ABCMdb

ABCC7 p.Arg352Gln

Admin's notes:	Class III (gating defect) Veit et al.
ClinVar:	c.1054C>T , p.Arg352Trp D , Likely pathogenic c.1055G>A , p.Arg352Gln D , Pathogenic
CF databases:	c.1055G>A , p.Arg352Gln D , CF-causing ; CFTR1: This missense mutation, at nucleotide position 1187 (G to A) in exon 7, has been detected in an Italian CF patient through DGGE and direct sequencing. The mutation generates an Arg to Gln substitution (R352Q) and creates a novel DdeI restriction site in the mutated allele. This mutation has been detected in a PS patient (paternal chromosome), associated with the haplotype A; the maternal chromosome carries a still uncharacterized mutation. It was found in one of 60 non-[delta] Italian CF chromosomes. c.1054C>G , p.Arg352Gly (CFTR1) ? , c.1054C>T , p.Arg352Trp (CFTR1) ? , The mutation was detected by SSCP/heteroduplex analysis and identified by direct DNA sequencing. The mutation was seen in a boy referred by West Midlands Regional Genetics Service, and whose other CF mutation was [delta]F508. We have seen it only once in over 150 samples tested.
Predicted by SNAP2:	A: D (91%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (91%), K: D (85%), L: D (91%), M: D (95%), N: D (95%), P: D (95%), Q: D (59%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: N, C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, S: N, T: N, V: N, W: N, Y: N,

[switch to compact view]
Comments [show]

III (gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Arg352 is a major determinant of charge selectivit... Biochemistry. 1999 Apr 27;38(17):5528-37. Guinamard R, Akabas MH
Arg352 is a major determinant of charge selectivity in the cystic fibrosis transmembrane conductance regulator chloride channel.
Biochemistry. 1999 Apr 27;38(17):5528-37., 1999-04-27 [PMID:10220340]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator forms an anion-selective channel. We previously showed that charge selectivity, the ability to discriminate between anions and cations, occurs near the cytoplasmic end of the channel. The molecular determinants of charge selectivity, however, are unknown. We investigated the role of Arg352, a residue flanking the predicted cytoplasmic end of the M6 segment, in the mechanism of charge selectivity. We determined the Cl- to Na+ permeability ratio (PCl/PNa) from the reversal potential measured in a 10-fold NaCl gradient. For the wild type, PCl/PNa was 36 (range of 28-51). For the R352H mutant, PCl/PNa was dependent on cytoplasmic pH. At pH 5.4, the PCl/PNa was 33 (range of 27-41), similar to that of the wild type, but at pH 7.2, where the histidine should be largely uncharged, PCl/PNa was 3 (range of 2.9-3.1). For the R352C and R352Q mutants, PCl/PNa was 7 (range of 6-8) and 4 (range of 3.5-4.4), respectively. Furthermore, Na+ which does not carry a significant fraction of the current through the wild type is measurably conducted through R352Q. Thus, the charge of the side chain at position 352 is a strong determinant of charge selectivity. In the wild type, the positive charge on Arg352 contributes to an electrostatic potential in the channel that forms a barrier to cation permeation. Mutation of Arg352 did not alter the halide selectivity sequence. Selectivity among halides must involve other residues.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 In cell-attached patches, with 140 mM NaCl in the pipet, the single-channel conductances (in picosiemens) were 6.0 ( 0.3 for the wild type (n ) 7), 5.3 ( 0.3 for R352C (n ) 11), 4.2 ( 0.1 for R352Q (n ) 10), 4.0 ( 0.2 for R352H (n ) 4), and 5.7 ( 0.2 for Q353C (n ) 8). Login to comment
113 The single-channel conductances (in picosiemens) were 6.2 ( 0.5 for the wild type (n ) 6)2 (Figure 3B), 5.9 ( 0.3 for R352C (n ) 5), 4.2 ( 0.1 for R352Q (n ) 8), and 5.7 ( 0.3 for Q353C (n ) 8). Login to comment
128 Similarly, for the R352Q mutant in the 10-fold NaCl gradient in the FIGURE 2: Whole-cell and single-channel current-voltage relationships for the wild type and Arg352 mutants in symmetrical Cl--containing solutions. Login to comment
131 (B) Average single-channel current-voltage relationships for the wild type (O) and the R352C (0), R352Q (3), and R352H (bath pH of 7.2) (]) mutants. Login to comment
133 The symbols for R352Q and R352H overlap at several voltages. Login to comment
164 These uncharged substitutions also shifted the reversal potential by an amount comparable to that observed by deprotonating R352H; Erev ) -34.9 ( 2 mV (n ) 7) for R352C, and Erev ) -26.3 ( 1.9 mV (n ) 9) for R352Q (Figure 6), resulting in calculated PCl/PNa ratios of 7 (range of 6-8) and 4 (range of 3.5-4.4), respectively. Login to comment
168 To be sure that the measured reversal potentials were not significantly affected by the low ionic strength of the cytoplasmic solution, we measured the reversal potentials for the wild type and R352Q following replacement of NaCl in the bath with sodium gluconate. Login to comment
170 For the R352Q mutant, we could not clearly identify single currents at potentials more negative than the reversal potential calculated by extrapolation from the currents seen at positive potentials. Login to comment
171 The reversal potential for R352Q calculated by extrapolation from the single-channel currents observed at positive potentials was -33.3 ( 1.4 mV (n ) 9) (Figure 7D, 0), close to that predicted with the Goldman-Hodgkin-Katz equation given the Cl- to Na+ permeability ratios calculated above in the 10-fold NaCl gradient and assuming that gluconate is impermeable through CFTR. Login to comment
176 The fractional current carried by a specific ion through the channel can be inferred from changes in conductance following ion substitutions.3 Therefore, we measured the Cl- to Na+ conductance ratios in the wild type (PCl/PNa ) 36) and in the R352Q (PCl/PNa ) 4) mutant to determine whether Na+ carries a significant fraction of the current in the mutants. Login to comment
178 With wild-type CFTR in inside-out patches, as was reported previously (9), substituting NMDG-Cl for NaCl in FIGURE 5: Sucrose in the cytoplasmic bath does not alter the reversal potentials determined from the outward currents for the wild type and the R352Q mutant. Login to comment
179 (A) Single-channel current-voltage relationships for the wild type (b and 0) and the R352Q mutant ([ and 4) in the presence of the 10-fold NaCl gradient. Login to comment
183 Note that the reversal potentials and the conductances for the wild type and the R352Q mutant were not affected by the presence or absence of sucrose. Login to comment
191 In R352Q, the effects of substituting NMDG+ for Na+ were different than in the wild type. Login to comment
192 For the R352Q mutant, in inside-out patches, substituting NMDG-Cl for NaCl in the bath changed the current-voltage relationship from linear in symmetrical NaCl to inwardly rectifying (Figure 7D, 2 vs O) and caused the reversal potential to shift to 8.6 ( 0.8 mV (n ) 8). Login to comment
196 Thus, for the R352Q mutant, the conductance of Cl- is about 3 pS and the conductance of Na+ is about 1 pS, giving a Cl- to Na+ conductance ratio of 3, similar to the permeability ratio of 4 for this mutant. Login to comment
209 (A and C) Average single-channel current-voltage relationships for the R352C (A) and R352Q (C) mutants in symmetrical 140 mM NaCl (2) and in the presence of the 10-fold NaCl gradient (O) as described in the legend of Figure 3A. Login to comment
212 (B and D) Single-channel recordings are shown for the R352C (B) and R352Q (D) mutants. Login to comment
227 FIGURE 7: A fraction of the current is carried by Na+ in the R352Q mutant but not in the wild type. Login to comment
232 (D) Single-channel current-voltage relationships for R352Q under the same ion gradients. Login to comment
235 Note the decreased current at positive potentials when NMDG+ replaces Na+ in the bath for the R352Q mutant (O vs 2), whereas there is no effect of this substitution for the wild type. Login to comment
244 In contrast, in the R352Q mutant, substitution of NMDG+ for Na+ caused rectification of the current-voltage relationship due to a unidirectional elimination of the contribution of Na+ to the single-channel conductance. Login to comment
259 The effect of this potential appears to be greater on cations than on anions because substitution of glutamine for arginine increased the Na+ conductance from an immeasurably low level in the wild type to about 1 pS in R352Q, whereas it only lowered the Cl-conductance by about 50%, i.e., from 6 to 3 pS (Figure 7). Login to comment

[hide] An alpha1-antitrypsin enhancer polymorphism is a g... Eur J Hum Genet. 2001 Apr;9(4):273-8. Henry MT, Cave S, Rendall J, O'Connor CM, Morgan K, FitzGerald MX, Kalsheker N
An alpha1-antitrypsin enhancer polymorphism is a genetic modifier of pulmonary outcome in cystic fibrosis.
Eur J Hum Genet. 2001 Apr;9(4):273-8., [PMID:11313771]

Abstract [show]
Lung disease is the direct cause of death in over 90% of cystic fibrosis (CF) patients. Excess neutrophil elastase is an important determinant of pulmonary disease in CF. alpha1-antitrypsin (AAT), also known as alpha1-proteinase inhibitor (alpha1PI) is a major modulator of elastase activity. We investigated the hypothesis that an enhancer polymorphism in the AAT gene would contribute to pulmonary prognosis in CF. Respiratory function, chest X-ray scores, bacterial colonisation and infective exacerbation were assessed to evaluate pulmonary disease severity in the CF group. Sixteen patients were found to have the 1237A allele, and 108 the more frequent G allele. Contrary to expectation, the patients with the 1237A allele were found to have better indices of pulmonary disease progression than those without, as indicated by less change in X-ray score (1237A: 0.2+/-0.1; 1237G: 1.2+/-0.1; P = 0.002) and fewer infective exacerbations (1237A: 2.8+/-0.6; 1237G: 4.6+/-0.3; P = 0.03) over the preceding 2 years. Also, a higher proportion of the 1237A (25%) than the 1237G (6.5%) were not colonised by Pseudomonas Aeruginosa (P = 0.04). Prospective monitoring of infections for a further 2 years confirmed a lesser propensity to infection in patients with the 1237A allele. These trends were also observed in a tightly matched sub-set of CF genotypes of similar age and sex, thus confirming that these effects were independent of the CF genotype. These results indicate that this AAT enhancer polymorphism is associated with better pulmonary prognosis in CF. Though the number of CF patients with the polymorphism is small, and these data need to be confirmed in larger studies, they suggest that a cautious approach should perhaps be taken to treatment of CF patients with supplemental AAT.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 1237G group: G551D (10); R117H (3); R560T (3); D1507 (2); E60X (2); N1303K (1); 1717-1 (1); 621H (1); G542X (1); POL 400 (1); R352Q (1); RT0F (1); 621+G4T (1); Unknown (15). Login to comment

[hide] Analysis of the entire coding region of the cystic... Hum Mutat. 2001 Aug;18(2):166. Castellani C, Gomez Lira M, Frulloni L, Delmarco A, Marzari M, Bonizzato A, Cavallini G, Pignatti P, Mastella G
Analysis of the entire coding region of the cystic fibrosis transmembrane regulator gene in idiopathic pancreatitis.
Hum Mutat. 2001 Aug;18(2):166., [PMID:11462247]

Abstract [show]
Many Cystic Fibrosis (CF) carriers have been detected testing some subjects with chronic pancreatitis for a limited number of mutations. The aim of this study was to find out if some subjects with pancreatitis and a CFTR mutation actually carry another, undetected mutation. We screened for 18 CFTR mutations plus the CFTR intron 8 poly(T) tract length a population of 67 patients suffering from idiopathic either acute, or recurrent acute, or chronic pancreatitis. Three of them were diagnosed as affected by CF. Among the others, a subset of 14 (8 CFTR mutation carriers, 4 5T carriers, and 2 sweat chloride borderliners) was selected and analyzed by denaturing gradient gel electrophoresis. Six possibly CF-related mutations were detected: L997F and 3878delG were found in two of the subjects already carrying another mutation, S1235R and L997F in one patient carrying the 5T, and L997F and D614G in the two patients with borderline sweat chloride. Among the 14 selected cases a total of 11 patients carried at least one mutation, and three of them were compound heterozygotes. Though it is debatable whether these three individuals can be considered affected by CF, their pancreatitis is possibly a clinical manifestation of some CFTR-related disease. Hum Mutat 18:166, 2001.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 Genetic analysis Phase 1 - Patients were tested for the following mutations: F508del, I507del, R117H, R1162X, 2183AA>G, N1303K, 3849+10KbC>T, G542X, 1717-1G>A, R347P, R352Q, R553X, Q552X, G85E, 711+5G>A, W1282X, 3132delTG and 2789+5G>A, plus the CFTR intron 8 poly(T) tract length. Login to comment
43 The same genetic screening, with the exception of the R347P, R352Q, R117H mutations and of the poly(T) variant, was performed in the control population. Login to comment

[hide] CFTR: covalent and noncovalent modification sugges... J Gen Physiol. 2001 Oct;118(4):407-31. Smith SS, Liu X, Zhang ZR, Sun F, Kriewall TE, McCarty NA, Dawson DC
CFTR: covalent and noncovalent modification suggests a role for fixed charges in anion conduction.
J Gen Physiol. 2001 Oct;118(4):407-31., [PMID:11585852]

Abstract [show]
The goal of the experiments described here was to explore the possible role of fixed charges in determining the conduction properties of CFTR. We focused on transmembrane segment 6 (TM6) which contains four basic residues (R334, K335, R347, and R352) that would be predicted, on the basis of their positions in the primary structure, to span TM6 from near the extracellular (R334, K335) to near the intracellular (R347, R352) end. Cysteines substituted at positions 334 and 335 were readily accessible to thiol reagents, whereas those at positions 347 and 352 were either not accessible or lacked significant functional consequences when modified. The charge at positions 334 and 335 was an important determinant of CFTR channel function. Charge changes at position 334--brought about by covalent modification of engineered cysteine residues, pH titration of cysteine and histidine residues, and amino acid substitution--produced similar effects on macroscopic conductance and the shape of the I-V plot. The effect of charge changes at position 334 on conduction properties could be described by electrodiffusion or rate-theory models in which the charge on this residue lies in an external vestibule of the pore where it functions to increase the concentration of Cl adjacent to the rate-limiting portion of the conduction path. Covalent modification of R334C CFTR increased single-channel conductance determined in detached patches, but did not alter open probability. The results are consistent with the hypothesis that in wild-type CFTR, R334 occupies a position where its charge can influence the distribution of anions near the mouth of the pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
146 (C) MTSEA produced a twofold increase in conductance in an oocyte expressing R352Q CFTR, which spontaneously reversed when MTSEA was removed from the perfusate. Login to comment
148 Changes of this magnitude are also seen in oocytes expressing R352Q or R352H CFTR, but were not seen in oocytes expressing wt CFTR. Login to comment
154 Importantly, we also obtained a transient response to the application of MTSEA in oocytes expressing R352Q CFTR (Fig. 5 C) or R352H CFTR (unpublished data). Login to comment
157 Guinamard and Akabas (1999) reported that substitutions for R352 (C, Q, and H) decreased the Cl-/Naϩ selectivity of CFTR as determined in detached patches (CHO cells), but we did not detect any alteration in the reversal potential associated with the expression of R352Q or H CFTR in oocytes. Login to comment

[hide] Cystic fibrosis mutation testing in Italy. Genet Test. 2001 Fall;5(3):229-33. Bombieri C, Pignatti PF
Cystic fibrosis mutation testing in Italy.
Genet Test. 2001 Fall;5(3):229-33., [PMID:11788089]

Abstract [show]
In Italy, Cystic fibrosis (CF) mutation frequency differences have been observed in different regions. In the northeastern Veneto and Trentino Alto Adige regions, a complete cystic fibrosis transmembrane conductance regulator (CFTR) gene screening in CF patients detected through a newborn screening program has identified about 90% of the mutations. In these two regions, the current detection rate using a CF screening panel containing the 16 most common mutations is 86.6%. CF mutations in some other Italian regions have not been so thoroughly analysed. Available data indicate that a more general national screening panel comprising 31 mutations may detect about 75% of all CF mutations in Italy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 CF GENE MUTATIONS IN ITALY Number of alleles Frequency Cumulative Mutation screened (%) frequency (%) DF508 3442 51.07 51.07 N1303K 3056 4.84 55.91 G542X 3082 4.83 60.75 2183 AA ® G 2596 2.66 63.41 R1162X 2580 2.42 65.83 1717-1 G ® A 2892 2.11 67.94 W1282X 2600 1.23 69.17 R553X 2882 1.15 70.31 T338I 2306 0.69 71.01 R347P 2642 0.61 71.61 711 1 5 G ® A 2454 0.57 72.18 G85E 1980 0.40 72.59 621 1 1 G ® T 2594 0.39 72.97 R334W 2366 0.30 73.27 R352Q 2112 0.24 73.50 S549N 2118 0.24 73.74 R347H 2184 0.18 73.92 L1077P 1840 0.16 74.09 R1158X 1878 0.16 74.25 541del C 1884 0.16 74.40 R1066H 1918 0.16 74.56 E585X 1922 0.16 74.72 Q552X 2172 0.14 74.86 D1152H 1824 0.11 74.97 2790-2 A ® G 1862 0.11 75.07 3132 del TG 1862 0.11 75.18 3667ins 4 1876 0.11 75.29 DI507 1914 0.10 75.39 1898 1 3 A ® G 1920 0.10 75.50 G1244E 1960 0.10 75.60 1784 del G 2052 0.10 75.69 From Rendine et al. (1997). Login to comment

