979A, and R347H-D979A were also significantly different from each other (p Ͻ 0.01).
X
ABCC7 p.Arg347His 11118444:97:0
status: NEWX
ABCC7 p.Arg347His 11118444:97:18
status: NEW98 As R347H processing is similar to wild-type, the small Cl- current produced by R347H reflected defective channel properties, as demonstrated by single-channel studies (9).
X
ABCC7 p.Arg347His 11118444:98:3
status: NEWX
ABCC7 p.Arg347His 11118444:98:79
status: NEW100 Thus these data indicate that the R347H-D979A double mutant combined at least D979A misprocessing and the R347H Cl-channel defect to produce a very severe phenotype.
X
ABCC7 p.Arg347His 11118444:100:34
status: NEWX
ABCC7 p.Arg347His 11118444:100:106
status: NEW101 Charge-reversal Mutants-Taking into account the functional defects that result when Arg-347 and Asp-979 are each replaced with an uncharged amino acid such as His (uncharged at pH 7.3) and Ala (R347H and D979A), we constructed additional mutants with different charge combinations at residues 347 and 979, including the R347D-D979R double mutant in which the positive and negative charges were swapped.
X
ABCC7 p.Arg347His 11118444:101:194
status: NEW102 The processing of R347D was similar to those of R347H and the wild-type (Fig. 3, open bars).
X
ABCC7 p.Arg347His 11118444:102:48
status: NEW109 C, current-voltage (I-V) curve in HeLa cells expressing R347H (filled circle), D979A (filled triangle), and R347H-D979A (filled square) mutants.
X
ABCC7 p.Arg347His 11118444:109:56
status: NEWX
ABCC7 p.Arg347His 11118444:109:108
status: NEW118 essing of D979R, R347H-D979R, and R347D-D979R was differently impaired (Fig. 3; gray bars).
X
ABCC7 p.Arg347His 11118444:118:17
status: NEW123 The Cl- current of R347D-D979R (2.8 Ϯ 1.7 pA/pF; n ϭ 9) was not significantly different from those of D979R and R347H-D979A (Fig. 2D).
X
ABCC7 p.Arg347His 11118444:123:124
status: NEW127 Clinical data suggested that R347H and D979A, two mild CF-associated mutations, can produce severe CF similar to that of ⌬F508 homozygotes when combined in cis.
X
ABCC7 p.Arg347His 11118444:127:29
status: NEW129 D979A reduces the amount of CFTR protein at the cell membrane, whereas R347H generates a defective Cl-channel.
X
ABCC7 p.Arg347His 11118444:129:71
status: NEW130 The mutant R347H-D979A combines both defects for a dramatic decrease in Cl- current.
X
ABCC7 p.Arg347His 11118444:130:11
status: NEW131 The magnitude of Cl- current in vitro paralleled the severity of the disease, with D979A (congenital bilateral absence of the vas deferens) Ͼ R347H (mild CF) Ͼ R347H-D979A (severe CF).
X
ABCC7 p.Arg347His 11118444:131:148
status: NEWX
ABCC7 p.Arg347His 11118444:131:172
status: NEW143 First, several lines of experimental evidence indicate that there is probably no direct salt bridge between Arg-347 and Asp-979: (i) removal of either the positive charge at position 347 (R347H and R347D) or the negative charge at position 979 (D979A, D979V, and D979R) has different effects on CFTR processing; (ii) the double-neutral (R347H-D979A) and reversed-charged (R347D-D979R) replacements for Arg-347 and Asp-979 do not lead to the recovery of wild-type processing.
X
ABCC7 p.Arg347His 11118444:143:188
status: NEWX
ABCC7 p.Arg347His 11118444:143:337
status: NEW
PMID: 11168024
[PubMed]
Scotet V et al: "Prevalence of CFTR mutations in hypertrypsinaemia detected through neonatal screening for cystic fibrosis."
No.
Sentence
Comment
11
Variability of mutations detected in carriers was greater than in CF children (21 mutations versus 10) and a high proportion of mild mutations or variants (A349V, R297Q, R347H, V317A, G544S, R553G, etc) was observed in carriers.
X
ABCC7 p.Arg347His 11168024:11:170
status: NEW74 We noted, among heterozygous children, a high proportion of mild mutations (R297Q, R347H, M348K, A349V, G544S) or for which the pathogenicity is yet impossible to determine (V317A, V322A, R553G).
X
ABCC7 p.Arg347His 11168024:74:83
status: NEW75 The R347H mutation was found at an abnormally high frequency in carrier babies (n=9, i.e. 4.2% of the mutated alleles), whereas only one CF child carrying this mutation was identified over the same period (1.0%).
X
ABCC7 p.Arg347His 11168024:75:4
status: NEW
PMID: 11243954
[PubMed]
Marchand E et al: "Frequency of cystic fibrosis transmembrane conductance regulator gene mutations and 5T allele in patients with allergic bronchopulmonary aspergillosis."
No.
Sentence
Comment
78
One of these patients was identified as a compound heterozygote (⌬F5085/ R347H), and she was reclassified as having atypical CF.
X
ABCC7 p.Arg347His 11243954:78:80
status: NEW91 In the study by Miller et al,12 only one ABPA patient was identified as carrying two CFTR mutations (⌬F508/R347H).
X
ABCC7 p.Arg347His 11243954:91:114
status: NEW
PMID: 11547256
[PubMed]
Lebecque P et al: "[Cystic fibrosis and normal sweat chloride values: a case-report]."
No.
Sentence
Comment
73
Dans des situations d`hétérozygotie composite, la présence de certaines d`entre elles a pu être associée de manière occasionnelle ou parfois plus consistante avec un taux de chlorure dans la sueur inférieur à 60 voire même (dans de très rares cas) 30 mmol/L. Dans ce singulier petit groupe, figurent notamment les mutations 3 849 + 10kb C→T, A455E, R117H, , R347H, G551S, D1152H.
X
ABCC7 p.Arg347His 11547256:73:415
status: NEW
PMID: 11569691
[PubMed]
Truninger K et al: "Mutations of the cystic fibrosis gene in patients with chronic pancreatitis."
No.
Sentence
Comment
56
Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A.
X
ABCC7 p.Arg347His 11569691:56:349
status: NEW
PMID: 11574497
[PubMed]
Josserand RN et al: "Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens."
No.
Sentence
Comment
30
Leukocytes samples were analysed for a series of 22 CF mutations including the five most frequently encountered in our region (The CF Genotype Consortium, 1994): ∆F508, G542X, N1303K, 1717-G-A, 885E; and 17 others: R117H, R334W, R347H, R347P, 556delA, S549N, S549I, S549R, G551D, R553X, R560T, G1244E, S1255X, W1282X, R1283K, 3898ins C, D1270N.
X
ABCC7 p.Arg347His 11574497:30:236
status: NEW40 sCFTR mutation was detected in 56 alleles of the 50 patients: ∆F508 in 30 alleles, R117H in six, D1270N in two, G542X in one, 1717ϩG-A in one, 2789ϩ5G-A in one, R347H in one and the 5T allele in 14.
X
ABCC7 p.Arg347His 11574497:40:180
status: NEW45 Description of the 50 men with CBAVD:CF genotype and phenotype Number age CF SCC CF-related (years) genotype (mmol/l) symptoms 1 29 ∆F508/R117H 59 2 35 ∆F508/R117H 54 3 24 ∆F508/R117H 43 4 33 ∆F508/R117H 39 5 26 ∆F508/5T 90 S/B 6 27 ∆F508/5T 67 S 7 32 ∆F508/5T 55 8 30 ∆F508/5T 51 9 31 ∆F508/5T 44 10 44 ∆F508/5T 38 S 11 36 ∆F508/5T 36 S 12 54 ∆F508/5T 21 S 13 31 R117H/R347H 79 S 14 36 1717G-A/5T 50 S 15 32 5T/5T 77 P/DM 16 27 ∆F508/- 94 S 17 41 ∆F508/- 90 S/B 18 30 ∆F508/- 88 19 30 ∆F508/- 82 S 20 32 ∆F508/- 81 21 25 ∆F508/- 79 22 31 ∆F508/- 79 23 27 ∆F508/- 75 S 24 43 ∆F508/- 70 25 38 ∆F508/- 65 26 34 ∆F508/- 52 S 27 31 ∆F508/- 47 S 28 35 ∆F508/- 40 S 29 26 ∆F508/- 39 S 30 25 ∆F508/- 36 31 33 ∆F508/- 33 32 37 ∆F508/- 28 S 33 36 ∆F508/- 18 S 34 33 G542X/- 45 S 35 37 D1270N/- 116 36 34 D1270N/- 103 S/P 37 46 R117H/- 95 39 37 2789ϩ5G-A/- 100 S 40 27 5T/- 90 S 38 30 5T/- 51 44 38 5T/- 45 41 30 -/- 57 S 42 35 -/- 52 S 43 36 -/- 46 B (tobacco) 45 33 -/- 40 S 46 31 -/- 36 S/asthma 47 32 -/- 28 B (tobacco) 48 28 -/- 28 49 30 -/- 26 50 35 -/- 20 S SCC ϭ sweat chloride concentration.
X
ABCC7 p.Arg347His 11574497:45:454
status: NEW49 Results of assisted reproduction procedures Number CF genotype CF mutation in Assisted reproduction procedure women ICSI IVFSD AID adoption 1 ∆F508/R117H 0 failure success 2 ∆F508/R117H failure 3 ∆F508/R117H failure 4 ∆F508/R117H 0 5 ∆F508/5T 0 6 ∆F508/5T success 7 ∆F508/5T ∆F508/- failure 1 8 ∆F508/5T success 9 ∆F508/5T failure 1 10 ∆F508/5T 0 1 11 ∆F508/5T 0 12 ∆F508/5T failure failure 13 R117H/R347H failure failure 14 1717G-A/5T failure 15 5T/5T 0 16 ∆F508/- ∆F508/- 0 success 17 ∆F508/- 0 1 18 ∆F508/- 0 19 ∆F508/- failure 20 ∆F508/- ∆F508/- 0 success 21 ∆F508/- success 22 ∆F508/- failure 23 ∆F508/- failure 24 ∆F508/- in process 25 ∆F508/- 0 1 26 ∆F508/- failure 27 ∆F508/- failure 28 ∆F508/- success 29 ∆F508/- 0 success 30 ∆F508/- failure success 31 ∆F508/- 0 1 32 ∆F508/- 0 33 ∆F508/- success 34 G542X/- failure failure 35 D1270N/- success 36 D1270N/- 0 37 R117H/- failure 39 2789ϩ5G-A/- in process 40 5T/- ∆F508/- 0 38 5T/- failure 44 5T/- 0 success 41 -/- success 42 -/- failure 43 -/- 0 45 -/- in process 46 -/- 0 47 -/- 0 success 48 -/- failure 49 -/- failure 50 -/- success IVFSD ϭ IVF with sperm donor; AID ϭ artificial insemination by donor.
X
ABCC7 p.Arg347His 11574497:49:491
status: NEW
PMID: 11781704
[PubMed]
Larriba S et al: "ATB(0)/SLC1A5 gene. Fine localisation and exclusion of association with the intestinal phenotype of cystic fibrosis."
No.
Sentence
Comment
151
Statistical analysis showed that the higher incidence for P17A and the lower incidence for V512L observed in the general population Table 3 CFTR mutations of the CF patients under study with and without meconium ileus (MI) CF-non MI CF-MI CFTR mutations n CFTR mutations n F508del/R117H 2 F508del/F508del 7 F508del/R334W 3 F508del/L365P 1 F508del/R347P 1 F508del/G542X 1 F508del/621+1G4Ta 1 F508del/621+IG4Ta 1 F508del/M1101K 1 F508del/R1066C 1 F508del/1609delCAa 1 F508del/W1089X 1 F508del/2789+5G4Aa 3 F508del/R1162X 1 F508del/3849+10kbC4T 1 F508del/1609delCAa 1 G542X/G85E 1 F508del/Q1281X 1 G542X/V232D 1 F508del/1811+1.6kbA4G 1 G542X/1811+1.6kb A4Ga 1 F508del/2789+5G4Aa 1 G542X/2789+5G4A 1 F508del/2869insG 1 Q890X/L206W 1 F508del/unknown 1 1811+1.6kbA4G/P205S 1 I507del/I507del 1 R1162X/3272-26A4G 1 G542X/1078delT 1 N1303K/R347H 1 G542X/1811+1.6kbA4Ga 1 N1303K/A1006E+5T 1 S549R/CFTR50kbdel 1 2789+5G4A/405+1G4A 1 R1066C/R1066C 1 W1282X/712-1G4T 1 a CF patient with a sibling presenting identical CFTR genotype and discordance of intestinal phenotype.
X
ABCC7 p.Arg347His 11781704:151:831
status: NEW
No.
Sentence
Comment
44
CF GENE MUTATIONS IN ITALY Number of alleles Frequency Cumulative Mutation screened (%) frequency (%) DF508 3442 51.07 51.07 N1303K 3056 4.84 55.91 G542X 3082 4.83 60.75 2183 AA ® G 2596 2.66 63.41 R1162X 2580 2.42 65.83 1717-1 G ® A 2892 2.11 67.94 W1282X 2600 1.23 69.17 R553X 2882 1.15 70.31 T338I 2306 0.69 71.01 R347P 2642 0.61 71.61 711 1 5 G ® A 2454 0.57 72.18 G85E 1980 0.40 72.59 621 1 1 G ® T 2594 0.39 72.97 R334W 2366 0.30 73.27 R352Q 2112 0.24 73.50 S549N 2118 0.24 73.74 R347H 2184 0.18 73.92 L1077P 1840 0.16 74.09 R1158X 1878 0.16 74.25 541del C 1884 0.16 74.40 R1066H 1918 0.16 74.56 E585X 1922 0.16 74.72 Q552X 2172 0.14 74.86 D1152H 1824 0.11 74.97 2790-2 A ® G 1862 0.11 75.07 3132 del TG 1862 0.11 75.18 3667ins 4 1876 0.11 75.29 DI507 1914 0.10 75.39 1898 1 3 A ® G 1920 0.10 75.50 G1244E 1960 0.10 75.60 1784 del G 2052 0.10 75.69 From Rendine et al. (1997).
X
ABCC7 p.Arg347His 11788089:44:506
status: NEW
PMID: 11883825
[PubMed]
Padoan R et al: "Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis."
No.
Sentence
Comment
34
It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14).
X
ABCC7 p.Arg347His 11883825:34:297
status: NEW
PMID: 11897640
[PubMed]
Lebecque P et al: "Mutations of the cystic fibrosis gene and intermediate sweat chloride levels in children."
No.
Sentence
Comment
77
C→T (6-9), R347H (12), G551S (13), D1152H (14), R117H (15, 16), and R117C (17) mutations.
X
ABCC7 p.Arg347His 11897640:77:18
status: NEW
PMID: 11897641
[PubMed]
Selvadurai HC et al: "The relationship between genotype and exercise tolerance in children with cystic fibrosis."
No.
Sentence
Comment
82
II ⌬F508 (36), W1282X (1) III G551D (10), N1303K (4), R560T (2), A559T (1) IV R117H (14), R347H (3) V 3849 ϩ 10KbC→T (7), 3120G→A (3) AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL 165 2002 All patients were recruited from a single center, and the sample size of this study was large compared with previously published studies of exercise capacity in children with CF (21).
X
ABCC7 p.Arg347His 11897641:82:97
status: NEW
No.
Sentence
Comment
115
Miller et al11 analyzed the CFTR gene in 11 patients with ABPM and found that 1 patient carried two CF mutations (⌬F508/R347H) and 5 patients carried one mutation (⌬F508, 4 patients; R117H, 1 patient).
X
ABCC7 p.Arg347His 12006459:115:127
status: NEW
PMID: 12007216
[PubMed]
Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."
No.
Sentence
Comment
109
Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Arg347His 12007216:109:3842
status: NEW112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL.
X
ABCC7 p.Arg347His 12007216:112:1643
status: NEW
PMID: 12070257
[PubMed]
Scotet V et al: "Prenatal detection of cystic fibrosis by ultrasonography: a retrospective study of more than 346 000 pregnancies."
No.
Sentence
Comment
196
The heterozygous fetuses carried a severe molecular abnormality (∆F508 (n=9) or G542X (n=1)), except one who carried a mild mutation (R347H).
X
ABCC7 p.Arg347His 12070257:196:141
status: NEW202 Therefore, the second mutation Table 1 Incidence of cystic fibrosis and CF heterozygosity among fetuses with echogenic bowel in Brittany, France (1991-2000) Fetuses with echogenic bowel 142 Affected fetuses Number 14 Incidence 1/10 Genotypes ∆F508/∆F508 9 ∆F508/4005+1G→A 1 ∆F508/3129del4 1 ∆F508/Q220X 1 ∆F508/W1282X 1 ∆F508/1717-1G→A 1 CF incidence in the general population during the present study 1/2987 Risk of CF: echogenic bowel fetuses/general population 294 Heterozygous fetuses Number 11 Incidence 1/13 Mutations ∆F508 9 G542X 1 R347H 1 CF heterozygosity in the general population during the present study 1/28 Risk of CF heterozygosity: echogenic bowel fetuses/general population 2.2 Letter www.jmedgenet.com will be identified in 88.5% of the 22.6% of fetuses for which the first analysis identified only one mutation (that is, in 20.0% of all CF fetuses).
X
ABCC7 p.Arg347His 12070257:202:610
status: NEW244 This was also observed in heterozygotes, excepted for one case (mutation R347H).
X
ABCC7 p.Arg347His 12070257:244:73
status: NEW
PMID: 12116247
[PubMed]
Muller F et al: "Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases."
No.
Sentence
Comment
52
T, 1078delT, R347P, R347H, R334W, A455E, 1898 þ 1G !
X
ABCC7 p.Arg347His 12116247:52:20
status: NEW
PMID: 12124743
[PubMed]
Salvatore F et al: "Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes."
No.
Sentence
Comment
46
A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994].
X
ABCC7 p.Arg347His 12124743:46:220
status: NEW
PMID: 12133923
[PubMed]
Corbetta C et al: "Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population."
No.
Sentence
Comment
266
Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K.
X
ABCC7 p.Arg347His 12133923:266:109
status: NEW285 The CFTR mutations identified and their frequencies among carriers were as follows: delF508 (72 chromosomes, 64.2%), N1303K (12, 10.7%), R117H (9, 8%), G542X (7, 6.25%), R347H, R1162X, 2789+5G→A (2 alleles each, 1.8%), 1898+1G→A, 1717-1G→A, W1282X, 2183-AA→G, 621+1G→T, and 3849+10kbC→T (1, 0.9%).
X
ABCC7 p.Arg347His 12133923:285:170
status: NEW
PMID: 12151438
[PubMed]
Wang Z et al: "Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
20
Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997).
X
ABCC7 p.Arg347His 12151438:20:695
status: NEW
PMID: 12215837
[PubMed]
Scotet V et al: "Spatial and temporal distribution of cystic fibrosis and of its mutations in Brittany, France: a retrospective study from 1960."
No.
Sentence
Comment
118
His genotype was ∆F508/∆F508 Mutation Exon Basse-Bretagne Haute-Bretagne Brittanya ∆F508 10 446 75.6% 224 73.7% 672 75.0% 1078delT 7 31 5.3% 3 1.0% 34 3.8% G551D 11 21 3.6% 12 3.9% 33 3.7% N1303K 21 3 0.5% 9 3.0% 12 1.3% W846X 14a 9 1.5% 1 0.3% 10 1.1% 2789+5G→A 14b 3 0.5% 6 2.0% 9 1.0% 1717-1G→A 11 5 0.8% 3 1.0% 8 0.9% Y1092X 17b 1 0.2% 6 2.0% 7 0.8% 4005+1G→A 20 6 1.0% 1 0.3% 7 0.8% E60X 3 3 0.5% 3 1.0% 6 0.7% 621+1G→T 4 3 0.5% 3 1.0% 6 0.7% R347H 7 6 1.0% 0 0.0% 6 0.7% S492F 10 2 0.3% 3 1.0% 5 0.6% G542X 11 4 0.7% 1 0.3% 5 0.6% 3272-26A→G 17b 2 0.3% 3 1.0% 5 0.6% R117H 4 3 0.5% 1 0.3% 4 0.4% G91R 3 3 0.5% 0 0.0% 3 0.3% ∆I507 10 1 0.2% 2 0.7% 3 0.3% R553X 11 3 0.5% 0 0.0% 3 0.3% W1282X 20 2 0.3% 1 0.3% 3 0.3% A72D 3 0 0.0% 2 0.7% 2 0.2% G85E 3 0 0.0% 2 0.7% 2 0.2% F311L 7 0 0.0% 2 0.7% 2 0.2% 1221delCT 7 2 0.3% 0 0.0% 2 0.2% R560K 11 0 0.0% 2 0.7% 2 0.2% 2622+1G→A 13 2 0.3% 0 0.0% 2 0.2% S945L 15 0 0.0% 2 0.7% 2 0.2% I1234V 19 2 0.3% 0 0.0% 2 0.2% G1249R 20 2 0.3% 0 0.0% 2 0.2% 3905insT 20 2 0.3% 0 0.0% 2 0.2% Unidentified - 3 0.5% 0 0.0% 3 0.3% Total - 590 65.7% 304 34.3% 896 100% IVS17bTA, IVS17bCA) of Irish, Scottish, English, Breton and Czech subjects who were carriers of this mutation, and showed that all these alleles carried a unique haplotype (16-7-17), testifying to the Celtic origin of this mutation (Cashman et al. 1995).
X
ABCC7 p.Arg347His 12215837:118:497
status: NEW
PMID: 12357328
[PubMed]
McCormick J et al: "Demographics of the UK cystic fibrosis population: implications for neonatal screening."
No.
Sentence
Comment
83
The additional eleven are S549N, 3849+4A?G, 3905insT, 2789+5G?A, Y122X, 711+1G?T, R347P, R347H, R334W, A455E and 3281AA?G.
X
ABCC7 p.Arg347His 12357328:83:89
status: NEW
PMID: 12439892
[PubMed]
Kilinc MO et al: "Highest heterogeneity for cystic fibrosis: 36 mutations account for 75% of all CF chromosomes in Turkish patients."
No.
Sentence
Comment
131
Our results were quite different than those of the collaborated work on CF mutations in European countries, which reported E92X and R347H to be as frequent as 1677delTA in Turkey [Estivill et al., 1997].
X
ABCC7 p.Arg347His 12439892:131:132
status: NEW
PMID: 12794695
[PubMed]
Timmreck LS et al: "Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina."
No.
Sentence
Comment
82
CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development.
X
ABCC7 p.Arg347His 12794695:82:63
status: NEW
PMID: 12815607
[PubMed]
Scotet V et al: "Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland."
No.
Sentence
Comment
64
Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering.
X
ABCC7 p.Arg347His 12815607:64:596
status: NEW76 Number Frequency Number Frequency 1652_1655del 3 bp F508del 384 75.6% 196 73.1% 582 74.8% 1784G>A G551D 17 3.3% 12 4.5% 29 3.7% 1078delT 25 4.9% 3 1.1% 28 3.6% 4041C>G N1303K 3 0.6% 8 3.0% 11 1.4% 2670G>A W846X2 7 1.4% 1 0.4% 8 1.0% 1717-1G>A 5 1.0% 3 1.1% 8 1.0% 3408C>A Y1092X 1 0.2% 6 2.2% 7 0.9% 2789+5G>A 2 0.4% 4 1.5% 6 0.8% 4005+1G>A 5 1.0% 1 0.4% 6 0.8% 310G>T E60X 3 0.6% 2 0.7% 5 0.6% 621+1G>T 2 0.4% 3 1.1% 5 0.6% 1172G>A R347H 5 1.0% 5 0.6% 1756G>T G542X 4 0.8% 1 0.4% 5 0.6% 482G>A R117H 3 0.6% 1 0.4% 4 0.5% 3272-26A>G 2 0.4% 2 0.7% 4 0.5% 1648_1653delATC I507del 1 0.2% 2 0.7% 3 0.4% 1789C>T R553X 3 0.6% 3 0.4% 3978G>A W1282X 2 0.4% 1 0.4% 3 0.4% Unidentified Unidentified 3 0.6% 3 0.4% Total Total 508 100.0% 268 100.0% 778 100.0% Basse-Bretagne Haute-Bretagne Brittany * Amino acid change Nucleotide change Table 3: Distribution of the Main CFTR Nutations Observed in the Irish Cohorts (Dublin and Cork) The 62 mutations detected in Brittany combined to give 81 different genotypes in CF patients.
X
ABCC7 p.Arg347His 12815607:76:433
status: NEW
PMID: 12865275
[PubMed]
Ahmed N et al: "Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas."
No.
Sentence
Comment
309
Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency.
X
ABCC7 p.Arg347His 12865275:309:263
status: NEWX
ABCC7 p.Arg347His 12865275:309:457
status: NEW
PMID: 12939655
[PubMed]
Perri F et al: "Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis."
No.
Sentence
Comment
33
Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation.
X
ABCC7 p.Arg347His 12939655:33:141
status: NEW
No.
Sentence
Comment
181
Clain et al. investigated the complex allele with two mild mutations (R347H-D979A) previously identified in pancreatic sufficient CF patients and CBAVD patients respectively (Clain et al. 2001).
X
ABCC7 p.Arg347His 12940920:181:70
status: NEW182 R347H was found to be associated with moderately defective Cl-channel activity whereas D979A led to misprocessing of CFTR.
X
ABCC7 p.Arg347His 12940920:182:0
status: NEW183 The double mutant, R347H-D979A, combined both defects and dramatically decreased the Cl- current.
X
ABCC7 p.Arg347His 12940920:183:19
status: NEW
PMID: 14641997
[PubMed]
Raskin S et al: "High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing."
No.
Sentence
Comment
63
FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes.
X
ABCC7 p.Arg347His 14641997:63:1456
status: NEWX
ABCC7 p.Arg347His 14641997:63:1552
status: NEWX
ABCC7 p.Arg347His 14641997:63:1648
status: NEW
PMID: 14998948
[PubMed]
Danziger KL et al: "Improved detection of cystic fibrosis mutations in infertility patients with DNA sequence analysis."
No.
Sentence
Comment
59
Polyacrylamide gels were analysed for the presence of mutations following staining in ethidium bromide (EtBr) and image capture under UV using the Gel Doc 1000 system Table I. List of CFTR mutations included in common mutation panels American College of Medical Genetics CF panel (25 mutations) DF508 G542X G551D R117H W1282X N1303K R1162X 3849+10kbC®T DI507 R553X 1717-1G®A 621+1G®T R560T 3659delC 3120+1G®A I148T G85E R334W A455E 1898+1G®A 2148delA 711+1G®T 2789+5G®A R347P 1078delT Six additional mutations and one polymorphism in UCSF panel (31 mutations) Y1092X R347H 3849+4 Q493X 3905insT S549N F508C (polymorphism) (BioRad).
X
ABCC7 p.Arg347His 14998948:59:602
status: NEW
PMID: 15070876
[PubMed]
Dayangac D et al: "Mutations of the CFTR gene in Turkish patients with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
35
We next screened for six further CFTR gene mutations of the coding region and ¯anking intron sequences by previously described restriction-enzyme based methods: G85E, D110H, R347H, 2789+5G®A, D1152H, N1303K (DoÈrk et al., 1994a, 1997).
X
ABCC7 p.Arg347His 15070876:35:179
status: NEW40 Finally, the 5'-UTR and minimum promoter region were Table I. CFTR gene mutations identi®ed in 51 CBAVD patients Mutation Location Nucleotide alteration Predicted effect Allele frequency (%) Reference IVS8-5T Intron 8 Deletion of 2T between 1342±12 and 1342±6 Aberrant splicing 20 (19.6)a Chu et al. 1993 D1152H Exon 18 G®C at 3586 Amino acid substitution 15 (14.7)a Highsmith et al. 1992* D110H Exon 4 G®C at 460 Amino acid substitution 3 (2.9) Dean et al. 1990 DF508 Exon 10 Deletion of 3 nt at 1652±1655 Amino acid deletion 3 (2.9) Kerem et al. 1989 2789+5G®A Intron 14b G®A at 2789+5 Aberrant splicing 3 (2.9) Highsmith et al. 1997 L997F Exon 17a G®C at 3123 Amino acid substitution 3 (2.9) Fanen et al. 1992b CFTRdele2 (ins186) Introns 1±2 Deletion of 8.1 kb and insertion of 186 bp In-frame-deletion 2 (2.0) DoÈrk et al. 2000b R347H Exon 7 G®A at 1172 Amino acid substitution 2 (2.0) Cremonesi et al. 1992 E831X Exon 14a G®T at 2623 Truncation 2 (2.0) Ferec et al. 1992* 1767del6 Exon 11 Deletion of 6 nt at 1767±1773 In-frame-deletion 2 (2.0) (a) This study 3041-15T®G Intron 15 T®G at 3041±15 Aberrant splicing?
X
ABCC7 p.Arg347His 15070876:40:888
status: NEW56 Several mutations were already known as `mild' alleles in cystic ®brosis, e.g. D110H, R347H or 2789+5G®A, and have been described previously in studies of patients with CBAVD.
X
ABCC7 p.Arg347His 15070876:56:91
status: NEW67 One mutant allele was identi®ed in six patients (11.7%), of whom two carried clearly pathogenic mutations (DF508 and R347H, respectively) and four harboured unclassi®ed variants.
