ABCC7 p.Arg1158*
| ClinVar: |
c.3472C>T
,
p.Arg1158*
D
, Pathogenic
|
| CF databases: |
c.3472C>T
,
p.Arg1158*
D
, CF-causing
|
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Detection of five rare cystic fibrosis mutations p... Clin Chem. 1999 Jul;45(7):957-62. Castaldo G, Fuccio A, Cazeneuve C, Picci L, Salvatore D, Raia V, Scarpa M, Goossens M, Salvatore F
Detection of five rare cystic fibrosis mutations peculiar to Southern Italy: implications in screening for the disease and phenotype characterization for patients with homozygote mutations.
Clin Chem. 1999 Jul;45(7):957-62., [PMID:10388469]
Abstract [show]
BACKGROUND: The search for the eight most frequent mutations (i.e., DeltaF508, G542X, W1282X, N1303K, 1717-1G-->A, R553X, 2183AA-->G, and I148T) by allele-specific oligonucleotide dot-blot analysis revealed 78% of 396 cystic fibrosis alleles in Southern Italy. The observation of frequent haplotypes on the unidentified cystic fibrosis alleles suggested that a few mutations could account for a large number of unidentified alleles. METHODS: We screened most of the coding sequence of the cystic fibrosis transmembrane regulator gene by denaturing gradient gel electrophoresis to determine the spectrum of these mutations in 68 unrelated cystic fibrosis patients bearing one or both unidentified mutations. RESULTS: The screening revealed five mutations, R1158X, 711+1G-->T, 4016insT, L1065P, and G1244E, each of which had a frequency of 1.3-1.8% (7% collectively). The 7% increase in the detection rate (85% vs 78%) reduces by >50% the residual risk of being cystic fibrosis carriers for couples who had tested negative by molecular analysis. We therefore designed a second allele-specific oligonucleotide set to analyze the five mutations. Among the patients analyzed, one patient homozygous for the L1065P mutation expressed a mild pulmonary and intestinal form of the disease with pancreatic insufficiency. Two other patients, homozygous for mutations R1158X and 4016insT, both expressed a severe cystic fibrosis phenotype. CONCLUSIONS: Five cystic fibrosis mutations are peculiar to patients from Southern Italy. The method described for their analysis is efficient, inexpensive, and can be semi-automated by use of a robotic workstation. The results obtained in patients from Southern Italy may have an impact on laboratories in other countries, given the large migrations of populations from Southern Italy to other countries in the last two centuries.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 aso dot-blot procedure for the analysis of the five "rare" cf mutations To analyze routinely the five mutations (i.e., L1065P, 711ϩ1G3T, R1158X, 4016insT, and G1244E) we set up a procedure based on a single multiplex PCR amplification followed by ASO dot-blot hybridization.
X
ABCC7 p.Arg1158* 10388469:46:143
status: NEW49 Mutation Forward primer (5) Reverse primer (3) Wild-type oligo for ASO dot blota Mutated oligo for ASO dot blota L1065P (exon 17b) 5ЈTTCAAAGAATGGCACCAGTGT 3ЈATAACCTATAGAATGCAGCA 5ЈATGGACACTTCGTGCCT (52 °C) 5ЈTGGACACCTCGTGCCT (52 °C) 4016insT (exon 21) 5ЈAATGTTCACAAGGGACTCCA 3ЈCAAAAGTACCTGTTGCTCCA 5ЈAGTATTTATTTTTTCTGGAAC (52 °C) 5ЈGTATTTATTTTTTTCTGGAAC (52 °C) 711ϩ1G3T (intron 5) 5ЈATTTCTGCCTAGATGCTGGG 3ЈAACTCCGCCTTTCCAGTTGT 5ЈTTGATGAAGTATGTACCTAT (52 °C) 5ЈTTTGATGAATTATGTACCTAT (52 °C) R1158X (exon 19) 5ЈGCCCGACAAATAACCAAGTGA 3ЈGCTAACATTGCTTCAGGCT 5ЈTTCAGATGCGATCTGTGA (52 °C) 5ЈTTTCAGATGTGATCTGTGA (52 °C) G1244E (exon 20) 5ЈGGTCAGGATTGAAAGTGTGCA 3ЈCTATGAGAAAACTGCACTGGA 5ЈCCTCTTGGGAAGAACTGGA (53 °C) 5ЈCCTCTTGGAAAGAACTGGA (51 °C) a For each oligonucleotide, the optimal washing temperature of the filter is reported.
X
ABCC7 p.Arg1158* 10388469:49:613
status: NEW53 Results The DGGE screening allowed us to identify 20 different mutations; five of these, i.e., R1158X, G1244E, 4016insT, 711ϩ1G3T, and L1065P, were observed with a frequency Ͼ1.0% among 396 CF alleles from Southern Italy.
X
ABCC7 p.Arg1158* 10388469:53:95
status: NEW66 The R1158X mutation was identified through the altered DGGE pattern of exon 19, followed by sequence Fig. 1.
X
ABCC7 p.Arg1158* 10388469:66:4
status: NEW76 The incidence of R1158X among CF chromosomes from our regions was 1.3%.
X
ABCC7 p.Arg1158* 10388469:76:17
status: NEW87 An example of the improved ASO dot-blot procedure used to analyze the five mutations is shown in Fig. 3 for R1158X (Fig. 3A), L1065P (Fig. 3B), 4016insT (Fig. 3C), 711ϩ1G3T (Fig. 3D), and G1244EG3A (Fig. 3E).
X
ABCC7 p.Arg1158* 10388469:87:108
status: NEW93 Mutation R1158X has a frequency of 0.8% in Greece (20); only one allele bearing the mutation has been described in Spain (21), and two alleles have been described in France (22).
X
ABCC7 p.Arg1158* 10388469:93:9
status: NEW99 Different haplotypes have been described only for R1158X, which suggests a recurrent origin (19) or rather, several recombinant events.
X
ABCC7 p.Arg1158* 10388469:99:50
status: NEW100 Mutation R1158X, which has a frequency of 0.8% in the Greek population (18, 20), could have been introduced into Southern Italy by the ancient Greeks who colonized this geographic area.
X
ABCC7 p.Arg1158* 10388469:100:9
status: NEW103 We observed the same haplotype in all five alleles bearing the R1158X mutation, i.e., 1, 2, 6, 7, 17 (XV2c, KM19, IVS8CA, IVS17bTA, and IVS17bCA).
X
ABCC7 p.Arg1158* 10388469:103:63
status: NEW105 Of the two chromosomes bearing the R1158X mutation described in France, one showed haplotype 2, 2, 16, 7, 17, and the other Table 2.
X
ABCC7 p.Arg1158* 10388469:105:35
status: NEW107 Genotype 4016insT/4016insT R1158X/R1158X L1065P/L1065P Ethnic origin Southern Italy Southern Italy Southern Italy Present age 23 years Death at 20 years 18 years Age at diagnosis 2 years 3 months 1 year Meconium ileus No No No Nasal polyposis No No No Lung involvement Severe Very severe Mild FEV 1, % of predicted 38 18 62 Liver involvement Cholestasis Moderate Mild Pancreatic insufficiency Moderate Moderate Moderate Sweat chloride 70 mEq/L 98 mEq/L 93 mEq/L Table 3.
X
ABCC7 p.Arg1158* 10388469:107:27
status: NEWX
ABCC7 p.Arg1158* 10388469:107:34
status: NEW109 CF mutation XV2c KM19 IVS18CA IVS17bTA IVS17bCA M470V R1158X 1 2 16 7 17 M L1065P 1 1 16 30 13 V 711ϩ1G3T 1 1 16 25 13 V 4016insT 2 1 16 30 13 V G1244EG3T 1 1 16 34 13 V showed haplotype 2, 2, 16, 45, 13, suggesting the recurrent origin of the mutation or a recombinant event (18, 22).
X
ABCC7 p.Arg1158* 10388469:109:54
status: NEW129 The patient homozygous for R1158X (a nonsense mutation) and the patient homozygous for 4016insT (a frameshift mutation) showed very severe expression of CF (because the synthesis of the wild-type protein was suppressed) compared with the patient homozygous for L1065P, a missense mutation associated with the synthesis of a protein with a single amino acid substitution.
X
ABCC7 p.Arg1158* 10388469:129:27
status: NEW135 For R1158X (A) and L1065P (B), 1 and 2 are heterozygotes for the mutation, 3 is a homozygote for the mutation, and 4 is a healthy control.
X
ABCC7 p.Arg1158* 10388469:135:4
status: NEW[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]
Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
92 The technique developed demonstrates excellent single-strand separation and non-radioactive visualisation on polyacrylamide gels, and is time-saving and directly Table 2 Known mutations identified in 198 CF patients analysed investigatively Exon (E) Number of CFTR mutations intron (I) chromosomes Patient`s nationality Highest prevalence ∆F508 E10 212 miscellaneous 3905insT E20 025 Swiss Swiss, Amish, Arcadian R553X E11 020 Swiss, German German 1717-1G->A I10 017 Swiss, Italian Italian N1303K E21 011 Swiss, French, Italian Italian W1282X E20 014 Swiss, Italian, Israelit Jewish-Askhenazi G542X E11 009 Swiss, Spanish, Italian Spanish 2347delG E13 008 Swiss R1162X E19 006 Swiss, Italian, Russian Italian 3849+10kbC->T I19 005 German, French R347P E07 004 Swiss T5 I08 004 Swiss R334W E07 003 Swiss Q525X E10 003 Swiss 3732delA E19 003 Swiss S1235R E19 003 Italian, Turkish G85E E03 002 Italian, Greek I148T E04 002 Austrian, Turkish French-Canadian 621+1G->T I04 002 French French-Canadian 1078delT E07 002 Swiss E585X E12 002 Italian 2176insC E13 002 Swiss, Italian 2789+5G->A I14b 002 Italian Spanish D1152H E18 002 Swiss, French 4016insT E21 002 Turkish Q39X E02 001 Swiss 394delTT E03 001 Swiss Nordic, Finnish R117H E04 001 Swiss A120T E04 001 Swiss G126D E04 001 Swiss 711+5G->A I05 001 Russian M348K E07 001 Italian L568F E12 001 Italian 2183AA->G E13 001 Italian Italian K710X E13 001 Swiss S945L E15 001 French 3272-26A.->G I17a 001 Swiss M1101K E17b 001 Swiss Huttite 3601-17C->T I18 001 Swiss R1158X E19 001 Swiss 4005+1G-A I20 001 Italian applicable to early diagnostic testing, carrier detection and prenatal diagnosis.
X
ABCC7 p.Arg1158* 10439967:92:1516
status: NEW[hide] A novel mutation in the CFTR gene correlates with ... J Med Genet. 2000 Mar;37(3):215-8. Wang J, Bowman MC, Hsu E, Wertz K, Wong LJ
A novel mutation in the CFTR gene correlates with severe clinical phenotype in seven Hispanic patients.
J Med Genet. 2000 Mar;37(3):215-8., [PMID:10777364]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
570 SYLVAIN R RIVARD* CHRISTIAN ALLARD† JEAN-PIERRE LEBLANC† MARCEL MILOT† GERVAIS AUBIN† FERNAND SIMARD† CLAUDE FÉREC‡ MARC DE BRAEKELEER†§¶ *Département des Sciences Fondamentales, Université du Québec à Chicoutimi, Canada Table 1 Distribution of cystic fibrosis patients diagnosed before the age of 5 by age groups in Saguenay-Lac-Saint-Jean, (A) by genotype, (B) by mutation 0-10 years 10.1-20 years Over 20 years All ages No % No % No % No % (A) Genotype F508/ F508 15 (1) 40.5 21 (2) 36.2 18 (3) 42.9 54 (6) 39.4 F508/621+1G→T 12 (1) 32.4 16 (1) 27.6 10 (1*) 23.8 38 (3*) 27.7 F508/A455E 1 2.7 6 10.3 5 11.9 12 8.8 F508/I148T 1 2.7 1 1.7 2 1.5 F508/Y1092X 3 (1) 5.2 1 2.4 4 (1) 2.9 F508/Q890X 1 2.4 1 0.7 F508/R1158X 1 2.4 1 0.7 621+1G→T/621+1G→T 2 (1) 5.4 4 6.9 1 2.4 7 (1) 5.1 621+1G→T/A455E 1 2.7 4 6.9 3 7.1 8 5.8 621+1G→T/711+1G→T 2 (1) 5.4 2 (1) 3.4 4 (2) 2.9 621+1G→T/Y1092X 1 2.7 1 0.7 621+1G→T/S489X 1 2.7 1 0.7 621+1G→T/G85E 1 (1) 1.7 1 (1) 2.4 2 (2) 1.5 A455E/R117C 1 2.7 1 0.7 N1303K/I148T 1 2.4 1 0.7 Total 37 58 42 137 Death (4) 10.8 (6) 10.3 (5*) 11.9 (15*) 10.9 (B) Mutation F508 16 (1) 43.2 25 (3) 43.1 21 (3) 51.2 62 (7) 45.6 621+1G→T 18 (3) 48.6 23 (3) 39.7 12 (2*) 29.3 53 (8*) 39.0 A455E 3 8.1 10 17.2 8 19.5 21 15.4 Total 37 58 41 136 Death (4) 10.8 (6) 10.3 (5*) (12.2) (15*) (11.0) ( ): Number of deaths.
X
ABCC7 p.Arg1158* 10777364:570:803
status: NEW[hide] Correlation between mutations and age in cystic fi... J Med Genet. 2000 Mar;37(3):225-7. Rivard SR, Allard C, Leblanc JP, Milot M, Aubin G, Simard F, Ferec C, de Braekeleer M
Correlation between mutations and age in cystic fibrosis in a French Canadian population.
J Med Genet. 2000 Mar;37(3):225-7., [PMID:10777368]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
570 SYLVAIN R RIVARD* CHRISTIAN ALLARD† JEAN-PIERRE LEBLANC† MARCEL MILOT† GERVAIS AUBIN† FERNAND SIMARD† CLAUDE FÉREC‡ MARC DE BRAEKELEER†§¶ *Département des Sciences Fondamentales, Université du Québec à Chicoutimi, Canada Table 1 Distribution of cystic fibrosis patients diagnosed before the age of 5 by age groups in Saguenay-Lac-Saint-Jean, (A) by genotype, (B) by mutation 0-10 years 10.1-20 years Over 20 years All ages No % No % No % No % (A) Genotype F508/ F508 15 (1) 40.5 21 (2) 36.2 18 (3) 42.9 54 (6) 39.4 F508/621+1G→T 12 (1) 32.4 16 (1) 27.6 10 (1*) 23.8 38 (3*) 27.7 F508/A455E 1 2.7 6 10.3 5 11.9 12 8.8 F508/I148T 1 2.7 1 1.7 2 1.5 F508/Y1092X 3 (1) 5.2 1 2.4 4 (1) 2.9 F508/Q890X 1 2.4 1 0.7 F508/R1158X 1 2.4 1 0.7 621+1G→T/621+1G→T 2 (1) 5.4 4 6.9 1 2.4 7 (1) 5.1 621+1G→T/A455E 1 2.7 4 6.9 3 7.1 8 5.8 621+1G→T/711+1G→T 2 (1) 5.4 2 (1) 3.4 4 (2) 2.9 621+1G→T/Y1092X 1 2.7 1 0.7 621+1G→T/S489X 1 2.7 1 0.7 621+1G→T/G85E 1 (1) 1.7 1 (1) 2.4 2 (2) 1.5 A455E/R117C 1 2.7 1 0.7 N1303K/I148T 1 2.4 1 0.7 Total 37 58 42 137 Death (4) 10.8 (6) 10.3 (5*) 11.9 (15*) 10.9 (B) Mutation F508 16 (1) 43.2 25 (3) 43.1 21 (3) 51.2 62 (7) 45.6 621+1G→T 18 (3) 48.6 23 (3) 39.7 12 (2*) 29.3 53 (8*) 39.0 A455E 3 8.1 10 17.2 8 19.5 21 15.4 Total 37 58 41 136 Death (4) 10.8 (6) 10.3 (5*) (12.2) (15*) (11.0) ( ): Number of deaths.
X
ABCC7 p.Arg1158* 10777368:570:803
status: NEW[hide] Mild clinical phenotype associated with R1158X/S54... Clin Genet. 2000 Aug;58(2):147-9. Frossard PM, Abdelaziz SA, Hertecant J, Girodon E, Goossens M, Dawson KP
Mild clinical phenotype associated with R1158X/S549R(T-->G) CFTR genotype.
Clin Genet. 2000 Aug;58(2):147-9., [PMID:11005149]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 All rights reser6ed Letter to the Editor Mild clinical phenotype associated with R1158X/S549R(TG) CFTR genotype To the Editor: Cystic fibrosis (CF) is due to DNA variations that modify the sequence, structure, function and/or expression of the cystic fibrosis transmembrane conductance regulator (CFTR) gene (1).
X
ABCC7 p.Arg1158* 11005149:1:81
status: NEW9 We report here the identification of the first compound heterozygote patient in the UAE, who harbours mutations S549R/R1158X in his CFTR gene.
X
ABCC7 p.Arg1158* 11005149:9:118
status: NEW35 Results indicate that AIM is a compound heterozygote harbouring mutation S549R(TG) in exon 11 of one CFTR allele, and nonsense mutation R1158X (7) in exon 19 of the other allele.
X
ABCC7 p.Arg1158* 11005149:35:142
status: NEW39 Moreover, his R1158X/S549R(TG) CFTR genotype is associated with an atypically mild course of the disease.
X
ABCC7 p.Arg1158* 11005149:39:14
status: NEW40 R1158X had originally been reported as a rare mutation, with, for example, one allele in Spain (8) and Portugal (9), and two alleles in southern France (10) and Canada (11).
X
ABCC7 p.Arg1158* 11005149:40:0
status: NEW42 Genotype-phenotype correlations for this mutation have indicated that R1158X homozygosity underlies a very severe expression of CF (13) and that a patient with a DF508/R1158X genotype had experienced several complications (11).
X
ABCC7 p.Arg1158* 11005149:42:70
status: NEWX
ABCC7 p.Arg1158* 11005149:42:168
status: NEW43 Thus, although a patient with an R1158X/S549R(TG) genotype could have been expected to present with severe clinical manifestations, we find here that it is not the case.
X
ABCC7 p.Arg1158* 11005149:43:33
status: NEW45 Indeed, Duarte et al. (9) have reported that a complex allele containing two mutations, R334W and R1158X, is associated with reduced levels of correctly processed mRNA, and that a patient with the complex genotype R334W-R1158X/DF508 presented with pancreatic sufficiency and an atypical course of CF.
X
ABCC7 p.Arg1158* 11005149:45:98
status: NEWX
ABCC7 p.Arg1158* 11005149:45:220
status: NEW50 Although almost all of the previously analysed nonsense CFTR mutations have been associated with either considerable transcript reduction or production of aberrant transcripts (skipping) (16), an explanation for the mild phenotype might be that the transcript corresponding to the R1158X allele is stable and correctly spliced.
X
ABCC7 p.Arg1158* 11005149:50:281
status: NEW53 As the R1158X mutation is located 4 codons upstream from codon 1162, it could be associated with the same non-standard decoding mechanism that rescues the message and thus produces milder symptoms.
X
ABCC7 p.Arg1158* 11005149:53:7
status: NEW77 Ronchetto P, Telleria Orriols JJ, Fanen P et al. A nonsense mutation (R1158X) and a splicing mutation (3849+4A----G) in exon 19 of the cystic fibrosis transmembrane conductance regulator gene.
X
ABCC7 p.Arg1158* 11005149:77:70
status: NEW85 Complex cystic fibrosis allele R334W-R1158X results in reduced levels of correctly processed mRNA in a pancreatic sufficient patient.
X
ABCC7 p.Arg1158* 11005149:85:37
status: NEW[hide] Two mild cystic fibrosis-associated mutations resu... J Biol Chem. 2001 Mar 23;276(12):9045-9. Epub 2000 Dec 15. Clain J, Fritsch J, Lehmann-Che J, Bali M, Arous N, Goossens M, Edelman A, Fanen P
Two mild cystic fibrosis-associated mutations result in severe cystic fibrosis when combined in cis and reveal a residue important for cystic fibrosis transmembrane conductance regulator processing and function.
J Biol Chem. 2001 Mar 23;276(12):9045-9. Epub 2000 Dec 15., 2001-03-23 [PMID:11118444]
Abstract [show]
The number of complex cystic fibrosis transmembrane conductance regulator (CFTR) genotypes identified as having double-mutant alleles with two mutations inherited in cis has been growing. We investigated the structure-function relationships of a severe cystic fibrosis (CF)-associated double mutant (R347H-D979A) to evaluate the contribution of each mild mutation to the phenotype. CFTR mutants expressed in HeLa cells were analyzed for protein biosynthesis and Cl(-) channel activity. Our data show that R347H is associated with mild defective Cl(-) channel activity and that the D979A defect leads to misprocessing. The mutant R347H-D979A combines both defects for a dramatic decrease in Cl(-) current. To decipher the molecular mechanism of this phenotype, single and double mutants with different charge combinations at residues 347 and 979 were constructed as charged residues were involved in this complex genotype. These studies revealed that residue 979, located in the third cytoplasmic loop, is critical for CFTR processing and Cl(-) channel activity highlighting the role of charged residues. These results have also important implications for CF, as they show that two mutations in cis can act in concert to alter dramatically CFTR function contributing to the wide phenotypic variability of CF disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
125 DISCUSSION Complex alleles have been described clinically (R553Q- ⌬F508, ⌬F508-V1212I, and R334W-R1158X), and most of them are considered to reverse the phenotype, as they are associated with milder symptoms than the most common mutation in isolation.
X
ABCC7 p.Arg1158* 11118444:125:111
status: NEW[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]
Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.
Comments [show]
None has been submitted yet.
No. Sentence Comment
125 It was unexpected that six of the next most common mutations after 3120 ϩ 1GϾA would be of Caucasian origin (R1158X, R117H, G551D, 1812-1GϾA, 1898 ϩ 1GϾA, and R1066C).
X
ABCC7 p.Arg1158* 11388756:125:121
status: NEW126 Of these, R1066C has a frequency of 3.1% in Portugal,5 1812-1GϾA was originally identified in 1/50 Spanish CF chromosomes,24 and R1158X was originally identified in an Italian CF patient.13 Our detection of R1158X on four African American chromosomes (2.0%) was not anticipated.
