ABCMdb

PMID: 24011517

Utz VM, Chappelow AV, Marino MJ, Beight CD, Sturgill-Short GM, Pauer GJ, Crowe S, Hagstrom SA, Traboulsi EI
Identification of three ABCA4 sequence variations exclusive to African American patients in a cohort of patients with Stargardt disease.
Am J Ophthalmol. 2013 Dec;156(6):1220-1227.e2. doi: 10.1016/j.ajo.2013.07.008. Epub 2013 Sep 4., [PubMed]

Sentences

No. Mutations Sentence Comment

4 ABCA4 p.Arg2107His ABCA4 p.Leu1201Arg ABCA4 p.Arg1300Gln RESULTS: ABCA4 sequence changes were identified in 85 patients from 80 families, of which 11 patients identified themselves as African American.Of these 11 patients, 10 unrelated patients shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). Login to comment 10 ABCA4 p.Arg2107His ABCA4 p.Leu1201Arg ABCA4 p.Arg1300Gln CONCLUSIONS: Three ABCA4 sequence variations were identified exclusively in 10 unrelated African American patients: p.L1201R and p.R1300Q likely represent nonpathogenic sequence variants, whereas the p.R2107H substitution appears to be pathogenic. Login to comment 36 ABCA4 p.Leu1201Arg For p.L1201R, exon 24 was amplified by polymerase chain reaction (PCR) and analyzed. The forward primer sequence was 59 TAAATAAAGCGGGC GGTGACAGCA 39 and the reverse primer sequence was 59 TGACCTGCAGAAGTACCCAGTGTT. Login to comment 37 ABCA4 p.Arg1300Gln For p.R1300Q, exon 27 was amplified by PCR and analyzed. The forward primer sequence was 59 GGCATTA GAGATCCAGACCTTATAGGCA 39 and the reverse primer sequence was 59 TAAAGAGGGTGCTCCTTGCT GAGT 3. Login to comment 38 ABCA4 p.Arg2107His For p.R2107H, exons 46 and 47 were amplified together as one amplicon by PCR and analyzed. The forward primer sequence was 59 CCTTCTGTCAGCTCATCCTC CACA 39 and the reverse primer sequence was 59 CCAAGTGTCAATGGAGAACACAGG 39 . Login to comment 61 ABCA4 p.Gln1513Arg In the 11th African American patient, a single heterozygous mutation (c.4538A>G, p.Q1513R) was identified. Login to comment 63 ABCA4 p.Leu1201Arg Of the 10 African American patients, 3 shared a c.3602T>G missense mutation located in exon 24 (p.L1201R). Login to comment 65 ABCA4 p.Arg1108Cys Patient 1 was heterozygous for a second c.3322C>T missense mutation in exon 21 (p.R1108C), which was present in 4% of our patients and not unique to the African American subset (Table 2). Login to comment 67 ABCA4 p.Val1693Ile Patient 3 possessed two additional known disease-causing variations, c.4537delC (p.Q1513fsX1525) and c.5077G>A (p.V1693I), neither of which was detected in other members of our cohort. Login to comment 68 ABCA4 p.Arg1300Gln ABCA4 p.Val1693Ile The c.4537delC reportedly causes a premature stop codon 12 amino acids downstream in the protein product.40 The c.5077G>A (p.V1693I) variation has been previously detected in Stargardt disease patients but not in controls.25 Patients 4, 5 and 6 possessed a c.3899G>A sequence variation located in exon 27 (p.R1300Q). Login to comment 70 ABCA4 p.Ala1038Val ABCA4 p.Arg2107His ABCA4 p.Val849Ala However, patient 5 possessed two additional sequence variations: c.618C>T (p.S206S), a synonymous sequence variation that has been found to cosegregate with disease in a family with Stargardt disease,41 and c.2546T>C (p.V849A).25 Patient 6 exhibited both a c.3113C>T mutation (p.A1038V), present in 15% of our cohort, and a c.1937&#fe;1G>C sequence variation that results in a