X
ABCC7 p.Arg347His 15070876:67:122
status: NEW72 CFTR genotypes in 51 patients with congenital bilateral absence of the vas deferens Mutation genotypes IVS8-(TG)mTn M470V n (%) Two mutations detected: D1152H/D1152H (TG)11 7T/ (TG)11 7T V/V 5 (9.8) IVS8-5T/IVS8-5T (TG)13 5T/ (TG)13 5T M/M 2 (3.9) (TG)12 5T/ (TG)13 5T M/V 1 (1.9) (TG)12 5T/ (TG)12 5T V/V 1 (1.9) IVS8-5T/D1152H (TG)12 5T/ (TG)11 7T V/V 2 (3.9) IVS8-5T/DF508 (TG)12 5T/ (TG)10 9T M/V 2 (3.9) IVS8-5T/2789+5G®A (TG)12 5T/ (TG)10 7T M/V 2 (3.9) IVS8-5T/365insT (TG)13 5T/ (TG)11 7T M/V 1 (1.9) IVS8-5T/D110H (TG)12 5T/ (TG)11 7T M/V 1 (1.9) IVS8-5T/E585X (TG)12 5T/ (TG)10 7T M/V 1 (1.9) IVS8-5T/2752-15C®G (TG)12 5T/ (TG)11 7T V/V 1 (1.9) IVS8-5T/M952I (TG)12 5T/ (TG)10 7T M/V 1 (1.9) IVS8-5T/3120+1G®A (TG)12 5T/ (TG)11 7T V/V 1 (1.9) D1152H/A349V (TG)10 7T/ (TG)11 7T M/V 1 (1.9) D1152H/2789+5G®A (TG)10 7T/ (TG)11 7T M/V 1 (1.9) D1152H/G1130A (TG)10 7T/ (TG)11 7T M/V 1 (1.9) CFTRdele2(ins186)/ IVS8-6T (TG)13 6T/ (TG)11 7T M/V 1 (1.9) CFTRdele2(ins186)/D110H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) E831X/D110H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) E831X/1677delTA (TG)11 7T/ (TG)11 7T V/V 1 (1.9) R334Q/R347H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) 1767del6/1767del6 (TG)11 7T/ (TG)11 7T V/V 1 (1.9) 3041-15T®G/3041-15T®G (TG)12 7T/ (TG)12 7T M/M 1 (1.9) 3041-13del7/3041-13del7 (TG)10 7T/ (TG)10 7T M/M 1 (1.9) R1070W/3272-26A®G (TG)10 7T/ (TG)11 7T M/V 1 (1.9) I853F/L997F (TG)11 7T/ (TG)10 9T V/V 1 (1.9) One mutation detected: L997F/?
X
ABCC7 p.Arg347His 15070876:72:1133
status: NEW74 (TG)12 5T/ (TG)10 7T M/V 1 (1.9) R347H/?
X
ABCC7 p.Arg347His 15070876:74:33
status: NEW
PMID: 15084988
[PubMed]
Naruse S et al: "A finger sweat chloride test for the detection of a high-risk group of chronic pancreatitis."
No.
Sentence
Comment
51
The 9 CF-causing mutations (R75X, Q98R, M152R, R347H, L441P, L571S, D979A, H1085R, and T1086I) in Japa- nese20,25-28 were screened by SNP typing with Masscode System (Shimadzu, Kyoto, Japan).
X
ABCC7 p.Arg347His 15084988:51:47
status: NEW
PMID: 15121783
[PubMed]
Fujiki K et al: "Genetic evidence for CFTR dysfunction in Japanese: background for chronic pancreatitis."
No.
Sentence
Comment
219
The nine CF causing (R75X, Q98R, M152R, R347H, L441P, L571S, D979A, H1085R, and T1086I) and two non-CF causing (Q1352H and R1453W) mutations in Japanese6 22-24 were screened by SNP typing with a Masscode system (Shimadzu, Kyoto, Japan) and confirmed by sequence analysis in positive and equivocal cases.
X
ABCC7 p.Arg347His 15121783:219:40
status: NEW
PMID: 15274098
[PubMed]
Davis PB et al: "Relation of sweat chloride concentration to severity of lung disease in cystic fibrosis."
No.
Sentence
Comment
26
T (12); A455E (1); D1270N; G85E (3); R117H (4); R334W (1); R347H (1); T347P (6); 2859 þ 5 G !
X
ABCC7 p.Arg347His 15274098:26:59
status: NEW
PMID: 15343184
[PubMed]
Borowitz D et al: "Use of fecal elastase-1 to classify pancreatic status in patients with cystic fibrosis."
No.
Sentence
Comment
116
FE-1 values in subjects with CFTR mutations associated with pancreatic sufficiency11 N Mean (mg/g stool) Median (mg/g stool) Range (mg/g stool) Subjects with at least one PS allele* FE-1 >200 mg/g stool 16 584 582.9 349-773 FE-1 <200 mg/g stool 5 64.4 74.8 0-125 Subjects with at least one PS variable alleley FE-1>200 mg/g stool 29 496.2 493.6 224-798 FE-1 <200 mg/g stool 13 76.1 65.9 0-187 *Pancreatic sufficient dominant CF alleles G551S R117H R347H P574H R334W R352Q T3381 yVariable pancreatic sufficient CF mutations G85E 3849 + 10 kb C fi T R347P 2789 + 5G fi A A455E In summary, FE-1 is an accurate, easily obtained screening test to classify patients with CF as PI or PS.
X
ABCC7 p.Arg347His 15343184:116:448
status: NEW
PMID: 15371903
[PubMed]
Sugarman EA et al: "CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations."
No.
Sentence
Comment
35
87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene.
X
ABCC7 p.Arg347His 15371903:35:341
status: NEW
PMID: 15371908
[PubMed]
Buyse IM et al: "Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation."
No.
Sentence
Comment
77
This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively.
X
ABCC7 p.Arg347His 15371908:77:322
status: NEW
PMID: 15516474
[PubMed]
Fajac I et al: "Nasal airway ion transport is linked to the cystic fibrosis phenotype in adult patients."
No.
Sentence
Comment
219
RESULTS Patients Four of the 79 CF patients included in the study had a normal sweat test; three were compound heterozygous for the F508D mutation and the R117H, D1152H and R347H mutations, respectively, and one patient was compound heterozygous for the G542X and 3849+10 kb (C)R (T) mutations.
X
ABCC7 p.Arg347His 15516474:219:173
status: NEW
PMID: 15537638
[PubMed]
Choi MY et al: "Destabilization of the transmembrane domain induces misfolding in a phenotypic mutant of cystic fibrosis transmembrane conductance regulator."
No.
Sentence
Comment
58
Construction and Expression of CFTR Variants in Mammalian Cells-The L346P, R347P, and R347H CFTR mutants were constructed FIG. 1.
X
ABCC7 p.Arg347His 15537638:58:86
status: NEW116 WT, L346P, R347P, L346P/R347I, and R347H CFTR expression was assayed by immunoblotting, using the mouse monoclonal anti-HA Ab.
X
ABCC7 p.Arg347His 15537638:116:35
status: NEW138 The R347H missense mutation, associated with a mild functional defect of CFTR channel activity, was also expressed at the same level as the WT CFTR, confirming previous reports (31).
X
ABCC7 p.Arg347His 15537638:138:4
status: NEW
PMID: 15537723
[PubMed]
Jalalirad M et al: "First study of CF mutations in the CFTR gene of Iranian patients: detection of DeltaF508, G542X, W1282X, A120T, R117H, and R347H mutations."
No.
Sentence
Comment
15
Most of the families in whom ∆F508, W1282X, and G542X mutations BRIEF REPORTS Journal of Tropical Pediatrics Vol. 50, No.
X
ABCC7 p.Arg347His 15537723:15:261
status: NEW16 6 359 First Study of CF Mutations in the CFTR Gene of Iranian Patients: Detection of ∆F508, G542X, W1282X, A120T, R117H, and R347H Mutations by M. Jalalirad,a,b M. Houshmand,a R. Mirfakhraie,a M. H. Goharbari,a and F. Mirzajania a National Research Center for Genetic Engineering and Biotechnology (NRCGEB),Tehran, Iran b Biology Department, Gilan University, Rasht, Iran Summary Thirty-seven unrelated Iranian CF families were screened for the presence of seven common mutations (∆F508, G542X, W1282X, G551D, N1303K, 1717-1G→A, and 621-1G→T) using ARMS PCR and exons 4 and 7 of the CFTR gene by SSCP method.
X
ABCC7 p.Arg347His 15537723:16:132
status: NEWX
ABCC7 p.Arg347His 15537723:16:173
status: NEW17 This study resulted in the identification of 26.8 per cent of all CF alleles: ∆F508 (16.2 per cent), W1282X (4 per cent), G542X (2.7 per cent), R117H (1.3 per cent), R347H (1.3 per cent), and A120T (1.3 per cent) mutations were detected.
X
ABCC7 p.Arg347His 15537723:17:173
status: NEW32 The next two most common mutations were W1282X (4 per cent) and G542X (2.7 per cent), which have high frequencies in Mediterranean countries.11 R347H, which has the highest incidence in Turkey,8 was detected in a Turkish child residing in north-west Iran with normal sweat chloride values.
X
ABCC7 p.Arg347His 15537723:32:11
status: NEWX
ABCC7 p.Arg347His 15537723:32:87
status: NEWX
ABCC7 p.Arg347His 15537723:32:110
status: NEWX
ABCC7 p.Arg347His 15537723:32:144
status: NEWX
ABCC7 p.Arg347His 15537723:32:160
status: NEW33 As regards R347H mutation and sex, two female patients carrying genotypes ∆F508/R347H and ∆F508/R347H + D979A have been reported so far.12,13 Our R347H compound case is the first female who does not carry the ∆F508 mutation as the other CF allele.
X
ABCC7 p.Arg347His 15537723:33:11
status: NEWX
ABCC7 p.Arg347His 15537723:33:87
status: NEWX
ABCC7 p.Arg347His 15537723:33:110
status: NEWX
ABCC7 p.Arg347His 15537723:33:160
status: NEW31 The next two most common mutations were W1282X (4 per cent) and G542X (2.7 per cent), which have high frequencies in Mediterranean countries.11 R347H, which has the highest incidence in Turkey,8 was detected in a Turkish child residing in north-west Iran with normal sweat chloride values.
X
ABCC7 p.Arg347His 15537723:31:144
status: NEW
PMID: 15591474
[PubMed]
Rodman DM et al: "Late diagnosis defines a unique population of long-term survivors of cystic fibrosis."
No.
Sentence
Comment
117
GENOTYPE DISTRIBUTION Early Diagnosis Late Diagnosis ⌬F508/⌬F508 10 1 ⌬F508/⌬I507 1 ⌬F508/G551D 1 ⌬F508/M1101K 1 ⌬F508/P67L/11027T 1 ⌬F508/3120G-A 1 ⌬F508/2789ϩ5G-A 1 2 ⌬F508/W1282X 1 ⌬F508/621ϩ1G-T 1 ⌬F508/R347P 1 ⌬F508/3849ϩ10kbC-T 1 1 ⌬F508/A455E 2 ⌬F508/R347H 2 ⌬F508/D1152H 1 ⌬508/I148T 1 ⌬F508/R117H 1 ⌬F508/Y109N 1 ⌬F508/IVS8-5T 1 ⌬F508/unknown 3 5 S1251N/D1152H 1 G542X/R117C 1 R117H/G551D 1 W1282X/D1152H 1 Unknown 4 4 Values represent number of individuals in each diagnostic group with each genotype.
X
ABCC7 p.Arg347His 15591474:117:381
status: NEW
No.
Sentence
Comment
56
T R334W A455E R347H 2789 5G !
X
ABCC7 p.Arg347His 15758625:56:14
status: NEW
PMID: 15832355
[PubMed]
Castellani C et al: "Cystic fibrosis carriers have higher neonatal immunoreactive trypsinogen values than non-carriers."
No.
Sentence
Comment
40
Distribution and Classification of the Tested Mutations in the Normal IRT Heterozygote Population Under Study Mutations Type of mutation Class of mutation Number of cases F508del Severe II 161 N1303K Severe II 19 G542X Severe I 19 711 þ 5G > A - V 15 R117H Mild IV 13 R1162X Severe I 13 R553X Severe I 11 G85E - IV 8 2183AA > G Severe I 8 1717-1G > A Severe I 8 R334Q Mild - 4 Q552X Severe I 4 W1282X Severe I 3 2789 þ 5G > A Mild V 2 1898 þ 3A > G Mild V 2 T338I Mild IV 1 R709X Severe I 1 R347H Mild IV 1 3849 þ 10KbC > T Mild V 1 Total 294 Other tested mutations: 1078delTn1609delCAn1717-8g/an394delTTn457TAT> Gn541delCn621 þ 1g/tn711 þ 1g/tnA559TnDI507nG551DnR1158XnR334Wn R347PnR352QnS549InS549NnS549Ra/cn2790-2G > An1811 þ 1.2KbA > G; 711þ5G > A and G85E not categorized in type of mutation; R334Q not categorized in class of mutation.
X
ABCC7 p.Arg347His 15832355:40:506
status: NEW
PMID: 15880796
[PubMed]
Kerem E et al: "Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy."
No.
Sentence
Comment
58
C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C !
X
ABCC7 p.Arg347His 15880796:58:305
status: NEW
PMID: 15908456
[PubMed]
Sanchez-Garcia JF et al: "Multiple mutation analysis of the cystic fibrosis gene in single cells."
No.
Sentence
Comment
62
G, R1162X, 3659delC, W1282X, 3905insT, N1303K, 1078delT, R347P, R347H and R334W labelled with TET (green) and A455E, 1898þ1G.A, 2183AA.G, 2789þ5G.A, G85E, 621þ1G.T, R117H, Y122X and 711þ1G.T labelled with HEX (yellow).
X
ABCC7 p.Arg347His 15908456:62:64
status: NEW
PMID: 15994263
[PubMed]
de Gracia J et al: "Genotype-phenotype correlation for pulmonary function in cystic fibrosis."
No.
Sentence
Comment
209
To study the decline in pulmonary function between groups the ANOVA method (repeated measures) was used with baseline and current spirometric values as dependent variables, genotype groups as the independent variable, and age and evolution time as Table 1 CFTR mutation according to functional classification Class Molecular dysfunction Mutation I Defective protein production G542X, 711+1GRT, 1609delCA, R1162X, 1717-8GRA, W1282X, 1782delA, Q890X, 1898+3ARG, CFTRdele19, 936delTA II Defective protein processing F508del, N1303K, I507del, R1066C III Defective protein regulation D1270N, G551D IV Defective protein conductance L206W, R334W, R117H, R347H, D836Y, P205S V Partially defective production or processing 2789+5GRA, 1811+1.6kbARG, 3849+10kbCRT, 3272+26GRA Table 2 Groups based on genotype in CF adult patients Functional classes Genotype No of subjects I-I G542X/W1282X 1 R1162X/1898+3ARG 1 R1162X/CFTRdele19 1 I-II F508del/G542X 5 F508del/711+1GRT 2 F508del/1717-8GRA 1 F508del/936delTA 1 F508del/R1162X 1 N1303K/1609delCA 1 I-III G542X/D1270N+R74W 1 711+1G-T/G551D 1 I-IV G542X/P205S 1 Q890X/R334W 1 1609delCA/R347H 1 I-V G542X/2789+5GRT 2 G542X/1811+1.6kbARG 1 1782delA/2789+5GRA 1 1609delCA/1811+1.6kbARG 1 II-II F508del/F508del 21 F508del/N1303K 1 F508del/R1066C 1 II-III F508del/D1270N+R74W 1 I507del/D1270N+R74W 1 II-IV F508del/L206W 4 F508del/R334W 3 F508del/R117H 3 F08del/R347H 2 F508del/D836Y 1 II-V F508del/2789+5GRA 5 F508del/3849+10kbCRT 2 F508del/1811+1.6kbARG 2 F508del/3272+26GRA 1 N1303K/1811+1.6kbARG 1 N1303K/2789+5GRA 1 adjusted variables.
X
ABCC7 p.Arg347His 15994263:209:647
status: NEWX
ABCC7 p.Arg347His 15994263:209:1121
status: NEWX
ABCC7 p.Arg347His 15994263:209:1391
status: NEW220 Sweat tests were positive (sweat chloride concentration >60 mEq/l) in all but three patients (pair of CFTR mutations: I507del/ D1270N+1274W, F508del/D836Y, and F508del/R347H, respectively).
X
ABCC7 p.Arg347His 15994263:220:168
status: NEW
No.
Sentence
Comment
67
Eleven ABPA subjects, all but one with Bx, either central or disseminated, and with a normal sweat test, were analyzed for CFTR gene mutations.24 Six ABPA subjects carried at least one CF mutation (p < 0.003 vs the general population), one patient carried two CF mutations (⌬F508/R347H), and five were heterozygous for one CF mutation (four ⌬F508 and one R117H).
X
ABCC7 p.Arg347His 16088537:67:287
status: NEW
No.
Sentence
Comment
50
In effect, virtually no func- Table 2 Unusually Common Cystic Fibrosis Mutations in Specific Populationsa Total Exon/ Number Number Frequency Mutation Intron Ethnic Origin Observed Screened (%) 296+12T→C intron 02 Pakistani 02 24 8.33 E60X exon 03 Belgian 06 394 1.52 G91R exon 03 French 04 266 1.50 394delTT exon 03 Scandinavian 78 1588 4.91 457TAT→G exon 04 Austrian 04 334 1.20 Y122X exon 04 Réunion Island 14 29 48.27 I148T exon 04 French Canadian 06 66 9.09 711+5G→A intron 05 Italian (North East) 06 225 2.67 1078delT exon 07 Celtic 27 475 5.68 1161delC exon 07 Pakistani 02 24 8.33 T338I exon 07 Italian, Sardinian 04 86 4.65 Q359K/T360K exon 07 Georgian Jews 07 8 87.50 R347H exon 07 Turkish 04 134 2.98 1609delCA exon 10 Spanish 03 96 3.12 1677delTA exon 10 Bulgarian 05 222 2.25 S549I exon 11 Arabs 02 40 5.00 Q552X exon 11 Italian (North East) 03 225 1.33 A559T exon 11 African-American 02 79 2.53 1811+1.2kbA→G intron 11 Spanish 22 1068 2.06 1898+5G→T intron 12 Chinese 03 10 30.00 1949del84 exon 13 Spanish 02 136 1.47 2143delT exon 13 Russian 04 118 3.39 2183AA→G exon 13 Italian (North East) 21 225 9.33 2184insA exon 13 Russian 03 118 2.54 3120+1G→A intron 16 African-American 14 112 12.50 3272-26A→G intron 17a Portugese, French 06 386 1.55 R1066C exon 17b Portugese 05 105 4.76 R1070Q exon 17b Bulgarian 04 166 2.41 Y1092X exon 17b French Canadian, 11 725 1.52 French M1101K exon 17b Hutterite 22 32 68.75 3821delT exon 19 Russian 03 118 2.54 S1235R exon 19 French (South) 04 340 1.18 S1251N exon 20 Dutch, Belgian 11 792 1.39 S1255X exon 20 African-American 02 79 2.53 3905insT exon 20 Swiss 45 982 4.58 Amish, Arcadian 13 86 15.12 W1282X Exon 20 Jewish-Ashkenazi 50 95 52.63 R1283M exon 20 Welsh 03 183 1.64 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/.
X
ABCC7 p.Arg347His 16088579:50:704
status: NEW
PMID: 16126774
[PubMed]
Morea A et al: "Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility."
No.
Sentence
Comment
47
CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T.
X
ABCC7 p.Arg347His 16126774:47:265
status: NEW
PMID: 16182665
[PubMed]
Sarles J et al: "Combining immunoreactive trypsinogen and pancreatitis-associated protein assays, a method of newborn screening for cystic fibrosis that avoids DNA analysis."
No.
Sentence
Comment
38
Among the 48 babies screened as having CF, 43 presented with symptoms compatible with CF or abnormal sweat test results ($60 mEq/L), but 5 were classified as having a borderline form of CF because they exhibited no symptoms, had normal sweat test results (<60 mEq/L), and mild mutations [R117H, TG12-T5(IVS8), S1251N, L997F, R347H], and they did not evolve toward CF status (appearance of clinical symptoms or elevation of sweat test) after more than 1 year of follow-up.
X
ABCC7 p.Arg347His 16182665:38:325
status: NEW
PMID: 16227367
[PubMed]
McWilliams R et al: "Cystic fibrosis transmembrane regulator gene carrier status is a risk factor for young onset pancreatic adenocarcinoma."
No.
Sentence
Comment
277
R McWilliams Department of Oncology and Department of Medicine, Mayo Clinic, Rochester, Minnesota, USA W E Highsmith Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, Minnesota, USA K G Rabe, M de Andrade, L A Tordsen Department of Health Sciences Research, Mayo Clinic, Rochester, Minnesota, USA Conflict of interest: None declared. Table 1 Comparison of CFTR mutation frequencies detected in the young onset pancreatic cancer cohort versus the clinical database Young onset pancreatic cancer cases (,60 y old at diagnosis, n = 166) Mayo Clinic clinical database reference group (n = 5349) No % No % CFTR mutation non-carriers 152 91.6 5132 95.9 CFTR mutation carriers 14 8.4 217 4.1 Mutation distribution DF508 12 85.7 155 71.4 R177H 1 7.1 28 12.9 G551D 6 2.8 2789+5G.A 6 2.8 G542X 4 1.8 N1303K 1 7.1 3 1.4 1717-1G.T 2 0.9 3849+10kbC.T 2 0.9 A455E 2 0.9 R1162X 2 0.9 R347H 1 0.5 R553X 1 0.5 3905insT 1 0.5 621+1G.T 1 0.5 W1282X 1 0.5 1898+1G.A 1 0.5 R560T 1 0.5 Young onset pancreatic cancer cases were more frequent carriers of the CFTR mutations compared with patients in the control database (odds ratio 2.18 (95% confidence interval 1.24-3.29); p = 0.006).
X
ABCC7 p.Arg347His 16227367:277:892
status: NEW
PMID: 16429424
[PubMed]
Choi EH et al: "Association of common haplotypes of surfactant protein A1 and A2 (SFTPA1 and SFTPA2) genes with severity of lung disease in cystic fibrosis."
No.
Sentence
Comment
33
Complementary mutations were identified in 51 CF subjects: R117H (4), R347H (1), R347P (1), G542X (7), G551D (4), 1717-1G-A (2), 2789 þ 5G > A(3), 3120 þ 1G > A (2), 3659delC (3), 3849 þ 10kbC>T (6), 394delTT (1), 621 þ 1G>T (4), 711 þ 1G > T (1), G85E (1), I507 (1), N1303K (2), R352Q (1), R553X (2), R560T (1), and W1282X (4).
X
ABCC7 p.Arg347His 16429424:33:70
status: NEW
PMID: 16435054
[PubMed]
Zilfalil BA et al: "Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays."
No.
Sentence
Comment
55
MUTATIONS R553X G551D 1507 del F508 del 1717-1 G>A G542X R560T R347P W1282X R334W 1078 Del T 3849 + 10KB C>T R1162X N1303K 3659 Del C A455E R117H 2183 AA>G 2789+5 G>A 1898 +1 G>A 621+1 G>T 711+1 G>T G85E S549N S549R V520F Q493X R347H 3849 +4 A>G 3905 INS T Y122X 4 software before running the gel electrophoresis in 1X TBE using ABI PRISM® 377 Genetic Analyzer (Applied Biosystems, USA) for 45 minutes.
X
ABCC7 p.Arg347His 16435054:55:228
status: NEW
PMID: 16714368
[PubMed]
Radpour R et al: "Molecular analysis of the IVS8-T splice variant 5T and M470V exon 10 missense polymorphism in Iranian males with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
55
The analysis of the entire coding sequence allowed us to identify 16 different mutations in CBAVD patients, 13 mutations identified by kit and 3 mutations identified by genome scan (R347H, R553X and 1540A/G) (Table III).
X
ABCC7 p.Arg347His 16714368:55:182
status: NEW90 Mutation geno types IVS8-PolyT M470V n (%) Two mutations detected F508del/R117H 9T/9T M/M 1 (0.94) F508del/621+1G>T 7T/7T V/V 1 (0.94) 1540A/G/1540A/G 7T/7T M/M 2 (1.89) R347H/R117H 9T/7T M/V 1 (0.94) G551D/IVS8-5T 7T/5T M/V 2 (1.89) F508del/IVS8-5T 7T/5T M/V 8 (7.55) 9T/5T M/M 6 (5.67) 1717-1G>A/IVS8-5T 7T/5T M/V 4 (3.77) R117H/IVS8-5T 7T/5T M/V 2 (1.89) 621+1G>T/IVS8-5T 7T/5T M/V 3 (2.83) 9T/5T M/M 2 (1.89) 1540A/G/IVS8-5T 7T/5T M/V 2 (1.89) R553X/IVS8-5T 7T/5T M/V 1 (0.94) IVS8-5T/IVS8-5T 5T/5T V/V 3 (2.83) 5T/5T M/M 8 (7.55) One mutation detected G85E/- 7T/7T V/V 2 (1.89) G551D/- 9T/7T V/V 1 (0.94) 621+1G>T/- 7T/7T M/M 2 (1.89) 9T/7T M/V 1 (0.94) R334W/- 7T/7T M/V 1 (0.94) F508del/- 7T/7T M/V 7 (6.60) 9T/7T M/M 3 (2.83) 9T/9T M/V 2 (1.89) IVS8-5T/- 5T/7T M/M 3 (2.83) 5T/9T M/V 2 (1.89) 1717-1G>A/- 7T/7T M/V 3 (2.83) 9T/7T M/V 2 (1.89) R117H/- 7T/7T M/M 2 (1.89) 9T/7T M/V 1 (0.94) 2789+5G>A/- 7T/7T M/M 1 (0.94) 3120+1G>A/- 9T/7T M/V 2 (1.89) R560T/- 9T/7T M/V 1 (0.94) N1303K/- 9T/7T V/V 1 (0.94) 1651A/G/- 7T/7T M/V 1 (0.94) R553X/- 9T/7T M/V 1 (0.94) No mutation detected -/- 7T/7T M/M 12 (11.32) -/- 9T/9T M/M 3 (2.83) -/- 9T/7T M/V 6 (5.66) Table IV.
X
ABCC7 p.Arg347His 16714368:90:170
status: NEW
PMID: 16778595
[PubMed]
Sun W et al: "CFTR 5T variant has a low penetrance in females that is partially attributable to its haplotype."
No.
Sentence
Comment
55
These mutations include R347H, S549N, S549R, 3876delA, 394delT, 3905insT, and V520F, in addition to the 25-mutation core panel recommended by ACMG/ACOG for population-based CF screening.
X
ABCC7 p.Arg347His 16778595:55:24
status: NEW
PMID: 17314234
[PubMed]
Radpour R et al: "Molecular study of (TG)m(T)n polymorphisms in Iranian males with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
77
CFTR gene mutations in 112 CBAVD patients and 7 CBAVD patients* Samples Mutation genotype3 (TG)m(T)n n (%) CBAVD Two mutations detected (5 /112 5 4.46%) F508del / R117H (TG)10 9T / (TG)10 9T 1 (0.89) F508del / 621+1G.T (TG)11 7T / (TG)11 7T 1 (0.89) 1540A/G / 1540A/G (TG)11 7T / (TG)11 7T 2 (1.79) R347H / R117H (TG)10 9T / (TG)11 7T 1 (0.89) One mutation detected with one 5T allele (32 / 112 5 28.57%) G551D / - (TG)10 7T/ (TG)13 5T 2 (1.79) F508del / - (TG)12 7T/ (TG)13 5T 8 (7.14) (TG)11 9T/ (TG)13 5T 6 (5.36) 1717-1G.A / - (TG)11 7T/ (TG)12 5T 4 (3.57) R117H / - (TG)12 7T/ (TG)13 5T 2 (1.79) 621+1G.T / - (TG)11 7T/ (TG)13 5T 3 (2.68) 2 (1.79) 1540A/G / - (TG)11 7T/ (TG)13 5T 2 (1.79) R553X / - (TG)12 7T/ (TG)13 5T 1 (0.89) Y122H / -4 (TG)11 7T / (TG)13 5T 1 (0.89) T338A / -4 (TG)10 7T / (TG)13 5T 1 (0.89) No mutation detected with two 5T alleles (11 / 112 5 9.82%) - / - (TG)12 5T / (TG)13 5T 3 (2.68) - / - (TG)13 5T / (TG)13 5T 8 (7.14) One mutation detected without 5T allele (35 / 112 5 31.25%) G85E / - (TG)11 7T / (TG)11 7T 2 (1.79) G551D / - (TG)10 9T / (TG)12 7T1 1 (0.89) 621+1G.T / - (TG)11 7T / (TG)11 7T 2 (1.79) (TG)10 9T / (TG)11 7T 1 (0.89) R334W / - (TG)12 7T / (TG)10 7T 1 (0.89) F508del / - (TG)11 7T / (TG)11 7T 7 (6.25) (TG)11 9T / (TG)12 7T 3 (2.68) (TG)10 9T / (TG)10 9T 2 (1.79) 1717-1G.A / - (TG)11 7T / (TG)12 7T 3 (2.68) (TG)10 9T / (TG)11 7T 2 (1.79) R117H/- (TG)12 7T / (TG)12 7T 2 (1.79) (TG)10 9T / (TG)11 7T 1 (0.89) 2789+5G.A / - (TG)10 7T / (TG)11 7T 1 (0.89) 3120+1G.A / - (TG)10 9T / (TG)11 7T 2 (1.79) R560T / - (TG)10 9T / (TG)11 7T 1 (0.89) N1303K / - (TG)10 9T / (TG)11 7T 1 (0.89) 1651A/G / - (TG)11 7T / (TG)12 7T 1 (0.89) R553X / - (TG)10 9T / (TG)10 7T 1 (0.89) K536X / -4 (TG)10 9T / (TG)10 9T 1 (0.89) No mutation detected with one 5T alleles (7 / 112 5 6.25%) - / - (TG)13 5T / (TG)12 7T 3 (2.68) - / - (TG)13 5T / (TG)10 9T 4 (3.57) No mutation detected (22 / 112 5 19.64%) - / - (TG)11 7T / (TG)11 7T 12 (10.71) - / - (TG)11 7T / (TG)12 7T 1 (1.79) - / - (TG)10 9T / (TG)10 9T 3 (2.68) - / - (TG)10 9T / (TG)11 7T 6 (5.36) CUAVD One mutation detected without 5T allele (2 / 7 5 28.57%) R334W / - (TG)10 9T / (TG)11 7T 1 (14.29) R117H / - (TG)11 7T / (TG)11 7T 1 (14.29) No mutation detected with one 5T alleles (3 / 7 5 42.86%) - / - (TG)11 9T / (TG)13 5T 2 (28.57) - / - (TG)10 7T / (TG)13 5T 1 (14.29) No mutation detected (2 / 7 5 28.57%) - / - (TG)10 9T / (TG)12 7T 2 (28.57) * CBAVD indicates congenital bilateral absence of the vas deferens; CUAVD, congenital unilateral absence of the vas deferens.