X
ABCC7 p.Arg1158* 11388756:126:135
status: NEWX
ABCC7 p.Arg1158* 11388756:126:213
status: NEW128 By comparison, eight "African" mutations accounted for a similar percentage of the chromosomes analyzed (23%) in the study by Macek et al.6 In contrast, 11 of the 20 mutations detected in this study are considered to be "Caucasian" mutations and account for 10.5% of the chromosomes analyzed (R117H, 621 ϩ 1GϾT, R334W, Q493X, G551D, 1812-1GϾA, 1898 ϩ 1GϾA, R1066C, R1158X, R1162X, and 3905insT).
X
ABCC7 p.Arg1158* 11388756:128:395
status: NEW[hide] The S549R (T-->G) cystic fibrosis gene mutation. J Trop Pediatr. 2001 Aug;47(4):196-8. Dawson KP, Frossard PM
The S549R (T-->G) cystic fibrosis gene mutation.
J Trop Pediatr. 2001 Aug;47(4):196-8., [PMID:11523757]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
28 Only one example of a heterozygote has been encountered and this patient had a mild phenotype and a genotype R1158X/S549R (T➝G).
X
ABCC7 p.Arg1158* 11523757:28:109
status: NEW[hide] Cystic fibrosis mutation testing in Italy. Genet Test. 2001 Fall;5(3):229-33. Bombieri C, Pignatti PF
Cystic fibrosis mutation testing in Italy.
Genet Test. 2001 Fall;5(3):229-33., [PMID:11788089]
Abstract [show]
In Italy, Cystic fibrosis (CF) mutation frequency differences have been observed in different regions. In the northeastern Veneto and Trentino Alto Adige regions, a complete cystic fibrosis transmembrane conductance regulator (CFTR) gene screening in CF patients detected through a newborn screening program has identified about 90% of the mutations. In these two regions, the current detection rate using a CF screening panel containing the 16 most common mutations is 86.6%. CF mutations in some other Italian regions have not been so thoroughly analysed. Available data indicate that a more general national screening panel comprising 31 mutations may detect about 75% of all CF mutations in Italy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
44 CF GENE MUTATIONS IN ITALY Number of alleles Frequency Cumulative Mutation screened (%) frequency (%) DF508 3442 51.07 51.07 N1303K 3056 4.84 55.91 G542X 3082 4.83 60.75 2183 AA ® G 2596 2.66 63.41 R1162X 2580 2.42 65.83 1717-1 G ® A 2892 2.11 67.94 W1282X 2600 1.23 69.17 R553X 2882 1.15 70.31 T338I 2306 0.69 71.01 R347P 2642 0.61 71.61 711 1 5 G ® A 2454 0.57 72.18 G85E 1980 0.40 72.59 621 1 1 G ® T 2594 0.39 72.97 R334W 2366 0.30 73.27 R352Q 2112 0.24 73.50 S549N 2118 0.24 73.74 R347H 2184 0.18 73.92 L1077P 1840 0.16 74.09 R1158X 1878 0.16 74.25 541del C 1884 0.16 74.40 R1066H 1918 0.16 74.56 E585X 1922 0.16 74.72 Q552X 2172 0.14 74.86 D1152H 1824 0.11 74.97 2790-2 A ® G 1862 0.11 75.07 3132 del TG 1862 0.11 75.18 3667ins 4 1876 0.11 75.29 DI507 1914 0.10 75.39 1898 1 3 A ® G 1920 0.10 75.50 G1244E 1960 0.10 75.60 1784 del G 2052 0.10 75.69 From Rendine et al. (1997).
X
ABCC7 p.Arg1158* 11788089:44:551
status: NEW[hide] Genetic and clinical features of false-negative in... Acta Paediatr. 2002;91(1):82-7. Padoan R, Genoni S, Moretti E, Seia M, Giunta A, Corbetta C
Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.
Acta Paediatr. 2002;91(1):82-7., [PMID:11883825]
Abstract [show]
A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. Conclusion: The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
40 Mutation Frequency (%) DelF508 54 N1303K 8 G542X 6.25 1717-1G ® A 2.50 R334W 1.75 2183AA ® G 1.50 R117H, L1077P, W1282X 1.25 D110E, R347P, E585X, 2789 ‡ 5G ® A 0.75 R352Q, R553X, R1066H, D1152H, R1158X, 1782delA, 1898 ‡ 1G ® A, 3659delC 0.50 G85E, R117L, G178R, D579G, H609R, Y1032C, V1153E, R1162X, 621 ‡ 1G ® T, 711 ‡ 1G ® T, 1845delAG o 1846delGA, 2143delT 0.25 Table2.Differencesinthethreestrategiesofneonatalscreening(audit1990-1999).
X
ABCC7 p.Arg1158* 11883825:40:217
status: NEW[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]
Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Arg1158* 12007216:109:4388
status: NEW110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Arg1158* 12007216:110:893
status: NEW112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL.
X
ABCC7 p.Arg1158* 12007216:112:2267
status: NEW[hide] Genotype-phenotype correlation in cystic fibrosis:... Am J Med Genet. 2002 Jul 22;111(1):88-95. Salvatore F, Scudiero O, Castaldo G
Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes.
Am J Med Genet. 2002 Jul 22;111(1):88-95., 2002-07-22 [PMID:12124743]
Abstract [show]
More than 1,000 mutations have been identified in the cystic fibrosis (CF) transmembrane regulator (CFTR) disease gene. The impact of these mutations on the protein and the wide spectrum of CF phenotypes prompted a series of Genotype-Phenotype correlation studies. The CFTR genotype is invariably correlated with pancreatic status-in about 85% of cases with pancreatic insufficiency and in about 15% of cases with pancreatic sufficiency. The correlations between the CFTR genotype and pulmonary, liver, and gastrointestinal expression are debatable. The heterogeneous phenotype in CF patients bearing the same genotype or homozygotes for nonsense mutations implicated environmental and/or genetic factors in the disease. However, the discordant phenotype observed in CF siblings argued against a major role of environmental factors and suggested that genes other than CFTR modulate the CF phenotype. A locus that modulates gastrointestinal expression was identified in mice and subsequently in humans. By analyzing nine CF patients discordant for meconium ileus we were able to show that this locus had a dominant effect. Moreover, in a collaborative study we found a higher rate of polymorphisms in beta-defensin genes 1 and 2 in CF patients and in controls. In another multicenter study mutations in alpha-1 antitrypsin (A1AT) and mannose binding lectin genes were found to be independent risk factors for liver disease in CF patients. The body of evidence available suggests that the variegated CF phenotype results from complex interactions between numerous gene products.
Comments [show]
None has been submitted yet.
No. Sentence Comment
66 On the contrary, a severe pulmonary phenotype was reported in 16 CF patient homozygotes for W1282X [Shoshani et al., 1992], and more recently in the first CF patient homozygote for the R1158X nonsense mutation [Castaldo et al., 1999], while a double heterozygote for R1158X showed a mild phenotype [Frossard et al., 2000].
X
ABCC7 p.Arg1158* 12124743:66:185
status: NEWX
ABCC7 p.Arg1158* 12124743:66:267
status: NEW[hide] Five percent of normal cystic fibrosis transmembra... Am J Respir Cell Mol Biol. 2002 Nov;27(5):619-27. Ramalho AS, Beck S, Meyer M, Penque D, Cutting GR, Amaral MD
Five percent of normal cystic fibrosis transmembrane conductance regulator mRNA ameliorates the severity of pulmonary disease in cystic fibrosis.
Am J Respir Cell Mol Biol. 2002 Nov;27(5):619-27., [PMID:12397022]
Abstract [show]
Estimates of the level of transcripts from the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene required to develop a CF phenotype range from 4-20% of normal. Due to the importance of obtaining reliable data on this issue for therapeutic strategies, we developed a novel polymerase chain reaction-based method to quantify CFTR transcripts and applied it to the analysis of nasal epithelium RNA of five patients with CF and the 3272-26A>G/F508del genotype. We calculated that 8.2 +/- 0.84% of the total CFTR RNA present in these five patients is normal full-length CFTR mRNA. We then demonstrated (in nasal samples from F508del carriers, n = 30) that the abundance of full-length F508del CFTR transcripts is reduced compared with wild-type transcripts, and estimated that the average ratio of F508del/wild-type transcripts is 0.87 +/- 0.06. To determine the amount of full-length transcripts relative to levels found in normal individuals, we corrected for the lower abundance of the F508del transcripts and calculated that the five patients with CF have, on average, 4.7 +/- 0.45% of the normal level of wild-type CFTR mRNA. Because these patients have mild CF compared with F508del homozygotes, this CFTR mRNA level appears to be sufficient to avoid the severe complications of the disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
280 Com-Increased apolipoprotein E and c-fms gene expression without elevated plex cystic fibrosis allele R334W-R1158X results in reduced levels ofinterleukin 1 or 6 mRNA levels indicates selective activation of macro- correctly processed mRNA in a pancreatic sufficient patient.
X
ABCC7 p.Arg1158* 12397022:280:108
status: NEW[hide] Clinical characteristics and genotype analysis of ... Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32. Cimmino M, Cavaliere M, Nardone M, Plantulli A, Orefice A, Esposito V, Raia V
Clinical characteristics and genotype analysis of patients with cystic fibrosis and nasal polyposis.
Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32., [PMID:12680831]
Abstract [show]
The prevalence of nasal polyps in a group of paediatric patients with cystic fibrosis was prospectively studied in comparison with a control group with cystic fibrosis but without polyps. Clinical variables, including pulmonary function tests, skin testing and mucociliary transport, were carried out in both groups, as well as genotype analysis. Endoscopic intranasal evaluation identified polyps in 29 of 89 patients (33%). Statistical analysis revealed that patients with nasal polyposis had better pulmonary function, a higher rate of Pseudomonas aeruginosa colonization, more hospitalizations, and more prevalence of allergy to Aspergillus fumigatus than did the comparison group. We found no statistically different genotype distribution between the polyposis and the control group. However, it can be emphasized that the prevalence of the compound heterozygous genotype is higher in the nasal polyposis group than in controls. Our observations suggest that other genetic and environmental factors could play an important role in the development of nasal polyposis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
47 Analysis of mutations in the CFTR gene as tested by the multiplex polymerase chain reaction (PCR), followed by the reverse dot-blot technique, which searches for 29 of the most frequent mutations (DF508, N1303K, G542X, W1282X, 1717±1 G-A, R553X, 2183 AA-G, DI507, G551D, R560T, 3849 10kbC > T, R1162X, 3659delC, 3905insT, G85E, 621 1GT, R117H, R347P, R334W, A455E, 2789 5GA, Q552X, S1251N, 3905insT, 394delTT, E60X, 2143delT, 2184delA, 711 5G > A), and by ASO dot-blot for the following mutations: I148T, R1158X, 4016 1T, G1244E G >A.26 Statistical analysis was performed using multivariate analysis, by forward stepwise comparison; it was done to ®nd out which of the examined characteristics could be associated (P < 0.01) to nasal polyposis.
X
ABCC7 p.Arg1158* 12680831:47:538
status: NEW[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]
Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.
Comments [show]
None has been submitted yet.
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes.
X
ABCC7 p.Arg1158* 14641997:63:1426
status: NEWX
ABCC7 p.Arg1158* 14641997:63:1522
status: NEWX
ABCC7 p.Arg1158* 14641997:63:1618
status: NEW[hide] CFTR localization in native airway cells and cell ... J Histochem Cytochem. 2004 Feb;52(2):193-203. Carvalho-Oliveira I, Efthymiadou A, Malho R, Nogueira P, Tzetis M, Kanavakis E, Amaral MD, Penque D
CFTR localization in native airway cells and cell lines expressing wild-type or F508del-CFTR by a panel of different antibodies.
J Histochem Cytochem. 2004 Feb;52(2):193-203., [PMID:14729871]
Abstract [show]
The intracellular localization of cystic fibrosis transmembrane conductance regulator (CFTR) in native tissues is a major issue in the study of mutation, processing, and trafficking effects in CFTR and in the evaluation of therapeutic strategies in cystic fibrosis (CF). This work evaluated the applicability of ten different antibodies (Abs) under various fixation techniques for CFTR localization in fresh-brushed nasal epithelial cells collected from CF patients homozygous for F508del and control individuals. In parallel, the same Ab panel was also tested on BHK cell lines overexpressing wild-type or F508del CFTR. The Abs MATG1061, 169, Lis1, MP-CT1, CC24-R, MAB25031, and MAB1660 gave the best detection of CFTR in the apical region (AR) of nasal tall columnar epithelial (TCE) cells. The labeling pattern of these Abs was consistent with the postulated processing defect of F508del CFTR because only a minority of CF TCE cells present CFTR in the AR. In contrast, M3A7, MM13-4, and L12B4 weakly react with the AR and stain almost exclusively a cis-Golgi-like structure in the majority of CF and non-CF airway cells. In BHK cells, all the Abs enabled distinction between wild-type CFTR localization in cell membrane from F508del CFTR, which in these cells is exclusively located in the endoplasmic reticulum.
Comments [show]
None has been submitted yet.
No. Sentence Comment
216 Pflugers Arch 443 (suppl 1):S117-120 Duarte A, Amaral M, Barreto C, Pacheco P, Lavinha J (1996) Complex cystic fibrosis allele R334W-R1158X results in reduced levels of correctly processed mRNA in a pancreatic sufficient patient.
X
ABCC7 p.Arg1158* 14729871:216:133
status: NEW[hide] Genotype/phenotype correlation of the G85E mutatio... Eur Respir J. 2004 May;23(5):679-84. Decaestecker K, Decaestecker E, Castellani C, Jaspers M, Cuppens H, De Boeck K
Genotype/phenotype correlation of the G85E mutation in a large cohort of cystic fibrosis patients.
Eur Respir J. 2004 May;23(5):679-84., [PMID:15176679]
Abstract [show]
In this European study, the phenotype in 68 patients, homozygous or compound heterozygous for the G85E mutation, was investigated. Each index case was compared with two cystic fibrosis (CF) patients from the same clinic, matched for age and sex: one with pancreatic sufficiency (PS) and one with pancreatic insufficiency (PI). When comparing 31 G85E/F508del and F508del/F508del patients, there were no differences in median age at diagnosis, mean sweat chloride value, most recent weight for height, most recent forced expiratory volume in one second % predicted, prevalence of chronic Pseudomonas aeruginosa colonisation and typical CF complications. However, PI was less frequent in the G85E/F508del group. Comparison of 55 G85E patients (with second mutation known and not classified as mild) with PS controls (n=44) showed that the G85E patients had a significantly higher sweat chloride, more often failure to thrive at diagnosis, higher prevalence of PI, worse current weight for height, higher prevalence of chronic P. aeruginosa colonisation and liver cirrhosis. Pulse-chase experiments revealed that G85E cystic fibrosis transmembrane conductance regulator failed to mature on a M470 as well as on a V470 background. Therefore, G85E is a class II mutation. Although there is variability in its clinical presentation, G85E mutation results in a severe phenotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
93 1 G85E/W496X 1 F508del# /N1303K# 1 G85E/N1303K# 1 T388I/R1158X 1 G85E/711z5GRA} 1 3272-26AwG} /E822X 1 G85E/R334W} 1 F508del# /R334W} 1 Total 68 574delA/2789z5GRA 1 F508del# /3272-26ARG} 1 F508del# /R352Q 1 F508del# /3272-26AwG} 1 R334W} /444delA 1 L206W/3272-26ARG} 1 F508del# /F508del# 1 L206W/?
X
ABCC7 p.Arg1158* 15176679:93:56
status: NEW[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]
Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.
Comments [show]
None has been submitted yet.
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene.
X
ABCC7 p.Arg1158* 15371903:35:296
status: NEW[hide] Genetic abnormalities among severely oligospermic ... J Clin Endocrinol Metab. 2005 Jan;90(1):152-6. Epub 2004 Oct 27. Foresta C, Garolla A, Bartoloni L, Bettella A, Ferlin A
Genetic abnormalities among severely oligospermic men who are candidates for intracytoplasmic sperm injection.
J Clin Endocrinol Metab. 2005 Jan;90(1):152-6. Epub 2004 Oct 27., [PMID:15509635]
Abstract [show]
Recent reports suggest that children born after intracytoplasmic sperm injection performed for male factor infertility are at increased risk of congenital malformations and chromosome aberrations. To explain these observations, we hypothesized that infertile men may be more likely than fertile men to have genetic abnormalities. We studied 750 severely oligozoospermic men (sperm count <5 million/ml) who were candidates for intracytoplasmic sperm injection, and 303 fertile men. We analyzed the peripheral blood karyotype, the Y chromosome long arm for detection of microdeletions in the azoospermia factors, and mutations in the cystic fibrosis gene and the androgen receptor gene. We also analyzed sperm for chromosome aneuploidies among the 421 men who subsequently entered the in vitro fertilization program. A total of 104 genetic abnormalities were diagnosed, corresponding to a frequency of 13.9% (104 of 750). Chromosomal aberrations were present in 5.6% (42 of 750) of infertile men and 0.3% of controls (one of 295), and they were in most cases alterations of the sex chromosomes. Y chromosome long-arm microdeletions were detected in 6.0% (45 of 750) of infertile men and most frequently included the azoospermia factor c, whereas no cases were found in controls (zero of 210). Mutations in the cystic fibrosis gene were diagnosed in 1.2% (nine of 750) of infertile men and 1.0% of controls (three of 303), and mutations in the androgen receptor gene were found in 1.1% (eight of 750) of infertile men and none of the 188 controls. Sperm sex chromosome aneuploidies were increased in men with karyotype anomalies and Y chromosome microdeletions as well as in subjects without constitutional genetic abnormalities. This study shows that the frequency of genetic alterations is increased among men with severe spermatogenic impairment. Genetic tests and genetic counseling should therefore be considered in oligozoospermic men who are candidates for intracytoplasmic sperm injection.
Comments [show]
None has been submitted yet.
No. Sentence Comment
69 Three of them had the classical ⌬F508 mutation, four cases had other less frequent mutations (R553X, D579G, and R1158X), and two subjects had the 5T allele.
X
ABCC7 p.Arg1158* 15509635:69:119
status: NEW[hide] Comprehensive cystic fibrosis mutation epidemiolog... Ann Hum Genet. 2005 Jan;69(Pt 1):15-24. Castaldo G, Polizzi A, Tomaiuolo R, Cazeneuve C, Girodon E, Santostasi T, Salvatore D, Raia V, Rigillo N, Goossens M, Salvatore F
Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population.
Ann Hum Genet. 2005 Jan;69(Pt 1):15-24., [PMID:15638824]
Abstract [show]
We screened the whole coding region of the cystic fibrosis transmembrane regulator (CFTR) gene in 371 unrelated cystic fibrosis (CF) patients from three regions of southern Italy. Forty-three mutations detected 91.5% of CF mutated chromosomes by denaturing gradient gel electrophoresis analysis, and three intragenic CFTR polymorphisms predicted a myriad of rare mutations in uncharacterized CF chromosomes. Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711 + 1G > T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Several mutations frequently found in northern Italy (e.g., R1162X, 711 + 5G > T) and northern Europe (e.g., G551D, I507del and 621 + 1G > T) are absent from the studied population. The I148T-3195del6 complex allele was present in two CF chromosomes, whereas I148T was present in both alleles (as a single mutation) in another CF patient and in five CF carriers; this could result from crossover events. The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849 + 10kbC > T, 1717-1G > A, E585X, 3272-26G > A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events. Given the large population migration from southern Italy, knowledge of the CF molecular epidemiology in this area is an important contribution to diagnosis, counselling and interlaboratory quality control for molecular laboratories worldwide.
Comments [show]
None has been submitted yet.
No. Sentence Comment
2 Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711+1G>T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles).
X
ABCC7 p.Arg1158* 15638824:2:69
status: NEWX
ABCC7 p.Arg1158* 15638824:2:288
status: NEW5 The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849+10kbC>T, 1717-1G>A, E585X, 3272-26G>A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events.
X
ABCC7 p.Arg1158* 15638824:5:280
status: NEW33 The 13 mutations in this panel are: F508del, N1303K, G542X, W1282X, 2183AA>G, 1717-1G>A, R553X, I148T, R1158X, 711+1G>T, 4016insT, L1065P and G1244E.
X
ABCC7 p.Arg1158* 15638824:33:103
status: NEW49 In particular, 4016insT, R1158X, 711+1 G>T and L1065P had a cumulative frequency of 6.3% in CF chromosomes from Campania; G1244E and 852del22 a cumulative frequency of 9.6% in CF chromosomes from Basilicata; and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D a cumulative frequency of 19.6% in CF chromosomes from Puglia.
X
ABCC7 p.Arg1158* 15638824:49:25
status: NEWX
ABCC7 p.Arg1158* 15638824:49:266
status: NEW52 We also identified three homozygotes for G542X, three for 852del22, two for 2183AA>G, and one each for N1303K, 1717-1G>A, 4016insT, R553X, R1158X and L1065P.
X
ABCC7 p.Arg1158* 15638824:52:139
status: NEW62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n.
X
ABCC7 p.Arg1158* 15638824:62:494
status: NEW86 However, 12 mutations (4016insT, R1158X, 711+1G>T, L1065P, G1244E, 4382delA, 1259insA, I502T, 852del22, D579G, L1077P and G1349D) have not been found (or have a low incidence) in populations from the British Isles (Cheadle et al. 1993; Ferec et al. 1992), Spain (Chillon et al. 1994; Casals et al.
X
ABCC7 p.Arg1158* 15638824:86:33
status: NEW109 Genetists Table 4 Mutations linked to different haplotypes due to recombinant or recurrent events, characteryzed at the level of three CFTR intragenic loci (IVS8CA, IVS17bTA, IVS17bCA) Present study Other studies Cases Haplotype Cases Haplotype (n) (n. of repeats) (n) (n. of repeats) references* I148T and 3195del6 2/2 23-7-17 3 23-7-17 2,3 (in cis) I148T 1/1 23-32-13 S549R (A>C) 1/1 23-33-13 1 16-33-13 2 1717-1G>A 13/13 16-7-17 23 16-7-17 1,2,3 2 16-30-13 1 1 16-32-13 1 R1158X 6/6 16-7-17 1/2 16-7-17 2 1/2 6-45-13 2 1/1 16-31-13 3 1/1 16-45-13 3 3849 +10kbC>T 5/5 23-31-13 2 23-31-13 1 1 16-14-31 4 1 16-7-17 1 3 16-46-13 2 1 16-17-19 2 1 17-31-13 2 E585X 2/2 16-7-17 1 16-32-13 2 1 17-31-13 2 1 16-7-16 see 2 3272-26G>A 1/1 15-7-17 1 16-32-13 1 4 16-7-17 5 L558S 1/1 16-32-13 1 16-32-13 1 1 15-7-17 1 2184 ins A 1/1 16-29-13 1 16-45-13 1 1 16-7-17 1 1 16-24-13 3 * References 1: Morral et al. 1996b.
