ABCMdb

ABCC7 p.Tyr122*

ClinVar:	c.366T>A , p.Tyr122* D , Pathogenic c.364T>C , p.Tyr122His ? , not provided
CF databases:	c.366T>A , p.Tyr122* D , CF-causing c.364T>C , p.Tyr122His (CFTR1) ? , This mutation was identified on CFTR gene in one Iranian CBAVD patient. c.365A>G , p.Tyr122Cys (CFTR1) ? , The mutation was detected by dHPLC analysis and characterised by direct sequencing. We have seen it only once, in over 2000 control chromosomes from Italian population.

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Proportion of cystic fibrosis gene mutations not d... JAMA. 1999 Jun 16;281(23):2217-24. Mak V, Zielenski J, Tsui LC, Durie P, Zini A, Martin S, Longley TB, Jarvi KA
Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia.
JAMA. 1999 Jun 16;281(23):2217-24., 1999-06-16 [PMID:10376575]

Abstract [show]
CONTEXT: Infertile men with obstructive azoospermia may have mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, many of which are rare in classic cystic fibrosis and not evaluated in most routine mutation screening. OBJECTIVE: To assess how often CFTR mutations or sequence alterations undetected by routine screening are detected with more extensive screening in obstructive azoospermia. DESIGN: Routine screening for the 31 most common CFTR mutations associated with the CF phenotype in white populations, testing for the 5-thymidine variant of the polythymidine tract of intron 8 (IVS8-5T) by allele-specific oligonucleotide hybridization, and screening of all exons through multiplex heteroduplex shift analysis followed by direct DNA sequencing. SETTING: Male infertility clinic of a Canadian university-affiliated hospital. SUBJECTS: Of 198 men with obstructive (n = 149) or nonobstructive (n = 49; control group) azoospermia, 64 had congenital bilateral absence of the vas deferens (CBAVD), 10 had congenital unilateral absence of the vas deferens (CUAVD), and 75 had epididymal obstruction (56/75 were idiopathic). MAIN OUTCOME MEASURE: Frequency of mutations found by routine and nonroutine tests in men with obstructive vs nonobstructive azoospermia. RESULTS: Frequency of mutations and the IVS8-5T variant in the nonobstructive azoospermia group (controls) (2% and 5.1% allele frequency, respectively) did not differ significantly from that in the general population (2% and 5.2%, respectively). In the CBAVD group, 72 mutations were found by DNA sequencing and IVS8-5T testing (47 and 25, respectively; P<.001 and P = .002 vs controls) vs 39 by the routine panel (P<.001 vs controls). In the idiopathic epididymal obstruction group, 24 mutations were found by DNA sequencing and IVS8-5T testing (12 each; P=.01 and P=.14 vs controls) vs 5 by the routine panel (P=.33 vs controls). In the CUAVD group, 2 mutations were found by routine testing (P=.07 vs controls) vs 4 (2 each, respectively; P=.07 and P=.40 vs controls) by DNA sequencing and IVS8-5T testing. The routine panel did not identify 33 (46%) of 72, 2 (50%) of 4, and 19 (79%) of 24 detectable CFTR mutations and IVS8-5T in the CBAVD, CUAVD, and idiopathic epididymal obstruction groups, respectively. CONCLUSIONS: Routine testing for CFTR mutations may miss mild or rare gene alterations. The barrier to conception for men with obstructive infertility has been overcome by assisted reproductive technologies, thus raising the concern of iatrogenically transmitting pathogenic CFTR mutations to the progeny.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining. Login to comment

[hide] Analysis of 31 CFTR mutations by polymerase chain ... J Med Screen. 1999;6(2):67-9. Gasparini P, Arbustini E, Restagno G, Zelante L, Stanziale P, Gatta L, Sbaiz L, Sedita AM, Banchieri N, Sapone L, Fiorucci GC, Brinson E, Shulse E, Rappaport E, Fortina P
Analysis of 31 CFTR mutations by polymerase chain reaction/oligonucleotide ligation assay in a pilot screening of 4476 newborns for cystic fibrosis.
J Med Screen. 1999;6(2):67-9., [PMID:10444722]