X
ABCC7 p.Arg347His 17314234:77:299
status: NEW
PMID: 17489851
[PubMed]
Tzetis M et al: "Contribution of the CFTR gene, the pancreatic secretory trypsin inhibitor gene (SPINK1) and the cationic trypsinogen gene (PRSS1) to the etiology of recurrent pancreatitis."
No.
Sentence
Comment
63
Nine patients (36%) were compound heterozygotes for two CFTR mutations, both mild (class IV or V): p.I148T/p.R75Q, c.278915G.A/p.R75Q or mild and severe: three with p.F508del/p.R334W and four withc.444delA/p.R334W,p.E822X/c.278915G.A, p.E822X/p.R347H and p.F508del/c.3272226A.G, each.
X
ABCC7 p.Arg347His 17489851:63:245
status: NEW83 This could especially apply for p.R334W, p.R347H, p.R1070Q, p.R75Q and c.278915G.A, for which the difference in mutation frequency between patients and classic CF cohort, reached statistical significance (Table 2).
X
ABCC7 p.Arg347His 17489851:83:43
status: NEW90 Mutations and variants in the CFTR gene CFTR mutation/variant Patients with pancreatitis, n ¼ 25 (%) Controlsa , n ¼ 211 (%) Classic patients with CF, n ¼ 426 (%) p vs controls p vs patients with CF p.F508del 5 (10) 2 (0.47) 465 (54.6) ,0.0001 ,0.0001 p.R334W 4 (8) - 7 (8.2) 0.00011 0.0019 c.444delA 1 (2) - 1 (0.1) c.278915G.A 2 (4) - 11 (1.3) 0.011 CFTRdel2,3 (21 kb) 1 (2) - 2 (0.2) c.E822X 2 (4) - 12 (1.5) 0.011 p.R347H 1 (2) - - 0.055 p.R1070Q 3 (6) 1 (0.24) 7 (0.8) 0.004 0.013 p.G576A 1 (2) - 1 (0.1) p.F1052V 1 (2) 4 (0.95) 1 (0.1) p.I148T 1 (2) - 1 (0.1) c.3272226A.G 1 (2) - 7 (0.82) p.R75Q 2 (4) 4 (0.95) 1 (0.1) 0.0086 c.2752215G/C 1 (2) 4 (1) 5 (0.6) TG11T7 26 (52) 286 (67.7) ND TG11T5 2 (4) 5 (1.18) ND TG10T7 8 (16) 79 (18.7) ND TG10T9 8 (16) 14 (3.3) ND 0.0005 TG12T7 2 (4) 8 (1.9) ND M470 6 (12) 48 (11.4) ND V470 8 (16) 166 (39.3) ND 0.008 CF, cystic fibrosis; ND, not determined.
X
ABCC7 p.Arg347His 17489851:90:435
status: NEW
PMID: 18193900
[PubMed]
Cheung JC et al: "Misfolding of the cystic fibrosis transmembrane conductance regulator and disease."
No.
Sentence
Comment
91
Mutants R334W, R347H/P also cause changes in ion conduction or regulation (74, 75).
X
ABCC7 p.Arg347His 18193900:91:15
status: NEW115 WT, L346P, R347P, L346P/R347I, and R347H CFTR expression was assayed by immunoblotting, using the mouse monoclonal anti-HA Ab. Equal loading of proteins was verified by visualizing the Na+/K+-ATPase (lower panel).
X
ABCC7 p.Arg347His 18193900:115:35
status: NEW137 When the biogenesis of corresponding full-length CFTR mutants was examined in this context, the protein harboring the L346P mutation was found to be unstable, while the wild type, R347P, along with the R347H mutant protein, processed normally (Figure 4A).
X
ABCC7 p.Arg347His 18193900:137:202
status: NEW
PMID: 18306312
[PubMed]
Gene GG et al: "N-terminal CFTR missense variants severely affect the behavior of the CFTR chloride channel."
No.
Sentence
Comment
133
Genotype^Phenotype Correlation in the N-Terminal CFTR MissenseVariants Under Studyà Missense varianta Phenotype Second allele (number of patients)b p.P5L CF p.F508del (1), p.P205S (1) p.S50P CBAVD p.F508del (1), p.E115del (1) p.E60K CF p.G542X (1), p.I507del (1) p.R75Q HT p.F508del (3), p.E725K (1) B p.R347H (1), p.R75Q (1), n.i. (4) Br c.1584G4A (2), c.1210-7_1210-6delTT (1), n.i.(3) NT p.F508del (1) CP c.1584G4A (1), n.i. (3) MI n.i. (1) CUAVD n.i. (2) OZ n.i. (2) Normal p.R75Q (1), c.2052_2053insA (1), n.i. (1) p.G85E CF p.F508del (8), p.G542X (2), p.I507del (1), c.580-1G4T (1), p.G85E (1), c.1477_ 1478delCA (1) CBAVD p.G576A (1) HT p.L997F (1),WT (1) p.G85V CF p.F508del (2), p.G542X (2), p.Y1092X (1), c.265715G4A (1), p.A1006E, c.1210-7_1210- 6delTT (1), n.i. (1) p.Y89C CF n.i. (1)c p.E92K CF p.F508del (2), p.Q890X (1), p.L206W (1) CBAVD c.1210-7_1210-6delTT (1) ÃThe recommendations for mutation nomenclature (www.hgvs.org/mutnomen/) were used to name CFTR gene sequence variations at both the nucleotide level and the protein level.
X
ABCC7 p.Arg347His 18306312:133:309
status: NEW
PMID: 18421494
[PubMed]
Cui G et al: "Mutations at arginine 352 alter the pore architecture of CFTR."
No.
Sentence
Comment
21
Alternatively, Cotten and Welsh (1999) reported that R347 plays an important role in regulating the overall structure of the CFTR pore; R347P-CFTR exhibited significantly decreased single-channel conductance and unstable channel openings, while R347H-CFTR displayed a pH-dependent conductance and anomalous mole-fraction behavior.
X
ABCC7 p.Arg347His 18421494:21:245
status: NEW
PMID: 18470946
[PubMed]
Berwouts S et al: "Evaluation and use of a synthetic quality control material, included in the European external quality assessment scheme for cystic fibrosis."
No.
Sentence
Comment
72
The MMQCI-CF-P1 control distributed to EQA participants contained six homozygous mutations and one polymorphism: R553X (c.1657C4T, p.Arg553X), I507del (c.1519_1521delATC, p.Ile507del), R117 H (c.350G4A, p.Arg117His), 394delTT (c.262_263delTT, p.Leu88fs), 2183AA4G (c.2051_2052delAAinsG, p.Lys684fs), R347 H (c.1040G4A, p.Arg347His), and 5 T (c.1210-12T[5]).
X
ABCC7 p.Arg347His 18470946:72:323
status: NEW135 Mutations 2183AA4G (c.2051_2052delAAinsG, p.Lys684fs) and R347 H (c.1040G4A, p.Arg347His) cross-react with 2184delA (c.2052delA, p.Lys684fs) and R347P (c.1040G4C, p.Arg347Pro), respectively, in many CFTR detection methods.
X
ABCC7 p.Arg347His 18470946:135:79
status: NEW136 This explains why seven laboratories made genotype errors (missing 2183AA4G (c.2051_2052delAAinsG, p.Lys684fs) and R347 H (c.1040G4A, p.Arg347His)) and/or reported mutations not present in the QCS (2184delA (c.2052delA, p.Lys684fs) and R347P (c.1040G4C, p.Arg347Pro)); they encountered difficulties in interpreting typical cross-reaction patterns that are explained in the manual of the assays.
X
ABCC7 p.Arg347His 18470946:136:136
status: NEW157 ErrorTypes for the QCS in More Detail, for the LaboratoriesThat Used Only One Detection Assayà Genotype error Genotype Detection assay Number of labs Expected Reported Comment OLA-CFASR v2.0 1 R117 H hom ^ Correct on raw data INNO-LiPA CFTR36 1 R117 H hom R117 H het No signal for wt R117 H visible on copy of the raw data, could be very weak on original raw data INNO-LiPA CFTR36 1 R553X hom R553X het No signal for wt R553X visible on copy of the raw data, could be very weak on original raw dataI507del hom I507del/F508del Sequencing 2 R347 H hom ^ No complete raw data received Sequencing 1 I507del hom ^ No raw data received Additional mutation(s) reported Detection assay Number of labs Additional mutation(s) Comment OLA-CFASR v3.0 US 1 2184delAa hom Software called it INNO-LiPA CFTR36 3 A455E het (3labs), F508del (1lab) No signal for mut A455E visible on copy of the raw data, could be very weak on original raw data ARMS-ElucigeneTM CF29 3 2184delAa (3labs), R347P (3labs), 1717-1G4A (3labs), 3849110kbC4T (2labs) Cross reaction with 2183AA4Gb and R347 H and no full compatibility of MMQCI-CF-P1and ARMS method: no control bands visible ARMS-ElucigeneTM CF29 1CF-HT 1 2184delAa , R347P Cross reaction with 2183AA4Gb and R347H Sequencing 1 W1282X het, N1303 K het No raw data received ASPE-CFTR 4014 Tag-It 1 71111G4T het No raw data received Genotype error 1 additional mutation(s) reported Genotype Detection assay Number of labs Expected Reported Comment Additional mutation(s) Comment OLA-CFASR v3.0 EU 1 R117 H hom ^ No raw data received; probably 2183AA4Gb missed, but 2184delAa reported due to cross reaction 2184delAa hom No raw data received, probably due to cross-reaction with 2183AA4Gb 394delTTc hom 394delTTc het 2183AA4Gb hom ^ INNO-LiPA CFTR36 1 R553X hom I507del hom R553X het I507del/ F508del No signal for wt R553X visible on copy of the raw data, could be very weak on original raw data G542X het A455E het No signal for mut G542X and mut A455E visible on copy of the raw data, could be very weak on original raw data INNO-LiPA CFTR36 1 Italian regional 1 R553X hom R553X het No signal for wt R553X visible on copy of the raw data, could be very weak on original raw data Q552X het Misinterpretation: wt and mut signal for Q552X not visible, but this is a normal reaction pattern when R553X is hom present; the lab reported R553X het ARMS-ElucigeneTM CF29 1 I507del hom ^ No full compatibility of MMQCI- CF-P1 and ARMS method: no control bands R347P Cross-reaction with R347H2183AA4Gb hom ^ ÃIf the zygosity is not mentioned in the table, the laboratory did not report it.
X
ABCC7 p.Arg347His 18470946:157:1236
status: NEW
PMID: 19652440
[PubMed]
Izumikawa K et al: "Unique mutations of the cystic fibrosis transmembrane conductance regulator gene of three cases of cystic fibrosis in Nagasaki, Japan."
No.
Sentence
Comment
4
Case 3; a 29-year-old woman complaining of cough and sputum was diagnosed as CF with a heterozygous R347H mutation in exon 7 and a polymorphic 125C in exon 1.
X
ABCC7 p.Arg347His 19652440:4:100
status: NEW16 The other novel or rare mutations such as R347H, D 979A, 1724delAG, H1085R, M152R and 1540del10 have The Second Department of Internal Medicine, Nagasaki University School of Medicine, Nagasaki, Department of Respiratory Medicine, National Hospital Organization Minami-Kyushu National Hospital, Kagoshima, Department of Respiratory Medicine, National Hospital Organization Ureshino Medical Center, Ureshino, Department of Laboratory Medicine, Nagasaki University School of Medicine, Nagasaki and Department of Respiratory Medicine, Respiratory Center, Toranomon Hospital, Tokyo Received for publication January 20, 2009; Accepted for publication April 14, 2009 Correspondence to Dr. Koichi Izumikawa, koizumik@nagasaki-u.ac.jp Figure1.
X
ABCC7 p.Arg347His 19652440:16:42
status: NEW60 Heterozygous R347H mutation in exon 7 and a polymorphic 125C in exon 1 were present by CFTR mutation screening.
X
ABCC7 p.Arg347His 19652440:60:13
status: NEW66 Locus of CFTR mutationCase Age Sex CP sinusitis CBAVD PFD test (%) sweat chloride concentration (mmol/L) Mutation (variant) Exon Mutation (variant) Exon 1 24 M - + + 17.0 94.0 125C 1 Q98R 4 2 13 F + - - 67.0 54.8 Q98R 4 Q98R 4 3 29 F - + - 69.8 60.0 125C 1 R347H 7 CP, consanguineous parents; CBAVD, congenital bilateral absence of the vas deferens; PFD, pancreatic functional diagnostant.
X
ABCC7 p.Arg347His 19652440:66:257
status: NEW90 The R347H mutation which was detected in Case 3 was originally reported in 1992 in a CF patient with mild phenotype (18).
X
ABCC7 p.Arg347His 19652440:90:4
status: NEW91 The clinical features of CF patients with R347H mutation were characterized as mild pulmonary symptoms and all men were infertile accompanied by CBAVD (7).
X
ABCC7 p.Arg347His 19652440:91:42
status: NEW92 Although a few cases with R347H mutations with F508del on the other allele were previously reported in Japan and Italy (7, 18), no cases with R347H/125C mutation have been reported before.
X
ABCC7 p.Arg347His 19652440:92:26
status: NEWX
ABCC7 p.Arg347His 19652440:92:142
status: NEW98 The mutations detected were Q 98R in Cases 1 and 2, and R347H in Case 3, although they were heterozygous in Cases 1 and 3.
X
ABCC7 p.Arg347His 19652440:98:56
status: NEW
PMID: 19843100
[PubMed]
Burgel PR et al: "Non-classic cystic fibrosis associated with D1152H CFTR mutation."
No.
Sentence
Comment
42
The CF genetic analysis panel used in France seeks for 32 mutations: G85E, 394delTT, 621+1G>T, 711+1G>T, R334W, R347P, R347H, 1078delT, 5T/7T/9T, A455E, F508del, I507del, V520F, 1717-1G>A, G542X, G551D, R553X, R560T, S549R (T>G), S549N, 1898+1G>A, 2183AA>G, 2184delA, 2789+5G>A, 3120+1G>A, R1162X, 3659delC, 3849+10kbC>T, W1282X, 3905insT, 3876delA, N1303K.
X
ABCC7 p.Arg347His 19843100:42:119
status: NEW
PMID: 19885835
[PubMed]
McWilliams RR et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations and risk for pancreatic adenocarcinoma."
No.
Sentence
Comment
84
(%) of Controls, n513,340 Significance Not detected 899 (94.7) 12,830 (96.2) OR, 1.40 (95% CI, 1.04-1.89) Detected 50 (5.3) 510 (3.8) P¼.027 DF508*,y 35 (70) 354 (69.4) R117H*,z 5 (10) 71 (13.9) G551D*,y 1 (2) 11 (2.2) N1303K*,y 1 (2) 8 (1.6) G542X*,y 8 (1.6) 1717-1G>A*,y 7 (1.4) 278915G>A* 6 (1.2) R553X*,y 6 (1.2) W1282X*,y 5 (10) 5 (1.0) R347H 5 (1.0) R1162X*,y 4 (0.8) 62111G>T*,y 4 (0.8) R560T*,y 3 (0.6) R347P* 1 (2) 2 (0.4) A455E* 2 (0.4) 3849110kbC>T* 2 (0.4) 394delTT 2 (0.4) G85E* 2 (0.4) 3905insTy 2 (0.4) 189811G>A* 2 (0.4) 2183AA>G 1 (0.2) 2184delA*,y 1 (0.2) 71111G>T*,y 1 (0.2) V520F 1 (0.2) S549Ry 1 (2) DI507*,y 1 (2) OR indicates odds ratio; CI, confidence interval.
X
ABCC7 p.Arg347His 19885835:84:347
status: NEW
PMID: 19897426
[PubMed]
Picci L et al: "A 10-year large-scale cystic fibrosis carrier screening in the Italian population."
No.
Sentence
Comment
48
Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT.
X
ABCC7 p.Arg347His 19897426:48:177
status: NEW89 Mutations found in the homozygous (n=2) and heterozygous (n=20) diagnosed foetuses are the following: ΔF508/ΔF508 (n=1), 711+5G→A/711+5G→A (n=1), ΔF508/P5L (n=1), 2183AA→G/S42F (n=1), ΔF508/ D1445N (n=1), 711+5G→A/ΔF508 (n=1), G542X/E527G (n=1), N1303K/1717-1 G→A (n=1), R117H/E527G (n=1), ΔF508/2183AA→G (n=1), ΔF508/D1152H (n=1), R347H/ ΔF508 (n=1), ΔF508/G542X (n=2), ΔF508/N1303K (n=2), R1162X/ΔF508 (n=3), N1303K/D1152H (n=3).
X
ABCC7 p.Arg347His 19897426:89:416
status: NEW97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction.
X
ABCC7 p.Arg347His 19897426:97:546
status: NEWX
ABCC7 p.Arg347His 19897426:97:865
status: NEW
PMID: 19914431
[PubMed]
Munck A et al: "The importance of sweat testing for older siblings of patients with cystic fibrosis identified by newborn screening."
No.
Sentence
Comment
32
Thus, if we consider our 7 symptom-free siblings, 2 had mutations associated with classical CF disease, 1 with variable phenotype expression (an intermediate chloride ST: 50 mmol/L, F508del/R347H) and 4 children (from 3 families) combined a severe mutation with R117H against a background polythymidine sequence of intron 8 7 T-9 T, with 2 ST that were positive.
X
ABCC7 p.Arg347His 19914431:32:190
status: NEW
PMID: 20059485
[PubMed]
Dorfman R et al: "Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?"
No.
Sentence
Comment
64
Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure).
X
ABCC7 p.Arg347His 20059485:64:699
status: NEW57 PI prevalence and in silico prediction scores for 13 most frequent missense mutations identified in Canadian CF patients Mutation Total PI Total (PI + PS) PI prevalence Class PANTHER scorea POLYPHENa SIFTa p.R334W 1 9 0.11 CF-PS -7.4419 Possibly damaging 0.01 p.P67L 2 14 0.14 CF-PS -4.1736 Probably damaging 0 p.R347P 2 12 0.17 CF-PS -7.5259 Possibly damaging 0.01 p.R347H 1 5 0.20 CF-PS -6.8327 Possibly damaging 0 p.A455E 8 39 0.21 CF-PS -8.8641 Probably damaging 0 p.L206W 4 19 0.21 CF-PS -8.5817 Possibly damaging 0 p.P574H 4 7 0.57 CF-PI/PSb -8.1252 Probably damaging 0 p.G85E 15 24 0.63 CF-PI/PSb -7.3194 Possibly damaging 0 p.M1101K 22 33 0.67 CF-PI/PSb -5.8849 Probably damaging 0.01 p.R1066C 7 8 0.88 CF-PI -7.7424 Probably damaging 0 p.G551D 56 59 0.95 CF-PI -9.5654 Probably damaging 0 p.N1303K 47 49 0.96 CF-PI -9.7687 Probably damaging 0 p.V520F 7 7 1.00 CF-PI -7.1652 Benign 0 aPANTHER scores range from zero to negative values (maximum -12).
X
ABCC7 p.Arg347His 20059485:57:368
status: NEW129 A disparity in prediction scores between two mild CF-PS mutations (p.R347H and p.R347P) that confer an amino acid change in the same position of the protein points to another limitation of these tools.
X
ABCC7 p.Arg347His 20059485:129:69
status: NEW
PMID: 20100616
[PubMed]
Havasi V et al: "Association of cystic fibrosis genetic modifiers with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
68
Portuguese CFTR alleles Spanish CFTR alleles Turkish CFTR alleles 5T 22 F508del 11 5T 20 F508del 14 5T 9 D1152H 14 R334W 5 D443Ya 3 D110H 3 R117H 3 G576Aa 3 F508del 2 S1235R 3 R668Ca 3 3041-11del7 2 N1303K 2 G542X 2 1767del6 2 P205S 2 R117H 2 2789þ5G>A 2 D614G 2 V232D 2 CFTRdele2(ins186) 2 G542X 1 L997F 1 3120þ1G>A 1 L206W 1 H609R 1 G1130A 1 V562I 1 N1303H 1 M952I 1 I507del 1 L206W 1 365insT 1 3272-26A>G 1 3272-26A/G 1 E585X 1 2789þ5G>A 1 L15P 1 2752-15C>G 1 G576Aa 1 R347H 1 R334Q 1 R668Ca 1 2689insG 1 R347H 1 CFTRdele2,3 1 R1070W 1 E831X 1 L1227S 1 I 1027T 1 R1070W 1 E831X 1 3272-26A>G 1 L997F 1 I853F 1 A349V 1 6T 1 Note: CFTR ¼ cystic fibrosis transmembrane conductance regulator.
X
ABCC7 p.Arg347His 20100616:68:487
status: NEWX
ABCC7 p.Arg347His 20100616:68:523
status: NEW
PMID: 20108119
[PubMed]
Joergensen M et al: "Incidence, prevalence, etiology, and prognosis of first-time chronic pancreatitis in young patients: a nationwide cohort study."
No.
Sentence
Comment
49
1G [ T, F508del, S549 N, I507del, S549R, 2184delA, G551D, G85E, N1303 K, R560T, R117H, R347H, R347P, R334 W, 2789 ?
X
ABCC7 p.Arg347His 20108119:49:87
status: NEW
PMID: 20167849
[PubMed]
Bienvenu T et al: "Cystic fibrosis transmembrane conductance regulator channel dysfunction in non-cystic fibrosis bronchiectasis."
No.
Sentence
Comment
82
GENOTYPE AND PHENOTYPE OF PATIENTS WITH DIFFUSE BRONCHIECTASIS BEARING TWO CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR MUTATIONS Patient No. Age (yr) Sex (M/F) CFTR Mutations Sweat Cl2 (mmol/L) Basal PD (mV) NPD Index Age at Onset (yr) FEV1 (% pred) Bacteria Colonization 1 55 F F508del/D1152H 19 219 1.00 54 99 Sa 2 71 F F508del/G576A-R668C 29 223 0.44 70 114 None 3 24 M G542X/3849110kbCT 52 224 1.22 10 78 Pa 4 41 F 394delTT/D1152H 19 225 0.30 41 89 Sa 5 31 M 3849110kbC.T/3849110kbC.T 35 230 0.64 2 30 Sa/Pa 6 74 F G542X/S912L 40 233 0.19 60 106 None 7 50 M W1282X/D1152H 35 236 1.00 10 32 Pa 8 42 F F508del/D1152H 13 240 0.68 30 32 Pa 9 56 F F508del/IVS8-5T 30 242 0.70 10 70 None 10 45 F 394delTT/D1152H 25 242 0.71 18 62 Sa/Pa 11 74 F W1282X/D1152H 25 244 0.66 12 56 Pa 12 23 F S1206X/D1152H 19 244 0.68 13 107 None 13 41 F R553X/R851L-T351S 31 248 0.50 35 72 Pa 14 58 M F508del/R117H-7T 46 251 0.61 45 35 Sa/Pa 15 53 F F508del/R347H 49 258 0.63 40 77 Pa Definition of abbreviations: Cl2 5 chloride; F 5 female; M 5 male; NPD index 5 nasal potential difference index 5 e(response to øCl2 and iso/response to amil); a cut off .
X
ABCC7 p.Arg347His 20167849:82:943
status: NEW
PMID: 20522854
[PubMed]
Sermet-Gaudelus I et al: "Measurement of nasal potential difference in young children with an equivocal sweat test following newborn screening for cystic fibrosis."
No.
Sentence
Comment
91
Of the three patients with two CFTR mutations in the HIRT-Nl group, one carried a mutation without any clinical consequence (3849+45G/A), while the other two carried F508del in trans with the R347H broad-spectrum mutation, or the CFTR-RD-associated mutation R117H.
X
ABCC7 p.Arg347His 20522854:91:192
status: NEW130 Table 3 Genotypes of the children with HIRT according to the diagnostic score cut-off in the 21 patients with reliable NPD tests; results after extensive genetic analysis CFTR genotypes Diagnosis score >0.27 (8 patients) £0.27 (13 patients) A/A 0 F508del/621+3A/G F508del/Q1291R A/AB F508del/R347H F508del/R117H;T7 W846X/R117C n¼2 F508del/R1070W 2183AA/G/L206W F508del/3272-26A/G F508del/R117H;T7; n¼4 A/D 0 F508del/R933G G551D/R352Q B/D G622D/3849+45G/A 0 A/0 F508del/0 n¼2 0 0/0 3 0 0, no identified mutation; A, CF-causing mutation; B, mutation associated with cystic CFTR-related disorders; C, mutation with no clinical consequence ; D, mutation of unknown or uncertain clinical relevance; AB, mutation that is associated with a wide phenotypic spectrum that might belong to either group A or B. CFTR, cystic fibrosis transmembrane conductance regulator; HIRT, hypertrypsinaemia; NPD, nasal potential difference.
X
ABCC7 p.Arg347His 20522854:130:297
status: NEW
PMID: 20657600
[PubMed]
Giuliani R et al: "Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols."
No.
Sentence
Comment
58
INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator.
X
ABCC7 p.Arg347His 20657600:58:568
status: NEW
PMID: 20706124
[PubMed]
Lucarelli M et al: "A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation."
No.
Sentence
Comment
103
In vivo findings and, in some cases, in vitro functional characterizations have been reported for [F508C; S1251N],38 [R347H; D979A],39,40 [R74W; D1270N],41 [G628R; S1235R],42,43 [M470V; S1235R],42 [S912L; G1244V],44 [R117H; (TG)mTn],45-47 [R117C; (TG)mTn],46 [S1235R; (TG)mT5],48 [G576A; R668C],10,49 [V562I; A1006E],49 [R352W; P750L],49 [1198_1203del TGGGCT; 1204GϾA],49 [V754M; CFTRdele3_10,14b_16],50 and [F508del; I1027T].51 These complex alleles have been found in patients with either CF or CFTR-RD, although more often in the former.
X
ABCC7 p.Arg347His 20706124:103:118
status: NEW
PMID: 20932301
[PubMed]
Green DM et al: "Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients."
No.
Sentence
Comment
74
For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function.
X
ABCC7 p.Arg347His 20932301:74:998
status: NEWX
ABCC7 p.Arg347His 20932301:74:1019
status: NEW
PMID: 21228336
[PubMed]
Brown MB et al: "Low abundance of sweat duct Cl- channel CFTR in both healthy and cystic fibrosis athletes with exceptionally salty sweat during exercise."
No.
Sentence
Comment
114
Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X.
X
ABCC7 p.Arg347His 21228336:114:133
status: NEW119 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X.
X
ABCC7 p.Arg347His 21228336:119:133
status: NEW
PMID: 21474639
[PubMed]
Rohlfs EM et al: "Cystic fibrosis carrier testing in an ethnically diverse US population."
No.
Sentence
Comment
123
CFTR mutationsa Individuals, n p.F508del/p.R117H 16 5T/9T 1 7T/9T 15 p.F508del/p.D1152H 3 p.R117H/p.R117H, 7T/7T 2 p.D1152H/p.D1152H 2 p.W1282X/p.D1152H 2 p.D1152H/p.G551D 1 c.3717ϩ12191CϾT/p.R352Q 1 c.3717ϩ12191CϾT/c.3717ϩ12191CϾT 1 p.F508del/c.3717ϩ12191CϾT 1 p.F508del/p.L206W 1 p.F508del/p.R117C 1 p.F508del/p.R347H 1 p.F508del/p.R347P 1 p.R117H/p.W1282X, 7T/7T 1 p.R117H/p.G551D, 7T/7T 1 p.R117H/p.G542X, 7T/9T 1 a Human Genome Variation Society nomenclature [Ogino et al. (23)].
X
ABCC7 p.Arg347His 21474639:123:362
status: NEW
PMID: 21538969
[PubMed]
Ren CL et al: "Clinical outcomes in infants with cystic fibrosis transmembrane conductance regulator (CFTR) related metabolic syndrome."
No.
Sentence
Comment
60
Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1-CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected.
X
ABCC7 p.Arg347His 21538969:60:510
status: NEW61 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1- CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected.
X
ABCC7 p.Arg347His 21538969:61:511
status: NEW
PMID: 21658632
[PubMed]
Becq F et al: "Pharmacological therapy for cystic fibrosis: from bench to bedside."
No.
Sentence
Comment
50
An explanation for why mutations at R347 decrease Cl- flow through CFTR was provided by Tabcharani et al. [14], who demonstrated that the CF mutant R347H converts CFTR from a multi-ion pore to a single-ion pore.
X
ABCC7 p.Arg347His 21658632:50:148
status: NEW
PMID: 9788722
[PubMed]
Petreska L et al: "Molecular basis of cystic fibrosis in the Republic of Macedonia."
