ABCMdb

ABCC7 p.Ser1251Asn

Admin's notes:	Class III (gating defect) Veit et al.
ClinVar:	c.3752G>A , p.Ser1251Asn D , Pathogenic
CF databases:	c.3752G>A , p.Ser1251Asn D , CF-causing ; CFTR1: The nucleotide change is G to A at position 3884 and results in an amino acid change of the conserved serine by an asparagine (S1251N). The two unrelated German CF patients (17 and 19 years old) are pancreas insufficient and suffer from all typical signs of the disease. The mutation destroys recognition sites for RsaI and EarI. Digestion with RsaI results in five fragments for the normal (188, 95, 82 79, 29 bp) and four fragments for the mutant allele (267, 95, 82, 29 bp). The mutation was not found on further 67 German and 12 turkish non-[delta] CF chromosomes nor on 20 normal chromosomes. S1251N is associated with the haplotype 2-1-1-2 (XV2c-KM, 19-D9-J44) and with F508C.
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: N (78%), P: D (95%), Q: D (95%), R: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: N, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: N, P: D, Q: D, R: D, T: N, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

III (gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Polymorphisms of MRP1 (ABCC1) and related ATP-depe... Pharmacogenet Genomics. 2005 Aug;15(8):523-33. Conseil G, Deeley RG, Cole SP
Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters.
Pharmacogenet Genomics. 2005 Aug;15(8):523-33., [PMID:16006996]

Abstract [show]
Genetic variations in drug metabolizing enzymes and targets are established determinants of adverse drug reactions and interactions, but less is known about the role of genetic polymorphisms in membrane transport proteins. MRP1 (ABCC1) is one of 13 polytopic membrane proteins that comprise the 'C' subfamily of the ATP-binding cassette (ABC) superfamily of transport proteins. MRP1 and related ABCC family members, including MRP2, 3, 4 and 5 (ABCC2, 3, 4 and 5), each have a distinctive pattern of tissue expression and substrate specificity. Together, these five transporters play important roles in the disposition and elimination of drugs and other organic anions, and in maintenance of blood-tissue barriers, as confirmed by enhanced chemosensitivity of respective knockout mice. Moreover, Mrp2 (Abcc2) deficient animals display mild conjugated hyperbilirubinemia, corresponding to a human condition known as Dubin-Johnson syndrome (DJS). Naturally occurring mutations in MRP/ABCC-related drug transporters have been reported, some of which are non-synonymous single nucleotide polymorphisms. The consequences of the resulting amino acid changes can sometimes be predicted from in vitro site-directed mutagenesis studies or from knowledge of mutations of analogous (conserved) residues in ABCC proteins that cause DJS, Pseudoxanthoma elasticum (ABCC6), cystic fibrosis (CFTR/ABCC7) or persistent hyperinsulinemic hypoglycemia of infancy (SUR1/ABCC8). Continual updating of databases of sequence variants and haplotype analysis, together with in vitro biochemical validation assays and pharmacological studies in knockout animals, should make it possible to determine how genetic variation in the MRP-related transporters contributes to the range of responses to drugs and chemicals observed in different human populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 In the kidney, glomeruli and distal collecting tubules express MRP1, and, in the brain, MRP1 appears to form part of the drug permeability barrier Fig. 1 CF (CFTR/ABCC7) Q1291R E1228G Q1238R G1244E/V G1247R G1249R S1251N S1255P/L W1282G/R/C R1283K/M N1303K Y1307C E1321Q K1351E Q1352H R1268Q V1298F T1301I G1302R A1303P R1314W/Q G1321S R1339C Q1347H I1350L G1354R D1361N Q1382R A1450T R1347E R1351P V1359G/M S1368A G1377R G1382S R1392H R1419C R1435Q G1477R G1479R R1492W E1505K DJS (MRP2/ABCC2) NBD1 NBD2 COOH MEMBRANE MSD MSD MSD 12131415161710116 7 8 91 23 4 5TM H2 N Extracellular Intracellular PXE (ABCC6) PHHI (SUR1/ABCC8) Two-dimensional structure of MRP-related proteins. Login to comment

[hide] The complex relationships between cystic fibrosis ... Hum Reprod. 1999 Feb;14(2):371-4. Dohle GR, Veeze HJ, Overbeek SE, van den Ouweland AM, Halley DJ, Weber RF, Niermeijer MF
The complex relationships between cystic fibrosis and congenital bilateral absence of the vas deferens: clinical, electrophysiological and genetic data.
Hum Reprod. 1999 Feb;14(2):371-4., [PMID:10099982]

Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is found in 1-2% of infertile males and in most male cystic fibrosis (CF) patients. CF and some of the CBAVD cases were found to share the same genetic background. In this study, 21 males with CBAVD had extensive physical and laboratory testing for symptoms of CF. Possible defective cellular chloride transport was measured by interstitial current measurement of rectal suction biopsies. Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation analysis was performed for 10 common CFTR mutations. CF-related symptoms were found in six men. On laboratory testing slightly abnormal liver and pancreatic function was found in seven patients. The sweat test was found to be abnormal in four patients; interstitial current measurement showed defective chloride excretion in 11 patients. CFTR gene mutations were found in 66% of the patients: eight were compound heterozygotes; in six, only one common mutation could be detected. The 5T allele in one copy of intron 8 was found in four men. CBAVD appears to be a heterogeneous clinical and genetic condition. A CFTR gene mutation was found in both copies of the allele or interstitial current measurement showed defective chloride excretion in 14/21 cases. Genetic counselling is clearly indicated for couples seeking pregnancy through epididymal or testicular sperm aspiration and intracytoplasmic sperm injection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 CFTR mutation analysis was performed for 10 mutations: we analysed for the mutations R117H, A455E, ∆F508, 1717-1G→A, G542X, R553X, R1162X, S1251N, W1282X, and N1303K. Login to comment

[hide] Mutations of the cystic fibrosis gene, but not cat... Am J Gastroenterol. 2000 Aug;95(8):2061-7. Ockenga J, Stuhrmann M, Ballmann M, Teich N, Keim V, Dork T, Manns MP
Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.
Am J Gastroenterol. 2000 Aug;95(8):2061-7., [PMID:10950058]

Abstract [show]
OBJECTIVE: We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. METHODS: Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). RESULTS: No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CONCLUSIONS: CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Using the ARMS technology (elucigene CF20, Zeneca Diagnostics, Oxfordshire, UK) all samples were tested additionally for the mutations E60X, R347P, A455E, 1078delT, 2183AA3G, G542X, G551D, N1303K, W1282X, 1717-1G3A, R553X, 621ϩ1G3T, R117H, R1162X, 3849ϩ10kbC3T, R334W, S1251N, and 3659delC. Login to comment

[hide] ATP hydrolysis-coupled gating of CFTR chloride cha... Biochemistry. 2001 May 15;40(19):5579-86. Zou X, Hwang TC
ATP hydrolysis-coupled gating of CFTR chloride channels: structure and function.
Biochemistry. 2001 May 15;40(19):5579-86., 2001-05-15 [PMID:11341822]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
207 Mutations of some of the corresponding amino acids in CFTR (S466L in NBD1 or T1246I, S1251N, and T1252P in NBD2) are associated with CF (Figure 3). Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]

Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 These were G91R, 711 ϩ 5GϾA, T338I, 712-1GϾT, Q359K/T360K, 1161delC, 1609delCA, S549I, Q552X, 1949del84, 1989 ϩ 5GϾT, S1251N, and R1283M. Login to comment

[hide] Genetic risk factors in infertile men with severe ... Hum Reprod. 2002 Jan;17(1):13-6. Dohle GR, Halley DJ, Van Hemel JO, van den Ouwel AM, Pieters MH, Weber RF, Govaerts LC
Genetic risk factors in infertile men with severe oligozoospermia and azoospermia.
Hum Reprod. 2002 Jan;17(1):13-6., [PMID:11756355]

Abstract [show]
BACKGROUND: Male infertility due to severe oligozoospermia and azoospermia has been associated with a number of genetic risk factors. METHODS: In this study 150 men from couples requesting ICSI were investigated for genetic abnormalities, such as constitutive chromosome abnormalities, microdeletions of the Y chromosome (AZF region) and mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. RESULTS: Genetic analysis identified 16/150 (10.6%) abnormal karyotypes, 8/150 (5.3%) AZFc deletions and 14/150 (9.3%) CFTR gene mutations. An abnormal karyotype was found both in men with oligozoospermia and azoospermia: 9 men had a sex-chromosomal aneuploidy, 6 translocations were identified and one marker chromosome was found. Y chromosomal microdeletions were mainly associated with male infertility, due to testicular insufficiency. All deletions identified comprised the AZFc region, containing the Deleted in Azoospermia (DAZ) gene. CFTR gene mutations were commonly seen in men with congenital absence of the vas deferens, but also in 16% of men with azoospermia without any apparent abnormality of the vas deferens. CONCLUSIONS: A genetic abnormality was identified in 36/150 (24%) men with extreme oligozoospermia and azoospermia. Application of ICSI in these couples can result in offspring with an enhanced risk of unbalanced chromosome complement, male infertility due to the transmission of a Y-chromosomal microdeletion, and cystic fibrosis if both partners are CFTR gene mutation carriers. Genetic testing and counselling is clearly indicated for these couples before ICSI is considered.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 Twelve common mutations of the CFTR gene were tested (∆F508, A445E, G542X, 1717-1G→A, R553X, R117H, R1162X, N1303K, W1282X, 3659delC, E60X and S1251N). Login to comment

[hide] Activation of ion secretion via proteinase-activat... Am J Physiol Gastrointest Liver Physiol. 2002 Feb;282(2):G200-10. Mall M, Gonska T, Thomas J, Hirtz S, Schreiber R, Kunzelmann K
Activation of ion secretion via proteinase-activated receptor-2 in human colon.
Am J Physiol Gastrointest Liver Physiol. 2002 Feb;282(2):G200-10., [PMID:11804840]

Abstract [show]
Proteinase-activated receptor (PAR) type 2 (PAR-2) has been shown to mediate ion secretion in cultured epithelial cells and rat jejunum. With the use of a microUssing chamber, we demonstrate the role of PAR-2 for ion transport in native human colonic mucosa obtained from 30 normal individuals and 11 cystic fibrosis (CF) patients. Trypsin induced Cl(-) secretion when added to the basolateral but not luminal side of normal epithelia. Activation of Cl(-) secretion by trypsin was inhibited by indomethacin and was further increased by cAMP in normal tissues but was not present in CF colon, indicating the requirement of luminal CF transmembrane conductance regulator. Effects of trypsin were largely reduced by low Cl(-), by basolateral bumetanide, and in the presence of barium or clotrimazole, but not by tetrodotoxin. Furthermore, trypsin-induced secretion was inhibited by the Ca(2+)-ATPase inhibitor cyclopiazonic acid and in low-Ca(2+) buffer. The effects of trypsin were almost abolished by trypsin inhibitor. Thrombin, an activator of PAR types 1, 3, and 4, had no effects on equivalent short-circuit currents. The presence of PAR-2 in human colon epithelium was confirmed by RT-PCR and additional experiments with PAR-2-activating peptide. PAR-2-mediated intestinal electrolyte secretion by release of mast cell tryptase and potentiation of PAR-2 expression by tumor necrosis factor-alpha may contribute to the hypersecretion observed in inflammatory processes such as chronic inflammatory bowel disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Testing of an additional panel of the 19 most prevalent CFTR mutations among the Caucasian population in Europe, including G542X, N1303K, 1717-1 GϾT, W1282X, G551D, R553X, R1162X, R334W, R117H, 621ϩ1GϾT, 3849ϩ10kbCϾT, 3659delC, 1078delT, R347P, A445E, S1251N, ⌬I507, 2183AAϾG, and E60X (ELUCIGENE CF20; AstraZeneca Diagnostics) failed to identify the second disease causing mutation in six CF patients. Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL. Login to comment

[hide] Genotype-phenotype correlation in cystic fibrosis:... Am J Med Genet. 2002 Jul 22;111(1):88-95. Salvatore F, Scudiero O, Castaldo G
Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes.
Am J Med Genet. 2002 Jul 22;111(1):88-95., 2002-07-22 [PMID:12124743]

Abstract [show]
More than 1,000 mutations have been identified in the cystic fibrosis (CF) transmembrane regulator (CFTR) disease gene. The impact of these mutations on the protein and the wide spectrum of CF phenotypes prompted a series of Genotype-Phenotype correlation studies. The CFTR genotype is invariably correlated with pancreatic status-in about 85% of cases with pancreatic insufficiency and in about 15% of cases with pancreatic sufficiency. The correlations between the CFTR genotype and pulmonary, liver, and gastrointestinal expression are debatable. The heterogeneous phenotype in CF patients bearing the same genotype or homozygotes for nonsense mutations implicated environmental and/or genetic factors in the disease. However, the discordant phenotype observed in CF siblings argued against a major role of environmental factors and suggested that genes other than CFTR modulate the CF phenotype. A locus that modulates gastrointestinal expression was identified in mice and subsequently in humans. By analyzing nine CF patients discordant for meconium ileus we were able to show that this locus had a dominant effect. Moreover, in a collaborative study we found a higher rate of polymorphisms in beta-defensin genes 1 and 2 in CF patients and in controls. In another multicenter study mutations in alpha-1 antitrypsin (A1AT) and mannose binding lectin genes were found to be independent risk factors for liver disease in CF patients. The body of evidence available suggests that the variegated CF phenotype results from complex interactions between numerous gene products.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994]. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

[hide] Clinical characteristics and genotype analysis of ... Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32. Cimmino M, Cavaliere M, Nardone M, Plantulli A, Orefice A, Esposito V, Raia V
Clinical characteristics and genotype analysis of patients with cystic fibrosis and nasal polyposis.
Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32., [PMID:12680831]

Abstract [show]
The prevalence of nasal polyps in a group of paediatric patients with cystic fibrosis was prospectively studied in comparison with a control group with cystic fibrosis but without polyps. Clinical variables, including pulmonary function tests, skin testing and mucociliary transport, were carried out in both groups, as well as genotype analysis. Endoscopic intranasal evaluation identified polyps in 29 of 89 patients (33%). Statistical analysis revealed that patients with nasal polyposis had better pulmonary function, a higher rate of Pseudomonas aeruginosa colonization, more hospitalizations, and more prevalence of allergy to Aspergillus fumigatus than did the comparison group. We found no statistically different genotype distribution between the polyposis and the control group. However, it can be emphasized that the prevalence of the compound heterozygous genotype is higher in the nasal polyposis group than in controls. Our observations suggest that other genetic and environmental factors could play an important role in the development of nasal polyposis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Analysis of mutations in the CFTR gene as tested by the multiplex polymerase chain reaction (PCR), followed by the reverse dot-blot technique, which searches for 29 of the most frequent mutations (DF508, N1303K, G542X, W1282X, 1717±1 G-A, R553X, 2183 AA-G, DI507, G551D, R560T, 3849 10kbC > T, R1162X, 3659delC, 3905insT, G85E, 621 1GT, R117H, R347P, R334W, A455E, 2789 5GA, Q552X, S1251N, 3905insT, 394delTT, E60X, 2143delT, 2184delA, 711 5G > A), and by ASO dot-blot for the following mutations: I148T, R1158X, 4016 1T, G1244E G >A.26 Statistical analysis was performed using multivariate analysis, by forward stepwise comparison; it was done to ®nd out which of the examined characteristics could be associated (P < 0.01) to nasal polyposis. Login to comment

[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]

Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment

[hide] Molecular consequences of cystic fibrosis transmem... Gut. 2003 Aug;52(8):1159-64. Ahmed N, Corey M, Forstner G, Zielenski J, Tsui LC, Ellis L, Tullis E, Durie P
Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas.
Gut. 2003 Aug;52(8):1159-64., [PMID:12865275]

Abstract [show]
BACKGROUND AND AIMS: We tested the hypothesis that the actual or predicted consequences of mutations in the cystic fibrosis transmembrane regulator gene correlate with the pancreatic phenotype and with measures of quantitative exocrine pancreatic function. METHODS: We assessed 742 patients with cystic fibrosis for whom genotype and clinical data were available. At diagnosis, 610 were pancreatic insufficient, 110 were pancreatic sufficient, and 22 pancreatic sufficient patients progressed to pancreatic insufficiency after diagnosis. RESULTS: We identified mutations on both alleles in 633 patients (85.3%), on one allele in 95 (12.8%), and on neither allele in 14 (1.9%). Seventy six different mutations were identified. The most common mutation was DeltaF508 (71.3%) followed by G551D (2.9%), G542X (2.3%), 621+1G-->T (1.2%), and W1282X (1.2%). Patients were categorized into five classes according to the predicted functional consequences of each mutation. Over 95% of patients with severe class I, II, and III mutations were pancreatic insufficient or progressed to pancreatic insufficiency. In contrast, patients with mild class IV and V mutations were consistently pancreatic sufficient. In all but four cases each genotype correlated exclusively with the pancreatic phenotype. Quantitative data of acinar and ductular secretion were available in 93 patients. Patients with mutations belonging to classes I, II, and III had greatly reduced acinar and ductular function compared with those with class IV or V mutations. CONCLUSION: The predicted or known functional consequences of specific mutant alleles correlate with the severity of pancreatic disease in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
309 Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment

[hide] Mutations of the CFTR gene in pancreatic disease. Pancreas. 2003 Nov;27(4):332-6. Pezzilli R, Morselli-Labate AM, Mantovani V, Romboli E, Selva P, Migliori M, Corinaldesi R, Gullo L
Mutations of the CFTR gene in pancreatic disease.
Pancreas. 2003 Nov;27(4):332-6., [PMID:14576497]

Abstract [show]
INTRODUCTION: An association has been found between CFTR gene mutations and chronic pancreatitis; however, there is a lack of information about the frequency of CFTR gene mutations in acute pancreatitis and in pancreatic cancer. AIM: To prospectively evaluate the prevalence of CFTR gene mutations in acute pancreatitis, chronic pancreatitis, and pancreatic cancer. METHODOLOGY: Ninety-eight consecutive patients were studied and divided into 3 groups: 34 patients with acute pancreatitis, 46 patients with chronic pancreatitis, and 18 patients with pancreatic cancer. The mutation analysis of the CFTR gene was carried out using diagnostic commercial kits for the simultaneous detection of 29 mutations and Tn polymorphism. RESULTS: Among the 98 patients studied, 12 (12.2%) had CFTR gene mutations: 2 of the 34 patients (5.9%) with acute pancreatitis, 9 of the 46 (19.6%) with chronic pancreatitis, and 1 of the 18 (5.6%) with pancreatic cancer. All the mutations were found in heterozygosis (2 DeltaF508, 1 W1282X, and 9 T5 allele). CONCLUSION: Our prospective study adds further information about the frequency of CFTR mutations in patients with a single episode of acute pancreatitis. Furthermore, our results suggest an association of CFTR gene mutations with chronic alcoholic pancreatitis and emphasize the need for a multicenter study, possibly multinational, to conclusively establish the role of CFTR mutations as a genetic susceptibility factor for this disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 The 29 Mutations and the Tn Polymorphism Which Can Be Detected by INNO-LiPA Assays Mutation Exon/Intron (i) E60X, G85E, 394delTT 3 621 + 1G > T, R117H (i) 4, 4 711 + 5G > A (i) 5 1078delT, R347P, R334W 7 A455E, Tn (i) 8, 9 ⌬F508, ⌬I507 10 G542X, 1717-1 G > A, G551D, R553X, R560T, Q552X (i) 10, 11 2183AA > G, 2184del A, 2143delT 13 2789 + 5G > A (i) 14b R1162X, 3659delC 19 3849 + 10kbC > T (i) 19 3905insT, W1282X, S1251N 20 N1303K 21 Group 3: pancreatic cancer CFTR gene mutations were identified only in 1 of the 18 patients (5.6%) with this cancer. Login to comment

[hide] Neonatal screening for cystic fibrosis: France ris... J Inherit Metab Dis. 2003;26(8):729-44. Farriaux JP, Vidailhet M, Briard ML, Belot V, Dhondt JL
Neonatal screening for cystic fibrosis: France rises to the challenge.
J Inherit Metab Dis. 2003;26(8):729-44., [PMID:14739679]

Abstract [show]
This paper describes the adjustments to the French neonatal screening programme required by the introduction of systematic screening for cystic fibrosis (CF), taking into account both the legal and statutory framework and the lessons of a pilot study carried out 10 years ago. The French association for the screening and prevention of infant handicaps (AFDPHE) has been mandated by its regulatory agencies to organize screening for CF in France (metropolitan and overseas territories). During the year 2001, expert groups (Technical Aspects, Information, Ethics and Genetics, Criteria for CF Centres, Protocol for the Care of a Newborn with CF) issued recommendations for the establishment of a national programme that would guarantee efficiency and adequate patient care from the time of diagnosis onward. The programme is based on a strategy combining immunoreactive trypsin (IRT) assay and the analysis of DNA mutations in dried blood samples obtained at 3 days of age. When an elevated IRT value is found, DNA analysis is performed on the same sample. Owing to the relative regional heterogeneity existing in France, 30 selected mutations are used, which provide 85% coverage. The Ethics and Genetics Committee recommended that, in order to avoid arousing anxiety by a recall, informed consent, according to the French legislation on bioethics, should be obtained for all neonates at birth by having the parents sign directly on the sampling paper. Information brochures for parents and health professionals have been designed. A new organization of patient care, involving the creation of CF centres recognized by the Ministry of Health, has been decided; all children diagnosed are to be referred to such centres, where they can be well cared for by a trained staff with sufficient means. The programme was implemented region by region in France, from the beginning of the year 2002 to early 2003. The expert groups still meet periodically to evaluate the implementation of the programme and to check that the terms of the agreement between the AFDPHE and the Social Security Agency are complied with.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
114 In its present version, the kit allows screening for 20 CFTR gene mutations (F508del, G542X, N1303K, 1717-1G>A, G551D, W1282X, R553X, I507del, 1078delT, 2183AA>G, 3849 þ 10kbC>T, R1162X, 621 þ 1G>T, R334W, R347P, 3659delC, R117H, S1251N, E60X, A455E) in one workday; moreover, it does not require any speci'c equipment. Login to comment

[hide] A finger sweat chloride test for the detection of ... Pancreas. 2004 Apr;28(3):e80-5. Naruse S, Ishiguro H, Suzuki Y, Fujiki K, Ko SB, Mizuno N, Takemura T, Yamamoto A, Yoshikawa T, Jin C, Suzuki R, Kitagawa M, Tsuda T, Kondo T, Hayakawa T
A finger sweat chloride test for the detection of a high-risk group of chronic pancreatitis.
Pancreas. 2004 Apr;28(3):e80-5., [PMID:15084988]

Abstract [show]
OBJECTIVES: Mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene are associated with chronic pancreatitis in Caucasians. We developed a simple method for measuring finger sweat chloride concentration to test whether CFTR dysfunction underlies chronic pancreatitis in Japan where cystic fibrosis (CF) is rare. METHODS: We studied 25 patients with chronic (21 alcoholic and 4 idiopathic) pancreatitis and 25 healthy volunteers. Sweat chloride concentrations were measured by a finger sweat chloride test. We analyzed DNA for 20 common CFTR mutations in Europeans, 9 CF-causing mutations in Japanese, and 2 polymorphic loci, a poly-T tract and (TG) repeats, at intron 8. RESULTS: Thirteen patients (52%) had sweat chloride levels >60 mmol/L, a level consistent with CF, while only 4 (16%) healthy subjects exceeded this level. The 29 CF mutations and the 5T allele were detected in neither the patients nor controls. The (TG) 12 allele was common in both the patients (58%) and controls (48%). The (TG) 12/12 genotype was common in alcoholic pancreatitis (29%) compared with the (TG) 11/11 (10%). Patients with the (TG) 12/12 genotype had significantly higher sweat chloride concentrations than the controls. CONCLUSION: CFTR dysfunction as evidenced by a finger sweat chloride test is present in about half of Japanese patients with chronic pancreatitis, suggesting that this test may be useful for detecting the high-risk group. A higher proportion of the (TG) 12 allele may be a genetic background for elevated sweat chloride concentrations in Japanese patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 The DNA samples were analyzed using an amplification refractory mutation system kit for 20 common major CFTR mutations (E60X, R117H, R334W, R347P, A455E, ⌬I507, ⌬F508, G542X, G551D, R553X, 621+1G>T, 1078delT, R1162X, S1251N, W1282X, N1303K, 1717-1G>A, 2183AA>G, 3659delC, 3849+10kbC>T) (Elucigene CF 20, AstraZeneca Diagnostics, Abingdon, UK) following the standard procedures recommended by the manufacturer. Login to comment

[hide] Genetic evidence for CFTR dysfunction in Japanese:... J Med Genet. 2004 May;41(5):e55. Fujiki K, Ishiguro H, Ko SB, Mizuno N, Suzuki Y, Takemura T, Yamamoto A, Yoshikawa T, Kitagawa M, Hayakawa T, Sakai Y, Takayama T, Saito M, Kondo T, Naruse S
Genetic evidence for CFTR dysfunction in Japanese: background for chronic pancreatitis.
J Med Genet. 2004 May;41(5):e55., [PMID:15121783]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
218 The 20 most common CF mutations (E60X, R117H, R334W, R347P, A455E, DI507, DF508, G542X, G551D, R553X, 621+1GRT, 1078delT, R1162X, S1251N, W1282X, N1303K, 1717-1GRA, 2183AARG, 3659delC, and 3849+10kbCRT) were tested by an Elucigene CF20 kit (AstraZeneca Diagnostics, Abingdon, Oxfordshire, UK). Login to comment

[hide] The role of CFTR and SPINK-1 mutations in pancreat... AIDS. 2004 Jul 23;18(11):1521-7. Felley C, Morris MA, Wonkam A, Hirschel B, Flepp M, Wolf K, Furrer H, Battegay M, Bernasconi E, Telenti A, Frossard JL
The role of CFTR and SPINK-1 mutations in pancreatic disorders in HIV-positive patients: a case-control study.
AIDS. 2004 Jul 23;18(11):1521-7., 2004-07-23 [PMID:15238770]

Abstract [show]
OBJECTIVE: Pancreatic disorders in HIV-positive patients are frequent. CFTR and SPINK-1 mutations have been reported to increase the risk of pancreatitis, but no data are available in HIV-positive patients. This study will evaluate the frequency of CFTR mutations and SPINK-1 polymorphisms in HIV-positive patients with clinical pancreatitis or asymptomatic elevation of serum pancreatic enzymes. METHOD: Cases (patients with hyperamylasemia) were identified during a toxicity study conducted in August 1999 among 1152 participants of the Swiss HIV Cohort Study. We designed a case-control study in which each case was matched one to one to an HIV-infected control according to sex, age, CD4 cell count, viraemia and medication use. CFTR mutations and SPINK-1 polymorphisms were studied using polymerase chain reaction techniques. RESULTS: Fifty-one HIV-positive patients with hyperamylasemia were detected among 1152 participants in the toxicity study (4.4%). There were 13 carriers of CFTR and SPINK-1 mutations (12.7%). Amylase levels were 316 +/- 130 U/l for the group with mutations, and 135 +/- 18 U/l for non-carriers (P = 0.79). However, among patients with hyperamylasemia, those with CFTR or SPINK-1 mutations had 648 +/- 216 U/l amylase levels compared with 232 +/- 28 U/l for those without (P = 0.025). Ten patients had acute pancreatitis, four of whom had CFTR mutations or SPINK-1 polymorphisms (40%) compared with seven of the control patients (14%) (P = 0.01). CONCLUSION: CFTR mutations and SPINK-1 polymorphisms are frequent among HIV-positive patients suffering from acute pancreatitis. These mutations may increase the susceptibility to pancreatitis when exposed to environmental risk factors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Samples were tested: (i) for 20 common CFTR mutations (delF508, 621+1G.T, G542X, 3849+10kbC.T, N1303K, 3659delC, 1717-1G.A, 1078delT, W1282X, R347P, G551D, A455E, R553X, S1251N, R1162X, delF507, R334W, 2183AA.G, R117H, and E60X; Elucigene CF20; Orchid Biosciences, Abingdon, UK); (ii) for the CFTR IVS8 5T variant (Elucigene CF Poly-T; Orchid); and (iii) for the SPINK-1 N34S polymorphism, by poly- Copyright (c) Lippincott Williams & Wilkins. Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment

[hide] Late diagnosis defines a unique population of long... Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10. Rodman DM, Polis JM, Heltshe SL, Sontag MK, Chacon C, Rodman RV, Brayshaw SJ, Huitt GA, Iseman MD, Saavedra MT, Taussig LM, Wagener JS, Accurso FJ, Nick JA
Late diagnosis defines a unique population of long-term survivors of cystic fibrosis.
Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10., 2005-03-15 [PMID:15591474]

Abstract [show]
Although the median survival for patients with cystic fibrosis (CF) is 32.9 years, a small group of patients live much longer. We analyzed the genotype and phenotype of CF patients 40 years and older seen between 1992 and 2004 at the National Jewish Medical and Research Center (n = 55). These patients were divided into two groups according to age at diagnosis: an early diagnosis (ED) group, median age at diagnosis 2.0 years (range 0.1-15 years, n = 28), and a late diagnosis (LD) group, median age of diagnosis 48.8 years (range 24-72.8 years, n = 27). Consistent with the hypothesis that the CFTR genotype affects the age at diagnosis, CFTR DeltaF508 homozygous individuals were more common in the ED group. Although patients in the ED group were predominantly male, the majority of LD patients were female. Patients with CF diagnosed late had a significantly lower prevalence of pancreatic insufficiency and CF-related diabetes, and better lung function. Fewer patients in the LD groups were infected with Pseudomonas aeruginosa, whereas a greater percentage had cultures positive for nontuberculous mycobacteria. This is the largest cohort of older patients with CF described to date, and our findings indicate that patients diagnosed as adults differ distinctly from survivors of long-term CF diagnosed as children.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 GENOTYPE DISTRIBUTION Early Diagnosis Late Diagnosis ⌬F508/⌬F508 10 1 ⌬F508/⌬I507 1 ⌬F508/G551D 1 ⌬F508/M1101K 1 ⌬F508/P67L/11027T 1 ⌬F508/3120G-A 1 ⌬F508/2789ϩ5G-A 1 2 ⌬F508/W1282X 1 ⌬F508/621ϩ1G-T 1 ⌬F508/R347P 1 ⌬F508/3849ϩ10kbC-T 1 1 ⌬F508/A455E 2 ⌬F508/R347H 2 ⌬F508/D1152H 1 ⌬508/I148T 1 ⌬F508/R117H 1 ⌬F508/Y109N 1 ⌬F508/IVS8-5T 1 ⌬F508/unknown 3 5 S1251N/D1152H 1 G542X/R117C 1 R117H/G551D 1 W1282X/D1152H 1 Unknown 4 4 Values represent number of individuals in each diagnostic group with each genotype. Login to comment