[hide] Genetic and clinical features of false-negative in... Acta Paediatr. 2002;91(1):82-7. Padoan R, Genoni S, Moretti E, Seia M, Giunta A, Corbetta C
Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.
Acta Paediatr. 2002;91(1):82-7., [PMID:11883825]

Abstract [show]
A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. Conclusion: The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 Mutation Frequency (%) DelF508 54 N1303K 8 G542X 6.25 1717-1G ® A 2.50 R334W 1.75 2183AA ® G 1.50 R117H, L1077P, W1282X 1.25 D110E, R347P, E585X, 2789 ‡ 5G ® A 0.75 R352Q, R553X, R1066H, D1152H, R1158X, 1782delA, 1898 ‡ 1G ® A, 3659delC 0.50 G85E, R117L, G178R, D579G, H609R, Y1032C, V1153E, R1162X, 621 ‡ 1G ® T, 711 ‡ 1G ® T, 1845delAG o 1846delGA, 2143delT 0.25 Table2.Differencesinthethreestrategiesofneonatalscreening(audit1990-1999). Login to comment

[hide] Molecular determinants of Au(CN)(2)(-) binding and... J Physiol. 2002 Apr 1;540(Pt 1):39-47. Gong X, Burbridge SM, Cowley EA, Linsdell P
Molecular determinants of Au(CN)(2)(-) binding and permeability within the cystic fibrosis transmembrane conductance regulator Cl(-) channel pore.
J Physiol. 2002 Apr 1;540(Pt 1):39-47., 2002-04-01 [PMID:11927667]

Abstract [show]
Lyotropic anions with low free energy of hydration show both high permeability and tight binding in the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel pore. However, the molecular bases of anion selectivity and anion binding within the CFTR pore are not well defined and the relationship between binding and selectivity is unclear. We have studied the effects of point mutations throughout the sixth transmembrane (TM6) region of CFTR on channel block by, and permeability of, the highly lyotropic Au(CN)(2)(-) anion, using patch clamp recording from transiently transfected baby hamster kidney cells. Channel block by 100 microM Au(CN)(2)(-), a measure of intrapore anion binding affinity, was significantly weakened in the CFTR mutants K335A, F337S, T338A and I344A, significantly strengthened in S341A and R352Q and unaltered in K329A. Relative Au(CN)(2)(-) permeability was significantly increased in T338A and S341A, significantly decreased in F337S and unaffected in all other mutants studied. These results are used to define a model of the pore containing multiple anion binding sites but a more localised anion selectivity region. The central part of TM6 (F337-S341) appears to be the main determinant of both anion binding and anion selectivity. However, comparison of the effects of individual mutations on binding and selectivity suggest that these two aspects of the permeation mechanism are not strongly interdependent.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
12 Channel block by 100 mM Au(CN)2 _ , a measure of intrapore anion binding affinity, was significantly weakened in the CFTR mutants K335A, F337S, T338A and I344A, significantly strengthened in S341A and R352Q and unaltered in K329A. Login to comment
42 Some of these have previously been associated with altered anion selectivity (F337S, T338A; Linsdelletal.1998,2000),alteredanion:cationselectivity(R352Q; Guinamard & Akabas, 1999), or disrupted open channel blocker binding (S341A; McDonough et al. 1994). Login to comment
70 Block of PPi-stimulated wild-type and mutant CFTR Cl_ currents by Au(CN)2 _ A, example CFTR I-V relationships recorded from inside-out membrane patches from BHK cells transfected with wild-type (left) or R352Q-CFTR (right). Login to comment
72 The PPi-induced increase in current amplitude was significantly different from wild-type only in R352Q (* P < 0.001, Student`s two-tailed t test). Login to comment
80 In contrast, while only very small R352Q currents were recorded in the presence of PKA and ATP, currents were massively stimulated on addition of PPi (by an average of 26.3 ± 5.7-fold; Fig. 2A, B). Login to comment
81 Although single channel recordings were not carried out, this implies that the channel open probability for R352Q in the absence of PPi is very low (< 0.04). Login to comment
87 Comparison between different channel variants at _100 mV reveals the sensitivity to this concentration of Au(CN)2 _ is R352Q > S341A > wild-type, K329A > I344A > K335A = F337S > T338A. Login to comment
88 At depolarised voltages, where the blocking effects of 100 mM Au(CN)2 _ are weak, block of most mutants was not significantly different from wild-type; the only differences in Au(CN)2 _ sensitivity at +60 mV were R352Q > S341A > wild-type. Login to comment
89 Although block of PPi-stimulated channels by 100 mM Au(CN)2 _ was strongly voltage dependent in wild-type and most mutants, consistent with the 'conduction effect` of this anion (Linsdell & Gong, 2002), the strong inhibitory effects on R352Q were practically voltage independent. Login to comment
91 Together with the extreme stimulation of R352Q current by PPi (Fig. 2A and B), this suggests that we are unable to separate permeation from gating effects in this mutant and, as such, the potential role of R352Q in contributing to intrapore anion binding cannot be addressed in the present study. Login to comment
123 At this voltage, block by 100 mM Au(CN)2 _ was significantly weakened in K335A, F337S, T338A and I334A, significantly strengthened in S341A and R352Q and unaffected in K329A (Fig. 3). Login to comment
124 The sequence of relative sensitivity to block by 100 mM Au(CN)2 _ at _100 mV (R352Q > S341A > wild-type, K329A > I344A > K335A = F337S > T338A) suggests that T338 normally makes the strongest contribution to Au(CN)2 _ binding within the pore, with nearby residues K335 and F337 also making large contributions. Login to comment
128 As discussed in the text, the effects of R352Q cannot be confidently ascribed to open channel block and, as such, we are unable to determine the role of R352 in anion binding in the pore. Login to comment
154 Unfortunately, we were unable to test the role of TM6 residues more intracellular than I344 on anion binding; R347 was not studied because of its association with pore stability (Cotten & Welsh, 1999), T351A was not well expressed in BHK cells and the blocking effects of Au(CN)2 _ on R352Q most likely do not reflect open channel block. Login to comment

[hide] DHPLC screening of cystic fibrosis gene mutations. Hum Mutat. 2002 Apr;19(4):374-83. Ravnik-Glavac M, Atkinson A, Glavac D, Dean M
DHPLC screening of cystic fibrosis gene mutations.
Hum Mutat. 2002 Apr;19(4):374-83., [PMID:11933191]

Abstract [show]
Denaturing high performance liquid chromatography (DHPLC) using ion-pairing reverse phase chromatography (IPRPC) columns is a technique for the screening of gene mutations. In order to evaluate the potential utility of this assay method in a clinical laboratory setting, we subjected the PCR products of 73 CF patients known to bear CFTR mutations to this analytic technique. We used thermal denaturation profile parameters specified by the MELT program tool, made available by Stanford University. Using this strategy, we determined an initial analytic sensitivity of 90.4% for any of 73 known CFTR mutations. Most of the mutations not detected by DHPLC under these conditions are alpha-substitutions. This information may eventually help to improve the MELT algorithm. Increasing column denaturation temperatures for one or two degrees above those recommended by the MELT program allowed 100% detection of CFTR mutations tested. By comparing DHPLC methodology used in this study with the recently reported study based on Wavemaker 3.4.4 software (Transgenomic, Omaha, NE) [Le Marechal et al., 2001) and with previous SSCP analysis of CFTR mutations [Ravnik-Glavac et al., 1994] we emphasized differences and similarities in order to refine the DHPLC system and discuss the relationship to the alternative approaches. We conclude that the DHPLC method, under optimized conditions, is highly accurate, rapid, and efficient in detecting mutations in the CFTR gene and may find high utility in screening individuals for CFTR mutations. Hum Mutat 19:374-383, 2002. Published 2002 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X. Login to comment

[hide] Determination of the relative contribution of thre... Eur J Hum Genet. 2002 Feb;10(2):100-6. Audrezet MP, Chen JM, Le Marechal C, Ruszniewski P, Robaszkiewicz M, Raguenes O, Quere I, Scotet V, Ferec C
Determination of the relative contribution of three genes-the cystic fibrosis transmembrane conductance regulator gene, the cationic trypsinogen gene, and the pancreatic secretory trypsin inhibitor gene-to the etiology of idiopathic chronic pancreatitis.
Eur J Hum Genet. 2002 Feb;10(2):100-6., [PMID:11938439]

Abstract [show]
In the last 5 years, mutations in three genes, the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the pancreatic secretory trypsin inhibitor (PSTI) gene, have been found to be associated with chronic pancreatitis (CP). In this study, using established mutation screening methods, we systematically analysed the entire coding sequences and all exon/intron junctions of the three genes in 39 patients with idiopathic CP (ICP), with a view to evaluating the relative contribution of each gene to the aetiology of the disease. Our results demonstrate that, firstly, 'gain-of-function' mutations in the PRSS1 gene may occasionally be found in an obvious ICP subject. Secondly, presumably 'loss-of-function' mutations in the PSTI gene appear to be frequent, with a detection rate of at least 10% in ICP and, finally, abnormal CFTR alleles are common: at least 20% of patients carried one of the most common CFTR mutations, and about 10% of patients were compound heterozygotes, having at least one 'mild' allele. Thus, in total, about 30% of ICP patients carried at least one abnormal allele in one of the three genes, and this is the most conservative estimate. Moreover, a trans-heterozygous state with sequence variations in the PSTI/CFTR genes was found in three patients. However, an association between the 5T allele in intron 8 of the CFTR gene and ICP remains unproven.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 `Gain-of-function' PRSS1 mutations are rare in ICP While PRSS1 mutations are often found in patients with hereditary pancreatitis, they can also be identified in subjects with ICP, albeit with an exceptionally low Table 1 Sequence variations identified in the PRSS1, PSTI, and CFTR genes in 39 patients with ICP CFTR Patient PRSS1 PSTI Mutant PolyT 1 ± a ± ± 7T/7T 2 ± ± F508del/R352Q 9T/7T 3 ± ± F508del/P5L 9T/7T 4 ± ± c.4575+2G4A 9T/7T 5 ± ± ± 7T/7T 6 ± N34Sb ± 7T/7T 7 ± ± ± 7T/5T 8 ± ± F508del/Q1476X 9T/7T 9 ± ± ± 7T/7T 10 ± ± ± 7T/7T 11 ± ± ± 7T/7T 12 ± ± ± 7T/7T 13 ± ± V562I 7T/5T 14 ± ± 2C4A W1282X 7T/5T 15 ± ± IVS3-6T4C 7T/7T 16 R122H ± ± 7T/7T 17 ± ± ± 9T/7T 18 ± ± ± 7T/5T 19 ± ± ± 7T/7T 20 ± N34S/N34S ± 7T/7T 21 ± ± ± 9T/5T 22 ± ± ± 7T/7T 23 ± ± E217G/A1136T 9T/7T 24 ± ± ± 7T/7T 25 ± ± ± NDc 26 ± ± ± ND 27 ± N34S IVS18 ± 20T4C 9T/7T 28 ± ± F508del 9T/7T 29 ± ± ± 7T/7T 30 ± ± N1303K ND 31 ± ± G542X 9T/7T 32 ± ± ± 7T/5T 33 ± ± F508del 9T/7T 34 ± ± 41G4Ad ± 7T/7T 35 ± ± ± 9T/7T 36 ± ± ± 9T/7T 37 ± ± ± 7T/7T 38 ± N34S L967S 7T/7T 39 ± ± ± 7T/5T a Indicates two wild alleles. Login to comment
85 Firstly, we found a total of 10 additional alleles (R352Q, P5L, c.4575+2G4A, V562I, IVS3-6T4C, E217G/A1136T, IVS18-20T4C, and L967S; Table 1) that would have been missed by the conventional genotyping method. Login to comment
87 For example, R352Q, P5L, and A1136T occur in strictly conserved residues (refer to Figure 2 in Chen et al33 ). Login to comment
88 In particular, R352Q is within the stringently conserved motif T351-R352- Q353, which is immediately downstream of TM6 and has been suggested to loop back into the chloride channel, narrowing the lumen and thereby forming both the major resistance to current flow and the anion selectivity filter;34 A1136T is within TM12; c.4575+2G4A, occurring just two nucleotides downstream of the translation stop codon, may affect the interplay between splicing and polyadenylation or alter the mRNA stability; Q1476X is a nonsense mutation. Login to comment

[hide] Genotype-phenotype correlation in cystic fibrosis:... Am J Med Genet. 2002 Jul 22;111(1):88-95. Salvatore F, Scudiero O, Castaldo G
Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes.
Am J Med Genet. 2002 Jul 22;111(1):88-95., 2002-07-22 [PMID:12124743]

Abstract [show]
More than 1,000 mutations have been identified in the cystic fibrosis (CF) transmembrane regulator (CFTR) disease gene. The impact of these mutations on the protein and the wide spectrum of CF phenotypes prompted a series of Genotype-Phenotype correlation studies. The CFTR genotype is invariably correlated with pancreatic status-in about 85% of cases with pancreatic insufficiency and in about 15% of cases with pancreatic sufficiency. The correlations between the CFTR genotype and pulmonary, liver, and gastrointestinal expression are debatable. The heterogeneous phenotype in CF patients bearing the same genotype or homozygotes for nonsense mutations implicated environmental and/or genetic factors in the disease. However, the discordant phenotype observed in CF siblings argued against a major role of environmental factors and suggested that genes other than CFTR modulate the CF phenotype. A locus that modulates gastrointestinal expression was identified in mice and subsequently in humans. By analyzing nine CF patients discordant for meconium ileus we were able to show that this locus had a dominant effect. Moreover, in a collaborative study we found a higher rate of polymorphisms in beta-defensin genes 1 and 2 in CF patients and in controls. In another multicenter study mutations in alpha-1 antitrypsin (A1AT) and mannose binding lectin genes were found to be independent risk factors for liver disease in CF patients. The body of evidence available suggests that the variegated CF phenotype results from complex interactions between numerous gene products.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994]. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

[hide] Germline mutations in CFTR and PSTI genes in chron... Dig Dis Sci. 2002 Nov;47(11):2416-21. Gaia E, Salacone P, Gallo M, Promis GG, Brusco A, Bancone C, Carlo A
Germline mutations in CFTR and PSTI genes in chronic pancreatitis patients.
Dig Dis Sci. 2002 Nov;47(11):2416-21., [PMID:12452372]

Abstract [show]
Mutations in the cationic trypsinogen, cystic fibrosis transmembrane conductance regulator (CFTR) and pancreatic secretory trypsinogen inhibitor (PSTI) genes have recently been associated with chronic pancreatitis. This paper investigates the frequency of CFTR and PSTI gene mutation in patients with idiopathic and alcoholic chronic pancreatitis, the clinical course of patients with these two kinds of disease, and examines the clinical differences between carriers and noncarriers of mutation. In idiopathic pancreatitis a significant increase was found in mutation frequency both in the CFTR gene (13%) and N34S mutation in the PSTI gene (3.9%), as well as an increase in familial disposition to pancreatic disorders. In alcohol-induced pancreatitis an increase in calcification, exocrine insufficiency, and diabetes mellitus was observed. In conclusions, mutations in the genes investigated are involved in causing idiopathic pancreatitis. Such mutations have no connection either with the age at onset or the clinical course of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 All mutations (W1282X, N187K, R352Q, ⌬F508, R75Q, R31C, 621ϩ2T-ϾG, I197V, K68N, R1162X) were found in heterozygotes, indicating that these patients are carriers of a single mutation. Login to comment
78 PATIENTS CARRYING THE CFTR MUTATION* Pt Sex Age (yr) Age at onset (yr) Alcohol (g/day)† Familial CFTR mutations Exocrine insufficiency Diabetes mellitus(Յ10) (10-40) (40-80) T.B. M 59 23 (Յ10) No W1282X Yes No B.G. M 40 29 (Յ10) Yes N187K No No E.P. M 40 34 (Յ10) No R352Q No Yes D.N. M 53 47 (10-40) No R75Q Yes No R.L. F 57 44 (Յ10) No R31C No No T.F. M 56 *‡ (Յ10) No 621 ϩ 2T 3 G Yes No F.G. M 54 46 (10-40) No I197V Yes No V.M. M 65 *† (10-40) No K68N Yes No B.L. F 57 56 (10-40) Yes ⌬F508 No Yes T.G. M 25 24 (Յ10) No R1162X No No *This table shows the characteristics of chronic pancreatitis patients, carriers of CFTR mutations. Login to comment
88 Four mutations were found in patients with mild forms of CF (R31C, K68N, R75Q, and R352Q). Login to comment

[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]

Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 Firstly, the National Centre for Medical Genetics, Dublin performed an analysis of the most common CFTR mutations, using the ARMS test (Ferrie et al., 1992), which enables the detection of the following mutations: F508del, R117H, I507del, G542X, G551D, R560T, N1303K, R352Q, 1717-1G>A and 621+1G>T. Login to comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment
98 Number Frequency Number Frequency 1652_1655del 3 bp F508del 966 76.5% 226 81.3% 1192 77.4% 1784G>A G551D 82 6.5% 27 9.7% 109 7.1% 482G>A R117H 38 3.0% 4 1.4% 42 2.7% 1811G>C R560T 30 2.4% 2 0.7% 32 2.1% 621+1G>T 21 1.7% 21 1.4% 1648_1653delATC I507del 10 0.8% 1 0.4% 11 0.7% 1717-1G>A 9 0.7% 9 0.6% 1756G>T G542X 8 0.6% 8 0.5% 1187G>A R352Q 3 0.2% 2 0.7% 5 0.3% 1461ins4 5 0.4% 5 0.3% 4041C>G N1303K 5 0.4% 5 0.3% 310G>T E60X 4 0.3% 4 0.3% 1690G>T V520F 4 0.3% 4 0.3% 3007delG 4 0.3% 4 0.3% 3272-26A>G 2 0.2% 2 0.7% 4 0.3% 386G>A G85E 3 0.2% 3 0.2% 3849+10kbC>T 3 0.2% 3 0.2% Unidentified Unidentified 41 3.2% 11 4.0% 52 3.4% Total Total 1262 100.0% 278 100.0% 1540 100.0% Dublin cohort Cork cohort Ireland Amino acid change Nucleotide change We noted similar high frequencies of the F508del and G551D mutations in the three cohorts studied. Login to comment