No.
Sentence
Comment
40
The screening procedures of 17 other known CF mutations included detection of mutations in the PCR products of positive controls and samples by: a) direct analysis on PAGE for A1507 and 1677delTA, simultaneously to AF508; b) hybridization with ASOs for mutation R117H (21), 1717-1GdA (22), G542X (22), N1303K (23), and W1316X (24), and c) restriction digestion `followed by agarose or polyacrylamide gel electrophoresis (exon 3 PCR product digested with HinfI for CUE, exon 4 with HinfI for 444delA, exon 5 with RsaI for 711 + 5G --*A,exon 7 with HhaI for R347H or with RsaI for Q359K/T360, exon 11 with HincII for both G551D and R553X, exon 19 with DdeI for R1162X or with HphI for 3849G+A, a 175 bp PCR fragment of exon 13 with HaeIII for 2556insAT) (4).
X
ABCC7 p.Arg347His 9788722:40:556
status: NEW
PMID: 9895335
[PubMed]
Cremonesi L et al: "Validation of double gradient denaturing gradient gel electrophoresis through multigenic retrospective analysis."
No.
Sentence
Comment
31
Mutations and polymorphisms analyzed in the CFTR gene. Position Denaturant gradient Mutation Exon 1 40-90% 125G/Ca,b M1V (A3G at 133) 175insT 182delT Exon 3 10-60% W57G (T3G at 301) 356G/Aa G85E (G3A at 386) Exon 4 20-70% R117H (G3A at 482) 541delC 621ϩ1G3T I148T (T3C at 575) Exon 5 20-70% E193K (G3A at 709) Intron 5 20-70% 711ϩ3A3G Exon 7 20-70% 1078delT R334W (C3T at 1132) T338I (C3T at 1145) R347P (G3C at 1172)b R347H (G3A at 1172) R352Q (G3A at 1187) Exon 10 20-70% M470V (1540A/G)a ⌬F508 (del 3 bp at 1652) Intron 10 10-60% 1717-1G3A Exon 11 10-60% G542X (G3T at 1756) 1784delG R553X (C3T at 1789) Exon 12 10-60% D579G (A3G at 1868) E585X (G3T at 1885) Intron 12 10-60% 1898ϩ3A3G Exon 13 30-80% 2183AA3G E730X (G3T at 2320) L732X (T3G at 2327) 2347delG Exon 14a 10-60% T854T (2694T/G)a V868V (2736G/A)a Intron 14b 30-80% 2789ϩ5G3A Exon 15 20-70% M952I (G3C at 2988)b Exon 17a 20-70% L997F (G3C at 3123)b Exon 17b 20-70% F1052V (T3G at 3286) R1066C (C3T at 3328) R1066H (G3A at 3329) A1067T (G3A at 3331) Exon 18 20-70% D1152H (G3C at 3586)b Exon 19 30-80% R1158X (C3T at 3604) Exon 20 20-70% S1251N (G3A at 3384) W1282X (G3A at 3978) Exon 21 20-70% N1303K (C3G at 4041)b Exon 22 30-80% G1349D (G3A at 4178) 4382delA Exon 24 30-80% Y1424Y (4404C/T)a a Polymorphism.
X
ABCC7 p.Arg347His 9895335:31:431
status: NEW
No.
Sentence
Comment
128
However, because P99C did(128) could control the pore properties of the CF-associated mutant R347H simply by manipulating pH.
X
ABCC7 p.Arg347His 9922375:128:93
status: NEW129 At pH 5.5, not react with MTS reagents (1), P99 probably does not directly line the CFTR pore.when histidine is positively charged, R347H had normal pore properties (128).
X
ABCC7 p.Arg347His 9922375:129:132
status: NEW
No.
Sentence
Comment
357
R347D construct, and if a histidine was substituted for R347 (R347H), the blocking effect of SCN (XSCN Å 0.075)The magnitude of the voltage dependence was consistent with the ion experiencing from 30 to 60% of the transmem- was greatly enhanced at pH 5.5, suggesting that the presence of the positive charge is important for the high-affin-brane potential as it accessed the binding site.
X
ABCC7 p.Arg347His 9922376:357:62
status: NEW556 The more dramatic an R347H construct suggested that a positive charge at this locus was important for high-affinity SCN binding.
X
ABCC7 p.Arg347His 9922376:556:21
status: NEW
PMID: 9922377
[PubMed]
Gadsby DC et al: "Control of CFTR channel gating by phosphorylation and nucleotide hydrolysis."
No.
Sentence
Comment
47
These biochemical resultsthe charge-neutralizing mutation R347H rendered single-channel conductance switchable between wild-type and provide a satisfying corollary to a substantial body of functional data that has established that opening and closingmutant values simply by changing cytoplasmic pH back and forth between 5.5 and 8.7 (195).
X
ABCC7 p.Arg347His 9922377:47:58
status: NEW
PMID: 15744523
[PubMed]
Clain J et al: "A neutral variant involved in a complex CFTR allele contributes to a severe cystic fibrosis phenotype."
No.
Sentence
Comment
12
The combination of two missense mutations on the same chromo some has been described clinically to lessen ([p.R553Q;p.F508del], [p.R334W;p.R1158X]; Dork et al. 1991; Duarte et al. 1996) or worsen ([p.R74W;p.D1270N], [p.R347H;p.D979A]; Casals et al. 1995; Hojo et al. 1998) the phenotype of CF patients with regard to the commonest mutation alone (p.F508del, p.R1158X, p.D1270N, p.R347H).
X
ABCC7 p.Arg347His 15744523:12:219
status: NEWX
ABCC7 p.Arg347His 15744523:12:380
status: NEW
PMID: 17331079
[PubMed]
Alonso MJ et al: "Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry."
No.
Sentence
Comment
52
Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4.
X
ABCC7 p.Arg347His 17331079:52:128
status: NEW
PMID: 20502448
[PubMed]
Joergensen MT et al: "Genetic, epidemiological, and clinical aspects of hereditary pancreatitis: a population-based cohort study in Denmark."
No.
Sentence
Comment
57
The samples were also tested for 33 CFTR mutations, and all 6 classeswererepresented:394delTT,p.R553X,621+1G>T,p.R1162X, 1717-1G>A,3659delC,p.G542X,2183AA>G,p.W1282X,1078delT, 711+1G>T, F508del, p.S549N, I507del, p.S549R, 2184delA, p.G551D, p.G85E, p.N1303K, p.R560T, p.R117H, p.R347H, p.R347P, p.R334W, 2789+5G>A, 3849+10kbC>T, p.A445E, 3120+1G>A, p.V520F,1898+1G>A,3876delA,3905insT,andIVS8-5T.DNAwas amplified by multiplex PCR (Hybaid 4 A62, Middlesex, UK).
X
ABCC7 p.Arg347His 20502448:57:279
status: NEW
PMID: 21036675
[PubMed]
Lay-Son G et al: "Cystic fibrosis in Chilean patients: Analysis of 36 common CFTR gene mutations."
No.
Sentence
Comment
81
Mutation This study Rios et al. [4] Molina et al. [5] Repetto et al. [6] Perez et al. [13] CFGAC [2] (n=578) (%) (n=72) (%) (n=36) (%) (n=100) (%) (n=4102) (%) (n=43,849) (%) Chile Chile Chile Chile Latin-Americaa Worldwide Unknown 58.0 66.6 61.1 34.0 36.7 22.7 p.F508del 30.6 29.2 30.6 45.0 47.1 66.0 p.R334W 3.1 - - 2.0 0.8 0.1 p.G542X 2.4 0 8.3 7.0 5.0 2.4 c.3849+10Kb CNT 1.7 - - 3.0 0.3 0.2 p.R553X 1.2 4.2 0 1.0 0.4 0.7 p.R1162X 0.9 - - 2.0 1.0 0.3 p.1078delT 0.5 - - 0 b0.1 0.1 p.G85E 0.5 - - - 0.8 0.2 p.W1282X 0.2 - - 5.0 1.0 1.2 c.3120+1 GNA 0.2 - - - 0.3 - c.711+1 GNT 0.2 - - - 0.1 0.1 p.R117H 0.2 - - 0 b0.1 0.3 p.A455E 0.2 - - 0 0 0.1 p.I148T 0.2 - - - - - p.G551D 0 0 0 1.0 0.1 1.6 p.N1303K 0 0 0 0 1.8 1.3 c.621+1 GNT 0 - - 0 0.2 0.7 c.1717-1 GNA 0 - - 0 0.3 0.6 p.I507del 0 - - 0 0.2 0.2 p.R347P 0 - - 0 0 0.2 c.2789+5 GNA 0 - - - 0.2 0.1 c.1898+1 GNA 0 - - - 0.1 0.1 c.2184delA 0 - - - b0.1 0.1 p.S549N 0 - 0 - 0.1 0.1 c.3659delC 0 - - 0 0.1 0.1 p.R560T 0 - - - 0 0.1 c.1811+1.6Kb ANG 0 - - - 0.4 - c.2183AANG 0 - - 0 0.1 - p.S549R 0 - - - 0.1 - c.3272-26 ANG 0 - - - 0.1 - c.3199del6 0 - - - b0.1 - p.E60X 0 - - 0 0 - c.3905insT 0 - - - 0 - p.S1251N 0 - - 0 - - CFTRdele2,3 0 - - - - - p.R347H 0 - - - - - p.V520F 0 - - - - - p.Q552X 0 - - - - - c.394delTT 0 - - - - - c.711+1 GNA 0 - - - - - c.2143delT 0 - - - - - c.3876delA 0 - - - - - a Data from Chilean patients published in Rios et al., Molina et al., and Repetto et al. [4-6] included in this publication were excluded in this table to avoid repetition.
X
ABCC7 p.Arg347His 21036675:81:1207
status: NEW
PMID: 7947814
[PubMed]
Loo TW et al: "Mutations to amino acids located in predicted transmembrane segment 6 (TM6) modulate the activity and substrate specificity of human P-glycoprotein."
No.
Sentence
Comment
280
Mutation of Arg347 to His resulted in the ability of CFTR to eliminate the multiple ion occupancy effects when the pH of the intracellular solution is changed (Tabcharani et al., 1993).
X
ABCC7 p.Arg347His 7947814:280:12
status: NEW
PMID: 22678879
[PubMed]
El-Seedy A et al: "CFTR mutation combinations producing frequent complex alleles with different clinical and functional outcomes."
No.
Sentence
Comment
105
[2002C>T;3718-2477C>T] p.Gln689X 2 CSD Nasal polyposis 14 y,16 y NA, 29 p.[Gly576Ala;Arg668Cys] NI 3 IP 35-39 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 IP Bronchitis 49 y NA p.[Gly576Ala;Arg668Cys] p.PheF508del 1 IP 42 y NA p.[Gly576Ala;Arg668Cys] p.Arg668Cys 1 IP NA NA p.[Gly576Ala;Arg668Cys] c.1210_34TG[12]T[5] 4 IP 19-69 y NA p.[Gly576Ala;Arg668Cys] NI 1 Cholestasis 60 y NA p.[Gly576Ala;Arg668Cys] c.1584G>A 33 CBAVD 27-50 y 9-82 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 2 CBAVD 30 y,36 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.2051_2052delAAinsG 1 CBAVD 34 y 72 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Trp1282X 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 CBAVD 35 y 65-66 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Ser549Asn 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.3605delA 1 CBAVD 30 y 41-69 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gln1411X 1 CBAVD 31 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg347His 3 CBAVD 29 y, 34 y, NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gly542X 1 CBAVD 35 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.946delT 1 CBAVD 26 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.4242_4242+1delGGinsT 1 CBAVD 41 y 31 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg117His 1 CBAVD 32 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr338Ile 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Glu379Lys 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Met1137Val 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr1246Ile 2 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 CBAVD 34 NA p.[Gly576Ala;Arg668Cys] p.Asn1303Lys 8 CBAVD 30-42 y NA p.[Gly576Ala;Arg668Cys] NI 1 CBAVD 27 y NA p.Arg668Cys p.Phe508del 1 CBAVD 30 y NA p.Arg668Cys NI 1 CUAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 1 CUAVD NA NA p.[Gly576Ala;Arg668Cys] NI 1 CUAVD Renal agenesis NA NA p.[Gly576Ala;Arg668Cys] NI 1 Hypofertility (not CBAVD) CF carrier`s partner NA NA p.[Gly576Ala;Arg668Cys] p.Asp1152His 1 FBA Mild CF considered possible, 2 older brothers with the same genotype, one with a very mild phenotype, the other being asymptomatic 22 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 FBA TOP for de novo chromosomal translocation; not CF 21 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg31Cys 1 FBA Not CF at birth 28 wg <30 p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Unknown outcome 23 wg NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Not CF at birth 21 wg <30 p.[Gly576Ala;Arg668Cys] p.Trp846X (Continued) Table 1.
X
ABCC7 p.Arg347His 22678879:105:922
status: NEW
PMID: 22658665
[PubMed]
Ooi CY et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis."
No.
Sentence
Comment
855
CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray.
X
ABCC7 p.Arg347His 22658665:855:1304
status: NEW
PMID: 22892530
[PubMed]
Sobczynska-Tomaszewska A et al: "Newborn screening for cystic fibrosis: Polish 4 years' experience with CFTR sequencing strategy."
No.
Sentence
Comment
57
Mutations D537N and P731L have not been Period of NBS CF Method The most frequent mutations in Polish population under analysis September 2006 - December 2007 Estonia Asper Biotech assay E60X, G85E, 394delTT, R117H, R117P, R117L, I148T, 621G>A, 711+1G>T, 711+5G>A, 1078delT, R334W, R347H, R347P, R347L, IVS8-T, A455E, I507del, F508del, 1717-1G>A, G542X, p.G551D, Q552X, R553X, R553G, R560T, R560K, 1898+1G>A, 1898+1G>T, 1898+1G>C, 2143delT, 2184delA, 2183AA>G, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, R1162X, 3659delC, 3849+10kbC>T, 3905insT, S1235R, S1251N, W1282X, W1282C, N1303K, CFTRdele2,3 January 2007 - June 2009 Sanger sequencing of exons: 4, 7, 10, 11, 13, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R117H+IVS8-T*, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K July 2009 - currently Sanger sequencing of exons: 7, 10, 11, 13, 17b, 20, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K, 3272-26A>G**, W1282X** * removed from DNA analysis since July 2009 , **added into DNA analysis since July 2009 Figure 1 NBS CF in Poland.
X
ABCC7 p.Arg347His 22892530:57:282
status: NEW
PMID: 22581207
[PubMed]
Krulisova V et al: "Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA."
No.
Sentence
Comment
81
According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations.
X
ABCC7 p.Arg347His 22581207:81:2803
status: NEWX
ABCC7 p.Arg347His 22581207:81:2814
status: NEW
PMID: 22483971
[PubMed]
Li H et al: "Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) in Chinese patients with congenital bilateral absence of vas deferens."
No.
Sentence
Comment
77
Lastly, we have observed previously reported mutations and polymorphisms (p.E217G, p.R347H, p.V470M, p.R553X, p.I556V, p.T854T, p.G970D, p.P1290P, p.Q1352H, p.Q1643Q, 744-5delGATT, IVS8-T5) (Supplementary Table 1).
X
ABCC7 p.Arg347His 22483971:77:85
status: NEW119 △F508 R117H Mutation genotypes IVS8-Tn n (%) Two mutations detected Neg Neg I556V/I556V 7T/7T 1(1.3) Neg Neg I556V/1209+2 G-C 5T/7T 1(1.3) Neg Neg I556V/726delATT 5T/5T 1(1.3) Neg Neg I556V/- 5T/5T 1(1.3) Neg Neg I556V/- 5T/7T 1(1.3) Neg Neg G970D/- 5T/7T 1(1.3) Neg Neg C592F/- 5T/5T 1(1.3) Neg Neg 1209+1 G-C/- 5T/7T 1(1.3) Neg Neg R553X/- 5T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg S485C/- 5T/7T 1(1.3) Neg Neg A357T/- 5T/7T 1(1.3) Neg Neg E217G/- 5T/7T 1(1.3) Neg Neg R347H/- 5T/7T 1(1.3) Neg Neg G451K/- 5T/7T 1(1.3) Neg Neg L558S/- 5T/7T 1(1.3) Neg Neg 3635delT/Q1352H 7T/7T 1(1.3) Neg Neg A1136T/G970D 7T/7T 1(1.3) Neg Neg 870-1 G-C/- 5T/7T 1(1.3) Neg Neg 520-2 A-G/- 5T/7T 1(1.3) Neg Neg R419I/- 5T/7T 1(1.3) Neg Neg C491F/Q1643Q 7T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg R851X/- 5T/7T 1(1.3) Neg Neg P750L/G970D 7T/7T 1(1.3) One mutation detected Neg Neg -/- 5T/7T 2(2.7) Neg Neg -/- 5T/7T 3(4.1) Neg Neg -/- 5T/7T 5(6.8) Neg Neg -/- 5T/5T 2(2.7) Neg Neg -/- 5T/5T 1(1.3) Neg Neg G970D/- 7T/7T 2(2.7) Neg Neg D993Y/- 7T/7T 1(1.3) Neg Neg I556V/- 7T/7T 1(1.3) Neg Neg T388R/- 7T/7T 1(1.3) No mutation detected Neg Neg -/- 7T/7T 8(10.9) Neg Neg -/- 7T/7T 15(20.5) Neg Neg -/- 7T/9T 2(2.7) Neg Neg -/- 7T/7T 4(5.5) Neg: Negative.
X
ABCC7 p.Arg347His 22483971:119:487
status: NEW76 Lastly, we have observed previously reported mutations and polymorphisms (p.E217G, p.R347H, p.V470M, p.R553X, p.I556V, p.T854T, p.G970D, p.P1290P, p.Q1352H, p.Q1643Q, 744-5delGATT, IVS8-T5) (Supplementary Table 1).
X
ABCC7 p.Arg347His 22483971:76:85
status: NEW118 b3;F508 R117H Mutation genotypes IVS8-Tn n (%) Two mutations detected Neg Neg I556V/I556V 7T/7T 1(1.3) Neg Neg I556V/1209+2 G-C 5T/7T 1(1.3) Neg Neg I556V/726delATT 5T/5T 1(1.3) Neg Neg I556V/- 5T/5T 1(1.3) Neg Neg I556V/- 5T/7T 1(1.3) Neg Neg G970D/- 5T/7T 1(1.3) Neg Neg C592F/- 5T/5T 1(1.3) Neg Neg 1209+1 G-C/- 5T/7T 1(1.3) Neg Neg R553X/- 5T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg S485C/- 5T/7T 1(1.3) Neg Neg A357T/- 5T/7T 1(1.3) Neg Neg E217G/- 5T/7T 1(1.3) Neg Neg R347H/- 5T/7T 1(1.3) Neg Neg G451K/- 5T/7T 1(1.3) Neg Neg L558S/- 5T/7T 1(1.3) Neg Neg 3635delT/Q1352H 7T/7T 1(1.3) Neg Neg A1136T/G970D 7T/7T 1(1.3) Neg Neg 870-1 G-C/- 5T/7T 1(1.3) Neg Neg 520-2 A-G/- 5T/7T 1(1.3) Neg Neg R419I/- 5T/7T 1(1.3) Neg Neg C491F/Q1643Q 7T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg R851X/- 5T/7T 1(1.3) Neg Neg P750L/G970D 7T/7T 1(1.3) One mutation detected Neg Neg -/- 5T/7T 2(2.7) Neg Neg -/- 5T/7T 3(4.1) Neg Neg -/- 5T/7T 5(6.8) Neg Neg -/- 5T/5T 2(2.7) Neg Neg -/- 5T/5T 1(1.3) Neg Neg G970D/- 7T/7T 2(2.7) Neg Neg D993Y/- 7T/7T 1(1.3) Neg Neg I556V/- 7T/7T 1(1.3) Neg Neg T388R/- 7T/7T 1(1.3) No mutation detected Neg Neg -/- 7T/7T 8(10.9) Neg Neg -/- 7T/7T 15(20.5) Neg Neg -/- 7T/9T 2(2.7) Neg Neg -/- 7T/7T 4(5.5) Neg: Negative.
X
ABCC7 p.Arg347His 22483971:118:486
status: NEW
PMID: 21999194
[PubMed]
Agarwal R et al: "Link between CFTR mutations and ABPA: a systematic review and meta-analysis."
No.
Sentence
Comment
56
(1996)[30] 11ABPA53chronic bronchitis Asthma,pulmonaryinfiltrates,CB, immediateAfskintestpositivity,totalIgE >1000ngml)1 ,positiveAfprecipitins, elevatedAfIgG/IgE,bloodeosinophilia, sweatchloride<40mmoll)1 /(United States) BothgroupssixmutationsF508del, G542X,GS51D,R553X,W1282X andN1303K;ninemoremutations inABPA:R117H,R347P,R347H, R334W,A455E,G551S, 2789+5G>A,D1152H,and 3849+10kbC>T ReverseASOanalysis andDGGEwithDNA sequencing 1patientcarried2CF (F508del;R347H)and5 carried1CF(4F508del; 1R117H).Mutationsseenin 6/11ABPAvs.1/53 controls Aronetal.
X
ABCC7 p.Arg347His 21999194:56:326
status: NEW59 (2002)[33] 31ABPAHealthycontrols (n=34) Asthma(n=51) Asthma,positiveSPTtoAf,totalIgE >1000ngml)1 ,elevatedAf-IgE,positive precipitinstoAf,bloodeosinophilia >350ll)1 ,pulmonaryinfiltratesonCXR orCBonCT/(NewZealand) 16CFmutations-F508del,I507del, R117H,W1282X,621+1G>T, R334W,R347P,A455E, 1717-1G>A,G542X,5549N, G551D,R553X,R560T,N1303Kand 3849+10kbC>T ASOhybridisationand DGGEwithDNA sequencing 4/31(F508del[n=3], R117H[n=1])vs.2/51 asthma(F508del[n=1], R117H[n=1])vs.1/34 healthycontrols ABPA,allergicbronchopulmonaryaspergillosis;ARMS,amplificationrefractorymutationsystem;ASO,allele-specificoligonucleotide;CB,centralbronchiectasis;CFTR,cysticfibrosis transmembraneconductanceregulator;DGGE,denaturinggradientgelelectrophoresis;OR,oddsratio CFTRmutationclass(classI--1717-1G>A,R1162X,G542X;classII--F508del,N1303K;classIV--R347H,R117H).
X
ABCC7 p.Arg347His 21999194:59:825
status: NEW
PMID: 22293084
[PubMed]
Yu H et al: "Ivacaftor potentiation of multiple CFTR channels with gating mutations."
No.
Sentence
Comment
139
Other CFTR gene mutations associated with residual CFTR function include A445E, R347H, D1152H, and certain splice mutations (3849 +10kbC→T) [4,29-30].
X
ABCC7 p.Arg347His 22293084:139:80
status: NEW140 Other CFTR gene mutations associated with residual CFTR function include A445E, R347H, D1152H, and certain splice mutations (3849 +10kbCT) [4,29-30].
X
ABCC7 p.Arg347His 22293084:140:80
status: NEW
PMID: 22427236
[PubMed]
Rosendahl J et al: "CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?"
No.
Sentence
Comment
140
Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p¼0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts.
X
ABCC7 p.Arg347His 22427236:140:1005
status: NEW150 Table 4 Homozygous and compound heterozygous patients and controls with at least two CFTR, SPINK1 or CTRC variants Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing severe or CF-causing mild/CF-causing mild) p.F508del/p.R117H (7T/9T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.R347H 1/660 (0.2%) 0/1758 NS e p.F508del/p.D1152Hy 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.R1158X 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.1717-1G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/9T)/p.N1303K 1/660 (0.2%) 0/1758 NS e p.D1152Hy/p.N1303K 1/660 (0.2%) 0/1758 NS e Total 9/660 (1.4%) 1/1758 (0.06%) 0.002 16.1 (1.9 to 134.2) CFTR (CF-causing severe or CF-causing mild or non-CF-causing/Non-CF-causing) p.F508del/p.R75Q* 0/660 1/1758 (0.06%) NS e p.F508del/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R75Q*/5T* 1/660 (0.2%) 1/1758 (0.06%) NS e p.R75Q*/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R117H (7T/7T)/p.R75Q* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.E528E* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.S1235R 1/660 (0.2%) 0/1758 NS e p.I148T*/5T* 0/660 1/1758 (0.06%) NS e p.R347P/p.E528E* 1/660 (0.2%) 0/1758 NS e p.E528E*/5T* 1/660 (0.2%) 4/1758 (0.23%) NS e p.H667Y/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/p.E528E* 0/660 1/1758 (0.06%) NS e p.D1152Hy/5T* 1/660 (0.2%) 0/1758 NS e p.S1235R/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e Total 17/660 (2.6%) 14/1758 (0.8%) 0.001 3.3 (1.6 to 6.7) CFTR Total (all, excluded)* 10/660 (1.5%) 1/1758 (0.06%) <0.0001 27 (3.5 to 211.7) SPINK1 p.N34S (hom) 17/660 (2.6%) 0/1758 <0.0001 95.6 (5.7 to 1594) p.N34S (het)/c.(1-215G>A;194+2T>C) 7/660 (1.1%) 0/1758 <0.0001 40.4 (2.3 to 708.2) Total 24/660 (3.6%) 0/1758 <0.0001 135.4 (8.2 to 2231) CTRC p.R254W (hom) 1/546 (0.2%) 0/1700 NS e p.R254W/p.V235I 1/546 (0.2%) 0/1700 NS e Total 2/546 (0.4%) 0/1700 NS e For CFTR compound heterozygous carriers, calculations were performed for patients and controls carrying a combination of one CF-causing severe or a CF-causing mild in addition with one CF-causing mild variant (upper section).
X
ABCC7 p.Arg347His 22427236:150:297
status: NEW135 Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p&#bc;0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts.
X
ABCC7 p.Arg347His 22427236:135:1004
status: NEW144 Table 4 Homozygous and compound heterozygous patients and controls with at least two CFTR, SPINK1 or CTRC variants Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing severe or CF-causing mild/CF-causing mild) p.F508del/p.R117H (7T/9T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.R347H 1/660 (0.2%) 0/1758 NS e p.F508del/p.D1152Hy 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.R1158X 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.1717-1G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/9T)/p.N1303K 1/660 (0.2%) 0/1758 NS e p.D1152Hy/p.N1303K 1/660 (0.2%) 0/1758 NS e Total 9/660 (1.4%) 1/1758 (0.06%) 0.002 16.1 (1.9 to 134.2) CFTR (CF-causing severe or CF-causing mild or non-CF-causing/Non-CF-causing) p.F508del/p.R75Q* 0/660 1/1758 (0.06%) NS e p.F508del/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R75Q*/5T* 1/660 (0.2%) 1/1758 (0.06%) NS e p.R75Q*/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R117H (7T/7T)/p.R75Q* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.E528E* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.S1235R 1/660 (0.2%) 0/1758 NS e p.I148T*/5T* 0/660 1/1758 (0.06%) NS e p.R347P/p.E528E* 1/660 (0.2%) 0/1758 NS e p.E528E*/5T* 1/660 (0.2%) 4/1758 (0.23%) NS e p.H667Y/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/p.E528E* 0/660 1/1758 (0.06%) NS e p.D1152Hy/5T* 1/660 (0.2%) 0/1758 NS e p.S1235R/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e Total 17/660 (2.6%) 14/1758 (0.8%) 0.001 3.3 (1.6 to 6.7) CFTR Total (all, excluded)* 10/660 (1.5%) 1/1758 (0.06%) <0.0001 27 (3.5 to 211.7) SPINK1 p.N34S (hom) 17/660 (2.6%) 0/1758 <0.0001 95.6 (5.7 to 1594) p.N34S (het)/c.(1-215G>A;194+2T>C) 7/660 (1.1%) 0/1758 <0.0001 40.4 (2.3 to 708.2) Total 24/660 (3.6%) 0/1758 <0.0001 135.4 (8.2 to 2231) CTRC p.R254W (hom) 1/546 (0.2%) 0/1700 NS e p.R254W/p.V235I 1/546 (0.2%) 0/1700 NS e Total 2/546 (0.4%) 0/1700 NS e For CFTR compound heterozygous carriers, calculations were performed for patients and controls carrying a combination of one CF-causing severe or a CF-causing mild in addition with one CF-causing mild variant (upper section).
X
ABCC7 p.Arg347His 22427236:144:297
status: NEW
PMID: 22256939
[PubMed]
Massie RJ et al: "Lessons learned from 20 years of newborn screening for cystic fibrosis."
No.
Sentence
Comment
30
Where possible, all patients with a diagnosis of CF had further CFTR mutation analysis performed in an attempt to clarify the genotype (p.A455E, p.S549N, p.R347H, p.R1162X, p.R347P, p.R334W, p.R117H).
X
ABCC7 p.Arg347His 22256939:30:156
status: NEW
PMID: 23056764
[PubMed]
Dooki MR et al: "Detecting Common CFTR Mutations by Reverse Dot Blot Hybridization Method in Cystic Fibrosis First Report from Northern Iran."
No.
Sentence
Comment
8
deltaF508, N1303K, G542X, R347H and W1282X using Reverse Dot Blot method.
X
ABCC7 p.Arg347His 23056764:8:26
status: NEW27 We selected five mutations, deltaF508, N1303K, G542X, R347H and W1282X based on previous reports in Iran and neighboring countries.