[hide] The CFTR 3849+10kbC->T and 2789+5G->A alleles are ... Eur Respir J. 2005 Mar;25(3):468-73. Dugueperoux I, De Braekeleer M
The CFTR 3849+10kbC->T and 2789+5G->A alleles are associated with a mild CF phenotype.
Eur Respir J. 2005 Mar;25(3):468-73., [PMID:15738290]

Abstract [show]
Most cystic fibrosis (CF) transmembrane receptor mutations are rare. The French CF Registry offers an opportunity to study the genotype-phenotype relationship of these rare alleles. Since 1992, 39 CF patients carrying one copy of the 3849+10kbC->T mutation and 88 the 2789+5G->A allele have been seen at least once in a CF care centre. Among them, 16 carrying the 3849+10kbC->T/Delta F508 genotype and 34 with the 2789+5G->A/Delta F508 genotype were seen in 2000. Their age at diagnosis, sweat chloride concentration, anthropometric and lung function results, and clinical aspects were compared with those homozygous for the Delta F508 mutation matched for sex, age and CF care centre. Major differences, most of them statistically significant, in the age at diagnosis, prevalence of pancreatic insufficiency, and other clinical signs, anthropometric and lung function measures were observed between both compound heterozygote groups and their matched Delta F508/Delta F508 groups. The mean sweat chloride concentration was also lower (close to normal values) among 3849+10kbC->T/Delta F508 patients, but not among 2789+5G->A/Delta F508 patients. In conclusion, both mutations studied here are associated with a milder course of cystic fibrosis disease. The 3849+10kbC->T and 2789+5G->A alleles are splice site mutations, leading to abnormal mRNA; however, a small amount of normally spliced transcripts can also be detected. The presence of these small amounts of normal cystic fibrosis transmembrane receptor protein in these cystic fibrosis patients is likely to be responsible for the milder severity of disease and a better life expectancy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Although only borderline significant, lung function was definitely better in the 3849+10kbC-.T/DF508 group (FEV1 83.0% and FVC 91.6% pred) than in the DF508 homozygote group (FEV1 59.9% TABLE 1 Genotypes identified among cystic fibrosis patients sharing the 3849+10kbC-.T or the 2789+5G-.A mutation Genotypes 3849+10kbC-.T 2789+5G-.A DI507 2 DF508 27 61 1525-1G-.A 1 1717-1G.A 1 2183AA.G 3 3129del4 1 3659delC 1 G542X 4 6 G551D 1 G970R 2 G1244E 2 L558S 1 M1V 1 N1303K 1 R347P 1 R553X 1 1 R1066C 1 S1251N 1 Unknown 1 6 Total 39 88 I. DUGUE´PE´ROUX AND M. DE BRAEKELEER MILD PHENOTYPE ASSOCIATED WITH TWO CFTR MUTATIONS c and FVC 76.9% pred). Login to comment

[hide] Pancreatitis among patients with cystic fibrosis: ... Pediatrics. 2005 Apr;115(4):e463-9. Epub 2005 Mar 16. De Boeck K, Weren M, Proesmans M, Kerem E
Pancreatitis among patients with cystic fibrosis: correlation with pancreatic status and genotype.
Pediatrics. 2005 Apr;115(4):e463-9. Epub 2005 Mar 16., [PMID:15772171]

Abstract [show]
OBJECTIVE: Pancreatitis is an infrequent complication among patients with cystic fibrosis (CF). It has mainly been reported for patients with pancreatic sufficiency (PS). Previous studies involved only a small number of patients because they contained data from single centers. The aim of this study was to evaluate the incidence of pancreatitis in a large heterogeneous CF population, to determine the relationship with pancreatic function, and to assess whether pancreatitis is associated with specific CFTR mutations. METHODS: Physicians caring for patients with CF were approached through the CF Thematic Network or through the European Cystic Fibrosis Foundation newsletter. They were asked to provide data on their current patient cohort through a standardized questionnaire and to report how many patients they had ever diagnosed as having pancreatitis. A detailed questionnaire was then sent, to be filled out for all of their patients for whom pancreatitis had ever occurred. We defined pancreatitis as an episode of acute abdominal pain associated with serum amylase levels elevated above the ranges established by each participating center's laboratory. General clinical data included age, genotype, age at diagnosis of CF, sweat chloride concentrations, pancreatic status, biometric findings, and respiratory status. CFTR mutations were also reported according to the functional classification of classes I to V. Patients were categorized as having PS, pancreatic insufficiency (PI), or PI after an initial period of PS. PI was defined as a 72-hour stool fat loss of >7 g/day, fat absorption of <93%, or fecal elastase levels of <200 microg/g feces. Clinical data on pancreatitis included age at the first episode, amylase and lipase levels, possible triggers, and occurrence of relapses or complications. RESULTS: A total of 10071 patients with CF, from 29 different countries, who were undergoing follow-up monitoring in 2002 were surveyed. Among this group, pancreatitis had ever been diagnosed for 125 patients (1.24%; 95% confidence interval [CI]: 1.02-1.46%). There was variability in the reported rates of pancreatitis for different countries. Twenty-six centers in 15 different countries sent detailed clinical data on their patients with pancreatitis and on their whole CF clinic. This involved 3306 patients with CF and 61 cases of pancreatitis, leading to a prevalence of 1.84% (95% CI: 1.39-2.30%). The mean age of the patients with pancreatitis ever was 24.4 years (SD: 10.8 years). The first episode of pancreatitis occurred at a mean age of 19.9 years (SD: 9.6 years). The median serum amylase level at the time of pancreatitis was 746 IU/L (interquartile range: 319-1630 IU/L), and the median lipase level was 577 IU/L (interquartile range: 229-1650 IU/L). The majority of patients had PS (34 of 61 patients, 56%; 95% CI: 43-68%). Pancreatitis occurred for 15 patients with PI (25%; 95% CI: 14-35%). Eight patients developed PI after initial PS. The occurrence of pancreatitis among patients with PS was 34 cases per 331 patients, ie, 10.27% (95% CI: 7.00-13.55%); the occurrence of pancreatitis among patients with PI was 15 cases per 2971 patients, ie, 0.5% (95% CI: 0.25-0.76%). The mean age (in 2002) of the CF cohort with pancreatitis did not differ between the PS and PI subgroups. The forced expiratory volume in 1 second was significantly lower among the patients with PI than among the patients with PS, ie, 65% (SEM: 7%) vs 79% (SEM: 4%). The mean age at the occurrence of pancreatitis and the amylase and lipase levels during pancreatitis were not different for patients with pancreatitis and PI versus PS. In the group with PS, 31 of 34 patients carried at least 1 class IV or V CFTR mutation. In the groups with PI and PI after PS, 5 of 15 patients and 3 of 8 patients, respectively, carried 2 class I, II, or III CFTR mutations. Relapses and/or evolution to chronic pancreatitis occurred for 42 patients. Pancreatitis preceded the diagnosis of CF in 18 of 61 cases. These patients were significantly older than the rest of the cohort, ie, age of 28.4 years (SEM: 3.4 years) vs 22.7 years (SEM: 1.3 years). Their median age at the diagnosis of CF was also significantly greater, ie, 21.5 years (interquartile range: 11.9-31 years) vs 7.6 years (interquartile range: 0.4-17.0 years). However, the ages at the occurrence of pancreatitis were similar, ie, 21.0 years (SEM: 3.0 years) vs 19.5 years (SEM: 1.2 years). CONCLUSIONS: This study of 10071 patients with CF from 29 different countries revealed an estimated overall occurrence of pancreatitis among patients with CF of 1.24% (95% CI: 1.02-1.46%). The incidence of pancreatitis was much higher among patients with PS. However, pancreatitis was also reported for 15 patients with PI from 11 centers in 9 different countries. A correct diagnosis of pancreatitis for the reported patients with PI was supported by amylase and lipase levels increased above 500 IU/L, similar to those for patients with PS and pancreatitis. A correct diagnosis of PI for these patients with pancreatitis was supported by the adequacy of the methods used. We chose the cutoff values used to distinguish between patients with PI and control subjects without gastrointestinal disease. For one half of the patients, the diagnosis of PI was established on the basis of low levels of stool elastase (mean: 97 mug/g stool). With a cutoff value of 200 microg/g stool, this noninvasive test has high sensitivity (>95%) and high specificity (>90%) to differentiate patients with PI from control subjects with normal pancreatic function. For the other one half of the patients with PI in the cohort, the pancreatic status was determined on the basis of the 3-day fecal fat balance, with the widely used cutoff value of >7 g of fat loss per day. The most likely reason for pancreatitis occurring among patients with PI is that some residual pancreatic tissue is present among these patients. Pancreatitis is a rare complication among patients with CF. It occurred for 1.24% (95% CI: 1.02-1.46%) of a large CF cohort. Pancreatitis occurs mainly during adolescence and young adulthood. It is much more common among patients with CF and PS (10.3%), but it can occur among patients with PI (0.5%). Pancreatitis can be the first manifestation of CF. Pancreatitis was reported for patients carrying a wide range of mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
187 S1251N is normally associated with PI3 but was included in the report by Durno et al13 as being associated with PS. Login to comment

[hide] Screening of mutations in the CFTR gene in 1195 co... Eur J Hum Genet. 2005 Aug;13(8):959-64. Stuppia L, Antonucci I, Binni F, Brandi A, Grifone N, Colosimo A, De Santo M, Gatta V, Gelli G, Guida V, Majore S, Calabrese G, Palka C, Ravani A, Rinaldi R, Tiboni GM, Ballone E, Venturoli A, Ferlini A, Torrente I, Grammatico P, Calzolari E, Dallapiccola B
Screening of mutations in the CFTR gene in 1195 couples entering assisted reproduction technique programs.
Eur J Hum Genet. 2005 Aug;13(8):959-64., [PMID:15870824]

Abstract [show]
Genetic testing of the cystic fibrosis transmembrane conductance (CFTR) gene is currently performed in couples undergoing assisted reproduction techniques (ART), because of the high prevalence of healthy carriers in the population and the pathogenic relationship with congenital bilateral absence of vas deferens (CBAVD). However, discordant data have been reported concerning the usefulness of this genetic test in couples with no family history of cystic fibrosis (CF). In this study, we report the results of CFTR molecular screening in 1195 couples entering ART. Genetic testing was initially carried out in a single partner of each couple. CFTR mutations were detected in 55 subjects (4.6%), a percentage that overlaps with the one reported in the general population. However, significantly higher frequencies of were found in CBAVD individuals (37.5%) and in males with nonobstructive azoospermia (6.6%). The 5T allele was found in 78 patients (6.5%). This figure was again significantly different in males with nonobstructive-azoospermia (9.9%) and in those with CBAVD (100%). All together, 139 subjects (11.6%) had either a CFTR mutation or the 5T allele. Subsequent molecular analysis of their partners disclosed a CFTR mutation or 5T allele in nine cases (6.5%). However, none of these couples had CFTR alterations in both members, a CFTR mutation being invariably present in one partner and the 5T allele in the other. In order to improve genetic counselling of these couples, the TG-M470V-5T association was analyzed, and a statistically significant relationship between 12TG-V470 and CBAVD was detected.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 of detected carriers Prevalence among detected CFTR mutations DF508 40 (3.34%) 65.58% DI507 0 0 G542X 6 (0.50%) 9.84% 1717-1G-A 1 (0.08%) 1.64% G551D 0 0 R553X 0 0 R560T 0 0 Q552X 0 0 W1282X 7 (0.58 %) 11.48% S1251N 0 0 N1303K 3 (0.20%) 4.91% 394delTT 0 0 G85E 3 (0.25%) 4.91% E60X 0 0 621+1G-T 0 0 R117H 0 0 1078delT 0 0 R347P 0 0 R334W 0 0 2143delT 0 0 2183AA-G 0 0 2184delA 0 0 711+5G-A 0 0 2789+5G-A 1 (0.08%) 1.64% R1162X 0 0 3659del5 0 0 3849+10kbC-T 0 0 A455E 0 0 5T 78 (6.52%) Table 2 Distribution of CFTR mutations and 5T allele according to phenotype for the 1195 individuals Phenotype CF/WT 5T/WT CF/5T WT/WT Infertile males (non-CBAVD), N ¼ 304 20 (6.58%) 30 (9.87%) 0 254 (83.55%) Infertile males (CBAVD), N ¼ 16 0 10 (62.50%) 6 (37.50 %) 0 Infertile females, N ¼ 93 5 (5.37%) 7 (7.53%) 0 81 (87.10%) Unexplained infertility, N ¼ 782 30 (3.84%) 31 (3.96%) 0 721 (92.20%) Total ¼ 1195 55 (4.60%) 78 (5.50%) 6 (0.50%) 1056 (88.40%) CFTR alteration was detected, including a mutation in three cases and the 5T polymorphism in the remaining six. Login to comment

[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 In effect, virtually no func- Table 2 Unusually Common Cystic Fibrosis Mutations in Specific Populationsa Total Exon/ Number Number Frequency Mutation Intron Ethnic Origin Observed Screened (%) 296+12T→C intron 02 Pakistani 02 24 8.33 E60X exon 03 Belgian 06 394 1.52 G91R exon 03 French 04 266 1.50 394delTT exon 03 Scandinavian 78 1588 4.91 457TAT→G exon 04 Austrian 04 334 1.20 Y122X exon 04 Réunion Island 14 29 48.27 I148T exon 04 French Canadian 06 66 9.09 711+5G→A intron 05 Italian (North East) 06 225 2.67 1078delT exon 07 Celtic 27 475 5.68 1161delC exon 07 Pakistani 02 24 8.33 T338I exon 07 Italian, Sardinian 04 86 4.65 Q359K/T360K exon 07 Georgian Jews 07 8 87.50 R347H exon 07 Turkish 04 134 2.98 1609delCA exon 10 Spanish 03 96 3.12 1677delTA exon 10 Bulgarian 05 222 2.25 S549I exon 11 Arabs 02 40 5.00 Q552X exon 11 Italian (North East) 03 225 1.33 A559T exon 11 African-American 02 79 2.53 1811+1.2kbA→G intron 11 Spanish 22 1068 2.06 1898+5G→T intron 12 Chinese 03 10 30.00 1949del84 exon 13 Spanish 02 136 1.47 2143delT exon 13 Russian 04 118 3.39 2183AA→G exon 13 Italian (North East) 21 225 9.33 2184insA exon 13 Russian 03 118 2.54 3120+1G→A intron 16 African-American 14 112 12.50 3272-26A→G intron 17a Portugese, French 06 386 1.55 R1066C exon 17b Portugese 05 105 4.76 R1070Q exon 17b Bulgarian 04 166 2.41 Y1092X exon 17b French Canadian, 11 725 1.52 French M1101K exon 17b Hutterite 22 32 68.75 3821delT exon 19 Russian 03 118 2.54 S1235R exon 19 French (South) 04 340 1.18 S1251N exon 20 Dutch, Belgian 11 792 1.39 S1255X exon 20 African-American 02 79 2.53 3905insT exon 20 Swiss 45 982 4.58 Amish, Arcadian 13 86 15.12 W1282X Exon 20 Jewish-Ashkenazi 50 95 52.63 R1283M exon 20 Welsh 03 183 1.64 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/. Login to comment
67 SSCP analysis is one of the most popular methods for the detection of sequence variants in polymerase chain reaction (PCR) amplified DNA fragments.29 The princi- Table 3 Cystic Fibrosis Mutations Detected by Commercial Kits INNO-LiPA Mutations CF2 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K CFTR12 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K, S1251N, R560T, 3905insT, Q552X CFTR17+Tn 394delTT, G85E, 621+1G→T, R117H, 1078delT, R347P, R334W, E60X, 2183AA→G, 2184delA, 711+5G→A, 2789+5G→A, R1162X, 3659delC, 3849+10kbC→T, 2143delT, A455E, (5T/7T/9T) Elucigene CF4 ⌬F508, G542X, G551D, 621+1G→T CF12 ⌬F508, G542X, G551D, N1303K, W1282X, 1717-1G→A, R553X, 621+1G→T, R117H, R1162X, 3849+10kbC→T, R334W CF20 1717-1G→A, G542X, W1282X, N1303K, ⌬F508, 3849+10kbC→T, 621+1G→T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA→G, 3659delC, 1078delT, ⌬I507, R345P, S1251N, E60X CF Poly-T 5T/7T/9T OLA CF OLA assay ⌬F508, F508C, ⌬I507, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183AA→G, 2789+5G→A b Figure 2 Mutation screening of exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene using polymerase chain reaction (PCR) followed by single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis on a silver-stained polyacrylamide gel. Login to comment

[hide] Combining immunoreactive trypsinogen and pancreati... J Pediatr. 2005 Sep;147(3):302-5. Sarles J, Berthezene P, Le Louarn C, Somma C, Perini JM, Catheline M, Mirallie S, Luzet K, Roussey M, Farriaux JP, Berthelot J, Dagorn JC
Combining immunoreactive trypsinogen and pancreatitis-associated protein assays, a method of newborn screening for cystic fibrosis that avoids DNA analysis.
J Pediatr. 2005 Sep;147(3):302-5., [PMID:16182665]

Abstract [show]
OBJECTIVES: To evaluate the performance of a strategy in which, after immunoreactive trypsinogen (IRT) determination, genetic analysis is replaced by a biological test, the pancreatitis-associated protein (PAP) enzyme-linked immunosorbent assay (ELISA). STUDY DESIGN: The French newborn screening program includes cystic fibrosis (CF) screening by the IRT/CFTR mutation strategy. PAP was assayed on screening cards, in parallel with IRT, in all newborns from 5 French regions (n = 204,749). Analysis of PAP values in CF and non-CF newborns with elevated IRT allowed direct comparison between the current strategy and the proposed IRT/PAP strategy. RESULTS: A protocol in which newborns with IRT >50 ng/mL and PAP >1.8 ng/mL and those with IRT >100 ng/mL and PAP >1.0 ng/mL are directly recalled for sweat testing would have the same performance as the IRT/CFTR mutation strategy. CONCLUSIONS: The IRT/PAP strategy is an alternative for CF newborn screening, which avoids the drawbacks of genetic analysis and is cheaper and easier to implement than the current IRT/CFTR mutation strategy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Among the 48 babies screened as having CF, 43 presented with symptoms compatible with CF or abnormal sweat test results ($60 mEq/L), but 5 were classified as having a borderline form of CF because they exhibited no symptoms, had normal sweat test results (<60 mEq/L), and mild mutations [R117H, TG12-T5(IVS8), S1251N, L997F, R347H], and they did not evolve toward CF status (appearance of clinical symptoms or elevation of sweat test) after more than 1 year of follow-up. Login to comment

[hide] Mutations of the CFTR gene in idiopathic pancreati... Pancreas. 2005 Nov;31(4):350-2. Gullo L, Mantovani V, Manca M, Migliori M, Bastagli L, Pezzilli R
Mutations of the CFTR gene in idiopathic pancreatic hyperenzymemia.
Pancreas. 2005 Nov;31(4):350-2., [PMID:16258369]

Abstract [show]
OBJECTIVES: Idiopathic pancreatic hyperenzymemia is a new syndrome that is characterized by a chronic increase of serum pancreatic enzymes in the absence of pancreatic disease. The aim of this study was to assess whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene may have a role in the etiology of this hyperenzymemia. METHODS: Seventy subjects with idiopathic pancreatic hyperenzymemia, 44 men and 26 women (mean age, 48 years; range, 8-74 years), were studied. Thirteen of these 70 subjects had the familial form of the syndrome. The mutation analysis of the CFTR gene was carried out using diagnostic commercial kits for the simultaneous detection of 29 mutations and Tn polymorphism. RESULTS: Among the 70 subjects studied, 7 (10.0%) had CFTR gene mutations. None of these 7 subjects had the familial form of pancreatic hyperenzymemia. These mutations were DeltaF 508 in 1 subject, 2789 + 5 G > A in another subject, and T5 allele in the remaining 5. All these mutations were heterozygous, with the exception of 1 T5 allele that was homozygous in 1 subject. CONCLUSIONS: The frequencies of the mutations of the CFTR gene found in these subjects are similar to the carrier frequencies in the general Italian population. This finding does not support a role for CFTR gene mutations in the etiology of idiopathic pancreatic hyperenzymemia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 T (i) 19 3905insT, W1282X, S1251N 20 N1303K 21 TABLE 2. Login to comment

[hide] Analysis of CFTR, SPINK1, PRSS1 and AAT mutations ... J Pediatr Gastroenterol Nutr. 2006 Sep;43(3):299-306. Sobczynska-Tomaszewska A, Bak D, Oralewska B, Oracz G, Norek A, Czerska K, Mazurczak T, Teisseyre M, Socha J, Zagulski M, Bal J
Analysis of CFTR, SPINK1, PRSS1 and AAT mutations in children with acute or chronic pancreatitis.
J Pediatr Gastroenterol Nutr. 2006 Sep;43(3):299-306., [PMID:16954950]

Abstract [show]
OBJECTIVES: Defects of PRSS1, SPINK1, CFTR and AAT are considered causative or predisposing to pancreatitis. The aim of this study was to evaluate the impact of these defects into molecular pathology of chronic pancreatitis (CP) and acute recurrent pancreatitis (ARP). METHODS: Ninety-two children with CP or ARP, 55 family members and 50 controls were investigated. The subjects were screened for PRSS1 mutations: R122H, R122C, A16V, N29I; SPINK1 N34S variant; panel of 14 CFTR defects: INNOLiPA CFTR12, CFTRdele2,3 and IVS8-T variant or panel of 3 CFTR defects-F508del, CFTRdele2,3 and IVS8-T; AAT mutations: E264V, E342K. RESULTS: We identified 1 mutated allele in at least 1 of 4 genes in 31 of 92 patients and 12 of 50 controls (P = 0.157). Mutations in SPINK1 and PRSS1 were most frequent. PRSS1 mutations were identified mainly in CP patients (9.6% of CP vs 2.5% of ARP alleles, P = 0.094), whereas N34S SPINK1 mutation was present with comparable frequency in CP and ARP patients (7.7% vs 10.0%, P = 0.768). The frequency of mutations in CFTR alleles was similar to controls (4.9% vs 5%, P = 0.587). Overall frequency of AAT mutations was lower than in the controls. Family studies showed that defects in the examined genes did not always segregate with disease. CONCLUSIONS: PRSS1 defects seem to be causative for pancreatitis, whereas defects in SPINK1 are suggested to be associated with the disease. No association between CFTR mutations and pancreatitis was observed. The importance of AAT variants remains speculative.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 For the first 50 patients enrolled in this study, the CFTR mutations F508del, G542X, G551D, R553X, N1303K, W1282X, 1717-1G/A, I507del, S1251N, R560T, 3905insT, Q552X (INNO-LiPA CFTR12, Innogenetics, Gent, Belgium), CFTRdele2,3 (16) and polyT variant in intron 8 (IVS8-T) (17) were analyzed. Login to comment

[hide] Analysis of cystic fibrosis gene mutations and ass... Genet Test. 2007 Summer;11(2):133-8. Knezevic J, Tanackovic G, Matijevic T, Barisic I, Pavelic J
Analysis of cystic fibrosis gene mutations and associated haplotypes in the Croatian population.
Genet Test. 2007 Summer;11(2):133-8., [PMID:17627383]

Abstract [show]
The aim of this study was to reveal the CFTR gene mutation status in the Croatian population as well as to establish the haplotypes associated with cystic fibrosis (CF) and those associated with specific gene mutations. A total of 48 unrelated CF patients from Croatia were examined. Among 96 tested alleles, we found nine different mutations: DeltaF508, 58.33%; G542X, 3.12%; N1303K, 2.08%; R1162X; 621 + 1G --> T; G85E; Y569C; E585X; and S466X, 1.04%. Analysis of three polymorphic loci revealed 15 different haplotypes. Two of them (21-23-13 and 21-17-13) occurred with a higher frequency (40% and 24%). Both of these haplotypes also carried a CFTR gene mutation (DeltaF508 or G542X) on 27 out of 32 chromosomes. Among 12 (of all together 29) CF alleles on which no mutations were found, we detected 10 different haplotypes. Because there are still no published data on the distribution of polymorphic loci in Croatia, nor haplotypes associated with mutations in the CFTR gene, our results greatly contribute to knowledge regarding the genetic background of CF in this region.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 INNOGENETICS INNO-LIPA CFTR 12 and INNO-LIPA CFTR 7 ϩ Tn diagnostic kits were used to assess the presence of the 29 mutations in CF patients; ⌬F508, ⌬I507, G542X, N1303K, 1717-1G Ǟ A, W1282X, G551D, R553X, S1251N, R560T, 3905insT, Q552X, 394delTT, G85E, E60X, 621 ϩ 1G Ǟ T, R117H, 1078delT, R347P, R334W, 2143delT, 2183AA Ǟ G, 2184delA, 711 ϩ 5G Ǟ A, 2789 ϩ 5G Ǟ A, R1162X, 3659delC, 3849 ϩ 10kbC Ǟ T, and A455E. Login to comment

[hide] Negative genetic neonatal screening for cystic fib... Clin Genet. 2007 Oct;72(4):374-7. Girardet A, Guittard C, Altieri JP, Templin C, Stremler N, Beroud C, des Georges M, Claustres M
Negative genetic neonatal screening for cystic fibrosis caused by compound heterozygosity for two large CFTR rearrangements.
Clin Genet. 2007 Oct;72(4):374-7., [PMID:17850636]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 If IRT at day 3 is positive (.65 ng/ml), the card is subjected to an ARMS Elucigen kit (Tepnel) testing for 30 common CF mutations (F508del, Y1092X, 1717-1G.A, G542X, W1282X, N1303K, 3849110kbC.T, 394delTT, 62111G.T, S1251N, G551D, R117H, R1162X, R334W, A455E, 2183AA.G, 3659delC, 1078delT, I507del, R347P, R553X, E60X, 1 8 1 1 11 . Login to comment

[hide] Serum zinc concentrations in cystic fibrosis patie... Biol Trace Elem Res. 2007 Oct;119(1):19-26. Van Biervliet S, Van Biervliet JP, Vande Velde S, Robberecht E
Serum zinc concentrations in cystic fibrosis patients aged above 4 years: a cross-sectional evaluation.
Biol Trace Elem Res. 2007 Oct;119(1):19-26., [PMID:17914215]

Abstract [show]
AIM: Assess the risk of zinc (Zn) deficiency in the older cystic fibrosis (CF) population. METHOD: Cross-sectional investigation of all CF patients above the age of 4 followed at the Ghent University center between 2002 and 2003. Data on age, weight, height z-score, pancreatic and pulmonary functions, chronic Pseudomonas infection, and CF transmembrane conductance regulator (CFTR) mutations were collected. Serum Zn, vitamins (vit) A and E, retinol-binding protein (RBP), albumin, sedimentation rate, total IgG, and cholesterol were determined. Serum Zn was compared with a local healthy control group (Van Biervliet et al., Biol Trace Elem Res 94:33-40, 2003) and with literature data (Hotz C, et al. Am J Clin Nutr 78:756-764, 2003). RESULTS: 101 patients (median age 16 years) were included. There was no difference in serum Zn concentration between CF patients and controls. In CF patients no difference in serum Zn concentration between pancreatic-sufficient or pancreatic-insufficient patients was seen. Serum Zn was not associated to nutritional status or height z-score. A significant association serum Zn to serum albumin (p < 0.0005) and to vit A (p < 0.01) was seen. No associations of serum Zn to serum vit E, RBP, cholesterol, or CFTR were present, but there is a significant association serum Zn to forced vital capacity (p < 0.01). Serum Zn was not associated to inflammatory parameters or chronic Pseudomonas infection. CONCLUSION: Comparison of CF patients with local controls revealed no significant differences. However, because persisting steatorrhea increases Zn loss (Easley et al., J Pediatr Gastroenterol Nutr 26:136-139, 1998) and 12.6% of our population has a serum Zn below the p value of 2.5 of the NHANES II study (Hotz C, et al. Am J Clin Nutr 78:756-764, 2003), there could remain an increased risk of Zn deficiency in some CF patients. Furthermore, the association with pulmonary function needs more investigation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 Table 1 Genotype of the 101 CF Patients: Details of the CF Mutations and Classification into Two Groups Genotype Groups Genotype No of Patients A ΔF508/ΔF508 47 ΔF508/E60X 1 ΔF508/G542X 7 ΔF508/N1303K 3 ΔF508/Q493X 1 ΔF508/1717-1G→A 1 ΔF508/Y1092X 1 ΔF508/394delTT 1 ΔF508/R785X 1 ΔF508/R553X 1 ΔF508/ΔI507 1 394delTT/394delTT 1 N1303K/N1303K 2 B ΔF508/3849+10kbC-T 1 ΔF508/306ΔTAGA 1 ΔF508/S1251N 8 ΔF508/L927P 1 G458V/1717-1G→A 1 ΔF508/I336K 2 G542X/622-2 A→C 1 ΔF508/G970R 3 ΔF508/3272-26A→G 2 ΔF508/R117H 2 ΔF508/2789+5G→A 2 1717-1G->A/S1251N 1 G542X/G970R 1 394delTT/Y913C 1 N1303K/deletion exon 19 1 Unidentified/unidentified 2 3600+2insTA/2005 del T 1 ΔF508/1898+1G→A 1 Deletion exon 2/del exon 2 1 There was no difference according to gender or age. Login to comment

[hide] Aquagenic wrinkling of the palms in cystic fibrosi... Arch Dermatol. 2009 Nov;145(11):1296-9. Berk DR, Ciliberto HM, Sweet SC, Ferkol TW, Bayliss SJ
Aquagenic wrinkling of the palms in cystic fibrosis: comparison with controls and genotype-phenotype correlations.
Arch Dermatol. 2009 Nov;145(11):1296-9., [PMID:19917960]