[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

[hide] Genotype/phenotype correlation of the G85E mutatio... Eur Respir J. 2004 May;23(5):679-84. Decaestecker K, Decaestecker E, Castellani C, Jaspers M, Cuppens H, De Boeck K
Genotype/phenotype correlation of the G85E mutation in a large cohort of cystic fibrosis patients.
Eur Respir J. 2004 May;23(5):679-84., [PMID:15176679]

Abstract [show]
In this European study, the phenotype in 68 patients, homozygous or compound heterozygous for the G85E mutation, was investigated. Each index case was compared with two cystic fibrosis (CF) patients from the same clinic, matched for age and sex: one with pancreatic sufficiency (PS) and one with pancreatic insufficiency (PI). When comparing 31 G85E/F508del and F508del/F508del patients, there were no differences in median age at diagnosis, mean sweat chloride value, most recent weight for height, most recent forced expiratory volume in one second % predicted, prevalence of chronic Pseudomonas aeruginosa colonisation and typical CF complications. However, PI was less frequent in the G85E/F508del group. Comparison of 55 G85E patients (with second mutation known and not classified as mild) with PS controls (n=44) showed that the G85E patients had a significantly higher sweat chloride, more often failure to thrive at diagnosis, higher prevalence of PI, worse current weight for height, higher prevalence of chronic P. aeruginosa colonisation and liver cirrhosis. Pulse-chase experiments revealed that G85E cystic fibrosis transmembrane conductance regulator failed to mature on a M470 as well as on a V470 background. Therefore, G85E is a class II mutation. Although there is variability in its clinical presentation, G85E mutation results in a severe phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 1 G85E/W496X 1 F508del# /N1303K# 1 G85E/N1303K# 1 T388I/R1158X 1 G85E/711z5GRA} 1 3272-26AwG} /E822X 1 G85E/R334W} 1 F508del# /R334W} 1 Total 68 574delA/2789z5GRA 1 F508del# /3272-26ARG} 1 F508del# /R352Q 1 F508del# /3272-26AwG} 1 R334W} /444delA 1 L206W/3272-26ARG} 1 F508del# /F508del# 1 L206W/? Login to comment

[hide] Use of fecal elastase-1 to classify pancreatic sta... J Pediatr. 2004 Sep;145(3):322-6. Borowitz D, Baker SS, Duffy L, Baker RD, Fitzpatrick L, Gyamfi J, Jarembek K
Use of fecal elastase-1 to classify pancreatic status in patients with cystic fibrosis.
J Pediatr. 2004 Sep;145(3):322-6., [PMID:15343184]

Abstract [show]
OBJECTIVE: To test the hypothesis that some patients with cystic fibrosis (CF) are misclassified as pancreatic insufficient, using fecal elastase-1 (FE-1) to define pancreatic status. STUDY DESIGN: Subjects with CF at 33 CF centers filled out questionnaires and submitted a stool specimen that was analyzed for FE-1. Subjects taking pancreatic enzyme supplements (PES) were asked to discontinue them and perform a 3-day fecal fat balance study if their FE-1 was >200 microg/g stool and they had never had pancreatitis. RESULTS: The median value for FE-1 in 1215 subjects was 0 microg/g stool (range, 0-867). There was a significant difference between patients who had been prescribed PES (n=1131) and those who had FE-1 <200 microg/g stool (n=1074; P<.0001). Sixty-seven subjects met criteria for discontinuation of PES. The mean coefficient of fat absorption for these subjects was 96.1%. CONCLUSIONS: FE-1 is an accurate, easily obtained screening test to classify pancreatic status in patients with CF. This information is important for prognostication, treatment, and to avoid misclassification in clinical research. Measurement of FE-1 should become a standard of care for patients with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
116 FE-1 values in subjects with CFTR mutations associated with pancreatic sufficiency11 N Mean (mg/g stool) Median (mg/g stool) Range (mg/g stool) Subjects with at least one PS allele* FE-1 >200 mg/g stool 16 584 582.9 349-773 FE-1 <200 mg/g stool 5 64.4 74.8 0-125 Subjects with at least one PS variable alleley FE-1>200 mg/g stool 29 496.2 493.6 224-798 FE-1 <200 mg/g stool 13 76.1 65.9 0-187 *Pancreatic sufficient dominant CF alleles G551S R117H R347H P574H R334W R352Q T3381 yVariable pancreatic sufficient CF mutations G85E 3849 + 10 kb C fi T R347P 2789 + 5G fi A A455E In summary, FE-1 is an accurate, easily obtained screening test to classify patients with CF as PI or PS. Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment

[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]

Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment

[hide] The role of cystic fibrosis gene mutations in dete... Gastroenterol Clin North Am. 2004 Dec;33(4):817-37, vii. Cohn JA, Mitchell RM, Jowell PS
The role of cystic fibrosis gene mutations in determining susceptibility to chronic pancreatitis.
Gastroenterol Clin North Am. 2004 Dec;33(4):817-37, vii., [PMID:15528020]

Abstract [show]
This article reviews current concepts regarding the pathobiology of cystic fibrosis pancreatic disease. It summarizes recent studies on the relationship between CFTR mutations and pancreatitis, and it reviews several unresolved issues in the field.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 The European data Table 1 Abnormal CFTR and PSTI genotypes detected in two studies of idiopathic chronic pancreatitis* CFTR genotype category N Genotypes detected in individual subjects US study (Noone et al [47]) CFsev / CFm-v compound heterozygotes 8 DF508 / R117H-7T**; DF508 / 5T; DF508 / 5T; DF508 / D1152H; DF508 / D1152H; DF508 / P574H; DF508 / 3120G>A; 621þ1G>T/G1069R CFm-v / CFm-v compound heterozygotes 1 5T / 5T** CFsev / - (CF carriers) 1 N1303K / - CFm-v / - 7 R117H-7T / -; 5T / -**; 5T / -; 5T / -; 5T / -; 5T / -; 5T / - Normal (- / -) CFTR genotype 22 1 was homozygous for the N34S PSTI mutation; 5 were N34S carriers European study (Audrezet et al [50]) CFsev / CFm-v compound heterozygotes 4 DF508/R352Q; DF508/P5L; DF508/Q1476X; W1282X/5T*** CFm-v / CFm-v compound heterozygotes 2 V562I/5T; E217G/A1136T CFsev / - (CF carriers)**** 3 DF508 / -; DF508 / -; G542X / - CFm-v / - 9 L967S/-**; IVS18-20T>C/-**; c.4575þ2G>A/-; IVS3-6T>C; 5T/-; 5T/-; 5T/-; 5T/-; 5T/- Normal (- / -) CFTR genotype 17 1 was homozygous for the N34S PSTI mutation; 1 was a N34S carrier * CFTR mutations were classified as causing either severe (CFsev ) or mild-variable loss-of-function (CFm-v ) [18,47]; all detected CFsev mutations are CF-causing mutations according to current consensus criteria [79]. Login to comment

[hide] The impact of cystic fibrosis and PSTI/SPINK1 gene... Clin Lab Med. 2005 Mar;25(1):79-100. Cohn JA, Mitchell RM, Jowell PS
The impact of cystic fibrosis and PSTI/SPINK1 gene mutations on susceptibility to chronic pancreatitis.
Clin Lab Med. 2005 Mar;25(1):79-100., [PMID:15749233]

Abstract [show]
This article reviews current concepts regarding the pathobiology of cystic fibrosis pancreatic disease. It summarizes recent studies on the relationship between CFTR mutations and pancreatitis, and it reviews several unresolved issues in the field.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
90 Table 1 Abnormal CFTR and PSTI genotypes detected in two studies of idiopathic chronic pancreatitis* CFTR genotype category N Genotypes detected in individual subjects US study (Noone et al [47]) CFsev / CFm-v compound heterozygotes 8 DF508 / R117H-7T**; DF508 / 5T; DF508 / 5T; DF508 / D1152H; DF508 / D1152H; DF508 / P574H; DF508 / 3120G>A; 621þ1G>T/G1069R CFm-v / CFm-v compound heterozygotes 1 5T / 5T** CFsev / - (CF carriers) 1 N1303K / - CFm-v / - 7 R117H-7T / -; 5T / -**; 5T / -; 5T / -; 5T / -; 5T / -; 5T / - Normal (- / -) CFTR genotype 22 1 was homozygous for the N34S PSTI mutation; 5 were N34S carriers European study (Audrezet et al [50]) CFsev / CFm-v compound heterozygotes 4 DF508/R352Q; DF508/P5L; DF508/Q1476X; W1282X/5T*** CFm-v / CFm-v compound heterozygotes 2 V562I/5T; E217G/A1136T CFsev / - (CF carriers)**** 3 DF508 / -; DF508 / -; G542X / - CFm-v / - 9 L967S/-**; IVS18-20T>C/-**; c.4575þ2G>A/-; IVS3-6T>C; 5T/-; 5T/-; 5T/-; 5T/-; 5T/- Normal (- / -) CFTR genotype 17 1 was homozygous for the N34S PSTI mutation; 1 was a N34S carrier * CFTR mutations were classified as causing either severe (CFsev ) or mild-variable loss-of-function (CFm-v ) [18,47]; all detected CFsev mutations are CF-causing mutations according to current consensus criteria [79]. Login to comment

[hide] Cystic fibrosis: an overview. J Clin Gastroenterol. 2005 Apr;39(4):307-17. Turcios NL
Cystic fibrosis: an overview.
J Clin Gastroenterol. 2005 Apr;39(4):307-17., [PMID:15758625]

Abstract [show]
Cystic fibrosis (CF) is one of the most common inherited disorders of white populations. The isolation and cloning of the gene in CF that encodes the production of a transport protein that acts as an apical membrane chloride channel, termed cystic fibrosis transmembrane conductance regulator (CFTR), have improved our understanding of the disorder's pathophysiology and has aided diagnosis, but has also revealed the disease's complexity. Gene replacement therapy is still far from being used in patients with CF, mostly because of difficulties in targeting the appropriate cells. Life expectancy of patients with this disorder has greatly improved over past decades because of better symptomatic treatment strategies. This article summarizes advances in understanding and treatment of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 A R352Q T3381 may mimic biliary atresia. Login to comment

[hide] Reduced CFTR function and the pathobiology of idio... J Clin Gastroenterol. 2005 Apr;39(4 Suppl 2):S70-7. Cohn JA
Reduced CFTR function and the pathobiology of idiopathic pancreatitis.
J Clin Gastroenterol. 2005 Apr;39(4 Suppl 2):S70-7., [PMID:15758663]

Abstract [show]
Idiopathic chronic pancreatitis (ICP) is the leading cause of chronic pancreatitis in children and nonalcoholic adults. The risk of developing ICP is increased in individuals who have mutations of the cystic fibrosis gene (CFTR) and of a trypsin inhibitor gene (PSTI). In studies from the United States and France, the risk of ICP is increased about 40-fold by having two abnormal copies of the CFTR gene, about 14-fold by having the N34S PSTI mutation, and about 500-fold by having both. When ICP patients have two abnormal copies of the CFTR gene, there is also evidence of reduced residual CFTR protein function in extrapancreatic tissues based on clinical findings and nasal ion transport responses. Thus, pancreatitis risk is highest in individuals who have abnormalities in both the pancreatic ducts (CFTR) and acini (PSTI). These findings indicate that PSTI is a modifier gene for CFTR-related ICP and have implications for the diagnosis and pathogenesis of pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 Abnormal CFTR and PSTI Genotypes Detected in Two Studies of ICP CFTR Genotype Category* N Genotypes Detected in Individual Subjects U.S. study (Noone et al47 ) CFsev / CFm-v compound heterozygotes 8 DF508 / R117H-7T †; DF508 / 5T; DF508 / 5T; DF508 / D1152H; DF508 / D1152H; DF508 / P574H; DF508 / 3120G.A; 621 + 1G.T/G1069R CFm-v / CFm-v compound heterozygotes 1 5T / 5T † CFsev / 2 (CF carriers) 1 N1303K / 2 CFm-v / 2 7 R117H-7T / 2; 5T / 2 †; 5T / 2; 5T / 2; 5T / 2; 5T / 2; 5T / 2 Normal (2 / 2) CFTR genotype 22 1 was homozygous for the N34S PSTI mutation; 5 were N34S carriers French study (Audrezet et al50 ) CFsev / CFm-v compound heterozygotes 4 DF508/R352Q; DF508/P5L; DF508/Q1476X; W1282X/5T‡ CFm-v / CFm-v compound heterozygotes 2 V562I/5T; E217G/A1136T CFsev / 2 (CF carriers)§ 3 DF508 / 2; DF508 / 2; G542X / 2 CFm-v / 2 9 L967S/2 †; IVS18-20T.C/ 2†; c.4575+2G.A/2; IVS3-6T.C; 5T/2; 5 /2; 5T/ 2; 5T/2; 5T/ 2 Normal (2 / 2) CFTR genotype 17 1 was homozygous for the N34S PSTI mutation; 1 was a N34S carriers *Mutations of the cystic fibrosis (CF) gene (CFTR) were classified as causing either severe (CFsev ) or mild-variable loss-of-function (CFm-v )18,47 ; all detected CFsev mutations are CF-causing mutations according to current consensus criteria.68 In the U.S. study, most patients were tested for rare mutations by DNA sequencing47 ; in the French study, most patients were tested by dHPL.50 †These patients were also carriers for the N34S mutation of a trypsin inhibitor gene (PSTI). Login to comment

[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]

Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T. Login to comment

[hide] Association of common haplotypes of surfactant pro... Pediatr Pulmonol. 2006 Mar;41(3):255-62. Choi EH, Ehrmantraut M, Foster CB, Moss J, Chanock SJ
Association of common haplotypes of surfactant protein A1 and A2 (SFTPA1 and SFTPA2) genes with severity of lung disease in cystic fibrosis.
Pediatr Pulmonol. 2006 Mar;41(3):255-62., [PMID:16429424]

Abstract [show]
Most individual cystic fibrosis transmembrane conductance regulator (CFTR) mutations appear not to correlate directly with severity of lung damage in cystic fibrosis (CF). Components of innate immunity, namely, mannose-binding lectin (MBL2), and surfactant protein A1 and A2 genes (SFTPA1 and SFTPA2), were shown to be critical in pulmonary host defenses. A pilot association study was conducted to identify genetic modifiers of lung disease in adult patients with CF. The structural and promoter (-221x/y) variants of MBL2, variants at codons 19, 50, 62, and 219 of SFTPA1, and at codons 9, 91, and 223 for SFTPA2, were studied in 135 adults with CF and compared to their forced expired volume in 1 sec (FEV1), diffusion of CO (DLCO), and other pulmonary scores. Predicted FEV1 was significantly lower in adults with the SFTPA1 6A3 allele and SFTPA2 1A1) allele (P = 0.01 and 0.009, respectively). The extended haplotype 6A3/1A1, which includes SFTPA1 and SFTPA2, was associated with lower pulmonary function, using FEV1 (P = 0.005) and poor pulmonary scores which were determined by American Medical Association, American Thoracic Society, and modified Shwachman-Kulczycki scores. Lower FEV1 and DLCO values were associated with MBL2 coding variants in those who had the DeltaF508 CFTR mutation (P = 0.03 and 0.004, respectively). These results support the current hypothesis that variants in pulmonary host defense molecules are potentially genetic modifiers of pulmonary disease in CF. Further work in larger populations is required to provide important new insights into the pathogenesis of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Complementary mutations were identified in 51 CF subjects: R117H (4), R347H (1), R347P (1), G542X (7), G551D (4), 1717-1G-A (2), 2789 þ 5G > A(3), 3120 þ 1G > A (2), 3659delC (3), 3849 þ 10kbC>T (6), 394delTT (1), 621 þ 1G>T (4), 711 þ 1G > T (1), G85E (1), I507 (1), N1303K (2), R352Q (1), R553X (2), R560T (1), and W1282X (4). Login to comment

[hide] Positive charges at the intracellular mouth of the... J Gen Physiol. 2006 Nov;128(5):535-45. Epub 2006 Oct 16. Aubin CN, Linsdell P
Positive charges at the intracellular mouth of the pore regulate anion conduction in the CFTR chloride channel.
J Gen Physiol. 2006 Nov;128(5):535-45. Epub 2006 Oct 16., [PMID:17043152]