X
ABCC7 p.Arg1158* 15638824:109:477
status: NEW[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]
Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.
Comments [show]
None has been submitted yet.
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T.
X
ABCC7 p.Arg1158* 16126774:47:576
status: NEW79 Concerning instead the mutations found in the male group, besides ∆F508 the following have been found: 2789+5 g/a, 711+5 g/a, D1152H, G85E, N1303K, Q552X, R1158X, R117H, R334Q, R334W and R553X.
X
ABCC7 p.Arg1158* 16126774:79:162
status: NEW[hide] Extensive sequencing of the CFTR gene: lessons lea... Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28. McGinniss MJ, Chen C, Redman JB, Buller A, Quan F, Peng M, Giusti R, Hantash FM, Huang D, Sun W, Strom CM
Extensive sequencing of the CFTR gene: lessons learned from the first 157 patient samples.
Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28., [PMID:16189704]
Abstract [show]
Cystic fibrosis (CF) is one of the most common monogenic diseases affecting Caucasians and has an incidence of approximately 1:3,300 births. Currently recommended screening panels for mutations in the responsible gene (CF transmembrane regulator gene, CFTR) do not detect all disease-associated mutations. Our laboratory offers extensive sequencing of the CFTR (ABCC7) gene (including the promoter, all exons and splice junction sites, and regions of selected introns) as a clinical test to detect mutations which are not found with conventional screening. The objective of this report is to summarize the findings of extensive CFTR sequencing from our first 157 consecutive patient samples. In most patients with classic CF symptoms (18/24, 75%), extensive CFTR sequencing confirmed the diagnosis by finding two disease-associated mutations. In contrast, only 5 of 75 (7%) patients with atypical CF had been identified with two CFTR mutations. A diagnosis of CF was confirmed in 10 of 17 (58%) newborns with either positive sweat chloride readings or positive immunoreactive trypsinogen (IRT) screen results. We ascertained ten novel sequence variants that are potentially disease-associated: two deletions (c.1641AG>T, c.2949_2853delTACTC), seven missense mutations (p.S158T, p.G451V, p.K481E, p.C491S, p.H949L, p.T1036N, p.F1099L), and one complex allele ([p.356_A357del; p.358I]). We ascertained three other apparently novel complex alleles. Finally, several patients were found to carry partial CFTR gene deletions. In summary, extensive CFTR gene sequencing can detect rare mutations which are not found with other screening and diagnostic tests, and can thus establish a definitive diagnosis in symptomatic patients with previously negative results. This enables carrier detection and prenatal diagnosis in additional family members.
Comments [show]
None has been submitted yet.
No. Sentence Comment
76 Meconium peritonitis;pseudocyst; volvulus 6 p.W1282X/p.S492F 2 months M IRT positive 57, 78, 75, 80, 81 Dx of CF, symptomatic 7 DF508/p.F1099Lb 2 months M IRT positive 48, 52 Asymptomatic at this point 8 DF508/[p.R352W; pP750L]c 1.5 months M IRT positive 1 nl, 44 Followed in CF clinic, being treated prophylactically, neg. elastase 9 DF508/c.1154insTC 4 days M Meconium ileus at birth Not done CF, two affected sibs 10 DF508/c.2789+2insA 2 months F IRT positive 58,57,53 Dx of CF a Concentrations >60 mmol/l on repeated analysis are diagnostic for cystic fibrosis b Novel CFTR mutation c Complex CFTR allele with two different mutations Table 4 Complex CFTR alleles observed in a series of 157 patient samples after extensive sequencing Subject Genotype Phenotype Age Sweat chloride concentration (mmol/l) 1 [p.G576A;p.R668C]/wta Chronic cough, sinusitis, and recurrent pneumonia 3 years Normal 2 p.R1158X/[p.V562I;p.A1006E] Mild CF 40 years 115 3 DF508/[p.R352W;p.P750L] Abnormal newborn screen 49 days 44 4 [c.1198_1203delTGGGCT;c.1204G>A]/wt Mild CF (respiratory symptoms) 12 years 110, 115 a This complex allele has been previously described in a patient with disseminated bronchiectasis with L997F on the other allele (Pignatti et al. 1995) Table6NovelCFTRvariantsfoundinaseriesof157patientsamplesafterextensivesequencing SubjectMutation type LocationNucleotidechangeEffectonproteinCFTRdomaina Mutationonother allele Phenotype 1MissenseExon4c.605G>Cp.S158TL1Nonedetected4-month-oldmale,abnormalnewbornscreen; 3borderlinesweattestresults 2ComplexalleleExon7[c.1198_1203delTGGGCT; c.1204G>A] [p.W356_A357del; p.V358I] AfterTM6and beforeNBD1 Nonedetected12-year-oldmale,meconiumilleusatbirth, respiratorysymptomsofCF;positivesweatchlorides (110,115mmol/l).Motheralsocarriescomplexallele 3MissenseExon9c.1484G>Tp.G451VNBD1DF50819-year-oldmale,diagnosisofCF 4MissenseExon10c.1573A>Gp.K481ENBD1Nonedetected15-year-oldmale,atypicalCF,asthma,2borderline sweatchlorides(low60s) 5MissenseExon10c.1604G>Cp.C491SNBD1NonedetectedNoabnormalsymptoms;sisterofCFpatientthat carriesp.P67L/DF508.Probablebenign variantascertainedduring singleexonsequencingofexon10 6DeletionExon10c.1641AG>Tp.K503NfsX23NBD1p.H609R22-year-oldmale,classicCF,PI,positivesweat chloride(>100mmol/l) 7DeletionExon15c.2949_2953delTACTCp.H939fsX32L3DF5083-month-oldfemale,diagnosisofCF,positivesweat chloride(105mmol/l) 8MissenseExon15c.2978A>Tp.H949LL3Nonedetected, but5Tpositive 12-year-oldmale,atypicalCF,sinusproblems.
X
ABCC7 p.Arg1158* 16189704:76:900
status: NEW53 Finally, one CF patient with mild symptoms carried a complex allele [p.V562I; p.A1006E] and a nonsense mutation (p.R1158X) on the other allele.
X
ABCC7 p.Arg1158* 16189704:53:115
status: NEW74 DF508/c.546insCTA CF; lung symptoms; PS; 2 sibs with CF NG Pos p.R1066C/c.3272-26 A>G Mild CF 40 115 [p.V562I;p.A1006E]b /p.R1158X CF, FTT 6 Not done DF508/c.1716G>A Classic CF 21 Not done p.R785X/c.2732insA Classic CF, PI 4 Not done DF508/p.R117C Classic CF 2 Not done DF508/p.R75X CF 19 Pos DF508/p.G451Va Mild CF 23 Pos DF508/p.L206W Classic CF 9 150s DF508/p.G542Xc Classic CF 15 Pos p.T1036N/p.T1036Na CF, PS 9 Pos DF508/c.3272-26 A>G Classic CF 33 Not done DF508/p.R117Hc Classic CF 35 Not done DF508/p.A455Ec CF 3 Pos p.G551D/p.Y275X a Novel CFTR variant b Complex CFTR allele c Both mutations are on the ACMG/ACOG panel Table 5 Diagnosis of CF in infants/newborns with abnormal newborn screening results Patient number Genotype Age at sequencing Sex Newborn screen result Sweat chloride concentration (mmol/l)a Phenotype 1 DF508/c.2789+2insA 3 months F Positive sweat test 88,96,89,84 Dx of CF, being treated prophylactically 2 DF508/c.2949del5b 3 months F IRT positive 105 Dx of CF 3 p.G551D/c.1259insA 14 months M Positive sweat test ?
X
ABCC7 p.Arg1158* 16189704:74:124
status: NEW
In reference to DF508 and 1716G>A. Does this mean these two mutation have resulted in "classic CF"? Does this mean 1716G>A is disease causing?
Gibson75 on 2013-08-12 07:00:25
Login to comment
Gibson75 on 2013-08-12 07:00:25
103 The last two samples were from affected siblings and were found to be positive for three previously described CFTR mutations: p.V562I, p.A1006E, and p.R1158X.
X
ABCC7 p.Arg1158* 16189704:103:151
status: NEW[hide] Distribution of CFTR mutations in Saguenay- Lac-Sa... Genet Med. 2008 Mar;10(3):201-6. Madore AM, Prevost C, Dorfman R, Taylor C, Durie P, Zielenski J, Laprise C
Distribution of CFTR mutations in Saguenay- Lac-Saint-Jean: proposal of a panel of mutations for population screening.
Genet Med. 2008 Mar;10(3):201-6., [PMID:18344710]
Abstract [show]
PURPOSE: Saguenay-Lac-Saint-Jean is a region located in the northeastern part of the Province of Quebec, Canada, and is characterized by a founder effect. In this region, it has been documented that the incidence of cystic fibrosis reached 1/902 live births between 1975 and 1988, three times higher than the average incidence of 1/2500 live births reported in other Caucasian populations. This corresponds to a carrier rate of 1/15. METHODS: Using genotyping data from the Canadian Consortium for Cystic Fibrosis Genetic Studies, this article describes the cystic fibrosis transmembrane conductance regulator profile of the cystic fibrosis population living in the Saguenay-Lac-Saint-Jean region and compares it with cystic fibrosis populations living in three other regions of the Province of Quebec. RESULTS: Significant differences in allelic frequencies of common mutations (as DeltaF508, 621 + 1G>T and A455E), and in percentage of covered allele with three or six mutations, were found in Saguenay-Lac-Saint-Jean compared to other regions. Based on this result, two mutation panels exceeding 90% sensitivity threshold are now proposed for cystic fibrosis carrier screening in this region. CONCLUSION: The implementation of the proposed carrier screening program could diminish the incidence of this disease in this region and allow future parents to make informed decisions about family planning.
Comments [show]
None has been submitted yet.
No. Sentence Comment
48 Altogether, the six mutations represent 95.89% of the CFTR allele of CF patients in the SLSJ population, whereas the proportions are 86.85, 85.27, and Table 2 Cystic fibrosis mutations present in the four populations studied Mutationa Allelic frequency (number of alleles [%]) Populationb 1 2 3 4 „F508 106 (62.35) 55 (72.37) 398 (72.36) 67 (57.78) 621 ؉ 1G>T 42 (24.71) 6 (7.89) 30 (5.45) 1 (0.85) A455E 12 (7.06) 2 (2.63) 14 (2.55) 1 (0.85) 3199del6 1 (0.59) 1 (1.32) 7 (1.27) 1 (0.85) 711 ؉ 1G>T 1 (0.59) 1 (1.32) 15 (2.73) 1 (0.85) Y1092X 1 (0.59) 1 (1.32) 5 (0.91) 0 R117C 2 (1.18) 0 0 0 ‚I507 1 (0.59) 2 (2.63) 10 (1.82) 0 L206W 1 (0.59) 1 (1.32) 9 (1.64) 0 R1158X 1 (0.59) 0 0 0 S489X 1 (0.59) 0 1 (0.18) 0 R553X 0 2 (2.63) 2 (0.36) 0 R334W 0 1 (1.32) 2 (0.36) 0 G542X 0 0 10 (1.82) 0 G85E 0 0 6 (1.09) 5 (4.24) N1303K 0 0 5 (0.91) 1 (0.85) IVS8-5T 0 0 4 (0.73) 0 W1282X 0 0 3 (0.55) 7 (5.93) R347P 0 0 1 (0.18) 2 (1.69) V520F 0 0 1 (0.18) 0 I1027T 0 0 1 (0.18) 0 R1066C/IVS 0 0 1 (0.18) 0 Q1313X 0 0 1 (0.18) 0 1898ϩ3GϾA 0 0 1 (0.18) 0 2183AAϾG 0 0 1 (0.18) 0 2951insA 0 0 1 (0.18) 0 G551D 0 0 0 2 (1.69) 1525-iG-A 0 0 0 2 (1.69) Y109C 0 0 0 1 (0.85) S549N 0 0 0 1 (0.85) 3154del1G 0 0 0 1 (0.85) UNKNOWN 1 (0.59) 4 (5.26) 20 (3.82) 25 (21.19) Number of alleles genotypedc 170 (100) 76 (100) 550 (100) 118 (100) a The six mutations included in the panels proposed are in bold.
X
ABCC7 p.Arg1158* 18344710:48:690
status: NEW[hide] Cystic fibrosis: defining a disease under-diagnose... Trop Med Int Health. 2009 May;14(5):542-5. Shah U, Frossard P, Moatter T
Cystic fibrosis: defining a disease under-diagnosed in Pakistan.
Trop Med Int Health. 2009 May;14(5):542-5., [PMID:19645745]
Abstract [show]
OBJECTIVE: Cystic fibrosis is frequently missed in the Pakistani population due to lack of appropriate diagnostic tools. Thus our aim was to define unknown disease-causing mutations to help create suitable diagnostic tests and improve understanding of what appears to be an aggressive and under-diagnosed disease in this population. METHODS: Patients with elevated sweat chloride values and clinically suspected CF were recruited from Aga Khan University, Pakistan. Mutations DF508, S549R, S549N, Y569D, 296 + 12(T>C), G553X, G551D and G551X were screened for by allele specific polymerase chain reactions. CFTR exons 10, 11 and 12 were sequenced by direct DNA sequencing. RESULTS: Of 150 patients tested by PCR, 26 (17.3%) were positive for DeltaF508. One patient was a F508/S549N compound heterozygote. Eighty-three of 87 patients sequenced for mutations in exon 10 were normal; 42/43 for exon 11 and 29 for exon 12 were normal. CONCLUSION: This first step in defining mutations involved in Pakistani CF suggests that DeltaF508 is uncommon and S549 was the only additional mutation identified in CFTR exons 10, 11 and 12. Identification of the remaining mutations and their frequency is required to design appropriate tests and improve understanding and management of the disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
29 For example, S549N (G>A) homozygosity previously reported from a Pakistani family has also been associated with significant disease, while in contrast another patient with a compound heterozygote mutation, S549R / R1158X gene, presented with a mild form of CF (Frossard et al. 1999; Romey et al. 1999).
X
ABCC7 p.Arg1158* 19645745:29:214
status: NEW[hide] CFTR mutations in cystic fibrosis patients from Mu... Clin Genet. 2009 Dec;76(6):577-9. Epub 2009 Oct 21. Moya-Quiles MR, Mondejar-Lopez P, Pastor-Vivero MD, Gonzalez-Gallego I, Juan-Fita MJ, Egea-Mellado JM, Carbonell P, Casals T, Fernandez-Sanchez A, Sanchez-Solis M, Glover G
CFTR mutations in cystic fibrosis patients from Murcia region (southeastern Spain): implications for genetic testing.
Clin Genet. 2009 Dec;76(6):577-9. Epub 2009 Oct 21., [PMID:19845690]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
17 of chromosomes Frequency (%) F508dela E.10 67 36.8 G542Xa E.11 22 12.1 A1006E E.17a 10 5.5 K710X E.13 10 5.5 2789+5G>Aa I.14b 9 4.9 L206W E.6a 7 3.8 1811+1.6kbA>G I.11 6 3.3 R334Wa E.7 5 2.7 2869insG E.15 5 2.7 I507dela E.10 4 2.2 N1303Ka E.21 4 2.2 R347Pa E.7 3 1.6 711+1G>Ta I.5 3 1.6 3849+10kbC>Ta I.19 3 1.6 Q890X E.15 3 1.6 R117Ha E.4 2 1.1 R1162Xa E.19 2 1.1 2183AA>Ga E.13 2 1.1 A561E E.12 2 1.1 R560G E.11 2 1.1 1717-1G>Aa I.10 1 0.5 E1308X E.21 1 0.5 E585X E.12 1 0.5 L997F E.17a 1 0.5 1677delTA E.10 1 0.5 R1158X E.19 1 0.5 W202X E.6a 1 0.5 R74W+D1270N E.3 + E.20 1 0.5 G576A+R668C E.12 + E.13 1 0.5 Unknown 2 1.1 Total 182 100 aCFTR mutations identified with the PCR OLA CF Genotyping Assay .
X
ABCC7 p.Arg1158* 19845690:17:516
status: NEW[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]
Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.
Comments [show]
None has been submitted yet.
No. Sentence Comment
48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT.
X
ABCC7 p.Arg1158* 19897426:48:488
status: NEW97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction.
X
ABCC7 p.Arg1158* 19897426:97:377
status: NEW[hide] Identification of the second CFTR mutation in pati... Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26. Giuliani R, Antonucci I, Torrente I, Grammatico P, Palka G, Stuppia L
Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols.
Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26., [PMID:20657600]
Abstract [show]
Congenital bilateral absence of vas deferens (CBAVD) is a manifestation of the mildest form of cystic fibrosis (CF) and is characterized by obstructive azoospermia in otherwise healthy patients. Owing to the availability of assisted reproductive technology, CBAVD patients can father children. These fathers are at risk of transmitting a mutated allele of the CF transmembrane conductance regulator (CFTR) gene, responsible for CF, to their offspring. The identification of mutations in both CFTR alleles in CBAVD patients is a crucial requirement for calculating the risk of producing a child with full-blown CF if the female partner is a healthy CF carrier. However, in the majority of CBAVD patients, conventional mutation screening is not able to detect mutations in both CFTR alleles, and this difficulty hampers the execution of correct genetic counselling. To obtain information about the most represented CFTR mutations in CBAVD patients, we analysed 23 CBAVD patients, 15 of whom had a single CFTR mutation after screening for 36 mutations and the 5T allele. The search for the second CFTR mutation in these cases was performed by using a triplex approach: (i) first, a reverse dot-blot analysis was performed to detect mutations with regional impact; (ii) next, multiple ligation-dependent probe amplification assays were conducted to search for large rearrangements; and (iii) finally, denaturing high-performance liquid chromatography was used to search for point mutations in the entire coding region. Using these approaches, the second CFTR mutation was detected in six patients, which increased the final detection rate to 60.8%.
Comments [show]
None has been submitted yet.
No. Sentence Comment
58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator.
X
ABCC7 p.Arg1158* 20657600:58:342
status: NEW[hide] A new complex allele of the CFTR gene partially ex... Genet Med. 2010 Sep;12(9):548-55. Lucarelli M, Narzi L, Pierandrei S, Bruno SM, Stamato A, d'Avanzo M, Strom R, Quattrucci S
A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation.
Genet Med. 2010 Sep;12(9):548-55., [PMID:20706124]
Abstract [show]
PURPOSE: To evaluate the role of complex alleles, with two or more mutations in cis position, of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in the definition of the genotype-phenotype relationship in cystic fibrosis (CF), and to evaluate the functional significance of the highly controversial L997F CFTR mutation. METHODS: We evaluated the diagnosis of CF or CFTR-related disorders in 12 unrelated subjects with highly variable phenotypes. According to a first CFTR mutational analysis, subjects appeared to be compound heterozygotes for a classic mutation and the L997F mutation. A further CFTR mutational analysis was conducted by means of a protocol of extended sequencing, particularly suited to the detection of complex alleles. RESULTS: We detected a new [R117L; L997F] CFTR complex allele in the four subjects with the highest sweat test values and CF. The eight subjects without the complex allele showed the most varied biochemical and clinical outcome and were diagnosed as having mild CF, CFTR-related disorders, or even no disease. CONCLUSIONS: The new complex allele partially explains the variable phenotype in CF subjects with the L997F mutation. CFTR complex alleles are likely to have a role in the definition of the genotype-phenotype relationship in CF. Whenever apparently identical CFTR-mutated genotypes are found in subjects with divergent phenotypes, an extensive mutational search is mandatory.
Comments [show]
None has been submitted yet.
No. Sentence Comment
105 Both in vivo and in vitro studies have also highlighted cases in which there is one main mutation with the phenotypical effect that is worsened by a second mutation, which may even be a neutral variant when isolated, as occurs for F508C,38 R74W,41 S912L,44 and M470V.42 However, different effects have also been described, as in the case of the two M470 and R1235 variants, which give rise to a hyperactive CFTR when present on different alleles but have a suppressive effect when combined on the same allele.42 In addition, the finding of complex alleles in CFTR-RD seems to suggest that a second CFTR mutation may even lead to a partial reversion of the phenotype.43 Indeed, in a reduced number of complex alleles, the effect of the second mutation may partially correct the functional defect, thereby lessening the phenotypical effect, as has been demonstrated for the R553Q mutation in the [F508del; R553Q] complex allele by in vivo52 and in vitro53 studies and for the R553M mutation in the [F508del; R553M] complex allele by an in vitro study.53 A milder phenotypical effect has also been demonstrated for the [R334W; R1158X]54 and [-102T; S549R(TϾG)]55 complex alleles if compared with alleles carrying, respectively, isolated R1158X or S549R(TϾG).
X
ABCC7 p.Arg1158* 20706124:105:1124
status: NEWX
ABCC7 p.Arg1158* 20706124:105:1240
status: NEW[hide] Comprehensive description of CFTR genotypes and ul... Hum Genet. 2011 Apr;129(4):387-96. Epub 2010 Dec 24. de Becdelievre A, Costa C, Jouannic JM, LeFloch A, Giurgea I, Martin J, Medina R, Boissier B, Gameiro C, Muller F, Goossens M, Alberti C, Girodon E
Comprehensive description of CFTR genotypes and ultrasound patterns in 694 cases of fetal bowel anomalies: a revised strategy.
Hum Genet. 2011 Apr;129(4):387-96. Epub 2010 Dec 24., [PMID:21184098]
Abstract [show]
Fetal bowel anomalies may reveal cystic fibrosis (CF) and the search for CF transmembrane conductance regulator (CFTR) gene mutations is part of the diagnostic investigations in such pregnancies, according to European recommendations. We report on our 18-year experience to document comprehensive CFTR genotypes and correlations with ultrasound patterns in a series of 694 cases of fetal bowel anomalies. CFTR gene analysis was performed in a multistep process, including search for frequent mutations in the parents and subsequent in-depth search for rare mutations, depending on the context. Ultrasound patterns were correlated with the genotypes. Cases were distinguished according to whether they had been referred directly to our laboratory or after an initial testing in another laboratory. A total of 30 CF fetuses and 8 cases compatible with CFTR-related disorders were identified. CFTR rearrangements were found in 5/30 CF fetuses. 21.2% of fetuses carrying a frequent mutation had a second rare mutation, indicative of CF. The frequency of CF among fetuses with no frequent mutation was 0.43%. Correlation with ultrasound patterns revealed a significant frequency of multiple bowel anomalies in CF fetuses. The results emphasize the need to search for rearrangements in the diagnosis strategy of fetal bowel anomalies. The diagnostic value of ultrasound patterns combining hyperechogenic bowel, loop dilatation and/or non-visualized gallbladder reveals a need to revise current strategies and to offer extensive CFTR gene testing when the triad is diagnosed, even when no frequent mutation is found in the first-step analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
122 [R1158X] c.[1521_1523delCTT]?