Abstract [show]
OBJECTIVE: To determine the prevalence of aquagenic wrinkling of the palms (AWP) in patients with cystic fibrosis (CF) compared with control patients, and evaluate for genotype-phenotype correlations. Since its first description over 30 years ago, AWP has frequently been anecdotally associated with CF, but this association has not been confirmed in a rigorous prospective case-control study. DESIGN: Blinded comparison. SETTING: The CF and dermatology clinics at St Louis Children's Hospital. PARTICIPANTS: Forty-four individuals with CF from a CF clinic and 26 controls from a dermatology clinic. Intervention Participants were tested for AWP using 3 minutes of water immersion with room-temperature tap water. Main Outcome Measure The degree of AWP was scored from 0 (no wrinkling) to 4 (severe wrinkling) by 3 blinded physicians. For genotype-phenotype correlations, patients with CF were divided into those homozygous for the DeltaF508 mutation and those with other genotypes. RESULTS: The mean AWP score of the CF group was significantly higher than the mean score of the control group (1.5 vs 0.6; P < .001). Patients with CF who were homozygous for the DeltaF508 mutation (n = 27) had significantly higher scores than patients with CF who were not homozygous for the DeltaF508 mutation (n = 17) (1.7 vs 1.1; P = .02). The 17 patients with CF who were not homozygous for the DeltaF508 mutation still had higher scores than the control group (1.1 vs 0.6; P = .03). There was no correlation between sweat chloride concentrations measured at the time of diagnosis and AWP score. CONCLUSIONS: Our results confirm the association between AWP and CF. Among patients with CF, greater AWP occurs in those who are homozygous for the DeltaF508 mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 (%) 12 (46) 23 (52) Mean age, y 9.3 11.5 CFTR genotype NA ⌬F508/⌬F508 27 ⌬F508/unidentified 4 ⌬F508/R553X 2 ⌬F508/1898 ϩ 1G ~ A 2 ⌬F508/G542X 1 ⌬F508/G551D 1 ⌬F508/W1282X 1 ⌬F508/1717 ϩ 1G ~ A 1 ⌬F508/3120 ϩ 1G ~ A 1 ⌬F508/3849 ϩ 10KBC→T 1 ⌬F508/S1251N 1 R560T/unidentified 1 2184insA/4357 2A→G 1 Abbreviations: CF, cystic fibrosis; NA, not applicable. Login to comment
59 (%) 12 (46) 23 (52) Mean age, y 9.3 11.5 CFTR genotype NA ⌬F508/⌬F508 27 ⌬F508/unidentified 4 ⌬F508/R553X 2 ⌬F508/1898 ϩ 1G ~ A 2 ⌬F508/G542X 1 ⌬F508/G551D 1 ⌬F508/W1282X 1 ⌬F508/1717 ϩ 1G ~ A 1 ⌬F508/3120 ϩ 1G ~ A 1 ⌬F508/3849 ϩ 10KBC→T 1 ⌬F508/S1251N 1 R560T/unidentified 1 2184insA/4357 2A→G 1 Abbreviations: CF, cystic fibrosis; NA, not applicable. Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

[hide] Identification of the second CFTR mutation in pati... Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26. Giuliani R, Antonucci I, Torrente I, Grammatico P, Palka G, Stuppia L
Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols.
Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26., [PMID:20657600]

Abstract [show]
Congenital bilateral absence of vas deferens (CBAVD) is a manifestation of the mildest form of cystic fibrosis (CF) and is characterized by obstructive azoospermia in otherwise healthy patients. Owing to the availability of assisted reproductive technology, CBAVD patients can father children. These fathers are at risk of transmitting a mutated allele of the CF transmembrane conductance regulator (CFTR) gene, responsible for CF, to their offspring. The identification of mutations in both CFTR alleles in CBAVD patients is a crucial requirement for calculating the risk of producing a child with full-blown CF if the female partner is a healthy CF carrier. However, in the majority of CBAVD patients, conventional mutation screening is not able to detect mutations in both CFTR alleles, and this difficulty hampers the execution of correct genetic counselling. To obtain information about the most represented CFTR mutations in CBAVD patients, we analysed 23 CBAVD patients, 15 of whom had a single CFTR mutation after screening for 36 mutations and the 5T allele. The search for the second CFTR mutation in these cases was performed by using a triplex approach: (i) first, a reverse dot-blot analysis was performed to detect mutations with regional impact; (ii) next, multiple ligation-dependent probe amplification assays were conducted to search for large rearrangements; and (iii) finally, denaturing high-performance liquid chromatography was used to search for point mutations in the entire coding region. Using these approaches, the second CFTR mutation was detected in six patients, which increased the final detection rate to 60.8%.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] A new complex allele of the CFTR gene partially ex... Genet Med. 2010 Sep;12(9):548-55. Lucarelli M, Narzi L, Pierandrei S, Bruno SM, Stamato A, d'Avanzo M, Strom R, Quattrucci S
A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation.
Genet Med. 2010 Sep;12(9):548-55., [PMID:20706124]

Abstract [show]
PURPOSE: To evaluate the role of complex alleles, with two or more mutations in cis position, of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in the definition of the genotype-phenotype relationship in cystic fibrosis (CF), and to evaluate the functional significance of the highly controversial L997F CFTR mutation. METHODS: We evaluated the diagnosis of CF or CFTR-related disorders in 12 unrelated subjects with highly variable phenotypes. According to a first CFTR mutational analysis, subjects appeared to be compound heterozygotes for a classic mutation and the L997F mutation. A further CFTR mutational analysis was conducted by means of a protocol of extended sequencing, particularly suited to the detection of complex alleles. RESULTS: We detected a new [R117L; L997F] CFTR complex allele in the four subjects with the highest sweat test values and CF. The eight subjects without the complex allele showed the most varied biochemical and clinical outcome and were diagnosed as having mild CF, CFTR-related disorders, or even no disease. CONCLUSIONS: The new complex allele partially explains the variable phenotype in CF subjects with the L997F mutation. CFTR complex alleles are likely to have a role in the definition of the genotype-phenotype relationship in CF. Whenever apparently identical CFTR-mutated genotypes are found in subjects with divergent phenotypes, an extensive mutational search is mandatory.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 In vivo findings and, in some cases, in vitro functional characterizations have been reported for [F508C; S1251N],38 [R347H; D979A],39,40 [R74W; D1270N],41 [G628R; S1235R],42,43 [M470V; S1235R],42 [S912L; G1244V],44 [R117H; (TG)mTn],45-47 [R117C; (TG)mTn],46 [S1235R; (TG)mT5],48 [G576A; R668C],10,49 [V562I; A1006E],49 [R352W; P750L],49 [1198_1203del TGGGCT; 1204GϾA],49 [V754M; CFTRdele3_10,14b_16],50 and [F508del; I1027T].51 These complex alleles have been found in patients with either CF or CFTR-RD, although more often in the former. Login to comment

[hide] Initial evaluation of a biochemical cystic fibrosi... J Inherit Metab Dis. 2010 Oct;33(Suppl 2):S263-71. Epub 2010 Aug 17. Sommerburg O, Lindner M, Muckenthaler M, Kohlmueller D, Leible S, Feneberg R, Kulozik AE, Mall MA, Hoffmann GF
Initial evaluation of a biochemical cystic fibrosis newborn screening by sequential analysis of immunoreactive trypsinogen and pancreatitis-associated protein (IRT/PAP) as a strategy that does not involve DNA testing in a Northern European population.
J Inherit Metab Dis. 2010 Oct;33(Suppl 2):S263-71. Epub 2010 Aug 17., [PMID:20714932]

Abstract [show]
BACKGROUND: Ethical concerns and disadvantages of newborn screening (NBS) for cystic fibrosis (CF) related to genetic testing have raised controversies and impeded implementation of CF NBS in some countries. In the present study, we used a prospective and sequential immunoreactive trypsinogene (IRT)/pancreatitis-associated protein (PAP) strategy, with IRT as first and PAP as second tier, and validated this biochemical approach against the widely used IRT/DNA protocol in a population-based NBS study in southwest Germany. METHODS: Prospective quantitation of PAP and genetic analysis for the presence of four mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene most prevalent in southwest Germany (F508del, R553X, G551D, G542X) were performed in all newborns with IRT > 99.0th percentile. NBS was rated positive when either PAP was >/=1.0 ng/mL and/or at least one CFTR mutation was detected. In addition, IRT > 99.9th percentile was also considered a positive rating. Positive rating led to referral to a CF centre for testing of sweat Cl(-) concentration. FINDINGS: Out of 73,759 newborns tested, 98 (0.13%) were positive with IRT/PAP and 56 (0.08%) with IRT/DNA. After sweat testing of 135 CF NBS-positive infants, 13 were diagnosed with CF. Detection rates were similar for both IRT/PAP and IRT/DNA. One of the 13 diagnosed CF newborns had a PAP concentration <1.0 ng/mL. CONCLUSIONS: Sequential measurement of IRT/PAP provides good sensitivity and specificity and allows reliable and cost-effective CF NBS which circumvents the necessity of genetic testing with its inherent ethical problems.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
110 In the second column, the results for both screening strategies are given CF patient True result for PAP/DNA Meconium ileus IRT (ng/ml) PAP (ng/ml) initial DNA result Age at referral (weeks) Mean of sweat Cl- measures (mmol/l) Age at diagnosis (weeks) Subsequent investigation Further DNA analysis 1 FN/FN No 36.0 n.d. n.d. 10 84 12 No special F508del/S1251N 2 TP/TP No 95.5 2.56 F508del/G542X 5 84 6 No special n.d. 3 TP/TP No 132.5 5.81 F508del/ - 4 95 5 No special n.d.a 4 TP/FN No 152.5 2.70 - / - 8b 44 10 ICMc CFTRdele2,3/ - c 5 TP/TP No 204.0 1.00 F508del/G551D 6 95 6 No special n.d. 6 TP/TP Yes 245.0 1.00 F508del/F508del - n.d.d 1 No special n.d. 7 TP/TP No 220.5 1.70 F508del/F508del 8b 82 10 No special n.d. 8 FN/FN No 139.0 0.95 - / - 15b 93 16 No special N1303K/R709X 9 TP/TP Yes 197.5 1.20 F508del/F508del - n.d.d 1 No special n.d. 10 TP/TP Yes 143.5 1.10 F508del/F508del - 92 1 No special n.d. 11 TP/TP No 114.0 1.45 F508del/ - 7b 116 7 No special F508del/p.Q552X 12 TP/TP No 174.5 2.60 F508del/F508del 4 88 5 No special n.d. 13 TP/TP Yes 81 1.30 F508del/F508del 1 n.d.d 1 No special n.d. 14 TP/FN No 198.5 9.45 - / - 8b 103 8 No special CFTRdele2,3/ E664X PAP IRT/PAP strategy, DNA IRT/DNA strategy, TP true positive, FN false negative a Further DNA analysis was not performed in the local CF centre after the health insurance of the patient refused to pay for further DNA analysis. Login to comment
144 Subsequent CFTR mutation analysis demonstrated that this patient was compound heterozygous for two disease-causing mutations (F508del and IRT/PAP positive 98 IRT/DNA positve 56 CF-Patients found 13 10 1 2 0 non-CF carriers 35 3 32 78 5 6 Fig. 4 Venn diagram illustrating infants who tested positive with IRT/ PAP and/or IRT/DNA, the distribution of the infants diagnosed with CF, and the distribution of non-CF carriers S1251N) and is therefore expected to develop a classical CF phenotype (Kalin et al. 1992). Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Distribution of CFTR mutations in Eastern Hungaria... J Cyst Fibros. 2011 May;10(3):217-20. doi: 10.1016/j.jcf.2010.12.009. Epub 2011 Feb 4. Ivady G, Madar L, Nagy B, Gonczi F, Ajzner E, Dzsudzsak E, Dvorakova L, Gombos E, Kappelmayer J, Macek M Jr, Balogh I
Distribution of CFTR mutations in Eastern Hungarians: relevance to genetic testing and to the introduction of newborn screening for cystic fibrosis.
J Cyst Fibros. 2011 May;10(3):217-20. doi: 10.1016/j.jcf.2010.12.009. Epub 2011 Feb 4., [PMID:21296036]

Abstract [show]
BACKGROUND: The aim of this study was characterization of an updated distribution of CFTR mutations in a representative cohort of 40 CF patients with the classical form of the disease drawn from Eastern Hungary. Due to the homogeneity of the Hungarian population our data are generally applicable to other regions of the country, including the sizeable diaspora. METHODS: We utilized the recommended "cascade" CFTR mutation screening approach, initially using a commercial assay, followed by examination of the common "Slavic" deletion CFTRdele2,3(21kb). Subsequently, the entire CFTR coding region of the CFTR gene was sequenced in patients with yet unidentified mutations. RESULTS: The Elucigene CF29(Tm) v2 assay detected 81.25% of all CF causing mutations. An addition of the CFTRdele2,3(21kb) increased the mutation detection rate to 86.25%. DNA sequencing enabled us to identify mutations on 79/80 CF alleles. Mutations [CFTRdele2,3(21kb), p.Gln685ThrfsX4 (2184insA) were found at an unusually high frequency, each comprising 5.00% of all CF alleles. CONCLUSION: We have identified common CF causing mutations in the Hungarian population with the most common mutations (p.Phe508del, p.Asn1303Lys, CFTRdele2,3(21kb), 2184insA, p.Gly542X, and p.Leu101X), comprising over 93.75% of all CF alleles. Obtained data are applicable to the improvement of DNA diagnostics in Hungary and beyond, and are the necessary prerequisite for the introduction of a nationwide "two tier" CF newborn screening program.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 The Elucigene CF29Tm v2 Kit is capable of detecting the following mutations: p.Asp1152His (c.3454 GNC), c.1585-1 GNA, p.Gly542X (c.1624 GNT), p.Trp1282X (c.3846 GNA), p.Asn1303Lys (c.3909 C NG), p.Phe508del (c.1521_ 1523delCTT), c.3717+12191 CNT, p.Leu88IlefsX22 (c.262_ 263delTT), c.489+1 GNT, p.Ser1251Asn (c.3752 GNA), p.Gly551Asp (c.1652 GNA), p.Arg117His (c.350 GNA), p.Arg1162X (c.3484 CNT), p.Arg334Trp (c.1000 CNT), p.Ala455Glu (c.1364 CNA), p.Lys684SerfsX38 (c.2051_ 2052delAAinsG), p.Lys1177SerfsX15 (c. Login to comment

[hide] Validation of double gradient denaturing gradient ... Clin Chem. 1999 Jan;45(1):35-40. Cremonesi L, Carrera P, Fumagalli A, Lucchiari S, Cardillo E, Ferrari M, Righetti SC, Zunino F, Righetti PG, Gelfi C
Validation of double gradient denaturing gradient gel electrophoresis through multigenic retrospective analysis.
Clin Chem. 1999 Jan;45(1):35-40., [PMID:9895335]

Abstract [show]
Among established techniques for the identification of either known or new mutations, denaturing gradient gel electrophoresis (DGGE) is one of the most effective. However, conventional DGGE is affected by major drawbacks that limit its routine application: the different denaturant gradient ranges and migration times required for different DNA fragments. We developed a modified version of DGGE for high-throughput mutational analysis, double gradient DGGE (DG-DGGE), by superimposing a porous gradient over the denaturant gradient, which maintains the zone-sharpening effect even during lengthy analyses. Because of this innovation, DG-DGGE achieves the double goals of retaining full effectiveness in the detection of mutations while allowing identical run time conditions for all fragments analyzed. Here we use retrospective analysis of a large number of well-characterized mutations and polymorphisms, spanning all predicted melting domains and the whole genomic sequence of three different genes--the cystic fibrosis transmembrane conductance regulator (CFTR), the beta-globin, and the p53 genes--to demonstrate that DG-DGGE may be applied to the rapid scanning of any sequence variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Mutations and polymorphisms analyzed in the CFTR gene. Position Denaturant gradient Mutation Exon 1 40-90% 125G/Ca,b M1V (A3G at 133) 175insT 182delT Exon 3 10-60% W57G (T3G at 301) 356G/Aa G85E (G3A at 386) Exon 4 20-70% R117H (G3A at 482) 541delC 621ϩ1G3T I148T (T3C at 575) Exon 5 20-70% E193K (G3A at 709) Intron 5 20-70% 711ϩ3A3G Exon 7 20-70% 1078delT R334W (C3T at 1132) T338I (C3T at 1145) R347P (G3C at 1172)b R347H (G3A at 1172) R352Q (G3A at 1187) Exon 10 20-70% M470V (1540A/G)a ⌬F508 (del 3 bp at 1652) Intron 10 10-60% 1717-1G3A Exon 11 10-60% G542X (G3T at 1756) 1784delG R553X (C3T at 1789) Exon 12 10-60% D579G (A3G at 1868) E585X (G3T at 1885) Intron 12 10-60% 1898ϩ3A3G Exon 13 30-80% 2183AA3G E730X (G3T at 2320) L732X (T3G at 2327) 2347delG Exon 14a 10-60% T854T (2694T/G)a V868V (2736G/A)a Intron 14b 30-80% 2789ϩ5G3A Exon 15 20-70% M952I (G3C at 2988)b Exon 17a 20-70% L997F (G3C at 3123)b Exon 17b 20-70% F1052V (T3G at 3286) R1066C (C3T at 3328) R1066H (G3A at 3329) A1067T (G3A at 3331) Exon 18 20-70% D1152H (G3C at 3586)b Exon 19 30-80% R1158X (C3T at 3604) Exon 20 20-70% S1251N (G3A at 3384) W1282X (G3A at 3978) Exon 21 20-70% N1303K (C3G at 4041)b Exon 22 30-80% G1349D (G3A at 4178) 4382delA Exon 24 30-80% Y1424Y (4404C/T)a a Polymorphism. Login to comment

[hide] Outcomes of a cystic fibrosis carrier testing clin... Med J Aust. 2009 Nov 2;191(9):499-501. Christie LM, Ingrey AJ, Turner GM, Proos AL, Watts GE
Outcomes of a cystic fibrosis carrier testing clinic for couples.
Med J Aust. 2009 Nov 2;191(9):499-501., 2009-11-02 [PMID:19883345]

Abstract [show]
OBJECTIVE: To review the outcomes of offering carrier testing for cystic fibrosis (CF) to couples considering pregnancy, and to women in early pregnancy and their partners. METHODS: An after-hours clinic was established in Newcastle for discussion of issues related to prenatal testing. Couples were offered CF carrier testing by extracting DNA from a mouthwash sample. An expanded one-step model was used with both partners being tested initially for the p.F508del cystic fibrosis transmembrane conductance regulator gene (CFTR) mutation. If one partner was a p.F508del carrier, the other partner was tested for an additional 28 CFTR mutations. RESULTS: Of 1000 individuals who were offered CF carrier testing, none declined. No re-collections of mouthwash samples were required, and results were available within 14 days. There were 730 individuals who had no family history of CF (73%); 27 were carriers (4%; 95% CI, 2.4%-5.3%), and there were two high-risk couples where both partners were carriers of p.F508del. There were 270 individuals who had an affected family member with CF or a child identified as a CF carrier through newborn screening; 126 were carriers (46%; 95% CI, 40.6%-52.8%), and there were two high-risk couples - one couple where both partners were carriers of p.F508del, and another couple where the woman was homozygous for p.F508del and the man was a p.F508del carrier. The information on carrier status led the four high-risk couples to change their reproductive decisions to avoid having a child with CF. CONCLUSION: CF carrier testing for couples using an expanded one-step model will detect about 80% of high-risk couples and enables various reproductive choices. We believe that all couples considering pregnancy, and women in early pregnancy and their partners, should be offered CF carrier testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 This provides each individual with information on their carrier status, and accurate residual risks of 1 CFTR mutations tested for in individuals whose partner was a carrier of p.F508del* p.F508del p.F316leufsX p.I507del p.R347P p.G542X p.S1251N p.G551D p.E60X p.N1303K p.W1282X c.1585-1G>A p.D1152H p.R553X c.2988+1G>A c.489+G>T c.2657+5G>A p.R117H c.1766+1G>A p.R1162X c.579+1G>A c.3717+10kbC>T p.G85E p.R334W p.K684fs p.A455E p.I148T p.K684fs p.R560T p.T1176fs CFTR = gene encoding cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] UMD-CFTR: a database dedicated to CF and CFTR-rela... Hum Mutat. 2010 Sep;31(9):1011-9. Bareil C, Theze C, Beroud C, Hamroun D, Guittard C, Rene C, Paulet D, Georges M, Claustres M
UMD-CFTR: a database dedicated to CF and CFTR-related disorders.
Hum Mutat. 2010 Sep;31(9):1011-9., [PMID:20607857]

Abstract [show]
With the increasing knowledge of cystic fibrosis (CF) and CFTR-related diseases (CFTR-RD), the number of sequence variations in the CFTR gene is constantly raising. CF and particularly CFTR-RD provide a particular challenge because of many unclassified variants and identical genotypes associated with different phenotypes. Using the Universal Mutation Database (UMD) software we have constructed UMD-CFTR (freely available at the URL: http://www.umd.be/CFTR/), the first comprehensive relational CFTR database that allows an in-depth analysis and annotation of all variations identified in individuals whose CFTR genes have been analyzed extensively. The system has been tested on the molecular data from 757 patients (540 CF and 217 CBAVD) including disease-causing, unclassified, and nonpathogenic alterations (301 different sequence variations) representing 3,973 entries. Tools are provided to assess the pathogenicity of mutations. UMD-CFTR also offers a number of query tools and graphical views providing instant access to the list of mutations, their frequencies, positions and predicted consequences, or correlations between genotypes, haplotypes, and phenotypes. UMD-CFTR offers a way to compile not only disease-causing genotypes but also haplotypes. It will help the CFTR scientific and medical communities to improve sequence variation interpretation, evaluate the putative influence of haplotypes on mutations, and correlate molecular data with phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 Four variants can be classified into two different categories: p.Phe508Cys (complex allele, mutation), c.1210À12T[5] (mutation, UV), p.Ser1251Asn (complex allele, mutation), p.Arg74Trp (complex allele, UV). Login to comment

[hide] Cystic fibrosis in Chilean patients: Analysis of 3... J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30. Lay-Son G, Puga A, Astudillo P, Repetto GM
Cystic fibrosis in Chilean patients: Analysis of 36 common CFTR gene mutations.
J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30., [PMID:21036675]

Abstract [show]
BACKGROUND: CFTR gene mutations have worldwide differences in prevalence and data on Chilean patients is scarce. METHODS: We studied 36 of the most common CFTR mutations in Chilean patients from the CF National Program [Programa Nacional de Fibrosis Quistica (PNFQ)] of the Ministry of Health of Chile. RESULTS: Two hundred and eighty-nine patients were studied. Fourteen different mutations were identified with an overall allele detection rate of 42.0%. Mutations with frequencies greater than 1% were p.F508del (30.3% of alleles), p.R334W (3.3%), p.G542X (2.4%), c.3849+10Kb C>T (1.7%), and p.R553X (1.2%). A north to south geographical gradient was observed in the overall rate of detection. CONCLUSIONS: Southern European CFTR mutations predominate in the Chilean population, but a high percentage of alleles remain unknown. Geographical heterogeneity could be explained in part by admixture. Complementary analyses are necessary to allow for effective genetic counselling and improve cost-effectiveness of screening and diagnostic tests.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Mutation This study Rios et al. [4] Molina et al. [5] Repetto et al. [6] Perez et al. [13] CFGAC [2] (n=578) (%) (n=72) (%) (n=36) (%) (n=100) (%) (n=4102) (%) (n=43,849) (%) Chile Chile Chile Chile Latin-Americaa Worldwide Unknown 58.0 66.6 61.1 34.0 36.7 22.7 p.F508del 30.6 29.2 30.6 45.0 47.1 66.0 p.R334W 3.1 - - 2.0 0.8 0.1 p.G542X 2.4 0 8.3 7.0 5.0 2.4 c.3849+10Kb CNT 1.7 - - 3.0 0.3 0.2 p.R553X 1.2 4.2 0 1.0 0.4 0.7 p.R1162X 0.9 - - 2.0 1.0 0.3 p.1078delT 0.5 - - 0 b0.1 0.1 p.G85E 0.5 - - - 0.8 0.2 p.W1282X 0.2 - - 5.0 1.0 1.2 c.3120+1 GNA 0.2 - - - 0.3 - c.711+1 GNT 0.2 - - - 0.1 0.1 p.R117H 0.2 - - 0 b0.1 0.3 p.A455E 0.2 - - 0 0 0.1 p.I148T 0.2 - - - - - p.G551D 0 0 0 1.0 0.1 1.6 p.N1303K 0 0 0 0 1.8 1.3 c.621+1 GNT 0 - - 0 0.2 0.7 c.1717-1 GNA 0 - - 0 0.3 0.6 p.I507del 0 - - 0 0.2 0.2 p.R347P 0 - - 0 0 0.2 c.2789+5 GNA 0 - - - 0.2 0.1 c.1898+1 GNA 0 - - - 0.1 0.1 c.2184delA 0 - - - b0.1 0.1 p.S549N 0 - 0 - 0.1 0.1 c.3659delC 0 - - 0 0.1 0.1 p.R560T 0 - - - 0 0.1 c.1811+1.6Kb ANG 0 - - - 0.4 - c.2183AANG 0 - - 0 0.1 - p.S549R 0 - - - 0.1 - c.3272-26 ANG 0 - - - 0.1 - c.3199del6 0 - - - b0.1 - p.E60X 0 - - 0 0 - c.3905insT 0 - - - 0 - p.S1251N 0 - - 0 - - CFTRdele2,3 0 - - - - - p.R347H 0 - - - - - p.V520F 0 - - - - - p.Q552X 0 - - - - - c.394delTT 0 - - - - - c.711+1 GNA 0 - - - - - c.2143delT 0 - - - - - c.3876delA 0 - - - - - a Data from Chilean patients published in Rios et al., Molina et al., and Repetto et al. [4-6] included in this publication were excluded in this table to avoid repetition. Login to comment

[hide] Newborn screening for cystic fibrosis: Polish 4 ye... Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180. Sobczynska-Tomaszewska A, Oltarzewski M, Czerska K, Wertheim-Tysarowska K, Sands D, Walkowiak J, Bal J, Mazurczak T
Newborn screening for cystic fibrosis: Polish 4 years' experience with CFTR sequencing strategy.
Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180., [PMID:22892530]

Abstract [show]
Newborn screening for cystic fibrosis (NBS CF) in Poland was started in September 2006. Summary from 4 years' experience is presented in this study. The immunoreactive trypsin/DNA sequencing strategy was implemented. The group of 1 212 487 newborns were screened for cystic fibrosis during the programme. We identified a total of 221 CF cases during this period, including, 4 CF cases were reported to be omitted by NBS CF. Disease incidence in Poland based on the programme results was estimated as 1/4394 and carrier frequency as 1/33. The frequency of the F508del was similar (62%) to population data previously reported. This strategy allowed us to identify 29 affected infants with rare genotypes. The frequency of some mutations (eg, 2184insA, K710X) was assessed in Poland for the first time. Thus, sequencing assay seems to be accurate method for screening programme using blood spots in the Polish population.European Journal of Human Genetics advance online publication, 15 August 2012; doi:10.1038/ejhg.2012.180.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Mutations D537N and P731L have not been Period of NBS CF Method The most frequent mutations in Polish population under analysis September 2006 - December 2007 Estonia Asper Biotech assay E60X, G85E, 394delTT, R117H, R117P, R117L, I148T, 621G>A, 711+1G>T, 711+5G>A, 1078delT, R334W, R347H, R347P, R347L, IVS8-T, A455E, I507del, F508del, 1717-1G>A, G542X, p.G551D, Q552X, R553X, R553G, R560T, R560K, 1898+1G>A, 1898+1G>T, 1898+1G>C, 2143delT, 2184delA, 2183AA>G, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, R1162X, 3659delC, 3849+10kbC>T, 3905insT, S1235R, S1251N, W1282X, W1282C, N1303K, CFTRdele2,3 January 2007 - June 2009 Sanger sequencing of exons: 4, 7, 10, 11, 13, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R117H+IVS8-T*, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K July 2009 - currently Sanger sequencing of exons: 7, 10, 11, 13, 17b, 20, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K, 3272-26A>G**, W1282X** * removed from DNA analysis since July 2009 , **added into DNA analysis since July 2009 Figure 1 NBS CF in Poland. Login to comment

[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]

Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

[hide] Improving test properties for neonatal cystic fibr... J Inherit Metab Dis. 2012 Jul;35(4):635-40. Cornel MC, Gille JJ, Loeber JG, Vernooij-van Langen AM, Dankert-Roelse J, Bolhuis PA
Improving test properties for neonatal cystic fibrosis screening in the Netherlands before the nationwide start by May 1st 2011.
J Inherit Metab Dis. 2012 Jul;35(4):635-40., [PMID:22302635]

Abstract [show]
When new technical possibilities arise in health care, often attunement is needed between different actors from the perspectives of research, health care providers, patients, ethics and policy. For cystic fibrosis (CF) such a process of attunement in the Netherlands started in a committee of the Health Council on neonatal screening in 2005. In the balancing of pros and cons according to Wilson and Jungner criteria, the advantages for the CF patient were considered clear, even though CF remains a severe health problem with treatment. Nevertheless, screening was not started then, mainly since the specificity of the tests available at that time was considered too low. Many healthy infants would have been referred for sweat testing and much uncertainty would arise in their parents. Also the limited sensitivity for immigrants and the detection of less severe phenotypes and carriers were considered problematic. The Health Council recommended a pilot screening project which was subsequently performed in some provinces, leading to a 4-step protocol: IRT, PAP, screening for a CFTR mutation panel, and sequencing of the CFTR gene. This would lead to the identification of 23 cases of classical CF, two infants with less severe forms and 12 carriers per year in the Netherlands. Thus many CF patients can be diagnosed early, while limiting the number of referrals, the number of infants with less severe forms diagnosed and the number of carriers identified. Technical solutions were found to limit the ethical problems. A nationwide program using this four step protocol started by 1 May 2011.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 This protocol was expected to identify 25 CF patients on an annual basis, additional to four infants already diagnosed because of meconium ileus (Health Council of 1 Using the LiPA test (INNO-LiPA CFTR 19 en INNO-LiPA CFTR 17+Tn; Innogenetics, Gent, Belgium) the following CFTR mutations can be detected: exon 2-3del (21 kb), 394delTT, E60X, G85E, R117H, 621+1G>T, 711+1G>T, 711+5G>A, 1078delT, R334W, R347P, A455E, I507del, F508del, 1717-1G>A, G542X, G551D, Q552X, R553X, R560T, 1898+1G>A, 2143delT, 2183AA>G, 2184delA, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, 3659delC, R1162X, 3849+10kbC>T, 3905insT, S1251N, W1282X en N1303K. Login to comment
70 This test also identifies the CFTR polymorphism Tn in intron 8 which is important in cases where the mutation R117H is detected. Login to comment