Abstract [show]
OBJECTIVES: Molecular biological testing for genetic diseases has grown rapidly, but speed, accuracy, specificity, sensitivity, throughput, and cost become more important as large scale screening is considered. This is a pilot study of an assay for the simultaneous detection of up to 31 cystic fibrosis mutations in a multicentre population based screening of 4476 Italian newborns. METHODS: The assay is a polymerase chain reaction, followed by an oligonucleotide ligation assay (PCR/OLA) and finally a sequence coded separation. It allows the detection of up to 31 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Guthrie spots were used as a source of template DNA. RESULTS: 144 carriers were detected during the analysis of 4476 samples, which translates into a carrier frequency of 1/31.1. Forty two carriers were detected from 1341 samples in Pavia (1/31.9), 53 from 1574 in Turin (1/29.7), and 49 from 1561 in San Giovanni Rotondo (1/31.8). Fifteen different mutations were detected, the most common being delta F508 (0.625). Other common mutations included G542X (16 of 144), which was particularly common in southern Italy (14 of 49), N1303K (8 of 144), and R117H (8 of 144), detected only in the northern centres. CONCLUSIONS: PCR/OLA is a robust, accurate, user friendly method for cystic fibrosis screening of newborns using blood spots in a semiautomated way at a low cost per mutation (0.8 Euro).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Table 1 Mutations analysed in the CFTR gene using polymerase chain reaction/oligonucleotide litigation assay/sequence coded separation Mutation Location Nucleotide Result F508 Exon 10 3 bp deletion Deletion of Phe-508 I507 Exon 10 3 bp deletion Deletion of Ile-507 (or -506) Q493X Exon 10 C-1609 →→ T Gln-493 → Stop V520F Exon 10 G-1690 → T Val-520 → Phe 1717-1G → A Intron 10 G-1717-1 → A 3`-splice site mutation G542X Exon 11 G-1756 → T Gly-542 → Stop G551D Exon 11 G-1784 → A Gly-551 → Asp R553X Exon 11 C-1789 → T Arg-553 → Stop R560T Exon 11 G-1811 → C Arg-560 → Thr S549R Exon 11 T-1779 → G Ser-549 → Arg S549N Exon 11 G-1778 → A Ser-549 → Asn 3849+10 kb C → T Intron 19 C-3849+10 kb → T Splice mutation 3849+4A → G Intron 19 A-3849+4 → G Splice mutation R1162X Exon 19 C-3616 → T Arg-1162 → Stop 3659delC Exon 19 1 bp deletion Frameshift W1282X Exon 20 G-3978 → A Trp-1282 → Stop 3905insT Exon 20 1 bp insertion Frameshift N1303K Exon 21 C-4041 → G Asn-1303 → Lys G85E Exon 3 G-386 → A Gly-85 → Glu 621+1G → T Intron 4 G-621+1 → T 5`-splice site mutation R117H Exon 4 G-482 → A Arg-117 → His Y122X Exon 4 T-498 → A Tyr-122 → Stop 711+1G → T Intron 5 G-711+1 → T 5`-splice site mutation 1078delT Exon 7 1 bp deletion Frameshift R347P Exon 7 G-1172 → C Arg-347 → Pro R347H Exon 7 G-1172 → A Arg-347 → His R334W Exon 7 C-1132 → T Arg-334 → Trp A455E Exon 9 C-1496 → A Ala-455 → Glu 1898+1G → A Intron 12 G-1898+1 → A 5`-splice site mutation 2184delA Exon 13 Deletion A-2184; A-2183 → G Frameshift 2789+5G → A Intron 14B G-2789+5 → A Splice mutation Table 2 Summary of cystic fibrosis screening results No of samples analysed Normal subjects Carriers Carrier frequency Turin 1574 1521 53 1/29.7 Pavia 1341 1299 42 1/31.9 San Giovanni Rotondo 1561 1512 49 1/31.8 Total 4476 4332 144 1/31.1 Table 3 Detailed list of mutations detected in the Italian population Centre F508 G542X R347P 2183-AG N1303K 711+1GT 1717-1A R347H R117H 1898+1G 2789+5G W1282X R1162X I507 Other TO 33 2 1 1 5 1 1 2 3 2 2 - - - PV 27 - - 1 2 - 1 - 5 - 1 2 1 1 SGR 30 14 2 1 1 1 - - - - - - - - TO, Dipartimento di Patologia Clinica, Ospedale Infantile "Regina Margherita, Torino; PV, Istituto di Anatomia Patologica, Sezione di Anatomia Patologica, Università di Pavia, Pavia; SGR, Servizio di Genetica Medica and Divisione di Neonatologia, IRCCS Casa Sollievo della SoVerenza, San Giovanni Rotondo, Foggia. Login to comment