X
ABCC7 p.Arg1158* 21184098:122:1
status: NEW[hide] Preconceptional identification of cystic fibrosis ... J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22. Coiana A, Faa' V, Carta D, Puddu R, Cao A, Rosatelli MC
Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program.
J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22., [PMID:21429822]
Abstract [show]
BACKGROUND: In Sardinia the mutational spectrum of CFTR gene is well defined. A mutation detection rate of 94% can be achieved by screening for 15 CFTR mutations with a frequency higher than 0.5%. The efficiency of this molecular test suggests that Sardinians may represent a suitable population for a preconceptional screening. METHODS: Five hundred couples of Sardinia descent were screened for 38 mutations using a semi-automated reverse-dot blot and PCR-gel electrophoresis assays. This mutation panel included the 15 most frequent CF alleles in Sardinia. RESULTS: We identified 38 CF carriers, revealing an overall frequency of 1/25 (4%). The most common CF allele was the p.Thr338Ile (T338I) (65%), followed by the p.Phe508del (F508del) (22.5%). We also identified one couple at risk and an asymptomatic female homozygote for the p.Thr338Ile allele. CONCLUSIONS: In spite of the low number of the couples tested, the results herein reported demonstrate the efficacy and efficiency of the preconceptional screening program and the high participation rate of the Sardinian population (99%).
Comments [show]
None has been submitted yet.
No. Sentence Comment
88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested.
X
ABCC7 p.Arg1158* 21429822:88:888
status: NEW[hide] Defective CFTR expression and function are detecta... PLoS One. 2011;6(7):e22212. Epub 2011 Jul 21. Sorio C, Buffelli M, Angiari C, Ettorre M, Johansson J, Vezzalini M, Viviani L, Ricciardi M, Verze G, Assael BM, Melotti P
Defective CFTR expression and function are detectable in blood monocytes: development of a new blood test for cystic fibrosis.
PLoS One. 2011;6(7):e22212. Epub 2011 Jul 21., [PMID:21811577]
Abstract [show]
BACKGROUND: Evaluation of cystic fibrosis transmembrane conductance regulator (CFTR) functional activity to assess new therapies and define diagnosis of cystic fibrosis (CF) is cumbersome. It is known that leukocytes express detectable levels of CFTR but the molecule has not been characterized in these cells. In this study we aim at setting up and validating a blood test to evaluate CFTR expression and function in leukocytes. DESCRIPTION: Western blot, PCR, immunofluorescence and cell membrane depolarization analysis by single-cell fluorescence imaging, using the potential-sensitive DiSBAC(2)(3) probe were utilized. Expression of PKA phosphorylated, cell membrane-localized CFTR was detected in non-CF monocytes, being undetectable or present in truncated form in monocytes derived from CF patients presenting with nonsense mutations. CFTR agonist administration induced membrane depolarization in monocytes isolated from non-CF donors (31 subjects) and, to a lesser extent, obligate CFTR heterozygous carriers (HTZ: 15 subjects), but it failed in monocytes from CF patients (44 subjects). We propose an index, which values in CF patients are significantly (p<0.001) lower than in the other two groups. Nasal Potential Difference, measured in selected subjects had concordant results with monocytes assay (Kappa statistic 0.93, 95%CI: 0.80-1.00). RESULTS AND SIGNIFICANCE: CFTR is detectable and is functional in human monocytes. We also showed that CFTR-associated activity can be evaluated in 5 ml of peripheral blood and devise an index potentially applicable for diagnostic purposes and both basic and translational research: from drug development to evaluation of functional outcomes in clinical trials.
Comments [show]
None has been submitted yet.
No. Sentence Comment
105 The specificity of the signal detected with the antibodies is further strengthened by the observation of the loss of the C-terminal epitope in monocytes derived from patients carrying two nonsense mutations (R1158X/E585X; R1162X/R1162X).
X
ABCC7 p.Arg1158* 21811577:105:208
status: NEW202 Case Gender Age at diagnosis (years) CFTR genotype* Age (years) Sweat Cl- mEq/L** FEV1 % mean values 2009 Pa PI NPD results*** CF-index 1 F 0 3132delTG 1497delGG 34 129 75 yes yes nd 222,10 2 F 0 R1162X R1162X 43 144 52 yes yes nd 229,65 3 M 0 R1162X R1162X 10 102 59 no yes 1,02 210,18 4 M 0 R1162X R1162X 25 115 81 no yes 1,07 267,11 5 M 7 G542X 711+5 G.A 24 105 59 yes yes nd 25,84 6 M 1 CFTRdele1 G542X 36 107 22 yes yes nd 2113,92 7 M 0 G542X G542X 16 110 71 yes yes 0,97 280,20 8 F 1 Q552X CFTRdele17a-18 35 99 72 yes yes 2,08 2219,81 9 M 16 R1162X 3849+10 Kb C.T 42 74 43 yes no 1,02 271,47 10 M 0 R1162X R1162X 32 105 45 yes yes 1,43 2114,67 11 M 1 F508del F508del 16 86 71 no yes nd 260,04 12 F 0 F508del F508del 16 88 118 no yes nd 248,20 13 M 0 F508del F508del 33 118 51 yes yes nd 265,49 14 M 7 F508del F508del 37 89 37 yes yes nd 2359,82 15 F 0 F508del F508del 27 118 71 yes yes nd 267,26 16 F 8 1717-1 G.A F508del 38 140 74 yes yes nd 2136,80 17 F 0 R1158X F508del 32 95 60 yes yes 1,77 228,31 18 M 7 G542X F508del 39 110 46 yes yes nd 247,52 19 M 0 Q39X F508del 17 101 79 no yes 1,11 264,20 20 F 1 R1162X F508del 41 188 60 no yes 0,94 296,73 21 M 13 3849+10 Kb C.T F508del 24 76 78 yes no 4,67 26,33 22 M 0 W1282X 621+1G.T 33 119 77 yes yes 1,27 242,74 23 F 4 R553X 2789+5 G.A 31 92 44 yes no 7,4 260,94 24 F 11 F508del R553X 39 116 55 yes yes nd 2113,67 25 M 12 F508del 3849+10 Kb C.T 27 51 71 yes no 1,12 298,84 26 F 0 F508del G542X 19 109 109 yes yes nd 2173,24 27 F 0 F508del R1162X 32 94 86 yes yes 1,34 270,16 28 F 0 F508del W57X (TAG) 27 99 78 yes yes 1,21 269,33 29 M 0 F508del Q552X 24 94 41 yes yes 1,50 272,75 30 M 20 F508del 3849+10 Kb C.T 43 58 60 no no 1,13 2112,56 31 M 0 F508del R1162X 12 99 65 no yes 2,14 280,92 32 M 4 F508del 3849+10 Kb C.T 17 60 100 no no nd 2121,31 33 F 1 F508del 1717-1 G.A 26 105 73 yes yes 2,05 255,66 34 F 11 F508del 3849+10 Kb C.T 40 85 59 yes no nd 2152,23 35 F 4 F508del 1717-1 G.A 44 130 97 yes yes nd 2116,56 36 M 13 F508del 3849+10 Kb C.T 43 70 65 yes no CF 265,10 37 F 19 F508del unknown 29 95 100 no no nd 240,53 38 M 6 F508del unknown 15 92 87 yes no nd 270,17 39 F 0 G542X N1303K 34 108 97 yes yes nd 296,14 40 M 50 G1249R IVS8 T5TG12 50 61 74 no no nd 2199,15 41 F 10 2183 AA.G IVS8 T5TG15/T7TG10 45 79 29 yes no 1,9 286,27 42 F 1 G85E unknown 43 120 107 yes no nd 249,21 43 F 0 3272-26 A.G I507del 21 113 88 no no nd 236,79 44 M 8 F508del D1152H 10 77 107 no no nd 210,85 *Cystic Fibrosis mutation database reference: http://www3.genet.sickkids.on.ca/cftr/app.
X
ABCC7 p.Arg1158* 21811577:202:964
status: NEW[hide] Characterization of 19 disease-associated missense... Hum Mol Genet. 1998 Oct;7(11):1761-9. Vankeerberghen A, Wei L, Jaspers M, Cassiman JJ, Nilius B, Cuppens H
Characterization of 19 disease-associated missense mutations in the regulatory domain of the cystic fibrosis transmembrane conductance regulator.
Hum Mol Genet. 1998 Oct;7(11):1761-9., [PMID:9736778]
Abstract [show]
In order to gain a better insight into the structure and function of the regulatory domain (RD) of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, 19 RD missense mutations that had been identified in patients were functionally characterized. Nine of these (I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R and L633P) resulted in aberrant processing. No or a very small number of functional CFTR proteins will therefore appear at the cell membrane in cells expressing these mutants. These mutations were clustered in the N-terminal part of the RD, suggesting that this subdomain has a folding pattern that is very sensitive to amino acid changes. Mutations that caused no aberrant processing were further characterized at the electrophysiological level. First, they were studied at the whole cell level in Xenopus laevis oocytes. Mutants that induced a whole cell current that was significantly different from wild-type CFTR were subsequently analysed at the single channel level in COS1 cells transiently expressing the different mutant and wild-type proteins. Three mutant chloride channels, G622D, R792G and E822K CFTR, were characterized by significantly lower intrinsic chloride channel activities compared with wild-type CFTR. Two mutations, H620Q and A800G, resulted in increased intrinsic chloride transport activities. Finally, T665S and E826K CFTR had single channel properties not significantly different from wild-type CFTR.
Comments [show]
None has been submitted yet.
No. Sentence Comment
87 Maturation pattern of RD mutations and their associated phenotype found in patients with the indicated genotype (when the mutation is associated with CF, only the pancreas status is given) Mutation A-form B-form C-form Clinical data Genotype Phenotype Reference I601F + + - I601F/G542X PS M. Schwarz, personal communication L610S + + - Unknown Unknown A613T + + - Unknown Unknown D614G + + - D614G/unknown PI 14 I618T + + - I618T/dF508 PS G.R. Cutting, personal communication L619S + + - L619S/unknown PI B. Tümmler, personal communication H620P + + - H620P/R1158X PS M. Schwarz, personal communication H620Q + + + H620Q/dF508 PI T. Dörk, personal communication G622D + + + G622D/unknown Oligospermia J. Zielenski, personal communication G628R + + - Unknown Unknown L633P + + - L633P/3659delC M. Schwarz, personal communication D648V + + + D648V/3849+10kb C/T PI C. Ferec, personal communication T665S + + + Unknown Unknown F693L + + + F693L/W1282X Healthy C. Ferec; CF Genetic Analysis Consortium R766M + + + R766M/R792G CBAVD D. Glavac, personal communication R792G + + + R766M/R792G CBAVD D. Glavac, personal communication A800G + + + A800G/unknown CBAVD 34 I807M + + + I807M/unknown CBAVD Our observation E822K + + + E822K/unknown PI 35 E826K + + + E826K/unknown Thoracic sarcoidosis C. Bombieri, personal communication +, the protein matures up to that form; -, the protein does not reach the respective maturation step.
X
ABCC7 p.Arg1158* 9736778:87:563
status: NEW[hide] Validation of double gradient denaturing gradient ... Clin Chem. 1999 Jan;45(1):35-40. Cremonesi L, Carrera P, Fumagalli A, Lucchiari S, Cardillo E, Ferrari M, Righetti SC, Zunino F, Righetti PG, Gelfi C
Validation of double gradient denaturing gradient gel electrophoresis through multigenic retrospective analysis.
Clin Chem. 1999 Jan;45(1):35-40., [PMID:9895335]
Abstract [show]
Among established techniques for the identification of either known or new mutations, denaturing gradient gel electrophoresis (DGGE) is one of the most effective. However, conventional DGGE is affected by major drawbacks that limit its routine application: the different denaturant gradient ranges and migration times required for different DNA fragments. We developed a modified version of DGGE for high-throughput mutational analysis, double gradient DGGE (DG-DGGE), by superimposing a porous gradient over the denaturant gradient, which maintains the zone-sharpening effect even during lengthy analyses. Because of this innovation, DG-DGGE achieves the double goals of retaining full effectiveness in the detection of mutations while allowing identical run time conditions for all fragments analyzed. Here we use retrospective analysis of a large number of well-characterized mutations and polymorphisms, spanning all predicted melting domains and the whole genomic sequence of three different genes--the cystic fibrosis transmembrane conductance regulator (CFTR), the beta-globin, and the p53 genes--to demonstrate that DG-DGGE may be applied to the rapid scanning of any sequence variation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
31 Mutations and polymorphisms analyzed in the CFTR gene. Position Denaturant gradient Mutation Exon 1 40-90% 125G/Ca,b M1V (A3G at 133) 175insT 182delT Exon 3 10-60% W57G (T3G at 301) 356G/Aa G85E (G3A at 386) Exon 4 20-70% R117H (G3A at 482) 541delC 621ϩ1G3T I148T (T3C at 575) Exon 5 20-70% E193K (G3A at 709) Intron 5 20-70% 711ϩ3A3G Exon 7 20-70% 1078delT R334W (C3T at 1132) T338I (C3T at 1145) R347P (G3C at 1172)b R347H (G3A at 1172) R352Q (G3A at 1187) Exon 10 20-70% M470V (1540A/G)a ⌬F508 (del 3 bp at 1652) Intron 10 10-60% 1717-1G3A Exon 11 10-60% G542X (G3T at 1756) 1784delG R553X (C3T at 1789) Exon 12 10-60% D579G (A3G at 1868) E585X (G3T at 1885) Intron 12 10-60% 1898ϩ3A3G Exon 13 30-80% 2183AA3G E730X (G3T at 2320) L732X (T3G at 2327) 2347delG Exon 14a 10-60% T854T (2694T/G)a V868V (2736G/A)a Intron 14b 30-80% 2789ϩ5G3A Exon 15 20-70% M952I (G3C at 2988)b Exon 17a 20-70% L997F (G3C at 3123)b Exon 17b 20-70% F1052V (T3G at 3286) R1066C (C3T at 3328) R1066H (G3A at 3329) A1067T (G3A at 3331) Exon 18 20-70% D1152H (G3C at 3586)b Exon 19 30-80% R1158X (C3T at 3604) Exon 20 20-70% S1251N (G3A at 3384) W1282X (G3A at 3978) Exon 21 20-70% N1303K (C3G at 4041)b Exon 22 30-80% G1349D (G3A at 4178) 4382delA Exon 24 30-80% Y1424Y (4404C/T)a a Polymorphism.
X
ABCC7 p.Arg1158* 9895335:31:1096
status: NEW[hide] A neutral variant involved in a complex CFTR allel... Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3. Clain J, Lehmann-Che J, Girodon E, Lipecka J, Edelman A, Goossens M, Fanen P
A neutral variant involved in a complex CFTR allele contributes to a severe cystic fibrosis phenotype.
Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3., [PMID:15744523]
Abstract [show]
In order to further elucidate the contribution of complex alleles to the wide phenotypic variability of cystic fibrosis (CF), we investigated the structure-function relationships of a severe CF-associated complex allele [p.S912L;p.G1244V]. To evaluate the contribution of each mutation to the phenotype, cystic fibrosis transmembrane conductance regulator (CFTR) mutants were expressed in HeLa cells and analysed for protein processing and Cl- channel activity. Both p.G1244V and [p.S912L;p.G1244V] mutants had normal protein processing but markedly decreased Cl- channel activity compared with wild-type. Notably, the double mutant displayed a dramatic decrease in Cl- channel activity compared with p.G1244V (P<0.001). p.S912L had normal protein processing and no detectable impact on CFTR function. In other respects, the p.S912L variation was identified in compound heterozygosity with p.R709X in a healthy fertile man. Together, these data strongly support the view that p.S912L in isolation should be considered as a neutral variant but one that might significantly impair CFTR function when inherited in cis with another CFTR mutation. Our data also further document the contribution of complex alleles to the wide phenotypic variability of CF. The results of functional studies of such complex alleles in other genetic diseases are discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
12 The combination of two missense mutations on the same chromo some has been described clinically to lessen ([p.R553Q;p.F508del], [p.R334W;p.R1158X]; Dork et al. 1991; Duarte et al. 1996) or worsen ([p.R74W;p.D1270N], [p.R347H;p.D979A]; Casals et al. 1995; Hojo et al. 1998) the phenotype of CF patients with regard to the commonest mutation alone (p.F508del, p.R1158X, p.D1270N, p.R347H).
X
ABCC7 p.Arg1158* 15744523:12:360
status: NEW[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]
Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4.
X
ABCC7 p.Arg1158* 17331079:52:1073
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]
Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray.
X
ABCC7 p.Arg1158* 22658665:855:524
status: NEW[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]
Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.
Comments [show]
None has been submitted yet.
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations.
X
ABCC7 p.Arg1158* 22581207:81:2740
status: NEW[hide] CFTR, SPINK1, CTRC and PRSS1 variants in chronic p... Gut. 2012 Mar 17. Rosendahl J, Landt O, Bernadova J, Kovacs P, Teich N, Bodeker H, Keim V, Ruffert C, Mossner J, Kage A, Stumvoll M, Groneberg D, Kruger R, Luck W, Treiber M, Becker M, Witt H
CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?
Gut. 2012 Mar 17., [PMID:22427236]
Abstract [show]
OBJECTIVE: In chronic pancreatitis (CP), alterations in several genes have so far been described, but only small cohorts have been extensively investigated for all predisposing genes. DESIGN: 660 patients with idiopathic or hereditary CP and up to 1758 controls were enrolled. PRSS1, SPINK1 and CTRC were analysed by DNA sequencing, and cystic fibrosis transmembrane conductance regulator (CFTR) by melting curve analysis. RESULTS: Frequencies of CFTR variants p.R75Q, p.I148T, 5T-allele and p.E528E were comparable in patients and controls. We identified 103 CFTR variants, which represents a 2.7-fold risk increase (p<0.0001). Severe cystic fibrosis (CF)-causing variants increased the risk of developing CP 2.9-fold, and mild CF-causing variants 4.5-fold (p<0.0001 for both). Combined CF-causing variants increased CP risk 3.4-fold (p<0.0001), while non-CF-causing variants displayed a 1.5-fold over-representation in patients (p=0.14). CFTR compound heterozygous status with variant classes CF-causing severe and mild represented an OR of 16.1 (p<0.0001). Notably, only 9/660 (1.4%) patients were compound heterozygotes in this category. Trans-heterozygosity increased CP risk, with an OR of 38.7, with 43/660 (6.5%) patients and 3/1667 (0.2%) controls being trans-heterozygous (p<0.0001). CONCLUSIONS: Accumulation of CFTR variants in CP is less pronounced than reported previously, with ORs between 2.7 and 4.5. Only CF-causing variants reached statistical significance. Compound and trans-heterozygosity is an overt risk factor for the development of CP, but the number of CFTR compound heterozygotes in particular is rather low. In summary, the study demonstrates the complexity of genetic interactions in CP and a minor influence of CFTR alterations in CP development.
Comments [show]
None has been submitted yet.
No. Sentence Comment
140 Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p¼0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts.
X
ABCC7 p.Arg1158* 22427236:140:708
status: NEW150 Table 4 Homozygous and compound heterozygous patients and controls with at least two CFTR, SPINK1 or CTRC variants Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing severe or CF-causing mild/CF-causing mild) p.F508del/p.R117H (7T/9T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.R347H 1/660 (0.2%) 0/1758 NS e p.F508del/p.D1152Hy 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.R1158X 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.1717-1G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/9T)/p.N1303K 1/660 (0.2%) 0/1758 NS e p.D1152Hy/p.N1303K 1/660 (0.2%) 0/1758 NS e Total 9/660 (1.4%) 1/1758 (0.06%) 0.002 16.1 (1.9 to 134.2) CFTR (CF-causing severe or CF-causing mild or non-CF-causing/Non-CF-causing) p.F508del/p.R75Q* 0/660 1/1758 (0.06%) NS e p.F508del/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R75Q*/5T* 1/660 (0.2%) 1/1758 (0.06%) NS e p.R75Q*/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R117H (7T/7T)/p.R75Q* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.E528E* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.S1235R 1/660 (0.2%) 0/1758 NS e p.I148T*/5T* 0/660 1/1758 (0.06%) NS e p.R347P/p.E528E* 1/660 (0.2%) 0/1758 NS e p.E528E*/5T* 1/660 (0.2%) 4/1758 (0.23%) NS e p.H667Y/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/p.E528E* 0/660 1/1758 (0.06%) NS e p.D1152Hy/5T* 1/660 (0.2%) 0/1758 NS e p.S1235R/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e Total 17/660 (2.6%) 14/1758 (0.8%) 0.001 3.3 (1.6 to 6.7) CFTR Total (all, excluded)* 10/660 (1.5%) 1/1758 (0.06%) <0.0001 27 (3.5 to 211.7) SPINK1 p.N34S (hom) 17/660 (2.6%) 0/1758 <0.0001 95.6 (5.7 to 1594) p.N34S (het)/c.(1-215G>A;194+2T>C) 7/660 (1.1%) 0/1758 <0.0001 40.4 (2.3 to 708.2) Total 24/660 (3.6%) 0/1758 <0.0001 135.4 (8.2 to 2231) CTRC p.R254W (hom) 1/546 (0.2%) 0/1700 NS e p.R254W/p.V235I 1/546 (0.2%) 0/1700 NS e Total 2/546 (0.4%) 0/1700 NS e For CFTR compound heterozygous carriers, calculations were performed for patients and controls carrying a combination of one CF-causing severe or a CF-causing mild in addition with one CF-causing mild variant (upper section).
X
ABCC7 p.Arg1158* 22427236:150:444
status: NEW135 Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p&#bc;0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts.