X
ABCC7 p.Arg347His 23056764:27:54
status: NEW67 Table 1: Human cystic fibrosis transconductance regulator probes CFTR probe sequenceLocation in the CFTR geneProbe name 5'-NH2-GAAACACCAAAGATGATA-3'Exon10∆F508-N 5'-NH2-GGAAACACCAATGATATT-3'Exon10∆F508-MUT 5'-NH2-TATAGTTCTTGGAGAAGGTG3'Exon11G542X-N 5'-NH2-TATAGTTCTTTGAGAAGGTG-3'Exon11G542X-MUT 5'-NH2-GCTTTCCTCCACTGTTG-3'Exon20W1282X-N 5'-NH2-CAACAGTGAAGGAAAGC-3'Exon20W1282X-MUT 5'-NH2-AGAAAAAACTTGGATCC-3'Exon21N1303K-N 5'-NH2-GGGATCCAACTTTTTTCT-3'Exon21N1303K-MUT 5'-NH2-AATTGTTCTGCGCATGG-3'Exon7R347H-N 5'-NH2-CATTGTTCTGCCCATGGC-3'Exon7R347H-MUT Table 2: Human cystic fibrosis transmembrane conductance regulator primers Cystic fibrosis primer sequence Exon amplified Cystic fibrosis primer name Cystic fibrosis mutation tested 5'-Biotin-AGACCATGCTCAGATCTTCCAT-3' 5'-Biotin-GCAAAGTTCATTAGAACTGATC-3' 7 CF7-F CF7-R R347P 5'-Biotin-GCAGAGTACCTGAAACAGGA-3' 5'-Biotin-CATTCACAGTAGCTTACCCA-3' 10 CF10-F CF10-R ∆F508 5'-Biotin-CAACTGTGGTTAAAGCAATAGTGT-3' 5'-Biotin-GCACAGATTCTGAGTAACCATAAT-3' 11 CF11-F CF11-R G542X 5'-Biotin-TGGGCCTCTTGGGAAGAACT-3' 5'-Biotin-CTCACCTGTGGTATCACTCC-3' 20 CF20-F CF20-R W1282X 5'-Biotin-GGTAAGTACATGGGTGTTTC-3' 5'-Biotin-CAAAAGTACCCTGTTGCTCCA-3' 21 CF21-F CF21-R N1303K Genotype Analysis: Mutation screening of the CFTR gene in 60 alleles by reverse dot blot hybridization for five common mutations showed that 13 (21.6%) alleles were ∆F508.
X
ABCC7 p.Arg347His 23056764:67:532
status: NEWX
ABCC7 p.Arg347His 23056764:67:575
status: NEW80 The other four mutations tested: N1303K, G542X, R347H and W1282X, were not found in these patients.
X
ABCC7 p.Arg347His 23056764:80:48
status: NEW98 Consequently, it is believed that the incidence of cystic fibrosis is also similarly high, and that the low incidence commonly believed to be associated cystic fibrosis is also similarly high, and that the Table 5: Comparison of the frequency of common CFTR mutations ∆F508, N1303K, G542X, R347H , W1282X in Europe and North Africa with Iran and some neighboring countries Region or Country Mutation Type Reference ∆F508 W1282X N1303K G542X R347H Europe and N Africa 66.8 1 1.6 2.6 0.8-3.6 6 Turkey 24.5-27 ND 2.9-3.7 2.6-4.9 3-3.6 6, 23, 25 Saudi Arabia 13 ND 2 ND ND 27, 28 India 19-27 ND ND ND ND 24, 26 Iran 16-17.8 0-4 4.3-5.5 1.6-3.6 1.6-3.6 7, 8, 9 Mazandaran 21.6 0 0 0 0 Present study ND: Not detected low incidence commonly believed to be associated with this non-European population is likely to be due to under-diagnosis.
X
ABCC7 p.Arg347His 23056764:98:298
status: NEWX
ABCC7 p.Arg347His 23056764:98:299
status: NEW139 Jalalirad M, Houshmand M, Mirfakhraie R, et al. First study of CF mutations in the CFTR gene of Iranian patients: detection of DeltaF508, G542X, W1282X, A120T, R117H, and R347H mutations.
X
ABCC7 p.Arg347His 23056764:139:173
status: NEW140 Jalalirad M, Houshmand M, Mirfakhraie R, et al. First study of CF mutations in the CFTR gene of Iranian patients: detection of DeltaF508, G542X, W1282X, A120T, R117H, and R347H mutations.
X
ABCC7 p.Arg347His 23056764:140:173
status: NEW
PMID: 22439061
[PubMed]
Mesoraca A et al: "The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis."
No.
Sentence
Comment
100
48 Journal of Prenatal Medicine 2010; 4 (3): 45-50 Table III Mutations found with II level screening through DHPLC Mutations of mutated alleles DF508 29 W1282X 3 N1303K 8 1717-1G®A 2 3659delC 1 G85E 1 2789 +5G®A 2 R553X 2 R1162X 1 R117H 1 G542X 3 Total 53Table I Mutations found through I level screeningMutations analysed with I level screening through OLA CFTR Mutations Position on the CFTR gene DF508 Exon 10 3849+10KbC®T Intron 19 R334W Exon 7 W1282X Exon 10 V520F Exon 10 3905insT Exon 20 N1303K Exon 21 3876delA Exon 20 1717-1G®A Exon 11 3659delC Exon 19 DI507 Exon 10 A455E Exon 9 G85E Exon 3 2789 +5G®A Exon 14 / Intron 14 2183AA®G Exon 13 1898+1G®A Exon 12 / Intron 12 R347P Exon 7 R347H Exon 7 R560T Exon 11 1078delT Exon 7 R553X Exon 11 711+1G®T Exon 5 / Intron 5 G551D Exon 11 R1162X Exon 19 S549R Exon 11 R117H Exon 4 S549N Exon 11 621+1G®T Exon 4 G542X Exon 11 394delTT Exon 3 3120+1G®ðA Exon 16/ Intron 16 2184delA Exon 13 Table II Mutations found through I level screening Mutations Positions on CFTR gene R1066C Exon 17 b L1065P Exon 17 b A1006E Exon 19 R75Q Exon 3 D537E Exon 11 W1134X Exon 18 W1145X Exon 18 L1077P Exon 17b C524X Exon 11 Total 9 The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis Journal of Prenatal Medicine 2010; 4 (3): 45-50 49 tion was to provide the couple with adequate counselling in order to better understand the genotype-phenotype correlation in the various associations of mutations.
X
ABCC7 p.Arg347His 22439061:100:721
status: NEWX
ABCC7 p.Arg347His 22439061:100:727
status: NEW
PMID: 19318035
[PubMed]
Seia M et al: "Borderline sweat test: Utility and limits of genetic analysis for the diagnosis of cystic fibrosis."
No.
Sentence
Comment
59
In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported.
X
ABCC7 p.Arg347His 19318035:59:2462
status: NEW57 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported.
X
ABCC7 p.Arg347His 19318035:57:2462
status: NEW
PMID: 18499536
[PubMed]
Visca A et al: "Improvement in clinical markers in CF patients using a reduced glutathione regimen: an uncontrolled, observational study."
No.
Sentence
Comment
45
24 25 29 57 57 60.5 7 7 15 AX AX AX 11, M, 15 DF508/R347H 42 44 51 50.5 50 54 30 24 32 PA SA,PA none 12, M, 1 NA NA NA NA 10 10 12 9 5 25 NA NA NA 13, F, 1 DF508/DF508 NA NA NA 7.5 8 9.5 0 0 3 NA NA NA NA - data not available. T3 - 3 months prior to baseline; T0 - baseline; T5.5 - 5.5 months after baseline.
X
ABCC7 p.Arg347His 18499536:45:52
status: NEW66 18.8 20.0 2 0 35 22 11, M, 15 DF508/R347H 17.5 18.7 1 1 10 18 12, M, 1 NA NA NA NA NA NA NA 13, F, 1 DF508/DF508 NA NA NA NA NA NA NA - data not available. T3 - 3 months prior to baseline; T0 - baseline; T5.5 - 5.5 months after baseline.
X
ABCC7 p.Arg347His 18499536:66:36
status: NEW
PMID: 18243066
[PubMed]
Ratbi I et al: "Cystic fibrosis carrier frequency and estimated prevalence of the disease in Morocco."
No.
Sentence
Comment
27
We screened for 32 CFTR gene mutations (G85E, 394delTT, R117H, 621+1GNT, 711+1GNT, R334W, R347P, R347H, 1078delT, A455E, I507del, F508del, V520F, 1717-1GNA, G542X, G551D, R553X, R560T, S549R(TNG), S549N, 1898+1GNA, 2183AANG, 2184delA, 2789+5GNA, 3120 + 1G NA, R1162X, 3659delC, 3849 + 10kbC NT, W1282X, 3905insT, 3876delA, N1303K) and the (T)5 splicing variant of intron 8, using a commercial kit (CF v3 Genotyping Assay, Abbott, Rungis, France).
X
ABCC7 p.Arg347His 18243066:27:97
status: NEW
PMID: 18456578
[PubMed]
Castellani C et al: "Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice."
No.
Sentence
Comment
1236
Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations.
X
ABCC7 p.Arg347His 18456578:1236:1138
status: NEW1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations.
X
ABCC7 p.Arg347His 18456578:1239:1138
status: NEW
PMID: 17825628
[PubMed]
Fichou Y et al: "Estimating the age of CFTR mutations predominantly found in Brittany (Western France)."
No.
Sentence
Comment
51
Primers amplifying the regions of interest were designed with PrimerQuestSM from Table 1 Genotypes of CF patients W846X2 1078delT G551D Mutation in trans Number Mutation in trans Number Mutation in trans Number ΔF508 6 ΔF508 21 ΔF508 18 R117C 1 1078delTa 2 E60K 1 ΔI507 1 4005+1GNA 2 W79X 1 Y563N 1 L610S 1 C225X 1 1078delTb 1 W846X2 b 1 F311L 1 621+1GNT 1 R1066H 1 R347H 1 2789+5GNA 1 1221delCT 1 G542X 1 3849+4ANG 1 1717-1GNA 1 G551D 1 3659delC 1 R553G 1 S942F 1 Y1092X 1 621+1GNT 1 2789+5GNA 1 4006-1GNA 1 Unidentified 1 Total 13 Total 31 Total 32 a One particular case: in this individual, the two chromosomes 7 are identical by descent.
X
ABCC7 p.Arg347His 17825628:51:386
status: NEW
PMID: 16581722
[PubMed]
Bertuzzo CS et al: "Molecular screening of CFTR gene in Brazilian men with bilateral agenesis of the vas deferens."
No.
Sentence
Comment
54
Patient CFTR mutation found 1 AG DF508/IVS8-5T 5 AG DF508/IVS8-5T 6 AG DF508 IVS8-5T 7 AG DF508/IVS8-5T 8 AG DF508/IVS8-5T 9 AG DF508/IVS8-5T 12 AG R117H/R117H 16 AG DF508/R1162X 18 AG N1303K/R1162X 21 AG DF508/IVS8-5T 23 AG R347H/R117H 24 AG N1303K/R117H 25 AG DF508/W1282X 27 AG N1303K/IVS8-5T 29 AG DF508/IVS8-5T 30 AG N1303K/W1282X 32 AG DF508/IVS8-5T 34 AG R347H/R117H 36 AG DF508/N1303K 38 AG IVS8-5T/IVS8-5T 39 AG DF508/R117H 40 AG DF508/N1303K Concerning the most prevalent mutation in our study, DF508, we found a higher proportion in our patients than that found in Argentine patients (Levy et al., 2004), 35% vs. 20.8%.
X
ABCC7 p.Arg347His 16581722:54:225
status: NEWX
ABCC7 p.Arg347His 16581722:54:362
status: NEW
PMID: 16049310
[PubMed]
Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."
No.
Sentence
Comment
51
Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS.
X
ABCC7 p.Arg347His 16049310:51:1945
status: NEW
PMID: 16156102
[PubMed]
Dunbar SA et al: "Rapid screening for 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator gene by Lminex xMAP suspension array."
No.
Sentence
Comment
119
Coriell Cell Repositories, NA12960 ΔI507/R347P Patient sample G551D/R347P Coriell Cell Repositories, NA12785 621+1G→T/711+1G→T Coriell Cell Repositories, NA11280 621+1G→T/G85E Coriell Cell Repositories, NA11282 3849+10kbC→T/3849+10kbC→T Coriell Cell Repositories, NA11860 A455E/normal Patient sample 621+1G→T/A455E Coriell Cell Repositories, NA11290 R1162X/normal Coriell Cell Repositories, NA12585 ΔF508/3659delC Coriell Cell Repositories, NA11275 2789+5G→A/2789+5G→A Coriell Cell Repositories, NA11859 2184delA/normal Patient sample 1898+1G→A/normal Patient sample 621+1G→T/3120+1G→A Coriell Cell Repositories, NA07441 3120+1G→A/3120+1G→A Patient sample F508C/normal Coriell Cell Repositories, NA13033 I506V/normal Coriell Cell Repositories, NA13032 R347H/normal Patient sample ΔF508/3120G→A Patient sample S549N/normal Patient sample S549R/normal Patient sample CFTR, cystic fibrosis transmembrane conductance regulator gene.
X
ABCC7 p.Arg347His 16156102:119:855
status: NEW
PMID: 12454843
[PubMed]
Durno C et al: "Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis."
No.
Sentence
Comment
105
CFTR Genotypes Among CF Patients With PS With and Without Pancreatitis Two mutations (n) ⌬F508/R117H (9) ⌬F508/(5T) (6) ⌬F508/3272-26A 3 G (4) ⌬F508/R347H (2) ⌬F508/P574H (2) ⌬F508/875 ϩ 1G Ͼ C (2) ⌬F508/3849 ϩ 10kb C 3 T (1) ⌬F508/A455E (1) ⌬F508/D614G (1) ⌬F508/G85E (1) ⌬F508/R347P (1) ⌬F508/S1251N (1) ⌬F508/⌬F508a (1) ⌬F508/3120G Ͼ A (1) ⌬F508/G551Da (1) G542X/R117H (1) R560T/L206W (1) R117H/R117H (1) R31L/P67L (1) 1461ins4 (AGAT)/G85E (1) G551D/(5T) (1) R1066C/3849 ϩ 10kb C Ͼ T (1) G551D/3849 ϩ 10kb C Ͼ T (1) R334W/R334W (1) R334W/681delC (1) W1282X/3489 ϩ 10kb C Ͼ T (1) One mutation (n) ⌬F508/- (18) L1077P/- (1) W1282X/- (1) M1137V/- (1) G551D/- (1) R347H/- (1) Q30X1/- (1) G1244E/- (1) R117H/- (1) 621 ϩ 2G621 ϩ 1G 3 T/- (1) NOTE.
X
ABCC7 p.Arg347His 12454843:105:177
status: NEWX
ABCC7 p.Arg347His 12454843:105:842
status: NEW124 of episodes of pancreatitis Genotype 1 0.3 12 21.7 2 ⌬F508/S1251N 2 0.3 34 30.0 1 ⌬F508/R347H 3 4.4 13 42.5 3 / 4 4.4 21 36.5 1 ⌬F508/ 5 7.3 26 40.8 10 ⌬F508/P67L 6 9.6 29 29.9 (D) 1 ⌬F508/ 7 12.0 18 39.9 1 ⌬F508/R347P 8 12.9 37 40.9 2 G542X/D1152H 9 13.0 30 50.3 1 ⌬F508/3849 ϩ 10Kbc Ͼ T 10 14.7 13 21.5 1 DF508/R117H 11 15.6 34 40.8 1 ⌬F508/2789ϩ5G Ͼ T 12 15.6 10 26.0 10 ⌬F508/R117H 13 16.0 10 22.0 14 ⌬F/508/3849 ϩ 10kbC Ͼ T 14 16.0 18 21.2 (D) 1 R1066C/3849 ϩ 10kbC Ͼ T 15 19.9 15 40.8 5 No DNA 16 23.2 19 23.2 15 ⌬F508/11234V 17 24.1 40 47.6 (D) 1 No DNA 18 26.9 25 43.3 12 No DNA 19 27.4 35 50.3 (D) 2 ⌬F508/A455E NOTE.
X
ABCC7 p.Arg347His 12454843:124:102
status: NEW
PMID: 12127423
[PubMed]
Girodon E et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene defects in patients with primary sclerosing cholangitis."
No.
Sentence
Comment
78
Four additional subjects (3.5%) carried one of the following mild defects: R117H, R347H, R74W-D1270N and R668C-G576A.
X
ABCC7 p.Arg347His 12127423:78:82
status: NEW
PMID: 12009340
[PubMed]
Robert F et al: "Relation between the anatomical genital phenotype and cystic fibrosis transmembrane conductance regulator gene mutations in the absence of the vas deferens."
No.
Sentence
Comment
81
Three patients had two CFTR gene mutations: two had the severe mutation ⌬F508 associated with the mild mutation R117H, and one had two mild mutations (R117H and R347H).
X
ABCC7 p.Arg347His 12009340:81:168
status: NEW108 Patient Mutations Intron 8 Phenotype Seminal vesicle Epididymis Testicular volume (right/left) (mL) Comments 1 ⌬F508/R117H 7T/9T BAVD A/D C/C 20/20 2 ⌬F508/R117H 7T/9T BAVD A/A E/C 15/12 3 R117H/R347H 7T/9T BAVD A/D E/E 15/15 Compound heterozygote 4 ⌬F508/o 5T/7T BAVD A/h C/C 10/13 Compound heterozygote 5 ⌬F508/o 5T/9T BAVD A/A E/E 16/17 Compound heterozygote 6 ⌬F508/o 5T/9T BAVD A/D E/E 15/15 7 ⌬F508/o 5T/9T BAVD A/A E/E 11/9 8 ⌬F508/o 5T/9T BAVD h/h E/E 20/20 9 ⌬F508/o 5T/9T BAVD A/A C/C 17/9 10 ⌬F508/o 5T/9T BAVD D/A E/E 15/12 11 ⌬F508/o 5T/9T BAVD A/D E/E 10/12 12 ⌬F508/o 7T/9T BAVD A/N C/E 20/20 13 ⌬F508/o 7T/7T BAVD A/A E/E 20/18 14 ⌬F508/o 7T/7T BAVD h/h E/E 10/9 15 ⌬F508/o 9T/9T BAVD A/D C/C 23/26 16 1612delTT/o 7T/9T BAVD A/D C/C 8/7 17 D1270N/o 7T/7T BAVD A/A E/E 12/13 18 R117H/o 7T/7T BAVD A/D E/E 20/18 19 2789ϩ5GBA/o 7T/7T BAVD A/A C/C 18/13 20 o/o 5T/5T BAVD D/A E/E 8/10 21 o/o 5T/9T BAVD A/A C/E 20/18 22 o/o 5T/7T BAVD A/A E/E 20/20 23 o/o 5T/9T BAVD A/A E/E 9/10 24 o/o 5T/7T BAVD A/D E/E 10/10 25 o/o 5T/7T BAVD A/A E/E 9/10 26 o/o 5T/9T BAVD A/D E/A 12/0 Left testicular atrophy 27 o/o 5T/7T BAVD A/A C/E 9/8 28 o/o 7T/7T BAVD A/A E/E 15/15 29 o/o 7T/7T BAVD A/h E/E 11/11 30 o/o 9T/9T BAVD h/h C/C 7/8 31 o/o 7T/7T BAVD h/A E/E 12/12 32 o/o 7T/7T BAVD A/A E/C 10/10 33 o/o 7T/9T BAVD A/A E/E 11/12 34 o/o 7T/7T BAVD h/A C/C 9/9 35 o/o 7T/7T BAVD A/D C/A 10/11 Bilateral dilatation of rete testis 36 o/o 7T/7T BAVD A/D C/C 12/12 37 o/o 7T/9T BAVD A/A C/E 15/15 38 o/o 7T/7T BAVD D/A C/C 12/15 39 o/o 7T/7T BAVDϩURA A/A C/C 12/12 40 o/o 7T/7T BAVDϩURA D/A A/C 0/20 Right testis absent 41 o/o 5T/9T UAVD D/A E/E 13/13 42 o/o 5T/7T UAVD D/A E/C 8/10 Right testicular hypotrophy 43 o/o 5T/7T UAVD h/N E/E 7/8 44 o/o 7T/7T UAVD A/D E/A 12/0 Left cryptorchidism 45 o/o 7T/7T UAVD D/A E/E 4/5 Bilateral testicular hypotrophy 46 o/o 7T/7T UAVD h/h E/E 8/8 47 o/o 7T/7T UAVDϩURA D/A E/E 15/15 Note: A ϭ absent; D ϭ dilated; C ϭ caput only; E ϭ whole; h ϭ hypotrophic; N ϭ normal; o ϭ no detected mutation; BAVD ϭ bilateral absence of the vas deferens; UAVD ϭ unilateral absence of the vas deferens; URA ϭ unilateral renal agenesis. Robert. Absence of the vas deferens.
X
ABCC7 p.Arg347His 12009340:108:209
status: NEW
PMID: 10923036
[PubMed]
Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."
No.
Sentence
Comment
102
Distribution of 310 CF Mutations in France With Respect to Relative Frequencies (Total Number of CF Chromosomes = 7,420) Group Mutations Number of alleles % Cum. % A F508del 4,985 67.18 G542X 212 2.86 N1303K 156 2.10 73.45 1717-1G>A 97 1.31 B G551D 73 0.98 2789+5G>A 72 0.97 W1282X 68 0.91 R553X 66 0.89 I507del 52 0.70 1078delT 49 0.66 7.47 2183AA>G 48 0.64 711+1G>T 33 0.44 R1162X 33 0.44 Y1092X 30 0.40 3849+10kbC>T 30 0.40 C 12 mutationsa 29 to 15 (239) 0.39-0.20 19 mutationsb 14 to 8 (190) 0.19-0.10 11 mutationsc 7 to 6 (71) 0.09-0.08 11 mutationsd 5 (55) 0.06 10.57 15 mutationse 4 (60) 0.05 23 mutationsf 3 (69) 0.04 50 mutationsg 2 (100) 0.02 D 154 mutationsh 1 (154) 0.01 2.07 6,942 93.56 a 3659delC, R347P, 3272-26A>G, R334W, W846X, 621+1G>T, G85E, R1066C, L206W, 394delTT, 4055+1G>A, R347H.
X
ABCC7 p.Arg347His 10923036:102:797
status: NEW153 Four mutations were detected on a 7T or a 9T background: L206W, R347H, D1152H, 3272-26A>G.
X
ABCC7 p.Arg347His 10923036:153:64
status: NEW171 CFTR Mutation Genotypes Identified Both in Cystic Fibrosis (CF) and in Congenital Bilateral Absence of the Vas Deferens (CBAVD) CF CBAVD F508del/5T 3 143 F508del/2789+5G>A 53 1 F508del/3272-26A>G 17 4 F508del/R117H* 10 39 F508del/R117C 2 2 F508del/L206W 12 4 F508del/R347H 10 5 F508del/R347L 1 1 F508del/D443Y 1 5 F508del/Y569C 1 1 F508del/P574H 3 1 F508del/G628R(G>A) 2 1 F508del/V920M 1 1 F508del/R1070W 2 3 F508del/D1152H 6 8 F508del/S1235R 3 1 F508del/T1246I 1 1 F508del/D1270N+R74W 2 3 F508delN1303I 1 1 3659delC/R347H 1 1 G542X/T338I 2 2 R347H/R1066H 1 1 *The only case with CF whose alleles at IVS8(T)n were reported had mutation R117H associated with a 5T allele.
X
ABCC7 p.Arg347His 10923036:171:267
status: NEWX
ABCC7 p.Arg347His 10923036:171:518
status: NEWX
ABCC7 p.Arg347His 10923036:171:544
status: NEW
PMID: 10862085
[PubMed]
Ellis LA et al: "A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning."
No.
Sentence
Comment
97
Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE.
X
ABCC7 p.Arg347His 10862085:97:882
status: NEW
PMID: 9512029
[PubMed]
Mansoura MK et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) anion binding as a probe of the pore."
No.
Sentence
Comment
229
Hipper et al. (1995) reported that the mutations R334E, R334H, K335E, K335H, R347E, and R347H did not alter CFTR conduction properties, but careful inspection of the data presented revealed that the level of CFTR expression was very low so that altered properties of mutant CFTRs might have been easily obscured.
X
ABCC7 p.Arg347His 9512029:229:88
status: NEW
PMID: 9454574
[PubMed]
Wigley WC et al: "Transmembrane domain of cystic fibrosis transmembrane conductance regulator: design, characterization, and secondary structure of synthetic peptides m1-m6."
No.
Sentence
Comment
287
For example, mutational data demonstrated that the substitution of glutamic acid for lysine 335 alters channel permeability of CFTR (4), and mutation of arginine 347 to histidine gives rise to pH-dependent ion selectivity of the channel (66).
X
ABCC7 p.Arg347His 9454574:287:153
status: NEW
No.
Sentence
Comment
92
Another group recently reported a single case of BED0 with compound heterozygosity for the CFTR mutations R347H and N1303K [18].
X
ABCC7 p.Arg347His 9755815:92:109
status: NEW93 Another group recently reported a single case of BED0 with compound heterozygosity for the CFTR mutations R347H and N1303K [18].
X
ABCC7 p.Arg347His 9755815:93:109
status: NEW
PMID: 9550362
[PubMed]
Hojo S et al: "Severe cystic fibrosis associated with a deltaF508/R347H + D979A compound heterozygous genotype."
No.
Sentence
Comment
7
Further testing of their CFTR gene as well as those of their Japanese mother and grandmother revealed missense mutations in exon 7 (R347H) and exon 16 (D979A).
X
ABCC7 p.Arg347His 9550362:7:132
status: NEW14 - R347H and D979A Received 25 September 1997, revisedand accepted for publication28 October 1997 Following the identification of AF508 as the major mutation causing cystic fibrosis (CF), approximately 800 additional mutations, sequence variations and polymorphisms have been reported by members of the CF Genetic Analysis Consortium. ,The rare mutation R347H was first detected by Cremonesi et al. (1) in a patient with mild CF.
X
ABCC7 p.Arg347His 9550362:14:2
status: NEWX
ABCC7 p.Arg347His 9550362:14:353
status: NEW17 In addition, Mercier et al. (4) reported two R347H mutations when analysing 67 otherwise healthy men with congenital bilateral absence of vas deferens (CBAVD).
X
ABCC7 p.Arg347His 9550362:17:45
status: NEW18 These observations suggest that the R347H mutation might be associated more frequently with CBAVD than other CF mutations.
X
ABCC7 p.Arg347His 9550362:18:36
status: NEW19 Furthermore, in a very recent paper, Kosztolanyi et al. (5) reported a woman with unusually mild CF and normal sweat chloride levels who camed the AF508 deletion on one CF chromosome and 50 the rare mutation R347H on the other.
X
ABCC7 p.Arg347His 9550362:19:208
status: NEW20 In this study, we report on two women (twins) with the AF508 deletion on one CF chromosome and R347H and D979A on the other who show very severe C F phenotypes.
X
ABCC7 p.Arg347His 9550362:20:95
status: NEW52 Sequence analysis of the parental samples showed that the R347H +D979A mutation was present on the maternal C F chromosome, while the paternal chromosome carried the AF508 deletion.
X
ABCC7 p.Arg347His 9550362:52:58
status: NEW58 As her German father had AF508 and her Japanese mother had R347H +D979A, R347H +D979A seemed to be derived from her Japanese mother.
X
ABCC7 p.Arg347His 9550362:58:59
status: NEWX
ABCC7 p.Arg347His 9550362:58:73
status: NEW59 It has been reported that patients, who have a G to A transition at position 1172 in exon 7 which causes the substitution of a histidine for an arginine (R347H) as well as the AF508 mutation on the other chromosome, have mild pulmonary diseases and pancreatic sufficiency.
X
ABCC7 p.Arg347His 9550362:59:154
status: NEW60 Literature which shows the clinical features of mutation R347H are summarized in Table 1.
X
ABCC7 p.Arg347His 9550362:60:57
status: NEW61 Kosztolanyi et al. (5) reported that a patient with AF508/R347H genotype has pancreatic sufficiency and normal sweat chloride levels.
X
ABCC7 p.Arg347His 9550362:61:58
status: NEW63 Summary of literaturewhich showed clinical features with mutation R347H Authors Sex Mutations Respiratory symptoms Other symptoms Pancreaticfunction Hqo [present repoctl Kosztolanyi(5) Mills (9) Yilmaz (a) Yilmaz (a) Mercer (4) Mercier (4) Chillon (3) Culard (12) Osbome (2) Cremonesi (1) 2 women (twins) Woman NS NS NS Mall Mall 2 NS 2 men Mall NS AF5081R347Hf W79A AF508/R347H AF508/R347H R347H/R347H R347HIR347H R347H/R1066H R347H/unidentified R347H/unidentiRed AF5081R347H AF508/R347H AF508/R347H Severe Mild ABPAa Severe Mild Absent Absent NS Absent Some Mild lnsufficent NS Mildly insufficient - - Sufficient - Insufficient CEAVD Sufficient CEAVD Sufficient CEAVD Sufficient CEAVD Mildly insufficient - sufficient - - NSNS, not stated.
X
ABCC7 p.Arg347His 9550362:63:66
status: NEWX
ABCC7 p.Arg347His 9550362:63:373
status: NEWX
ABCC7 p.Arg347His 9550362:63:385
status: NEWX
ABCC7 p.Arg347His 9550362:63:391
status: NEWX
ABCC7 p.Arg347His 9550362:63:397
status: NEWX
ABCC7 p.Arg347His 9550362:63:415
status: NEWX
ABCC7 p.Arg347His 9550362:63:428
status: NEWX
ABCC7 p.Arg347His 9550362:63:447
status: NEWX
ABCC7 p.Arg347His 9550362:63:483
status: NEWX
ABCC7 p.Arg347His 9550362:63:495
status: NEW67 (3), who identified two chromosomes with mutation R347H when studying CF patients, also gave no data on sex, age or genotype/phenotype details.