splice site mutation in intron 13.27 The c.3113C>T mutation produces a biochemically altered protein product42 and has been detected in patients with Stargardt disease but not in control patients.18,20,25 The third sequence variation, c.6320 G>A (p.R2107H), existed as a heterozygous sequence variation in patients 7, 8, 9, and 10. Login to comment 73 ABCA4 p.Glu2096Lys ABCA4 p.Asn58Lys This sequence variation has been found commonly in patients with ABCA4-associated disease43 and is proposed to be in linkage disequilibrium with a pathogenic mutation.27 Patient 8 had a c.174C>G sequence variation (p.N58K) that was predicted to be pathogenic in a study by Briggs and associates.44 The c.6286G>A (p.E2096K) variant identified in patient 9 is likely to be a pathogenic mutation20 and was located in nucleotide binding domain 2; it reduces adenosine triphosphate enzymatic (ATPase) activity in biochemical studies.42 SEQUENCE VARIATION STUDIES: The three sequence variations detected in the African American patients with Stargardt disease were studied in control African American patients. Login to comment 82 ABCA4 p.Arg2107His ABCA4 p.Leu1201Arg ABCA4 p.Arg1300Gln DISCUSSION IN THE PRESENT STUDY, 10 UNRELATED AFRICAN AMERICAN patients with Stargardt disease shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). Login to comment 85 ABCA4 p.Leu1201Arg ABCA4 p.Arg1300Gln Three Sequence Variations Specific to African American Patients with Stargardt Disease Sequence Variation Exon Protein Age of Onset (y) Age of Presentation (y) LogMAR BCVA (Snellen) c.3602T>G 24 p.L1201R 33.3 6 12.6 37.3 6 12.5 0.583 6 0.385 (z20/75) c.3899G>A 27 p.R1300Q 20.0 6 12.8 37.7 6 6.3 0.783 6 0.189 (z20/120) c.6320G>A 46 p.R2017H 24.5 6 14.2 26.8 6 14.2 0.473 6 0.401 (z20/60) BCVA &#bc; best-corrected visual acuity; logMAR &#bc; logarithm of minimum angle of resolution; Y &#bc; years. Login to comment 87 ABCA4 p.Arg1108Cys ABCA4 p.Leu1201Arg ABCA4 p.Leu1201Arg ABCA4 p.Leu1201Arg ABCA4 p.Arg1300Gln ABCA4 p.Arg1300Gln ABCA4 p.Arg1300Gln ABCA4 p.Val849Ala ABCA4 p.Val1693Ile Molecular Characteristics of Individual African American Patients with Stargardt Disease: Percentage of the Remaining Population, with the Specific Sequence Variations Identified Pt cDNA (Protein Product) % Popn (n &#bc; 75) cDNA (Protein Product) % Popn (n &#bc; 75) cDNA (Protein Product) % Popn (n &#bc; 75) 1 c.3602T>G (p.L1201R 0 c.3322C>T (p.R1108C) 4 2 c.3602T>G (p.L1201R) 0 3 c.3602T>G (p.L1201R) 0 c.4537delC (p.Q1513fsX1525) 0 c.5077G>A (p.V1693I) 0 4 c.3899G>A (p.R1300Q) 0 5 c.3899G>A (p.R1300Q) 0 c.618C>T (p.S207S) 0 c.2546T>C (p.V849A) 0 6 c.3899G>A (p.R1300Q) 0 c. Login to comment 88 ABCA4 p.Ala1038Val ABCA4 p.Arg2107His ABCA4 p.Arg2107His ABCA4 p.Arg2107His ABCA4 p.Arg2107His ABCA4 p.Glu2096Lys ABCA4 p.Asn58Lys 3113C>T (p.A1038V) 15 c.1937&#fe;1G>C (N/A) 0 7 c.6320G>A (p.R2107H) 0 c.IVS38-10T>C (N/A) 10 8 c.6320G>A (p.R2107H) 0 c.174C>G (p.N58K) 0 9 c.6320G>A (p.R2107H) 0 c.6286G>A (p.E2096K) 0 10 c.6320G>A (p.R2107H) 0 cDNA &#bc; complementary DNA; N/A &#bc; not applicable; % Popn &#bc; percentage of patients in the remaining population with the specific sequence variation; Pt &#bc; patient. Login to comment 89 ABCA4 p.Arg1300Gln VOL. 156, NO. 6 The two sequence variants, c.3601T>G (p.L1291R)20,44,45 and c.3899G>A (p.R1300Q),30,44 are reported in the literature as being