[hide] Ivacaftor potentiation of multiple CFTR channels w... J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30. Yu H, Burton B, Huang CJ, Worley J, Cao D, Johnson JP Jr, Urrutia A, Joubran J, Seepersaud S, Sussky K, Hoffman BJ, Van Goor F
Ivacaftor potentiation of multiple CFTR channels with gating mutations.
J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30., [PMID:22293084]

Abstract [show]
BACKGROUND: The investigational CFTR potentiator ivacaftor (VX-770) increased CFTR channel activity and improved lung function in subjects with CF who have the G551D CFTR gating mutation. The aim of this in vitro study was to determine whether ivacaftor potentiates mutant CFTR with gating defects caused by other CFTR gating mutations. METHODS: The effects of ivacaftor on CFTR channel open probability and chloride transport were tested in electrophysiological studies using Fischer rat thyroid (FRT) cells expressing different CFTR gating mutations. RESULTS: Ivacaftor potentiated multiple mutant CFTR forms with defects in CFTR channel gating. These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. CONCLUSION: These in vitro data suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support investigation of the potential clinical benefit of ivacaftor in CF patients who have CFTR gating mutations beyond G551D.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. Login to comment
39 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
67 The CF-associated CFTR mutations, S549N, S549R, and S1251N, are located in the ABC signature sequence (Fig. 4; LSGGQ; S549N,R in NBD1) and Walker A motif (Fig. 4; S1251N in NBD2), that form the ATP binding sites [14]. Login to comment
68 Immunoblot and Ussing chamber studies indicated that, although the maturation of S549N- and S1251N-CFTR was similar to normal, the baseline level of chloride transport was b10% of normal CFTR (Figs. 1 and 3; Table 2). Login to comment
69 S549R-CFTR showed maturation comparable to 26±2% (n=5) of normal CFTR (Fig. 1D), which did not account for the b1% of normal CFTR function (Fig. 3; Table 2). Login to comment
70 These results indicated that the function of S549N-, S549R-, and S1251N-CFTR at the cell surface was minimal. Login to comment
71 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTRmRNA (%NormalCFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTRMaturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations MatureCFTR (%NormalCFTR) A B D C Mature Immature Fig. 1. Login to comment
82 Taken together, these data suggested that defective channel gating was the predominant defect in S549N-, S549R- and S1251N-CFTR. Login to comment
83 In FRT cells expressing S549N-, S549R-, and S1251N-CFTR, acute addition of 10 μM ivacaftor increased the channel open probability and total chloride transport by N10-fold over baseline levels (Figs. 2 and 3; Tables 1 and 2). Login to comment
84 The EC50 for ivacaftor in FRT cells expressing S549N-, S549R-, and S1251N-CFTR were similar to G551D-CFTR (Fig. 3C; Table 2). Login to comment
85 These results indicated that S549N-, S549R-, and S1251N-CFTR were potentiated by ivacaftor in vitro. Login to comment
91 In addition, we showed that the 3 additional mutations, S549N, S549R, and S1251N also have characteristics consistent with gating defects. Login to comment
93 Ivacaftor addition caused a N10-fold increase in CFTR-mediated chloride transport in FRT cells expressing G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR. Login to comment
96 Taken together, these in vitro results provide a rationale for testing the potential benefit of ivacaftor in individuals with CF who have a CFTR gating mutation other than G551D, including the G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P, and G1349D CFTR gating mutations. Login to comment
97 Evaluation of CF-associated CFTR mutations that were expected to cause protein alterations in the ATP-binding sites formed by the NBDs indicated that S549N- and S1251N-CFTR also shared similar in vitro functional characteristics with G551D-CFTR and could be classified as CFTR gating mutations. Login to comment
98 Unlike S549N-CFTR and S1251N-CFTR, S549R-CFTR exhibited a partial reduction in the level of CFTR maturation compared to normal CFTR (see also Ref. [16]). Login to comment
99 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 µM Ivacaftor * * * * * * * * * * * CFTR Mutation ChannelOpenProbability ChannelOpenProbability (%NormalCFTR) B 1pA 3sec + 10 µM Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
127 Like G551D, the G551S, G1244E, S1255P, and G1349D CFTR gating mutations, as well as the S549N, S549R, and S1251N CFTR gating mutations identified in the Table 1 Effect of ivacaftor on the channel gating activity of CFTR with gating mutations. Login to comment
128 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 μM ivacaftor Baseline With 10 μM ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57±0.03 100 0.63±0.02 111 0.400±0.04 100 0.800±0.04 a 200 G551D 0.46±0.06 81 0.46±0.03 81 0.019±0.01 b 5 0.121±0.035 a 30 G178R 0.59±0.11 103 0.66±0.08 116 0.005±0.001 b 1 0.228±0.022 a 57 S549N 0.55±0.02 97 0.61±0.02 108 0.003±0.010 b 1 0.396±0.119 a 99 S549R 0.45±0.01 b 79 0.55±0.02 a 96 0.004±0.010 b 1 0.143±0.031 a 36 G551S 0.57±0.13 100 0.64±0.02 113 0.010±0.001 b 3 0.337±0.110 a 84 G970R 0.55±0.03 96 0.55±0.03 97 0.001±0.001 b 0 0.245±0.042 a 61 G1244E 0.44±0.11 77 0.54±0.08 94 0.011±0.010 b 3 0.470±0.122 a 118 S1251N 0.54±0.07 95 0.63±0.04 111 0.003±0.010 b 1 0.350±0.03 a 88 S1255P 0.70±0.03 b 122 0.71±0.02 125 0.018±0.016 b 5 0.468±0.168 a 117 G1349D 0.49±0.08 85 0.63±0.06 111 0.019±0.015 b 5 0.315±0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
130 0 100 200 300 400 -9 -8 -7 -6 -5 -4 G178R G551D G551S 0 S549N S549R Ivacaftor [Log M] 0 100 200 300 400 0 50 100 150 200 -9 -8 -7 -6 -5 -4 G970R G1244E S1255P G1349D 0 S1251N Ivacaftor [Log M] ChlorideTransport (%NormalCFTR) Normal Forskolin G178R G551S G970R G1244E 50 2 1 min S1255P Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 0 50 100 150 200 * * * * * * * * * * * * * CFTR Mutation ChlorideTransport(µA/cm2)ChlorideTransport(µA/cm2) ChlorideTransport(A/cm2) ChlorideTransport (%NormalCFTR) B G1349D G551D A F508del C S549N S549R S1251N Baseline Baseline present study, cause protein alterations in the ATP binding pockets formed by the two NBDs required for normal CFTR channel gating (Fig. 4) [2]. Login to comment
131 The G178R and G970R CFTR gating mutations alter the intracellular cytoplasmic loops that are believed to link the ATP-driven conformational changes in the NBDs to the opening of the CFTR channel pore formed by the membrane spanning domains [27]. Login to comment
144 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment
40 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
72 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTR mRNA (% Normal CFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTR Maturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations Mature CFTR (% Normal CFTR) A B D C Mature Immature Fig. 1. Login to comment
86 These results indicated that S549N-, S549R-, and S1251N-CFTR were potentiated by ivacaftor in vitro. Login to comment
92 In addition, we showed that the 3 additional mutations, S549N, S549R, and S1251N also have characteristics consistent with gating defects. Login to comment
94 Ivacaftor addition caused a N10-fold increase in CFTR-mediated chloride transport in FRT cells expressing G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR. Login to comment
100 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 &#b5;M Ivacaftor * * * * * * * * * * * CFTR Mutation Channel Open Probability Channel Open Probability (% Normal CFTR) B 1pA 3sec + 10 &#b5;M Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
129 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 bc;M ivacaftor Baseline With 10 bc;M ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57&#b1;0.03 100 0.63&#b1;0.02 111 0.400&#b1;0.04 100 0.800&#b1;0.04 a 200 G551D 0.46&#b1;0.06 81 0.46&#b1;0.03 81 0.019&#b1;0.01 b 5 0.121&#b1;0.035 a 30 G178R 0.59&#b1;0.11 103 0.66&#b1;0.08 116 0.005&#b1;0.001 b 1 0.228&#b1;0.022 a 57 S549N 0.55&#b1;0.02 97 0.61&#b1;0.02 108 0.003&#b1;0.010 b 1 0.396&#b1;0.119 a 99 S549R 0.45&#b1;0.01 b 79 0.55&#b1;0.02 a 96 0.004&#b1;0.010 b 1 0.143&#b1;0.031 a 36 G551S 0.57&#b1;0.13 100 0.64&#b1;0.02 113 0.010&#b1;0.001 b 3 0.337&#b1;0.110 a 84 G970R 0.55&#b1;0.03 96 0.55&#b1;0.03 97 0.001&#b1;0.001 b 0 0.245&#b1;0.042 a 61 G1244E 0.44&#b1;0.11 77 0.54&#b1;0.08 94 0.011&#b1;0.010 b 3 0.470&#b1;0.122 a 118 S1251N 0.54&#b1;0.07 95 0.63&#b1;0.04 111 0.003&#b1;0.010 b 1 0.350&#b1;0.03 a 88 S1255P 0.70&#b1;0.03 b 122 0.71&#b1;0.02 125 0.018&#b1;0.016 b 5 0.468&#b1;0.168 a 117 G1349D 0.49&#b1;0.08 85 0.63&#b1;0.06 111 0.019&#b1;0.015 b 5 0.315&#b1;0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
145 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment

[hide] Novel strategies in newborn screening for cystic f... Thorax. 2012 Apr;67(4):289-95. Epub 2012 Jan 23. Vernooij-van Langen AM, Loeber JG, Elvers B, Triepels RH, Gille JJ, Van der Ploeg CP, Reijntjens S, Dompeling E, Dankert-Roelse JE
Novel strategies in newborn screening for cystic fibrosis: a prospective controlled study.
Thorax. 2012 Apr;67(4):289-95. Epub 2012 Jan 23., [PMID:22271776]

Abstract [show]
CONTEXT: Newborn screening for cystic fibrosis (CF) is included in many routine programmes but current strategies have considerable drawbacks, such as false-positive tests, equivocal diagnosis and detection of carriers. OBJECTIVE: To assess the test performance of two newborn screening strategies for CF. DESIGN, SETTING AND PARTICIPANTS: In 2008 and 2009, CF screening was added to the routine screening programme as a prospective study in part of The Netherlands. INTERVENTIONS: Two strategies were performed in all newborns. In the first strategy, concentrations of immunoreactive trypsinogen (IRT) and pancreatitis-associated protein (PAP) were measured. In the second method, samples with IRT >/=60 mug/litre were analysed for 36 CFTR mutations, followed by sequencing when a single mutation was detected. Tests were positive only with two identified CFTR mutations. MAIN OUTCOME: Sensitivity, specificity and positive predictive value (PPV) of both screening strategies. RESULTS: 145,499 infants were screened. The IRT/PAP approach showed a sensitivity of 95.0%, a specificity of 99.897% and a PPV of 12.3%. Test properties for the IRT/DNA/sequencing strategy were respectively 100%, 100% and 64.9%. Combining both strategies (IRT/PAP/DNA/sequencing) led to a sensitivity of 95.0%, a specificity of 100% and a PPV of 87.5%. CONCLUSION: In conclusion, all strategies performed well. Although there was no statistically significant difference in test performance, the IRT/DNA/sequencing strategy detected one infant that was missed by IRT/PAP (/DNA/sequencing). IRT/PAP may be the optimal choice if the use of DNA technology must be avoided. If identification of carriers and equivocal diagnosis is considered an important disadvantage, IRT/PAP/DNA/sequencing may be the best choice.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 Three of these infants had equivocal sweat test results (chloride 33, 34, 36 mmol/litre; all had R117H-7T as a second mutation), the other 10 had normal sweat tests (F508del/394delTT/ S1251N/R553X combined with R117H-7T n¼8, F508del/L967S, F508del/Q1352H) (table 3). Login to comment
110 Table 2 Immunoreactive trypsinogen and pancreatitis-associated protein concentrations, CFTR gene mutation analysis and sweat tests in infants with cystic fibrosis detected by newborn screening IRT (mg/litre) PAP (mg/litre) Mutation 1 Mutation 2 Sweat test chloride (mmol/litre) 1 438 5.3 F508del F508del 74 2 284 1.8 F508del F508del 88 3 266 9.8 F508del F508del 97 4 237 1.8 F508del F508del 11 and 74 5 197 4.3 F508del F508del 69 6* 191 12.6 F508del C.3889dupT 94 7 164 14.4 F508del G542X 102 8 129 4.3 F508del F508del Failed 9 110 2.2 F508del F508del 94 10 109 2.0 F508del F508del 51 11 105 4.4 F508del F508del 149 12 155 2.6 F508del F508del 111 13 191 12.6 F508del F508del 4 14 116 15.8 F508del F508del Failed 3 times 15 293 5.7 F508del 2184A 120 16* 228 15.8 F508del 1294_1300del 99 17 218 4.5 F508del G85E 99 18 153 4.0 F508del S1251N 77 19* 141 15.8 F508del E730X 82 20z 78 0.8 F508del A455E 65 21y 114 11.2 F508del F508del Failed 22y 109 0.8 F508del F508del 78 23y 93 1.3 F508del F508del e 24y 75 6.7 F508del F508del 78 *Second mutation detected by sequencing. Login to comment
136 CF, cystic fibrosis; IRT, immunoreactive trypsinogen; PAP, pancreatitis-associated protein. Table 3 Immunoreactive trypsinogen and pancreatitis-associated protein concentrations, CFTR gene mutation analysis and sweat tests for all infants with an equivocal diagnosis IRT (mg/litre) PAP (mg/litre) Mutation 1 Mutation 2 Sweat test chloride (mmol/litre) 1 199 1.4 E60X R117H-7T 36 2 139 0.8 394delTT R117H-7T/9T 21 3 123 0.6 F508del R117H-7T 22 4 89 1.4 S1251N R117H-7T 29 5 79 1.6 F508del R117H-7T 26 6 77 2.4 R553X R117H-7T 22 7 76 0.8 F508del R117H-7T 34 8 73 0.5 F508del R117H-7T 25 9 70 1.0 F508del R117H-7T 22 10 69 1.1 F508del R117H-7T 33 11 67 2.7 F508del R117H-7T 17 12* 174 3.8 F508del L967S 19 13* 84 3.2 F508del Q1352H 17 Equivocal diagnosis¼two CFTR gene mutations of which one has unclear clinical significance, and a normal or equivocal sweat test result. Login to comment
104 Three of these infants had equivocal sweat test results (chloride 33, 34, 36 mmol/litre; all had R117H-7T as a second mutation), the other 10 had normal sweat tests (F508del/394delTT/ S1251N/R553X combined with R117H-7T n&#bc;8, F508del/L967S, F508del/Q1352H) (table 3). Login to comment
109 Table 2 Immunoreactive trypsinogen and pancreatitis-associated protein concentrations, CFTR gene mutation analysis and sweat tests in infants with cystic fibrosis detected by newborn screening IRT (mg/litre) PAP (mg/litre) Mutation 1 Mutation 2 Sweat test chloride (mmol/litre) 1 438 5.3 F508del F508del 74 2 284 1.8 F508del F508del 88 3 266 9.8 F508del F508del 97 4 237 1.8 F508del F508del 11 and 74 5 197 4.3 F508del F508del 69 6* 191 12.6 F508del C.3889dupT 94 7 164 14.4 F508del G542X 102 8 129 4.3 F508del F508del Failed 9 110 2.2 F508del F508del 94 10 109 2.0 F508del F508del 51 11 105 4.4 F508del F508del 149 12 155 2.6 F508del F508del 111 13 191 12.6 F508del F508del 4 14 116 15.8 F508del F508del Failed 3 times 15 293 5.7 F508del 2184A 120 16* 228 15.8 F508del 1294_1300del 99 17 218 4.5 F508del G85E 99 18 153 4.0 F508del S1251N 77 19* 141 15.8 F508del E730X 82 20z 78 0.8 F508del A455E 65 21y 114 11.2 F508del F508del Failed 22y 109 0.8 F508del F508del 78 23y 93 1.3 F508del F508del e 24y 75 6.7 F508del F508del 78 *Second mutation detected by sequencing. Login to comment
135 CF, cystic fibrosis; IRT, immunoreactive trypsinogen; PAP, pancreatitis-associated protein. Table 3 Immunoreactive trypsinogen and pancreatitis-associated protein concentrations, CFTR gene mutation analysis and sweat tests for all infants with an equivocal diagnosis IRT (mg/litre) PAP (mg/litre) Mutation 1 Mutation 2 Sweat test chloride (mmol/litre) 1 199 1.4 E60X R117H-7T 36 2 139 0.8 394delTT R117H-7T/9T 21 3 123 0.6 F508del R117H-7T 22 4 89 1.4 S1251N R117H-7T 29 5 79 1.6 F508del R117H-7T 26 6 77 2.4 R553X R117H-7T 22 7 76 0.8 F508del R117H-7T 34 8 73 0.5 F508del R117H-7T 25 9 70 1.0 F508del R117H-7T 22 10 69 1.1 F508del R117H-7T 33 11 67 2.7 F508del R117H-7T 17 12* 174 3.8 F508del L967S 19 13* 84 3.2 F508del Q1352H 17 Equivocal diagnosis&#bc;two CFTR gene mutations of which one has unclear clinical significance, and a normal or equivocal sweat test result. Login to comment

[hide] CFTR, SPINK1, CTRC and PRSS1 variants in chronic p... Gut. 2012 Mar 17. Rosendahl J, Landt O, Bernadova J, Kovacs P, Teich N, Bodeker H, Keim V, Ruffert C, Mossner J, Kage A, Stumvoll M, Groneberg D, Kruger R, Luck W, Treiber M, Becker M, Witt H
CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?
Gut. 2012 Mar 17., [PMID:22427236]

Abstract [show]
OBJECTIVE: In chronic pancreatitis (CP), alterations in several genes have so far been described, but only small cohorts have been extensively investigated for all predisposing genes. DESIGN: 660 patients with idiopathic or hereditary CP and up to 1758 controls were enrolled. PRSS1, SPINK1 and CTRC were analysed by DNA sequencing, and cystic fibrosis transmembrane conductance regulator (CFTR) by melting curve analysis. RESULTS: Frequencies of CFTR variants p.R75Q, p.I148T, 5T-allele and p.E528E were comparable in patients and controls. We identified 103 CFTR variants, which represents a 2.7-fold risk increase (p<0.0001). Severe cystic fibrosis (CF)-causing variants increased the risk of developing CP 2.9-fold, and mild CF-causing variants 4.5-fold (p<0.0001 for both). Combined CF-causing variants increased CP risk 3.4-fold (p<0.0001), while non-CF-causing variants displayed a 1.5-fold over-representation in patients (p=0.14). CFTR compound heterozygous status with variant classes CF-causing severe and mild represented an OR of 16.1 (p<0.0001). Notably, only 9/660 (1.4%) patients were compound heterozygotes in this category. Trans-heterozygosity increased CP risk, with an OR of 38.7, with 43/660 (6.5%) patients and 3/1667 (0.2%) controls being trans-heterozygous (p<0.0001). CONCLUSIONS: Accumulation of CFTR variants in CP is less pronounced than reported previously, with ORs between 2.7 and 4.5. Only CF-causing variants reached statistical significance. Compound and trans-heterozygosity is an overt risk factor for the development of CP, but the number of CFTR compound heterozygotes in particular is rather low. In summary, the study demonstrates the complexity of genetic interactions in CP and a minor influence of CFTR alterations in CP development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A. Login to comment
69 The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A. Login to comment

[hide] Role of Cystic Fibrosis Transmembrane Conductance ... Chest. 2012 Mar 15. Gonska T, Choi P, Stephenson A, Ellis L, Martin S, Solomon M, Dupuis A, Dorfman R, Zielenski J, Ooi CY, Weiser W, Durie PR, Tullis E
Role of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) in patients with chronic sinopulmonary disease.
Chest. 2012 Mar 15., [PMID:22423042]

Abstract [show]
ABSTRACT INTRODUCTION:Previous studies report a high frequency of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene in patients with idiopathic bronchiectasis. However, most studies have based their findings on pre-selected patient groups or have performed limited testing for CFTR dysfunction. The objective of our study was to evaluate the prevalence of CFTR gene mutations and/or CFTR-related ion channel abnormalities among subjects with idiopathic chronic sinopulmonary disease and the prevalence of CF or a CFTR-related disorder in this population. METHODS:We evaluated 72 prospectively enrolled patients from 1995-2005 at the Hospital for Sick Children and St. Michael's Hospital with idiopathic chronic sinopulmonary disease for evidence of CFTR-mediated abnormalities. We performed CFTR genotyping and assessed CFTR function using sweat testing and nasal potential difference testing. The results were compared with data from healthy controls, CF heterozygotes and CF patients. RESULTS:The CFTR functional tests in idiopathic sinopulmonary patients showed a continuous spectrum, ranging from normal to values typically seen in individuals with CF. Forty eight patients (66%) demonstrated CFTR mutations and/or abnormalities of CFTR function. Twenty two (31%) fulfilled criteria for a CF diagnosis and 26 (36%) for a CFTR-related disorder with a strong female preponderance. Functional tests, more than genotyping, were instrumental in establishing a CF diagnosis. Clinical features failed to distinguish CF subjects from those with CFTR-related or idiopathic disease. CONCLUSION:The high prevalence of CF and CFTR dysfunction among patients with idiopathic chronic sinopulmonary disease underscores the need for extensive diagnostic evaluation for CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 All P values are two-sided with a Table 2-CFTR Genotypes Identified in Subjects With Idiopathic Sinopulmonary Disease CF Causing/CF Causing CF Causing/CFTR Mutation CFTR Mutation/CFTR Mutation CF Causing/Unknown CFTR Mutation/Unknown F508del/A455E 3x F508del /D1152H 2x D579G/D579G 2x F508del /26x R764X/2 F508del/S1251N R75X/V456A 758delC/2 F508del/L967S 1716G.A/5T 1716G.A/2 F508del/5T R75Q/5T R117H (7T)/23x F508del/3212T.C 5T/23x G542X/D1152H 1717-1G.A/Q1291H Patients are grouped according to the identified CFTR alterations on allele 1/allele 2. Login to comment

[hide] CFTR mutation analysis and haplotype associations ... Mol Genet Metab. 2012 Feb;105(2):249-54. doi: 10.1016/j.ymgme.2011.10.013. Epub 2011 Oct 26. Cordovado SK, Hendrix M, Greene CN, Mochal S, Earley MC, Farrell PM, Kharrazi M, Hannon WH, Mueller PW
CFTR mutation analysis and haplotype associations in CF patients.
Mol Genet Metab. 2012 Feb;105(2):249-54. doi: 10.1016/j.ymgme.2011.10.013. Epub 2011 Oct 26., [PMID:22137130]

Abstract [show]
Most newborn screening (NBS) laboratories use second-tier molecular tests for cystic fibrosis (CF) using dried blood spots (DBS). The Centers for Disease Control and Prevention's NBS Quality Assurance Program offers proficiency testing (PT) in DBS for CF transmembrane conductance regulator (CFTR) gene mutation detection. Extensive molecular characterization on 76 CF patients, family members or screen positive newborns was performed for quality assurance. The coding, regulatory regions and portions of all introns were sequenced and large insertions/deletions were characterized as well as two intronic di-nucleotide microsatellites. For CF patient samples, at least two mutations were identified/verified and four specimens contained three likely CF-associated mutations. Thirty-four sequence variations in 152 chromosomes were identified, five of which were not previously reported. Twenty-seven of these variants were used to predict haplotypes from the major haplotype block defined by HapMap data that spans the promoter through intron 19. Chromosomes containing the F508del (p.Phe508del), G542X (p.Gly542X) and N1303K (p.Asn1303Lys) mutations shared a common haplotype subgroup, consistent with a common ancient European founder. Understanding the haplotype background of CF-associated mutations in the U.S. population provides a framework for future phenotype/genotype studies and will assist in determining a likely cis/trans phase of the mutations without need for parent studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
138 Researchers found that the phenotypic severity of a CF-causing mutation could be impacted by the genomic context of the CFTR gene as seen when R117H is in cis with the 5T variant and when S1251N is in cis with F508C [33,34]. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Hepatol. 2009 Jan;50(1):150-7. Epub 2008 Oct 7. Henckaerts L, Jaspers M, Van Steenbergen W, Vliegen L, Fevery J, Nuytten H, Roskams T, Rutgeerts P, Cassiman JJ, Vermeire S, Cuppens H
Cystic fibrosis transmembrane conductance regulator gene polymorphisms in patients with primary sclerosing cholangitis.
J Hepatol. 2009 Jan;50(1):150-7. Epub 2008 Oct 7., [PMID:18992954]

Abstract [show]
BACKGROUND/AIMS: Primary sclerosing cholangitis (PSC) is a progressive cholestatic disease commonly associated with inflammatory bowel disease (IBD) and characterized by fibrosing inflammatory destruction of bile ducts. The histological features in the liver of PSC patients are similar to those observed in cystic fibrosis (CF). Our aim was to study whether variants in the CFTR gene are associated with the occurrence and/or evolution of PSC. METHODS: PSC patients (n=140) were genotyped for F508del, the TGmTn variants, and four additional polymorphic loci (1001+11 C>T, M470V, T854T and Q1463Q), and compared to 136 matched healthy controls. RESULTS: The 1540G-allele, encoding V470, was less frequent in PSC (52%) than in controls (64%, p=0.003), and was associated with protection against PSC in individuals without IBD (OR 0.25, 95% CI 0.12-0.52, p=0.0002). Also TG11-T7 was less frequent in PSC (53%) than in controls (61%, p=0.04), this haplotype was associated with reduced risk for PSC (OR 0.34, 95% CI 0.17-0.70, p=0.003) in individuals without IBD. CONCLUSIONS: In this cohort of PSC patients, several CFTR-variants affecting the functional properties of the CFTR protein seem to offer protection against the development of PSC, confirming our hypothesis that CFTR might be implicated in the pathogenesis of PSC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
91 There was Table 4 Summary of the 37 CFTR variants studied in the exploratory phase INNO-LiPA CFTR 19 INNO-LiPA CFTR17+Tn Update F508del 621+1GfiT G542X 3849+10kbCfiT N1303K 2183AAfiG W1282X 394delTT G551D 2789+5GfiA 1717-1GfiA R1162X R553X 3659delC CFTRdele2,3(21kb) R117H I507del R334W 711+1GfiT R347P 3272-26AfiG G85E 3905insT 1078delT R560T A455E 1898+1GfiA 2143delT S1251N E60X I148T 2184delA 3199del6 711+5GfiA 3120+1GfiA Tn Q552X Fig. 1. Login to comment

[hide] Consensus on the use and interpretation of cystic ... J Cyst Fibros. 2008 May;7(3):179-96. Castellani C, Cuppens H, Macek M Jr, Cassiman JJ, Kerem E, Durie P, Tullis E, Assael BM, Bombieri C, Brown A, Casals T, Claustres M, Cutting GR, Dequeker E, Dodge J, Doull I, Farrell P, Ferec C, Girodon E, Johannesson M, Kerem B, Knowles M, Munck A, Pignatti PF, Radojkovic D, Rizzotti P, Schwarz M, Stuhrmann M, Tzetis M, Zielenski J, Elborn JS
Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice.
J Cyst Fibros. 2008 May;7(3):179-96., [PMID:18456578]

Abstract [show]
It is often challenging for the clinician interested in cystic fibrosis (CF) to interpret molecular genetic results, and to integrate them in the diagnostic process. The limitations of genotyping technology, the choice of mutations to be tested, and the clinical context in which the test is administered can all influence how genetic information is interpreted. This paper describes the conclusions of a consensus conference to address the use and interpretation of CF mutation analysis in clinical settings. Although the diagnosis of CF is usually straightforward, care needs to be exercised in the use and interpretation of genetic tests: genotype information is not the final arbiter of a clinical diagnosis of CF or CF transmembrane conductance regulator (CFTR) protein related disorders. The diagnosis of these conditions is primarily based on the clinical presentation, and is supported by evaluation of CFTR function (sweat testing, nasal potential difference) and genetic analysis. None of these features are sufficient on their own to make a diagnosis of CF or CFTR-related disorders. Broad genotype/phenotype associations are useful in epidemiological studies, but CFTR genotype does not accurately predict individual outcome. The use of CFTR genotype for prediction of prognosis in people with CF at the time of their diagnosis is not recommended. The importance of communication between clinicians and medical genetic laboratories is emphasized. The results of testing and their implications should be reported in a manner understandable to the clinicians caring for CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment
1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment

[hide] ENaCbeta and gamma genes as modifier genes in cyst... J Cyst Fibros. 2008 Jan;7(1):23-9. Epub 2007 Jun 7. Viel M, Leroy C, Hubert D, Fajac I, Bienvenu T
ENaCbeta and gamma genes as modifier genes in cystic fibrosis.
J Cyst Fibros. 2008 Jan;7(1):23-9. Epub 2007 Jun 7., [PMID:17560176]

Abstract [show]
BACKGROUND: Clinical phenotype varies among cystic fibrosis (CF) patients with identical CF transmembrane conductance regulator (CFTR)genotype, suggesting that genetic modifiers exist. Transgenic mice that overexpress SCNN1beta present CF-like lung disease symptoms. Mutations or variants in SCNN1beta may therefore potentially modulate the clinical phenotype in CF patients. METHODS: We analysed by DHPLC SCNN1beta and SCNN1gamma genes in 56 patients with classical CF. Patients were classified into two groups according to their CFTR genotype and their severity: 38 patients with severe genotype and an unexpectedly mild lung phenotype, and 18 patients with mild genotype and a severe lung phenotype. RESULTS: We found 3 patients out of 56 carrying at least one missense mutation. Two were novel (p.Thr313Met in SCNN1beta, p.Leu481Gln in SCNN1gamma) and two were previously described (p.Gly589Ser in SCNN1beta and p.Val546Ileu in SCNNgamma). p.Thr313Met has been identified in a CF patient with mild genotype and severe lung phenotype suggesting that it could act in increasing ENaC activity. The three other variants have been identified in CF patients with severe genotype and mild lung phenotype suggesting that they might decrease ENaC activity. However, the function of ENaC in the nasal epithelia of these patients, evaluated by nasal potential difference measurements, did not support the fact that these variants were functional, at least in nasal epithelium. CONCLUSION: Our results suggest that genetic variants in ENaCbeta and gamma genes do not modulate disease severity in the majority of CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Their genotypes were: 2 G542X:3849+10kbCNT, Phe508del:3276-26ANG, Phe508del:A455E, 297-3CNT:W361R, S1251N:3849+10kbCNT, Phe508del:G178R, Phe508del:3849+10kbCNT, Phe508del:A561E, Phe508del: G1061R, 1717-1GNA:3272-26ANG, 2 Phe508del:R347P, Phe508del:G85E, L227R:L227R, R300G:3007delG, Phe508del:R347H, Phe508del:G1244E. Login to comment