X
ABCC7 p.Arg347His 9550362:67:50
status: NEW73 Kosztolanyi et al. (5) suggested that the unusually mild nature of CF in patient AF508/R347H genotype is associated with the fact that a missense mutation resulting in an exchange between similarly charged (basic) amino acids, histidine for arginine, produces even less significant change in ion flow through the chloride channel than the transition in R347P and R347L.
X
ABCC7 p.Arg347His 9550362:73:87
status: NEW79 These facts suggested that D979A mutants have a significant effect on CFTR function when combined with the R347H mutation.
X
ABCC7 p.Arg347His 9550362:79:107
status: NEW80 In conclusion, we reported twins who had AF508/R347H +D979A genotype.
X
ABCC7 p.Arg347His 9550362:80:47
status: NEW81 Although D979A mutant is very rare, the combination of AF508 on one chromosome and R347H +D979A on the other chromosome resulted in a severe phenotype.
X
ABCC7 p.Arg347His 9550362:81:83
status: NEW
PMID: 10200050
[PubMed]
de Meeus A et al: "Genetic findings in congenital bilateral aplasia of vas deferens patients and identification of six novel mutatations. Mutations in brief no. 138. Online."
No.
Sentence
Comment
56
However, some genotypes (DF508/L206W, DF508/R347H, DF508/D1152H, DF508/R117H, W1282X/D1152H and even DF508/5T) can induce both CF and CBAVD phenotypes.
X
ABCC7 p.Arg347His 10200050:56:44
status: NEW83 Phenotype CFTRamutations Intron 8, Poly(T) tract 1 3 crisis of acute pancreatitis F508 / L206W 9/7 2 F508 / L206W 9/9 3 frequent bronchitis F508 / R347H 9/9 4 F508 / R347H 9/9 5 F508 / M244K 9/7 6 F508 / A1364V 9/7 7 F508 / D1152H 9/7 8 chronic sinusitis and bronchitis F508 / D1152H 9/7 9 F508 / R117H 9/7 10 F508 / R117H 9/7 11 F508 / M952I 9/7 12 D443Y / G542X 7/9 13 D443Y / G542X 7/9 14 2184delA / D443Y 7/7 15 2184delA / D443Y 7/7 16 R347H / D443Y 9/7 17 seminal vesicles agenesia R117H / G1349D 7/7 18 R117H / G1244E 7/7 19 N1303K / P111L 9/7 20 chronic sinusitis, nasal polyps W1282X / D1152H 7/7 21 chronic sinusitis R347H / Y1092X 7/7 22 seminal vesicles agnesia 297-3C-GTT / 4279insA 7/7 23 G544V / F508C 7/7 24 D1152H / 2896insAG 7-9 25 F508 / - 9/5 26 F508 / - 9/5 27 F508 / - 9/5 28 F508 / - 9/5 29 F508 / - 9/5 30 chronic sinusitis, bronchitis F508 / - 9/5 31 sinusitis and allergy F508 / - 9/5 32 allergy F508 / - 9/5 33 F508 / - 9/5 34 F508 / - 9/5 35 F508 / - 9/5 36 F508 / - 9/5 37 bronchitis, asthma F508 / - 9/5 38 chronic sinusitis F508+A1067T / - 9/5 39 chronic sinusitis D1152H / - 7/5 40 2184delA / - 7/5 41 R764X / - 7/5 42 711+1G-GTT / - 7/5 43 F508 / - 9/7 44 F508 / - 9/7 45 F508 / - 9/7 46 F508 / - 9/9 47 R553X / - 7/7 48 -33G-GTA / - 7/7 49 K710X / - 7/7 50 - / - 5/5 51 - / - 5/7 52 - / - 5/7 53 - / - 7/7 54 - / - 7/7 55 - / - 7/7 56 - / - 7/7 57 - / - 7/7 58 - / - 7/7 59 - / - 7/7 60 - / - 7/7 61 - / - 7/9 62 - / - 7/9 63 NIDDb - / - 7/9 64 - / - 7/9 a : Cystic Fibrosis Transmembrane Regulator gene b : Non Insulino-Dependant Diabetis References Anguiano A, Oates RD, Amos JA, Dean M, Gerrard B, Stewart C, Maher TA, White MB, Milunsky A (1992) Congenital absence of the vas deferens: a primarily genital form of cystic fibrosis.
X
ABCC7 p.Arg347His 10200050:83:147
status: NEWX
ABCC7 p.Arg347His 10200050:83:166
status: NEWX
ABCC7 p.Arg347His 10200050:83:440
status: NEWX
ABCC7 p.Arg347His 10200050:83:627
status: NEW
PMID: 9439669
[PubMed]
Casals T et al: "High heterogeneity for cystic fibrosis in Spanish families: 75 mutations account for 90% of chromosomes."
No.
Sentence
Comment
33
Eight mutations have frequencies 366 Table 1 Seventy-five CFTR mutations identified in 640 Spanish families with cystic fibrosis (CF) Mutation Exon/intron CF alleles % ∆F508 E.10 681 53.20 G542X E.11 108 8.43 N1303K E.21 34 2.65 1811+1.6kbA→Ga I.11 24 1.87 711+1G→T I.5 22 1.71 R1162Xa E.19 21 1.64 R334Wa E.7 21 1.64 R1066C E.17b 14 1.09 1609delCAa E.10 13 1.01 Q890X E.15 13 1.01 G85E E.3 12 0.94 712-1G→Ta I.5 11 0.86 2789+5G→A I.14b 11 0.86 ∆I507 E.10 10 0.78 W1282X E.20 10 0.78 2869insGa E.15 9 0.70 L206W E.6a 7 0.54 R709X E.13 7 0.54 621+1G→T I.4 6 0.47 3272-26A→G I.17a 6 0.47 R347H E.7 5 0.39 2183AA→G E.13 5 0.39 K710X E.13 5 0.39 2176insC E.13 5 0.39 3849+10kbC→T I.19 5 0.39 P205Sa E.6a 4 0.31 1078delT E.7 4 0.31 R553X E.11 4 0.31 G551D E.11 4 0.31 1812-1G→Aa I.11 4 0.31 CFdel#1a E.4-7/11-18 4 0.31 V232D E.6a 3 0.23 936delTAa E.6b 3 0.23 1717-8G→A I.10 3 0.23 1949del84 E.13 3 0.23 W1089X E.17b 3 0.23 R347P E.7 3 0.23 del E.3a E.3 2 0.16 R117H E.4 2 0.16 L558S E.11 2 0.16 A561E E.12 2 0.16 2603delT E.13 2 0.16 Y1092X E.17b 2 0.16 Q1100Pa E.17b 2 0.16 M1101K E.17b 2 0.16 delE.19a E.19 2 0.16 G1244E E.20 2 0.16 P5La E.1 1 0.08 Q30Xa E.2 1 0.08 G85Va E.3 1 0.08 E92Ka E.4 1 0.08 A120Ta E.4 1 0.08 I148T E.4 1 0.08 711+3A→Ta I.5 1 0.08 H199Y E.6a 1 0.08 875+1G→A I.6a 1 0.08 Table 1 (continued) Mutation Exon/intron CF alleles % 1717-1G→A I.10 1 0.08 L571S E.12 1 0.08 T582Ra E.12 1 0.08 E585X E.12 1 0.08 1898+3A→G I.12 1 0.08 G673X E.13 1 0.08 E692Xa E.13 1 0.08 R851X E.14a 1 0.08 R851La E.14a 1 0.08 A1006E E.17a 1 0.08 L1065Ra E.17b 1 0.08 F1074La E.17b 1 0.08 R1158X E.19 1 0.08 3667del4a E.19 1 0.08 3860ins31a E.20 1 0.08 3905insT E.20 1 0.08 4005+1G→A I.20 1 0.08 Q1281Xa E.20 1 0.08 Q1313X E.21 1 0.08 Known mutations (75) 1155 90.23 Unknown mutations 125 9.77 a Mutations discovered by the CF group of the Medical and Molecular Genetics Centre - IRO, Barcelona, Spain that range between 0.5% and 0.9%, representing 6.0% of the CF chromosomes.
X
ABCC7 p.Arg347His 9439669:33:642
status: NEW
PMID: 9429141
[PubMed]
el-Harith EA et al: "Novel and characteristic CFTR mutations in Saudi Arab children with severe cystic fibrosis."
No.
Sentence
Comment
26
Deletions of two or more base pairs were screened for by electrophoresis using a native 12% polyacrylamide gel. The 20 common CFTR mutations that were screened for were AF508, AI507, 1677delTA, R347P, R347H, R553X, G551D, G542X, N1303K, 3849+1OKbC-8'T, R334W, I336K, 2789+5G-A, 1717-1G-A, 3272- 26A- G, Y1092X, 2143delT, W1282X, RI 17H, and the 5T allele.
X
ABCC7 p.Arg347His 9429141:26:201
status: NEW
PMID: 9374552
[PubMed]
Fanen P et al: "Cystic fibrosis phenotype associated with pancreatic insufficiency does not always reflect the cAMP-dependent chloride conductive pathway defect. Analysis of C225R-CFTR and R1066C-CFTR."
No.
Sentence
Comment
101
Six CF-associated mutations (P99L, R117H, P205S, R334W, R347P, and R347H) located in putative membrane-spanning domains that have already been analyzed for their functional properties (2-5) were all associated with a mild phenotype (pancreatic sufficiency, PS).
X
ABCC7 p.Arg347His 9374552:101:67
status: NEW
PMID: 9511928
[PubMed]
Seibert FS et al: "Cystic fibrosis: channel, catalytic, and folding properties of the CFTR protein."
No.
Sentence
Comment
51
If Arg 347 is mutated to His, the anomalous mole fraction behavior can be turned on and off, simply by changing the pH of the bath solutions (the imidazole group of histidineispositively charged at low pH and uncharged at high pH) (Tabcharani et al, 1993).
X
ABCC7 p.Arg347His 9511928:51:3
status: NEW
PMID: 9379168
[PubMed]
Linsdell P et al: "Permeability of wild-type and mutant cystic fibrosis transmembrane conductance regulator chloride channels to polyatomic anions."
No.
Sentence
Comment
13
Some of these low conductance mutations (R334W, R347P, and R347H) occur in cystic fibrosis patients and have been associated with relatively mild disease symptoms.
X
ABCC7 p.Arg347His 9379168:13:59
status: NEW17 Some of these low conductance mutations (R334W, R347P, and R347H) occur in cystic fibrosis patients and have been associated with relatively mild disease symptoms.
X
ABCC7 p.Arg347His 9379168:17:59
status: NEW
PMID: 9272157
[PubMed]
Dork T et al: "Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens."
No.
Sentence
Comment
43
This initial screening included the mutations ∆F508, G542X, R553X, G551D, N1303K, 1717-1 G→A, 3272-26 A→G, Y1092X, 2143delT, R347P, R347H, R334W, I336K, R117H, R117C, 2789+5 G→A, 3849+10kB C→T and the "5T" allele, the latter two splice variants being tested according to the instructions of Highsmith et al. (1994) and Chillón et al. (1995).
X
ABCC7 p.Arg347His 9272157:43:153
status: NEW69 Only four other common CF mutations were found in more than one family by this initial screening: 2789+5 G→A on 4 alleles, R347H on 3 alleles, G542X and 3272-26 A→G each on 2 alleles (Table 1).
X
ABCC7 p.Arg347His 9272157:69:130
status: NEW86 The V938G substitution was identified in two unrelated patients, one homozygote with unilateral ab- 368 Table 1A Frequency distribution and haplotypes of CFTR mutations in 106 CAVD patients Mutationa Nucleotide changesb Locationc Frequencyd Haplotypee Referencef 174delA deletion of A at 174 exon 1 1 D3 This study E56K G→A at 298 exon 3 1 B3 This study D58N G→A at 304 exon 3 1 C2 This study D110H G→A at 460 exon 4 2 C2 Dean et al. (1990) R117H G→A at 482 exon 4 24 B6 Dean et al. (1990) A120T G→A at 490 exon 4 1 n.p. Chillón et al. (1994) ̃L138 insertion of CTA after 546 exon 4 1 A2 This study L206W T→G at 749 exon 6a 1 B8 Claustres et al. (1993) M265R T→G at 926 exon 6b 1 A2 Schwarz et al. (pers. comm.) R297W C→T at 1021 exon 7 1 C2 This study 1078delT deletion of T at 1078 exon 7 1 C2 Claustres et al. (1992) R334W C→T at 1132 exon 7 1 B1 Gasparini et al. (1991) R334L G→T at 1133 exon 7 1 D3 This study I336K T→A at 1139 exon 7 1 A2 Cuppens et al. (1993) R347H G→A at 1172 exon 7 3 D1 Cremonesi et al. (1992) L375F A→C at 1257 exon 8 1 B3 Jézéquel et al. (1996) ∆F508 deletion of 3 bp between 1652-1655 exon 10 57 B1 Kerem et al. (1989) G542X G→T at 1756 exon 11 2 B1 Kerem et al. (1990) R553X C→T at 1789 exon 11 1 A4 Cutting et al. (1990) L568F G→T at 1836 exon 12 1 B3 This study 2184insA insertion of A at 2184 exon 13 1 D3 Dörk et al. (1994b) 2789+5 G→A G→A at 2789+5 intron 14b 4 D3 Highsmith et al. (1997) R933S A→T at 2931 exon 15 1 n.p.
X
ABCC7 p.Arg347His 9272157:86:1057
status: NEW137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level.
X
ABCC7 p.Arg347His 9272157:137:706
status: NEWX
ABCC7 p.Arg347His 9272157:137:2195
status: NEW144 Lung function tests indicated initial pulmonary deterioration in a few cases (FEV1 forced expiratory volume in 1 s, given as percent predicted) Subject Age Genotype Height Weight Sweat C1- Symptoms (years) (cm) (kg) (mM) 1 33 ∆F508/R117H 172 75 46 Dyspnoe 2 37 ∆F508/R117H 178 83 31 Nasal polyposis 3 31 ∆F508/R117H 181 91 n.d. Nasal polyposis 4 32 R117H/unknown 164 70 33 Recurrent infections 5 33 ∆F508/E56K 193 100 85 Sinusitis, recurrent bronchitis 6 31 ∆F508/M265R 192 112 59 Recurrent infections, pancreatitis 7 33 ∆F508/R334W 182 78 n.d. Recurrent infections, pneumonia 8 28 ∆F508/R347H n.d. n.d. n.d. Recurrent infections 9 32 ∆F508/F508C 192 98 32 Pneumonia 10 34 ∆F508/Y1032C n.d. n.d. n.d. Recurrent bronchitis 11 33 ∆F508/3272-26 A→G 172 82 125 Recurrent infections, maldigestion, FEVI 73% 12 28 ∆F508/unknown 185 95 n.d.
X
ABCC7 p.Arg347His 9272157:144:637
status: NEW145 Maldigestion 13 25 5T/D58N 184 99 55 - 14 34 5T/̃L138 177 80 53 - 15 33 5T/1078delT 187 87 56 Recurrent bronchitis 16 31 5T/G542X 181 85 79 - 17 31 5T/2184insA n.d. n.d. 60 Borderline pancreatic sufficiency 18 31 5T/D979A n.d. n.d. 55 Recurrent infections, FEVI 76% 19 29 5T/D1152H n.d. n.d. 57 - 20 32 5T/W1282X 180 76 n.d. Recurrent infections, nasal polyposis 21 37 5T/unknown 180 74 n.d. Nasal polyposis 22 28 D110H/D110H 175 80 n.d Asthma bronchiale, obstipation 23 33 R334L/I336K 170 65 n.d. Recurrent infections, nasal polyposis, maldigestion, salt depletion episodes 24 35 N1303K/R347H 167 77 93 - 25 30 V938G/174delA n.d. n.d. 42 - 26 29 V938G/V938G 197 115 n.d. Asthma bronchiale Fig.2 Spectrum of CFTR mutation genotypes in CF patients (left) and in patients with congenital absence of the vas deferens (right).
X
ABCC7 p.Arg347His 9272157:145:594
status: NEW153 A few other genotypes overlapped with those previously observed in some CF adults with mild or very mild disease, e.g. compound heterozygosity for ∆F508 and mutations R334W, R347H, 3272-26 A→G or D1152H.
X
ABCC7 p.Arg347His 9272157:153:181
status: NEW177 Two further CAVD missense mutations, viz. R117H and R347H, have been thoroughly studied in vitro and both were shown to result in a pH-sensitive decrease of chloride conductance (Sheppard et al. 1993; Tabcharani et al. 1993).
X
ABCC7 p.Arg347His 9272157:177:52
status: NEW
PMID: 9194642
[PubMed]
Mau UA et al: "Chromosomal findings in 150 couples referred for genetic counselling prior to intracytoplasmic sperm injection."
No.
Sentence
Comment
22
In comparison, the rate of R334W, 3849ϩ10 kb C→T, R117H, R347H and poly-T allelic congenital chromosomal abnormalities in newborns is 0.5% variants in intron 8.
X
ABCC7 p.Arg347His 9194642:22:70
status: NEW62 Results and importance of molecular genetic examinations of cystic fibrosis transmembrane regulator (CFTR) mutations Mutation detection Female Male Clinical findings Remaining risk for Couple number Nationality rate (%)a mutations mutations in the male CF/CBAVD I German 82 -/- dF508/dF508 CBAVD & CF 1:280 II German 82 -/- dF508/R347H CBAVD 1:280 III German 82 dF508/- R117H/- CBAVD 1:4 IV Turkish 32 -/- R117H/- CBAVD 1:150 V Turkish 32 -/- -/- CBAVD 1:5400 VI Italian 63 -/- -/- CBAVD 1:34 300 aThe percentage indicates the frequency of the identified mutations in the reference population, based on the difference in the distribution of CFTR mutations in different populations (according to the frequencies published by the Cystic Fibrosis Genetic Analysis Consortium, 1994).
X
ABCC7 p.Arg347His 9194642:62:330
status: NEW
PMID: 9089437
[PubMed]
Cheung M et al: "Locating the anion-selectivity filter of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel."
No.
Sentence
Comment
19
Mutation of Arg347 to His resulted in pH-dependent anomalous mole-fraction effects, indicating that the positive charge at this position was important and that Arg347 was at or near one of the anion-binding sites (Tabcharani et al., 1993).
X
ABCC7 p.Arg347His 9089437:19:12
status: NEW
PMID: 9259194
[PubMed]
Friedman KJ et al: "Rapid characterization of the variable length polythymidine tract in the cystic fibrosis (CFTR) gene: association of the 5T allele with selected CFTR mutations and its incidence in atypical sinopulmonary disease."
No.
Sentence
Comment
29
The mutations R117H, R347H, ∆F508, and 384910kb C>T exist in association with more than one intron 8 allele (Dörk et al., 1994; Chillón et al., 1995), but small numbers of any particular mutation-intron 8 combination make phenotypic conclusions difficult to establish.
X
ABCC7 p.Arg347His 9259194:29:21
status: NEW
PMID: 8663098
[PubMed]
Becq F et al: "cAMP- and Ca2+-independent activation of cystic fibrosis transmembrane conductance regulator channels by phenylimidazothiazole drugs."
No.
Sentence
Comment
153
We also examined a CFTR mutation (R347D) that is at a residue where disease-causing mutations have been identified (R347P and R347H).
X
ABCC7 p.Arg347His 8663098:153:126
status: NEW152 We also examined a CFTR mutation (R347D) that is at a residue where disease-causing mutations have been identified (R347P and R347H).
X
ABCC7 p.Arg347His 8663098:152:126
status: NEW
PMID: 8659542
[PubMed]
Miller PW et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in allergic bronchopulmonary aspergillosis."
No.
Sentence
Comment
7
One patient carried two CF mutations (AF508/R347H), and five were found to carry one CF mutation (four AF508; one R117H).
X
ABCC7 p.Arg347His 8659542:7:44
status: NEW63 DNA samples from ABPA patients were screened for nine additional mutations associated with pancreatic sufficient and atypical CF: R117H (ASO), R347P (NcoI digest) and R347H (HhaI digest), R334W (MspI digest), A455E (ASO and BamHI digest), G551S (ASO) (Strong et al. 1991), 2789+5G-*A (ASO), D1152H (ASO) (Tsui 1992), and 3849+10kbC-*T (ASO and HphI digest) (Highsmith et al. 1994).
X
ABCC7 p.Arg347His 8659542:63:167
status: NEW95 The ABPA patient with a mildly elevated serum IRT (1) was found to be a compound heterozygote for CF mutations, AF508 and R347H.
X
ABCC7 p.Arg347His 8659542:95:122
status: NEW103 Her baseline NPD was -45 mV, which de- 59:45-S1, 1996 Table 2 Demographics and Genotype of ABPA Patients CFTR I.D. Race CF Mutations Polymorphismsa 1 Caucasianb AFS08/R347H 2 Caucasianb -/- M470V, 129G/C 3 Caucasianb AFS08/- ... 4 African-American -/- 5 Caucasian -5-ST, M470V 6 Caucasian &FS08/- R75Q, M470V 7 Caucasian -/- M470V 8 Caucasian R117H-7T/- R75Q 9 Caucasian AFS08/- M470V 10 Caucasian AFS08/- M470V 11 Caucasian -/- ST a The 5 thymidine variant (ST) does not cause CF (Chu et al. 1992) but has been associated with the CBAVD phenotype (Chill6n et al. 1995).
X
ABCC7 p.Arg347His 8659542:103:170
status: NEW
PMID: 8662892
[PubMed]
Seibert FS et al: "Disease-associated mutations in the fourth cytoplasmic loop of cystic fibrosis transmembrane conductance regulator compromise biosynthetic processing and chloride channel activity."
No.
Sentence
Comment
88
Other disease-causing CFTR mutants, which are appropriately processed and trafficked to the plasma membrane, show defective ion conduction properties (e.g. R334W, R347H, and R347P; Sheppard et al., 1993; Tabcharani et al., 1993) or defective regulation of channel activity (e.g. G551S, G1244E, S1255P, and G1349D; Anderson and Welsh, 1992).
X
ABCC7 p.Arg347His 8662892:88:163
status: NEW95 Other disease-causing CFTR mutants, which are appropriately processed and trafficked to the plasma membrane, show defective ion conduction properties (e.g. R334W, R347H, and R347P; Sheppard et al., 1993; Tabcharani et al., 1993) or defective regulation of channel activity (e.g. G551S, G1244E, S1255P, and G1349D; Anderson and Welsh, 1992).
X
ABCC7 p.Arg347His 8662892:95:163
status: NEW
PMID: 8744306
[PubMed]
Cheung M et al: "Identification of cystic fibrosis transmembrane conductance regulator channel-lining residues in and flanking the M6 membrane-spanning segment."
No.
Sentence
Comment
26
In the mutant R347H, multiple ion occupancy was dependent on the pH of the intracellular solution, and presumably titration of the histidine altered a nearby anion-binding site (Tabcharani et al., 1993).
X
ABCC7 p.Arg347His 8744306:26:14
status: NEW27 The ability to titrate the histidine in the R347H mutant also suggests that Arg347 is on the water-exposed surface of the channel lining.
X
ABCC7 p.Arg347His 8744306:27:44
status: NEW190 The multiple ion occupancy effects were eliminated by mutation of Arg347 to Asp or His, and the single-channel conductance was reduced (Tabcharani et al., 1993).
X
ABCC7 p.Arg347His 8744306:190:66
status: NEW188 The multiple ion occupancy effects were eliminated by mutation of Arg347 to Asp or His, and the single-channel conductance was reduced (Tabcharani et al., 1993).
X
ABCC7 p.Arg347His 8744306:188:66
status: NEW
PMID: 8617131
[PubMed]
McGill JM et al: "Survey of cystic fibrosis transmembrane conductance regulator genotypes in primary sclerosing cholangitis."
No.
Sentence
Comment
33
In total, 32 mutations were evaluated, which represent 90% of the most common mutations (t4): AF508 G542X G551D W1282X 3905insT NI303K 3849+ 10kbC--~T R553X 621+ IG--*T 1717- IG--,A lt)78delT 2789+5G---~A 3849+4A--~G 711+ IG---oT R1162X 1898+IG----~A R117H 3659delC G85E 2184delA A1507 R347P Y1092X R560T A455E R334W Y122X S549R(T---~G) Q493X V520F $549N R347H Patient Selection.
X
ABCC7 p.Arg347His 8617131:33:355
status: NEW
PMID: 8844213
[PubMed]
Morral N et al: "Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers."
No.
Sentence
Comment
91
Other mutations appeared in varioushaplotypes that were different at both microsatelliteand diallelic markers: R117H, H199Y, R347H, R347P, L558S, 2184insA, 3272-26A+G, R1162X, and 3849+10kbC-T (Table 4).
X
ABCC7 p.Arg347His 8844213:91:125
status: NEW105 CFTR Haplotypes for Diallelic and Multiallelic DNA Markers for 94 CF Mutations" J44-GATT- 8CA-17BTA- No. of T854-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 2-7-1-2 17-47-13 (55.4%) 17-46-13 17-45-13 17-34-13 17-32-13 17-31-14 17-31-13 17-29-14 17-28-13 16-48-13 16-46-14 16-46-13 16-45-13 16-44-13 16-35-13 16-33-13 16-32-13 16-31-14 16-31-13 16-30-13 16-29-13 16-26-13 16-25-13 16-24-13 14-31-13 1-7-2-1 17-7-17 (16.8%) R334W R334W 3860ins31 G1244E R1162X R1162X R1162X G91R MllOlK R347P R334W R117C E92K 3849+lOkbC+T 3293delA 1811+1.6kb A-tG 1811+1.6kb A-tG 2184insA P205S 3659delC G673X 11005R I336K W58S R347P W846X 405+1-A G178R 3905insT R1162X R347H 3100insA E60X 1078delT 4005+1-A K710X 1677delTA H199Y 3601-2AjG 3850-3T+G 3272-26A-tG 3850-1-A 1812-1-A R117H L1059X S492F Y1092X Y569H 3732delA C866Y 711+1G+T 711+1-T G85E 1949del84 2789+5-A H1085R W1282X R1066C 2043delG V456F 2 1 1 1 2 1 6 2 2 1 2 1 1 2 1 1 4 1 1 1 3 2 1 1 1 1 1 1 2 7 1 1 1 1 2 1 1 3 19 3 3 1 1 2 1 1 5 1 1 1 1 3 6 3 5 1 13 2 1 1 - 0.48 0.48 - - - 0.24 - - - 2.65 2.40 1.93 2.65 1.68 2.65 0.72 13.94 13.46 1.93 - 0.72 0.24 3.37 - b b fP fP fP t b,fb.fP h fb t h t h h fP fP b.h b h h b h h h h h fb fb,fP.t fP fP fP9t fP b t fPh b h fb b.fb,h fb*fP b,fP h h t h fb fb,fp,h.t fP fP fb t b.fP,t b,fb,h,t b f b h h fb b,fb.fP,h fP h h Gasparini et al. (1991b) Chilldn et al. (1993a) Devoto et al. (1991) Gasparini et al. (1991b) Dork et al. (1993a) Guillermit et al. (1993) Zielenski et al. (1993) Dean et al. (1990) Dork et al. (1994a) Nunes et al. (1993) Highsmith et al. (1994) Ghanem et al. (1994) Chilldn et al. (1995) Dork et al. (1994a) Dork et al. (1993a) Chilldn et al. (1993b) Kerem et al. (1990) Dork et al. (1994a) Dork et al. (1994a) Cuppenset al. (1993) Fanen et al. (1992) Maggio et al. (personal communication) Audrezet et al. (1993) Vidaud et al. (1990) Dork et al. (1993b) Zielenski et al. (1991a) Chilldn et al. (1994b) Malik et al. (personal communication) Cremonesi et at.
X
ABCC7 p.Arg347His 8844213:105:670
status: NEW106 (1992) Dork et al. (1994a) Malone et al. (personal communication) Claustreset al. (1992) Ferec et al. (1992) Fanen et al. (1992) lvaschenko et al. (1991) T. Dork (personal communication) Dean et al. (1990) Dork et al. (1994a) Ferec et al. (1992) Bozon et al. (1994) Costes et al. (personal communication) Fanen et al. (1992) Audrezet et al. (personal communication) Zielenski et al. (1991a) Zielenski et al. (1991a) Granell et al. (1992) Highsmith et al. (1990) Mercier et al. (1993b) Vidaud et al. (1990) Fanen et al. (1992) Fanen et al. (1992) Dork et al. (1994b) (continued) HAPLOTYPESFOR 94 CF MUTATIONS TABLE2. CFTR HaplotvpesforDiallelic and Multiallelic DNA Markers for 94 CF Mutations"(Continued) ~~ ~ J44-GAIT- 8CA-17BTA- No. of TSU-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 1-6-1-2 (9.1%) 1-6-2-2 (8.9%) 1-7-1-2 (3.4%) 1-7-2-2 (2.6%) 2-7-1-1 (1.2%) 2-7-2-2 (0.7%) 17-7-16 16-7-18 16-7-17 15-7-17 24-31-13 23-52-13 23-34-13 23-33-14 23-33-13 23-32-13 23-31-13 23-30-13 23-21-19 23-18-13 22-35-13 22-31-13 22-30-13 21-31-13 19-33-13 18-45-13 18-37-13 18-35-13 17-57-11 17-55-13 17-55-11 17-54-11 17-53-11 17-52-11 17-51-11 17-33-13 16-46-13 16-45-13 16-44-13 16-42-13 16-35-13 16-30-13 16-30-13 16-7-17 16-21-19 L107% L1077P 24ldelAT L719X A1507 3849+10kbC-T 2184insA 2991de132 G551D 1154insTC V520F R560T 4114ATA+lT 3667de14 435insA Q414X C225R Q39X N1303K R1162X H199Y G542X G542X w1204x R347H G542X AF50gb N1303K 2143delT 3849f 10kbC-T N1303K 681delC R347H A455E N1303K A120T 621+1 h T 574delA 1221delCT F311L R560K R553X R533X R553X Q552X R553X Q552X R116W R553X 1898+5 h T 3272-26A-G 1717-1hA 1342-2A-C A1507 2869insG 2869insG E92X 4374+1 h T 2183AA-G R117H 1609delCA I336K W1063X 1 1 1 1 6 1 3 1 1 22 17 1 1 1 1 1 1 1 1 1 1 1 1 1 17 1 1 4 157 7 1 2 2 1 1 2 2 1 9 1 1 1 1 1 1 6 1 1 1 2 1 3 2 1 3 1 1 1 4 2 4 1 1 - - 10.33 1.45 - - 0.48 1.45 - 0.24 1.45 0.24 - - - - 0.24 0.48 - - - - - - 0.49 0.48 - 0.24 0.24 0.24 - - - - - 0.72 0.24 0.72 - t h fP h b.fb,fP h b,fp.t t h b.fb.fp,h,t b.fb.fp,h,t t t t h b h h fP h fP fb b fP b.fb,fP,h.t fP fb b,fP,t b.fb,fp,h,t b.fb,h h h h,t t fb t b b b.fb.t fP fb fb tb h fP h h t t b h t h b b h h b,fb,h fP.h b h fP fP Bozon et al. (1994) Fanen et al. (1992) Dork et al. (1994a) Kerem et al. (1990) Dork et al. (1994~) Cutting et al. (1990) Kerem et al. (1990) lannuui et d.