Abstract [show]
Many different ion channel pores are thought to have charged amino acid residues clustered around their entrances. The so-called surface charges contributed by these residues can play important roles in attracting oppositely charged ions from the bulk solution on one side of the membrane, increasing effective local counterion concentration and favoring rapid ion movement through the channel. Here we use site-directed mutagenesis to identify arginine residues contributing important surface charges in the intracellular mouth of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel pore. While wild-type CFTR was associated with a linear current-voltage relationship with symmetrical solutions, strong outward rectification was observed after mutagenesis of two arginine residues (R303 and R352) located near the intracellular ends of the fifth and sixth transmembrane regions. Current rectification was dependent on the charge present at these positions, consistent with an electrostatic effect. Furthermore, mutagenesis-induced rectification was more pronounced at lower Cl(-) concentrations, suggesting that these mutants had a reduced ability to concentrate Cl(-) ions near the inner pore mouth. R303 and R352 mutants exhibited reduced single channel conductance, especially at negative membrane potentials, that was dependent on the charge of the amino acid residue present at these positions. However, the very low conductance of both R303E and R352E-CFTR could be greatly increased by elevating intracellular Cl(-) concentration. Modification of an introduced cysteine residue at position 303 by charged methanethiosulfonate reagents reproduced charge-dependent effects on current rectification. Mutagenesis of arginine residues in the second and tenth transmembrane regions also altered channel permeation properties, however these effects were not consistent with changes in channel surface charges. These results suggest that positively charged arginine residues act to concentrate Cl(-) ions at the inner mouth of the CFTR pore, and that this contributes to maximization of the rate of Cl(-) ion permeation through the pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 To investigate the role of the charge on these residues in controlling I-V shape, these two arginines were also mutated to neutral glutamine residues; as shown in Fig. 3, R303Q and R352Q were also associated with outward rectification, although in both cases the degree of rectification observed was significantly less than with the charge-changing glutamate substitutions. Login to comment
75 (B) The degree of rectification in R303E, R303Q, and R352Q is dependent on the Cl- concentra- tion. Login to comment
149 Under these conditions, current carried not only by wild-type CFTR, but also by each of the channel mutants R303E, R352E (Fig. 10), R80E, R242E, R933E, R1102E, and R352Q (not depicted) showed reversal potentials that were not significantly different from the calculated Cl- equilibrium potential (+33.4 mV). Login to comment
184 Furthermore, rectification in R303Q and R303E appeared more sensitive to the intracellular Cl-concentration than in R352Q and R352E (Fig. 3 B). Login to comment
206 Examples of similar data obtained from three to four patches for these channel variants and also for R80E, R242E, R352Q, R933E, and R1102E (not depicted). Login to comment
208 R134Q is associated with outward rectification (Fig. 10, A and B); however, this effect shows a complex Cl-dependence that, unlike that of R303E, R303Q, and R352Q (Fig. 3 B), is not consistent with a simple surface charge effect. Furthermore, R134Q shows an extremely small apparent unitary conductance (Fig. 10 C). Login to comment

[hide] CFTR mutations in Turkish and North African cystic... Genet Test. 2008 Mar;12(1):25-35. Lakeman P, Gille JJ, Dankert-Roelse JE, Heijerman HG, Munck A, Iron A, Grasemann H, Schuster A, Cornel MC, Ten Kate LP
CFTR mutations in Turkish and North African cystic fibrosis patients in Europe: implications for screening.
Genet Test. 2008 Mar;12(1):25-35., [PMID:18373402]

Abstract [show]
AIMS: To obtain more insight into the variability of the CFTR mutations found in immigrant cystic fibrosis (CF) patients who are living in Europe now, and to estimate the test sensitivity of different frequently used methods of DNA analysis to detect CF carriers or patients among these Turkish or North African immigrants. METHODS: A survey among 373 European CF centers asking which CFTR mutations had been found in Turkish and North African CF patients. RESULTS: 31 and 26 different mutations were reported in Turkish and North African patients, identifying 64.2% (113/176) and 87.4% (118/135) alleles, respectively (p < 0.001). The mean sensitivity (detection rate) of three most common CFTR mutation panels to detect these mutations differed between Turkish and North African people, 44.9% (79/176) versus 69.6% (94/135) (p < 0.001), and can be increased to 57.4% (101/176) and 79.3% (107/135) (p < 0.001), respectively, by expanding these panels with 13 mutations which have been found on two or more alleles. CONCLUSION: 35.8% and 12.6%, respectively, of CF alleles in Turkish and North African patients living in Europe now had not been identified. Among these populations, the test sensitivity of common CFTR mutation panels is insufficient for use in screening programs in Europe, even after expansion with frequent Turkish and North African mutations. This raises questions about whether and how to implement CF carrier and neonatal screening in a multiethnic society.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 Identity and Frequency of CFTR Mutations on Unrelated Turkish (Tr) and North African (NA) CF alleles Total number of allelesa Number of CF patients with this mutationb Mutation Exon All Tr NA Homozygote Compound heterozygote: two mutations found Compound heterozygote: one mutation found F508delc 10 73 33 40 27 11 6 N1303K 21 22 12 10 10 5 2 711 þ 1G > T Intron 5 14 - 14 7 2 0 G542X 11 14 6 8 7 1 0 R1162X 19 11 - 11 1 5 2 2183AA > G 13 9 9 - 3 3 1 W1282X 20 7 3 4 2 3 1 2789 þ 5G > A Intron 14b 6 3 3 1 4 1 L227R 6a 4 - 4 3 1 0 1677delTA 10 4 4 - 2 1 1 2184insA 13 4 4 - 1 2 0 R334W 7 4 4 - 1 1 1 G85E 3 4 3 1 1 2 0 R709X 13 3 - 3 2 0 0 L732X 13 3 3 - 2 0 0 2184delA 13 3 3 - 0 3 0 del exon 1-4d 1-4 3 3 - 1 1 0 del exon 19 19 2 2 - 2 0 0 3849 þ 10kbC > T Intron 19 2 - 2 1 0 0 S549N 11 2 1 1 0 1 1 3120 þ G > A Intron 16 2 2 - 1 0 0 3601-2A > G Intron 18 2 2 - 1 0 0 D1152H 18 2 2 - 1 0 0 E1104X 17b 2 - 2 1 0 0 S1159F 19 2 2 - 1 0 0 S977F 16 2 - 2 0 1 0 2347delG 13 2 - 2 1 0 0 4096-3C > G Intron 21 1 1 - 1 0 0 E831X 14a 1 1 - 1 0 0 L619S 13 1 1 - 1 0 0 1525-1G > Ac Intron 9 1 1 - 1 0 0 F1052V 17b 1 1 - 1 0 0 3130delA 17a 1 1 - 1 0 0 R352Q 7 1 - 1 0 1 0 1812-1G > A Intron 11 1 - 1 0 1 0 R553X 11 1 - 1 0 0 1 IVS8-5T Intron 8 1 1 - 0 1 0 R1066C 17b 1 - 1 0 1 0 3129del4 17a 1 - 1 0 1 0 D110H 4 1 1 - 0 1 0 R117H 4 1 - 1 0 1 0 S945L 15 1 - 1 0 1 0 1716G=A 10 1 - 1 0 0 1 711 þ 3A > G Intron 5 1 1 - 0 1 0 R75X 3 1 1 - 0 1 0 R764X 13 1 - 1 0 1 0 S1196X 19 1 1 - 0 1 0 S492F 10 1 - 1 0 1 0 G551D 11 1 - 1 1 0 0 del exon 2 2 1 1 - 1 0 0 Subtotal 231 113 118 - No mutation 80 63 17 - Total 311 176 135 88 60 18 a n ¼ 311 alleles, based on 166 CF patients (332 alleles) with both parents and 22 CF patients (22 alleles) with one parent from Turkey or North Africa, minus 43 alleles of homozygous CF patients with consanguineous parents of whom only one allele was taken into account. Login to comment

[hide] Mutations at arginine 352 alter the pore architect... J Membr Biol. 2008 Mar;222(2):91-106. Epub 2008 Apr 18. Cui G, Zhang ZR, O'Brien AR, Song B, McCarty NA
Mutations at arginine 352 alter the pore architecture of CFTR.
J Membr Biol. 2008 Mar;222(2):91-106. Epub 2008 Apr 18., [PMID:18421494]

Abstract [show]
Arginine 352 (R352) in the sixth transmembrane domain of the cystic fibrosis transmembrane conductance regulator (CFTR) previously was reported to form an anion/cation selectivity filter and to provide positive charge in the intracellular vestibule. However, mutations at this site have nonspecific effects, such as inducing susceptibility of endogenous cysteines to chemical modification. We hypothesized that R352 stabilizes channel structure and that charge-destroying mutations at this site disrupt pore architecture, with multiple consequences. We tested the effects of mutations at R352 on conductance, anion selectivity and block by the sulfonylurea drug glipizide, using recordings of wild-type and mutant channels. Charge-altering mutations at R352 destabilized the open state and altered both selectivity and block. In contrast, R352K-CFTR was similar to wild-type. Full conductance state amplitude was similar to that of wild-type CFTR in all mutants except R352E, suggesting that R352 does not itself form an anion coordination site. In an attempt to identify an acidic residue that may interact with R352, we found that permeation properties were similarly affected by charge-reversing mutations at D993. Wild-type-like properties were rescued in R352E/D993R-CFTR, suggesting that R352 and D993 in the wild-type channel may interact to stabilize pore architecture. Finally, R352A-CFTR was sensitive to modification by externally applied MTSEA+, while wild-type and R352E/D993R-CFTR were not. These data suggest that R352 plays an important structural role in CFTR, perhaps reflecting its involvement in forming a salt bridge with residue D993.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Three cystic fibrosis (CF)-associated mutations have been identified at this position (R352G, R352W and R352Q), but the mechanisms by which these mutations cause disease are not clear (Cremonesi et al. 1992; Audre´zet et al. 1993; Brancolini et al. 1995). Login to comment
100 Surprisingly, mutation R352Q also resulted in sensitivity to MTSEA+ , suggesting that loss of positive charge at position 352 caused an endogenous cysteine to become available for modification, perhaps reflecting loss of gross pore structure. Login to comment
111 Both R352A- and R352Q-CFTR showed three distinct open conductance states: s1, s2 and f.In contrast to WT-CFTR, channels formed by R352A- and R352Q-CFTR occupied the s1 and s2 states in the vast majority of open bursts, while transitions to the f conductance state were rare events. Login to comment
113 The transitions between the three open states in R352A- and R352Q-CFTR were random, showing no regular pattern. Login to comment
122 0 0.0 -0.4 -0.8 #ofevents 4000 -1.2 0.0 -0.4 -0.8 6000 #ofevents 0 -1.2 0.0 -0.4 -0.8 3000 #ofevents 0 -1.2 2500 #ofevents 0.0 -0.4 -0.8 0 -1.2 Current (pA) fc s1 s2 s1 s2 B C D A 0.4 pA 2 s c s1 s2 f R352A 0.4 pA 2 s 0.4 pA 2 s c s1 s2 f c f 0.4 pA 2 s c f WT R352Q R352K 00 s1 s2 s1 s2 Fig. 1 Sample traces of WT-CFTR and indicated R352 mutants from excised inside-out membrane patches with symmetrical 150 mM Cl- solution (left) and their all-points amplitude histograms (right). Login to comment
124 In R352A- and R352Q-CFTR, there are four current levels indicating the c, s1, s2 and f states. Login to comment
134 Figure 4 shows the i-V relationship for the f conductance states of WT-, R352A-, R352Q- and R352K-CFTR (Fig. 4B) and for the subconductance states of R352A- and R352Q-CFTR (Fig. 4C), at potentials ranging between VM = -100 and +100 mV. Login to comment
136 The f state slope conductance in R352Q-CFTR was slightly reduced at both negative and positive membrane potentials. Login to comment
139 The single-channel conductance of the f state exhibited significant outward rectification in R352A-, R352Q- and R352E-CFTR (Table 1). Login to comment
141 Shown in the top trace is a single record for R352Q-CFTR in a patch with low open probability, VM = -80 mV. Login to comment
156 The normalization of relative conductances between the different anions tested likely f 0.2 pA 2 s -100mV -80mV -60mV -40mV 0.2 pA 2 s -100mV -80mV - - pA - - s1 s2 c s1 s2 f c s1 s2 f c f cA B C WT -CFTR R352Q R352A R352K WT -CFTR R352Q R352A R352K mV -100 -50 50 100 -0.8 -0.4 0.4 0.8 pA mV -100 -50 50 100 0.4 0.2 -0.2 -0.4 pA0.6 -0.6 -100 -50 50 100 0.4 0.2 -0.2 -0.4 0.6 -0.6 -100 -50 50 100 0.4 0.2 -0.2 -0.4 0.6 -0.6 R352Q s1 R352Q s2 R352A s1 R352A s2 R352Q s1 R352Q s2 f 0.2 pA 2 s -100mV -80mV -60mV -40mV - - pA - - 0.2 pA 2 s -100mV -80mV - - Fig. 4 Sample traces of R352A-CFTR and i-V relationships of the conducting states of WT-CFTR and R352 mutants. Login to comment
159 (B) Single-channel i-V relationships for f conductance states of R352A-, R352Q- and R352K-CFTR, with WT-CFTR for comparison. Login to comment
161 (C) The i-V relationship of the s1 and s2 subconductance states of R352A- and R352Q-CFTR. Login to comment
162 Slope conductances are summarized in Table 1 Table 1 Slope conductancea (in pS) of the f state of WT-CFTR and multiple single and double mutants CFTR n Negative VM Positive VM WT 7 6.82 ± 0.03 6.97 ± 0.06 R352A 6 6.80 ± 0.06 7.85 ± 0.07*, ** R352Q 6 5.29 ± 0.02* 6.28 ± 0.05*, ** R352K 5 6.87 ± 0.03 6.86 ± 0.01 R352E 5 3.78 ± 0.01* 6.03 ± 0.01*, ** R352E/E873R 6 3.84 ± 0.01* 5.64 ± 0.01*, ** R352E/ E1104R 6 4.36 ± 0.01* 5.86 ± 0.02*, ** R352E/D993R 5 5.90 ± 0.02* 6.44 ± 0.01*, ** D993R 7 8.27 ± 0.05* 7.13 ± 0.07** a Slope conductance indicates single-channel conductance calculated from 0 to +100 mV (positive VM) or to -100 mV (negative VM) by linear regression * P B 0.001 compared to the equivalent slope conductance in WT-CFTR, ** P B 0.001 compared to the slope conductance in the same mutant at negative VM reflects the loss of anion binding properties within the core of the permeation pathway, which contributes to the tight binding of SCN (Smith et al. 1999). Login to comment
186 In summary, mutations at R352 that destroyed the positive charge (R352A, R352E and R352Q) altered the pore architecture of CFTR and caused instability of the open state, changing anion selectivity and pore block by glipizide. Login to comment
230 Surprisingly, similar results were found in R352Q-CFTR, suggesting that the response to MTSEA+ in R352C-CFTR was nonspecific, not being due to modification of that engineered cysteine. Login to comment
246 First, channels bearing charge-destroying mutations at this site, including R352Q, R352E and R352A, exhibited instability of the open state compared to WT-CFTR, as indicated by frequent transitions between all three open conductance states (s1, s2, f). Login to comment
281 Several R352 mutations are CF-associated mutations, including R352G, R352W and R352Q (Cremonesi et al. 1992; Audre´zet et al. 1993; Brancolini et al. 1995; Feldmann et al. 2003); similarly, D993Y and D993G are associated with disease (Tsui et al. 2007). Login to comment

[hide] Clinical and radiological outcome of patients suff... Pancreas. 2008 Nov;37(4):371-6. Frulloni L, Scattolini C, Graziani R, Cavestro GM, Pravadelli C, Amodio A, Manfredi R, Scarpa A, Vantini I
Clinical and radiological outcome of patients suffering from chronic pancreatitis associated with gene mutations.
Pancreas. 2008 Nov;37(4):371-6., [PMID:18953248]

Abstract [show]
OBJECTIVES: Cystic fibrosis transmembrane conductance regulator (CFTR), cationic trypsinogen gene (PRSS1), and serine protease inhibitor kazal type 1 (SPINK1) gene mutations have been associated with chronic pancreatitis (CP). The aim of this study was to compare clinical and radiological findings in sporadic CP with (CPgm) and without (CPwt) gene mutations. METHODS: Data from patients observed between 2001 and 2006 were collected. All patients were tested for 25 CFTR gene mutations, for R122H and N29I on the PRSS1 gene, and for N34S mutation on the SPINK1 gene. RESULTS: We found 34 (17.2%) of 198 patients with CPgm, 23 (11.6%) of them on the CFTR gene, 11 (5.6%) on the SPINK1, and none on the PRSS1 gene. The age at clinical onset was younger in CPgm (36.2 +/- 17.2 years) than in CPwt (44 +/- 12.6 years; P = 0.005). There were more heavy drinkers among CPwt (33%) than among CPgm (9%; P = 0.003), and the same applied to smokers (69% vs 33%, respectively; P < 0.0001). In CPgm group, the onset of pancreatic calcifications was observed more frequently in drinkers and/or smokers. Exocrine and endocrine insufficiency occurred less frequently and later in CPgm than in CPwt patients. CONCLUSIONS: Clinical and radiological outcome differ in CPgm compared with CPwt. Alcohol, even in small quantities, and cigarette smoking influence the onset of pancreatic calcifications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 All patients were tested for 25 CFTR gene mutations ($F508, $I507, R117H, R1162X, 2183AAYG, N1303K, 3849 + 10KbCYT, G542X, G551D, 1717-1GYA, R347P, R352Q, R553X, Q552X, G85E, 711 + 5GYA, W1282X, 3272-26AYG, 3132delTG, R334W, I148T, 3659del_C, 3120 + 1GYA, 1898 + 1GYA, and 2789 + 5GYA), which cover approximately 72% of the cystic fibrosis mutations in the Italian population. Login to comment

[hide] Phenotypic characterisation of patients with inter... Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23. Goubau C, Wilschanski M, Skalicka V, Lebecque P, Southern KW, Sermet I, Munck A, Derichs N, Middleton PG, Hjelte L, Padoan R, Vasar M, De Boeck K
Phenotypic characterisation of patients with intermediate sweat chloride values: towards validation of the European diagnostic algorithm for cystic fibrosis.
Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23., [PMID:19318346]