X
ABCC7 p.Arg1158* 22427236:135:707
status: NEW144 Table 4 Homozygous and compound heterozygous patients and controls with at least two CFTR, SPINK1 or CTRC variants Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing severe or CF-causing mild/CF-causing mild) p.F508del/p.R117H (7T/9T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.R347H 1/660 (0.2%) 0/1758 NS e p.F508del/p.D1152Hy 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.R1158X 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.1717-1G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/9T)/p.N1303K 1/660 (0.2%) 0/1758 NS e p.D1152Hy/p.N1303K 1/660 (0.2%) 0/1758 NS e Total 9/660 (1.4%) 1/1758 (0.06%) 0.002 16.1 (1.9 to 134.2) CFTR (CF-causing severe or CF-causing mild or non-CF-causing/Non-CF-causing) p.F508del/p.R75Q* 0/660 1/1758 (0.06%) NS e p.F508del/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R75Q*/5T* 1/660 (0.2%) 1/1758 (0.06%) NS e p.R75Q*/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R117H (7T/7T)/p.R75Q* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.E528E* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.S1235R 1/660 (0.2%) 0/1758 NS e p.I148T*/5T* 0/660 1/1758 (0.06%) NS e p.R347P/p.E528E* 1/660 (0.2%) 0/1758 NS e p.E528E*/5T* 1/660 (0.2%) 4/1758 (0.23%) NS e p.H667Y/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/p.E528E* 0/660 1/1758 (0.06%) NS e p.D1152Hy/5T* 1/660 (0.2%) 0/1758 NS e p.S1235R/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e Total 17/660 (2.6%) 14/1758 (0.8%) 0.001 3.3 (1.6 to 6.7) CFTR Total (all, excluded)* 10/660 (1.5%) 1/1758 (0.06%) <0.0001 27 (3.5 to 211.7) SPINK1 p.N34S (hom) 17/660 (2.6%) 0/1758 <0.0001 95.6 (5.7 to 1594) p.N34S (het)/c.(1-215G>A;194+2T>C) 7/660 (1.1%) 0/1758 <0.0001 40.4 (2.3 to 708.2) Total 24/660 (3.6%) 0/1758 <0.0001 135.4 (8.2 to 2231) CTRC p.R254W (hom) 1/546 (0.2%) 0/1700 NS e p.R254W/p.V235I 1/546 (0.2%) 0/1700 NS e Total 2/546 (0.4%) 0/1700 NS e For CFTR compound heterozygous carriers, calculations were performed for patients and controls carrying a combination of one CF-causing severe or a CF-causing mild in addition with one CF-causing mild variant (upper section).
X
ABCC7 p.Arg1158* 22427236:144:444
status: NEW[hide] Extensive molecular analysis of patients bearing C... J Mol Diagn. 2012 Jan;14(1):81-9. Epub 2011 Oct 20. Amato F, Bellia C, Cardillo G, Castaldo G, Ciaccio M, Elce A, Lembo F, Tomaiuolo R
Extensive molecular analysis of patients bearing CFTR-related disorders.
J Mol Diagn. 2012 Jan;14(1):81-9. Epub 2011 Oct 20., [PMID:22020151]
Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR)-related disorders (CFTR-RDs) may present with pancreatic sufficiency, normal sweat test results, and better outcome. The detection rate of mutations is lower in CFTR-RD than in classic CF: mutations may be located in genes encoding proteins that interact with CFTR or support channel activity. We tested the whole CFTR coding regions in 99 CFTR-RD patients, looking for gene mutations in solute carrier (SLC) 26A and in epithelial Na channel (ENaC) in 33 patients who had unidentified mutations. CFTR analysis revealed 28 mutations, some of which are rare. Of these mutations, RT-PCR demonstrated that the novel 1525-1delG impairs exon 10 splicing; by using minigene analysis, we excluded the splicing effect of three other novel intronic variants. Analysis of SLC26A genes revealed several variants, some of which are novel, that did not affect mRNA expression. Other mutations occurred in the ENaC genes encoding the ENaC subunits, but their frequency did not significantly differ between patients and controls. Our data, although obtained on a preliminary cohort of CFTR-RD patients, exclude a role of mutations in SLC26A and in SCNN genes in the pathogenesis of such disease; we confirm that CFTR analysis has a relevant role in CFTR-RD patients; and it appears mandatory to use CFTR scanning techniques and approaches to reveal the effect of novel mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
69 Allele Frequency and CFTR Mutations in Patients Bearing CFTR-RDs Mutation (traditional name) HGVS nomenclature15 CBAVD (118 alleles)* RP (42 alleles)* DB (38 alleles)* Total (198 alleles)* TG12-T5-470V 34 (28.8) 2 (4.8) 10 (26.3) 46 (23.2) F508del c.1521_1523del 19 (16.1) 7 (16.7) 4 (10.5) 30 (15.2) 3195del6 c.3063_3069del 9 (7.6) 0 0 9 (4.5) N1303K c.3909CϾG 3 (2.5) 1 (2.4) 4 (10.5) 8 (4.0) G542X c.1624GϾT 4 (3.4) 1 (2.4) 1 (2.6) 6 (3.0) D1152H c.3454GϾC 1 (0.8) 2 (4.8) 2 (5.3) 5 (2.5) G85E c.254GϾA 2 (1.7) 3 (7.1) 0 5 (2.5) 1525-1delG c.1394de 3 (2.5) 1 (2.4) 0 4 (3.0) 4016insT c.3885insT 2 (1.7) 1 (2.4) 0 3 (1.5) 2789ϩ5GϾA c.2657ϩ5GϾA 0 3 (7.1) 0 3 (1.5) Q1476X c.4426CϾT 3 (2.5) 0 0 3 (1.5) 2183AAϾG c.2051_2052delinsG 1 (0.8) 1 (2.4) 0 2 (1.0) R553X c.1657CϾT 1 (0.8) 1 (2.4) 0 2 (1.0) L568F c.1704GϾT 2 (1.7) 0 0 2 (1.0) R1158X c.3472CϾT 2 (1.7) 0 0 2 (1.0) V920M c.2758GϾA 1 (0.8) 0 1 (2.6) 2 (1.0) 711ϩ1GϾT c.579ϩ1GϾT 0 1 (2.4) 0 1 (0.5) D614G c.1841AϾG 1 (0.8) 0 0 1 (0.5) 2184insA c.2052del 0 1 (2.4) 0 1 (0.5) 621ϩ1GϾT c.489ϩ1GϾT 1 (0.8) 0 0 1 (0.5) R1438W c.4312CϾT 0 1 (2.4) 0 1 (0.5) E193X c.577GϾT 0 1 (2.4) 0 1 (0.5) G1244E c.3731GϾA 1 (0.8) 0 0 1 (0.5) K68E c.202AϾG 1 (0.8) 0 0 1 (0.5) R347P c.1040GϾC 1 (0.8) 0 0 1 (0.5) 621ϩ3AϾG c.489ϩ3AϾG 1 (0.8) 0 0 1 (0.5) L997F c.2991GϾC 0 1 (2.4) 0 1 (0.5) F508C c.1523TϾG 1 (0.8) 0 0 1 (0.5) Total 94 (79.7) 28 (66.7) 22 (57.9) 144 (72.7) Undetected 24 (20.3) 14 (33.3) 16 (42.1) 54 (27.3) *Data are given as number (percentage).
X
ABCC7 p.Arg1158* 22020151:69:907
status: NEW[hide] Cystic fibrosis mutations for p.F508del compound h... Clin Genet. 2012 Dec;82(6):546-551. doi: 10.1111/j.1399-0004.2011.01804.x. Epub 2011 Nov 29. Sebro R, Levy H, Schneck K, Dimmock D, Raby B, Cannon C, Broeckel U, Risch N
Cystic fibrosis mutations for p.F508del compound heterozygotes predict sweat chloride levels and pancreatic sufficiency.
Clin Genet. 2012 Dec;82(6):546-551. doi: 10.1111/j.1399-0004.2011.01804.x. Epub 2011 Nov 29., [PMID:22035343]
Abstract [show]
Sebro R, Levy H, Schneck K, Dimmock D, Raby BA, Cannon CL, Broeckel U, Risch NJ. Cystic fibrosis mutations for p.F508del compound heterozygotes predict sweat chloride levels and pancreatic sufficiency. Cystic fibrosis (CF) is a monogenetic disease with a complex phenotype. Over 1500 mutations in the CFTR gene have been identified; however, the p.F508del mutation is most common. There has been limited correlation between the CFTR mutation genotype and the disease phenotypes. We evaluated the non-p.F508del mutation of 108 p.F508del compound heterozygotes using the biological classification method, Grantham and Sorting Intolerant from Tolerant (SIFT) scores to assess whether these scoring systems correlated with sweat chloride levels, pancreatic sufficiency, predicted FEV(1) , and risk of infection with Pseudomonas aeruginosa in the last year. Mutations predicted to be 'mild' by the biological classification method are associated with more normal sweat chloride levels (p < 0.001), pancreatic sufficiency (p < 0.001) and decreased risk of infection with Pseudomonas in the last year (p = 0.014). Lower Grantham scores are associated with more normal sweat chloride levels (p < 0.001), and pancreatic sufficiency (p = 0.014). Higher SIFT scores are associated with more normal sweat chloride levels (p < 0.001) and pancreatic sufficiency (p = 0.011). There was no association between pulmonary function measured by predicted FEV(1) and the biological classification (p = 0.98), Grantham (p = 0.28) or SIFT scores (p = 0.62), which suggests the pulmonary disease related to CF may involve other modifier genes and environmental factors.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 CFTR mutation classification for compound heterozygotesa Mutations n (%) Biological classification Grantham score SIFT Q493X 3 (3) Ib - - G542X 21 (20) Ib,c,e - - R553X 4 (4) Ib,e - - Y1092X 2 (2) Ib - - R1158X 1 (1) NA - - W1282X 9 (9) Ib,e - - G85E 4 (4) IIIb 98 0.01 R117H 4 (4) IVb,c 29 0.60 R334W 1 (1) IVb 101 0.02 R347P 1 (1) IVb 103 0.05 R352Q 1 (1) NA 43 0.35 G551D 20 (19) IIIb,c 94 0.00 R560T 3 (3) IIIb 71 0.00 D1270N 1 (1) NA 23 0.01 N1303K 6 (6) IIg 94 0.00 I507del 3 (3) IId - - 394delTT 1 (1) NAc - - 621+1G>T 7 (7) Ib,f - - 711+1G>T 2 (2) Ib - - 1717-1G>A 5 (5) Ib,c,e,f - - 1898+1G>A 2 (2) NA - - 2789+5G>A 3 (3) Vb - - 3659delC 1 (1) Ib - - 3849+10kbC>T 2 (2) Vb,c,f - - 3905insT 1 (1) Ib - - NA, not applicable; SIFT, Sorting Intolerant from Tolerant. a The following mutations biological classification scores could not be verified: 1898+G-A, 394delTT, D1270N, R352Q, and R1158X.
X
ABCC7 p.Arg1158* 22035343:64:204
status: NEWX
ABCC7 p.Arg1158* 22035343:64:893
status: NEW[hide] Genotype-phenotype correlation in cystic fibrosis ... Genet Mol Biol. 2011 Jul;34(3):416-20. Epub 2011 Jul 1. Polizzi A, Tesse R, Santostasi T, Diana A, Manca A, Logrillo VP, Cazzato MD, Pantaleo MG, Armenio L
Genotype-phenotype correlation in cystic fibrosis patients bearing [H939R;H949L] allele.
Genet Mol Biol. 2011 Jul;34(3):416-20. Epub 2011 Jul 1., [PMID:21931512]
Abstract [show]
Cystic fibrosis (CF) is caused by CFTR (cystic fibrosis transmembrane conductance regulator) gene mutations. We ascertained five patients with a novel complex CFTR allele, with two mutations, H939R and H949L, inherited in cis in the same exon of CFTR gene, and one different mutation per patient inherited in trans in a wide population of 289 Caucasian CF subjects from South Italy. The genotype-phenotype relationship in patients bearing this complex allele was investigated. The two associated mutations were related to classical severe CF phenotypes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
62 Particularly, 1259insA and G1349D represent with few other mutations, 4382delA, I502T, 852del22, 4016insT, D579G, R1158X and L1077P, almost 20% of the CF alleles found in the Apulian population (Castaldo et al., 2005; Polizzi et al., 2005).
X
ABCC7 p.Arg1158* 21931512:62:114
status: NEW[hide] The K+ channel opener 1-EBIO potentiates residual ... PLoS One. 2011;6(8):e24445. Epub 2011 Aug 31. Roth EK, Hirtz S, Duerr J, Wenning D, Eichler I, Seydewitz HH, Amaral MD, Mall MA
The K+ channel opener 1-EBIO potentiates residual function of mutant CFTR in rectal biopsies from cystic fibrosis patients.
PLoS One. 2011;6(8):e24445. Epub 2011 Aug 31., [PMID:21909392]
Abstract [show]
BACKGROUND: The identification of strategies to improve mutant CFTR function remains a key priority in the development of new treatments for cystic fibrosis (CF). Previous studies demonstrated that the K(+) channel opener 1-ethyl-2-benzimidazolone (1-EBIO) potentiates CFTR-mediated Cl(-) secretion in cultured cells and mouse colon. However, the effects of 1-EBIO on wild-type and mutant CFTR function in native human colonic tissues remain unknown. METHODS: We studied the effects of 1-EBIO on CFTR-mediated Cl(-) secretion in rectal biopsies from 47 CF patients carrying a wide spectrum of CFTR mutations and 57 age-matched controls. Rectal tissues were mounted in perfused micro-Ussing chambers and the effects of 1-EBIO were compared in control tissues, CF tissues expressing residual CFTR function and CF tissues with no detectable Cl(-) secretion. RESULTS: Studies in control tissues demonstrate that 1-EBIO activated CFTR-mediated Cl(-) secretion in the absence of cAMP-mediated stimulation and potentiated cAMP-induced Cl(-) secretion by 39.2+/-6.7% (P<0.001) via activation of basolateral Ca(2)(+)-activated and clotrimazole-sensitive KCNN4 K(+) channels. In CF specimens, 1-EBIO potentiated cAMP-induced Cl(-) secretion in tissues with residual CFTR function by 44.4+/-11.5% (P<0.001), but had no effect on tissues lacking CFTR-mediated Cl(-) conductance. CONCLUSIONS: We conclude that 1-EBIO potentiates Cl(-)secretion in native CF tissues expressing CFTR mutants with residual Cl(-) channel function by activation of basolateral KCNN4 K(+) channels that increase the driving force for luminal Cl(-) exit. This mechanism may augment effects of CFTR correctors and potentiators that increase the number and/or activity of mutant CFTR channels at the cell surface and suggests KCNN4 as a therapeutic target for CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 CFabsent CFresidual CFTR genotype Number of individuals CFTR genotype Number of individuals F508del/F508del 10 F508del/Y161C 1 F508del/W57X 1 F508del/V232D 1 F508del/G85E 3 F508del/R334W 2 F508del/120del23 1 F508del/T338I 1 F508del/182delT 1 F508del/I1234V 1 F508del/G542X 1 F508del/3272-26 A.G 1 F508del/A561E 1 F508del/3849+10 kb C.T 1 F508del/Y1092X 1 F508del/4005 +5727 A.G 1 F508del/N1303K 1 F508del/G576A 1 F508del/1525-1 G.A 2 N1303K/R334W 1 F508del/Q39X 1 F1052V/M1137R 1 F508del/Q552X 1 1898+3 A.G/ 1898+3 A.G 1 G85E/G85E 1 R334W/3199del6 1 Q552X/R1162X 1 R334W/X 1 A561E/A561E 2 dele2,3/X 1 R764X/1717-1 G.A 1 R1158X/2183AA.G 1 R1158X/R560T 1 doi:10.1371/journal.pone.0024445.t001 luminal and basolateral surfaces of the epithelium were perfused continuously with a solution of the following composition (mmol/ L): NaCl 145, KH2PO4 0.4, K2HPO4 1.6, D-glucose 5, MgCl2 1, Ca-gluconate 1.3, pH 7.4, at 37uC.
X
ABCC7 p.Arg1158* 21909392:46:620
status: NEWX
ABCC7 p.Arg1158* 21909392:46:638
status: NEW79 (A,B) Original recordings of effects of 1-EBIO (500 mM, basolateral) on basal and carbachol-induced (CCH) transepithelial voltage (Vte) and transepithelial resistance (Rte) across rectal biopsies from a control subject (A) and a CF patient carrying two severe CFTR mutations (R1158X/2183AA.G).
X
ABCC7 p.Arg1158* 21909392:79:276
status: NEW149 (A-C) Original recordings of effects of cAMP-mediated (IBMX/forskolin) and cholinergic (CCH) activation, and effects of 1-EBIO (500 mM, basolateral) on transepithelial voltage (Vte) and resistance (Rte) in rectal tissues from a control subject (A), a CF patient with no detectable Cl2 secretion (CFabsent; R1158X/2183AA.G) (B), and a CF patient with residual Cl2 secretion (CFresidual; F508del/Y161C), as evidence by lumen-negative Vte responses (C).
X
ABCC7 p.Arg1158* 21909392:149:306
status: NEW[hide] Consensus on the use and interpretation of cystic ... J Cyst Fibros. 2008 May;7(3):179-96. Castellani C, Cuppens H, Macek M Jr, Cassiman JJ, Kerem E, Durie P, Tullis E, Assael BM, Bombieri C, Brown A, Casals T, Claustres M, Cutting GR, Dequeker E, Dodge J, Doull I, Farrell P, Ferec C, Girodon E, Johannesson M, Kerem B, Knowles M, Munck A, Pignatti PF, Radojkovic D, Rizzotti P, Schwarz M, Stuhrmann M, Tzetis M, Zielenski J, Elborn JS
Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice.
J Cyst Fibros. 2008 May;7(3):179-96., [PMID:18456578]
Abstract [show]
It is often challenging for the clinician interested in cystic fibrosis (CF) to interpret molecular genetic results, and to integrate them in the diagnostic process. The limitations of genotyping technology, the choice of mutations to be tested, and the clinical context in which the test is administered can all influence how genetic information is interpreted. This paper describes the conclusions of a consensus conference to address the use and interpretation of CF mutation analysis in clinical settings. Although the diagnosis of CF is usually straightforward, care needs to be exercised in the use and interpretation of genetic tests: genotype information is not the final arbiter of a clinical diagnosis of CF or CF transmembrane conductance regulator (CFTR) protein related disorders. The diagnosis of these conditions is primarily based on the clinical presentation, and is supported by evaluation of CFTR function (sweat testing, nasal potential difference) and genetic analysis. None of these features are sufficient on their own to make a diagnosis of CF or CFTR-related disorders. Broad genotype/phenotype associations are useful in epidemiological studies, but CFTR genotype does not accurately predict individual outcome. The use of CFTR genotype for prediction of prognosis in people with CF at the time of their diagnosis is not recommended. The importance of communication between clinicians and medical genetic laboratories is emphasized. The results of testing and their implications should be reported in a manner understandable to the clinicians caring for CF patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations.
X
ABCC7 p.Arg1158* 18456578:1236:1555
status: NEW1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations.
X
ABCC7 p.Arg1158* 18456578:1239:1555
status: NEW[hide] Characterisation of mutations and genotype-phenoty... J Cyst Fibros. 2008 Mar;7(2):110-5. Epub 2007 Aug 22. Shastri SS, Kabra M, Kabra SK, Pandey RM, Menon PS
Characterisation of mutations and genotype-phenotype correlation in cystic fibrosis: experience from India.
J Cyst Fibros. 2008 Mar;7(2):110-5. Epub 2007 Aug 22., [PMID:17716958]
Abstract [show]
BACKGROUND: Very little is known about the genetics of cystic fibrosis (CF) from the Indian subcontinent. The aims of the study were to identify the mutations and study the relation of genotype with phenotype in Indian children with CF. METHODS: A total of 100 patients with CF were screened for mutations in the CFTR gene. These included c.1521_1523delCTT (p.F508del) and c.3849+10 kb C>T mutations followed by single strand conformation polymorphism/heteroduplex analysis for mutations in 19 out of 27 exons of the CFTR gene. RESULTS: At least one mutation was identified in 40 patients. The most common mutation identified was p.F508del; 20 patients were homozygous and 13 heterozygous. In addition, c.3849+10 kb C>T, c.1161delC, and p.S549N were identified in two patients each and p.R352Q, p.R1158X and p.R75Q were identified in one patient each. Three novel mutations, viz. c.1002-7_1002-5delTTT, p.G149X and p.L183I were also identified. Majority of patients who were p.F508del positive originated from Pakistan and north-western states of India. The phenotypes of all patients were classical. Genotype-phenotype correlation revealed that p.F508del positive patients had a more severe disease, manifesting at an earlier age. CONCLUSIONS: A strategy for mutation screening for CF in India must involve testing for p.F508del followed by c.1161delC, c.3849+10 kb C>T and p.S549N. There is a need for large multicentric studies using more sensitive techniques for the identification of mutations in Indian CF patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
6 In addition, c.3849+10 kb CNT, c.1161delC, and p.S549N were identified in two patients each and p. R352Q, p.R1158X and p.R75Q were identified in one patient each.
X
ABCC7 p.Arg1158* 17716958:6:108
status: NEW82 SSCP/HA SSCP/HA identified at least one mutation in exons 3, 4, 7, 11 and 19 viz. p.R75Q in exon 3, p.G149X in exon 4, c.1161delC, p.R352Q and c.1002-7_1002-5delTTT in exon 7, p.S549N in exon 11 and p.R1158X in exon 19.
X
ABCC7 p.Arg1158* 17716958:82:201
status: NEW100 Of these six were p.F508del homozygotes, one was compound heterozygous for p.F508del with p.R1158X and another was homozygous for c.1161delC.
X
ABCC7 p.Arg1158* 17716958:100:92
status: NEW121 9 p.[F508del]/[c.3849+10 kb CNT] 2 p.[F508del]+[R1158X] 1 p.[F508del]+[G149X] 1 c.
X
ABCC7 p.Arg1158* 17716958:121:48
status: NEW[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]
Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.
Comments [show]
None has been submitted yet.