[hide] High incidence of the CFTR mutations 3272-26A-->G ... J Cyst Fibros. 2007 Nov 30;6(6):371-5. Epub 2007 May 3. Storm K, Moens E, Vits L, De Vlieger H, Delaere G, D'Hollander M, Wuyts W, Biervliet M, Van Schil L, Desager K, Nothen MM
High incidence of the CFTR mutations 3272-26A-->G and L927P in Belgian cystic fibrosis patients, and identification of three new CFTR mutations (186-2A-->G, E588V, and 1671insTATCA).
J Cyst Fibros. 2007 Nov 30;6(6):371-5. Epub 2007 May 3., [PMID:17481968]

Abstract [show]
We have analyzed 143 unrelated Belgian patients with a positive diagnosis of cystic fibrosis (CF) for mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. An initial screening for 29 CFTR mutations led to mutation identification in 89.9% of the tested chromosomes. Subsequently an extensive analysis of the CFTR gene was performed by denaturating gradient gel electrophoresis (DGGE) in those patients with at least one unknown mutation after preliminary screening. In addition to 10 previously reported mutations we identified 2 new mutations 186-2A-->G and E588V. A third new mutation 1671insTATCA was identified during routine screening for DeltaF508. Two mutations were detected with a higher frequency than expected: 3272-26A-->G, which is the second most common mutation after DeltaF508 in our CF population with a frequency of 3.8%, and L927P (2.4%). The clinical data is presented for the mutations 186-2A-->G, E588V, 3272-26A-->G and L927P. The mutation data are useful for the Belgian population to supplement the initial screening set of mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 The Inno Lipa™ CFTR12 assay contains normal and mutant probes for 12 different CFTR mutations (ΔF508, G542X, N1303K, 1717-1G→A, W1282X, G551D, R553X, S1251N, R560T, 3905insT, Q552X, ΔI507). Login to comment
60 L927P (together with G542X and S1251N) is the fourth most common CFTR mutation, with a frequency of 2.4%. Login to comment
80 We found L927P in 7 CF patients: four patients have ΔF508 as the second mutation, one patient 1717-1G→A, another patient S1251N, and a last patient 2789+ 5G→A. Login to comment
83 The patients described in Table 3 presented more gastro-intestinal problems and Table 2 Frequency of the mutations 3272-26A→G and L927P for different parts of Belgium and other countries Country/Region Frequency 3272-26A→G (%) Reference Belgium/Antwerp 3.8 This study Belgium/Brussels 1.7 W. Lissens, pers. comm. Belgium/Ghent 0.9 L. Messiaen, pers. comm. Belgium/Leuven 1.0 [14] The Netherlands 0.9 H. Scheffer, pers. comm. France 0.5 [15-17] Germany 0.9 [18] Greece 0.8 [19,20] Spain 0.5 [21] Canada (Toronto) 0.5 [22] Portugal 2.0 [11] South Africa (white population) 4.2 [23] Frequency L927P (%) Belgium/Antwerp 2.4 This study Belgium/Brussels 0.7 W. Lissens, pers. comm. Belgium/Gent 0.3 L. Messiaen, pers. comm. The Netherlands 0.5 [13] Table 3 Clinical phenotypes of patients compound heterozygous for L927P and a second mutation Genotype (L927P/any) Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Patient 6 Second mutation ΔF508 ΔF508 ΔF508 ΔF508 1717-1GNA S1251N Sex Male Female Male Female Female Female Age at diagnosis 1 month (meconium ileus) ? Login to comment
81 We found L927P in 7 CF patients: four patients have ƊF508 as the second mutation, one patient 1717-1G࢐A, another patient S1251N, and a last patient 2789+ 5G࢐A. Login to comment
84 The patients described in Table 3 presented more gastro-intestinal problems and Table 2 Frequency of the mutations 3272-26A࢐G and L927P for different parts of Belgium and other countries Country/Region Frequency 3272-26A࢐G (%) Reference Belgium/Antwerp 3.8 This study Belgium/Brussels 1.7 W. Lissens, pers. comm. Belgium/Ghent 0.9 L. Messiaen, pers. comm. Belgium/Leuven 1.0 [14] The Netherlands 0.9 H. Scheffer, pers. comm. France 0.5 [15-17] Germany 0.9 [18] Greece 0.8 [19,20] Spain 0.5 [21] Canada (Toronto) 0.5 [22] Portugal 2.0 [11] South Africa (white population) 4.2 [23] Frequency L927P (%) Belgium/Antwerp 2.4 This study Belgium/Brussels 0.7 W. Lissens, pers. comm. Belgium/Gent 0.3 L. Messiaen, pers. comm. The Netherlands 0.5 [13] Table 3 Clinical phenotypes of patients compound heterozygous for L927P and a second mutation Genotype (L927P/any) Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Patient 6 Second mutation ƊF508 ƊF508 ƊF508 ƊF508 1717-1GNA S1251N Sex Male Female Male Female Female Female Age at diagnosis 1 month (meconium ileus) ? Login to comment

[hide] Mutational spectrum of cystic fibrosis patients fr... Mol Genet Metab. 2006 Apr;87(4):370-5. Epub 2006 Jan 19. Ramirez AM, Ramos MD, Jimenez J, Ghio A, de Botelli MM, Rezzonico CA, Marques I, Pereyro S, Casals T, de Kremer RD
Mutational spectrum of cystic fibrosis patients from Cordoba province and its zone of influence: implications of molecular diagnosis in Argentina.
Mol Genet Metab. 2006 Apr;87(4):370-5. Epub 2006 Jan 19., [PMID:16423550]

Abstract [show]
Cystic Fibrosis (CF) is an autosomal recessive disorder affecting 1/2000-4000 newborns in Caucasian populations. This lethal disease mainly affects respiratory and digestive organs as well as fertility in man. So far, the CF prevalence and mutational spectrum have showed specificity among populations and regions, making it necessary to establish them in each one. In this study, we present the spectrum and frequency of CFTR gene mutations in CF patients from Cordoba (a province with 3.1 millions inhabitants in the middle of Argentina) and its zone of influence, to offer an accurate genetic testing. The study includes 78 families in which 98 patients fulfilled clinical criteria to CF diagnosis. The strategy for the molecular diagnosis comprised analysis of 21 common mutations, microsatellite haplotypes and the complete CFTR gene analysis using scanning techniques followed by sequencing of the abnormal migration patterns. Our first step led us to the identification of 10 mutations that represented 76% of alleles. Another four mutations (p.R1066C, c.1811 + 1.6 kbA > G, c.711 + 1G > T, and p.G85E) were found based on the microsatellite haplotype-mutation association. Finally, 14 mutations were characterized after the CFTR gene scanning, three of them are not previously described (p.G27R, c.622-2A > G, and p.W277R). In summary, we have identified 27 mutations accounting for 94.23% of CF alleles. This characteristic mutational spectrum highlights the 14 most frequent mutations (>1%) in the Cordoba region.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 Mutations (p.F508del, p.N1303K, p.G542X, p.R334W, c.2789 + 5G > A, c.3659delC, p.R553X, c.3849 + 10kbC > T, p.R1162X, c.621 + 1G > T, p.W1282X, p.R117H, c.1078delT, p.E60X, p.R347P, p.A455E, p.I507del, c.1717-1G > A, p.G551D, [c.2183A > G; c.2184delA] and p.S1251N) were analyzed by heteroduplex analysis on polyacrylamide gel electrophoresis [11,12] and by ampliWcation refractory mutation system [13] in all 78 patients. Login to comment

[hide] Spectrum of mutations in CFTR in Finland: 18 years... J Cyst Fibros. 2005 Dec;4(4):233-7. Epub 2005 Jul 26. Kinnunen S, Bonache S, Casals T, Monto S, Savilahti E, Kere J, Jarvela I
Spectrum of mutations in CFTR in Finland: 18 years follow-up study and identification of two novel mutations.
J Cyst Fibros. 2005 Dec;4(4):233-7. Epub 2005 Jul 26., [PMID:16051530]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) is low in the isolated Finnish population and the Finnish CF mutation spectrum has differed from many European countries. METHODS: We have analyzed the mutation spectrum and the geographical distribution of CF mutations in Finland covering the last 18 years (1987-2004). RESULTS: A total of 14 mutations were identified; two of them new, 774insT and S589T (G>C at 1,898). The overall coverage of mutations was 97% (99/102 chromosomes). The most frequent mutations were F508del and 394delTT, found in 36% (37/102) and 35% (36/102) of the CF chromosomes respectively. Of the rare mutations, a mutation of presumable Slavic origin, CFTRdele2.3 (21 kb), was enriched in a rural isolate with a frequency of 5,9% (6/102), and a mutation that possibly indicates Swedish influence, 3659delC, was scattered throughout the country with a similar frequency of 5,9% (6/102). G542X, R1162X, R117H, 3732delA, 1,898 + 3A >C, S1196X, S945L, W57R, 774insT and S589T were each identified in a number of chromosomes from one to three. CONCLUSIONS: Our observations of the Finnish CF mutation spectrum fit well with the characteristics of Finland as a population of multiple local founder effects.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 The InnoLipa assay recognizes 36 mutations: E60X (c.178G>T, p.Glu60X), G85E (c.254G>A, p.Gly85- Glu), 394delTT, R117H (c.350G>A, p.Arg117His), I148T (c.443T>C, p.Ile148Thr), 621+1G>T (c.489+1G>T), 711+1G>T (c.579+1G>T), 711+5G>A (c.579+5G>A), 1078delT (c.948delT, p.Phe316fs), R334W (c.1000C>T, p.Arg334Trp), R347P (c.1040G>C, p.Arg347Pro), A455E (c.1364C>A, p.Ala455Glu), I507del (c.1519_1521delATC, p.Ile507del), F508del, 1717À1G>A (c.1585À1G>A), G542X, G551D (c.1652G >A, p.Gly551Asp), Q552X (c.1654C > T, p.Gln552X), R553X (c.1657C > T, p.Arg553X), R560T (1679G>vC, p.Arg560Thr), 1898+ 1G > A (c.1766 + 1G > A), 2143delT (c.2012delT, p.Leu671fs), 2183AA > G (c.2051_2052delAAinsG, p.Lys684fs), 2184delA (c.2052delA, p.Lys684fs), 2789+ 5G>A (c.2657+5G>A), 3120+1G>A (c.2988+1G>A), 3199del6 (c.3067_3072del, p.Ile1023_Val1024del), 3272À 26A > G (c.3140 À26A > G), R1162X (c.3484C > T, p.Arg1162X), 3849+10kbCYT, 3659delC (c.3528delC, p.Lys1177fs), S1251N (c.3752G > A, p.Ser1251Asn), 3905insT (c.3773dupT, p.Leu1258fs), W1282X (c.3846G> A, p.Trp1282X), N1303K (c.3909C>G, p.Asn1303Lys), CFTRdele2,3(21kb) and Tn-polymorphism on intron 8. Login to comment
37 The InnoLipa assay recognizes 36 mutations: E60X (c.178G>T, p.Glu60X), G85E (c.254G>A, p.Gly85Glu), 394delTT, R117H (c.350G>A, p.Arg117His), I148T (c.443T>C, p.Ile148Thr), 621+1G>T (c.489+1G>T), 711+1G>T (c.579+1G>T), 711+5G>A (c.579+5G>A), 1078delT (c.948delT, p.Phe316fs), R334W (c.1000C>T, p.Arg334Trp), R347P (c.1040G>C, p.Arg347Pro), A455E (c.1364C>A, p.Ala455Glu), I507del (c.1519_1521delATC, p.Ile507del), F508del, 1717 1G>A (c.1585 1G>A), G542X, G551D (c.1652G >A, p.Gly551Asp), Q552X (c.1654C > T, p.Gln552X), R553X (c.1657C > T, p.Arg553X), R560T (1679G>vC, p.Arg560Thr), 1898+ 1G > A (c.1766 + 1G > A), 2143delT (c.2012delT, p.Leu671fs), 2183AA > G (c.2051_2052delAAinsG, p.Lys684fs), 2184delA (c.2052delA, p.Lys684fs), 2789+ 5G>A (c.2657+5G>A), 3120+1G>A (c.2988+1G>A), 3199del6 (c.3067_3072del, p.Ile1023_Val1024del), 3272 26A > G (c.3140 26A > G), R1162X (c.3484C > T, p.Arg1162X), 3849+10kbCYT, 3659delC (c.3528delC, p.Lys1177fs), S1251N (c.3752G > A, p.Ser1251Asn), 3905insT (c.3773dupT, p.Leu1258fs), W1282X (c.3846G> A, p.Trp1282X), N1303K (c.3909C>G, p.Asn1303Lys), CFTRdele2,3(21kb) and Tn-polymorphism on intron 8. Login to comment

[hide] Hyperechogenic fetal bowel: counseling difficultie... Eur J Med Genet. 2005 Oct-Dec;48(4):421-5. Marcus-Soekarman D, Offermans J, Van den Ouweland AM, Mulder AL, Muntjewerff N, Vossen M, Kleijer W, Schrander-Stumpel C, Dooijes D
Hyperechogenic fetal bowel: counseling difficulties.
Eur J Med Genet. 2005 Oct-Dec;48(4):421-5., [PMID:16378926]

Abstract [show]
The detection of echodense fetal bowel on ultrasound examination in the second trimester of pregnancy justifies invasive procedures such as amniocentesis to detect an underlying cause. We present a case in which initial tests identified only one mutation in the cystic fibrosis transmembrane regulator (CFTR)-gene of the fetus, the family history being negative for CF. Strongly reduced intestinal enzyme activities suggested intestinal obstruction and further increased the estimated risk for CF. After the 24th gestational week, a second mutation was found, confirming cystic fibrosis in this child. Problems in counseling in this particular case are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Routine CFTR-mutation analysis, using Table 1 CFTR-mutations screened for in the first step E60X 2143delT G542X G85E 2183AA-G G551D 394delTT 2184delA Q552X 621 + 1G-T 2789 + 5G-A R553X R117H 3849 + 10kbC-T R560T 711 + 5G-A R1162X S1251N 1078delT 3659delC 390insT R334W delta I507 W1282X R347P delta F508 N1303K A455E 1717-1G-A a panel of 29 CFTR-mutations, detects only 41.6% of CFTR-mutations in the Turkish population [1]. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Table 1. Continued CFTR location Amino acid change Nucleotide change 141 IVS 16 Splicing defect 3120 ϩ 1GϾA 142 IVS 16 Splicing defect 3121 - 2AϾG 143 IVS 16 Splicing defect 3121 - 2AϾT 144 E 17a Frameshift 3132delTG 145 E 17a I1005R 3146TϾG 146 E 17a Frameshift 3171delC 147 E 17a Frameshift 3171insC 148 E 17a del V1022 and I1023 3199del6 149 E 17a Splicing defect 3271delGG 150 IVS 17a Possible splicing defect 3272 - 26AϾG 151 E 17b G1061R 3313GϾC 152 E 17b R1066C 3328CϾT 153 E 17b R1066S 3328CϾA 154 E 17b R1066H 3329GϾA 155 E 17b R1066L 3329GϾT 156 E 17b G1069R 3337GϾA 157 E 17b R1070Q 3341GϾA 158 E 17b R1070P 3341GϾC 159 E 17b L1077P 3362TϾC 160 E 17b W1089X 3398GϾA 161 E 17b Y1092X (TAA) 3408CϾA 162 E 17b Y1092X (TAG) 3408CϾG 163 E 17b L1093P 3410TϾC 164 E 17b W1098R 3424TϾC 165 E 17b Q1100P 3431AϾC 166 E 17b M1101K 3434TϾA 167 E 17b M1101R 3434TϾG 168 IVS 17b 3500 - 2AϾT 3500 - 2AϾT 169 IVS 17b Splicing defect 3500 - 2AϾG 170 E 18 D1152H 3586GϾC 171 E 19 R1158X 3604CϾT 172 E 19 R1162X 3616CϾT 173 E 19 Frameshift 3659delC 174 E 19 S1196X 3719CϾG 175 E 19 S1196T 3719TϾC 176 E 19 Frameshift and K1200E 3732delA and 3730AϾG 177 E 19 Frameshift 3791delC 178 E 19 Frameshift 3821delT 179 E 19 S1235R 3837TϾG 180 E 19 Q1238X 3844CϾT 181 IVS 19 Possible splicing defect 3849 ϩ 4AϾG 182 IVS 19 Splicing defect 3849 ϩ 10 kb CϾT 183 IVS 19 Splicing defect 3850 - 1GϾA 184 E 20 G1244E 3863GϾA 185 E 20 G1244V 3863GϾT 186 E 20 Frameshift 3876delA 187 E 20 G1249E 3878GϾA 188 E 20 S1251N 3884GϾA 189 E 20 T1252P 3886AϾC 190 E 20 S1255X 3896CϾA and 3739AϾG in E19 191 E 20 S1255L 3896CϾT 192 E 20 Frameshift 3905insT 193 E 20 D1270N 3940GϾA 194 E 20 W1282R 3976TϾC 195 E 20 W1282X 3978GϾA 196 E 20 W1282C 3978GϾT 197 E 20 R1283M 3980GϾT 198 E 20 R1283K 3980GϾA 199 IVS 20 Splicing defect 4005 ϩ 1GϾA 200 E 21 Frameshift 4010del4 201 E 21 Frameshift 4016insT 202 E 22 Inframe del E21 del E21 203 E 21 N1303K 4041CϾG 204 E 24 Frameshift 4382delA Genomic and Synthetic Template Samples Where possible, native genomic DNA was collected. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] High heterogeneity of CFTR mutations and unexpecte... J Cyst Fibros. 2004 Dec;3(4):265-72. des Georges M, Guittard C, Altieri JP, Templin C, Sarles J, Sarda P, Claustres M
High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France.
J Cyst Fibros. 2004 Dec;3(4):265-72., [PMID:15698946]

Abstract [show]
In this report, we present updated spectrum and frequency of mutations of the CFTR gene that are responsible for cystic fibrosis (CF) in Languedoc-Roussillon (L-R), the southwestern part of France. A total of 75 different mutations were identified by DGGE in 215 families, accounting for 97.6% of CF genes and generating 88 different mutational genotypes. The frequency of p.F508del was 60.23% in L-R versus 67.18% in the whole country and only five other mutations (p.G542X, p.N1303K, p.R334W, c.1717-1G>A, c.711+1G>T) had a frequency higher than 1%. The mutations were scattered over 20 exons or their border. This sample representing only 5.7% of French CF patients contributed to 24% of CFTR mutations reported in France. This is one of the highest molecular allelic heterogeneity reported so far in CF. We also present the result of a neonatal screening program based on a two-tiered approach "IRT/20 mutations/IRT" analysis on blood spots, implemented in France with the aim to improve survival and quality of life of patients diagnosed before clinical onset. This 18-month pilot project showed an unexpected low incidence of CF (1/8885) in South of France, with only six CF children detected among 43,489 neonates born in L-R, and 13 among 125,339 neonates born in Provence-Alpes-Cote-d'Azur (PACA).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 The 20 most common mutations responsible for CF worldwide were investigated by amplification refractory mutation system (ARMS) and migration on agarose gel (Kit Elucigene CF20, including mutations c.1717-1GNA, p.G542X, p.W1282X, p.N1303K, p.F508del, c.3849+10kbCNT, c.621+1GNT, p.R553X, p.G551D, p.R117H, p.R1162X, p.R334W, p.A455E, c.2183AANG, c.3659delC, c.1078delT, p.I507del, p.R347P, p.S1251N, p.E60X). Login to comment
131 The panel of 30 mutations (c.1717-1GNA, p.G542X, p.W1282X, p.N1303K, p.F508del, c.3849+10kbCNT, c.621+1GNT, p.R553X, p.G551D, p.R117H, p.R1162X, p.R334W, p.A455E, c.2183AANG, c.3659delC, c.1078delT, p.I507del, p.R347P, p.S1251N, p.E60X, p.Y1092X, c.394delTT, c.1811+1.6kbANG, c.3272-26ANG, c.2789+5GNA, c.3120+1GNA, c.711+ 1GNT, p.G85E, p.Y122X, p.W846X) should account for 83.32% of the CF alleles in L-R and 84.25% in the whole country. Login to comment

[hide] Genotype and phenotype correlations in patients wi... Gastroenterology. 2002 Dec;123(6):1857-64. Durno C, Corey M, Zielenski J, Tullis E, Tsui LC, Durie P
Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis.
Gastroenterology. 2002 Dec;123(6):1857-64., [PMID:12454843]

Abstract [show]
BACKGROUND & AIMS: Pancreatitis is known to occur in some patients with cystic fibrosis (CF), but the prevalence, natural history, and genotypic basis are unclear. We examined a well-defined cohort of patients with CF to answer these questions. METHODS: Patients with CF were identified from a computerized database (1966-1996). Chart audit identified all patients with CF and pancreatitis. RESULTS: Among 1075 patients with CF, 937 (87%) were pancreatic insufficient at diagnosis, 28 (3%) were pancreatic sufficient but developed pancreatic insufficiency after diagnosis, and 110 (10%) have remained pancreatic sufficient. No patients with pancreatic insufficiency developed pancreatitis. Nineteen patients (17.3%) with pancreatic sufficiency experienced one or more attacks of pancreatitis. The mean age at diagnosis of pancreatitis was 22.7 +/- 10.3 years (range, 10-35 years), and pancreatitis was recognized before the diagnosis of CF in 6 patients (32%). The diagnosis of CF in pancreatic-sufficient patients, with and without pancreatitis, was established at a significantly older age than in those with pancreatic insufficiency (P < 0.0001). Genotyped patients with pancreatic insufficiency carried 2 severe mutant alleles. All genotyped patients with pancreatic sufficiency and pancreatitis carried at least one mild mutation. No specific genotype was predictive of pancreatitis. CONCLUSIONS: Patients with CF with pancreatic sufficiency carry at least one mild mutant allele and are at a significant risk of developing pancreatitis. Symptoms of pancreatitis may precede the diagnosis of CF. Pancreatitis is associated with an otherwise mild CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 CFTR Genotypes Among CF Patients With PS With and Without Pancreatitis Two mutations (n) ⌬F508/R117H (9) ⌬F508/(5T) (6) ⌬F508/3272-26A 3 G (4) ⌬F508/R347H (2) ⌬F508/P574H (2) ⌬F508/875 ϩ 1G Ͼ C (2) ⌬F508/3849 ϩ 10kb C 3 T (1) ⌬F508/A455E (1) ⌬F508/D614G (1) ⌬F508/G85E (1) ⌬F508/R347P (1) ⌬F508/S1251N (1) ⌬F508/⌬F508a (1) ⌬F508/3120G Ͼ A (1) ⌬F508/G551Da (1) G542X/R117H (1) R560T/L206W (1) R117H/R117H (1) R31L/P67L (1) 1461ins4 (AGAT)/G85E (1) G551D/(5T) (1) R1066C/3849 ϩ 10kb C Ͼ T (1) G551D/3849 ϩ 10kb C Ͼ T (1) R334W/R334W (1) R334W/681delC (1) W1282X/3489 ϩ 10kb C Ͼ T (1) One mutation (n) ⌬F508/- (18) L1077P/- (1) W1282X/- (1) M1137V/- (1) G551D/- (1) R347H/- (1) Q30X1/- (1) G1244E/- (1) R117H/- (1) 621 ϩ 2G621 ϩ 1G 3 T/- (1) NOTE. Login to comment
124 of episodes of pancreatitis Genotype 1 0.3 12 21.7 2 ⌬F508/S1251N 2 0.3 34 30.0 1 ⌬F508/R347H 3 4.4 13 42.5 3 / 4 4.4 21 36.5 1 ⌬F508/ 5 7.3 26 40.8 10 ⌬F508/P67L 6 9.6 29 29.9 (D) 1 ⌬F508/ 7 12.0 18 39.9 1 ⌬F508/R347P 8 12.9 37 40.9 2 G542X/D1152H 9 13.0 30 50.3 1 ⌬F508/3849 ϩ 10Kbc Ͼ T 10 14.7 13 21.5 1 DF508/R117H 11 15.6 34 40.8 1 ⌬F508/2789ϩ5G Ͼ T 12 15.6 10 26.0 10 ⌬F508/R117H 13 16.0 10 22.0 14 ⌬F/508/3849 ϩ 10kbC Ͼ T 14 16.0 18 21.2 (D) 1 R1066C/3849 ϩ 10kbC Ͼ T 15 19.9 15 40.8 5 No DNA 16 23.2 19 23.2 15 ⌬F508/11234V 17 24.1 40 47.6 (D) 1 No DNA 18 26.9 25 43.3 12 No DNA 19 27.4 35 50.3 (D) 2 ⌬F508/A455E NOTE. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 b 3905insT, 1811+1.6kbA>G, S945L, S1251N, Y122X, 2711delT, R117H, E60X, 2184insA, E585X, L558S, S1235R, D1152H, K710X, Q493X, A455E, G178R, I148T, 574delA. Login to comment

[hide] Genotype-phenotype correlations for the paranasal ... Am J Respir Crit Care Med. 1999 May;159(5 Pt 1):1412-6. Jorissen MB, De Boeck K, Cuppens H
Genotype-phenotype correlations for the paranasal sinuses in cystic fibrosis.
Am J Respir Crit Care Med. 1999 May;159(5 Pt 1):1412-6., [PMID:10228103]

Abstract [show]
Genotype-phenotype correlations in cystic fibrosis (CF) have been found for lung and pancreatic function, but not for paranasal sinus disease. Because such correlations may have pathophysiological and clinical implications, the correlation of mutations, in particular DeltaF508, with paranasal sinus disease was investigated in 113 CF patients with known genotype. The clinical importance of paranasal sinus disease was evaluated using three parameters: polyps, overall clinical severity of upper airway problems, and surgery. Polyps were evaluated by nasal endoscopy and graded on a five-point scale. Four severity groups were distinguished based on history, clinical records, and examination: no upper airway problems; more problems than in control subjects; severe, recurrent or chronic problems; and paranasal sinus surgery cases. DeltaF508 homozygosity correlated with clinical severity (p < 0.02) and with the presence of polyps on endoscopy (p < 0.05). The relative risk for paranasal sinus surgery in DeltaF508 homozygous CF patients was 2.33. In conclusion, there are genotype-phenotype correlations for paranasal sinus disease in CF. DeltaF508 homozygosity is a risk factor for paranasal sinus disease in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 of Patients in Surgical Group ⌬F508 Genotype Homozygosity 69 61 22 Compound heterozygosity 33 29 5 Negative 11 10 1 Mutations ⌬F508 171 75.7 27 Non-⌬F508 55 24.3 6 R117H (4) C276X (1) 394delT (1) W401X (2,† ) A455E (1) G542X (4,‡ ) G551D (1) R553X (1) G628R(G→C) (1) Y1092X (1) D1152H (1) S1251N (1) W1282X (3) N1303K (8) W1310X (1) 1717-1G→A (3,† ) 1898ϩ1G→C (1) 2183AA-G (3,†† ) 3659delC (2) 3272-26A→G (2,† ) 4218-insT (2) unknown (11,‡ ) * The genotype and mutations are given for the 113 patients with CF. Login to comment
121 of Patients in Surgical Group DF508 Genotype Homozygosity 69 61 22 Compound heterozygosity 33 29 5 Negative 11 10 1 Mutations DF508 171 75.7 27 Non-DF508 55 24.3 6 R117H (4) C276X (1) 394delT (1) W401X (2,ߤ ) A455E (1) G542X (4,ߥ ) G551D (1) R553X (1) G628R(G࢐C) (1) Y1092X (1) D1152H (1) S1251N (1) W1282X (3) N1303K (8) W1310X (1) 1717-1G࢐A (3,ߤ ) 189811G࢐C (1) 2183AA-G (3,ߤߤ ) 3659delC (2) 3272-26A࢐G (2,ߤ ) 4218-insT (2) unknown (11,ߥ ) * The genotype and mutations are given for the 113 patients with CF. Login to comment

[hide] Correlation of sweat chloride concentration with g... Clin Biochem. 1998 Feb;31(1):33-6. De Braekeleer M, Allard C, Leblanc JP, Aubin G, Simard F
Correlation of sweat chloride concentration with genotypes in cystic fibrosis patients in Saguenay Lac-Saint-Jean, Quebec, Canada.
Clin Biochem. 1998 Feb;31(1):33-6., [PMID:9559222]

Abstract [show]
OBJECTIVES: Saguenay Lac-Saint-Jean, a geographically isolated region of northeastern Quebec has a high incidence of cystic fibrosis (CF) and three mutations only account for 94% of the CF chromosomes. The objective of the present study was to determine whether different mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene had different effects upon the sweat chloride concentration. DESIGN AND METHODS: The sweat chloride concentration of 114 patients was measured by quantitative pilocarpine iontophoresis. RESULTS: CF patients carrying the A455E mutation, usually associated with pancreatic sufficiency, had lower sweat chloride concentrations than those carrying mutations associated with pancreatic insufficiency (delta F508 and 621 + 1G-->T). CONCLUSIONS: Our results confirm that mutations resulting in a reduction of the chloride current at the apical membrane of epithelial cells induce lower sweat chloride values. However, there are differences in the chloride current between genotypes, even if they are composed of mutations apparently having the same functional effect.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Class IV mutations result in a reduction in the amount of chloride current (e.g., R117H, R347P, S1251N mutations) while class V mutations result in a reduction in the amount of a normally functioning CFTR protein (e.g., A455E, 3849ϩ10kbC3T mutations). Login to comment
60 Class IV mutations result in a reduction in the amount of chloride current (e.g., R117H, R347P, S1251N mutations) while class V mutations result in a reduction in the amount of a normally functioning CFTR protein (e.g., A455E, 3849110kbC3T mutations). Login to comment