Abstract [show]
BACKGROUND: In patients with symptoms suggestive of cystic fibrosis (CF) and intermediate sweat chloride values (30-60 mmol/l), extensive CFTR gene mutation analysis and nasal potential difference (NPD) measurement are used as additional diagnostic tests and a positive result in either test provides evidence of CFTR dysfunction. To define the phenotype of such patients and confirm the validity of grouping them, patients with intermediate sweat chloride values in whom either additional CF diagnostic test was abnormal were compared with subjects in whom this was not the case and patients with classic CF. METHODS: The phenotypic features of four groups were compared: 59 patients with CFTR dysfunction, 46 with an intermediate sweat chloride concentration but no evidence of CFTR dysfunction (CF unlikely), 103 patients with CF and pancreatic sufficiency (CF-PS) and 62 with CF and pancreatic insufficiency (CF-PI). RESULTS: The CFTR dysfunction group had more lower respiratory tract infections (p = 0.01), more isolation of CF pathogens (p<0.001) and clubbing (p = 0.001) than the CF unlikely group, but less frequent respiratory tract infections with CF pathogens than the CF-PS group (p = 0.05). Patients in the CF-PS group had a milder phenotype than those with PI. Many features showed stepwise changes through the patient groups. CONCLUSION: Patients with intermediate sweat chloride values and two CFTR mutations or an abnormal NPD measurement have a CF-like phenotype compatible with CFTR dysfunction and, as a group, differ phenotypically from patients with intermediate sweat chloride values in whom further CF diagnostic tests are normal as well as from CF-PS and CF-PI patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Table 2 CFTR mutations in the patient subgroups CF-PS CFTR dysfunction CF unlikely Genotype Subjects (n) Genotype Subjects (n) Genotype Subjects (n) F508del*/Not found 12 F508del*/3849+10 kb(C.T){ 11 Not found/Not found 39 Not found/Not found 10 F508del*/R117H{ 7 F508del*/Not found 4 F508del*/3849+10 kb(C.T){ 7 F508del*/Not found 7 IVS8-5T{/Not found 1 F508del*/R347P{ 5 Not found/Not found 5 S1235E/E528E 1 F508del*/R117H{ 4 F508del*/D1152H{ 4 No mutation analysis 1 F508del*/2789+5G.A{ 4 F508del*/IVS8-5T{ 4 Total 46 F508del*/S945L* 3 F508del*/S945L* 2 2789+5G.A{/Not found 3 W1282X*/IVS8-5T{ 2 F508del*/3272-26 A.G{ 2 F508del*/R1070W{ 1 F508del*/A455E{ 2 F508del*/L159S 1 F508del*/711+5G.A 2 F508del*/T1246I 1 F508del*/2789+5G.A 2 F508del*/L165S 1 G542X*/R334W{ 2 W1282X*/D1152H{ 1 F508del*/R334W{ 2 R1162X*/D1152H{ 1 R347P{/Not found 2 R347Hu/D1152H{ 1 F508del*/2116delCTAA 1 R553X*/R117H{ 1 F508del*/IVS8-5T{ 1 3659delC*/R117H{ 1 F508del*/D1152H{ 1 3849+10kb(C.T){/G551R 1 F508del*/711+3A.G 1 R1162X*/3849+10 kb(C.T){ 1 F508del*/L206W{ 1 2789+5G.A{/Not found 1 F508del*/I336K{ 1 G542X*/T854A 1 F508del*/G970D 1 R553X*/Q1463H 1 F508del*/L159S 1 S1235R/R668C 1 F508del*/R751L 1 2789+5G.A{/S977F 1 F508del*/E656X 1 No mutation analysis 1 F508del*/4015delA 1 Total 59 F508del*/Y913S 1 F508del*/L165S 1 F508del*/2143delT 1 G551D*/I336K{ 1 G551D*/3272-26A.G{ 1 G551D*/711+3A.G 1 R553X*/4005+2T.C 1 R553X*/E92K{ 1 G542X*/L206W{ 1 W1282X*/I336K 1 R1162X*/3849+10 kb(C.T){ 1 R1162X*/2789+5G.A{ 1 574delA*/3141del9 1 9890X/I105N 1 R334W{/R1070Q{ 1 3272-26A.G{/4218insT 1 3272-26A.G{/L165S 1 711+3A.G/G1244E 1 R352Q/1812-1G.A 1 F1052V/IVS8-5T{ 1 R74W/D1270N 1 1898-3G.A/1898-3G.A 1 1717-1G.A*/R334W{ 1 3659delC*/Not found 1 394delTT/Not found 1 R1162X*/Not found 1 R553X*/Not found 1 R117H{/Not found 1 G85E*/Not found 1 3849+10k(C.T){/Not found 1 Total 103 *Mutation class I, II or III. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Biochemistry. 2009 Oct 27;48(42):10078-88. Alexander C, Ivetac A, Liu X, Norimatsu Y, Serrano JR, Landstrom A, Sansom M, Dawson DC
Cystic fibrosis transmembrane conductance regulator: using differential reactivity toward channel-permeant and channel-impermeant thiol-reactive probes to test a molecular model for the pore.
Biochemistry. 2009 Oct 27;48(42):10078-88., 2009-10-27 [PMID:19754156]

Abstract [show]
The sixth transmembrane segment (TM6) of the CFTR chloride channel has been intensively investigated. The effects of amino acid substitutions and chemical modification of engineered cysteines (cysteine scanning) on channel properties strongly suggest that TM6 is a key component of the anion-conducting pore, but previous cysteine-scanning studies of TM6 have produced conflicting results. Our aim was to resolve these conflicts by combining a screening strategy based on multiple, thiol-directed probes with molecular modeling of the pore. CFTR constructs were screened for reactivity toward both channel-permeant and channel-impermeant thiol-directed reagents, and patterns of reactivity in TM6 were mapped onto two new, molecular models of the CFTR pore: one based on homology modeling using Sav1866 as the template and a second derived from the first by molecular dynamics simulation. Comparison of the pattern of cysteine reactivity with model predictions suggests that nonreactive sites are those where the TM6 side chains are occluded by other TMs. Reactive sites, in contrast, are generally situated such that the respective amino acid side chains either project into the predicted pore or lie within a predicted extracellular loop. Sites where engineered cysteines react with both channel-permeant and channel-impermeant probes occupy the outermost extent of TM6 or the predicted TM5-6 loop. Sites where cysteine reactivity is limited to channel-permeant probes occupy more cytoplasmic locations. The results provide an initial validation of two, new molecular models for CFTR and suggest that molecular dynamics simulation will be a useful tool for unraveling the structural basis of anion conduction by CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
182 In those experiments, however, qualitatively identical, reversible reactivity toward MTSEAþ was also seen using either R352Q/wt or R352H/wt CFTR constructs, suggesting that the target of MTSEAþ was 1 of the 18 endogenous cysteines in the R352C/wt protein (7). Login to comment

[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT. Login to comment

[hide] Cystic fibrosis genotype and assessing rates of de... Radiology. 2009 Dec;253(3):813-21. Cleveland RH, Zurakowski D, Slattery D, Colin AA
Cystic fibrosis genotype and assessing rates of decline in pulmonary status.
Radiology. 2009 Dec;253(3):813-21., [PMID:19952026]

Abstract [show]
PURPOSE: To evaluate the hierarchical phenotypic expression of cystic fibrosis transmembrane conductance regulator (CFTR) genotypes in the respiratory system as has been documented in the pancreas. MATERIALS AND METHODS: This study was institutional review board approved; informed consent was not required. HIPAA guidelines were followed. Genotype effects were assessed by using chest radiographic and pulmonary function test (PFT) results in 93 patients. Serial chest radiographic and PFT (percentage of predicted forced expiratory volume in 1 second [FEV(1)], percentage of predicted forced vital capacity [FVC]) results were compared by using analysis of variance with repeated measures. By using CFTR class of mutations, two groups were created: group S (severe disease) and group M (mild disease). Within group S, three subgroups were created: A consisted of patients with two class I alleles; B, class I allele and class II or III allele; C, class II allele and class II or III allele. Group M consisted of patients with at least one allele from class IV-VI. RESULTS: Within group S, subgroup A had a faster deterioration than B or C according to radiographic data (A vs B, P = .014; A vs C, P = .009), with only a borderline difference in FEV(1) for subgroups A versus C (P = .031). Otherwise, PFTs were not sensitive for distinguishing subgroups. Only radiographic results identified that subgroup B had faster progression than C (P = .003); all parameters had trends of decline in the same direction. Group S had a faster decline than group M (radiography, P = .005; FVC, P = .011; FEV(1), P = .529). CONCLUSION: Disease progressed more rapidly with gene class hierarchical correlations seen in pancreatic disease. Radiography was more sensitive for identifying differences.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Measurement Tools All chest radiographic, FEV1, and FVC studies were performed at the study institution during the observed life spans Table 2 Patients according to CF Genotype Group Parameter Genotype Class Pancreatic Exocrine Status* No. of Patients Group S (severe pancreatic and pulmonary phenotypes) Subgroup A (class I and class I) 5 G542X/W1282X I/I PI 2 W1282X/W1282X I/I PI 1 621ϩ1G-T/Y1092X I/I PI 1 3120ϩ1G-A/3120ϩ1G-A I/I PI 1 Subgroup B (class I and class II or III) 16 G542X/⌬F508 I/II PI 6 W1282X/⌬F508 I/II PI 3 Q493X/⌬F508 I/II PI 2 R553X/⌬F508 I/II PI 2 1717-1G/⌬F508 I/II PI 1 621ϩ1G-T/⌬F508 I/II PI 1 2184delA/G551D I/III PI 1 Subgroup C (class II and class II or III) 68 D1507/⌬F508 II/II PI 3 N1303K/⌬F508 II/II PI 2 ⌬F508/⌬F508 II/II PI 57 G551D/⌬F508 II/III PI 6 Group M (mild pancreatic and pulmonary phenotypes) Miscellaneous severe and miscellaneous mild 4 ⌬F508/G85E II/IV PS 2 ⌬F508/R117H II/IV PS 1 D1507/R352Q II/IV PS 1 Miscellaneous mild and miscellaneous mild . Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

[hide] Measurement of nasal potential difference in young... Thorax. 2010 Jun;65(6):539-44. Sermet-Gaudelus I, Girodon E, Roussel D, Deneuville E, Bui S, Huet F, Guillot M, Aboutaam R, Renouil M, Munck A, des Georges M, Iron A, Thauvin-Robinet C, Fajac I, Lenoir G, Roussey M, Edelman A
Measurement of nasal potential difference in young children with an equivocal sweat test following newborn screening for cystic fibrosis.
Thorax. 2010 Jun;65(6):539-44., [PMID:20522854]

Abstract [show]
BACKGROUND: A challenging problem arising from cystic fibrosis (CF) newborn screening is the significant number of infants with hypertrypsinaemia (HIRT) with sweat chloride levels in the intermediate range and only one or no identified CF-causing mutations. OBJECTIVES: To investigate the diagnostic value for CF of assessing CF transmembrane conductance regulator (CFTR) protein function by measuring nasal potential difference in children with HIRT. METHODS: A specially designed protocol was used to assess nasal potential difference (NPD) in 23 young children with HIRT (3 months-4 years) with inconclusive neonatal screening. Results were analysed with a composite score including CFTR-dependent sodium and chloride secretion. Results were correlated with genotype after extensive genetic screening and with clinical phenotype at follow-up 3 years later. RESULTS: NPD was interpretable for 21 children with HIRT: 13 had NPD composite scores in the CF range. All 13 were finally found to carry two CFTR mutations. At follow-up, nine had developed a chronic pulmonary disease consistent with a CF diagnosis. The sweat test could be repeated in nine children, and six had sweat chloride values >or=60 mmol/l. Of the eight children with normal NPD scores, only two had two CFTR mutations, both wide-spectrum mutations. None had developed a CF-like lung disease at follow-up. The sweat test could be reassessed in five of these eight children and all had sweat chloride values <60 mmol/l. CF diagnosis was ruled out in six of these eight children. CONCLUSION: Evaluation of CFTR function in the nasal epithelium of young children with inconclusive results at CF newborn screening is a useful diagnostic tool for CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
130 Table 3 Genotypes of the children with HIRT according to the diagnostic score cut-off in the 21 patients with reliable NPD tests; results after extensive genetic analysis CFTR genotypes Diagnosis score >0.27 (8 patients) £0.27 (13 patients) A/A 0 F508del/621+3A/G F508del/Q1291R A/AB F508del/R347H F508del/R117H;T7 W846X/R117C n¼2 F508del/R1070W 2183AA/G/L206W F508del/3272-26A/G F508del/R117H;T7; n¼4 A/D 0 F508del/R933G G551D/R352Q B/D G622D/3849+45G/A 0 A/0 F508del/0 n¼2 0 0/0 3 0 0, no identified mutation; A, CF-causing mutation; B, mutation associated with cystic CFTR-related disorders; C, mutation with no clinical consequence ; D, mutation of unknown or uncertain clinical relevance; AB, mutation that is associated with a wide phenotypic spectrum that might belong to either group A or B. CFTR, cystic fibrosis transmembrane conductance regulator; HIRT, hypertrypsinaemia; NPD, nasal potential difference. Login to comment

[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
123 CFTR mutationsa Individuals, n p.F508del/p.R117H 16 5T/9T 1 7T/9T 15 p.F508del/p.D1152H 3 p.R117H/p.R117H, 7T/7T 2 p.D1152H/p.D1152H 2 p.W1282X/p.D1152H 2 p.D1152H/p.G551D 1 c.3717ϩ12191CϾT/p.R352Q 1 c.3717ϩ12191CϾT/c.3717ϩ12191CϾT 1 p.F508del/c.3717ϩ12191CϾT 1 p.F508del/p.L206W 1 p.F508del/p.R117C 1 p.F508del/p.R347H 1 p.F508del/p.R347P 1 p.R117H/p.W1282X, 7T/7T 1 p.R117H/p.G551D, 7T/7T 1 p.R117H/p.G542X, 7T/9T 1 a Human Genome Variation Society nomenclature [Ogino et al. (23)]. Login to comment

[hide] Pathology of pancreatic and intestinal disorders i... J R Soc Med. 1998;91 Suppl 34:40-9. Wilschanski M, Durie PR
Pathology of pancreatic and intestinal disorders in cystic fibrosis.
J R Soc Med. 1998;91 Suppl 34:40-9., [PMID:9709387]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
152 A small number of more Table 1 Classification of cystic fibrosis gene mutation as severe, mild or indeterminate with respect to pancreatic function Severe Mild Variable (classes 1, I/ or 111) (classes IV or V) (classes IV or V) AF508 R117H G85E 1148T R334W 2789+5G-*A G480C R347P G551D A455E R560T P574H N1303K 3849+1 Okb C-+T G542X G551S W1282X P5748 621 +1 G-T R352Q 1717-1G-T T3381 556delA Adapted from Ref 20 with permission recently described mutations [G85E and 278+5G-÷AI are less clearly determinant with respect to the pancreatic sufficient and pancreatic insufficient phenotypes. Login to comment

[hide] Validation of double gradient denaturing gradient ... Clin Chem. 1999 Jan;45(1):35-40. Cremonesi L, Carrera P, Fumagalli A, Lucchiari S, Cardillo E, Ferrari M, Righetti SC, Zunino F, Righetti PG, Gelfi C
Validation of double gradient denaturing gradient gel electrophoresis through multigenic retrospective analysis.
Clin Chem. 1999 Jan;45(1):35-40., [PMID:9895335]

Abstract [show]
Among established techniques for the identification of either known or new mutations, denaturing gradient gel electrophoresis (DGGE) is one of the most effective. However, conventional DGGE is affected by major drawbacks that limit its routine application: the different denaturant gradient ranges and migration times required for different DNA fragments. We developed a modified version of DGGE for high-throughput mutational analysis, double gradient DGGE (DG-DGGE), by superimposing a porous gradient over the denaturant gradient, which maintains the zone-sharpening effect even during lengthy analyses. Because of this innovation, DG-DGGE achieves the double goals of retaining full effectiveness in the detection of mutations while allowing identical run time conditions for all fragments analyzed. Here we use retrospective analysis of a large number of well-characterized mutations and polymorphisms, spanning all predicted melting domains and the whole genomic sequence of three different genes--the cystic fibrosis transmembrane conductance regulator (CFTR), the beta-globin, and the p53 genes--to demonstrate that DG-DGGE may be applied to the rapid scanning of any sequence variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Mutations and polymorphisms analyzed in the CFTR gene. Position Denaturant gradient Mutation Exon 1 40-90% 125G/Ca,b M1V (A3G at 133) 175insT 182delT Exon 3 10-60% W57G (T3G at 301) 356G/Aa G85E (G3A at 386) Exon 4 20-70% R117H (G3A at 482) 541delC 621ϩ1G3T I148T (T3C at 575) Exon 5 20-70% E193K (G3A at 709) Intron 5 20-70% 711ϩ3A3G Exon 7 20-70% 1078delT R334W (C3T at 1132) T338I (C3T at 1145) R347P (G3C at 1172)b R347H (G3A at 1172) R352Q (G3A at 1187) Exon 10 20-70% M470V (1540A/G)a ⌬F508 (del 3 bp at 1652) Intron 10 10-60% 1717-1G3A Exon 11 10-60% G542X (G3T at 1756) 1784delG R553X (C3T at 1789) Exon 12 10-60% D579G (A3G at 1868) E585X (G3T at 1885) Intron 12 10-60% 1898ϩ3A3G Exon 13 30-80% 2183AA3G E730X (G3T at 2320) L732X (T3G at 2327) 2347delG Exon 14a 10-60% T854T (2694T/G)a V868V (2736G/A)a Intron 14b 30-80% 2789ϩ5G3A Exon 15 20-70% M952I (G3C at 2988)b Exon 17a 20-70% L997F (G3C at 3123)b Exon 17b 20-70% F1052V (T3G at 3286) R1066C (C3T at 3328) R1066H (G3A at 3329) A1067T (G3A at 3331) Exon 18 20-70% D1152H (G3C at 3586)b Exon 19 30-80% R1158X (C3T at 3604) Exon 20 20-70% S1251N (G3A at 3384) W1282X (G3A at 3978) Exon 21 20-70% N1303K (C3G at 4041)b Exon 22 30-80% G1349D (G3A at 4178) 4382delA Exon 24 30-80% Y1424Y (4404C/T)a a Polymorphism. Login to comment