[hide] Prenatal detection by real-time quantitative PCR a... Clin Chem. 2000 Sep;46(9):1417-20. Costes B, Girodon E, Vidaud D, Flori E, Ardalan A, Conteville P, Fanen P, Niel F, Vidaud M, Goossens M
Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19).
Clin Chem. 2000 Sep;46(9):1417-20., [PMID:10973878]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E. Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]

Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 These mutations, Y122X, 556delA, 2909delT, 3358delAC, 3750delAG, W1310X, and W1316X, were subsequently excluded from the 86-mutation panel. Login to comment

[hide] Mutations of the cystic fibrosis gene in patients ... Am J Gastroenterol. 2001 Sep;96(9):2657-61. Truninger K, Malik N, Ammann RW, Muellhaupt B, Seifert B, Muller HJ, Blum HE
Mutations of the cystic fibrosis gene in patients with chronic pancreatitis.
Am J Gastroenterol. 2001 Sep;96(9):2657-61., [PMID:11569691]

Abstract [show]
OBJECTIVE: Several studies have reported an increased frequency of cystic fibrosis gene mutations in idiopathic but not in alcoholic chronic pancreatitis. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis has not been analyzed. The aim of our study was to determine the frequency of cystic fibrosis gene mutations in patients with chronic pancreatitis with long-term follow-up and to see whether patients with mutations have a clinically different natural course compared to those without mutations. METHODS: Eighty two patients with chronic pancreatitis and 11 patients with recurrent acute pancreatitis of our well defined pancreatitis cohort were screened for the 31 most common cystic fibrosis gene mutations. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis was assessed. RESULTS: A cystic fibrosis gene mutation was detected in five of 49 patients with alcoholic chronic pancreatitis (10.2%; 2.3 times the expected frequency) and in three of 14 patients with idiopathic-juvenile chronic pancreatitis (21.4%; 4.8 times the expected frequency). No mutations were found in the remaining patients with chronic pancreatitis of rare causes, hereditary pancreatitis, and recurrent acute pancreatitis. The frequency of pancreatic calcifications was significantly higher in patients with alcoholic chronic pancreatitis without mutations. This result was not confirmed in patients with idiopathic-juvenile chronic pancreatitis. The duration of pain and the frequency of exocrine and endocrine insufficiency was comparable in both subgroups irrespective of the mutation status. CONCLUSION: Our data indicate a significantly increased frequency of cystic fibrosis gene mutations both in patients with alcoholic and idiopathic-juvenile chronic pancreatitis. The natural course was similar in patients with mutations compared to those without mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A. Login to comment

[hide] Genetic and clinical features of false-negative in... Acta Paediatr. 2002;91(1):82-7. Padoan R, Genoni S, Moretti E, Seia M, Giunta A, Corbetta C
Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.
Acta Paediatr. 2002;91(1):82-7., [PMID:11883825]

Abstract [show]
A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. Conclusion: The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14). Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL. Login to comment
112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL. Login to comment

[hide] Predicting the risk of cystic fibrosis with abnorm... Am J Med Genet. 2002 Jun 15;110(2):109-15. Muller F, Simon-Bouy B, Girodon E, Monnier N, Malinge MC, Serre JL
Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases.
Am J Med Genet. 2002 Jun 15;110(2):109-15., 2002-06-15 [PMID:12116247]