[hide] Distinct spectrum of CFTR gene mutations in congen... Hum Genet. 1997 Sep;100(3-4):365-77. Dork T, Dworniczak B, Aulehla-Scholz C, Wieczorek D, Bohm I, Mayerova A, Seydewitz HH, Nieschlag E, Meschede D, Horst J, Pander HJ, Sperling H, Ratjen F, Passarge E, Schmidtke J, Stuhrmann M
Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens.
Hum Genet. 1997 Sep;100(3-4):365-77., [PMID:9272157]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a frequent cause for obstructive azoospermia and accounts for 1%-2% of male infertility. A high incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has recently been reported in males with CAVD. We have investigated a cohort of 106 German patients with congenital bilateral or unilateral absence of the vas deferens for mutations in the coding region, flanking intron regions and promotor sequences of the CFTR gene. Of the CAVD patients, 75% carried CFTR mutations or disease-associated CFTR variants, such as the "5T" allele, on both chromosomes. The distribution of mutation genotypes clearly differed from that observed in cystic fibrosis. None of the CAVD patients was homozygous for delta F508 and none was compound heterozygous for delta F508 and a nonsense or frameshift mutation. Instead, homozygosity was found for a few mild missense or splicing mutations, and the majority of CAVD mutations were missense substitutions. Twenty-one German CAVD patients were compound heterozygous for delta F508 and R117H, which was the most frequent CAVD genotype in our study group. Haplotype analysis indicated a common origin for R117H in our population, whereas another frequent CAVD mutation, viz. the "5T allele" was a recurrent mutation on different intragenic haplotypes and multiple ethnic backgrounds. We identified a total of 46 different mutations and variants, of which 15 mutations have not previously been reported. Thirteen novel missense mutations and one unique amino-acid insertion may be confined to the CAVD phenotype. A few splice or missense variants, such as F508C or 1716 G-->A, are proposed here as possible candidate CAVD mutations with an apparently reduced penetrance. Clinical examination of patients with CFTR mutations on both chromosomes revealed elevated sweat chloride concentrations and discrete symptoms of respiratory disease in a subset of patients. Thus, our collaborative study shows that CAVD without renal malformation is a primary genital form of cystic fibrosis in the vast majority of German patients and links the particular expression of clinical symptoms in CAVD with a distinct subset of CFTR mutation genotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level. Login to comment

[hide] False-positive results of genetic testing in cysti... J Pediatr. 1997 Apr;130(4):658-60. Warren WS, Hamosh A, Egan M, Rosenstein BJ
False-positive results of genetic testing in cystic fibrosis.
J Pediatr. 1997 Apr;130(4):658-60., [PMID:9108869]

Abstract [show]
We describe a patient in whom newborn immunoreactive trypsin screening and mutation analysis suggested a diagnosis of cystic fibrosis; however, the clinical course and sweat test results were not consistent with the diagnosis. Direct sequencing of the patient's genomic DNA showed compound heterozygosity for delta F508 and F508C, a polymorphism not associated with clinical disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Two German patients with CF were found to carry AF508 on one allele and both F508C and the S1251N mutation on the other allele.11 Several states and districts screen newborn infants for CF because of its high incidence.l'~Screening programs use an assay for rRT, a pancreatic enzyme precursor that is persistently elevated in the blood of infants with CF. Login to comment
33 Two German patients with CF were found to carry AF508 on one allele and both F508C and the S1251N mutation on the other allele.11 Several states and districts screen newborn infants for CF because of its high incidence.l'~Screening programs use an assay for rRT, a pancreatic enzyme precursor that is persistently elevated in the blood of infants with CF. Login to comment

[hide] Genotype-phenotype relationships in a cohort of ad... Eur Respir J. 1996 Nov;9(11):2207-14. Hubert D, Bienvenu T, Desmazes-Dufeu N, Fajac I, Lacronique J, Matran R, Kaplan JC, Dusser DJ
Genotype-phenotype relationships in a cohort of adult cystic fibrosis patients.
Eur Respir J. 1996 Nov;9(11):2207-14., [PMID:8947061]

Abstract [show]
In cystic fibrosis (CF), relationships between genotype and phenotype have been shown for pancreatic status but not for pulmonary disease. One hundred and ten adult CF patients were classified according to the expected effect of their mutations on cystic fibrosis transmembrane conductance regulator (CFTR) protein: Group 1 (n=48) included deltaF508 homozygotes; Group 2 (n=26), patients with two "severe" mutations and no expected CFTR production; Group 3 (n=17), patients with expected partly functional CFTR corresponding to at least one "mild" mutation; Group 4 (n=19), patients with no mutation identified or only one identified "severe" mutation. As compared to Groups 1 and 2: patients from Groups 3 and 4 had higher arterial oxygen tension (Pa,O2) (9.5+/-1.9 and 9.9+/-1.5 vs 8.8+/-1.5 and 8.3+/-1.7 kPa, respectively p<0.02); and a slower decline in their pulmonary function, estimated by the mean annual loss in forced vital capacity (FVC) (1.2+/-1.0 and 1.5+/-1.1 vs 2.0+/-0.9 and 2.2+/-1.0%, respectively; p<0.01) and in forced expiratory volume in one second (FEV1) (1.7+/-1.1 and 1.9+/-1.3 vs 2.6+/-1.0 and 2.8+/-1.0%, respectively; p<0.005). They had fewer episodes of colonization of the airways by Pseudomonas aeruginosa, and colonization occurred at a more advanced age (median age 25 and 19 vs 15 and 17 yrs, respectively; p<0.01) and required fewer intravenous antibiotic courses (p<0.01). Pancreatic insufficiency was less frequent in Groups 3 (23%) and 4 (63%) than in Groups 1 (100%) and 2 (96%). This study suggests that the phenotype of adult cystic fibrosis patients, including the severity of the lung disease, is related to the severity of the cystic fibrosis transmembrane conductance regulator mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 - Genotype of the 110 CF patients: details of the CF mutations and classification into four groups Genotype Genotype Pts groups n 1 ∆F508/∆F508 48* 2 ∆F508/G542X 6 ∆F508/E827X 3† ∆F508/R553X 2 ∆F508/W1282X 2 ∆F508/E595X 1 ∆F508/E60X 1 ∆F508/W846X 1 ∆F508/1078delT 1 ∆F508/2143delT 1 ∆F508/2347delG 1 ∆F508/3659delC 1 ∆F508/4382delA 1 ∆F508/2183 AA→G 1 ∆F508/1717-1 G→A 1 ∆F508/1811+1.6 kb A→G 1 E595X/Y1092X 1 1717-1 G→A/1078delT 1 3 ∆F508/I336K 1 ∆F508/G27E 1 ∆F508/D192N 1 ∆F508//I980K 1 ∆F508/P205S 1 ∆F508/2789+5 G→A 1 ∆F508/3272-26 A→G 1 G542X/3849+10 kb C→T 2‡ G542X/2789+5 G→A 1 W361R/297-3 C→T 1 G551D/1717-1 G→A 1 N1303H/2183 AA→G 1 2789+5 G→A/2183 AA→G 1 R1070Q/D1152H 1 R1070Q/unidentified 1 S1251N/unidentified 1 4 ∆F508/unidentified 7 ∆I507/unidentified 2 1811+1.6 kb A→G/unidentified 1 1161delC/unidentified 1 unidentified/unidentified 8 *: two patients are brothers; †: three brothers; ‡: two sisters. Login to comment

[hide] Genetic and clinical features of patients with cys... Thorax. 1995 Dec;50(12):1301-4. Gan KH, Geus WP, Bakker W, Lamers CB, Heijerman HG
Genetic and clinical features of patients with cystic fibrosis diagnosed after the age of 16 years.
Thorax. 1995 Dec;50(12):1301-4., [PMID:8553305]

Abstract [show]
BACKGROUND: Cystic fibrosis is usually diagnosed in childhood, but a number of patients are not diagnosed until adulthood. The aim of this study was to investigate whether patients diagnosed at an older age had a different genetic constitution, manifestations of disease, and prognosis from those diagnosed at an early age. METHODS: Clinical data and results of lung function tests and DNA analysis of 143 adult patients with cystic fibrosis were entered into a computerised database. Patients diagnosed before their 16th birthday (early diagnosis, ED) were compared with those diagnosed at 16 years of age or older (late diagnosis, LD). RESULTS: Mean age of diagnosis of the ED group was 4.6 years compared with 27.7 years for the LD group. Mean (SD) percentage predicted pulmonary function was better for the LD group than for the ED group: forced expiratory volume in one second (FEV1) 72.5 (31.1)% and 52.0 (24.8)%, and forced vital capacity (FVC) 89.8 (25.7)% and 71.9 (23.0)%, respectively. Colonisation with Pseudomonas aeruginosa was present in 70% of the ED group and 24% of the LD group. In the ED group 81% had pancreatic insufficiency compared with only 12% of the LD group. None of the LD group was homozygous for delta F508 compared with 58% of the ED group. In the LD group 72% were compound AF508 heterozygotes and 28% had two non-delta F508 mutations. CONCLUSIONS: Among this group of 143 adult patients with cystic fibrosis late diagnosis is caused mainly by delayed expression and mild progression of clinical symptoms. Late diagnosis is associated with milder pulmonary disease, less pancreatic insufficiency, and different cystic fibrosis mutations. Since mortality in cystic fibrosis depends on the progression of pulmonary disease, patients with a late diagnosis have a better prognosis than those diagnosed early.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 DNA was analysed for the following mutations: E60X, R117H, A455E, AI507, AF508, G542X, S549N, G550X, G551D, R553X, R560T, R1162X, S1251N, W1282X, N1303K, 621 + 1G-+T, 1717-1G--+A. These mutations represent 80% ofthe expected cystic fibrosis mutations in The Netherlands. Login to comment
65 Table 3 CFTR mutations in 278 chromosomes of adult cystic fibrosis patients Early diagnosis Late diagnosis (n= 118) (n=25) n % n % AF508s 175 74-2 18 36-0 A455Em 12 5-1 14 28-0 1717-15 6 2-5 1 2-0 G542X' 4 1-7 - W1282X1 3 1-3 - R553X' 1 04 1 2-0 S1251N 2 0-8 - N1303K' 1 0 4 - E60X 1 0-4 3 6-0 Not identified 31 13-2 13 26-0 Total 236 50 Mutations not found: RI 17H, AI507, S549N, G550X, G551D, R560T, R1162X, 621+1G-+T. Login to comment

[hide] Correlation of sweat chloride concentration with c... J Pediatr. 1995 Nov;127(5):705-10. Wilschanski M, Zielenski J, Markiewicz D, Tsui LC, Corey M, Levison H, Durie PR
Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations.
J Pediatr. 1995 Nov;127(5):705-10., [PMID:7472820]

Abstract [show]
OBJECTIVE: To compare differences in epithelial chloride conductance according to class of mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. METHODS: We evaluated the relationship between the functional classes of CFTR mutations and chloride conductance using the first diagnostic sweat chloride concentration in a large cystic fibrosis (CF) population. RESULTS: There was no difference in sweat chloride value value between classes of CFTR mutations that produce no protein (class I), fail to reach the apical membrane because of defective processing (class II), or produce protein that fails to respond to cyclic adenosine monophosphate (class III). Those mutations that produce a cyclic adenosine monophosphate-responsive channel with reduced conductance (class IV) were associated with a significantly lower, intermediate sweat chloride value. However, patients with the mutations that cause reduced synthesis or partially defective processing of normal CFTR (class V) had sweat chloride concentrations similar to those in classes I to III. CONCLUSION: Studies of differences in chloride conductance between functional classes of CFTR mutations provide insight into phenotypic expression of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles. Login to comment

[hide] Search for mutations in pancreatic sufficient cyst... Hum Genet. 1995 Sep;96(3):312-8. Brancolini V, Cremonesi L, Belloni E, Pappalardo E, Bordoni R, Seia M, Russo S, Padoan R, Giunta A, Ferrari M
Search for mutations in pancreatic sufficient cystic fibrosis Italian patients: detection of 90% of molecular defects and identification of three novel mutations.
Hum Genet. 1995 Sep;96(3):312-8., [PMID:7544319]

Abstract [show]
A cohort of 31 cystic fibrosis patients showing pancreatic sufficiency and bearing an unidentified mutation on at least one chromosome was analyzed through denaturing gradient gel electrophoresis of the whole coding region of the cystic fibrosis transmembrane conductance regulator gene, including intron-exon boundaries. Three new and 19 previously described mutations were detected. The combination of these with known mutations detected by other methods, allowed the characterization of mutations on 56/62 (90.3%) chromosomes. Among those identified, 17 can be considered responsible for pancreatic sufficiency, since they were found in patients carrying a severe mutation on the other chromosome. Among these presumed mild mutations, eight were detected more than once, R352Q being the most frequent in this sample (4.83%). Intragenic microsatellite analysis revealed that the six chromosomes still bearing unidentified mutations are associated with five different haplotypes. This may indicate that these chromosomes bear different mutations, rarely occurring among cystic fibrosis patients, further underlying the molecular heterogeneity of the genetic defects present in patients having pancreatic sufficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The remaining 19 included R352Q (Cremonesi et al. 1992) (three chromosomes), G85E (Zielenski et al. 1991a), Dl152H (High- Fig. 1 A-C Direct sequencing of PCR products from three cystic fibrosis patients (CF) carrying the W57G (A), E193K (B) and D579G (C) mutations, in parallel with control samples (C) displaying normal sequences (N/N) smith et al., personal communication to the CF Genetic Analysis Consortium), R1066H (Ferec et al. 1992), T338I (Saba et al. 1993), 711 +5G--+A (Gasparini et al., personal communication to the CF Genetic Analysis Consortium), M1V (Cheadle et al. 1993), R334W (Gasparini et al. 1991) (two chromosomes each), 4382delA (Claustres et al. 1993), R1158X (Ronchetto et al. 1992), F1052V (Mercier et al. 1993), G1349D (Beaudet et al. 1991), 1898+3A-+G (Cremonesi et al. 1992), $549N (Cutting et al. 1990), 711+ 3A-->G (Petreska et al. 1994), R347P (Dean et al. 1990), 2789+5G--+A (Highsmith et al. 1990), R1066C (Fanen et al. 1992) and S1251N (K~ilin et al. 1992) (one chromosome each). Login to comment
70 (UN yet unidentified mutation) Patient Genotype after Genotype at the end number preliminary screening of the analysis UN/UN M1V/4382delA 1717-1G---~A/UN 1717-1G---~A/R1066H AF508/UN AF508/D579G UN/UN M1V/UN AF508/UN AF508/UN UN/UN T338I/R1158X UN/UN G85E/71 I+5G---~A UN/UN D1152H/UN AF508/UN AF508/UN AF508/UN AF508/3849+ 10kbC---~T UN/UN 711+3A---~G/UN AF508/UN AF508/F1052V UN/UN R352Q/W57G UN/UN 1898+3A----~G/UN AF508/UN AF508/711+5G--~A G542X/UN G542X/DI 152H AF508/UN AF508/E193K 1717-1G---~A/UN 1717-1G---~A/2789+5A---)G AF508/UN AF508/G1349D AF508/UN AF508/G85E AF508/UN AF508/R347P AF508/UN AF508/R352Q AF508/UN AF508/R352Q AF508/UN AF508/S549N G542X/UN G542X/R1066H AF508/UN AF508/T338I AF508/UN AF508/R334W AF508/UN AF508/R334W AF508/UN AF508/S1251N AF508/UN AF508/R1066C AF508/UN AF508/D579G results) while the remaining three haplotypes had been found in association with other rare mutations, which were excluded by DGGE analysis in these patients (Table 3). Login to comment
85 In total, among the mutations detected in our PS patients, 17 (D579G, E193K, F1052V, 711+5G---~A, G1349D, G85E, R347R R352Q, $549N, 2789+5A---~G, D1152H, R1066H, R334W, T338I, 3849+10kbC---~T, S1251N, R1066C) have been detected in compound heterozygosity with a mutation already classified as severe (AF508, 1717-1G--~A, G542X) and thus can be considered as presumably mild. Login to comment
87 R1066C R1066H F1052V 2789+5A->G D1152H 14a14b 15 1617a 17b 18 19 S1251N ItKbC->T G1349D m III! Login to comment
88 20 21 22 23 24 MEMBRANE SPANNING ATP R DOMAIN MEMBRANE SPANNING ATP BINDING BINDING tide binding folds ($549N and D579G in the NBF I, G1349D and S1251N in the NBF II) and one in intron 19 (3849+10kbC--~T), further confirming that the milder defects mostly affect the membrane spanning domains with a greater incidence on the I TM (Fig. 2). Login to comment

[hide] Identification of seven rather infrequent and one ... Hum Mol Genet. 1994 Dec;3(12):2249-50. Teng H, Cuppens H, De Boeck C, Cassiman JJ
Identification of seven rather infrequent and one novel CFTR mutation in the Belgian population.
Hum Mol Genet. 1994 Dec;3(12):2249-50., [PMID:7881429]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Five mutations had a frequency higher than 1%: AF508 (72.5%), G542X (5.5%), N1303K (3.5%), 1717-1G-A (2.5%) and S1251N (2.0%). Login to comment

[hide] Detection of more than 50 different CFTR mutations... Hum Genet. 1994 Nov;94(5):533-42. Dork T, Mekus F, Schmidt K, Bosshammer J, Fislage R, Heuer T, Dziadek V, Neumann T, Kalin N, Wulbrand U, et al.
Detection of more than 50 different CFTR mutations in a large group of German cystic fibrosis patients.
Hum Genet. 1994 Nov;94(5):533-42., [PMID:7525450]

Abstract [show]
We have conducted a comprehensive study of the molecular basis of cystic fibrosis (CF) in 350 German CF patients. A screening approach based on single-strand conformation analysis and direct sequencing of genomic polymerase chain reaction products has allowed us to detect the molecular defects on 95.4% of the CF chromosomes within the coding region and splice sites of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The spectrum of sequence changes comprises 54 different mutations, including 17 missense mutations, 14 nonsense mutations, 11 frameshift mutations, 10 splice site variants and two amino acid deletions. Eleven of these mutations have not previously been described. Our results reflect the marked mutational heterogeneity of CF in a large sample of patients from a non-isolated population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 a Detection of mutations in exon 20 (HphI fragment): 3850-3 T-eG (lane 3), S1251N (lane 4), W1282X (lane 5), 4002 A---~G(lane 6). Login to comment
120 There are, however, only six additional CFTR mutations with a frequency of approximately 1% or more of the CF chromosomes; two nonsense mutations, G542X and R553X, and the missense mutations G551D and NI303K were predominantly seen in severely affected patients, whereas the transmembrane missense mutation R347P and the splice mutation 3849 + 10 kB C---~T Table 2 Rare sequence variants in the CFTR promoter and coding region Sequence variant Nucleotide change Location Frequency Associated mutatiow' Reference 125 G--+C G--~C at 125 Promoter 1 (0.1%) R75X F508C T--~G at 1655 Exon 10 2 (0.3%) S1251N 1716 G---)A G---~Aat 1716 Exon 10 1 (0.1%) L619S R553Q G-~A at 1790 Exon I 1 I (0.1%) * R668C C--~T at 2134 Exon 13 1 (0.1%) 3849+10 kB C--eT 3030 G---~A G--+A at 3030 Exon 15 1 (0.1%) 405+1 G--~A I1027 T T--~C at 3212 Exon 17a 2 (0.3%) * 3417 A-+T A--->Tat 3417 Exon 17b 1 (0.1%) Unknown 4002 A--eG A--~G at 4002 Exon 20 2 (0.3%) Unknown Cutting et al. (1992) Kobayashi et al. (1990) Kerem et al. (1990) D6rk et al. ( 1991) Fanen et al. (1992) Chillon et al. (1992) Fanen et al. (1992) This study Ferec et al. (1992) ~'Marked (*) sequence variations were present on AF508 chromosomes were the most frequent in pancreas-sufficient patients. Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 This mutation has previously been described as a "mild" mutation.24 As reported by Kalin et al,25 the two CF chromosomes (from unrelated patients) positive for S1251N also carry the polymorphism F508C,26 but two other CF chromosomes bearing F508C are negative for S1251N and have unknown mutations. Login to comment

[hide] The cystic fibrosis transmembrane conductance regu... J Biol Chem. 1994 May 20;269(20):14584-8. Ko YH, Thomas PJ, Pedersen PL
The cystic fibrosis transmembrane conductance regulator. Nucleotide binding to a synthetic peptide segment from the second predicted nucleotide binding fold.
J Biol Chem. 1994 May 20;269(20):14584-8., [PMID:7514174]

Abstract [show]
Previous studies from this laboratory with a 67-amino acid synthetic peptide (P-67) demonstrated directly that the first predicted nucleotide binding fold of the cystic fibrosis transmembrane conductance regulator (CFTR) binds ATP (Thomas, P.J, Shenbagamurthi, P., Ysern, S., and Pedersen, P.L. (1991) Science 251, 555-557). Although mutational analysis within the predicted second nucleotide binding fold indicates that this domain may be functionally important also, direct evidence for nucleotide binding is lacking. Here, we report the design, chemical synthesis, and purification of a 51-amino acid segment (P-51) of the second predicted nucleotide binding fold of CFTR and demonstrate that this peptide binds ATP. P-51 consists of amino acid residues from glutamic acid 1228 through threonine 1278 and contains a motif, GX4GKS, very similar or identical to that found in many nucleotide-binding proteins. The freshly dissolved peptide moves predominantly as a single species upon molecular sieve chromatography and readily binds ATP without eliciting its hydrolysis. P-51 also readily binds the fluorescent ATP analogs TNP-ATP (2'(3')-0-(2,4,6-trinitrophenyl)-adenosine-5'-triphosphate) and TNP-ADP but exhibits much less capacity to bind TNP-AMP. ATP displaces TNP-ATP with a Kd (ATP) of 0.46 mM. In the presence of the denaturant urea, P-51 loses most of its binding capacity indicating that structure is important for binding. Consistent with this conclusion, circular dichroism spectroscopy revealed that P-51 has significant secondary structure. Elements of such structure calculated from deconvolution of the circular dichroism spectra compare favorably with those predicted from the program of Chou, P.Y., and Fasman, G.D. (1977) J. Mol. Biol. 115, 135-175. These experiments provide the first direct evidence that the second predicted nucleotide binding fold of CFTR binds ATP and define a 51-amino acid segment within the approximately 150-amino acid fold critical for this function. They also indicate that the beta and gamma phosphate groups of ATP may be important for binding and that the 51-amino acid region studied is not sufficient to catalyze ATP hydrolysis. Finally, as seven different mutations within P-51 are known to cause cystic fibrosis, these studies will be important in future efforts to understand the molecular basis of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 TNP Nucleotide Binding-The enhancement of fluorescence of the TMS-1 TMS-2 NBF-2 COO- + % N E P-51 (122B-<278) ENISFSISPGQRVGLL&TGSG~TLLSAFLP.LLNTEGEIQIDGVSWDSIT1/1 51 -ttl).ttttttt"-, CF Mutations within P-51 Q123ESTOP 11234" G1244E S1251N S1255P D1270N S1255STOP FIG.1.Primary sequence of P-51 and its predicted secondary structure. Login to comment

[hide] CFTR haplotype backgrounds on normal and mutant CF... Hum Mol Genet. 1994 Apr;3(4):607-14. Cuppens H, Teng H, Raeymaekers P, De Boeck C, Cassiman JJ
CFTR haplotype backgrounds on normal and mutant CFTR genes.
Hum Mol Genet. 1994 Apr;3(4):607-14., [PMID:7520797]

Abstract [show]
Ten polymorphic loci, located in a 1 Mb interval across the cystic fibrosis locus, were analyzed on normal and mutant CFTR genes. A different distribution of haplotype backgrounds among normal and mutant CFTR genes was observed. With exception of the D7S8 locus, the three most common mutations, delta F508, G542X and N1303K, were found on an identical haplotype background. In agreement with the observed linkage equilibrium between the Q1463Q and D7S8 loci, both alleles at the D7S8 locus were found on delta F508 CFTR genes. However, the G542X and N1303K mutations, which have been estimated to be at least 35000 years old, were found to be associated with a single allele at the D7S8 locus. Absence of recombination between the D7S8 and Q1463Q loci was also observed on normal CFTR genes with this haplotype background. At the Tn locus in intron 8, allele 9 known to result in very efficient splicing was associated with the most frequent mutations. At the M470V locus, located in a conserved region of the first nucleotide binding fold, the amino acid methionine was found to be associated with the frequent mutations, in particular with mutations located in one of the two nucleotide binding folds which are generally known as severe mutations with regard to exocrine pancreatic function. On mutant CFTR gene, this locus was in complete association with the centromeric D9 locus, in the absence of a complete association with the intervening loci.(ABSTRACT TRUNCATED AT 250 WORDS)

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Distribution of alleles at 10 polymorphic loci Locus Allele Normal Mutant Mutations XV2c KM19 D9 1 2 1 2 1 2 58 (0.492) 60 (0.508) 84 (0.622) 51 (0.378) 78 (0.586) 55 (0.414) 146 (0.918) 13 (0.082) 19(0.109) 156 (0.891) 15 (0.085) 161 (0.915) 1001 + llC/T Tn 115 (0.927) R 9 (0.073) 5 7 (0.057) 7 102 (0.836) 9 13 (0.107) M470V C 62 (0.496) R 63 (0.504) 1898+15 2T/A C 84(0.641) R 47 (0.359) T854T Q1463Q D7S8 C 82 (0.636) R 47 (0.364) C 90 (0.692) R 40 (0.308) 1 38 (0.317) 2 82 (0.683) 33 (0.192) 139 (0.808) 0 (0.000) 32 (0.190) 136 (0.810) 156 (0.902) 17 (0.098) 163 (0.926) 13 (0.074) 162 (0.926) 13 (0.074) 162 (0.931) 12 (0.069) 91 (0.569) 69 (0.431) E60X, 622-2A-C, A455E, AF508 (98.3%), 1717-1G-A, G542X, 0.479 63.54 G628R(G-C)/S1235R,2183AA-G, G970R, W1282X, N1303K p<10~ G458V, AI5O7, AF508 (1.7%), 1898 + 1G-C, E73OX, 3272-26A-G, W1310X, 4218insT, UA, UB, UC I336K, W401X, 2T2ldelll, Y1092X, 3659delC, S1251N: not included (5%) E60X, 622-2A-C, W401X, G458V, AF5O8 (1.6%), 1898+ 1G-C, -0.541 90.63 G628R(G-Q/S1235R, E730X, G970R, 3272-26A-G (50.0%), p<10" Y1092X, 3659delC, S1251N, W1310X, UB, UTC A455E, AI507, AF5O8 (98.4%), 1717- 1G-A, G542X, 2183AA-G, 3272-26A-G (50.0%), W1282X, N13O3K, 4218insT, UA 1336K, 2721delU: not included (1%) E60X, 622-2A-C, W401X, G458V, 1898 +1G-C, E730X, G970R, -0.541 90.46 Y1092X, 3659delC, S1251N, W1310X, UB, UC p<10" A455E, AI507, AF508, 1717- 1G-A, G542X, G628R(G-Q/S1235R, 2183AA-G, 3272-26A-G, W1282X, N13O3K, 4218insT, UA I336K, 2721delll: not included (1%) E60X, 622-2A-C, I336K, W401X, G458V, AI507, 1717- 1G-A, -0.726 155.94 1898 + 1G-C, G628R(G-C)/S1235R, 2183AA-G, E730X, 2721delll, p< 10" G970R, 3272-26A-G, Y1092X, 3659delC, S1251N, W1282X, W1310X, 4218insT, UA, UB, UC A455E, AF5O8, G542X, N13O3K E60X, 622-2A-C, I336K, W401X, G458V, AI507, 1717-1G-A, 1898 + 1G-C, G628R(G-C)/S1235R, 2183AA-G, E730X, 2721delll, G970R, 3272-26A-G, Y1092X, 3659delC, S1251N, W1282X, W1310X, 4218insT, UA, UB, UC A455E, AF5O8, G542X, N13O3K A455E, AI5O7, AF508, 1717-1G-A, G542X, G628R(G-Q/S1235R, 2183AA-G, 3272-26A-G, W1282X, N13O3K, 4218insT, UA E60X, 622-2A-C, W401X, G458V, 1898 + 1G-C, E730X, G970R, Y1092X, 3659delC, S1251N, W1310X, UB, UC 1336K, midclll: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF508 (99.2%), G542X, 1898 + 1G-C, 2183AA-G, E730X, G970R, Y1092X, 3659delC, S1251N, N1303K, W1310X, UB, UC AI507, AF5O8 (0.8%), 1717-1G-A, G628R(G-Q/S1235R, 3272-26A-G, W1282X, 4218insT, UA I336K, 2721delU: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF508 (99.2%), G542X, 1898+1G-C, 2183AA-G, E730X, G970R, Y1092X, 3659delC,S1251N, N13O3K, W1310X, UB, UC AI507, AF508 (0.8%), 1717-1G-A, G628R(G-C)/S1235R, 3272-26A-G, W1282X, 4218insT, UA 1336K, midelll: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF5O8 (99.2%), G542X, G628R(G-Q/S1235R, 2183AA-G, E730X, G970R, Y1092X, 3659delC, S1251N,N1303K, W1310X, UC AI507, AF5O8 (0.8%), 1717-1G-A, 1898 + 1G-C, 3272-26A-G, W1282X, 4218insT 1336K, 2721del11. Login to comment
35 UA, UB: not included (2%) A455E, AF508 (61.2%), 1717-1G-A (66.7%), G542X, G628R(G-C)/S1235R, 3272-26A-G, S1251N, W1282X, W1310X E60X, 622-2A-C, W401X, G458V, AJ507, AF5O8 (38.8%), 1717- 1G-A (33.3%), 1898 +1G-C, 2183AA-G, E730X, G970R, Y1092X, 3659delC, N13O3K, 4218insT, UA, UB, UC 1336K, 2721delll: not included (1%) -0.694 139.81 p<10~ 0.452 60.83 p<10" 0.355 38.77 p<10" 0.360 39.44 p<10~7 0.314 29.91 0.250 17.54 p<10"4 The observed CFTR genes associated with a particular allele are given, proportions are given between brackets. Not all the mutations were informative for each of the tested loci, which were therefore not included. For the Tn locus the standardized linkage disequilibrium coefficient was calculated for the group of the non-T9 alleles and the T9 alleles. Login to comment
73 The I336K, W401X, 2721delll, Y1092X, 3659delC and S1251N mutations, contributing for 5% of all mutant CFTR genes, are not included. Login to comment
103 CFTR haplocypes I II ma mb rv V VI Haplotype C7RCCC 211C7RCCC1 111C7RCCC1 /11C7RCCC1 211C7RCCC2 111C7RCCC2 /11C7RCCC2 122C7RCCC2 121C7RCCC2 C5CRRR 122C5CRRR1 211C5CRRR2 222C5CRRR2 C7CRRR 122C7CRRR1 222C7CRRR1 212C7CRRR1 122C7CRRR2 222C7CRRR2 122C7CRRR/ C9CRRR 211C9CRRR1 R9CCCC 122R9CCCC1 222R9CCCC1 /22R9CCCC1 112R9CCCC1 122R9CCCC2 222R9CCCC2 112R9CCCC2 R9CRRR 122R9CRRR1 C7CRRC 112C7CRRC1 112C7CRRC2 C9CRRC 211C9CRRC1 C7CCCC 211C7CCCC1 222C7CCCC1 122C7CCCC2 C7RCCR 211C7RCCR2 Normal 0.524 (43) 0.085 0.073 0.195 0.146 0.012 0.012 0.049 (4) 0.012 0.024 0.012 0.220 (18) 0.024 0.073 0.000 0.073 0.049 0.012 (1) 0.012 0.073 (6) 0.000 0.000 0.000 0.061 0.012 0.000 0.000 (0) 0.000 0.061 (5) 0.000 0.061 0.012 (1) 0.012 0.037 (3) 0.012 0.024 0.000 0.012 (1) 0.012 Mutant 0.080 (IS) 0.005 0.000 0.020 0.015 0.020 0.020 0.000 0.000 0.000 (0) 0.000 0.000 0.000 Mutations p<10"7 W1310X S1251N G458V, E730X, UC E60X, 622-2A-C, G970R W401X, Y1092X, 3659delC 0.055 (9) p<10"2 0.017 0.005 0.005 0.008 0.010 0.010 0.000 (0) 0.000 1717-1G-A (66.7%) 50.0% of 3272-26A-G 50.0% of 3272-26A-G 1717-1G-A(33.3%) AI507, 4218insT W1282X 0.819 (130) p<10~7 0.466 0.007 0.010 0.007 0.312 0.007 0.007 0.005 (1) 0.005 0.005 (1) 0.005 0.000 0.000 (0) 0.000 0.010 (2) 0.000 0.000 0.010 0.005 (1) 0.005 56.7% of AF508, G542X 1% of AF5O8 A455E 1% of AF5O8 38.1% of AF508, N1303K 1.0% of AF5O8 1% of AF508 1% of AF508 G628R(G-Q/S1235R 2183AA-G 1898+1G-C The proportion of CFTR genes associated with a particular haplotype, and the mutations found to be associated with that haplotype are given. Login to comment
164 However the S1251N mutation is associated with the F508C polymorphism which is, like M470V, located in exon 10 of the CFTR gene (5). Login to comment