[hide] Nonintegral stoichiometry in CFTR gating revealed ... J Gen Physiol. 2012 Oct;140(4):347-59. Epub 2012 Sep 10. Jih KY, Sohma Y, Hwang TC
Nonintegral stoichiometry in CFTR gating revealed by a pore-lining mutation.
J Gen Physiol. 2012 Oct;140(4):347-59. Epub 2012 Sep 10., [PMID:22966014]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is a unique member of the ATP-binding cassette (ABC) protein superfamily. Unlike most other ABC proteins that function as active transporters, CFTR is an ATP-gated chloride channel. The opening of CFTR's gate is associated with ATP-induced dimerization of its two nucleotide-binding domains (NBD1 and NBD2), whereas gate closure is facilitated by ATP hydrolysis-triggered partial separation of the NBDs. This generally held theme of CFTR gating-a strict coupling between the ATP hydrolysis cycle and the gating cycle-is put to the test by our recent finding of a short-lived, post-hydrolytic state that can bind ATP and reenter the ATP-induced original open state. We accidentally found a mutant CFTR channel that exhibits two distinct open conductance states, the smaller O1 state and the larger O2 state. In the presence of ATP, the transition between the two states follows a preferred O1-->O2 order, a telltale sign of a violation of microscopic reversibility, hence demanding an external energy input likely from ATP hydrolysis, as such preferred gating transition was abolished in a hydrolysis-deficient mutant. Interestingly, we also observed a considerable amount of opening events that contain more than one O1-->O2 transition, indicating that more than one ATP molecule may be hydrolyzed within an opening burst. We thus conclude a nonintegral stoichiometry between the gating cycle and ATP consumption. Our results lead to a six-state gating model conforming to the classical allosteric mechanism: both NBDs and transmembrane domains hold a certain degree of autonomy, whereas the conformational change in one domain will facilitate the conformational change in the other domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
166 We introduced the R352Q mutation into the Cysless/ I344C-CFTR channel. Login to comment
167 Before MESET modification, Cysless/I344C/R352Q mutant channels behaved similarly as Cysless/R352C-CFTR in the presence of ATP (Fig. 5 A). Login to comment
170 After MTSET modification of Cysless/I344C/R352Q, we indeed observed robust ATP-independent openings (Fig. 5 B) with an open lifetime of 1.03 ± 0.30 s (n = 10), the R352C-CFTR (Fig. S2). Login to comment
171 Correspondingly, the percentage of opening bursts encompassing more than one O1→O2 transition is higher in Cysless/R352C (Table 1). Login to comment
177 Representative traces and amplitude histograms for Cysless/ I344C/R352Q-CFTR under these conditions: (A) in the presence of 2.75 mM ATP; (B-C) after MTSET modification, in the absence (B) or presence (C) of 2.75 mM ATP. Login to comment
179 (E) The amplitude of O1 and O2 states of Cysless/I344C/R352Q-CFTR before (the left bar) or after (the right bar) being modified by MTSET. Login to comment
168 Before MESET modification, Cysless/I344C/R352Q mutant channels behaved similarly as Cysless/R352C-CFTR in the presence of ATP (Fig. 5 A). Login to comment
178 Representative traces and amplitude histograms for Cysless/ I344C/R352Q-CFTR under these conditions: (A) in the presence of 2.75 mM ATP; (B-C) after MTSET modification, in the absence (B) or presence (C) of 2.75 mM ATP. Login to comment
180 (E) The amplitude of O1 and O2 states of Cysless/I344C/R352Q-CFTR before (the left bar) or after (the right bar) being modified by MTSET. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]

Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

[hide] Cystic fibrosis mutations for p.F508del compound h... Clin Genet. 2012 Dec;82(6):546-551. doi: 10.1111/j.1399-0004.2011.01804.x. Epub 2011 Nov 29. Sebro R, Levy H, Schneck K, Dimmock D, Raby B, Cannon C, Broeckel U, Risch N
Cystic fibrosis mutations for p.F508del compound heterozygotes predict sweat chloride levels and pancreatic sufficiency.
Clin Genet. 2012 Dec;82(6):546-551. doi: 10.1111/j.1399-0004.2011.01804.x. Epub 2011 Nov 29., [PMID:22035343]

Abstract [show]
Sebro R, Levy H, Schneck K, Dimmock D, Raby BA, Cannon CL, Broeckel U, Risch NJ. Cystic fibrosis mutations for p.F508del compound heterozygotes predict sweat chloride levels and pancreatic sufficiency. Cystic fibrosis (CF) is a monogenetic disease with a complex phenotype. Over 1500 mutations in the CFTR gene have been identified; however, the p.F508del mutation is most common. There has been limited correlation between the CFTR mutation genotype and the disease phenotypes. We evaluated the non-p.F508del mutation of 108 p.F508del compound heterozygotes using the biological classification method, Grantham and Sorting Intolerant from Tolerant (SIFT) scores to assess whether these scoring systems correlated with sweat chloride levels, pancreatic sufficiency, predicted FEV(1) , and risk of infection with Pseudomonas aeruginosa in the last year. Mutations predicted to be 'mild' by the biological classification method are associated with more normal sweat chloride levels (p < 0.001), pancreatic sufficiency (p < 0.001) and decreased risk of infection with Pseudomonas in the last year (p = 0.014). Lower Grantham scores are associated with more normal sweat chloride levels (p < 0.001), and pancreatic sufficiency (p = 0.014). Higher SIFT scores are associated with more normal sweat chloride levels (p < 0.001) and pancreatic sufficiency (p = 0.011). There was no association between pulmonary function measured by predicted FEV(1) and the biological classification (p = 0.98), Grantham (p = 0.28) or SIFT scores (p = 0.62), which suggests the pulmonary disease related to CF may involve other modifier genes and environmental factors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 CFTR mutation classification for compound heterozygotesa Mutations n (%) Biological classification Grantham score SIFT Q493X 3 (3) Ib - - G542X 21 (20) Ib,c,e - - R553X 4 (4) Ib,e - - Y1092X 2 (2) Ib - - R1158X 1 (1) NA - - W1282X 9 (9) Ib,e - - G85E 4 (4) IIIb 98 0.01 R117H 4 (4) IVb,c 29 0.60 R334W 1 (1) IVb 101 0.02 R347P 1 (1) IVb 103 0.05 R352Q 1 (1) NA 43 0.35 G551D 20 (19) IIIb,c 94 0.00 R560T 3 (3) IIIb 71 0.00 D1270N 1 (1) NA 23 0.01 N1303K 6 (6) IIg 94 0.00 I507del 3 (3) IId - - 394delTT 1 (1) NAc - - 621+1G>T 7 (7) Ib,f - - 711+1G>T 2 (2) Ib - - 1717-1G>A 5 (5) Ib,c,e,f - - 1898+1G>A 2 (2) NA - - 2789+5G>A 3 (3) Vb - - 3659delC 1 (1) Ib - - 3849+10kbC>T 2 (2) Vb,c,f - - 3905insT 1 (1) Ib - - NA, not applicable; SIFT, Sorting Intolerant from Tolerant. a The following mutations biological classification scores could not be verified: 1898+G-A, 394delTT, D1270N, R352Q, and R1158X. Login to comment

[hide] Borderline sweat test: Utility and limits of genet... Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24. Seia M, Costantino L, Paracchini V, Porcaro L, Capasso P, Coviello D, Corbetta C, Torresani E, Magazzu D, Consalvo V, Monti A, Costantini D, Colombo C
Borderline sweat test: Utility and limits of genetic analysis for the diagnosis of cystic fibrosis.
Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24., [PMID:19318035]

Abstract [show]
OBJECTIVE: The sweat test remains the gold standard for the diagnosis of Cystic Fibrosis (CF) even despite the availability of molecular analysis of Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR). We investigated the relationship between CFTR mutation analysis and sweat chloride concentration in a cohort of subjects with borderline sweat test values, in order to identify misdiagnosis of CF. DESIGN AND METHODS: In the period between March 2006 and February 2008 we performed 773 sweat tests in individuals referred for suspect CF. Ninety-one subjects had chloride values in the border-line range. Clinicians required CFTR gene complete scanning on 66 of them. RESULTS: The mean value of sweat chloride in the DNA negative subjects was lower than in those with at least one CFTR mutation. Our data indicate that 39 mEq/l is the best sensitivity trade off for the sweat test with respect to genotype. CONCLUSIONS: To optimise diagnostic accuracy of reference intervals, it may be useful to modify from 30 to 39 mEq/l the threshold for sweat chloride electrolytes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment
57 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment

[hide] Characterisation of mutations and genotype-phenoty... J Cyst Fibros. 2008 Mar;7(2):110-5. Epub 2007 Aug 22. Shastri SS, Kabra M, Kabra SK, Pandey RM, Menon PS
Characterisation of mutations and genotype-phenotype correlation in cystic fibrosis: experience from India.
J Cyst Fibros. 2008 Mar;7(2):110-5. Epub 2007 Aug 22., [PMID:17716958]

Abstract [show]
BACKGROUND: Very little is known about the genetics of cystic fibrosis (CF) from the Indian subcontinent. The aims of the study were to identify the mutations and study the relation of genotype with phenotype in Indian children with CF. METHODS: A total of 100 patients with CF were screened for mutations in the CFTR gene. These included c.1521_1523delCTT (p.F508del) and c.3849+10 kb C>T mutations followed by single strand conformation polymorphism/heteroduplex analysis for mutations in 19 out of 27 exons of the CFTR gene. RESULTS: At least one mutation was identified in 40 patients. The most common mutation identified was p.F508del; 20 patients were homozygous and 13 heterozygous. In addition, c.3849+10 kb C>T, c.1161delC, and p.S549N were identified in two patients each and p.R352Q, p.R1158X and p.R75Q were identified in one patient each. Three novel mutations, viz. c.1002-7_1002-5delTTT, p.G149X and p.L183I were also identified. Majority of patients who were p.F508del positive originated from Pakistan and north-western states of India. The phenotypes of all patients were classical. Genotype-phenotype correlation revealed that p.F508del positive patients had a more severe disease, manifesting at an earlier age. CONCLUSIONS: A strategy for mutation screening for CF in India must involve testing for p.F508del followed by c.1161delC, c.3849+10 kb C>T and p.S549N. There is a need for large multicentric studies using more sensitive techniques for the identification of mutations in Indian CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 In addition, c.3849+10 kb CNT, c.1161delC, and p.S549N were identified in two patients each and p. R352Q, p.R1158X and p.R75Q were identified in one patient each. Login to comment
82 SSCP/HA SSCP/HA identified at least one mutation in exons 3, 4, 7, 11 and 19 viz. p.R75Q in exon 3, p.G149X in exon 4, c.1161delC, p.R352Q and c.1002-7_1002-5delTTT in exon 7, p.S549N in exon 11 and p.R1158X in exon 19. Login to comment
126 1 p.[R352Q]+[?] Login to comment

[hide] Cystic fibrosis mutations and genotype-pulmonary p... J Cyst Fibros. 2006 Jan;5(1):33-41. Epub 2005 Nov 4. Braun AT, Farrell PM, Ferec C, Audrezet MP, Laxova A, Li Z, Kosorok MR, Rosenberg MA, Gershan WM
Cystic fibrosis mutations and genotype-pulmonary phenotype analysis.
J Cyst Fibros. 2006 Jan;5(1):33-41. Epub 2005 Nov 4., [PMID:16275171]

Abstract [show]
BACKGROUND: Although there are more than 1000 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, most of them are uncommon and only limited information exists regarding genotype-pulmonary phenotype relationships. METHODS: We determined and classified the CFTR mutations using denaturing high-performance liquid chromatography and developed new, quantitative methods to categorize pulmonary phenotypes. RESULTS: Two novel alleles were discovered, namely G1047R and 1525-2A-->G, which were accompanied by F508del and G551D mutations, respectively. Assessment of numerous options revealed that CF pulmonary phenotype categorization in children cannot be accomplished with clinical or pulmonary function data but is facilitated by longitudinal quantitative chest radiology. It was most useful to categorize pulmonary disease status by evaluating the typical pattern of abnormalities in patients homozygous for the F508del mutation, and then compare patients with minor mutations to this typical CF pulmonary phenotype. By this method, both patients with novel mutations have pulmonary phenotypes typical of F508del homozygotes. However, patients with class IV mutations (e.g., R347P) or with pancreatic sufficiency showed serial chest radiographs that were atypically mild. CONCLUSIONS: Longitudinal quantitative chest radiography provides a new strategy for CF pulmonary phenotype categorization that should be useful for genotype-phenotype delineation in individual patients and in both epidemiologic studies and clinical trials involving groups of children with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Thereafter, the longitudinal patterns of WCXR and BCXR for the two patients with novel mutations (i.e., G1047R and 1525-2AYG) were superimposed on the Table 1 Summary of patient characteristics Characteristics F508del homozygote group (n =38) Pancreatic sufficiency groupa (n =19) Sex Male 25 8 Female 13 11 Center Madison 21 12 Milwaukee 17 7 Group Screened 38 3 Control 0 14 Other 0 2 Meconium ileus Yes 6 0 No 32 19 Mean age at diagnosis (weeks)TS.D. 7.15T2.4 193.1T192 Mean sweat Cl mEq/lTS.D. Login to comment
81 101.0T9.5 83.5T21.2 CXR scores at diagnosis WCXR 2.48T32b 4.68T71 BCXR 21.9T0.3 21.1T.48 Pulmonary function at 8 years FEV1 (%)c 97T4 104T2 FVC (%)c 103T3 103T2 FEV1/FVC% 0.92T0.03 0.98T.01 FEF25 - 75% 99T11 104T5 a Mild pancreatic phenotype mutations include: R117H occurring with F508del (n =5) and G542X (n =1); R117C with F508del (n =2); R347P with F508del (n =1), R1066H (n =1) and 2184insA (n À1), 2789+5G>A with F508del (n =3); 3272À26A>G with F508del (n =1); 3849+10kbC>T with F508del (n =1); L138ins with 3272À26A>G (n =1); R352Q with F508del (n =1); and 1336K with F508del (n =1). Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] The patch-clamp and planar lipid bilayer technique... J Cyst Fibros. 2004 Aug;3 Suppl 2:101-8. Sheppard DN, Gray MA, Gong X, Sohma Y, Kogan I, Benos DJ, Scott-Ward TS, Chen JH, Li H, Cai Z, Gupta J, Li C, Ramjeesingh M, Berdiev BK, Ismailov II, Bear CE, Hwang TC, Linsdell P, Hug MJ
The patch-clamp and planar lipid bilayer techniques: powerful and versatile tools to investigate the CFTR Cl- channel.
J Cyst Fibros. 2004 Aug;3 Suppl 2:101-8., [PMID:15463939]

Abstract [show]
Using the patch-clamp (PC) and planar lipid bilayer (PLB) techniques the molecular behaviour of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel can be visualised in real-time. The PC technique is a highly powerful and versatile method to investigate CFTR's mechanism of action, interaction with other proteins and physiological role. Using the PLB technique, the structure and function of CFTR can be investigated free from the influence of other proteins. Here we discuss how these techniques are employed to investigate the CFTR Cl- channel with special emphasis on its permeation, conduction and gating properties.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
147 Alternatively, mutations might disrupt channel gating (e.g., R352Q, [21]). Login to comment
143 Alternatively, mutations might disrupt channel gating (e.g., R352Q, [21]). Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b. Login to comment

[hide] Identification of common cystic fibrosis mutations... Am J Hum Genet. 1997 May;60(5):1122-7. Macek M Jr, Mackova A, Hamosh A, Hilman BC, Selden RF, Lucotte G, Friedman KJ, Knowles MR, Rosenstein BJ, Cutting GR
Identification of common cystic fibrosis mutations in African-Americans with cystic fibrosis increases the detection rate to 75%.
Am J Hum Genet. 1997 May;60(5):1122-7., [PMID:9150159]

Abstract [show]
Cystic fibrosis (CF)--an autosomal recessive disorder caused by mutations in CF transmembrane conductance regulator (CFTR) and characterized by abnormal chloride conduction across epithelial membranes, leading to chronic lung and exocrine pancreatic disease--is less common in African-Americans than in Caucasians. No large-scale studies of mutation identification and screening in African-American CF patients have been reported, to date. In this study, the entire coding and flanking intronic sequence of the CFTR gene was analyzed by denaturing gradient-gel electrophoresis and sequencing in an index group of 82 African-American CF chromosomes to identify mutations. One novel mutation, 3120+1G-->A, occurred with a frequency of 12.3% and was also detected in a native African patient. To establish frequencies, an additional group of 66 African-American CF chromosomes were screened for mutations identified in two or more African-American patients. Screening for 16 "common Caucasian" mutations identified 52% of CF alleles in African-Americans, while screening for 8 "common African" mutations accounted for an additional 23%. The combined detection rate of 75% was comparable to the sensitivity of mutation analysis in Caucasian CF patients. These results indicate that African-Americans have their own set of "common" CF mutations that originate from the native African population. Inclusion of these "common" mutations substantially improves CF mutation detection rates in African-Americans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al. Login to comment
71 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al. Login to comment