X
ABCC7 p.Arg347His 8844213:106:1421
status: NEWX
ABCC7 p.Arg347His 8844213:106:1485
status: NEW136 Other mutations with relative frequency of less than 0.7% are associated with more than one haplotype that should be the result of slippage at one or several microsatellite repeats (R553X, R334W, 1811+1.6kbA-+G, 711 + lG+T, Q552X, 2869insG, L1077P, R347H, and R1162X).
X
ABCC7 p.Arg347His 8844213:136:249
status: NEW138 Nine mutations (R117H, H199Y, R347H, R347P, L558S, 2184insA, 3272-26A+G, R1162X, and 3849+10kbC+T) have been found associated with more than one haplotype for both diallelic and microsatellite markers.
X
ABCC7 p.Arg347His 8844213:138:30
status: NEW141 In addition, fiveof them (R177H, R347H, R347P, R1162X, and 3849+1OkbC-T) have occurredat CpG dinucleotides.Although it is difficult to prove recurrence for these mutations, this has already been postulated for severalCFmu- tations (Reisset al., 1991;Kiesewetteret al., 1993; Dork et al., 1994a; Morral et al., 1994b).
X
ABCC7 p.Arg347His 8844213:141:33
status: NEW
PMID: 8829658
[PubMed]
Cronin MT et al: "Cystic fibrosis mutation detection by hybridization to light-generated DNA probe arrays."
No.
Sentence
Comment
238
Cystic Fibrosis Mutation-Specific DNA Probe Array" Mutation Exon and column Tested Subarrayhow G85E R117H I148T 621 -+ l(G+T) 711 + 1(G+T) R334W R347H R347P 1078 delT A455E G480C Q493X A1507 F508C AF508 V520F G542X S549R(T-+ G) G551D Q552X R553X A559T R560T 1898 + l(G-,A) 2184 del A 2789 + 5(G+ A) R1066C L1077P Y1092X R1162X 3659 del C 1717-1(& A) 3272 - 26(A+ G) 3 4 4 in 4 in 5 7 7 7 7 9 10 10 10 10 10 10 in 10 11 11 11 11 11 11 11 in 12 13 in 14b in 17a 17b 17b 17b 19 19 * * * * * * * * * * * * * * * * * * * * * * * * * * * * 3849 + lOkb C-, T in 19 9,3 W1282X 20 994 3905insT 20 10.1 * N1303K 21 10,2 * * * "Row and column locations for each of the mutation specific,40 probe sets included in the specialized probe array design.
X
ABCC7 p.Arg347His 8829658:238:145
status: NEW
PMID: 7589561
[PubMed]
Hipper A et al: "Mutations in the putative pore-forming domain of CFTR do not change anion selectivity of the cAMP activated Cl- conductance."
No.
Sentence
Comment
6
The following mutations were examined: K335E, R347E, R334E, K335H, R347H, R334H.
X
ABCC7 p.Arg347His 7589561:6:67
status: NEW9 Various mutants for which positively charged amino acids were replaced by histidines (K335H, R347H, R334H) did not show pH sensitivity of the IBMX activated wc conductance.
X
ABCC7 p.Arg347His 7589561:9:93
status: NEW32 Synthesis of mutated CFTR-cDNA was induced by annealing of ampicillin repair oligonucleotide and oligonucleotide primers carrying the respective mutation changing positively charged to negatively charged amino acids (R334E, R347E, K335E) or replacing R and K at these positions by histidines (R334H, R347H, K335H).
X
ABCC7 p.Arg347His 7589561:32:300
status: NEW76 I R334EIIR334HI K335E...... I K335H I R347EII R347H l (n=16) n=10) (n=10) (n=24) (n=9) "° ,11 ml I'lnt;"i' ii Illll 111 0.8 X T °., I ~ 0.4 0.2 I o.o ~ ~ ~ 6!~ 6 ~ 8 ~ ,I I ~ ...... ] J I I L ...... ,j I I t 1 I * *J t........ ~,_J L * * I * *I _ J I .......... I I , * * * , (n=18) (n=lO) (n=22) (n=7) 1.o - T T (n=8) (n=14) T / T T T o.eT T T o 1 "~ 0.4-O 0.2- oo_ L__J , i I i t - - I 1 I I I ~ t J L ' t * J I__~ * I [ * * I l * * j l.
X
ABCC7 p.Arg347His 7589561:76:46
status: NEW80 Next, positively charged amino acids R334, R347, K335 located in the putative 6th pore forming transmembrane a-helical domain of CFTR, were exchanged by histidines (R334H, R347H, K335H) or by the negatively charged glutamate (R334E, R347E, K335E).
X
ABCC7 p.Arg347His 7589561:80:172
status: NEW81 Wc conductances were activated significantly by IBMX in all 6 mutants but to variable degrees (AG in/.tS): 3.2 + 0.6 (R334E, n = 20), 2.7 + 0.6 (R334H, n = 13), 7.1 + 0.9 (K335E, n-- 20), 2.8 + 0.7 (K335H, n = 10), 3.2 + 0.04 (R347E, n = 32) and 1.8 + 0.3 (R347H, n = 10).
X
ABCC7 p.Arg347His 7589561:81:257
status: NEW91 Following previous experiments [7] wc C1- conductances were examined in mutants bearing a histidine mutation (K335H, R347H, R334H) at different extracellular pH values.
X
ABCC7 p.Arg347His 7589561:91:117
status: NEW92 However, unlike in the previous study in R347H [7] no significant changes of G could be detected when extracellular pH was G wtCFTR R347E 10 - (n=17) 0.8- _T_ T 0~- ~ ~, ~, 0.4- ~ ~ o.2- ~ 0.0-I # 10 0.8 0.60.40.20.0- (n=14) T .__T_ i:I I L J Fig. 4. Summary of the conductance ratios obtained in wt and R347E-CFTR transfected oocytes stimulated by IBMX when 101 mmol/1 extracellular CI- was replaced by (mmol/1) 94 C1- and 7 SCN- (94/7) and 5 C1- and 96 SCN- (5/96), respectively.
X
ABCC7 p.Arg347His 7589561:92:41
status: NEW94 aL IFEBS Letters 374 (1995) 312-316 - ~ - K335H (n=7) .... ~ .... R347H (n=8) 8 - • R334H (n=5) ...6- I~ ...L 25.5/6 7.5 8/8.5 opH Fig. 5. Summary of the conductances obtained from IBMX stimulated oocytes at different extracellular pH values.
X
ABCC7 p.Arg347His 7589561:94:67
status: NEW95 Experiments were performed with oocytes overexpressing three different CFTR mutants: K335H, R347H, R334H.
X
ABCC7 p.Arg347His 7589561:95:92
status: NEW108 In the present study we repeated some of the published (K335E, R347E, R347H) and performed additional mutations (R334E, R334H, K335H) which are all located in the putative sixth transmembrane domain and overexpressed the respective CFTRs in oocytes.
X
ABCC7 p.Arg347His 7589561:108:70
status: NEW117 Additional mutations were constructed in which positively charged lysine and two arginines in the sixth transmembrane domain were replaced by pH-sensitive histidines (R334H, K335H, R347H).
X
ABCC7 p.Arg347His 7589561:117:181
status: NEW120 In the present study, unlike in the previous one ([7], R347H), we did not find significant differences for the cAMP activated wc conductances at different pH values in all three mutants.
X
ABCC7 p.Arg347His 7589561:120:55
status: NEW
PMID: 8530001
[PubMed]
Ferec C et al: "Neonatal screening for cystic fibrosis: result of a pilot study using both immunoreactive trypsinogen and cystic fibrosis gene mutation analyses."
No.
Sentence
Comment
80
Identification of novel mutations The systematic screening of exons 7, 10, and I I performed on each positive Guthrie card during this period has led us to identify five new mutations in the CFTR 30 545 % of non AF508 mutations 20 9 1717-1G->A 10 & & i i Esox G91R I 621+1G->T R117H 6b[ 7 905delG 1078 del T R347H 1221 det CT F311L R347L i10 i11i12 13 14a~l !
X
ABCC7 p.Arg347His 8530001:80:309
status: NEW82 {17bi DI507 [ Y569X W846X 2789+5G->A ,' $492F i ] i I G551D 2622+1 G->A Y1092X 1717-1 G->A E827X A1067T G542X 2183 AA->G R1066H R560K 2184 ins A 3320,ins 5 R553G R1070W 1806 del A & 4005+1G->A W1282X ] i "- Exons Fig.2 Distribution of the different mutations (except AF508) of the CFTR gene in Brittany Table 1 Mutations and genotypes in newborns Genotypes of newborns Number Sweat test AF508/AF508 7 + > 90 AF508/1806 del A 1 + > 90 R553G/G551D 1 Borderline (60) AF508/G551D 1 + > 90 AF508/R1070W 1 40 AF508/G542X 1 + > 90 AF508/G149R 1 45 Total 13 Mutations found in heterozygote newborns AF508 31 R560K 1 1078 del T 1 G544S l G542X 1 V317A 1 R347H 1 V322A 1 Total 38 gene.
X
ABCC7 p.Arg347His 8530001:82:645
status: NEW
PMID: 7472820
[PubMed]
Wilschanski M et al: "Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations."
No.
Sentence
Comment
43
Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles.
X
ABCC7 p.Arg347His 7472820:43:853
status: NEW
No.
Sentence
Comment
78
Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No.
X
ABCC7 p.Arg347His 7551394:78:325
status: NEW
PMID: 7739684
[PubMed]
Chillon M et al: "Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens."
No.
Sentence
Comment
74
OF PATIENTS POLYT GENOTYPE† ⌬F508/R668C ⌬F508/D1152H ⌬F508/D1270N ⌬F508/R75L ⌬F508/R117H ⌬;F508/L206W #2c;F508/R258G ⌬F508/S1235R ⌬F508/R347H ⌬F508/R347H R117H/G1349D R117H/712-1G→T G149R/R668C R347H/R1066H R553X/R668C R1070W/2869insG ⌬F508/- G542X/- W1282X/- R334W/- K1060T/- R1162X/- N1303K/- A800G/- ⌬F508/- ⌬F508/- ⌬F508/- ⌬E115/- R117H/- R347H/- G542X/- R553X/- 1677delTA/- 2184delA/- 2789ϩ5G→Α/- S1235R/- W1282X/- -/- -/- -/- -/- 2 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1 22 4 3 1 1 1 1 1 7 1 1 1 1 2 1 1 1 1 1 1 1 3 3 1 19 9T/7T 9T/7T 9T/7T 9T/7T 9T/7T 9T/9T 9T/7T 9T/7T 9T/7T 9T/9T 7T/7T 7T/9T 9T/7T 9T/7T 7T/7T 7T/7T 9T/5T 9T/5T 7T/5T 7T/5T 7T/5T 7T/5T 9T/5T 5T/5T 9T/7T 9T/9T 7T/7T 7T/7T 7T/7T 9T/7T 9T/7T 7T/7T 7T/7T 7T/7T 7T/7T 7T/9T 7T/7T 9T/5T 7T/5T 5T/5T 7T/7T -/- 3 7T/9T *Data were obtained from the Spanish population analyzed in this study.
X
ABCC7 p.Arg347His 7739684:74:138
status: NEWX
ABCC7 p.Arg347His 7739684:74:150
status: NEWX
ABCC7 p.Arg347His 7739684:74:202
status: NEWX
ABCC7 p.Arg347His 7739684:74:221
status: NEWX
ABCC7 p.Arg347His 7739684:74:274
status: NEWX
ABCC7 p.Arg347His 7739684:74:351
status: NEWX
ABCC7 p.Arg347His 7739684:74:458
status: NEW
PMID: 7529962
[PubMed]
Mercier B et al: "Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients."
No.
Sentence
Comment
65
In addition, we identified the following missense mutations: four R668C, one A800G, one (G628R + S1235R, borne on the same chromosome), one (R74W + D1270N, borne on the same chromosome), six R117H, one F1052V, one R117C, one S1235R, one G149R, one R258G, two R347H, one R1066H, one R75L, and one E193K.
X
ABCC7 p.Arg347His 7529962:65:259
status: NEW77 of Patients Genotypea 1 AF508 + (G628R + S1235R) 1 AF508 + (R74W + D1270N) 2 AF508 + R668C 4 AF508 + R117H 1 AF508 + R258G 1 AF508 + R75L 1 E193K + N1303K 1 R347H + R1066H 1 R117C + W1282X 1 R553X + R668C 1 G149R + R668C 1 R117H+R117H 18 AF508/unidentified 4 W1282X/unidentified 1 G542X/unidentified 1 N1303K/unidentified 1 S1235R/unidentified 1 R347H/unidentified 1 A800G/unidentified 1 F1052V/unidentified 23 unidentified/unidentified a In parentheses are the two mutations located on the same haplotype.
X
ABCC7 p.Arg347His 7529962:77:157
status: NEWX
ABCC7 p.Arg347His 7529962:77:346
status: NEW
No.
Sentence
Comment
20
The conclusion that certain residues in M l and M6 line the anion-selective pore is corroborated by three new pieces of evidence: (a) Tabcharani et al (130) found that the charge-switching mutation R347D lowered channel conductance and abolished the anomalous mole-fraction effect seen with mixtures of CI- and SCN- ions, and that channel conductance and anomalous mole-fraction behavior became pH sensitive in the mutant R347H.
X
ABCC7 p.Arg347His 7539989:20:422
status: NEW
PMID: 7526685
[PubMed]
Morral N et al: "Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene."
No.
Sentence
Comment
107
1990 G--*-T R117L G. Novelli, personal communication 1171 ......... CT R347C C. Ferec, personal communication 1172 ......... G--A R347H Cremonesi et al. 1992 G I.
X
ABCC7 p.Arg347His 7526685:107:130
status: NEW124 Two other mutations (R347H and R347L) (Cremonesi et al. 1992; Audrezet et al. 1993) have occurred at nucleotide 1172 (G--A and G--T), and another one (R347C) has occurred at nucleotide 1171, which consists of a C-*T transition (C. Ferec, personal communication).
X
ABCC7 p.Arg347His 7526685:124:21
status: NEW144 A collaborative study involving the analysis of 94 mutations in the CFTR gene has shown that mutations R117H, H199Y, R347H, R347P, L558S, 2184insA, R1162X, 3272-26A--G, and 3849+10kbC-)T have arisen more than once in different genetic backgrounds (authors' unpublished data).
X
ABCC7 p.Arg347His 7526685:144:117
status: NEW145 A collaborative study involving the analysis of 94 mutations in the CFTR gene has shown that mutations R117H, H199Y, R347H, R347P, L558S, 2184insA, R1162X, 3272-26A--G, and 3849+10kbC-)T have arisen more than once in different genetic backgrounds (authors' unpublished data).
X
ABCC7 p.Arg347His 7526685:145:117
status: NEW
PMID: 7525963
[PubMed]
Chevalier-Porst F et al: "Mutation analysis in 600 French cystic fibrosis patients."
No.
Sentence
Comment
82
Four new mutations of the CFTR gene (541delC, R347H, R352Q, E585X) detected by DGGE analysis in Italian CF patients, associated with different clinical phenotypes.
X
ABCC7 p.Arg347His 7525963:82:46
status: NEW
PMID: 7515047
[PubMed]
Akabas MH et al: "Amino acid residues lining the chloride channel of the cystic fibrosis transmembrane conductance regulator."
No.
Sentence
Comment
18
Mutation of Arg-347 to His resulted in theability to eliminate themultiple ion occupancy effects by changing the pH of the intracellular solution, presumablyby titrating the stateof protonation of the histidine.
X
ABCC7 p.Arg347His 7515047:18:12
status: NEW
PMID: 7513294
[PubMed]
Culard JF et al: "Analysis of the whole CFTR coding regions and splice junctions in azoospermic men with congenital bilateral aplasia of epididymis or vas deferens."
No.
Sentence
Comment
30
Two CBAVD patients were found to be compound heterozygous for AF508 and the missense mutation R347H (Cremonesi et al. 1992), whereas another was heterozygous for the frameshift mutation 2184delA+A---~G'at 2183 (Bozon et al. CF Consortium).
X
ABCC7 p.Arg347His 7513294:30:94
status: NEW33 CFTR mutations identified in 12 patients lacking an epididymis or vas deferens Patient Age Mutations Exon XV2c/KM19 (years) haplotypesa CBAVD 1 43 Unknown B Unknown A CBAVD 6 33 p AF508/A1067T 10/17b B m Unknown A CBAVD 8 32 p Unknown A m AF508 10 B CBAVD 9 27 p R347H 7 C m AF508 10 B CBAVD 11 31 m Unknown D p 2184delA+A---~G at 2183 13 B CBAVD 12 30 Unknown B Unknown B CBAVD 13 32 p AF508 10 B m Unknown A CBAVD 14 AF508 10 B R347H 7 C CUAVD 4 35 m G542X 11 B p Unknown D CBAE 2 28 Unknown C Unknown D CBAE 7 34 p Unknown B m S1235R 19 A CBAE 10 30 Unknown B Unknown C CBAVD, Congenital bilateral aplasia of the vas deferens; CUAVD, congenital unilateral aplasia of the vas deferens; CBAE, congenital bilateral aplasia of the epididymis; p, paternal chromosome; m, maternal chromosome The four haplotypes defined by the CFTR-linked polymorphic restriction sites XV-2c and KM-19 are as follows: A, 1-1; B, -2; C, 2-1; D, 2-2 (the absence of the restriction site for each polymorphism is defined as allele "1", and the presence of the site as allele "2") Table .
X
ABCC7 p.Arg347His 7513294:33:263
status: NEWX
ABCC7 p.Arg347His 7513294:33:430
status: NEW
PMID: 7513293
[PubMed]
Chillon M et al: "Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes."
No.
Sentence
Comment
41
A Exon 13 4 0.41 621-1 G--~T Intron 4 3 0.31 P205S Exon 6a 3 0.31 936 del TA Exon 6b 3 0.31 1949 del 84 Exon 13 3 0.31 K710X Exon 13 3 0.31 CF del #1 Exon 4-7/11-18 3 0.31 L206W Exon 6a 2 0.20 R347H Exon 7 2 0.20 Y1092X Exon 17b 2 0.20 Q1100P Exon 17b 2 0.20 Q30X Exon 2 1 0.10 E92K Exon 4 1 0.10 A120T Exon 4 1 0.10 I148T Exon 4 1 0.10 H199Y Exon 6a 1 0.10 1078 del T Exon 7 1 0.10 1717-1 G--+A Intron 10 1 0.10 T582R Exon 12 1 0.10 E585X Exon 12 1 0.10 1898+3 A~---G Intron 12 1 0.10 W1098X Exon 17b 1 0.10 R1158X Exon 19 1 0.10 3667 del 4 Exon 19 1 0.10 3860 ins 31 Exon 20 1 0.10 3905 ins T Exon 20 1 0.10 Unknown 212 21.81 The Basque subset The Basques have a different genetic background with respect to other ethnic groups (Pancorbo et al. 1989) as they are the only pre-Indoeuropean group in Spain.
X
ABCC7 p.Arg347His 7513293:41:193
status: NEW
PMID: 7516233
[PubMed]
Culard JF et al: "A novel splice site mutation in the first exon of the cystic fibrosis transmembrane regulator (CFTR) gene identified in a CBAVD patient."
No.
Sentence
Comment
3
Some of these are compound heterozygotes for AF508 and missense mutations such as R117H or R347H (2-4), which are known to be associated with mild forms of CF.
X
ABCC7 p.Arg347His 7516233:3:91
status: NEW
PMID: 7505767
[PubMed]
Dork T et al: "Exon 9 of the CFTR gene: splice site haplotypes and cystic fibrosis mutations."
No.
Sentence
Comment
146
Nature Genet 3:151-156 Cremonesi L, Ferrari M, Belloni E, Magnani C, Seia M, Ronchetto P, Rady M, Russo MP, Romeo G, Devoto M (1992) Four new mutations of the CFTR gene (541delC, R347H, R352Q, E585X) detected by DGGE analysis in Italian patients, associated with different clinical phenotypes.
X
ABCC7 p.Arg347His 7505767:146:179
status: NEW
PMID: 7505692
[PubMed]
Osborne LR et al: "Nasal epithelial ion transport and genetic analysis of infertile men with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
22
Only one subject (genotype AF508/R347H) had a history of upper and lower respiratory symptoms from childhood.
X
ABCC7 p.Arg347His 7505692:22:33
status: NEW25 Nasal potential difference, sweat sodium concentration and CF genotype in subjects with CBAVD, CF patients and controls CF genotype Control cohort CBAVD cohort CF cohort N/N« AF5O8/R347H SM9N/R1070Q AF508/Other R553X/N*> Unknown/Unknowtf AF 5«/AF5O8 AFjQj/Other AF508/R347P AF50e/G542X AFjQg/RllTH AF5O8/G85E AF5Q8/R553X AFJO8/G551D AF5O8A^520F AFJO8/S549N AF^/DIjQ, N1303K/Other G542X/R117H AFJ08/R334W Other/Other Subjects 50 1 1 1 6 1 16 25 18 3 2 1 1 1 2 1 1 1 3 1 1 3 Mean (range) sweat Na+ concentration (mmol/1) 50 (27-78) 88 N/A 94 57 (47-70) 36 49 (32-76) 126(80-162) 99 (80-128) 108 (99-115) 128 (118-137) 95 107 130 122 (116-128) 90 80 118 96 (92-99) 84 123 108(83-130) Mean (range) nasal potential difference (-mV) 21 (8-30) 31 N/A 34 23 (13-29) -15 20 (-13-28) 45 (32-58) 41 (33-61) 50 (36-77) 43 (33-52) 51 42 39 60 (50-71) 32 37 41 38 (36-40) 32 34 44(31-57) N = non-CF chromosome Other = uncharacterised CF chromosome N/A not available • with CF carrier frequency of 1/20-1/25, it is likely that 2 or 3 of these individuals will be carriers.
X
ABCC7 p.Arg347His 7505692:25:186
status: NEW34 One of these was a British Caucasian whose genotype was AFJ08/R347H and the second, a Pakistani Asian, was heterozygous for the S549N and R1070Q mutations (Table 1).
X
ABCC7 p.Arg347His 7505692:34:62
status: NEW58 The 2 subjects with elevated sweat sodium (AF5Og/R347H and AF^/Other) also had elevated nasal PD (Table 1).
X
ABCC7 p.Arg347His 7505692:58:49
status: NEW63 As expected, the two subjects with elevated sweat sodium concentrations and elevated basal nasal PD (AF508/R347H and AF^/Other) had nasal PD responses to amiloride and low chloride solutions that were comparable to those found in patients with CF.
X
ABCC7 p.Arg347His 7505692:63:107
status: NEW
PMID: 7691344
[PubMed]
Claustres M et al: "Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France."
No.
Sentence
Comment
26
Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation?
X
ABCC7 p.Arg347His 7691344:26:169
status: NEW
No.
Sentence
Comment
40
It appears that codon 347 could be a hot spot for mutations since two other nucleotide changes have been reported at nucleotide 1172 leading to R347P (12) or R347H which is associated with pancreatic sufficiency (Devoto, personal comm.).
X
ABCC7 p.Arg347His 7683952:40:158
status: NEW
PMID: 11755047
[PubMed]
Gomez-Llorente MA et al: "Analysis of 31 CFTR mutations in 55 families from the South of Spain."
No.
Sentence
Comment
30
T I.5 R553X E.11 1078delT E.7 R560T E.11 R347P E.7 S549R E.11 R347H E.7 S549N E.11 R334W E.7 3849 + 10kbC !
X
ABCC7 p.Arg347His 11755047:30:62
status: NEW
PMID: 12706377
[PubMed]
Streit C et al: "CFTR gene: molecular analysis in patients from South Brazil."
No.
Sentence
Comment
2
The present work aimed (1) to detect sequence alterations in the nucleotide binding regions and at the membrane spanning domain of the CFTR gene and (2) to detect the following frequent mutations R347P, R347H, R334W, and Q359K (located in exon 7), DF508 (located in exon 10), G542X, G551D, R553X, and S549N (located in exon 11), W1282X (located in exon 20), and N1303K (located in exon 21).
X
ABCC7 p.Arg347His 12706377:2:203
status: NEW8 No alleles were found to carry mutations G551D, R334W, R347P, R347H, Q359K, S549N, and N1303K, which were included in the screening protocol.
X
ABCC7 p.Arg347His 12706377:8:62
status: NEW34 The main aims of the present work were (1) to establish the frequency of the DF508 mutation this studied population, (2) to identify alterations in the nucleotide sequence of the exons 3, 5, and 7 which are located in the first membrane spanning domain (MSD1); of exons 9, 10, 11, and 12 which are located in the first nucleotide binding domain (NBD1); of exons 19, 20, 21, and 22 which are located in the second nucleotide binding domain (NBD2) of the CFTR gene, and finally (3) to identify some specific frequent mutations (R347P, R347H, R334W, Q359K, G542X, G551D, R553X, S54 9N, W1282X, and N1303K) in these patients.
X
ABCC7 p.Arg347His 12706377:34:533
status: NEW59 Restriction fragment length polymorphism Mutations R347P, R347H, R334W, Q359K (located in exon 7), G542X, S549N, G551D, R553X mutations (exon 11), W1282X (exon 20), and N1303K (exon 21) were identified by restriction fragment length polymorphism (RFLP) protocol, using specific restriction endonucleases.
X
ABCC7 p.Arg347His 12706377:59:58
status: NEW76 Screening of four additional mutations (G542X, R553X, R334W, and W1282X) together with DF508 Table 2 Mutations detected in 77 CF patients from south region of Brazil Mutation Location Number of alleles Frequency (%) R334W Exon 7 2 1.3 R347P Exon 7 0 0 R347H Exon 7 0 0 Q359K Exon 7 0 0 DF508 Exon 10 75 48.7 S549N Exon 11 0 0 G542X Exon 11 5 3.2 G551D Exon 11 0 0 R553X Exon 11 1 0.7 W1282X Exon 20 1 0.7 N1303K Exon 21 0 0 ?
X
ABCC7 p.Arg347His 12706377:76:252
status: NEW
PMID: 15463882
[PubMed]
Hubert D et al: "Diagnosis of cystic fibrosis in adults with diffuse bronchiectasis."
No.
Sentence
Comment
47
We used an oligonucleotide ligation assay using a commercially available kit (Cystic Fibrosis Assay, Applied Biosystems, Foster City, CA, USA) to seek 31 mutations in the CFTR gene (F508del, I507del, Q943X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA) which allowed to detect 82% of the CF alleles in France.
X
ABCC7 p.Arg347His 15463882:47:410
status: NEW129 * 31 mutations: F508del, I507del, Q493X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q ** 4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA. that the laboratory criteria for the diagnosis of CF should be expanded to include identification of CFTR mutations and abnormal bioelectrical properties of the nasal epithelium, in addition to the sweat test w7x.
X
ABCC7 p.Arg347His 15463882:129:248
status: NEW
PMID: 16635477
[PubMed]
Lucarelli M et al: "A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene."
No.
Sentence
Comment
26
None of these subjects showed any clinical manifestations of CF, nor were any positive for CFTR mutations when analyzed by means of the PCR/OLA/SCS method (Celera Diagnostics) [21], which searches for the most common worldwide 31 CFTR mutations (G85E, R117H, Y122X, 621+1G->T, 711+1G->T, 1078delT, R347P, R347H, R334W, A455E, DF508, DI507, Q493X, V520F, 1717-1G->A, G542X, G551D, R553X, R560T, S549R(T->G), S549N, 1898+1G->A, 2183AA->G, 2789+5G->A, R1162X, 3659delC, 3849+10kbC->T, 3849+4A->G, W1282X, 3905insT, N1303K), including the 12 most common in Italy [1,22].
X
ABCC7 p.Arg347His 16635477:26:305
status: NEW
PMID: 16963320
[PubMed]
Perez MM et al: "CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent."
No.
Sentence
Comment
78
At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT.
X
ABCC7 p.Arg347His 16963320:78:158
status: NEW
PMID: 22043142
[PubMed]
Lilley M et al: "Newborn screening for cystic fibrosis in Alberta: Two years of experience."