[hide] Exon 9 of the CFTR gene: splice site haplotypes an... Hum Genet. 1994 Jan;93(1):67-73. Dork T, Fislage R, Neumann T, Wulf B, Tummler B
Exon 9 of the CFTR gene: splice site haplotypes and cystic fibrosis mutations.
Hum Genet. 1994 Jan;93(1):67-73., [PMID:7505767]

Abstract [show]
The alternatively spliced exon 9 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene codes for the initial part of the amino-terminal nucleotide-binding fold of CFTR. A unique feature of the acceptor splice site preceding this exon is a variable length polymorphism within the polypyrimidine tract influencing the extent of exon 9 skipping in CFTR mRNA. We investigated this repeat for its relationship to CFTR mutations and intragenic markers on 200 chromosomes from German patients with cystic fibrosis (CF). Four frequent length variations were strongly associated with the four predominant haplotypes previously defined by intragenic marker dimorphisms. One of these alleles displayed absolute linkage disequilibrium to the major CF mutation delta F508. Other frequent CFTR mutations were linked to one particular splice site haplotype indicating that differential exon 9 skipping contributes little to the clinical heterogeneity among CF patients with an identical mutation. We also identified a novel missense mutation (V456F) and a novel nonsense mutation (Q414X) within the coding region of exon 9. The missense mutation V456F adjacent to Walker motif A was present in a pancreas-sufficient CF patient. In contrast, the pancreas-insufficient Q414X/delta F508 compound heterozygote suffered from a severe form of the disease, indicating that alternative splicing of exon 9 does not overcome the deleterious effect of a stop codon with this exon.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Association of (TG),Tm alleles with CFTR mutations (TG),Tm CFTR mutationsa (TG)llT7 E60X, E92X, R117C, 1078delT, R347P, R553X, 2184delA, 2184insA, I1005R, 3272-26A--~G, L1059X, Y1092X, R1162X, 3659delC, 3850-3T-oG, S1251N Q39X, R117H, Q414X, V456F, AI507, 1717-1G--~A, G551D, 2043delG, 2183AA---~G, 2184insA, 2789 + 5 G---~A,3272-26A---~G, R1066C, L1077P, 3849 + l0 kB C---~T,4374 + 1 G---~T 621 + 1 G---~T,R334W, A455E, AF508, G542X, 2143delT, 3849 + 10 kB C---~T,NI303K 405 + 1 G----~A,1342-2 A---~C,R553X (TG)IoT7 (TG)10T9 (TG)12T7 a References are compiled in Tsui (1992), except for 2143delT (Dtrk et al. 1992b), 3850-3 T---~G,4374 + 1 G---~T,1342-2 A---~C (Dtrk et al. 1993a, b), Q414X, V456F (this work), 405 + 1 G---~A, E92X, R117C, 2184delA, 2184insA, I1005R, L1059X (T. Login to comment

[hide] The spectrum of cystic fibrosis mutations. Trends Genet. 1992 Nov;8(11):392-8. Tsui LC
The spectrum of cystic fibrosis mutations.
Trends Genet. 1992 Nov;8(11):392-8., [PMID:1279852]

Abstract [show]
Although the major mutation causing cystic fibrosis accounts for almost 70% of mutant chromosomes screened, almost 300 sequence alterations have been identified in the gene during the past two and a half years. At least 230 of these mutations are probably associated with disease. This rapid accumulation of data is in part due to the highly coordinated effort by members of the Cystic Fibrosis Genetic Analysis Consortium. The information is not only essential to genetic diagnosis, but also will aid in understanding the structure and function of the protein, and possibly in correlating genotype with phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
123 8 NO. 11 m []~EVIEWS G551D R553Q G551S I L558S aI~7 S5491 I I 1&559T A455F E5040 I&F508 V520F SS49NII IIR560T PS74H I G458V G480C $492F /" • ss,9 II III* oa. / III / NBF1 ~t ~t NBF2 I I I I I III I I I 11234V G1244E IS1255P D1270N II I Q1291H N1303K G1349D S1251N W1282R] F1286S N1303H Q1283M, FIG[] Cystic fibrosis (missense) mutations located within the two presumptive ATP-binding domains (NBF1 and NBF2) of CFTR. Login to comment

[hide] [The French nationwide cystic fibrosis newborn scr... Arch Pediatr. 2008 Jun;15 Suppl 1:S1-6. doi: 10.1016/S0929-693X(08)73940-X. Munck A, Roussey M
[The French nationwide cystic fibrosis newborn screening program: strategy and results].
Arch Pediatr. 2008 Jun;15 Suppl 1:S1-6. doi: 10.1016/S0929-693X(08)73940-X., [PMID:18822253]

Abstract [show]
In 2002 France implemented a nationwide newborn screening program for cystic fibrosis (CF). The strategy combined immunoreactive trypsinogen and, in case of a value over the cut-off level, DNA analysis in dried blood samples at day 3. Data were centralized and periodically analyzed thus maintaining the percentage of samples requiring mutation analysis (0.6%), limiting the number of false-positive cases (0.1%) without increasing the number of false-negative cases (3.2%). 3.527.353 infants were screened between 2002 and 2006. The overall cystic fibrosis incidence was 1/ 4136 with a wide range of regional variations. Dilemma case presentation occurred for 14 % of the patients; an European working group is actively working on this topic, attempting to establish a consensus on the adequate procedures. Cystic fibrosis newborn screening is feasible all over a nation but needs a strong organization from maternity wards to CF care centers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 L`organigramme du DNN (fig. 1) pr&#e9;voit une valeur seuil de TIR &#e0; J3 d&#e9;termin&#e9;e sur les donn&#e9;es des r&#e9;gions fran&#e7;aises ayant d&#e9;but&#e9; ce d&#e9;pistage il y a plus de 10 ans afin de s&#e9;lec- Mutations recherch&#e9;es par le Kit Elucigen dans le cadre du d&#e9;pistage n&#e9;onatal de la mucoviscidose (Kit CF30) : F508del ; I 507del ; 1078delT, 1717-1 G>A ; 2183AA>G ; 3659delC ; 3849+10kbC>T ; 621+1G>T ; A455E ; E60X ; G542X ; G551D ; N1303K ; R1162X ; R117H ; R334W ; R347P ; R553X ; S1251N ;W1282X ; 1811+1.6kbA>G ; 2789+5G>A ; 3120+1G>A ; 3272-26A>G ; 394delT ; 711+1G>T ; G85E ; Y1092X ; Y122X ;W846X. Login to comment

[hide] [Mucoviscidosis: CFTR mutation-specific therapy: a... Arch Pediatr. 2013 Jan;20(1):63-73. doi: 10.1016/j.arcped.2012.10.018. Epub 2012 Nov 27. Leonard A, Leal T, Lebecque P
[Mucoviscidosis: CFTR mutation-specific therapy: a ray of sunshine in a cloudy sky].
Arch Pediatr. 2013 Jan;20(1):63-73. doi: 10.1016/j.arcped.2012.10.018. Epub 2012 Nov 27., [PMID:23199563]

Abstract [show]
There is a need to find a cure for pulmonary disease in cystic fibrosis (CF), though full benefit of this approach will be restricted to those patients with well-preserved lungs. The most promising route is currently that of a pharmacological mutation-specific approach aiming at correcting the mechanism by which mutations lead to impairment of chloride conductance across respiratory epithelial cells. In the past 14years, 7 candidate drugs (CPX, 4PBA, gentamicin, PTC124, VX-770 or Ivacaftor, VX-809 or Lumacaftor, and Miglustat) have been investigated in CF patients. A postulate of 14 out of the 15 published studies has been that an effective agent had to improve total chloride secretion as assessed in vivo by nasal potential difference measurements. The present review casts a critical look at these studies. Apparent inconsistencies are discussed as well as possible limitations of nasal potential difference measurements as outcome parameters in these trials. Primarily targeting a mutation carried by less than 2% of French CF patients, the 2 Ivacaftor studies could well be a milestone on the long road toward a cure for CF. However, further data on safety and long-term efficacy are obviously needed and the current price of this medication in the US would make it unaffordable for European patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
178 De re &#b4;centes donne &#b4;es in vitro sugge `rent que cette me &#b4;dication soit e &#b4;galement efficace sur 9 autres mutations de la me c6;me classe (G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, G1349D) [50,51]. Login to comment

[hide] Apical CFTR expression in human nasal epithelium c... PLoS One. 2013;8(3):e57617. doi: 10.1371/journal.pone.0057617. Epub 2013 Mar 6. van Meegen MA, Terheggen-Lagro SW, Koymans KJ, van der Ent CK, Beekman JM
Apical CFTR expression in human nasal epithelium correlates with lung disease in cystic fibrosis.
PLoS One. 2013;8(3):e57617. doi: 10.1371/journal.pone.0057617. Epub 2013 Mar 6., [PMID:23483918]

Abstract [show]
INTRODUCTION: Although most individuals with cystic fibrosis (CF) develop progressive obstructive lung disease, disease severity is highly variable, even for individuals with similar CFTR mutations. Measurements of chloride transport as expression of CFTR function in nasal epithelial cells correlate with pulmonary function and suggest that F508del-CFTR is expressed at the apical membrane. However, an association between quantitative apical CFTR expression in nasal epithelium and CF disease severity is still missing. METHODS AND MATERIALS: Nasal epithelial cells from healthy individuals and individuals with CF between 12-18 years were obtained by nasal brushing. Apical CFTR expression was measured by confocal microscopy using CFTR mAb 596. Expression was compared between both groups and expression in CF nasal epithelial cells was associated with standardized pulmonary function (FEV1%). RESULTS: The proportion of cells expressing apical CFTR in columnar epithelium is lower in CF compared to non-CF. The apical CFTR expression level was significantly correlated with FEV1% in F508del homozygous subjects (r = 0.63, p = 0.012). CONCLUSION: CFTR expression in nasal epithelial cells is lower in subjects with CF compared to healthy subjects. The proportion of cells expressing F508del-CFTR at the apical membrane is variable between subjects and is positively correlated with FEV1% in F508del-CFTR homozygous subjects.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 48% yes sufficient 4 F508del/S1251N F 14. Login to comment
120 Apical expression in a subject with S1251N was somewhat lower than anticipated since we expected that CFTR mutations that affect gating or conductivity would be expressed at levels of healthy control subjects. Login to comment
125 A similar trend was observed when the subject containing F508del/S1251N that contained a gating mutant that can be expected to be expressed at levels of wt-CFTR, was excluded from analysis. Login to comment
204 A subject that expresses a CFTR allele associated with reduced gating is indicated in green (F508del/S1251N). Login to comment

[hide] Clinical and genetic features in patients with cys... Iran J Pediatr. 2013 Apr;23(2):212-5. Farjadian S, Moghtaderi M, Kashef S, Alyasin S, Najib K, Saki F
Clinical and genetic features in patients with cystic fibrosis in southwestern iran.
Iran J Pediatr. 2013 Apr;23(2):212-5., [PMID:23724185]

Abstract [show]
OBJECTIVE: Cystic fibrosis (CF) is a common autosomal recessive genetic disease caused by a mutation in the CF transmembrane conductance regulatory (CFTR) gene. This study attempted to identify the most common CFTR mutations and any correlations between certain mutations and the clinical presentation of the disease in CF patients in southwestern Iran. METHODS: Twenty nine common CFTR gene mutations were examined in 45 CF patients. FINDINGS: Chronic cough, intestinal obstruction, dehydration, heat exhaustion and steatorrhea were the most common early clinical symptoms among our patients. The most common mutation was DeltaF508, with an allele frequency of 21%. The homozygous DeltaF508 mutation was observed in eight patients (18%), and three patients (7%) were DeltaF508 carriers. The 2183AA > G mutation was observed in four patients, one of whom was also a DeltaF508 carrier. The R1162X mutation was detected in two patients. The G542X, R334W and N1303K mutations were detected each in one patient, the first of whom was also a DeltaF508 carrier. CONCLUSION: Out of 45 patients, 27 (60%) had none of the CFTR gene mutations we tested for. The most frequent mutations in southwestern Iranian patients with CF should be identified by sequencing the entire CFTR gene in order to optimize the design of a diagnostic kit for common regional mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Genomic DNA was extracted from 200 &#b5;L of whole blood with the QiaAmp DNA Mini Kit (Qiagen, Valencia, CA, USA) and 29 common CFTR gene mutations (D1152H, 1717-1G>A, G542X, W1282X, N1303K, ࢞F508, 3849+10kbC>T, 394delTT, 621+1G>T, S1251N, G551D, R117H, R1162X, R334W, A455E, 2183AA>G, 3659delC, 1078delT, ࢞I507, R347P, R553X, E60X, 3120+1G>A, 2789+5G>A, 1898+1G>A, 711+1G>T, G85E, 2184delA and R560T) were analyzed with the ELUCIGENE CF29 v. 2 kit using four multiplex PCR. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 These include the most common CFTR gating mutation, G551D, as well as the G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D mutations [12]. Login to comment

[hide] Ivacaftor: a review of its use in patients with cy... Drugs. 2013 Sep;73(14):1595-604. doi: 10.1007/s40265-013-0115-2. Deeks ED
Ivacaftor: a review of its use in patients with cystic fibrosis.
Drugs. 2013 Sep;73(14):1595-604. doi: 10.1007/s40265-013-0115-2., [PMID:24030637]

Abstract [show]
Ivacaftor (Kalydeco) is a potentiator of the cystic fibrosis transmembrane conductance regulator (CFTR) and is the first drug that treats an underlying cause of cystic fibrosis to be licensed for use. Ivacaftor increases the open probability (i.e. gating) of CFTR channels with the G551D mutation, thus enhancing chloride transport, and is indicated in a number of countries for the treatment of cystic fibrosis in patients aged >/=6 years who carry this mutation. This review focuses on pharmacological, clinical efficacy and tolerability data relevant to the use of ivacaftor in this indication. In two 48-week, double-blind, phase III trials in patients aged >/=12 (STRIVE) or 6-11 (ENVISION) years with cystic fibrosis and the G551D mutation, oral ivacaftor 150 mg every 12 h significantly improved lung function relative to placebo, when used in combination with standard care. Significant improvements in pulmonary exacerbation risk (in STRIVE) as well as bodyweight and some aspects of health-related quality of life (both studies) were also seen with the drug versus placebo. Moreover, the beneficial effects of ivacaftor on parameters such as lung function and bodyweight were maintained over up to 96 weeks of treatment in an ongoing open-label extension of these studies. Ivacaftor was generally well tolerated, with headache, oropharyngeal pain, upper respiratory tract infection and nasal congestion being among the most common adverse events. Thus, ivacaftor expands the current treatment options for patients with cystic fibrosis who have the G551D mutation. Its potential for use in patients with other CFTR mutations is also of interest.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 For example, in rodent cells expressing G551D/S, G178R, S549N/R, G970R, G1244E, S1251N, S1255P or G1349D CFTR, ivacaftor increased channel open probability from B5 % of normal at baseline to 30-118 % of normal and increased chloride transport C16- fold (EC50 124-594 nmol/L). Login to comment

[hide] Sinonasal manifestations of cystic fibrosis: a cor... J Cyst Fibros. 2014 Jul;13(4):442-8. doi: 10.1016/j.jcf.2013.10.011. Epub 2013 Nov 5. Berkhout MC, van Rooden CJ, Rijntjes E, Fokkens WJ, el Bouazzaoui LH, Heijerman HG
Sinonasal manifestations of cystic fibrosis: a correlation between genotype and phenotype?
J Cyst Fibros. 2014 Jul;13(4):442-8. doi: 10.1016/j.jcf.2013.10.011. Epub 2013 Nov 5., [PMID:24210900]

Abstract [show]
BACKGROUND: Patients with Cystic Fibrosis are prone to develop sinonasal disease. Studies in genotype-phenotype correlations for sinonasal disease are scarce and inconclusive. METHODS: In this observational study several aspects of sinonasal disease were investigated in 104 adult patients with CF. In each patient a disease specific quality of life questionnaire (RSOM-31), nasal endoscopy and a CT scan of the paranasal sinuses were performed. Patients were divided into two groups, class I-III mutations and class IV-V mutations, based on their CFTR mutations. RESULTS: The prevalence of rhinosinusitis in adult patients with CF was 63% and the prevalence of nasal polyps 25%. Patients with class I-III mutations had significantly smaller frontal sinuses, sphenoid sinuses, more opacification in the sinonasal area and more often osteitis/neoosteogenesis of the maxillary sinus wall compared to patients with class IV and V mutations. CONCLUSION: These data suggest more severe sinonasal disease in patients with class I-III mutations compared to patients with class IV-V mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
163 Genotype Frequency; N (%) Class of mutation F508del/F508del 61 (58.7) I-III F508del/3849 + 10kbC 2 (1.9) IV-V F508del/N1303K 2 (1.9) I-III F508del/R1162X 2 (1.9) I-III F508del/A455E 12 (11.5) IV-V F508del/3272-26A N G 5 (4.8) IV-V F508del/E528X 1 (1.0) I-III F508del/S1251N 3 (2.9) IV-V F508del/R75Q 1 (1.0) IV-V F508del/G542X 2 (1.9) I-III F508del/1717-1G N A 1 (1.0) I-III F508del/Ser489X 1 (1.0) I-III F508del/4382delA 1 (1.0) -a F508del/L1077 1 (1.0) I-III F508del/1813insC 1 (1.0) -b A455E/S1251N 1 (1.0) IV-V A455E/E60X 1 (1.0) IV-V 3272-26A N G/G970R 1 (1.0) IV-V 3272-26A N G/R1162X 1 (1.0) IV-V F508del/UNK 2 (1.9) -c R117H-7T/UNK 1 (1.0) -d UNK/UNK 1 (1.0) -e Total 104 (100.4) One patient with pancreatic sufficiency and diagnosed at 46 years of age (class IV-V). Login to comment

[hide] The relative frequency of CFTR mutation classes in... J Cyst Fibros. 2014 Jul;13(4):403-9. doi: 10.1016/j.jcf.2013.12.003. Epub 2014 Jan 16. De Boeck K, Zolin A, Cuppens H, Olesen HV, Viviani L
The relative frequency of CFTR mutation classes in European patients with cystic fibrosis.
J Cyst Fibros. 2014 Jul;13(4):403-9. doi: 10.1016/j.jcf.2013.12.003. Epub 2014 Jan 16., [PMID:24440181]

Abstract [show]
More than 1900 different mutations in the CFTR gene have been reported. These are grouped into classes according to their effect on the synthesis and/or function of the CFTR protein. CFTR repair therapies that are mutation or mutation class specific are under development. To progress efficiently in the clinical phase of drug development, knowledge of the relative frequency of CFTR mutation classes in different populations is useful. Therefore, we describe the mutation class spectrum in 25,394 subjects with CF from 23 European countries. In 18/23 countries, 80% or more of the patients had at least one class II mutation, explained by F508del being by far the most frequent mutation. Overall 16.4% of European patients had at least one class I mutation but this varied from 3 countries with more than 30% to 4 countries with less than 10% of subjects. Overall only respectively 3.9, 3.3 and 3.0% of European subjects had at least one mutation of classes III, IV and V with again great variability: 14% of Irish patients had at least one class III mutation, 7% of Portuguese patients had at least one class IV mutation, and in 6 countries more than 5% of patients had at least one class V mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations Large deletions and insertions 1078delT; 1717-1G࢐A; 3659delC; 621+1G࢐T Class II Defective protein processing G85E, F508del, I507del, R560T, N1303K Class III Defective protein regulation ('gating`) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R117H, R334W, R347P Class V Reduced amount of functioning protein 2789+5G࢐A, 3849+10KbC࢐T, A455E Unclassified All other mutations, including those unknown. Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] CFTR mutations spectrum and the efficiency of mole... PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014. Zietkiewicz E, Rutkiewicz E, Pogorzelski A, Klimek B, Voelkel K, Witt M
CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.
PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014., [PMID:24586523]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans Pathogenic mutations 1 1 L15Ffs10X c.43delC 175delC 1 CFMDB 1717-1G.A 2 2 G27V 21.92 c.80G.T 212G.T 1 Novel F508del 2 2 S18RfsX16 c.54-5940_273 +10250del21kb exon2,3del21kb 66 IL19 various CF mutations i2 i2 IVS2_Donor c.164+1G.A 296+1G.A 3 CFMDB various CF mutations 3 3 G85E 22.61 c.254G.A 386G.A 1 IL17 unknown 3 3 E60X c.178G.T 310G.T 0 IL17 x 3 3 L88IfsX22 c.262_263delTT 394delTT 0 IL17 x 4 4 E92K 21.92 c.274G.A 406G.A 2 CFMDB c.164+1G.A; c.2051- 2AA.G 4 4 L101X c.302T.G 434T.G 1 CFMDB c.3717+12191C.T 4 4 K114IfsX5 c.341_353del13bp 473del13bp 1 Novel F508del 4 4 R117H 20.35 c.350G.A 482G.A 5 IL17 F508del; 2x unknown 4 4 R117C 22.07 c.349C.T 481C.T 2 CFMDB S1206X;1x unknown 4 4 L137_L138insT c.412_413insACT L138ins 1 CFMDB F508del 4 4 R153I 22.61 c.458G.T 590G.T 2 Novel F508del; c.3527delC i4 i4 IVS4_Donor c.489+1G.T 621+1G.T 5 IL17 F508del; c.489+1G.T 5 5 L165X c.494T.A 626T.A 1 Novel F508del i5 i5 IVS5_Donor c.579+1G.T 711+1G.T 0 IL19 x i5 i5 IVS5_Donor c.579+3A.G 711+3A.G 2 CFMDB 2,3del21kb; c.2052-3insA i5 i5 IVS5_Donor c.579+5G.A 711+5G.A 0 IL17 x 7 8 F311L 20.90 c.933C.G 965C.G 2 CFMDB 2x F508 7 8 G314R 20.58 c.940G.A 1072G.A 4 CFMDB various CF mutations 7 8 F316LfsX12 c.948delT 1078delT 1 IL17 unkown 7 8 R334W 22.41 c.1000C.T 1132C.T 6 IL17 various CF mutations 7 8 I336K 22.07 c.1007T.A 1139T.A 2 CFMDB 2,3de21kb; F508del 7 8 R347P 22.27 c.1040G.C 1172G.C 11 IL17 various CF mutations i7 i8 IVS8_Donor c.1116+2T.A 1248+2T.A 1 Novel Q1412X 9 10 A455E 22.61 c.1364C.A 1496C.A 0 IL17 x i9 i10 IVS10_Donor c.1392+1G.A 1524+1G.A 1 CFMDB c.3816-7delGT 10 11 S466X c.1397C.G 1529C.G 1 CFMDB G542X 10 11 I507del c.1519_1521delATC 1651delATC 2 IL19 F508del 10 11 F508del c.1521_1523delCTT 1654delCTT 805 IL19 various CF mutations i10 i11 IVS11_Acceptor c.1585-1G.A 1717-1G.A 27 IL19 various CF mutations 11 12 G542X c.1624G.T 1756G.T 25 IL19 various CF mutations 11 12 G551D 21.24 c.1624G.T 1756G.T 5 IL19 various CF mutations 11 12 Q552X c.1654C.T 1786C.T 0 IL19 x 11 12 R553X c.1657C.T 1789C.T 14 IL19 various CF mutations 11 12 R560T 21.92 c.1679G.C 1811G.C 0 IL19 x i12 i13 IVS13_Donor c.1766+1G.A 1898+1G.A 6 IL19 various CF mutations i12 i13 IVS13_Donor c.1766+1G.C 1898+1G.C 1 CFMDB F508del 13 14 H620P 21.73 c.1859A.C 1991A.C 1 CFMDB F508del 13 14 R668C//G576A 21.61//1.73 c.2002C.T//c.1727G.C 2134C.T// 1859G.C 5 b CFMDB// rs1800098 c.1585-1G.A; 4 unknown 13 14 L671X c.2012delT 2143delT 27 IL17 various CF mutations 13 14 K684SfsX38 c.2051_2052delAAinsG 2183AA.G 10 IL17 various CF mutations 13 14 K684NfsX38 c.2052delA 2184delA 0 IL17 x 13 14 Q685TfsX4 c.2052_2053insA 2184insA 15 CFMDB various CF mutationsc , 1 unknown Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 13 14 L732X c.2195T.G 2327T.G 1 CFMDB F508del 14A 15 R851X c.2551C.T 2683C.T 3 CFMDB various CF mutations 14A 15 I864SfsX28 c.2589_2599del11bp 2721del11bp 2 CFMDB F508del; 2,3del21kb i14B i16 IVS16_Donor c.2657+2_2657+3insA 2789+2insA 1 CFMDB F508del i14B i16 IVS16_Donor c.2657+5G.A 2789+5G.A 0 IL17 unkown 15 17 Y919C 21.02 c.2756A.G 2888A.G 1 CFMDB unknown 15 17 H939HfsX27 c.2817_2820delTACTC 2949delTACTC 1 Novel unkown i15 i17 IVS17_Donor c.2908+3A.C 3040+3A.C 1 Novel F508del i16 i18 IVS18_Donor c.2988+1G.A 3120+1G.A 0 IL19 x 17A 19 I1023_V1024del c.3067_3072delATAGTG 3199del6 0 IL19 x i17A i19 IVS19 c.3140-26A.G 3272-26A.G 9 IL19 various CF mutations 17B 20 L1065R 21.90 c.3194T.G 3326T.G 1 CFMDB F508del 17B 20 Y1092X c.3276C.A 3408C.A 1 CFMDB R334W i18 i21 IVS21_Donor c.3468+2_3468+3insT 3600+2insT 11 CFMDB various CF mutationsd , 1 unknown 18 21 E1126EfsX7 c.3376_3379delGAAG 3508delGAAG 1 Novel F508del 19 22 R1158X c.3472C.T 3604C.T 2 CFMDB F508del; R553X 19 22 R1162X c.3484C.T 3616C.T 1 IL17 F508del 19 22 L1177SfsX15 c.3528delC 3659delC 4 IL17 various CF mutations 19 22 S1206X c.3617C.A 3749C.A 1 CFMDB R117C i19 i22 IVS22 c.3717+12191C.T 3849+10kbC.T 58 IL17 various CF mutations 20 23 G1244R 22.62 c.3730G.C 3862G.C 1 CFMDB F508del 20 23 S1251N 22.28 c.3752G.A 3884G.A 0 IL19 x 20 23 L1258FfsX7 c.3773_3774insT 3905insT 0 IL19 x 20 23 V1272VfsX28 c.3816_3817delGT 3944delGT 1 CFMDB c.1392+1G.A 20 23 W1282X c.3846G.A 3978G.A 9 IL19 various CF mutations 21 24 N1303K 22.62 c.3909C.G 4041C.G 18 IL19 various CF mutations 22 25 V1327X c.3979delG 4111delG 1 Novel F508del 22 25 S1347PfsX13 c.4035_4038dupCCTA c.4167dupCCTA 1 CFMDB 2,3del21kb 23 26 Q1382X c.4144C.T 4276C.T 1 CFMDB F508del 23 26 Q1412X c.4234C.T 4366C.T 2 CFMDB F508del; c.1116+2T.A i23 i26 IVS26_Donor c.4242+1G.T 4374+1G.T 1 CFMDB F508del Sequence changes of uncertain pathogenic effect, tentatively counted as mutations 6A 6 E217G 0.30 c.650A.G 782A.G 1 CFMDB; rs1219109046 unknown 7 8 R352Q 20.01 c.1055G.A 1187G.A 1 CFMDB; rs121908753 F508del 7 8 Q359R 0.33 c.1076A.G 1208A.G 1 CFMDB F508del i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)12 1332-12Tn_- 34TGm 6 CFMDB F508del; 3x unknown i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)13 1332-12Tn_- 34TGm 2 CFMDB 2143delT; 1x unknown i8 i9 IVS9 c.1210-12T8 1332-12Tn 1 Novel unknown 10 11 I506V 20.21 c.1516A.G 1648A.G 1 CFMDB; rs1800091 unknown 12 13 V562L 0.79 c.1684G.C 1816G.C 1 CFMDB; rs1800097 unknown 13 14 G723V 0.44 c.2168G.T 2300G.T 1 CFMDB; rs200531709 unknown 15 17 D924N 0.03 c.2770G.A 2902G.A 1 CFMDB; rs201759207 unknown patient with F508del on another allele) was not supported by the SVM value (+0.35); the patient was PS and had ambiguous chloride values (45, 64 and 83 mmol/L). Login to comment
102 a Mutations detected by two INNOLiPA_CFTR tests (legacy names): IL19 (INNOLiPA_CFTR19): F508del; G542X; N1303K; W1282X; G551D; 1717-1G.A; R553X; CFTRdele2,3(21kb); I507del; 711+1G.T; 3272-26A.G; 3905insT; R560T; 1898+1G.A; S1251N; I148T; 3199del6; 3120+1G.A; Q552X. Login to comment