likely to cause disease. Login to comment 94 ABCA4 p.Arg2107His In contrast to the c.3602T>G and c.3899G>A sequence variations, the c.6320G>A (p.R2107H) likely represents a pathogenic mutation. Login to comment 97 ABCA4 p.Arg2107His ABCA4 p.Leu1201Arg ABCA4 p.Arg1300Gln Allele Frequency of Sequence Variations Found in African American patients with Stargardt Disease in a Local African American Control Population and Corresponding Population Frequency in Those of African American and European Ancestry per the Exome Variant Server35 Sequence Variation and Amino Acid Substitution Allele Frequency in Control AA Patients (CEI) Allele Frequency in AA Population (EVS) Allele Frequency in European American Population (EVS) c.3602T>G (p.L1201R) 7.50% (n &#bc; 305) 9.35% (n &#bc; 2203) 0.05% (n &#bc; 4300) c.3899G>A (p.R1300Q) 6.30% (n &#bc; 301) 6.17% (n &#bc; 2203) 0.05% (n &#bc; 4300) c.6320G>A (p.R2107H) 2.00% (n &#bc; 294) 2.04% (n &#bc; 2203) 0.01% (n &#bc; 4300) AA &#bc; African American; CEI &#bc; Cole Eye Institute; EVS &#bc; Exome Variant Server; N &#bc; number of alleles tested. Login to comment 102 ABCA4 p.Arg2107His Of note, our control population of African Americans had a normal retinal phenotype, whereas the purpose of the Exome Variant Server is to provide general population reference, and ocular phenotyping was not part of the project; therefore, the ocular phenotype of the individual homozygous for c.6320G>A (p.R2107H) is unknown. Login to comment 116 ABCA4 p.Arg2107His ABCA4 p.Leu1201Arg ABCA4 p.Arg1300Gln In contrast to previous reports of potential pathogenicity, our study of controls and bioinformatic analyses suggests that c.3602T>G (p.L1201R) and c.3899G>A (p.R1300Q) are not directly pathogenic, whereas c.6320G>A (p.R2107H) likely alters protein structure and therefore is pathogenic. Login to comment 119 ABCA4 p.Arg2107His ABCA4 p.Leu1201Arg ABCA4 p.Arg1300Gln In Silico Analysis of ABCA4 Missense Variants Identified in African American Patients with Stargardt Disease Sequence Variation (Amino Acid Substitution) Polymorphism Phenotyping V2 PMut Sorting Intolerant from Tolerant Human Var Score Prediction NN output Reliability Prediction Score Prediction c.3602T>G (p.L1201R) 0.031 Benign 0.7702 5 Pathologic 0.52 Tolerant c.3899G>A (p.R1300Q) 0.143 Benign 0.6548 3 Pathologic 0.61 Tolerant c.6320G>A (p.R2107H) 1.00 Probably damaging 0.8993 7 Pathologic 0.00 Intolerant NN &#bc; neural network; V &#bc; version; Var &#bc; variability. Login to comment 121 ABCA4 p.Ala1038Val ABCA4 p.Gly863Ala ABCA4 p.Leu541Pro ABCA4 p.Leu11Pro ABCA4 p.Cys1490Tyr ABCA4 p.Arg602Trp ABCA4 p.Asn965Ser ABCA4 p.Arg1129Leu ABCA4 p.Trp700* Population-Specific ABCA4 Alleles in Patients with Stargardt Disease References Population Allele Protein Rivera et al.28 Hargitai et al.12 Hungaro-German c.1622T>C/c.3113C>T p.L541P/p.A1038V September et al.47 Afrikaner c.4469G>A p.C1490Y September et al.47 Afrikaner c.1804C>T p.R602W Rosenberg et al.48 Danish c.2894A>G p.N965S Maugeri et al.27 Western European c.2588G>C p.G863A Maia-Lopes et al.49 Portuguese c.32T>C p.L11P Valverde et al.29 Spanish c.5882G>A p.R1129L Fumagalli et al.50 Italian c.2099G>A p.W700X VOL. 156, NO. 6 ALL AUTHORS HAVE COMPLETED AND SUBMITTED THE ICMJE FORM FOR DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST, and the following were reported. Login to comment