No. Sentence Comment
53 Table 1. Continued CFTR location Amino acid change Nucleotide change 141 IVS 16 Splicing defect 3120 ϩ 1GϾA 142 IVS 16 Splicing defect 3121 - 2AϾG 143 IVS 16 Splicing defect 3121 - 2AϾT 144 E 17a Frameshift 3132delTG 145 E 17a I1005R 3146TϾG 146 E 17a Frameshift 3171delC 147 E 17a Frameshift 3171insC 148 E 17a del V1022 and I1023 3199del6 149 E 17a Splicing defect 3271delGG 150 IVS 17a Possible splicing defect 3272 - 26AϾG 151 E 17b G1061R 3313GϾC 152 E 17b R1066C 3328CϾT 153 E 17b R1066S 3328CϾA 154 E 17b R1066H 3329GϾA 155 E 17b R1066L 3329GϾT 156 E 17b G1069R 3337GϾA 157 E 17b R1070Q 3341GϾA 158 E 17b R1070P 3341GϾC 159 E 17b L1077P 3362TϾC 160 E 17b W1089X 3398GϾA 161 E 17b Y1092X (TAA) 3408CϾA 162 E 17b Y1092X (TAG) 3408CϾG 163 E 17b L1093P 3410TϾC 164 E 17b W1098R 3424TϾC 165 E 17b Q1100P 3431AϾC 166 E 17b M1101K 3434TϾA 167 E 17b M1101R 3434TϾG 168 IVS 17b 3500 - 2AϾT 3500 - 2AϾT 169 IVS 17b Splicing defect 3500 - 2AϾG 170 E 18 D1152H 3586GϾC 171 E 19 R1158X 3604CϾT 172 E 19 R1162X 3616CϾT 173 E 19 Frameshift 3659delC 174 E 19 S1196X 3719CϾG 175 E 19 S1196T 3719TϾC 176 E 19 Frameshift and K1200E 3732delA and 3730AϾG 177 E 19 Frameshift 3791delC 178 E 19 Frameshift 3821delT 179 E 19 S1235R 3837TϾG 180 E 19 Q1238X 3844CϾT 181 IVS 19 Possible splicing defect 3849 ϩ 4AϾG 182 IVS 19 Splicing defect 3849 ϩ 10 kb CϾT 183 IVS 19 Splicing defect 3850 - 1GϾA 184 E 20 G1244E 3863GϾA 185 E 20 G1244V 3863GϾT 186 E 20 Frameshift 3876delA 187 E 20 G1249E 3878GϾA 188 E 20 S1251N 3884GϾA 189 E 20 T1252P 3886AϾC 190 E 20 S1255X 3896CϾA and 3739AϾG in E19 191 E 20 S1255L 3896CϾT 192 E 20 Frameshift 3905insT 193 E 20 D1270N 3940GϾA 194 E 20 W1282R 3976TϾC 195 E 20 W1282X 3978GϾA 196 E 20 W1282C 3978GϾT 197 E 20 R1283M 3980GϾT 198 E 20 R1283K 3980GϾA 199 IVS 20 Splicing defect 4005 ϩ 1GϾA 200 E 21 Frameshift 4010del4 201 E 21 Frameshift 4016insT 202 E 22 Inframe del E21 del E21 203 E 21 N1303K 4041CϾG 204 E 24 Frameshift 4382delA Genomic and Synthetic Template Samples Where possible, native genomic DNA was collected.
X
ABCC7 p.Arg1158* 16049310:53:1135
status: NEW73 Genomic DNA Samples Used for Mutation Evaluation on the APEX Array Mutations validated with native DNA CFTRdel 2,3 (21 kb) 394delTT G85E R75X 574delA Y122X R117C R117H 621 ϩ 1GϾT 621 ϩ 3AϾG 711 ϩ 1GϾT I336K R334W R347P IVS8-5T IVS8-7T IVS8-9T A455E ⌬F508 ⌬I507 1677delTA 1717 - 1GϾA G542X G551D R553X R560T S549N 1898 ϩ 1GϾA 1898 ϩ 1GϾC 2183AAϾG 2043delG R668C 2143delT 2184delA 2184insA 2789 ϩ 5GϾA S945L 3120 ϩ 1GϾA I1005R 3272 - 26AϾG R1066C G1069R Y1092X (CϾA) 3500 - 2AϾT R1158X R1162X 3659delC S1235R 3849 ϩ 10 kb CϾT W1282X primer.
X
ABCC7 p.Arg1158* 16049310:73:605
status: NEW150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide.
X
ABCC7 p.Arg1158* 16049310:150:11299
status: NEWX
ABCC7 p.Arg1158* 16049310:150:11345
status: NEW[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]
Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
103 Table 1. Continued Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) R1070W 1 0.55 0.19 R1158X 1 0.55 0.19 R1438W 1 0.55 0.19 R334W 2 1.09 0.39 R352W 1 0.55 0.19 R553X 2 1.09 0.39 R668C 2 1.09 0.39 R74W 3 1.64 0.58 R75X 3 1.64 0.58 S1235R 2 1.09 0.39 S492F 2 1.09 0.39 S549N 1 0.55 0.19 S573CS573C 1 0.55 0.19 S945L 1 0.55 0.19 T351S 1 0.55 0.19 T501A 2 1.09 0.39 T604ST604S 1 0.55 0.19 V11I 1 0.55 0.19 V201 mol/L 1 0.55 0.19 V232D 2 1.09 0.39 V754 mol/L 1 0.55 0.19 W1089X 2 1.09 0.39 W1098C 1 0.55 0.19 W1204X 4 2.19 0.78 Y563N 1 0.55 0.19 Y913XY913X 1 0.55 0.19 85 different mutations 183 100.00 35.60 Novel variants are in boldface, mutations on the ACMG/ACOG panel are italicized.
X
ABCC7 p.Arg1158* 15858154:103:152
status: NEW186 Table 3. Continued CFTR mutations Alleles Relative mutation frequency (%) (of 317) G567A 1 Ͻ1 S573C 1 Ͻ1 E585X 1 Ͻ1 T604S 1 Ͻ1 F693L 1 Ͻ1 V754 mol/L 1 Ͻ1 2108delA 1 Ͻ1 2184delA 1 Ͻ1 2215insG 1 Ͻ1 2585delT 1 Ͻ1 2752 - 6TϾC 1 Ͻ1 E831X 1 Ͻ1 D836Y 1 Ͻ1 Y913X 1 Ͻ1 S945L 1 Ͻ1 L967S 1 Ͻ1 3171delC 1 Ͻ1 3199del6 1 Ͻ1 3271 ϩ 8AϾG 1 Ͻ1 R1066H 1 Ͻ1 R1070W 1 Ͻ1 Y1092X 1 Ͻ1 W1098C 1 Ͻ1 3500 - 2AϾT 1 Ͻ1 4016insT 1 Ͻ1 4374 ϩ 13AϾG 1 Ͻ1 D1152H 1 Ͻ1 R1158X 1 Ͻ1 R1162X 1 Ͻ1 W1282X 1 Ͻ1 N1303K 1 Ͻ1 Q1313X 1 Ͻ1 P1372L 1 Ͻ1 R1438W 1 Ͻ1 Total 317 100 Table 3.
X
ABCC7 p.Arg1158* 15858154:186:634
status: NEW[hide] High heterogeneity of CFTR mutations and unexpecte... J Cyst Fibros. 2004 Dec;3(4):265-72. des Georges M, Guittard C, Altieri JP, Templin C, Sarles J, Sarda P, Claustres M
High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France.
J Cyst Fibros. 2004 Dec;3(4):265-72., [PMID:15698946]
Abstract [show]
In this report, we present updated spectrum and frequency of mutations of the CFTR gene that are responsible for cystic fibrosis (CF) in Languedoc-Roussillon (L-R), the southwestern part of France. A total of 75 different mutations were identified by DGGE in 215 families, accounting for 97.6% of CF genes and generating 88 different mutational genotypes. The frequency of p.F508del was 60.23% in L-R versus 67.18% in the whole country and only five other mutations (p.G542X, p.N1303K, p.R334W, c.1717-1G>A, c.711+1G>T) had a frequency higher than 1%. The mutations were scattered over 20 exons or their border. This sample representing only 5.7% of French CF patients contributed to 24% of CFTR mutations reported in France. This is one of the highest molecular allelic heterogeneity reported so far in CF. We also present the result of a neonatal screening program based on a two-tiered approach "IRT/20 mutations/IRT" analysis on blood spots, implemented in France with the aim to improve survival and quality of life of patients diagnosed before clinical onset. This 18-month pilot project showed an unexpected low incidence of CF (1/8885) in South of France, with only six CF children detected among 43,489 neonates born in L-R, and 13 among 125,339 neonates born in Provence-Alpes-Cote-d'Azur (PACA).
Comments [show]
None has been submitted yet.
No. Sentence Comment
69 of chromosomes (frequency %) p.E1104X 17b 2 (0.47) p.R1158X 19 3 (0.70) p.R1162X 19 2 (0.47) c.3659delC 19 1 (0.23) c.3737delA 19 2 (0.47) p.I1234V 19 1 (0.23) c.3849+10kbCNT intron 19 4 (0.93) c.3850-1GNA intron 19 1 (0.23) p.G1244E 20 1 (0.23) p.W1282X 20 2 (0.47) p.N1303H 21 1 (0.23) p.N1303K 21 13 (3.02) p.Q1313X 21 1 (0.23) c.4382delA 24 1 (023) Mutations described for the first time by our laboratory appear in bold.
X
ABCC7 p.Arg1158* 15698946:69:53
status: NEW[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]
Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
104 c 4016insT, G1244E, R1158X, 3120+1G>A, 1677delTA, I1234V, E831X, 5T, Q220X, E92K, G91R.
X
ABCC7 p.Arg1158* 10923036:104:20
status: NEW140 Non-F508del Mutations Found as Homozygous in a Sample of 3,710 Patients With Cystic Fibrosis Mutation n 711+1G>T 8 G542X 7 N1303K 7 2183delAA>G 5 W1282X 4 G551D 3 3905insT 3 R334W 2 R347P 2 1078delT 2 1811+1.6kbA>G 2 2113delA 2 Y1092X 2 R1162X 2 306insA 1 E92K 1 G178R 1 L227R 1 1677delTA 1 1717-1G>A 1 1717-8G>A 1 R553X 1 S549R(T>G) 1 R560S 1 V562I 1 Y569D 1 2711delT 1 S945L 1 R1158X 1 I1234V 1 3849+10kbC>T 1 Q1313X 1 del25kb 1 E831X 1 I175V 1 G314V 1 L1077P 1 produce a small quantity of functional protein as a result of a variable proportion of normal CFTR mRNA transcripts in addition to the abnormal ones (class V); 3) they are located in sites known to generate less severe mutants (external loops, residues lining the pore); and/or 4) they have been observed in CF with pancreatic sufficiency, CBAVD, and/or CF-related attenuated phenotypes only.
X
ABCC7 p.Arg1158* 10923036:140:379
status: NEW[hide] Complete identification of cystic fibrosis transme... Clin Genet. 1998 Jan;53(1):44-6. De Braekeleer M, Mari C, Verlingue C, Allard C, Leblanc JP, Simard F, Aubin G, Ferec C
Complete identification of cystic fibrosis transmembrane conductance regulator mutations in the CF population of Saguenay Lac-Saint-Jean (Quebec, Canada).
Clin Genet. 1998 Jan;53(1):44-6., [PMID:9550360]
Abstract [show]
Over the past few years, we have conducted a systematic study of 230 cystic fibrosis (CF) chromosomes in the Saguenay Lac-Saint-Jean (SLSJ) population which has a high CF incidence (1/936 live births). We identified 11 mutations accounting for 100% of the CF chromosomes found in patients born in SLSJ. Our results indicate that denaturing gradient gel electrophoresis (DGGE) is a powerful method of identifying CF mutations. They have also considerable implications for genetic counselling and molecular characterization of doubtful patients. They make carrier screening technically feasible in this population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
33 Distributon of CFTR mutations in CF patients born in SLSJ Mutations No. CF chromosomes Proportion(%) AF508 120 621tlG-T 51 A455E 17 Y1092X 3 1148T 2 711+1G+T 2 G85E 1 Q890X 1 s489x 1 R117C 1 R1158X 1 60 25.5 8.5 1.5 1 1 0.5 0.5 0.5 0.5 0.5 Table 1 gives the distribution of the mutations found on the C F chromosomes from patients born in the SLSJ region.
X
ABCC7 p.Arg1158* 9550360:33:191
status: NEW43 Distributionof CFtR genotypes in CF patients born in SLSJ Genotypes No. CF patients AFS08/AF508 AF5@/621+lG-T AF508/A455E 621t 1G+T/A455E 621t 1G+T/621 t 1G-T AF508,N109W AF508/1148T 621t1G+T/711 t1G+T 621t 1G+T/G85E 621t1G+T/YlO92X A455E/R117C 621+1G+TjS489X AF508/Q890X AF508/R1158X 37 30 6 5 2 2 2 1 1 1 1 1 1 45 De Braekeleer et al. identify 100% of the CFTR mutations in the CF population born in SLSJ.
X
ABCC7 p.Arg1158* 9550360:43:278
status: NEW[hide] High heterogeneity for cystic fibrosis in Spanish ... Hum Genet. 1997 Dec;101(3):365-70. Casals T, Ramos MD, Gimenez J, Larriba S, Nunes V, Estivill X
High heterogeneity for cystic fibrosis in Spanish families: 75 mutations account for 90% of chromosomes.
Hum Genet. 1997 Dec;101(3):365-70., [PMID:9439669]
Abstract [show]
We have analyzed 640 Spanish cystic fibrosis (CF) families for mutations in the CFTR gene by direct mutation analysis, microsatellite haplotypes, denaturing gradient gel electrophoresis, single-strand conformation analysis and direct sequencing. Seventy-five mutations account for 90.2% of CF chromosomes. Among these we have detected seven novel CFTR mutations, including four missense (G85V, T582R, R851L and F1074L), two nonsense (E692X and Q1281X) and one splice site mutation (711+3A-->T). Three variants, two in intronic regions (406-112A/T and 3850-129T/C) and one in the coding region (741C/T) were also identified. Mutations G85V, T582R, R851L, E692X and Q1281X are severe, with lung and pancreatic involvement; 711+3A-->T could be responsible for a pancreatic sufficiency/insufficiency variable phenotype; and F1074L was associated with a mild phenotype. These data demonstrate the highest molecular heterogeneity reported so far in CF, indicating that a wide mutation screening is necessary to characterize 90% of the Spanish CF alleles.
Comments [show]
None has been submitted yet.
No. Sentence Comment
33 Eight mutations have frequencies 366 Table 1 Seventy-five CFTR mutations identified in 640 Spanish families with cystic fibrosis (CF) Mutation Exon/intron CF alleles % ∆F508 E.10 681 53.20 G542X E.11 108 8.43 N1303K E.21 34 2.65 1811+1.6kbA→Ga I.11 24 1.87 711+1G→T I.5 22 1.71 R1162Xa E.19 21 1.64 R334Wa E.7 21 1.64 R1066C E.17b 14 1.09 1609delCAa E.10 13 1.01 Q890X E.15 13 1.01 G85E E.3 12 0.94 712-1G→Ta I.5 11 0.86 2789+5G→A I.14b 11 0.86 ∆I507 E.10 10 0.78 W1282X E.20 10 0.78 2869insGa E.15 9 0.70 L206W E.6a 7 0.54 R709X E.13 7 0.54 621+1G→T I.4 6 0.47 3272-26A→G I.17a 6 0.47 R347H E.7 5 0.39 2183AA→G E.13 5 0.39 K710X E.13 5 0.39 2176insC E.13 5 0.39 3849+10kbC→T I.19 5 0.39 P205Sa E.6a 4 0.31 1078delT E.7 4 0.31 R553X E.11 4 0.31 G551D E.11 4 0.31 1812-1G→Aa I.11 4 0.31 CFdel#1a E.4-7/11-18 4 0.31 V232D E.6a 3 0.23 936delTAa E.6b 3 0.23 1717-8G→A I.10 3 0.23 1949del84 E.13 3 0.23 W1089X E.17b 3 0.23 R347P E.7 3 0.23 del E.3a E.3 2 0.16 R117H E.4 2 0.16 L558S E.11 2 0.16 A561E E.12 2 0.16 2603delT E.13 2 0.16 Y1092X E.17b 2 0.16 Q1100Pa E.17b 2 0.16 M1101K E.17b 2 0.16 delE.19a E.19 2 0.16 G1244E E.20 2 0.16 P5La E.1 1 0.08 Q30Xa E.2 1 0.08 G85Va E.3 1 0.08 E92Ka E.4 1 0.08 A120Ta E.4 1 0.08 I148T E.4 1 0.08 711+3A→Ta I.5 1 0.08 H199Y E.6a 1 0.08 875+1G→A I.6a 1 0.08 Table 1 (continued) Mutation Exon/intron CF alleles % 1717-1G→A I.10 1 0.08 L571S E.12 1 0.08 T582Ra E.12 1 0.08 E585X E.12 1 0.08 1898+3A→G I.12 1 0.08 G673X E.13 1 0.08 E692Xa E.13 1 0.08 R851X E.14a 1 0.08 R851La E.14a 1 0.08 A1006E E.17a 1 0.08 L1065Ra E.17b 1 0.08 F1074La E.17b 1 0.08 R1158X E.19 1 0.08 3667del4a E.19 1 0.08 3860ins31a E.20 1 0.08 3905insT E.20 1 0.08 4005+1G→A I.20 1 0.08 Q1281Xa E.20 1 0.08 Q1313X E.21 1 0.08 Known mutations (75) 1155 90.23 Unknown mutations 125 9.77 a Mutations discovered by the CF group of the Medical and Molecular Genetics Centre - IRO, Barcelona, Spain that range between 0.5% and 0.9%, representing 6.0% of the CF chromosomes.
X
ABCC7 p.Arg1158* 9439669:33:1695
status: NEW[hide] Mutation characterization of CFTR gene in 206 Nort... Hum Mutat. 1996;8(4):340-7. Hughes DJ, Hill AJ, Macek M Jr, Redmond AO, Nevin NC, Graham CA
Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes.
Hum Mutat. 1996;8(4):340-7., [PMID:8956039]
Abstract [show]
A variety of mutation detection techniques, including restriction endonuclease digestion, allele specific oligonucleotides, and automated fluorescent sequencing, were used in the identification of 15 CFTR mutations representing 86.7% of CF chromosomes in 206 Northern Irish cystic fibrosis (CF) families. A systematic analysis of the 27 exons and intron/exon boundaries of the CFTR gene was performed using denaturing gradient gel electrophoresis (DGGE) in an attempt to characterise the 55 unknown CF mutations in 51 patients. Twenty different mutations were detected by DGGE on 30 chromosomes accounting for a further 7.3% of CF alleles. Fifteen of these mutations had not previously been found in Northern Ireland, and two are novel, M1I(G > T) and V562L. In total, 30 CFTR mutations account for 93.9% of the 412 Northern Irish CF chromosomes tested. The three major CF mutations in Northern Ireland are delta F508, G551D, and R117H with respective frequencies of 68.0%, 5.1%, and 4.1%. The efficacy of the DGGE technique was proven by the detection of 77 out of 77 control variants from all the CFTR exons. DGGE is a highly efficient and sensitive method for mutation screening especially in large genes where the mutation spectrum is known to be heterogeneous.
Comments [show]
None has been submitted yet.
No. Sentence Comment
79 3120G>A 11027T,3130de115 L1059X G1123R D1152H 3659delC, 3849G>A, 3849+4A>G, R1158X, R1162X.
X
ABCC7 p.Arg1158* 8956039:79:76
status: NEW[hide] Fluorescent multiplex microsatellites used to defi... Hum Mutat. 1996;8(3):229-35. Hughes D, Wallace A, Taylor J, Tassabehji M, McMahon R, Hill A, Nevin N, Graham C
Fluorescent multiplex microsatellites used to define haplotypes associated with 75 CFTR mutations from the UK on 437 CF chromosomes.
Hum Mutat. 1996;8(3):229-35., [PMID:8889582]
Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene contains three highly informative microsatellites: IVS8CA, IVS17bTA, and IVS17bCA. Their analysis improves prenatal/ carrier diagnosis and generates haplotypes from CF chromosomes that are strongly associated with specific mutations. Microsatellite haplotypes were defined for 75 CFTR mutations carried on 437 CF chromosomes (220 for delta F508, 217 for other mutations) from Northern Ireland and three English regions: the North-West, East Anglia, and the South. Fluorescently labelled microsatellites were amplified in a triplex PCR reaction and typed using an ABI 373A fluorescent fragment analyser. These mutations cover all the common and most of the rare CF defects found in the UK, and their corresponding haplotypes and geographic region are tabulated here. Ancient mutations, delta F508, G542X, N1303K, were associated with several related haplotypes due to slippage during replication, whereas other common mutations were associated with the one respective haplotype (e.g., G551D and R560T with 16-7-17, R117H with 16-30-13, 621 + 1G > T with 21-31-13, 3659delC with 16-35-13). This simple, fast, and automated method for fluorescent typing of these haplotypes will help to direct mutation screening for uncharacterised CF chromosomes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
74 CF 8CA-17bTA-17bCA Mutation chromosomes % Normal Laboratoryb Reference' HaplotVpe 1)15-29-13 557delT Nl Graham et al.. 1992 21 16-07-17 MU (G>T) 3) 16-24-13 4) 16-25-13 5) 16-29-13 6) 16-30-13 7) 16-30-14 8) 16-31-13 9) 16-31-14 10) 16-32-13 12) 16-33-13 13) 16-34-13 14) 16-35-13 11)16-32-17 15)1645-13 16) 1646-13 17) 1646-14 19) 17-07-17 18)16-53-13 20)17-29-14 21) 17-31-13 22) 17-32-13 23) 17-35-13 24) 17-51-11 25) 17-55-13 27) 17-58-13 28) 21-31-13 29) 22-31-13 31)23-22-17 26) 17-56-13 30) 22-33-13 32) 23-29-13 33)23-31-13 34)23-32-13 35)23-33-13 36)23-34-13 37) 23-36-13 38)24-22-17 39) 24-31-13 182delT P67L R75X L206W 1154insTC 146linsAGAT Q493x V520F 1717-1G>A G551D R560T V562L R709X S1196X L1254X R1283M G85E 2184insA 711+lG>T 3495delA 4279insA SlOR L88S R117C R117H G178R 1717-1G>A Y563N W1098R G1123R 3850- 1G>A E6OX %%deIT 1138insG R34P 2183AA>G 2184delA R1158X 1078delT R1162X 3849G>A Q141W R347P Y917C G2iX 711+3A>G 441delA 3130de115 3659delC 1898+1G>A R709X 2711delT R1158X E92K 3849+lOkbC>T 2118delAACT 4048insCC 296+1 2 T S Q22OX R297Q A1507 2789+5G>A 3120+1G>A W128W 1811+lG>C AF508 E831X R116W AF508 W846X1 3120G>A R785X R553X R553X R553X 621+1G>T G542X G542X Y1182X N1303K AF508 G54W 3041delG 1525-1G>A N1303K G542X G542X G542X 394delTT R709X N1303K 1 1 1 2 1 1 4 2 3 4 2 26 8 1 1 1 1 1 8 1 1 1 1 1 1 1 19 1 2 1 1 1 1 7 1 1 2 1 1 2 1 1 1 1 1 1 1 1 2 1 1 7 4 1 2 1 1 2 1 1 4 Asian 1 2 1Asian 5 4 i Afro-Caribbean 5 1 42 (19%) 1 1 57 (26%) 1 2 1 1 1 2 12 2 11.4 0.4 4.9 16.3 1.1 3.8 1.9 10.6 2.3 1.5 2.3 1.5 2.7 4.5 0.4 0.8 0.8 0.4 0.8 0.4 1 2 1 7 1 1 1Asian 1 1.5 0.8 0.8 NI G NI, M M NI NI.