[hide] The Irish cystic fibrosis database. J Med Genet. 1995 Dec;32(12):972-5. Cashman SM, Patino A, Delgado MG, Byrne L, Denham B, De Arce M
The Irish cystic fibrosis database.
J Med Genet. 1995 Dec;32(12):972-5., [PMID:8825927]

Abstract [show]
We have found records of 1014 Irish cystic fibrosis patients alive by December 1994, belonging to 883 families. Prevalence in the population is 1/3475 and incidence at birth 1/1461, with a gene frequency of 2.6%. Twenty percent of the patients are aged over 20 years, but at present survival rate falls rapidly after that age. We have identified 85% of the mutations on the CFTR gene in a sample of 29% of the families (506 CF chromosomes). Mutation delta F508 is found in 72% of Irish CF chromosomes, G551D in 6.9%, and R117H in 2%. These are the highest frequencies reported for the latter two mutations world wide. Another seven mutations are found in an additional 4% of CF families. We present new microsatellite haplotype data that could be useful for genetic counselling of CF families bearing some of the 15% of CF mutations still unidentified, and comment on possible uses of our database.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Care Table 2 Haplotypes associated with the most common CF mutations in Ireland, as well as with Irish CF chromosomes with unidentified mutations and non-CF chromosomes Mutation NmlNcf % X/Kt Mt Microsatellite§ No chrsll AF508 367/506 72-5 A 1 See table 3 2 B 2 116 C - 0 D 2 2 G551D 35/506 6-9 B 2 16-7-17 20 R117H 10/506 2-0 C 1 16-30-13 5 C 1 16-31-13 1 G542X 5/506 1-0 B 2 17-32-13 2 621 + 1G-T 4/506 0-8 B 2 21-7-17 2 B 2 21-31-13 2 R560T 4/506 0-8 D 2 16-7-17 1 D 2 16-31-17 1 1717-1G-A 3/506 0-6 C 1 16-32-13 2 A 2 17-32-13 1 N1303K 2/506 0-4 B 2 23-29-13 2 3659delC 2/506 0-4 C 1 16-35-13 2 AI507 2/506 0-4 ND ND R352Q 1/506 0-2 C 1 16-31-13 1 R553X 0/506 0 0 ND ND 1078delT 0/506 0.0 ND ND Total identified 435/506 85-6 Unidentified 71/506 14-4 A 1 See table 3 3 A 2 5 B 2 17 C 1 5 D 2 8 Normal A 1 See table 3 16 A 2 1 B 2 3 C 1 13 C 2 1 D 2 2 * Nm = number of chromosomes bearing the mutation. Login to comment
38 Care Table 2 Haplotypes associated with the most common CF mutations in Ireland, as well as with Irish CF chromosomes with unidentified mutations and non-CF chromosomes Mutation NmlNcf % X/Kt Mt Microsatellite&#a7; No chrsll AF508 367/506 72-5 A 1 See table 3 2 B 2 116 C - 0 D 2 2 G551D 35/506 6-9 B 2 16-7-17 20 R117H 10/506 2-0 C 1 16-30-13 5 C 1 16-31-13 1 G542X 5/506 1-0 B 2 17-32-13 2 621 + 1G-T 4/506 0-8 B 2 21-7-17 2 B 2 21-31-13 2 R560T 4/506 0-8 D 2 16-7-17 1 D 2 16-31-17 1 1717-1G-A 3/506 0-6 C 1 16-32-13 2 A 2 17-32-13 1 N1303K 2/506 0-4 B 2 23-29-13 2 3659delC 2/506 0-4 C 1 16-35-13 2 AI507 2/506 0-4 ND ND R352Q 1/506 0-2 C 1 16-31-13 1 R553X 0/506 0 0 ND ND 1078delT 0/506 0.0 ND ND Total identified 435/506 85-6 Unidentified 71/506 14-4 A 1 See table 3 3 A 2 5 B 2 17 C 1 5 D 2 8 Normal A 1 See table 3 16 A 2 1 B 2 3 C 1 13 C 2 1 D 2 2 * Nm = number of chromosomes bearing the mutation. Login to comment

[hide] Screening Young syndrome patients for CFTR mutatio... Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7. Friedman KJ, Teichtahl H, De Kretser DM, Temple-Smith P, Southwick GJ, Silverman LM, Highsmith WE Jr, Boucher RC, Knowles MR
Screening Young syndrome patients for CFTR mutations.
Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7., [PMID:7551394]

Abstract [show]
Young syndrome is characterized by obstructive azoospermia associated with chronic sinobronchial disease of an infectious nature, but normal sweat-gland and pancreatic function as well as normal nasal potential differences. Congenital bilateral absence of the vas deferens (CBAVD) in some patients arises from mutations within the cystic fibrosis (CF) transmembrane regulator (CFTR) gene. Because of some similarities between Young syndrome, CF, and CBAVD, we evaluated 13 patients with Young syndrome, including screening for more than 30 different mutations within the CFTR gene. The mean age of the patients was 43 yr (range, 32 to 50 yr), and all were of northern European extraction. The sweat chloride concentration was normal in all patients (mean = 29 mEq/L; range, 8 to 43 mEq/L). Most had intermittent bronchial and sinus infections, but none was chronically colonized with Staphylococcus aureus or Pseudomonas aeruginosa. The FEV1 was normal or only mildly reduced in most patients (mean = 74%; range, 48 to 100% predicted). Of 26 Young syndrome chromosomes, we identified one with the recognized CF mutation delta F508. The incidence of CFTR mutations (1 in 26) did not differ significantly from the expected carrier frequency in this population. In summary, it is unlikely that the typical Young syndrome patient has a clinical disease associated with CFTR mutation on both alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No. Login to comment

[hide] Search for mutations in pancreatic sufficient cyst... Hum Genet. 1995 Sep;96(3):312-8. Brancolini V, Cremonesi L, Belloni E, Pappalardo E, Bordoni R, Seia M, Russo S, Padoan R, Giunta A, Ferrari M
Search for mutations in pancreatic sufficient cystic fibrosis Italian patients: detection of 90% of molecular defects and identification of three novel mutations.
Hum Genet. 1995 Sep;96(3):312-8., [PMID:7544319]

Abstract [show]
A cohort of 31 cystic fibrosis patients showing pancreatic sufficiency and bearing an unidentified mutation on at least one chromosome was analyzed through denaturing gradient gel electrophoresis of the whole coding region of the cystic fibrosis transmembrane conductance regulator gene, including intron-exon boundaries. Three new and 19 previously described mutations were detected. The combination of these with known mutations detected by other methods, allowed the characterization of mutations on 56/62 (90.3%) chromosomes. Among those identified, 17 can be considered responsible for pancreatic sufficiency, since they were found in patients carrying a severe mutation on the other chromosome. Among these presumed mild mutations, eight were detected more than once, R352Q being the most frequent in this sample (4.83%). Intragenic microsatellite analysis revealed that the six chromosomes still bearing unidentified mutations are associated with five different haplotypes. This may indicate that these chromosomes bear different mutations, rarely occurring among cystic fibrosis patients, further underlying the molecular heterogeneity of the genetic defects present in patients having pancreatic sufficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The remaining 19 included R352Q (Cremonesi et al. 1992) (three chromosomes), G85E (Zielenski et al. 1991a), Dl152H (High- Fig. 1 A-C Direct sequencing of PCR products from three cystic fibrosis patients (CF) carrying the W57G (A), E193K (B) and D579G (C) mutations, in parallel with control samples (C) displaying normal sequences (N/N) smith et al., personal communication to the CF Genetic Analysis Consortium), R1066H (Ferec et al. 1992), T338I (Saba et al. 1993), 711 +5G--+A (Gasparini et al., personal communication to the CF Genetic Analysis Consortium), M1V (Cheadle et al. 1993), R334W (Gasparini et al. 1991) (two chromosomes each), 4382delA (Claustres et al. 1993), R1158X (Ronchetto et al. 1992), F1052V (Mercier et al. 1993), G1349D (Beaudet et al. 1991), 1898+3A-+G (Cremonesi et al. 1992), $549N (Cutting et al. 1990), 711+ 3A-->G (Petreska et al. 1994), R347P (Dean et al. 1990), 2789+5G--+A (Highsmith et al. 1990), R1066C (Fanen et al. 1992) and S1251N (K~ilin et al. 1992) (one chromosome each). Login to comment
44 The W57G mutation was a T301 to G transversion in exon 3 substituting tryptophan at position 57 with glycine, and was detected in a patient from Northern Italy (Lombardia) bearing the R352Q mutation on the other chromosome. Login to comment
70 (UN yet unidentified mutation) Patient Genotype after Genotype at the end number preliminary screening of the analysis UN/UN M1V/4382delA 1717-1G---~A/UN 1717-1G---~A/R1066H AF508/UN AF508/D579G UN/UN M1V/UN AF508/UN AF508/UN UN/UN T338I/R1158X UN/UN G85E/71 I+5G---~A UN/UN D1152H/UN AF508/UN AF508/UN AF508/UN AF508/3849+ 10kbC---~T UN/UN 711+3A---~G/UN AF508/UN AF508/F1052V UN/UN R352Q/W57G UN/UN 1898+3A----~G/UN AF508/UN AF508/711+5G--~A G542X/UN G542X/DI 152H AF508/UN AF508/E193K 1717-1G---~A/UN 1717-1G---~A/2789+5A---)G AF508/UN AF508/G1349D AF508/UN AF508/G85E AF508/UN AF508/R347P AF508/UN AF508/R352Q AF508/UN AF508/R352Q AF508/UN AF508/S549N G542X/UN G542X/R1066H AF508/UN AF508/T338I AF508/UN AF508/R334W AF508/UN AF508/R334W AF508/UN AF508/S1251N AF508/UN AF508/R1066C AF508/UN AF508/D579G results) while the remaining three haplotypes had been found in association with other rare mutations, which were excluded by DGGE analysis in these patients (Table 3). Login to comment
75 These, in combination with three mutations identified through a preliminary screening for predominant mutations and one intronic mutation, identified molecular de- Table 3 Microsatellite haplotypes detected in association with yet uncharacterized chromosomes and their distribution among CF and normal chromosomes Patient Microsatellite haplotype CF chromosomes Normal number chromosomes IVS8 IVS 17b IVS 17b AF508 Other Unknown GT TA CA mutations mutations 14 16 30 14 0 0 1 0 4 16 31 13 0 2~ 7 36 II 16 28 12 0 0 l 0 5,8 16 30 13 0 5b 11 25 9 16 7 17 0 21~ 8 33 Total chromosomes analyzed 97 77 46 220 ~Both chromosomes carry the D 1152H mutation bG 1349D, R352Q, 1898+3A---~G, 4382delA, R334W (one chromosome each) 1717-1G---~A (15 chromosomes). Login to comment
78 W57G was found in a patient carrying R352Q on the other chromosome, and we cannot exclude a contribution to the PS phenotype by the W57G mutation. Login to comment
85 In total, among the mutations detected in our PS patients, 17 (D579G, E193K, F1052V, 711+5G---~A, G1349D, G85E, R347R R352Q, $549N, 2789+5A---~G, D1152H, R1066H, R334W, T338I, 3849+10kbC---~T, S1251N, R1066C) have been detected in compound heterozygosity with a mutation already classified as severe (AF508, 1717-1G--~A, G542X) and thus can be considered as presumably mild. Login to comment
86 Of these mutations, seven (G85E, EI93K, 711+5G--qA, R347P, R334W, R352Q, T338|) are located in the first transmembrane (I TM) domain, five (2789+ 5A---~G, RI066H, F1052V, D1152H, R1066C) in the second transmembrane (II TM) domain, four in the nucleo- R334W R347P R352Q T338I E193K 711+.E G85E 1 2 3 4 D579G G->A I S 549N 5 6a 6b 7 8 9 10 11 12 13 3849+11 !11 ! Login to comment
91 Conversely, other presumably mild mutations such as R352Q (three chromosomes), and G85E, Dl152H, 711+5G--~A, R1066H, T338I, R334W, D579G (two chromosomes each), are more frequently detected in the PS cohort, accounting in total for 27.4% of chromosomes. Login to comment
93 Screening for only eight presumed mild mutations (R352Q, R1066H, G85E, Dl152H, 711+5G---~A, T338I, R334W and D579G) in addition to the predominant four severe mutations (AF508, G542X, 1717-1G-+A and N1303K), would have allowed the identification of 64.5% of the molecular defects in our patients having PS. Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment
82 Four new mutations of the CFTR gene (541delC, R347H, R352Q, E585X) detected by DGGE analysis in Italian CF patients, associated with different clinical phenotypes. Login to comment

[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]

Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 As seen in Fig. 3a, on an MDE/sucrose gel of eight exon 7 mutations, DNAs containing two different mutations (R347P and R352Q) produced SSCPs almost identical to the wild type DNA. Login to comment
77 Mutations L327R, R347P and R352Q were better distinguished from wild type on gel with higher acrylamide concentration. Login to comment
121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.). Login to comment

[hide] Exon 9 of the CFTR gene: splice site haplotypes an... Hum Genet. 1994 Jan;93(1):67-73. Dork T, Fislage R, Neumann T, Wulf B, Tummler B
Exon 9 of the CFTR gene: splice site haplotypes and cystic fibrosis mutations.
Hum Genet. 1994 Jan;93(1):67-73., [PMID:7505767]

Abstract [show]
The alternatively spliced exon 9 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene codes for the initial part of the amino-terminal nucleotide-binding fold of CFTR. A unique feature of the acceptor splice site preceding this exon is a variable length polymorphism within the polypyrimidine tract influencing the extent of exon 9 skipping in CFTR mRNA. We investigated this repeat for its relationship to CFTR mutations and intragenic markers on 200 chromosomes from German patients with cystic fibrosis (CF). Four frequent length variations were strongly associated with the four predominant haplotypes previously defined by intragenic marker dimorphisms. One of these alleles displayed absolute linkage disequilibrium to the major CF mutation delta F508. Other frequent CFTR mutations were linked to one particular splice site haplotype indicating that differential exon 9 skipping contributes little to the clinical heterogeneity among CF patients with an identical mutation. We also identified a novel missense mutation (V456F) and a novel nonsense mutation (Q414X) within the coding region of exon 9. The missense mutation V456F adjacent to Walker motif A was present in a pancreas-sufficient CF patient. In contrast, the pancreas-insufficient Q414X/delta F508 compound heterozygote suffered from a severe form of the disease, indicating that alternative splicing of exon 9 does not overcome the deleterious effect of a stop codon with this exon.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
146 Nature Genet 3:151-156 Cremonesi L, Ferrari M, Belloni E, Magnani C, Seia M, Ronchetto P, Rady M, Russo MP, Romeo G, Devoto M (1992) Four new mutations of the CFTR gene (541delC, R347H, R352Q, E585X) detected by DGGE analysis in Italian patients, associated with different clinical phenotypes. Login to comment

[hide] The genetic background of osteoporosis in cystic f... J Cyst Fibros. 2006 Dec;5(4):229-35. Epub 2006 May 18. Castellani C, Malerba G, Sangalli A, Delmarco A, Petrelli E, Rossini M, Assael BM, Mottes M
The genetic background of osteoporosis in cystic fibrosis: association analysis with polymorphic markers in four candidate genes.
J Cyst Fibros. 2006 Dec;5(4):229-35. Epub 2006 May 18., [PMID:16713399]

Abstract [show]
BACKGROUND: Reduced Bone Mass Density (BMD) is frequent in Cystic Fibrosis (CF). Potentially, other genes than the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene may contribute to the bone phenotype variability in CF patients. METHODS: Four candidate genes likely associated with BMD variability were studied: the vitamin D receptor (VDR) gene, the estrogen receptor alpha (ESR1), the calcitonin receptor (CALCR) and the type I alpha 1 collagen (COL1A1) gene. A complete bone and CF evaluation was obtained for 82 subjects (39 m, 43 f): 15 had normal BMD (group 1), 46 were osteopenic (group 2), and 21 were osteoporotic (group 3). RESULTS: No statistical difference was found among the three groups for age, sex, pancreatic status, and vertebral fractures, nor for any of the biochemical markers. Weight, Body Mass Index (BMI), and FEV1, scored significantly worse in the two groups with the lowest T score. The CFTR mutations R1162X and F508del were more frequent in patients with lower BMD (p=0.044 and p=0.071). There was no significant difference in the distribution of the five marker genotypes among the 3 groups defined according to the unadjusted or adjusted (BMI and FEV1) BMD T score. No significant correlation was found between the VDR, CALCR, or COL1A1 gene polymorphisms and reduced BMD values. The individual ESR1 PvuII-XbaI haplotype C-A is associated to elevated u-calcium levels whereas the haplotype T-A is associated to lower values (p=0.00251). CONCLUSIONS: There was no evidence that the genes under study, with the possible exception of ESR1 gene variants, may modulate bone phenotype in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 CFTR analysis Patients selected for the study had been characterized previously for CFTR mutations with a reverse dot blot (RDB) Table 1 Anthropometric and CF-associated variables in normal, osteopenic and osteoporotic patients Group 1 normal bone density Group 2 osteopenia Group 3 osteoporosis Statistical evaluation Numerosity 15/82 46/82 21/82 - Mean age (years) 27.73T4.19 26.71T5.93 28.1T9.51 NS Males/females 9/6 19/27 11/10 NS CFTR genotype F508del/UK: 3 UK/ UK: 3 F508del/ F508del: 2 F508del/ G542X: 2 F508del/ R553X: 2 1717-1G> AvW1282X: 1 F508del/ N1303K: 1 G542X/UK: 1 F508del/F508del: 6 UK/UK: 5 F508del/ UK: 3 2183AA>G/UK: 3 2789+5G> A /UK: 3 F508del/N1303K: 3 F508del / R1162X: 3 F508del/2183AA>G: 2 N1303K/ N1303K: 2 R1162X/R1162X: 2 R1162X/ 2183AA>G: 2 2183AA>G/G542X: 1 F508del/ 1898+3A>G: 1 F508del/2789+5G> A: 1 F508del/711+5G>A: 1 F508del/ Q353X: 1 I507del/R1162X: 1 Q552X/ UK: 1 N1303K/G542X: 1 R1162X/3849+ 10KbC>T: 1 R1162X/711+5G>A: 1 T338I/ UK: 1 R553X/UK: 1 F508del/F508del: 4 F508del/ UK: 3 F508del/N1303K: 2 UK/ UK: 2 2789+5G>A/2789+5G> A: 1 F508del/1898+3A>G: 1 F508del/ 2183AA>G: 1 F508del/3849+10KbC> T: 1 F508del/G542X: 1 F508del/ R1066H: 1 F508del/R1162X: 1 Q552X/: 1 R352Q/: 1 R553X/UK: 1 Weight (kg) 61.7T5.89 56.5T8.25 48.9T9.40 p <0.0001 BMI 22.6T1.3 20.3T2.7 18T2.9 p <0.0001 PS/PI 3/12 10/36 7/14 NS FEV1% predicted 52.33T16.73 49.82T21.44 37.1T21.07 p =0.0205 NS = not significant. Login to comment