No.
Sentence
Comment
46
These include the following mutations: delF508, I507del, G542X, G85E, R117H, 621+1GT, 711+1GT, G551D, R334W, R347P, A455E, 1717-1GA, R560T, R553X, N1303K, 1898+1GA, 2184delA, 2789+5GA, 3120+1GA, R1162X, 3659delC, 3849+10kbCT, W1282X, 1078delT, 394delTT, Y122X, R347H, V520F, A559T, S549N, S549R, 1898+5GT, 2183AAG, 2307insA, Y1092X, M1101K, S1255X, 3876delA and 3905insT.
X
ABCC7 p.Arg347His 22043142:46:310
status: NEW84 TAbLe 1 Mutation frequency Mutation name Number of times detected (247 total mutations) Frequency, % expected, % (reference) delF508* 156 63.2 68.6 (1) R117H* 36 14.6 0.7 (1) G551D* 11 4.5 2.1 (1) 3849+10kbCT* 6 2.4 0.7 (1) M1101K 5 2.0 Undetermined (1) G542X* 4 1.6 2.4 (1) 1717-1GA* 4 1.6 0.7 (1) 621+1GT* 3 1.2 0.9 (1) 3120+1GA* 3 1.2 1.5 (1) G85E* 2 0.8 0.3 (1) A455E* 2 0.8 0.2 (1) R553X* 2 0.8 0.9 (1) 2789+5GA* 2 0.8 0.3 (1) ƊI507* 1 0.4 0.3 (1) 711+1GT* 1 0.4 0.1 (1) R334W* 1 0.4 0.2 (1) N1303K* 1 0.4 1.3 (1) 1898+1GA* 1 0.4 Undetermined (1) 2184delA* 1 0.4 0.1 (1) 394delTT 1 0.4 Undetermined (1) R347H 1 0.4 0.2 (4) V520F 1 0.4 0.2 (4) S549N 1 0.4 0.1 (1) 2307insA 1 0.4 0.2 (1) R347P* 0 0 0.2 (1) R560T* 0 0 0.2 (1) R1162X* 0 0 0.2 (1) 3659delC* 0 0 0.2 (1) W1282X* 0 0 1.4 (1) 1078delT 0 0 0.03 (2) Y122X 0 0 Undetermined (3) A559T 0 0 0.2 (1) S549R 0 0 Undetermined (1) 1898+5GT 0 0 Undetermined (1) 2183AAG 0 0 0.1 (1) Y1092X 0 0 Undetermined (1) S1255X 0 0 0.2 (1) 3876delA 0 0 Undetermined (4) 3905insT 0 0 0.12 (1) *American College of Medical Genetics-recommended mutations TAbLe 2 Positive cystic fibrosis newborn screen summary Screen result Unaffected Affected Further follow-up required Lost to follow-up Total Probable screen 0 23 0 0 23 Inconclusive screen One mutation 179 8 2 2 191 Markedly elevated IRT 2 0 0 0 2 R117H/F508del 0 0 5 0 5 Total 181 31 7 2 221 Data presented as n. IRT Immunoreactive trypsinogen TAbLe 3 F508del/R117H cases ID number Mutation status Sweat test result(s), &#b5;mol/L Other clinical information 24827 F508del/R117H 28 None 23726 F508del/R117H 36/insufficient/20 Fecal elastase normal 22578 F508del/R117H 10 None 24500 F508del/R117H 34/insufficient None 18527 F508del/R117H 29 None 23317 F508del/R117H+5T 47/62 Affected sibling 5T 5 thymine There were 23 newborns with probable screens.
X
ABCC7 p.Arg347His 22043142:84:662
status: NEW
No.
Sentence
Comment
19
Bei Neugeborenen kommt es typischerweise zu einem Tab. 1ߓ Typische Mutationen bei der Mukoviszidose Mutationsklasse Defektbeschreibung Beispiele (alte Nomenklatur) I Vollst&#e4;ndigerVerlust der CFTR-Protein- synthese R553X, G542X, N1303K, Êf; 1717-1 G &#e1;ߙ A II St&#f6;rung der Reifung und des intrazellul&#e4;- renTransports des CFTR-Proteins DF508 III Regulationsst&#f6;rung des Ionenkanals G551D IV St&#f6;rung der Ionenleitf&#e4;higkeit des CFTR-Kanals R347H, R117H V Verminderte CFTR-Konzentration in der Zelle 3849+10kBÊf;C &#e1;ߙ T VI Beschleunigter CFTR-Abbau ߕ CFTRÉe;Cystic fibrosis transmembrane conductance regulator".
X
ABCC7 p.Arg347His 22527665:19:476
status: NEW
PMID: 23709221
[PubMed]
Cui G et al: "Two salt bridges differentially contribute to the maintenance of cystic fibrosis transmembrane conductance regulator (CFTR) channel function."
No.
Sentence
Comment
21
However, subconductance states are dominant events with short burst durations in CFTR channels bearing known salt bridge mutations, such as R352A, R347H, D993R, and D924R (13, 14).
X
ABCC7 p.Arg347His 23709221:21:147
status: NEW
PMID: 23712087
[PubMed]
Torresani T et al: "Newborn screening for cystic fibrosis in Switzerland--consequences after analysis of a 4 months pilot study."
No.
Sentence
Comment
105
Case no GA (weeks) Weight at birth (g) 1st IRT (4th day of life) (ng/ml) 2nd IRT (repeat heel prick) (ng/ml) a CFTR mutation screening SWISS PANEL in NBS laboratory b CFTR mutation screening LUMINEX in NBS laboratory b CFTR mutation diagnosis in genetic reference laboratory c Sweat chloride macroduct method (mmol/l) d Sweat conductivity nanoduct method (mmol/l) d Pancreas function faecal elastase (ng) e Diagnosis 1 39 2980 183.0 F508del/- F508del/- F508del/420del9 97 113 45 CF 4 39 3290 150.2 F508del/F508del F508del/F508del F508del/F508del - 129 23 CF 11 37 3400 270.0 F508del/- F508del/- F508del/2347delG 105 98 b15 CF 14 40 3655 114.4 F508del/F508del F508del/F508del F508del/F508del - 116 37 CF 21 37 3280 119.5 F508del/F508del F508del/F508del F508del/F508del ND ND b15 CF with MI 23 f 38 2900 76.9 F508del/F508del F508del/F508del F508del/F508del ND ND b15 CF 35 37 2930 134.8 F508del/- F508del/621+1GNT F508del/621+1GNT 110 139 b15 CF 40 37 2980 39.5 41.8 F508del/F508del F508del/F508del F508del/F508del - 97 b15 CF with MI 12 41 3810 65.9 -/- R347P/- R347P/4006-46del5 h 38 37 ND i Equivocal CF 20 g 38 2720 63.0 122.9 -/- -/- T5/T1086A h 35 - 382 Equivocal CF 2 41 3250 50.1 F508del/- F508del/- - 39 No CF 10 38 2590 51.3 F508del/- F508del/- 14 47 No CF 13 39 3330 68.8 F508del/- F508del/- 11 36 No CF 17 39 2670 64.1 1717-1GNA/- 1717-1GNA/- 20 15 No CF 18 40 3360 58.9 3905insT/- 3905insT/- 13 36 No CF 22 38 2970 51.3 F508del/- F508del/- - 27 No CF 24 36 2790 49.1 F508del/- F508del/- 10 48 No CF 27 40 3420 60.7 F508del/- F508del/- 6 23 No CF 31 40 4400 55.5 F508del/- F508del/- 14 29 No CF 32 41 4460 89.5 F508del/- F508del/- 14 33 No CF 33 40 3700 130.6 F508del/- F508del/- ND 36 No CF 34 40 3005 65.4 N1303K/- N1303K/- 24 37 No CF 36 39 2780 61.5 F508del/- F508del/- F508del/- d ND - No CF 15 40 3310 49.3 -/- R347H/- 10 39 No CF 16 37 3240 56.0 -/- R347H/- 18 54 No CF 29 34 1870 126.5 -/- 2184delA/- 2184delA/- - - No CF 3 41 3860 46.2 72.6 -/- -/- 13 44 No CF 5 37 2840 60.1 61.0 -/- -/- - 51/34 No CF 6 40 3030 56.6 56.2 -/- -/- 16 34 No CF 7 37 3130 49.0 43.6 -/- -/- 6 18 No CF 8 39 4320 48.7 94.9 -/- -/- 13 27 No CF 9 37 2050 127.9 52.3 -/- -/- 28 28 No CF 19 38 3570 68.1 54.5 -/- -/- 6 45 No CF 25 35 2300 61.5 50.2 -/- -/- 12 37 No CF 26 40 2780 58.2 59.8 -/- -/- 10 48 No CF 28 40 3430 56.5 53.4 -/- -/- 13 31 No CF 30 37 2930 54.2 65.6 -/- -/- - 32 No CF 37 40 3615 65.9 191.4 -/- -/- ND 51 No CF 38 41 4350 56.2 65.1 -/- -/- ND 41 No CF 39 42 2900 51.6 68.5 -/- -/- 20 - No CF nine, CF diagnosis was confirmed either by a positive sweat test and/or two CFTR mutations (PPV = 23.1%; Table 1).
X
ABCC7 p.Arg347His 23712087:105:1827
status: NEWX
ABCC7 p.Arg347His 23712087:105:1867
status: NEW
PMID: 23724185
[PubMed]
Farjadian S et al: "Clinical and genetic features in patients with cystic fibrosis in southwestern iran."
No.
Sentence
Comment
82
Jalalirad M, Houshmand M, Mirfakhraie R, et al. First study of CF mutations in the CFTR gene of Iranian patients: detection of DeltaF508, G542X, W1282X, A120T, R117H, and R347H mutations.
X
ABCC7 p.Arg347His 23724185:82:171
status: NEW
PMID: 23775370
[PubMed]
Abou Tayoun AN et al: "A comprehensive assay for CFTR mutational analysis using next-generation sequencing."
No.
Sentence
Comment
53
of cases af9;/af9; c.1521_1523delCTT; c.1521_1523delCTT èc;F508; èc;F508 CF Yes 97 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.350Gb0e;A èc;F508; R117H CF Yes 53; 50 Dartmouth 1 af9;/af9; c.350Gb0e;A; c.1477Cb0e;T R117H; Q493*b CF Yes 52; 49 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.1000Cb0e;T èc;F508; R334W CF Yes 49; 54 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.489af9;1Gb0e;T èc;F508; 621af9;1Gb0e;T CF Yes 48; 47 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.1364Cb0e;A èc;F508; A455E CF Yes 51; 46 Dartmouth 1 af9;/af9; c.489af9;1Gb0e;T; c.2988af9;1Gb0e;A 621af9;1Gb0e;T; 3120af9;1Gb0e;A CF Yes 48; 49 Coriell 1 af9;/af9; c.1521_1523delCTT; c.1657Cb0e;T èc;F508; R553* CF Yes 44; 49c Coriell 2 af9;/af9; c.1521_1523delCTT; c.3528delC èc;F508; 3659delC CF Yes 46; 46 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.579af9;1Gb0e;T 621af9;1Gb0e;T; 711af9;1Gb0e;T CF Yes 50; 51 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.254Gb0e;A 621af9;1Gb0e;T; G85E CF Yes 50; 45 Coriell 1 af9;/af9; c.1521_1523delCTT; c.1679Gb0e;C èc;F508; R560T CF Yes 44; 52 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.1364Cb0e;A 621af9;1Gb0e;T; A455E CF Yes 50; 49 Coriell 1 af9;/af9; c.3909Cb0e;G; c.4046Gb0e;A N1303K; G1349D CF Yes 47; 52 Coriell 1 af9;/af9; c.2657af9;5Gb0e;A; c.2657af9;5Gb0e;A 2789af9;5Gb0e;A; 2789af9;5Gb0e;A CF Yes 100 Coriell 1 af9;/af9; c.1040Gb0e;C; c.1652Gb0e;A R347P; G551D CF Yes 51; 49 Coriell 1 af9;/af9; c.1000Cb0e;T; c.3368-2Ab0e;T R334W; 3500-2Ab0e;G CF Yes 53; 45 Coriell 1 af9;/af9; c.254Gb0e;A; c.3454Gb0e;C G85E; D1152H CF Yes 44; 47 Coriell 1 af9;/af9; c.1521_1523delCTT; c.350Gb0e;A èc;F508; R117H CF Yes 49; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.54-5940_273af9;10250del21kb èc;F508; CFTRdel2,3 CF Yes 47; N/Ad Coriell 1 af9;/af9; c.1521_1523delCTT; c.1766af9;1Gb0e;A èc;F508; 1898af9;1Gb0e;A CF Yes 47; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.2051_2052delAAinsG èc;F508; K684Sfs CF Yes 47; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.2052del èc;F508; K684Nfs*38 CF Yes 51; 55 Coriell 1 af9;/afa; c.1521_1523delCTT èc;F508 Carrier Yes 50c Dartmouth 16 af9;/afa; c.1652Gb0e;A G551D Carrier Yes 50c Dartmouth 5 af9;/afa; c.1519_1521delATC èc;I507 Carrier Yes 46 Dartmouth 1 af9;/afa; c.3454Gb0e;C D1152H Carrier Yes 50 Dartmouth 1 af9;/afa; c.1657Cb0e;T R553* Carrier Yes 51 Dartmouth 1 af9;/afa; c.178Gb0e;T E60* Carrier Yes 51 Dartmouth 1 af9;/afa; c.3846Gb0e;A W1282* Carrier Yes 45c Dartmouth 3 af9;/afa; c.1000Cb0e;T R334W Carrier Yes 51 Dartmouth 1 af9;/afa; c.1624Gb0e;T G542* Carrier Yes 47c Dartmouth 4 af9;/afa; c.3484Cb0e;T R1162* Carrier Yes 43 Dartmouth 1 af9;/afa; c.1766af9;1Gb0e;A 1898af9;1Gb0e;A Carrier Yes 57 Dartmouth 1 af9;/afa; c.3773_3774insT 3905insT (L1258Ffs*7) Carrier Yes 37 Dartmouth 1 af9;/afa; c.350Gb0e;A R117H Carrier Yes 50c Dartmouth 3 af9;/afa; c.1645Ab0e;C S549R Ab0e;C Carrier No N/A Dartmouth 1 af9;/afa; c.1040Gb0e;A R347H Carrier Yes 47 Dartmouth 1 af9;/afa; c.3909Cb0e;G N1303K Carrier Yes 46 Dartmouth 1 af9;/afa; c.3718-2477Cb0e;T 3849af9;10kbCb0e;T Carrier Yes 51 Coriell 1 af9;/afa; c.2988af9;1Gb0e;A 3120af9;1Gb0e;A Carrier Yes 49 Coriell 1 af9;/afa; c.489af9;1Gb0e;T 621af9;1Gb0e;T Carrier Yes 50 Coriell 1 af9;/afa; c.1585-1Gb0e;A 1717-1Gb0e;A Carrier Yes 51 Coriell 1 afa;/afa;e N/Af N/A Normal N/A N/A Dartmouth 9 a af9;/af9;, 2 pathogenic mutations; af9;/afa;, carrier of a single pathogenic mutation; afa;/afa;, absence of any pathogenic mutations.
X
ABCC7 p.Arg347His 23775370:53:3384
status: NEW
PMID: 23866907
[PubMed]
Landaburu I et al: "Genetic testing of sperm donors for cystic fibrosis and spinal muscular atrophy: evaluation of clinical utility."
No.
Sentence
Comment
51
The panel of mutations studied was: S549N, S549R, R553X, G551D, V520F, I507del, F508del, 3876delA, 1717-1G->A, G542X, R560T, 3120+1G->A, A455E, R117H, 394delTT, 2183AA- >G, 2184delA, 2789+5G->A, 1898+1G->A, 621+1G->T, 711+1G- >T, G85E, R347P, R347H, W1282X, R334W, 1078delT, 3849+10kbC->T, R1162X, N1303K, 3659delC, 3905insT.
X
ABCC7 p.Arg347His 23866907:51:243
status: NEW
PMID: 23891399
[PubMed]
Van Goor F et al: "Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function."
No.
Sentence
Comment
44
None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1.
X
ABCC7 p.Arg347His 23891399:44:99
status: NEW64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations.
X
ABCC7 p.Arg347His 23891399:64:1929
status: NEW74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2.
X
ABCC7 p.Arg347His 23891399:74:410
status: NEWX
ABCC7 p.Arg347His 23891399:74:903
status: NEW82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org).
X
ABCC7 p.Arg347His 23891399:82:2346
status: NEW87 Similarly, the baseline chloride transport and ivacaftor response were higher for mutant CFTR forms with mild defects in channel conductance (30-84% of normal; D110H-, R347H, and R352Q-CFTR) [17-19], compared with those with severe defects in CFTR channel conductance (undetectable R334W- and T338I-CFTR) [9,20].
X
ABCC7 p.Arg347His 23891399:87:168
status: NEW91 This suggests that the R117H mutation may be associated with defective channel gating, as well as conductance defects, and may explain why the ivacaftor response was larger than for CFTR mutations that result in defects in conductance alone (e.g., R347H, R352Q).
X
ABCC7 p.Arg347His 23891399:91:248
status: NEW92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3.
X
ABCC7 p.Arg347His 23891399:92:955
status: NEW
PMID: 24357848
[PubMed]
Zvereff VV et al: "Cystic fibrosis carrier screening in a North American population."
No.
Sentence
Comment
44
RESULTS The 32-mutation panel is composed of the 23 variants from the ACMG/ACOG screening panel combined with 9 additional mutations, namely, 3876delA, R347H, S549N, 3905insT, 1078delT, V520F, 394delTT, S549R, and 2183AA>G.
X
ABCC7 p.Arg347His 24357848:44:152
status: NEW63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population.
X
ABCC7 p.Arg347His 24357848:63:829
status: NEWX
ABCC7 p.Arg347His 24357848:63:2607
status: NEW
PMID: 24517344
[PubMed]
Raju SV et al: "Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis."
No.
Sentence
Comment
81
As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B).
X
ABCC7 p.Arg347His 24517344:81:429
status: NEW
PMID: 24727426
[PubMed]
Wang Y et al: "Understanding how cystic fibrosis mutations disrupt CFTR function: from single molecules to animal models."
No.
Sentence
Comment
2005
By contrast, the CF mutation R347H reduced single-channel conductance, converting CFTR to a single-ion pore.
X
ABCC7 p.Arg347His 24727426:2005:29
status: NEW
PMID: 25077647
[PubMed]
Lyon E et al: "Molecular genetic testing for cystic fibrosis: laboratory performance on the College of American Pathologists external proficiency surveys."
No.
Sentence
Comment
40
Two other surveys included samples with non-ACMG mutations: MGL2-2011B contained a sample with E60X (in combination with F508del), and MGL5- 2011B included a sample with R347H.
X
ABCC7 p.Arg347His 25077647:40:170
status: NEW111 Given the previously discussed issues with the potential problems with missing data and the known problems with some methods for distinguishing the Table 1ߒ Results from external proficiency testing for CFTR mutations: common types of genotyping errors Sample switch ߓ Two genotypes and associated clinical interpretations are correct, but results are reversed from the original challenge ߓ ߓ Samples actually reversed before testing ߓ ߓ Testing correct but genotypes reversed during reporting False-positive genotypes ߓ Genotype reported as homozygous instead of heterozygous ߓ ߓ Data entry error ߓ ߓ Methodology cannot distinguish zygosity and reported incorrectly ߓ Wrong mutation (examples) ߓ ߓ R347H reported when R347P was challenged ߓ ߓ R553X homozygosity reported instead of compound heterozygosity ߓ ߓ I507del reported for a F508del challenge ߓ ߓ I507del/F508del for I507del False-negative genotype ߓ Reported a homozygous genotype as heterozygous Table 2ߒ Results from external proficiency testing for CFTR mutations: analytic sensitivity and specificity for US and international clinical laboratories Time period (survey) Total alleles True positive False negative Analytical sensitivity (95% CI) True negative False positive Analytical specificity (95% CI) 2003-2013 (All) 10,952 3,941 49 98.8 (98.4-99.1) 6,932 30 99.6 (99.4-99.7) 2008-2013 (All) 5,521 2,525 19 99.3 (98.8-99.5) 2,965 12 99.6 (99.3-99.8) 2008-2013 (MGL2) 2,444 737 8 98.9 (97.8-99.5) 1,696 3 99.8 (99.4-99.9) 2008-2013 (MGL5) 3,077 1,788 11 99.4 (98.9-99.7) 1,269 9 99.3 (98.6-99.7) 2008-2013 (international) 770 288 12 96.0 (92.9-97.8) 470 0 100 (99.9-100) CI, confidence interval.
X
ABCC7 p.Arg347His 25077647:111:785
status: NEW
PMID: 25122143
[PubMed]
Audrezet MP et al: "Comprehensive CFTR gene analysis of the French cystic fibrosis screened newborn cohort: implications for diagnosis, genetic counseling, and mutation-specific therapy."
No.
Sentence
Comment
81
Some molecular defects that could belong to either the CF-causing group or the CFTR-related disorders group (group A/B) were reported in patients presenting a broad spectrum of phenotypes from classic CF to mild monosymptomatic presentations.16 These are four missense mutations (p.Leu206Trp (L206W), p.Arg347His (R347H), p.Asp1152His (D1152H), and p.Ser945Leu (S945L)) and three splice mutations (c.2657+5G>A (2789+5G>A), c.3718-2477C>T (3849+10kbC>T), and c.1210-34TG(13);1210-12T(5) (TG13T5)).
X
ABCC7 p.Arg347His 25122143:81:303
status: NEWX
ABCC7 p.Arg347His 25122143:81:314
status: NEW
PMID: 25287046
[PubMed]
Mornon JP et al: "Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics."
No.
Sentence
Comment
346
First, almost all CF-causing mutations involving residues located in the MSD transmembrane segments are encountered in MSD1 and generally concern positions lining the pore (G85E, E92K, D110H, P205S, R334W, I336K, T338I, S341P, R347H/R347P, and R352Q) (Fig. 7a).
X
ABCC7 p.Arg347His 25287046:346:227
status: NEW
PMID: 25304080
[PubMed]
Dell'Edera D et al: "Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study."
No.
Sentence
Comment
79
The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%.
X
ABCC7 p.Arg347His 25304080:79:445
status: NEW
PMID: 25583415
[PubMed]
Terlizzi V et al: "Clinical expression of patients with the D1152H CFTR mutation."
No.
Sentence
Comment
85
Legacy name Protein name CDNA name Patients Homozygous for the D1152Ha D1152H p.Asp1152His c.3454GNC 7 Compound heterozygous for class I-II-III mutationsa : 74 F508del p.Phe508del c.1521_1523delCTT 43 G542X p.Gly542X c.1624GNT 7 N1303K p.Asn1303Lys c.3909CNG 4 1717-1GNA No protein name c.1585-1GNA 4 R1158X p.Arg1158X c.3472CNT 4 2183AANG p.Lys684SerfsX38 c.2051_2052delAAinsG 2 W1282X p.Trp1282X c.3846GNA 2 711 + 1GNT No protein name c.579 + 1GNT 1 Y849X p.Tyr849X c.2547CNA 1 L1065P p.Leu1065Pro c.3194 TNC 1 4016insT p.Ser1297PhefsX5 c.3884_3885insT 1 R1066H p.Arg1066His c.3197GNA 2 R1066C p.Arg1066Cys c.3196CNT 1 4382delA p.Glu1418ArgfsX14 c.4251delA 1 Compound heterozygous for class IV-V mutationsa : 8 (TG)12T5 No protein name Not available 2 2789 + 5GNA No protein name c.2657 + 5GNA 1 D579G p.Asp579Gly c.1736ANG 1 [R74W;V201M; D1270N] No protein name Not available 1 3849 + 10KbCNT No protein name c.3717 + 12191CNT 1 R347H p.Arg347His c.1040GNA 1 R347P p.Arg347Pro c.1040GNC 1 a Protein name and cDNA name from the CFTR2 database (http://www.http. com//www.cftr2) and http://www.genet.sickkids.on.ca/Home.html.
X
ABCC7 p.Arg347His 25583415:85:932
status: NEWX
ABCC7 p.Arg347His 25583415:85:940
status: NEW
PMID: 25674778
[PubMed]
Baker MW et al: "Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study."
No.
Sentence
Comment
15
Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve.
X
ABCC7 p.Arg347His 25674778:15:2692
status: NEW74 However, the sensitivity of the IRT/NGS algorithm would have decreased as much as 50% for classic CF cases when a positive screen is defined as two CF-causing mutations because of uncommon mutations found in five patients Table 2ߒ Cases with a second mutation detected from the next-generation sequencing panel Case no. IRT (ng/ml) Second-tier DNA Additional mutation Sweat chloride (mmol/l) Clinical assessmenta Test 1 Test 2 1 64 F508del D110H 71.4 67.1 CF 2 327 F508del Q1313X N/A N/A CF 3 297 F508del Q1313X N/A N/A CF 4 71 R117H (7T) R347H 45.2 41.5 CRMSb 5 148 F508del R117C 40 38 CRMSb 6 66 F508del 5Tc 36.9 30.8 CRMSb 7 147 F508del D1152Hc 27.9 24.6 CRMSb 8 121 F508del D1152Hc 11 QNS Carrier 9 176 F508del D1152Hc 24 26 Carrier CF, cystic fibrosis; CRMS, CFTR-related metabolic syndrome; IRT, immunoreactive trypsinogen; QNS, quantity not sufficient.
X
ABCC7 p.Arg347His 25674778:74:545
status: NEW
PMID: 25910067
[PubMed]
Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."
No.
Sentence
Comment
370
991del5 c.859_863delAACTT CF-PI nd p.Asn287LysfsX19 L320V c.958T>G uncertain: CF-PI and/or CF-PS and/or CFTR-RD nd p.Leu320Val R334W c.1000C>T CF-PI,CF-PS CF-causing p.Arg334Trp R334L c.1001G>T CF-PS nd p.Arg334Leu T338I c.1013C>T CF-PS,CFTR-RD,CBAVD CF-causing p.Thr338Ile R347P c.1040G>C CF-PI,CF-PS CF-causing p.Arg347Pro R347H c.1040G>A CF-PS CF-causing p.Arg347His [M348K;S912X] c.
X
ABCC7 p.Arg347His 25910067:370:325
status: NEWX
ABCC7 p.Arg347His 25910067:370:360
status: NEW
PMID: 26014425
[PubMed]
Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."
No.
Sentence
Comment
79
(unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance.
X
ABCC7 p.Arg347His 26014425:79:982
status: NEWX
ABCC7 p.Arg347His 26014425:79:1000
status: NEW92 Well known examples include missense variants D110H, R117C, L206W, R347P, R347H, R1066H, or splice variants that produce both aberrant and full-length transcript such as 3849+10kbC4T, 2789+5G4A, 3272-26 A4G, 711+3 A4G.
X
ABCC7 p.Arg347His 26014425:92:74
status: NEW
PMID: 26087176
[PubMed]
Dupuis A et al: "Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene."
No.
Sentence
Comment
63
Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented.
X
ABCC7 p.Arg347His 26087176:63:2776
status: NEW109 While non-CFTR modifier genes as well as environmental factors largely influence the development and progression of lung disease and nutritional decline,33-36 we demonstrate that the severity of the underlying CFTR genotype Table 2ߒ Meconium ileus prevalence scores and CFTR function CFTR mutation MIP score CFTR function (%wt) High MIP score ߓ V520F 0.38 0.2 ߓ N1303K 0.25 0.5 ߓ F508del 0.27 0.4 ߓ R560T 0.27 0.1 ߓ A559T 0.24 0 ߓ G551D 0.15 1 ߓ G85E 0.14 0.8 ߓ R1066C 0.13 0 Low MIP score ߓ R347P 0.1 0 ߓ R117C 0.1 2.9 ߓ R117H 0.07 33 ߓ R347H 0.06 5 ߓ R334W 0.05 1.3 ߓ A455E 0.05 6 ߓ L206W 0.04 5 ߓ M1101K 0.04 0 ߓ P67L 0.0 8 The table compares meconium ileus prevalence (MIP) scores and measured cystic fibrosis transmembrane conductance regulator (CFTR) function in Fisher rat thyroid determined by VanGoor et al.24 for the major and missense cystic fibrosis-causing variants for which patient group size was ࣙ10 in at least the US group.
X
ABCC7 p.Arg347His 26087176:109:616
status: NEW
PMID: 26209275
[PubMed]
Cui G et al: "Murine and human CFTR exhibit different sensitivities to CFTR potentiators."
No.
Sentence
Comment
306
However, recent data indicating that VX-770 potentiates channels bearing multiple disease-causing mutations, spread across CFTR, and that VX-770 potentiates one mutant but not another one in the same domain (for example, VX-770 potentiated TM mutants T338I- and R347H- but not S341P- and E92K-CFTR and potentiated cytoplasmic loop mutants E193K- and K1060T- but not R1066M- and L1065P-CFTR) do not support this conclusion (30, 38).
X
ABCC7 p.Arg347His 26209275:306:262
status: NEW
PMID: 9092029
[PubMed]
Durieu I et al: "[Male infertility caused by bilateral agenesis of the vas deferens: a new clinical form of cystic fibrosis?]."
No.
Sentence
Comment
46
Vingt-deux mutations du gene CFTR ont Cte recher- chtes : les cinq plus frequentes (AF508, G542X, N1303K, 1717-G--A, G85E) et les 17 suivantes : R117H, 556delA, R334W, R347H, R347P, S549N, S5491, S549R, G551D, R553X,R560T,G1244E3,S1255X,W1282X,R1283K,3898 ins C, D1270N.
X
ABCC7 p.Arg347His 9092029:46:168
status: NEW
admin on 2016-08-19 15:16:22