X
ABCC7 p.Arg1158* 8889582:74:873
status: NEWX
ABCC7 p.Arg1158* 8889582:74:988
status: NEW[hide] Complex cystic fibrosis allele R334W-R1158X result... Hum Mutat. 1996;8(2):134-9. Duarte A, Amaral M, Barreto C, Pacheco P, Lavinha J
Complex cystic fibrosis allele R334W-R1158X results in reduced levels of correctly processed mRNA in a pancreatic sufficient patient.
Hum Mutat. 1996;8(2):134-9., [PMID:8844211]
Abstract [show]
CFTR alleles containing two mutations have been very rarely found in cystic fibrosis (CF) patients. They provide an opportunity to study the effect of two in cis-interacting gene defects on gene expression. Here, we describe a three-generation CF family with a complex CFTR allele that has not been previously described, containing the missense mutation R334W in exon 7 and the nonsense mutation R1158X in exon 19. Lymphocyte RNA analysis showed that (1) the mRNA corresponding to the complex allele is present although at markedly reduced levels; and (2) the nonsense mutation does not lead to detectable skipping of exon 19. The clinical picture of the patients with the genotype R334W-R1158X/delta F508 is characterized by pancreatic sufficiency and an atypical course of the disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
4 Here, we describe a three-generation CF family with a complex CFTR allele that has not been previously described, containing the missense mutation R334W in exon 7 and the nonsense mutation R1158X in exon 19.
X
ABCC7 p.Arg1158* 8844211:4:189
status: NEW34 Direct DNA sequencing of exons 7 and 19 revealed the presence of two mutations previously described in separate, namely R334W in exon 7 (Gasparini et al., 1991)and R1158X in exon 19 (Ronchetto et al., 1992).
X
ABCC7 p.Arg1158* 8844211:34:164
status: NEW46 On the other hand, R1158X as a nonsense mutation, would be expected to cause notorious effects upon protein production or function, either by leading to mRNA instability (Lim et al., 1992), synthesis of a labile truncated protein (Fei et al., 1989), or skipping of the exon in which it is located (Dietz et al., 1993).
X
ABCC7 p.Arg1158* 8844211:46:19
status: NEW49 Both experiments showed that the mRNA corresponding to the transcript from the R334W- R1158X complex allele was present, although markedly reduced as compared with the transcript from the AF508 allele.
X
ABCC7 p.Arg1158* 8844211:49:86
status: NEW50 On the other hand, amplification of the fragment containing exon 19 (Fig 2C) showed a single, normal-sizeband, indicating that the R1158X mutation does not lead to detectable skipping of exon 19.
X
ABCC7 p.Arg1158* 8844211:50:131
status: NEW55 In what concerns the R1158X, as a nonsense mutation, it would be expected to be a PI allele.
X
ABCC7 p.Arg1158* 8844211:55:21
status: NEW56 Indeed, one CF patient with AF508/ R1158X genotype was found to have severe digestive symptoms (L. Cremonesi, personal communication).
X
ABCC7 p.Arg1158* 8844211:56:35
status: NEW57 It is therefore noteworthy that the complex allele R334W-Rl158X is PS, suggesting that the R334W mutation in cis with R1158X can, at least partially, revert the deleterious effects caused by the latter.
X
ABCC7 p.Arg1158* 8844211:57:118
status: NEW59 4 5 1 2 3 4 CFTR cDNA C 1 2 3 R334W -508 R1158X I1 1 3 4 5 6a 6b 7 8 9 10 1 1 1 2 13 BlL+ t B l R B2R+ t B 2 R FIGURE2.
X
ABCC7 p.Arg1158* 8844211:59:41
status: NEW82 Similarly, the truncated R1158X CFTR AL. protein might as well function as a C1` channel.
X
ABCC7 p.Arg1158* 8844211:82:25
status: NEW84 However, the presence of R334W in cis with R1158X might somehow stabilize such truncated CFTR protein, thus conferring the mild pancreatic symptoms found in these two patients.
X
ABCC7 p.Arg1158* 8844211:84:43
status: NEW[hide] Mutation analysis of ten exons of the CFTR gene in... Hum Genet. 1995 Sep;96(3):364-6. Kanavakis E, Tzetis M, Antoniadi T, Traeger-Synodinos J, Doudounakis S, Adam G, Matsaniotis N, Kattamis C
Mutation analysis of ten exons of the CFTR gene in Greek cystic fibrosis patients: characterization of 74.5% of CF alleles including one novel mutation.
Hum Genet. 1995 Sep;96(3):364-6., [PMID:7544320]
Abstract [show]
To initiate the complete characterization of mutations in the CFTR gene in Greek cystic fibrosis (CF) patients, we screened 184 patients for six relatively common mutations (delta F 508, G542X, G551D, 621 + 1 G-->T, N1303K, W1282X) using allele-specific hybridization and, in addition, analyzed exons 4, 5, 7, 8, 10, 11, 17b, 19, 20 and 21 using the method of denaturing gradient gel electrophoresis (DGGE). Six mutations accounted for 65.9% of the CF alleles in Greek patients, of which the delta F 508 mutation had a frequency of 52.7%. A further 15 previously described mutations accounted for another 8.3% CF alleles and one previously undescribed mutation (3272-4A-->G) was found in one chromosome. The W1282X mutation was not detected at all. Thus, so far, we have identified 21 mutations in the CFTR gene in Greek CF patients, accounting for 74.5% of the CF alleles.
Comments [show]
None has been submitted yet.
No. Sentence Comment
26 (ASO allele-specific hybridization, DGGE denaturing gradient gel electrophoresis, Seq direct genomic sequencing) Mutation Method Number of Percentage positive alleles AF 508 621+lG---~T G542X N1303K Rll7H R334W 574delA 3272-26A---~G R1158X 1677delTA R1070Q G551D G 1244V R553X 444delA 3849+4A---)G 457-TAT--)G 4010delTATT 4040delA W361R 3272-4A--)Ga Known Unknown Total number alleles ASO, DGGE ASO, DGGE ASO, DGGE ASO, DGGE DGGE, Seq DGGE, Seq DGGE, Seq DGGE, Seq DGGE, Seq DGGE DGGE, Seq ASO, DGGE DGGE, Sec DGGE, Sec DGGE, Sec DGGE, Sec DGGE, Sec DGGE, Sec DGGE, Sec DGGE, Sec DGGE, Sec 194 52.7 17 4.6 16 4.3 14 3.8 4 1.1 4 1.1 3 0.8 3 0.8 3 0.8 3 0.8 2 0.5 2 0.5 1 0.3 1 O.3 1 0.3 1 0.3 1 0.3 1 0.3 1 0.3 1 0.3 1 0.3 274 74.5% 94 25.5% 368 aNovel mRNA splicing mutations Acknowledgements This work was supported by the Greek Ministry of Health, the Hellenic Cystic Fibrosis Association and the Bodosakis Foundation.
X
ABCC7 p.Arg1158* 7544320:26:233
status: NEW[hide] Search for mutations in pancreatic sufficient cyst... Hum Genet. 1995 Sep;96(3):312-8. Brancolini V, Cremonesi L, Belloni E, Pappalardo E, Bordoni R, Seia M, Russo S, Padoan R, Giunta A, Ferrari M
Search for mutations in pancreatic sufficient cystic fibrosis Italian patients: detection of 90% of molecular defects and identification of three novel mutations.
Hum Genet. 1995 Sep;96(3):312-8., [PMID:7544319]
Abstract [show]
A cohort of 31 cystic fibrosis patients showing pancreatic sufficiency and bearing an unidentified mutation on at least one chromosome was analyzed through denaturing gradient gel electrophoresis of the whole coding region of the cystic fibrosis transmembrane conductance regulator gene, including intron-exon boundaries. Three new and 19 previously described mutations were detected. The combination of these with known mutations detected by other methods, allowed the characterization of mutations on 56/62 (90.3%) chromosomes. Among those identified, 17 can be considered responsible for pancreatic sufficiency, since they were found in patients carrying a severe mutation on the other chromosome. Among these presumed mild mutations, eight were detected more than once, R352Q being the most frequent in this sample (4.83%). Intragenic microsatellite analysis revealed that the six chromosomes still bearing unidentified mutations are associated with five different haplotypes. This may indicate that these chromosomes bear different mutations, rarely occurring among cystic fibrosis patients, further underlying the molecular heterogeneity of the genetic defects present in patients having pancreatic sufficiency.
Comments [show]
None has been submitted yet.
No. Sentence Comment
42 The remaining 19 included R352Q (Cremonesi et al. 1992) (three chromosomes), G85E (Zielenski et al. 1991a), Dl152H (High- Fig. 1 A-C Direct sequencing of PCR products from three cystic fibrosis patients (CF) carrying the W57G (A), E193K (B) and D579G (C) mutations, in parallel with control samples (C) displaying normal sequences (N/N) smith et al., personal communication to the CF Genetic Analysis Consortium), R1066H (Ferec et al. 1992), T338I (Saba et al. 1993), 711 +5G--+A (Gasparini et al., personal communication to the CF Genetic Analysis Consortium), M1V (Cheadle et al. 1993), R334W (Gasparini et al. 1991) (two chromosomes each), 4382delA (Claustres et al. 1993), R1158X (Ronchetto et al. 1992), F1052V (Mercier et al. 1993), G1349D (Beaudet et al. 1991), 1898+3A-+G (Cremonesi et al. 1992), $549N (Cutting et al. 1990), 711+ 3A-->G (Petreska et al. 1994), R347P (Dean et al. 1990), 2789+5G--+A (Highsmith et al. 1990), R1066C (Fanen et al. 1992) and S1251N (K~ilin et al. 1992) (one chromosome each).
X
ABCC7 p.Arg1158* 7544319:42:677
status: NEW70 (UN yet unidentified mutation) Patient Genotype after Genotype at the end number preliminary screening of the analysis UN/UN M1V/4382delA 1717-1G---~A/UN 1717-1G---~A/R1066H AF508/UN AF508/D579G UN/UN M1V/UN AF508/UN AF508/UN UN/UN T338I/R1158X UN/UN G85E/71 I+5G---~A UN/UN D1152H/UN AF508/UN AF508/UN AF508/UN AF508/3849+ 10kbC---~T UN/UN 711+3A---~G/UN AF508/UN AF508/F1052V UN/UN R352Q/W57G UN/UN 1898+3A----~G/UN AF508/UN AF508/711+5G--~A G542X/UN G542X/DI 152H AF508/UN AF508/E193K 1717-1G---~A/UN 1717-1G---~A/2789+5A---)G AF508/UN AF508/G1349D AF508/UN AF508/G85E AF508/UN AF508/R347P AF508/UN AF508/R352Q AF508/UN AF508/R352Q AF508/UN AF508/S549N G542X/UN G542X/R1066H AF508/UN AF508/T338I AF508/UN AF508/R334W AF508/UN AF508/R334W AF508/UN AF508/S1251N AF508/UN AF508/R1066C AF508/UN AF508/D579G results) while the remaining three haplotypes had been found in association with other rare mutations, which were excluded by DGGE analysis in these patients (Table 3).
X
ABCC7 p.Arg1158* 7544319:70:238
status: NEW[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]
Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).
Comments [show]
None has been submitted yet.
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population.
X
ABCC7 p.Arg1158* 7525963:21:500
status: NEW[hide] Analysis of the CFTR gene confirms the high geneti... Hum Genet. 1994 Apr;93(4):447-51. Chillon M, Casals T, Gimenez J, Ramos MD, Palacio A, Morral N, Estivill X, Nunes V
Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes.
Hum Genet. 1994 Apr;93(4):447-51., [PMID:7513293]
Abstract [show]
We have analysed 972 unrelated Spanish cystic fibrosis patients for 70 known mutations. Analysis was performed on exons 1, 2, 3, 4, 5, 6a, 6b, 7, 10, 11, 12, 13, 14a, 14b, 15, 16, 17b, 18, 19, 20 and 21 of the cystic fibrosis transmembrane regulator gene using single strand conformation polymorphism analysis and denaturing gradient gel electrophoresis. The major mutation delta F508 accounts for 50.6% of CF chromosomes, whereas another 42 mutations account for 27.6% of CF chromosomes, with 21.8% of Spanish CF chromosomes remaining uncharacterized. At present, we have identified 36 mutations that have frequency of less than 1% and that are spread over 15 different exons. This indicates that, in the Spanish population, with the exception of delta F508 (50.6%) and G542X (8%), the mutations are not concentrated in a few exons of the gene nor are there any predominating mutations. This high degree of genetic heterogeneity is mainly a result of the different ethnic groups that have populated Spain and of the maintenance of separated population sets (Basques, Arab-Andalusian, Mediterranean, Canarian and Gallician). The high proportion of CF chromosomes still unidentified (21.8%) together with association analysis with intragenic markers suggest that at least 100 different mutations causing CF are present in our population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
41 A Exon 13 4 0.41 621-1 G--~T Intron 4 3 0.31 P205S Exon 6a 3 0.31 936 del TA Exon 6b 3 0.31 1949 del 84 Exon 13 3 0.31 K710X Exon 13 3 0.31 CF del #1 Exon 4-7/11-18 3 0.31 L206W Exon 6a 2 0.20 R347H Exon 7 2 0.20 Y1092X Exon 17b 2 0.20 Q1100P Exon 17b 2 0.20 Q30X Exon 2 1 0.10 E92K Exon 4 1 0.10 A120T Exon 4 1 0.10 I148T Exon 4 1 0.10 H199Y Exon 6a 1 0.10 1078 del T Exon 7 1 0.10 1717-1 G--+A Intron 10 1 0.10 T582R Exon 12 1 0.10 E585X Exon 12 1 0.10 1898+3 A~---G Intron 12 1 0.10 W1098X Exon 17b 1 0.10 R1158X Exon 19 1 0.10 3667 del 4 Exon 19 1 0.10 3860 ins 31 Exon 20 1 0.10 3905 ins T Exon 20 1 0.10 Unknown 212 21.81 The Basque subset The Basques have a different genetic background with respect to other ethnic groups (Pancorbo et al. 1989) as they are the only pre-Indoeuropean group in Spain.
X
ABCC7 p.Arg1158* 7513293:41:509
status: NEW[hide] Analysis of the 27 exons and flanking regions of t... Hum Mol Genet. 1993 Aug;2(8):1209-13. Claustres M, Laussel M, Desgeorges M, Giansily M, Culard JF, Razakatsara G, Demaille J
Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France.
Hum Mol Genet. 1993 Aug;2(8):1209-13., [PMID:7691344]
Abstract [show]
In order to characterize the non-delta F508 mutations that account for 36% of cystic fibrosis (CF) chromosomes in Southern France in a sample of 137 patients, we have systematically screened the entire coding region and adjacent sequences of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by the single strand conformation polymorphism (SSCP) technique followed by direct sequencing of the mutant DNAs. We identified 13 novel mutations (9 reported in this paper) and 4 novel rare nucleotide sequence variations. Forty different mutations including delta F508, located in 15 exons, account for only 91.2% of mutants in a population originating from Southern France, in contrast with a recent report on the Celtic population of Brittany demonstrating that 90% of mutations can be detected with only three mutations. We present a very large spectrum of different CF mutations identified in a small geographical area.
Comments [show]
None has been submitted yet.
No. Sentence Comment
26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation?
X
ABCC7 p.Arg1158* 7691344:26:272
status: NEW[hide] Microsatellite haplotypes for cystic fibrosis: mut... Hum Mol Genet. 1993 Jul;2(7):1015-22. Morral N, Nunes V, Casals T, Chillon M, Gimenez J, Bertranpetit J, Estivill X
Microsatellite haplotypes for cystic fibrosis: mutation frameworks and evolutionary tracers.
Hum Mol Genet. 1993 Jul;2(7):1015-22., [PMID:7689896]
Abstract [show]
Highly informative intragenic microsatellite markers within the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene allow the analysis of associations between specific mutations and haplotypes. We have analysed 440 Spanish CF families carrying 22 different CF mutations and have established haplotypes in 1,036 chromosomes for microsatellites IVS8CA, IVS17BTA and IVS17BCA. No new alleles were detected at the three CFTR microsatellites, in more than 3,000 meiosis analysed (estimated mutation rate of less than 3.3 x 10(-4)). The evolution of 16 haplotypes associated with the most common CF mutation, delta F508, and the low mutation rate at these microsatellite loci suggest that delta F508 originated within the 23-31-13 haplotype at least 53,000 years ago, very early in the history of the European population. The number of haplotype changes seen for two other common mutations, G542X (haplotype 23-33-13) and N1303K (23-31-13), suggests that they originated at least 35,000 years ago. Microsatellite allele variability associated with delta F508, G542X and N1303K demonstrates that slippage and mispairing is the main mechanism generating microsatellite alleles. In spite of the haplotype variability detected for these 3 common mutations, the association between haplotype and mutations is very strong. Mutations 1609delCA, 3667del4, delta I507 and G551D are all associated with haplotype 16-7-17, which has a frequency of 14.5% in normal chromosomes. 5 haplotypes bearing specific CF mutations were not found in normal chromosomes. Haplotype 16-46-13 is strongly associated with CF mutations E92K and 3601-111G-->C. About 23% of CF chromosomes with unknown mutations show significant linkage disequilibrium for microsatellite haplotypes.(ABSTRACT TRUNCATED AT 250 WORDS)
Comments [show]
None has been submitted yet.
No. Sentence Comment
49 Mutations I148T A120T E92K 621+1G->T R334W 1078delT CFSOKBdeUM G551D G54 AJ507 lDuIKJt AF5O8 2X If*A Iv 1OA 28691m '10X }f)a\OA (G 3601-111G->C R1162X 3860)ns31 R1158X 3€€7deM I W1282X 141303K | | 1 2 3 Exons Markers 6 7 8 8 • b 10 11 12 13 14 15 • t> 16 17 18 19 20 21 22 23 24 IVS8CA IVS17BTA / IVS17BCA Figure 1.
X
ABCC7 p.Arg1158* 7689896:49:161
status: NEW58 CF mutations identified in the Spanish population Mutation AF5O8 G542X N13O3K 36O1-111G-C R1162X 1609delCA 2869insG W1282X AI507 G551D 1949del84 CF50KBdel tt 1 K710X 621 + 1G-T R334W 1078delT E92K 3667deM R1158X A120T I148T 386Oins31 Unknown Total N 437 73 18 18 14 8 6 6 5 4 3 3 3 2 2 1 1 1 1 1 1 1 271 880 % 49.7 8.3 2.1 2.1 1.6 0.9 0.7 0.7 0.6 0.5 0.3 0.3 0.3 0.2 0.2 0.
X
ABCC7 p.Arg1158* 7689896:58:205
status: NEW200 Several mutations were analysed by digestion with restriction enzymes: R1162X/£WeI, 1609delCA/£WeI, N13O3K/D<ieI, KllOX/Xmnl, 3667del4/AfariI, R1158X/§SJNI, G551D/tfincII, W1282X/M/iII, 2869insG/AftoI, 3601-lllG-C/Afa«III, E92K/£coNI, R334W/AftpI and 621 + 1G-T/Miefl.
X
ABCC7 p.Arg1158* 7689896:200:153
status: NEW[hide] Prenatal diagnosis of cystic fibrosis: a case of t... Clin Chim Acta. 2000 Aug;298(1-2):121-33. Castaldo G, Martinelli P, Massa C, Fuccio A, Grosso M, Rippa E, Paladini D, Salvatore F
Prenatal diagnosis of cystic fibrosis: a case of twin pregnancy diagnosis and a review of 5 years' experience.
Clin Chim Acta. 2000 Aug;298(1-2):121-33., [PMID:10876009]
Abstract [show]
We performed prenatal diagnoses for cystic fibrosis in 32 high risk (1:4) couples (including a dizygotic pregnancy). Chorionic villi sampling did not cause abortion or fetal malformation in any case. The preliminary analysis of 9 short tandem repeats always excluded maternal contamination of the DNA extracted from chorionic villi and confirmed paternity. Twenty-two prenatal diagnoses were made by direct analysis of the mutations. In seven cases diagnosis was made by the analysis of intragenic polymorphisms; in three cases, we analyzed two extragenic polymorphisms. The prenatal diagnosis (including genetic counselling) was completed within 24 h from the sampling. Seven prenatal diagnoses revealed an affected fetus; all couples opted for therapeutic abortion. In 17 cases the fetus was heterozygote, and in seven cases it was non carrier of mutated alleles. In the twin pregnancy, mutations were DeltaF508/N1303K. Direct analysis of the DNA extracted from the two independent samples of chorionic villi revealed one fetus non carrier of mutated alleles and the other a carrier of the N1303K mutation. Analysis of the HPRT locus predicted both the fetuses as males. Furthermore, the genotype of each fetus was defined after birth. The prenatal diagnosis with chorionic villi sampling plays a key role in the prevention of cystic fibrosis. The laboratories must be equipped for both the direct analysis of mutations and for the analysis of a large number of polymorphisms. The preliminary analysis of short tandem repeats is recommended both to exclude maternal contamination and to confirm parentage.
Comments [show]
None has been submitted yet.
No. Sentence Comment
68 T, 4016insT, G1244E and R1158X) was analysed on all the CF families with an allele Table 1 Short tandem repeats (STR) used to exclude maternal contamination and to confirm paternity in prenatal diagnosis of cystic fibrosis.
X
ABCC7 p.Arg1158* 10876009:68:24
status: NEW[hide] Laboratory tests for the diagnosis of cystic fibro... Am J Clin Pathol. 2002 Jun;117 Suppl:S109-15. Wang L, Freedman SD
Laboratory tests for the diagnosis of cystic fibrosis.