Abstract [show]
Hyperechogenic fetal bowel is prenatally detected by ultrasound during the second trimester of pregnancy in 0.1-1.8% of fetuses. It has been described as a normal variant but has often been associated with severe diseases, notably cystic fibrosis (CF). The aim of our study was to determine the risk of CF in a prospective study of 641 fetuses with ultrasonographically abnormal fetal bowel and the residual risk when only one mutation is detected in the fetus. Fetal cells and/or parental blood cells were screened for CFTR mutations. Two screening steps were used, the first covering the mutations most frequently observed in French CF patients (mutation detection rate of 70-90%) and, when a CF mutation was detected, a DGGE-sequencing strategy. We observed a 3.1% risk of CF when a digestive tract anomaly was prenatally observed at routine ultrasound examination. The risk was higher when hyperechogenicity was associated with bowel dilatation (5/29; 17%) or with the absence of gall bladder (2/8; 25%). The residual risk of CF was 11% when only one CF mutation was detected by the first screening step, thereby justifying in-depth screening. Mutations associated with severe CF (DeltaF508 mutation) were more frequently observed in these ultrasonographically and prenatally detected CF cases. However, the frequency of heterozygous cases was that observed in the normal population, which demonstrates that heterozygous carriers of CF mutations are not at increased risk for hyperechogenic bowel. In conclusion, fetal bowel anomalies indicate a risk of severe cystic fibrosis and justify careful CFTR molecular analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 T, R117H, Y122X, 711 þ 1G ! Login to comment

[hide] Genotype-phenotype correlation in cystic fibrosis:... Am J Med Genet. 2002 Jul 22;111(1):88-95. Salvatore F, Scudiero O, Castaldo G
Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes.
Am J Med Genet. 2002 Jul 22;111(1):88-95., 2002-07-22 [PMID:12124743]

Abstract [show]
More than 1,000 mutations have been identified in the cystic fibrosis (CF) transmembrane regulator (CFTR) disease gene. The impact of these mutations on the protein and the wide spectrum of CF phenotypes prompted a series of Genotype-Phenotype correlation studies. The CFTR genotype is invariably correlated with pancreatic status-in about 85% of cases with pancreatic insufficiency and in about 15% of cases with pancreatic sufficiency. The correlations between the CFTR genotype and pulmonary, liver, and gastrointestinal expression are debatable. The heterogeneous phenotype in CF patients bearing the same genotype or homozygotes for nonsense mutations implicated environmental and/or genetic factors in the disease. However, the discordant phenotype observed in CF siblings argued against a major role of environmental factors and suggested that genes other than CFTR modulate the CF phenotype. A locus that modulates gastrointestinal expression was identified in mice and subsequently in humans. By analyzing nine CF patients discordant for meconium ileus we were able to show that this locus had a dominant effect. Moreover, in a collaborative study we found a higher rate of polymorphisms in beta-defensin genes 1 and 2 in CF patients and in controls. In another multicenter study mutations in alpha-1 antitrypsin (A1AT) and mannose binding lectin genes were found to be independent risk factors for liver disease in CF patients. The body of evidence available suggests that the variegated CF phenotype results from complex interactions between numerous gene products.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 Several mutations are frequent in specific populations: W1282X among Ashkenazi [Shoshani et al., 1992], 2143delT in Germany [Dork et al., 1994], Y122X in Iceland [Chevalier-Porst et al., 1994], T338I in Sardinia, and 2183AA > G and R1162X in Northeast Italy [Rendine et al., 1997]. Login to comment

[hide] Screening for cystic fibrosis in newborn infants: ... J Med Screen. 2002;9(2):60-3. Corbetta C, Seia M, Bassotti A, Ambrosioni A, Giunta A, Padoan R
Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population.
J Med Screen. 2002;9(2):60-3., [PMID:12133923]