[hide] Personalised medicine in cystic fibrosis is unaffo... Paediatr Respir Rev. 2014 Jun;15 Suppl 1:2-5. doi: 10.1016/j.prrv.2014.04.003. Epub 2014 Apr 13. Balfour-Lynn IM
Personalised medicine in cystic fibrosis is unaffordable.
Paediatr Respir Rev. 2014 Jun;15 Suppl 1:2-5. doi: 10.1016/j.prrv.2014.04.003. Epub 2014 Apr 13., [PMID:24832698]

Abstract [show]
Personalised medicine refers to a tailored approach to treatment of an individual based on molecular analysis of genes, proteins or metabolites, and commonly involves a companion diagnostic test. It usually applies to small subsets of patients, often with rare diseases. In cystic fibrosis (CF), the best example is the CFTR (CF transmembrane conductance regulator) potentiator, ivacaftor, relevant to the 5% of cystic fibrosis patients with the p.Gly551Asp gene mutation. However the cost of personalised medicine is too high, making it unaffordable in the long term for many healthcare systems. Society needs to find a way to make personalised medicine affordable in order to not deny life-changing treatments from patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 It is currently licensed for use only in those with the p.Gly551Asp mutation; but a further license has been recently approved in the USA for use in other rarer gating mutations (G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, or G1349D). Login to comment

[hide] New pharmacological approaches for cystic fibrosis... Pharmacol Ther. 2015 Jan;145:19-34. doi: 10.1016/j.pharmthera.2014.06.005. Epub 2014 Jun 14. Bell SC, De Boeck K, Amaral MD
New pharmacological approaches for cystic fibrosis: promises, progress, pitfalls.
Pharmacol Ther. 2015 Jan;145:19-34. doi: 10.1016/j.pharmthera.2014.06.005. Epub 2014 Jun 14., [PMID:24932877]

Abstract [show]
With the discovery of the CFTR gene in 1989, the search for therapies to improve the basic defects of cystic fibrosis (CF) commenced. Pharmacological manipulation provides the opportunity to enhance CF transmembrane conductance regulator (CFTR) protein synthesis and/or function. CFTR modulators include potentiators to improve channel gating (class III mutations), correctors to improve abnormal CFTR protein folding and trafficking (class II mutations) and stop codon mutation read-through drugs relevant for patients with premature stop codons (most class I mutations). After several successful clinical trials the potentiator, ivacaftor, is now licenced for use in adults and children (>six years), with CF bearing the class III G551D mutation and FDA licence was recently expanded to include 8 additional class III mutations. Alternative approaches for class I and class II mutations are currently being studied. Combination drug treatment with correctors and potentiators appears to be required to restore CFTR function of F508del, the most common CFTR mutation. Alternative therapies such as gene therapy and pharmacological modulation of other ion channels may be advantageous because they are mutation-class independent, however progress is less well advanced. Clinical trials for CFTR modulators have been enthusiastically embraced by patients with CF and health care providers. Whilst novel trial end-points are being evaluated allowing CFTR modulators to be efficiently tested, many challenges related to the complexity of CFTR and the biology of the epithelium still need to be overcome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
547 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations: G542X, R1162X, RW1282X Deletions and insertions: CFTRdele2,3; 1078delT; 1717-1G ࢐ A; 3659delC; 621+1G N T Class II Defective protein processing G85E, F508del, I507del, R560T, A561E, R1066C, N1303K Class III Defective protein regulation (gating) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R334W, R347P, R117H Class V Reduced amount of functioning protein 2789+5G ࢐ A, 3272-26ANG, 3849+10KbC ࢐ T, A455E Class VI Reduced cell surface stability Rescued F508del, c.120del23 Unclassified All other mutations, including those unknown a F508del-CFTR pocket (at NBD1:ICL4 interface) (Farinha et al., 2013). Login to comment

[hide] CFTR Modulators for the Treatment of Cystic Fibros... P T. 2014 Jul;39(7):500-11. Pettit RS, Fellner C
CFTR Modulators for the Treatment of Cystic Fibrosis.
P T. 2014 Jul;39(7):500-11., [PMID:25083129]

Abstract [show]
Defects in a single gene lead to the defective proteins that cause cystic fibrosis, making the disease an ideal candidate for mutation-targeted therapy. Although ivacaftor is currently the only FDA-approved CFTR modifier, others are in development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 At 48 weeks, 67% of patients in the ivacaftor group had not had a pulmonary exacerbation compared with 41% in the Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Ramsey(2011)30 STRIVE: Randomized, double-blind, placebo-controlled G551D Age 12-53 years N = 161 FEV1 40-90% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Percent change in FEV1 from baseline to 24 wks (P < 0.001): IVA, 10.4%; PBO, -0.2% ߦ Percent change in FEV1 from baseline to 48 wks compared with PBO (P < 0.001): IVA, 10.5% ߦ Percent of patients pulmonary exacerbation-free at 48 wks: IVA, 67%; PBO, 41% ߦ Change in body weight from baseline to 48 wks: IVA, 3.1 kg; PBO, 0.4 kg ߦ Sweat chloride change from baseline to 48 wks compared with PBO (P < 0.001): IVA, -48.1 mmol/L ߦ Change in CFQ-R respiratory domain from baseline to 48 wks (P < 0.001): IVA, 5.9 pts; PBO, -2.7 pts Davies (2013)29 ENVISION: Randomized, double-blind, placebo-controlled G551D Age 6-11 years N = 52 FEV1 40-105% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Absolute change in FEV1 percentage from baseline at 48 wks compared with PBO (P < 0.001): IVA, 10% ߦ Absolute change in FEV1 percentage from baseline at 24 wks (P < 0.001): IVA, 12.6%; PBO, 0.1% ߦ Mean change in sweat chloride from baseline to 48 wks compared with PBO (P < 0.001): IVA, -54.3 mmol/L ߦ Body weight change from baseline to 48 wks compared with PBO (P < 0.001): IVA, 2.8 kg ߦ Absolute CFQ-R change from baseline to 24 wks compared with PBO (P = 0.109): IVA, 6.1 pts McKone (2013)31 PERSIST: Open-label extension G551D Age ࣙ 6 years Patients had completed 48 wks of either ENVISION or STRIVE IVA 150 mg b.i.d. 96 wks (patients received 96 wks or 144 wks of IVA depending on ENVISION or STRIVE randomization) ߦ Absolute change in percent predicted FEV1: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 9.4 &#b1; 8.3 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 9.4 &#b1; 10.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -1.2 &#b1; 7.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.5 &#b1; 11.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 10.2 &#b1; 15.7 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.3 &#b1; 12.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: -0.6 &#b1; 10.1 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.5 &#b1; 11.5 ߦ Absolute change in weight (kg): &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 3.4 &#b1; 4.9 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 4.1 &#b1; 7.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: 0.3 &#b1; 2.2 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 3 &#b1; 4.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.1 &#b1; 2.9 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 14.8 &#b1; 5.7 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 2.9 &#b1; 1.8 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.1 &#b1; 4.1 ߦ Absolute change in CFQ-R respiratory domain: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.4 &#b1; 16.8 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 6.8 &#b1; 19.6 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -3.6 &#b1; 14.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.8 &#b1; 16.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 7.4 &#b1; 17.4 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.6 &#b1; 18.9 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 0.8 &#b1; 18.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.8 &#b1; 12.8 CFTR Modulators for the Treatment of Cystic Fibrosis Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Davies (2013)32 Placebo-controlled, double-blind, crossover study G551D Age > 6 years N = 17 FEV1 > 90% LCI > 7.4 Sequence 1: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. Sequence 2: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO 28-day treatment and WO periods ߦ Average change in LCI from baseline compared with PBO (P < 0.0001): IVA, -2.16 (95% CI, -2.88 to -1.44) ߦ Average change in FEV1 from baseline compared with PBO (P = 0.0103): IVA, 8.67 (95% CI, 2.36 to 14.97) ߦ Average change in FEF25-75 from baseline compared with PBO (P = 0.0237): IVA, 16.56 (95% CI, 2.30 to 27.71) Barry (2013)34 Retrospective review G551D Age 20-31 in IVA group N = 21 FEV1 < 40% IVA 150 mg b.i.d. (n = 21); matched controls (n = 35) Median duration, 237 days ߦ Absolute FEV1 change from baseline (P = 0.0075): IVA, 0.125 L; CON, 0.01 L ߦ Percent predicted FEV1 change from baseline (P = 0.0092): IVA, 12.7%, CON, 2.2% ߦ Median weight increase from baseline: IVA, 1.8 kg; CON, 0.1 kg ߦ Median inpatient days per year decreased from 23 days to 0 days in the IVA group (P = 0.001) ߦ Median total intravenous antibiotic days per year decreased from 74 days to 38 days in the IVA group (P = 0.002) De Boeck (2013)37 KONNECTION: Randomized, double-blind, crossover, placebo-controlled Non-G551D gating mutations G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, G1349D Age ࣙ 6 years N = 39 FEV1 ࣙ 40% Treatment sequence 1: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO ࢐ open-label Treatment sequence 2: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. ࢐ open-label 8 wks of IVA or PBO; 4-8 wks WO period; 16 wks open label ߦ Absolute change from baseline percent predicted FEV1 (P < 0.0001): IVA, 7.49%; PBO, -3.19% ߦ Absolute change from baseline BMI (P < 0.0001): IVA, 0.68; PBO, 0.02 ߦ Absolute change from baseline in CFQ-R respiratory domain (P = 0.0004): IVA, 8.94 pts; PBO, -0.67 pts ߦ Absolute change from baseline in sweat chloride (mmol/L): IVA, -52.28; PBO, -3.11 Flume (2011)35 Randomized, double-blind, placebo-controlled, parallel group with open-label extension Homozygous F508del Age ࣙ 12 years Part 1: N = 140 Part 2: N = 33 42 patients were eligible for part 2 if change in FEV1 ࣙ 10% or sweat chloride decreased by at least 15 mmol/L at day 15 and week 8 Part 1: IVA 150 mg b.i.d. or PBO 16 wks Part 2: Open label IVA 150 mg b.i.d. Login to comment
56 These promising results led to an FDA label expansion to include CF patients with the following eight mutations in addition to G551D: G178R, S549R, S549N, G551S, G1244E, S1251N, S1255P, and G1349D.38 Clinical Considerations Ivacaftor was well tolerated in clinical trials. Login to comment

[hide] A cocktail drug therapy for patients with cystic f... J Cyst Fibros. 2014 Sep;13(5):489-90. doi: 10.1016/j.jcf.2014.07.002. Epub 2014 Jul 24. Chen JH
A cocktail drug therapy for patients with cystic fibrosis?
J Cyst Fibros. 2014 Sep;13(5):489-90. doi: 10.1016/j.jcf.2014.07.002. Epub 2014 Jul 24., [PMID:25088968]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 More recently, VX-770 has been approved by the FDA (NDA 203188, www.fda.gov) and recommended by the EMA (EMA/CHMP/365663/2014) for use with an additional eight CF gating (class III) mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D), although, including G551D, these mutations still just occur in ~5% of CF patients worldwide. Login to comment

[hide] Comprehensive CFTR gene analysis of the French cys... Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14. Audrezet MP, Munck A, Scotet V, Claustres M, Roussey M, Delmas D, Ferec C, Desgeorges M
Comprehensive CFTR gene analysis of the French cystic fibrosis screened newborn cohort: implications for diagnosis, genetic counseling, and mutation-specific therapy.
Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14., [PMID:25122143]

Abstract [show]
PURPOSE: Newborn screening (NBS) for cystic fibrosis (CF) was implemented throughout France in 2002. It involves a four-tiered procedure: immunoreactive trypsin (IRT)/DNA/IRT/sweat test [corrected] was implemented throughout France in 2002. The aim of this study was to assess the performance of molecular CFTR gene analysis from the French NBS cohort, to evaluate CF incidence, mutation detection rate, and allelic heterogeneity. METHODS: During the 8-year period, 5,947,148 newborns were screened for cystic fibrosis. The data were collected by the Association Francaise pour le Depistage et la Prevention des Handicaps de l'Enfant. The mutations identified were classified into four groups based on their potential for causing disease, and a diagnostic algorithm was proposed. RESULTS: Combining the genetic and sweat test results, 1,160 neonates were diagnosed as having cystic fibrosis. The corresponding incidence, including both the meconium ileus (MI) and false-negative cases, was calculated at 1 in 4,726 live births. The CF30 kit, completed with a comprehensive CFTR gene analysis, provides an excellent detection rate of 99.77% for the mutated alleles, enabling the identification of a complete genotype in 99.55% of affected neonates. With more than 200 different mutations characterized, we confirmed the French allelic heterogeneity. CONCLUSION: The very good sensitivity, specificity, and positive predictive value obtained suggest that the four-tiered IRT/DNA/IRT/sweat test procedure may provide an effective strategy for newborn screening for cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Because only a limited number of functional studies have assessed the pathogenicity of variants, mutations have been classified in previous studies according to their disease-causing potential.16,22,23 Based on the recommendations and data from these studies (UMD-CFTR-France),24 variants were classified into four groups: A, CF-causing; B, associated with CFTR-RDs; C, no clinical consequences; and D, unknown or Table 1ߒ Allelic frequencies of CF30-kit mutations, identified in neonates with CF, and correspondence between traditional mutation nomenclature and that on the Human Genome Variation Society website Frequency (F) % Mutation Legacy mutation nomenclature Number of alleles/2,320 % of alleles/2,320 Cumulative % ࣙ5 p.Phe508del F508del 1,560 67.24 67.24 p.Gly542* G542X 113 3.19 10.51 p.Asn1303Lys N1303K 81 1.98 c.1585-1G>A 1717-1G>A 48 1.47 1.00ࣙFࣙ4.99 c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A 37 1.42 p.Arg553* R553X 36 1.29 p.Gly551Asp G551D 31 1.16 p.Tyr122* Y122X 26 0.97 6.86 c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 22 0.82 c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 18 0.67 p.Ile507del I507del 17 0.63 c.3140-26A>G 3272-26A>G 16 0.59 0.40ࣙFࣙ0.99 p.Arg347Pro R347P 15 0.56 p.Arg1162* R1162X 15 0.56 p.Trp1282* W1282X 14 0.52 p.Tyr1092* Y1092X 13 0.48 c.2051_2052delinsG 2183AA>G 12 0.45 c.3528delC 3659delC 11 0.41 c.1680-886A>G 1811ߙ+ߙ1.6kbA>G 9 0.39 p.Gly85Glu G85E 8 0.34 3.06 p.Ser1251Asn S1251N 7 0.30 p.Arg334Trp R334W 7 0.30 p.Arg117His R117H 7 0.30 0.1ࣙFࣙ0.39 p.Trp846* W846X 6 0.26 c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T 6 0.26 c.948delT 1078delT 5 0.22 p.Ala455Glu A455E 5 0.22 p.Glu60* E60X 4 0.17 c.262_263delTT 394delTT 4 0.17 c.3718-2477C>T 3849ߙ+ߙ10kbC>T 3 0.13 Total 2,034 87.67 87.67 Mutations are clustered into four groups of frequency intervals (>5%, 1-4.99%, 0.99-0.4%, and <0.4%). Login to comment

[hide] Ivacaftor and sinonasal pathology in a cystic fibr... J Cyst Fibros. 2015 May;14(3):412-3. doi: 10.1016/j.jcf.2014.07.013. Epub 2014 Aug 26. Vreede CL, Berkhout MC, Sprij AJ, Fokkens WJ, Heijerman HG
Ivacaftor and sinonasal pathology in a cystic fibrosis patient with genotype deltaF508/S1215N.
J Cyst Fibros. 2015 May;14(3):412-3. doi: 10.1016/j.jcf.2014.07.013. Epub 2014 Aug 26., [PMID:25169789]

Abstract [show]
In patients with Cystic Fibrosis and a type III mutation, ivacaftor (Kalydeco((R)), Vertex) can increase the opening time of the CFTR channel and improve chloride transport. Research showed significant improvement of lung function and increase in weight following ivacaftor use. However, ivacaftor showed to have adverse events on the sinonasal system as well, such as upper respiratory tract infections, nasal congestion and headaches. This case report showed a positive effect of ivacaftor on the sinonasal pathology in a 17 year old patient with CF. After 5 months of ivacaftor use, the CT-sinus showed complete resolution of the opacification of the paranasal sinuses and a decrease in symptoms of sinonasal disease. This positive effect of ivacaftor on sinonasal pathology seems promising, therefore more research is needed to evaluate the effect of ivacaftor on the upper airways in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 CF genotype showed a heterozygous deltaF508/S1251N mutation. Login to comment
29 The S1251N mutation is a class III mutation resulting in a defective CFTR protein on the apical membrane. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
359 Third, at the level of the NBD1:NBD2 heterodimer, CF-causing mutations are concentrated within the canonical ATP-binding site (S549N, S549R, G551D/G551S, G1244E, S1251N, and S1255P) (Fig. 7d). Login to comment

[hide] A bioassay using intestinal organoids to measure C... J Cyst Fibros. 2015 Mar;14(2):178-81. doi: 10.1016/j.jcf.2014.10.007. Epub 2014 Nov 6. Dekkers R, Vijftigschild LA, Vonk AM, Kruisselbrink E, de Winter-de Groot KM, Janssens HM, van der Ent CK, Beekman JM
A bioassay using intestinal organoids to measure CFTR modulators in human plasma.
J Cyst Fibros. 2015 Mar;14(2):178-81. doi: 10.1016/j.jcf.2014.10.007. Epub 2014 Nov 6., [PMID:25467948]

Abstract [show]
Treatment efficacies of drugs depend on patient-specific pharmacokinetic and pharmacodynamic properties. Here, we developed an assay to measure functional levels of the CFTR potentiator VX-770 in human plasma and observed that VX-770 in plasma from different donors induced variable CFTR function in intestinal organoids. This assay can help to understand variability in treatment response to CFTR potentiators by functionally modeling individual pharmacokinetics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Introduction The CFTR potentiator VX-770 (ivacaftor) is registered for the CFTR gating mutation CFTR-G551D and recently also for eight other gating mutations including CFTR-S1251N (http://investors. Login to comment
26 CFTR function measurements in organoids Intestinal crypts were isolated from cystic fibrosis patients (R117H/F508del, S1251N/F508del and F508del/F508del), and CFTR function was quantified by measurement of forskolin-induced swelling of intestinal organoid cultures as previously described [9]. Login to comment
31 CFTR-S1251N potentiation by VX-770 in pooled plasma To determine assay conditions that allow us to discriminate between relevant concentrations of VX-770 in plasma, we stimulated organoids expressing the gating mutant CFTR-S1251N with various amounts of pooled plasma from ten healthy individuals in combination with VX-770 concentrations. Login to comment
33 We stimulated organoids with a suboptimal amount of forskolin (0.4 bc;M) to facilitate the optimal detection of VX-770-induced CFTR function since considerable residual function associated with S1251N at high forskolin levels limits the VX-770-dependent swelling (Fig. S2A and B). Login to comment
37 (A) Pooled plasma from ten healthy donors, VX-770 and forskolin (0.4 bc;M) were combined to stimulate CFTR-S1251N expressing organoids. Login to comment
54 Variability of VX-770-dependent swelling between plasma samples We investigated the variability of VX-770-dependent organoid swelling in plasma samples derived from 9 different healthy donors in the presence of VX-770 on CFTR-S1251N expressing organoids. Login to comment
73 (A) CFTR-S1251N expressing organoids were stimulated with 6% plasma from 9 different donors in the absence or presence of VX-770 (60 nM, representing 1 bc;M in 100% plasma) and forskolin (0.5 bc;M). Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] Functional reconstitution and channel activity mea... J Vis Exp. 2015 Mar 9;(97). doi: 10.3791/52427. Eckford PD, Li C, Bear CE
Functional reconstitution and channel activity measurements of purified wildtype and mutant CFTR protein.
J Vis Exp. 2015 Mar 9;(97). doi: 10.3791/52427., [PMID:25867140]

Abstract [show]
The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of transporters. The phosphorylation and nucleotide dependent chloride channel activity of CFTR has been frequently studied in whole cell systems and as single channels in excised membrane patches. Many Cystic Fibrosis-causing mutations have been shown to alter this activity. While a small number of purification protocols have been published, a fast reconstitution method that retains channel activity and a suitable method for studying population channel activity in a purified system have been lacking. Here rapid methods are described for purification and functional reconstitution of the full-length CFTR protein into proteoliposomes of defined lipid composition that retains activity as a regulated halide channel. This reconstitution method together with a novel flux-based assay of channel activity is a suitable system for studying the population channel properties of wild type CFTR and the disease-causing mutants F508del- and G551D-CFTR. Specifically, the method has utility in studying the direct effects of phosphorylation, nucleotides and small molecules such as potentiators and inhibitors on CFTR channel activity. The methods are also amenable to the study of other membrane channels/transporters for anionic substrates.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 While the correctors VX-809 and VX-661 (are not yet approved for use in patients, the potentiator Kalydeco (ivacaftor; VX-770) is being used at 150 mg every 12 hr in CF patients >6 years with at least one G551D-CFTR mutation, and more recently for patients with one of G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D. Login to comment

[hide] Translating the genetics of cystic fibrosis to per... Transl Res. 2015 Apr 15. pii: S1931-5244(15)00131-0. doi: 10.1016/j.trsl.2015.04.008. Corvol H, Thompson KE, Tabary O, le Rouzic P, Guillot L
Translating the genetics of cystic fibrosis to personalized medicine.
Transl Res. 2015 Apr 15. pii: S1931-5244(15)00131-0. doi: 10.1016/j.trsl.2015.04.008., [PMID:25940043]

Abstract [show]
Cystic fibrosis (CF) is the most common life-threatening recessive genetic disease in the Caucasian population. This multiorgan disease is caused by mutations in the gene encoding the CF transmembrane conductance regulator (CFTR) protein, a chloride channel recognized as regulating several apical ion channels. The gene mutations result either in the lack of the protein at the apical surface or in an improperly functioning protein. Morbidity and mortality because of the mutation of CFTR are mainly attributable to lung disease resulting from chronic infection and inflammation. Since its discovery as the causative gene in 1989, much progress has been achieved not only in clinical genetics but also in basic science studies. Recently, combinations of these efforts have been successfully translated into development and availability for patients of new therapies targeting specific CFTR mutations to correct the CFTR at the protein level. Current technologies such as next gene sequencing and novel genomic editing tools may offer new strategies to identify new CFTR variants and modifier genes, and to correct CFTR to pursue personalized medicine, which is already developed in some patient subsets. Personalized medicine or P4 medicine ("personalized," "predictive," "preventive," and "participatory") is currently booming for CF. The various current and future challenges of personalized medicine as they apply to the issues faced in CF are discussed in this review.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
155 Furthermore, Kalydeco has been tested in patients carrying other class III mutations, or targeted class IVand V mutations (sharing functional similarities with the class III).58 The new trials led to an extension of the FDA and European Medical Agency approval to 8 additional gating mutations: p.Gly178Arg (p.G178R), p.Ser549Asn (p.S549N), p.Ser549Arg (p.S549R), p.Gly551Ser (p.G551S), p.Gly1244Glu (p.G1244E), p.Ser1251Asn (p.S1251N), p.Ser1255Pro (pS1255P), and p.Gly1349Asp (p.G1349D).59 Recently, ivacaftor has also been shown to benefit patients carrying the c.350G . Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 G1244E c.3731G4A p.Gly1244Glu 3876delA c.3744delA p.Lys1250Argfs*9 S1251N c.3752G4A p.Ser1251Asn 3905insT c.3773dupT p.Leu1258Phefs*7 4005+1G4A c.3873+1G4A 4016insT c.3889dupT p.Ser1297Phefs*5 Q1313X c.3937C4T p.Gln1313* CFTRdele22,23 c.3964-78_4242+577del p. Login to comment

[hide] [Challenges of personalized medicine for cystic fi... Arch Pediatr. 2015 Jul;22(7):778-86. doi: 10.1016/j.arcped.2015.04.015. Epub 2015 May 26. Corvol H, Taytard J, Tabary O, Le Rouzic P, Guillot L, Clement A
[Challenges of personalized medicine for cystic fibrosis].
Arch Pediatr. 2015 Jul;22(7):778-86. doi: 10.1016/j.arcped.2015.04.015. Epub 2015 May 26., [PMID:26021452]

Abstract [show]
Personalized medicine, or P4 medicine for "Personalized", "Predictive", "Preventive" and "Participatory", is currently booming for cystic fibrosis, with the development of therapies targeting specific CFTR mutations. The various challenges of personalized medicine applied to cystic fibrosis issues are discussed in this paper.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
135 Compte tenu de l`efficacite &#b4; de KalydecoW chez ces patients, le laboratoire VertexW a ensuite teste &#b4;, puis de &#b4;montre &#b4; son efficacite &#b4; chez des patients porteurs d`autres mutations de classe III, ce qui a permis cette anne &#b4;e une extension d`autorisation de mise sur le marche &#b4; (AMM) pour 8 mutations supple &#b4;mentaires : G1244E, G1349D, G178R, G551S, S1251N, S1255P, S549N et S549R [37]. Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 Using the US and Italian data, we calculated equally low MIP scores for G178R (0.09, n = 22), S549N (0.12, n = 39), S1251N (0.07, n = 14), and G1244E (0.0, n = 3), but not for S549R (0.21, n = 14) (Supplementary Table S1 online). Login to comment
105 MIP scores were significantly different between the mutations F508del and G551D, which is in agreement with early studies of smaller numbers of patients with CF that reported a lower MI incidence in patients carrying F508del/G551D when compared with patients with CF with F508del/ F508del.28,29 We demonstrated equally low MIP scores for other class III CFTR mutations (G178R, S549N, G1244E, S1251N), further supporting the idea that class III CFTR mutations are not as severe as F508del, at least with respect to gastrointestinal development. Login to comment

[hide] Targeting ion channels in cystic fibrosis. J Cyst Fibros. 2015 Sep;14(5):561-70. doi: 10.1016/j.jcf.2015.06.002. Epub 2015 Jun 23. Mall MA, Galietta LJ
Targeting ion channels in cystic fibrosis.
J Cyst Fibros. 2015 Sep;14(5):561-70. doi: 10.1016/j.jcf.2015.06.002. Epub 2015 Jun 23., [PMID:26115565]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause a characteristic defect in epithelial ion transport that plays a central role in the pathogenesis of cystic fibrosis (CF). Hence, pharmacological correction of this ion transport defect by targeting of mutant CFTR, or alternative ion channels that may compensate for CFTR dysfunction, has long been considered as an attractive approach to a causal therapy of this life-limiting disease. The recent introduction of the CFTR potentiator ivacaftor into the therapy of a subgroup of patients with specific CFTR mutations was a major milestone and enormous stimulus for seeking effective ion transport modulators for all patients with CF. In this review, we discuss recent breakthroughs and setbacks with CFTR modulators designed to rescue mutant CFTR including the common mutation F508del. Further, we examine the alternative chloride channels TMEM16A and SLC26A9, as well as the epithelial sodium channel ENaC as alternative targets in CF lung disease, which remains the major cause of morbidity and mortality in patients with CF. Finally, we will focus on the hurdles that still need to be overcome to make effective ion transport modulation therapies available for all patients with CF irrespective of their CFTR genotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
604 When tested in clinical trials, the potentiator ivacaftor (also known as VX-770) showed a marked clinical benefit, with substantial improvement of lung function, reduction of pulmonary exacerbations, and increase in body weight in CF patients with G551D and 8 additional Class III mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D) [32-35]. Login to comment

[hide] Hallmarks of therapeutic management of the cystic ... J Cyst Fibros. 2015 Nov;14(6):687-99. doi: 10.1016/j.jcf.2015.09.006. Epub 2015 Oct 29. Amaral MD, Balch WE
Hallmarks of therapeutic management of the cystic fibrosis functional landscape.
J Cyst Fibros. 2015 Nov;14(6):687-99. doi: 10.1016/j.jcf.2015.09.006. Epub 2015 Oct 29., [PMID:26526359]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) protein does not operate in isolation, rather in a dynamic network of interacting components that impact its synthesis, folding, stability, intracellular location and function, referred to herein as the 'CFTR Functional Landscape (CFFL)'. For the prominent F508del mutation, many of these interactors are deeply connected to a protein fold management system, the proteostasis network (PN). However, CF encompasses an additional 2000 CFTR variants distributed along its entire coding sequence (referred to as CFTR2), and each variant contributes a differential liability to PN management of CFTR and to a protein 'social network' (SN) that directs the probability of the (patho)physiologic events that impact ion transport in each cell, tissue and patient in health and disease. Recognition of the importance of the PN and SN in driving the unique patient CFFL leading to disease highlights the importance of precision medicine in therapeutic management of disease progression. We take the view herein that it is not CFTR, rather the PN/SN, and their impact on the CFFL, that are the key physiologic forces driving onset and clinical progression of CF. We posit that a deep understanding of each patients PN/SN gained by merging genomic, proteomic (mass spectrometry (MS)), and high-content microscopy (HCM) technologies in the context of novel network learning algorithms will lead to a paradigm shift in CF clinical management. This should allow for generation of new classes of patient specific PN/SN directed therapeutics for personalized management of the CFFL in the clinic.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
656 The FDA approval of Ivacaftor for multiple G551D like phenotypic variants including G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D [159,160] found at the cell surface with gating defects [161,162], and the FDA-approval of a combination of Lumacaftor and Ivacaftor for treatment of F508del [156] are examples of successful application of these technologies. Login to comment