Am J Clin Pathol. 2002 Jun;117 Suppl:S109-15., [PMID:14569807]
Abstract [show]
Cystic fibrosis (CF) remains the most common life-limiting inherited disease in America. Making an accurate, early diagnosis is essential to the management of the disease. The diagnostic criteria for CF require the presence of 1 or more typical clinical features, a family history of CF, or a positive newborn screening test, plus laboratory evidence of the CF transmembrane conductance regulator (CFTR) dysfunction. In the past, the laboratory test of abnormal CFTR function was based largely on an elevated sweat chloride test result. The recent development of a genotypic CFTR mutation screen has greatly improved diagnostic accuracy. Increased screening of the CFTR locus has led to the recognition of a number of atypical CF disorders. Recently, a 2-tiered newborn screening protocol including CFTR genotyping has become popular, increasing the likelihood of early diagnosis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
67 For example, the complex allele R553Q-delta F508 has been shown to revert partially or ameliorate the phenotype of delta F508 mutation.15 Other revertants (delta F508-V1212I and R334W-R1158X) associated with mild or atypical CF have also been described.16,17 Nasal Potential-Difference Measurements This is a functional test for the CFTR gene product.
X
ABCC7 p.Arg1158* 14569807:67:184
status: NEW[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]
Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.
Comments [show]
None has been submitted yet.
No. Sentence Comment
78 At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT.
X
ABCC7 p.Arg1158* 16963320:78:267
status: NEW[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]
Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population.
X
ABCC7 p.Arg1158* 24357848:63:2860
status: NEW107 These variants are 3876delA, S549N, 406-1G>A, 3199del6, W1089X, R1158X, R352Q, and 2183AA>G, and they account for 8.1% of the mutations detected in the Hispanic population.
X
ABCC7 p.Arg1158* 24357848:107:64
status: NEW[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]
Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B).
X
ABCC7 p.Arg1158* 24517344:81:640
status: NEW[hide] CFTR mutations spectrum and the efficiency of mole... PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014. Zietkiewicz E, Rutkiewicz E, Pogorzelski A, Klimek B, Voelkel K, Witt M
CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.
PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014., [PMID:24586523]
Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.
Comments [show]
None has been submitted yet.
No. Sentence Comment
71 Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans Pathogenic mutations 1 1 L15Ffs10X c.43delC 175delC 1 CFMDB 1717-1G.A 2 2 G27V 21.92 c.80G.T 212G.T 1 Novel F508del 2 2 S18RfsX16 c.54-5940_273 +10250del21kb exon2,3del21kb 66 IL19 various CF mutations i2 i2 IVS2_Donor c.164+1G.A 296+1G.A 3 CFMDB various CF mutations 3 3 G85E 22.61 c.254G.A 386G.A 1 IL17 unknown 3 3 E60X c.178G.T 310G.T 0 IL17 x 3 3 L88IfsX22 c.262_263delTT 394delTT 0 IL17 x 4 4 E92K 21.92 c.274G.A 406G.A 2 CFMDB c.164+1G.A; c.2051- 2AA.G 4 4 L101X c.302T.G 434T.G 1 CFMDB c.3717+12191C.T 4 4 K114IfsX5 c.341_353del13bp 473del13bp 1 Novel F508del 4 4 R117H 20.35 c.350G.A 482G.A 5 IL17 F508del; 2x unknown 4 4 R117C 22.07 c.349C.T 481C.T 2 CFMDB S1206X;1x unknown 4 4 L137_L138insT c.412_413insACT L138ins 1 CFMDB F508del 4 4 R153I 22.61 c.458G.T 590G.T 2 Novel F508del; c.3527delC i4 i4 IVS4_Donor c.489+1G.T 621+1G.T 5 IL17 F508del; c.489+1G.T 5 5 L165X c.494T.A 626T.A 1 Novel F508del i5 i5 IVS5_Donor c.579+1G.T 711+1G.T 0 IL19 x i5 i5 IVS5_Donor c.579+3A.G 711+3A.G 2 CFMDB 2,3del21kb; c.2052-3insA i5 i5 IVS5_Donor c.579+5G.A 711+5G.A 0 IL17 x 7 8 F311L 20.90 c.933C.G 965C.G 2 CFMDB 2x F508 7 8 G314R 20.58 c.940G.A 1072G.A 4 CFMDB various CF mutations 7 8 F316LfsX12 c.948delT 1078delT 1 IL17 unkown 7 8 R334W 22.41 c.1000C.T 1132C.T 6 IL17 various CF mutations 7 8 I336K 22.07 c.1007T.A 1139T.A 2 CFMDB 2,3de21kb; F508del 7 8 R347P 22.27 c.1040G.C 1172G.C 11 IL17 various CF mutations i7 i8 IVS8_Donor c.1116+2T.A 1248+2T.A 1 Novel Q1412X 9 10 A455E 22.61 c.1364C.A 1496C.A 0 IL17 x i9 i10 IVS10_Donor c.1392+1G.A 1524+1G.A 1 CFMDB c.3816-7delGT 10 11 S466X c.1397C.G 1529C.G 1 CFMDB G542X 10 11 I507del c.1519_1521delATC 1651delATC 2 IL19 F508del 10 11 F508del c.1521_1523delCTT 1654delCTT 805 IL19 various CF mutations i10 i11 IVS11_Acceptor c.1585-1G.A 1717-1G.A 27 IL19 various CF mutations 11 12 G542X c.1624G.T 1756G.T 25 IL19 various CF mutations 11 12 G551D 21.24 c.1624G.T 1756G.T 5 IL19 various CF mutations 11 12 Q552X c.1654C.T 1786C.T 0 IL19 x 11 12 R553X c.1657C.T 1789C.T 14 IL19 various CF mutations 11 12 R560T 21.92 c.1679G.C 1811G.C 0 IL19 x i12 i13 IVS13_Donor c.1766+1G.A 1898+1G.A 6 IL19 various CF mutations i12 i13 IVS13_Donor c.1766+1G.C 1898+1G.C 1 CFMDB F508del 13 14 H620P 21.73 c.1859A.C 1991A.C 1 CFMDB F508del 13 14 R668C//G576A 21.61//1.73 c.2002C.T//c.1727G.C 2134C.T// 1859G.C 5 b CFMDB// rs1800098 c.1585-1G.A; 4 unknown 13 14 L671X c.2012delT 2143delT 27 IL17 various CF mutations 13 14 K684SfsX38 c.2051_2052delAAinsG 2183AA.G 10 IL17 various CF mutations 13 14 K684NfsX38 c.2052delA 2184delA 0 IL17 x 13 14 Q685TfsX4 c.2052_2053insA 2184insA 15 CFMDB various CF mutationsc , 1 unknown Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 13 14 L732X c.2195T.G 2327T.G 1 CFMDB F508del 14A 15 R851X c.2551C.T 2683C.T 3 CFMDB various CF mutations 14A 15 I864SfsX28 c.2589_2599del11bp 2721del11bp 2 CFMDB F508del; 2,3del21kb i14B i16 IVS16_Donor c.2657+2_2657+3insA 2789+2insA 1 CFMDB F508del i14B i16 IVS16_Donor c.2657+5G.A 2789+5G.A 0 IL17 unkown 15 17 Y919C 21.02 c.2756A.G 2888A.G 1 CFMDB unknown 15 17 H939HfsX27 c.2817_2820delTACTC 2949delTACTC 1 Novel unkown i15 i17 IVS17_Donor c.2908+3A.C 3040+3A.C 1 Novel F508del i16 i18 IVS18_Donor c.2988+1G.A 3120+1G.A 0 IL19 x 17A 19 I1023_V1024del c.3067_3072delATAGTG 3199del6 0 IL19 x i17A i19 IVS19 c.3140-26A.G 3272-26A.G 9 IL19 various CF mutations 17B 20 L1065R 21.90 c.3194T.G 3326T.G 1 CFMDB F508del 17B 20 Y1092X c.3276C.A 3408C.A 1 CFMDB R334W i18 i21 IVS21_Donor c.3468+2_3468+3insT 3600+2insT 11 CFMDB various CF mutationsd , 1 unknown 18 21 E1126EfsX7 c.3376_3379delGAAG 3508delGAAG 1 Novel F508del 19 22 R1158X c.3472C.T 3604C.T 2 CFMDB F508del; R553X 19 22 R1162X c.3484C.T 3616C.T 1 IL17 F508del 19 22 L1177SfsX15 c.3528delC 3659delC 4 IL17 various CF mutations 19 22 S1206X c.3617C.A 3749C.A 1 CFMDB R117C i19 i22 IVS22 c.3717+12191C.T 3849+10kbC.T 58 IL17 various CF mutations 20 23 G1244R 22.62 c.3730G.C 3862G.C 1 CFMDB F508del 20 23 S1251N 22.28 c.3752G.A 3884G.A 0 IL19 x 20 23 L1258FfsX7 c.3773_3774insT 3905insT 0 IL19 x 20 23 V1272VfsX28 c.3816_3817delGT 3944delGT 1 CFMDB c.1392+1G.A 20 23 W1282X c.3846G.A 3978G.A 9 IL19 various CF mutations 21 24 N1303K 22.62 c.3909C.G 4041C.G 18 IL19 various CF mutations 22 25 V1327X c.3979delG 4111delG 1 Novel F508del 22 25 S1347PfsX13 c.4035_4038dupCCTA c.4167dupCCTA 1 CFMDB 2,3del21kb 23 26 Q1382X c.4144C.T 4276C.T 1 CFMDB F508del 23 26 Q1412X c.4234C.T 4366C.T 2 CFMDB F508del; c.1116+2T.A i23 i26 IVS26_Donor c.4242+1G.T 4374+1G.T 1 CFMDB F508del Sequence changes of uncertain pathogenic effect, tentatively counted as mutations 6A 6 E217G 0.30 c.650A.G 782A.G 1 CFMDB; rs1219109046 unknown 7 8 R352Q 20.01 c.1055G.A 1187G.A 1 CFMDB; rs121908753 F508del 7 8 Q359R 0.33 c.1076A.G 1208A.G 1 CFMDB F508del i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)12 1332-12Tn_- 34TGm 6 CFMDB F508del; 3x unknown i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)13 1332-12Tn_- 34TGm 2 CFMDB 2143delT; 1x unknown i8 i9 IVS9 c.1210-12T8 1332-12Tn 1 Novel unknown 10 11 I506V 20.21 c.1516A.G 1648A.G 1 CFMDB; rs1800091 unknown 12 13 V562L 0.79 c.1684G.C 1816G.C 1 CFMDB; rs1800097 unknown 13 14 G723V 0.44 c.2168G.T 2300G.T 1 CFMDB; rs200531709 unknown 15 17 D924N 0.03 c.2770G.A 2902G.A 1 CFMDB; rs201759207 unknown patient with F508del on another allele) was not supported by the SVM value (+0.35); the patient was PS and had ambiguous chloride values (45, 64 and 83 mmol/L).
X
ABCC7 p.Arg1158* 24586523:71:3947
status: NEW137 Mutations a Poland Czechs Slovakia c Germany Lithuania W. Ukraine E. Hungary Romania c Bulgaria Serbia Greece Number of chromosomes 1476 1200 856 700 98 264 80 256 208 352 874 F508del 54.54 b 67.42 d 66.80 d 72.00 d 52.0 54.17 70.00 56.3 65.38 d 72.28 d 53.40 exon2,3del21kb (l.n.CFTRdele2,3_21kb) 4.47 5.75 2.26 1.2 f 2.0 4.17 5.00 1.6 NA 0 e 0.34 e c.3717+12191C.T (l.n.3849+10kbC.T) 3.93 1.67 e 4.28 1.00 e NA 0.76 0 0.4 e 1.44 0 e 0.11 e c.2012delT (l.n.2143delT) 1.83 0.92 1.10 0.71 0 1.14 0 0 e 0 0 e 0 e c.1585-1G.A (l.n.1717-1G.A) 1.83 0.33 e NA 0.86 0 0.38 1.25 0.4 0 0 e 0 e G542X 1.69 2.00 4.06 d 1.43 0 2.65 3.75 3.9 3.37 2.57 3.90 d R347P 1.57 0.92 1.10 1.57 0 0 1.25 NA 1.44 0 e 0.11 e N1303K 1.22 2.42 2.03 2.29 2.0 4.92 d 5.00 0.8 6.73 d 0 2.63 c.2052-2053insA (l.n.2184insA) 1.02 0.42 1.58 0.57 0 7.20 d 5.00 d 0 0.48 0.28 0 e R553X 0.95 0.50 0.90 2.29 4.2 d 0.38 0 NA 0 0 0 c.3468+223insT (l.n.3600+2insT) 0.75 0.25 NA 0 e 0 NA 0 NA 0 0 0 e c.2051-2052AA.G (l.n.2183AA.G) 0.68 0.08 NA 0.57 0 0.38 0 0.8 0 0 1.38 W1282X 0.61 0.58 0.50 0.71 1.0 2.27 0 2.3 d 0.96 0 0.67 c.3140-26A.G (l.n.3272-26A.G) 0.61 0.67 0.50 0.86 0 0.76 0 0.4 0 0 0.81 l.n.IVS8 T 5 _TG 12-13 0.54 NA NA NA 0 NA NA NA NA 0 NA R334W 0.41 0.25 NA 0.29 0 0.76 0 0.4 0 0.28 0.81 c.1766+1G.A (l.n.1898+1G.A) 0.41 1.42 d 0.50 0 0 1.14 0 NA 0 0 0.11 c.489+1G.T (l.n.621+1G.T) 0.34 0.42 NA 0.14 0 0.76 0 0.8 0 2.86 d 5.72 d R117H 0.34 NA NA 0.29 0 0 0 0.4 0 0 0.23 G551D 0.34 2.91 d 0.50 1.00 0 0 0 0 0 0 0.34 G314R 0.37 0 NA 0 0 0 0 NA 0 0 0 R668C 0.34 0 NA 0 0 0 0 NA 0 0 0 c.3528delC (l.n.3659delC) 0.27 0.17 NA 0.57 0 0 0 NA 0 0 0 c.164+1G.A (l.n.296+1G.A) 0.20 0.08 NA 0 0 0 0 NA 0 0 0 R851X 0.20 0.08 NA 0 0 0 0 NA 0 0 0 I336K 0.14 0.58 NA 0.45 0 0 0 NA 0 0 0 R1158X 0.14 0.08 NA 0 0 0 0 NA 0 0 1.03 E92K 0.14 0.08 NA 0 0 0.38 0 NA 0 0 0 R153I 0.14 0 NA 0 0 0 0 NA 0 0 0 c.579+3A.G (l.n.711+3A.G) 0.14 0.17 NA 0 0 0 0 NA 0 0 0.69 c.2589-2599del11bp (l.n.2721- 31del11bp) 0.14 0.08 NA 0 0 0.38 0 NA 0 0 0 I507del 0.14 0.08 NA 0.15 0 0 0 0 0 0.28 0.69 R117C 0.14 0.08 NA 0.15 0 0 0 NA 0 0 0.23 of mutation panels [20]), listed in Table 4, were compared to those reported for several Central and Southeastern European countries [21-29].
X
ABCC7 p.Arg1158* 24586523:137:1746
status: NEW[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]
Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17].
X
ABCC7 p.Arg1158* 25304080:59:524
status: NEW79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%.
X
ABCC7 p.Arg1158* 25304080:79:528
status: NEW[hide] Clinical expression of patients with the D1152H CF... J Cyst Fibros. 2015 Jul;14(4):447-52. doi: 10.1016/j.jcf.2014.12.012. Epub 2015 Jan 10. Terlizzi V, Carnovale V, Castaldo G, Castellani C, Cirilli N, Colombo C, Corti F, Cresta F, D'Adda A, Lucarelli M, Lucidi V, Macchiaroli A, Madarena E, Padoan R, Quattrucci S, Salvatore D, Zarrilli F, Raia V
Clinical expression of patients with the D1152H CFTR mutation.
J Cyst Fibros. 2015 Jul;14(4):447-52. doi: 10.1016/j.jcf.2014.12.012. Epub 2015 Jan 10., [PMID:25583415]
Abstract [show]
BACKGROUND: Discordant results were reported on the clinical expression of subjects bearing the D1152H CFTR mutation, and also for the small number of cases reported so far. METHODS: A retrospective review of clinical, genetic and biochemical data was performed from individuals homozygous or compound heterozygous for the D1152H mutation followed in 12 Italian cystic fibrosis (CF) centers. RESULTS: 89 subjects carrying at least D1152H on one allele were identified. 7 homozygous patients had very mild clinical expression. Over half of the 74 subjects compound heterozygous for D1152H and a I-II-III class mutation had borderline or pathological sweat test and respiratory or gastrointestinal symptoms; one third had pulmonary bacteria colonization and 10/74 cases had complications (i.e. diabetes, allergic bronchopulmonary aspergillosis, and hemoptysis). However, their clinical expression was less severe as compared to a group of CF patients homozygous for the F508del mutation. Finally, 8 subjects compound heterozygous for D1152H and a IV-V class mutation showed very mild disease. CONCLUSIONS: The natural history of subjects bearing the D1152H mutation is widely heterogeneous and is influenced by the mutation in trans.
Comments [show]
None has been submitted yet.
No. Sentence Comment
85 Legacy name Protein name CDNA name Patients Homozygous for the D1152Ha D1152H p.Asp1152His c.3454GNC 7 Compound heterozygous for class I-II-III mutationsa : 74 F508del p.Phe508del c.1521_1523delCTT 43 G542X p.Gly542X c.1624GNT 7 N1303K p.Asn1303Lys c.3909CNG 4 1717-1GNA No protein name c.1585-1GNA 4 R1158X p.Arg1158X c.3472CNT 4 2183AANG p.Lys684SerfsX38 c.2051_2052delAAinsG 2 W1282X p.Trp1282X c.3846GNA 2 711 + 1GNT No protein name c.579 + 1GNT 1 Y849X p.Tyr849X c.2547CNA 1 L1065P p.Leu1065Pro c.3194 TNC 1 4016insT p.Ser1297PhefsX5 c.3884_3885insT 1 R1066H p.Arg1066His c.3197GNA 2 R1066C p.Arg1066Cys c.3196CNT 1 4382delA p.Glu1418ArgfsX14 c.4251delA 1 Compound heterozygous for class IV-V mutationsa : 8 (TG)12T5 No protein name Not available 2 2789 + 5GNA No protein name c.2657 + 5GNA 1 D579G p.Asp579Gly c.1736ANG 1 [R74W;V201M; D1270N] No protein name Not available 1 3849 + 10KbCNT No protein name c.3717 + 12191CNT 1 R347H p.Arg347His c.1040GNA 1 R347P p.Arg347Pro c.1040GNC 1 a Protein name and cDNA name from the CFTR2 database (http://www.http. com//www.cftr2) and http://www.genet.sickkids.on.ca/Home.html.
X
ABCC7 p.Arg1158* 25583415:85:301
status: NEW[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]
Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.
Comments [show]
None has been submitted yet.
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve.
X
ABCC7 p.Arg1158* 25674778:15:2166
status: NEW[hide] Mutation analysis of PRSS1, SPINK1 and CFTR gene i... Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287. Sisman G, Tugcu M, Ayla K, Sebati O, Senturk H
Mutation analysis of PRSS1, SPINK1 and CFTR gene in patients with alcoholic and idiopathic chronic pancreatitis: A single center study.
Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287., [PMID:25835118]
Abstract [show]
BACKGROUND/AIMS: A relation between some genetic mutations and chronic pancreatitis (CP) has been reported. However, the relation of genetic mutation to alcoholic CP (ACP) and idiopathic CP (ICP) still remains controversial. In this study, we investigated the prevalence of protease serine 1 (PRSS1), serine protease inhibitor, Kazal type 1 (SPINK1) SPINK1 and cystic fibrosis transmembrane conductance regulator (CFTR) mutations in ACP and ICP patients in Turkey. MATERIALS AND METHODS: Forty-one patients with ACP and 38 patients with ICP were enrolled, and 35 healthy individuals served as controls. The PRSS1 and SPINK1 mutations were investigated by the polymerase chain reaction (PCR)-restriction fragment-length polymorphism (RFLP) technique. The CFTR mutation was examined with PCR direct sequencing. RESULTS: The mean ages of the ACP, ICP and healthy control groups were 53.2, 40.4 and 46.3 years, respectively. A CFTR F508 mutation was detected as a heterozygote in one (2.4%) patient with ACP. In the ICP and control populations, PRSS1, SPINK1 and CFTR mutations were not detected. CONCLUSION: This study shows that PRSS1, SPINK1 and CFTR mutations do not play a role in ACP and ICP patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
45 DNA samples were multiplied by multiplex PCR with a CF 22Mut and CF 14Mut+Tn strip assay kit which has 36 common mutations of the CFTR gene (DF508, DI507, F508C, I502T, 1706del17, 1677del TA, G542X, 1717-1G>A, R553X, Q552X, G551D, S549R(A>C), N1303K, 4016insT, R1162X, R1158X, W1282X, G1244E, 2789+5G>A, 2183AA>G, 711+5G>A, 711+1G>T, G85E, 3849+10kbC>T, 621+1G>T, R117H, D1152H, L1065P, R1066H, L1077P, 4382delA, 1259insA, 852del22, R347P, T338I, S912X and Allele5T-7T-9T).
X
ABCC7 p.Arg1158* 25835118:45:269
status: NEW[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]
Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.
Comments [show]
None has been submitted yet.
No. Sentence Comment
83 In several countries, when at least one Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name 3121-1G4A c.2989-1G4A 3199del6 (3195del6) c.3067_3072delATAGTG p.Ile1023_Val1024del 3272-26 A4G c.3140-26 A4G L1065P c.3194 T4C p.Leu1065Pro R1066C c.3196C4T p.Arg1066Cys R1066H c.3197G4A p.Arg1066His L1077P c.3230 T4C p.Leu1077Pro W1089X c.3266G4A p.Trp1089* Y1092X c.3276C4A p.Tyr1092* E1104X c.3310G4T p.Glu1104* R1158X c.3472C4T p.Arg1158* S1196X c.3587C4G p.Ser1196* W1204X(3743G4A) c.3611G4A p.Trp1204* W1204X(3744G4A) c.3612G4A p.Trp1204* 3791delC c.3659delC p.Thr1220Lysfs*8 3849+10kbC4T c.3718-2477C4T p.(?)
X
ABCC7 p.Arg1158* 26014425:83:441
status: NEW[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]
Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.
Comments [show]
None has been submitted yet.
No. Sentence Comment
63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented.
X
ABCC7 p.Arg1158* 26087176:63:772
status: NEW