[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT. Login to comment

[hide] XV-2c/KM19 haplotypes analysis of cystic fibrosis ... Acta Physiol Hung. 2008 Sep;95(3):313-25. doi: 10.1556/APhysiol.95.2008.3.7. Flores-Martinez SE, Martinez JF, Machorro-Lazo MV, Garcia-Zapien AG, Salgado-Goytia L, Cruz-Quevedo EG, Moran-Moguel MC, Sanchez-Corona J
XV-2c/KM19 haplotypes analysis of cystic fibrosis patients from western Mexico.
Acta Physiol Hung. 2008 Sep;95(3):313-25. doi: 10.1556/APhysiol.95.2008.3.7., [PMID:18788470]

Abstract [show]
The analysis of polymorphic markers within or closely linked to the cystic fibrosis transmembrane regulator (CFTR) gene is useful as a molecular tool for carrier detection of known and unknown mutations. To establish the association between mutations in the CFTR gene in western Mexican cystic fibrosis (CF) patients, the distribution of XV2c/KM19 haplotypes was analyzed by PCR and restriction enzyme digestion in 384 chromosomes from 74 CF patients, their unaffected parents, and normal subjects. The haplotype analysis revealed that haplotype B was present in 71.9% of CF chromosomes compared to 0% of non-CF chromosomes. The F508del and G542X mutations were strongly associated with haplotype B (96.7% and 100% of chromosomes, respectively). The haplotype distribution of the CF chromosomes carrying other CFTR mutations had a more heterogeneous background. Our results show that haplotype B is associated with CFTR mutations. Therefore, haplotype analysis is a suitable alternate strategy for screening CF patients with a heterogeneous clinical picture from populations with a high molecular heterogeneity where carrier detection programs are not available. In addition, it may be a helpful diagnostic tool for genetic counseling and carrier detection in the relatives of CF patients and in couples who are planning to have children.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Of the 64 CF chromosomes, 30 carried the F508del mutation, 7 the G542X mutation, and the remaining 27 chromosomes carried the 3849+10 Kb C>T, 621+1 G>T, G551D, R553X, F311de1, R352Q, R74W mutations, as well as the new mutation 2053-2060del (unpublished data) or unidentified mutations; all of these were grouped as "other" (Table II). Login to comment
78 (%) of XV-2c/KM19 haplotypes Chromosomes A B C D CF (n=64) 10 (15.6%) 46 (71.9%) 5 (7.8%) 3 (4.7%) F508del (n=30) - 29 (96.7%) - 1 (3.3%) G542X (n=7) - 7 (100%) - - Other* (n=27) 10 (37.0%) 10 (37.0%) 5 (18.5%) 2 (7.4%) Non-CF (n=30) 18 (60%) 0 (0%) 9 (30%) 3 (10%) *Chromosomes bearing detected mutations (3849+10 Kb C>T, 621+1 G>T, G551D, R553X, F311del, R352Q, R74W, 2053-2060del), or unidentified mutations. Login to comment

[hide] Two salt bridges differentially contribute to the ... J Biol Chem. 2013 Jul 12;288(28):20758-67. doi: 10.1074/jbc.M113.476226. Epub 2013 May 24. Cui G, Freeman CS, Knotts T, Prince CZ, Kuang C, McCarty NA
Two salt bridges differentially contribute to the maintenance of cystic fibrosis transmembrane conductance regulator (CFTR) channel function.
J Biol Chem. 2013 Jul 12;288(28):20758-67. doi: 10.1074/jbc.M113.476226. Epub 2013 May 24., [PMID:23709221]

Abstract [show]
Previous studies have identified two salt bridges in human CFTR chloride ion channels, Arg(352)-Asp(993) and Arg(347)-Asp(924), that are required for normal channel function. In the present study, we determined how the two salt bridges cooperate to maintain the open pore architecture of CFTR. Our data suggest that Arg(347) not only interacts with Asp(924) but also interacts with Asp(993). The tripartite interaction Arg(347)-Asp(924)-Asp(993) mainly contributes to maintaining a stable s2 open subconductance state. The Arg(352)-Asp(993) salt bridge, in contrast, is involved in stabilizing both the s2 and full (f) open conductance states, with the main contribution being to the f state. The s1 subconductance state does not require either salt bridge. In confirmation of the role of Arg(352) and Asp(993), channels bearing cysteines at these sites could be latched into a full open state using the bifunctional cross-linker 1,2-ethanediyl bismethanethiosulfonate, but only when applied in the open state. Channels remained latched open even after washout of ATP. The results suggest that these interacting residues contribute differently to stabilizing the open pore in different phases of the gating cycle.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
162 Recovery of Charge at R352C and D993C Rescued Channel Stability in the Full Open State-R352C-CFTR exhibited single channel behavior similar to that previously reported for R352A-, R352Q-, and R352E-CFTR (13). Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
54 In contrast, the estimated total protein levels for E193K-CFTR (177 &#b1; 12% normal CFTR; n = 6), R352Q-CFTR (178 &#b1; 4% normal CFTR; n = 6), and D1152H-CFTR (256 &#b1; 16% normal CFTR; n = 9) were higher (P b 0.05; ANOVA followed by Tukey's least significant difference test) compared with normal CFTR, suggesting that the baseline chloride transport may be overestimated by ~1.8 to 2.6 fold for these three mutant CFTR forms. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
87 Similarly, the baseline chloride transport and ivacaftor response were higher for mutant CFTR forms with mild defects in channel conductance (30-84% of normal; D110H-, R347H, and R352Q-CFTR) [17-19], compared with those with severe defects in CFTR channel conductance (undetectable R334W- and T338I-CFTR) [9,20]. Login to comment
91 This suggests that the R117H mutation may be associated with defective channel gating, as well as conductance defects, and may explain why the ivacaftor response was larger than for CFTR mutations that result in defects in conductance alone (e.g., R347H, R352Q). Login to comment
92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3. Login to comment

[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]

Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 The 69-mutation panel was a combined panel that included variants approved by the Food and Drug Administration with 10 additional variants (R117C, R352Q, S364P, 3120G>A, 2869insG, G480C, 405+3A>C, 1812-1G>A, 444delA, and F311del) added on the basis of their published frequencies and relevancy to CF. Login to comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
107 These variants are 3876delA, S549N, 406-1G>A, 3199del6, W1089X, R1158X, R352Q, and 2183AA>G, and they account for 8.1% of the mutations detected in the Hispanic population. Login to comment
117 Four ethnicity-specific variants (R352Q, 406-1G>A, 3199del6, and W1089X) and 12 panethnic variants were detected. Login to comment

[hide] CFTR mutations spectrum and the efficiency of mole... PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014. Zietkiewicz E, Rutkiewicz E, Pogorzelski A, Klimek B, Voelkel K, Witt M
CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.
PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014., [PMID:24586523]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Three of them (R352Q, Q359R and D1152H) were in a compound heterozygosity with F508del, six (E217G, I506, V562L, G723V, D924N and L967S) had no accompanying mutation in trans. Login to comment
71 Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans Pathogenic mutations 1 1 L15Ffs10X c.43delC 175delC 1 CFMDB 1717-1G.A 2 2 G27V 21.92 c.80G.T 212G.T 1 Novel F508del 2 2 S18RfsX16 c.54-5940_273 +10250del21kb exon2,3del21kb 66 IL19 various CF mutations i2 i2 IVS2_Donor c.164+1G.A 296+1G.A 3 CFMDB various CF mutations 3 3 G85E 22.61 c.254G.A 386G.A 1 IL17 unknown 3 3 E60X c.178G.T 310G.T 0 IL17 x 3 3 L88IfsX22 c.262_263delTT 394delTT 0 IL17 x 4 4 E92K 21.92 c.274G.A 406G.A 2 CFMDB c.164+1G.A; c.2051- 2AA.G 4 4 L101X c.302T.G 434T.G 1 CFMDB c.3717+12191C.T 4 4 K114IfsX5 c.341_353del13bp 473del13bp 1 Novel F508del 4 4 R117H 20.35 c.350G.A 482G.A 5 IL17 F508del; 2x unknown 4 4 R117C 22.07 c.349C.T 481C.T 2 CFMDB S1206X;1x unknown 4 4 L137_L138insT c.412_413insACT L138ins 1 CFMDB F508del 4 4 R153I 22.61 c.458G.T 590G.T 2 Novel F508del; c.3527delC i4 i4 IVS4_Donor c.489+1G.T 621+1G.T 5 IL17 F508del; c.489+1G.T 5 5 L165X c.494T.A 626T.A 1 Novel F508del i5 i5 IVS5_Donor c.579+1G.T 711+1G.T 0 IL19 x i5 i5 IVS5_Donor c.579+3A.G 711+3A.G 2 CFMDB 2,3del21kb; c.2052-3insA i5 i5 IVS5_Donor c.579+5G.A 711+5G.A 0 IL17 x 7 8 F311L 20.90 c.933C.G 965C.G 2 CFMDB 2x F508 7 8 G314R 20.58 c.940G.A 1072G.A 4 CFMDB various CF mutations 7 8 F316LfsX12 c.948delT 1078delT 1 IL17 unkown 7 8 R334W 22.41 c.1000C.T 1132C.T 6 IL17 various CF mutations 7 8 I336K 22.07 c.1007T.A 1139T.A 2 CFMDB 2,3de21kb; F508del 7 8 R347P 22.27 c.1040G.C 1172G.C 11 IL17 various CF mutations i7 i8 IVS8_Donor c.1116+2T.A 1248+2T.A 1 Novel Q1412X 9 10 A455E 22.61 c.1364C.A 1496C.A 0 IL17 x i9 i10 IVS10_Donor c.1392+1G.A 1524+1G.A 1 CFMDB c.3816-7delGT 10 11 S466X c.1397C.G 1529C.G 1 CFMDB G542X 10 11 I507del c.1519_1521delATC 1651delATC 2 IL19 F508del 10 11 F508del c.1521_1523delCTT 1654delCTT 805 IL19 various CF mutations i10 i11 IVS11_Acceptor c.1585-1G.A 1717-1G.A 27 IL19 various CF mutations 11 12 G542X c.1624G.T 1756G.T 25 IL19 various CF mutations 11 12 G551D 21.24 c.1624G.T 1756G.T 5 IL19 various CF mutations 11 12 Q552X c.1654C.T 1786C.T 0 IL19 x 11 12 R553X c.1657C.T 1789C.T 14 IL19 various CF mutations 11 12 R560T 21.92 c.1679G.C 1811G.C 0 IL19 x i12 i13 IVS13_Donor c.1766+1G.A 1898+1G.A 6 IL19 various CF mutations i12 i13 IVS13_Donor c.1766+1G.C 1898+1G.C 1 CFMDB F508del 13 14 H620P 21.73 c.1859A.C 1991A.C 1 CFMDB F508del 13 14 R668C//G576A 21.61//1.73 c.2002C.T//c.1727G.C 2134C.T// 1859G.C 5 b CFMDB// rs1800098 c.1585-1G.A; 4 unknown 13 14 L671X c.2012delT 2143delT 27 IL17 various CF mutations 13 14 K684SfsX38 c.2051_2052delAAinsG 2183AA.G 10 IL17 various CF mutations 13 14 K684NfsX38 c.2052delA 2184delA 0 IL17 x 13 14 Q685TfsX4 c.2052_2053insA 2184insA 15 CFMDB various CF mutationsc , 1 unknown Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 13 14 L732X c.2195T.G 2327T.G 1 CFMDB F508del 14A 15 R851X c.2551C.T 2683C.T 3 CFMDB various CF mutations 14A 15 I864SfsX28 c.2589_2599del11bp 2721del11bp 2 CFMDB F508del; 2,3del21kb i14B i16 IVS16_Donor c.2657+2_2657+3insA 2789+2insA 1 CFMDB F508del i14B i16 IVS16_Donor c.2657+5G.A 2789+5G.A 0 IL17 unkown 15 17 Y919C 21.02 c.2756A.G 2888A.G 1 CFMDB unknown 15 17 H939HfsX27 c.2817_2820delTACTC 2949delTACTC 1 Novel unkown i15 i17 IVS17_Donor c.2908+3A.C 3040+3A.C 1 Novel F508del i16 i18 IVS18_Donor c.2988+1G.A 3120+1G.A 0 IL19 x 17A 19 I1023_V1024del c.3067_3072delATAGTG 3199del6 0 IL19 x i17A i19 IVS19 c.3140-26A.G 3272-26A.G 9 IL19 various CF mutations 17B 20 L1065R 21.90 c.3194T.G 3326T.G 1 CFMDB F508del 17B 20 Y1092X c.3276C.A 3408C.A 1 CFMDB R334W i18 i21 IVS21_Donor c.3468+2_3468+3insT 3600+2insT 11 CFMDB various CF mutationsd , 1 unknown 18 21 E1126EfsX7 c.3376_3379delGAAG 3508delGAAG 1 Novel F508del 19 22 R1158X c.3472C.T 3604C.T 2 CFMDB F508del; R553X 19 22 R1162X c.3484C.T 3616C.T 1 IL17 F508del 19 22 L1177SfsX15 c.3528delC 3659delC 4 IL17 various CF mutations 19 22 S1206X c.3617C.A 3749C.A 1 CFMDB R117C i19 i22 IVS22 c.3717+12191C.T 3849+10kbC.T 58 IL17 various CF mutations 20 23 G1244R 22.62 c.3730G.C 3862G.C 1 CFMDB F508del 20 23 S1251N 22.28 c.3752G.A 3884G.A 0 IL19 x 20 23 L1258FfsX7 c.3773_3774insT 3905insT 0 IL19 x 20 23 V1272VfsX28 c.3816_3817delGT 3944delGT 1 CFMDB c.1392+1G.A 20 23 W1282X c.3846G.A 3978G.A 9 IL19 various CF mutations 21 24 N1303K 22.62 c.3909C.G 4041C.G 18 IL19 various CF mutations 22 25 V1327X c.3979delG 4111delG 1 Novel F508del 22 25 S1347PfsX13 c.4035_4038dupCCTA c.4167dupCCTA 1 CFMDB 2,3del21kb 23 26 Q1382X c.4144C.T 4276C.T 1 CFMDB F508del 23 26 Q1412X c.4234C.T 4366C.T 2 CFMDB F508del; c.1116+2T.A i23 i26 IVS26_Donor c.4242+1G.T 4374+1G.T 1 CFMDB F508del Sequence changes of uncertain pathogenic effect, tentatively counted as mutations 6A 6 E217G 0.30 c.650A.G 782A.G 1 CFMDB; rs1219109046 unknown 7 8 R352Q 20.01 c.1055G.A 1187G.A 1 CFMDB; rs121908753 F508del 7 8 Q359R 0.33 c.1076A.G 1208A.G 1 CFMDB F508del i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)12 1332-12Tn_- 34TGm 6 CFMDB F508del; 3x unknown i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)13 1332-12Tn_- 34TGm 2 CFMDB 2143delT; 1x unknown i8 i9 IVS9 c.1210-12T8 1332-12Tn 1 Novel unknown 10 11 I506V 20.21 c.1516A.G 1648A.G 1 CFMDB; rs1800091 unknown 12 13 V562L 0.79 c.1684G.C 1816G.C 1 CFMDB; rs1800097 unknown 13 14 G723V 0.44 c.2168G.T 2300G.T 1 CFMDB; rs200531709 unknown 15 17 D924N 0.03 c.2770G.A 2902G.A 1 CFMDB; rs201759207 unknown patient with F508del on another allele) was not supported by the SVM value (+0.35); the patient was PS and had ambiguous chloride values (45, 64 and 83 mmol/L). Login to comment

[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]

Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
346 First, almost all CF-causing mutations involving residues located in the MSD transmembrane segments are encountered in MSD1 and generally concern positions lining the pore (G85E, E92K, D110H, P205S, R334W, I336K, T338I, S341P, R347H/R347P, and R352Q) (Fig. 7a). Login to comment

[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]

Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented. Login to comment