Abstract [show]
OBJECTIVE: To assess the performance of a two tier neonatal screening programme (IRT/DNA/IRT) for cystic fibrosis, based on immunoreactive trypsinogen (IRT) followed by direct cystic fibrosis transmembrane conductance regulator (CFTR) gene analysis (based on a panel of up to 31 mutations) in hypertrypsinaemic newborn infants and to compare it with a previous screening protocol. SETTING: The study comprised all the newborn infants in the period 1 October 1998 to 31 December 1999 in the Lombardia region, north western Italy. METHODS: The screening strategy consisted of an immunoreactive trypsinogen assay from dried blood spots, a polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (PCR-OLA), and a sequence code separation. RESULTS: 104 609 newborn infants were screened. 1457 hypertrypsinaemic infants (1.39%) were analysed with the PCR-OLA assay. 18 newborn homozygotes or compound heterozygotes for CFTR mutations were identified and referred to the cystic fibrosis (CF) centre at a mean age of 3 weeks. 125 infants presenting only one mutation were recalled for a sweat test: a diagnosis of CF was made in 13 infants, and parents of 112 neonates identified as carriers (1:13) received genetic counselling. The remaining 1314 hypertrypsinaemic newborn infants were recalled for IRT retesting and 177 were referred for a sweat test because the second IRT measurement was above the cut off value. Among this group a further two infants were diagnosed with CF (1.1%) leading to a CF prevalence of 1:3170. CONCLUSIONS: This strategy resulted in an early and accurate diagnosis of CF. The IRT/DNA/IRT protocol with an OLA assay was shown to be useful in an Italian population with a genetic heterogeneity, leading to the identification of 94% of infants with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
266 Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

[hide] Demographics of the UK cystic fibrosis population:... Eur J Hum Genet. 2002 Oct;10(10):583-90. McCormick J, Green MW, Mehta G, Culross F, Mehta A
Demographics of the UK cystic fibrosis population: implications for neonatal screening.
Eur J Hum Genet. 2002 Oct;10(10):583-90., [PMID:12357328]

Abstract [show]
The objective was to determine the composition of the Cystic Fibrosis (CF) Population attending specialist UK CF centres in terms of age, gender, age at diagnosis, genotype and ethnicity. With the planned introduction of the national CF screening programme in the UK, cystic fibrosis transmembrane regulator (CFTR) mutations were compared between different ethnic groups enabling a UK-specific frequency of mutations to be defined. Data were analysed from the patient biographies held in the UK CF Database (see www.cystic-fibrosis.org.uk). The currently registered population of 5,274 CF patients is 96.3% Caucasian with a male preponderance that significantly increases with age. The majority of the 196 non-Caucasian CF patients are from the Indian Subcontinent (ISC), of which one in 84 UK CF patients are of Pakistani origin. The commonest CFTR mutation, deltaF508, is found in 74.1% of all CF chromosomes. In the Caucasian CF population, 57.5% are deltaF508 homozygotes but the UK ISC CF population with only 24.7%, has significantly fewer deltaF508 homozygotes patients (95% confidence interval (CI) 0.2-0.4). The distribution of Caucasian patients with deltaF508/deltaF508, deltaF508/Other and Other/Other does not fit the expected distribution with a Hardy-Weinberg model unless those patients without a detected mutation are excluded (P<0.001). The UK CF Database has shown the UK CF population to have distinct characteristics separate from the North American and European CF Registries. The ISC group contains many mutations not recognised by current genetic analysis, and one in four ISC patients have no CFTR mutations identified. The CFTR analysis proposed for the screening programme would detect 96% of patients registered in the database, but is unlikely to achieve the desired >80% detection rates in the ethnic minority groups. Screen-positive, non-Caucasian infants without an identifiable CFTR mutation should be referred for a sweat test and genetic counselling when serum trypsinogen concentrations remain elevated after birth.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 The additional eleven are S549N, 3849+4A?G, 3905insT, 2789+5G?A, Y122X, 711+1G?T, R347P, R347H, R334W, A455E and 3281AA?G. Login to comment

[hide] [National program for neonatal screening for cysti... J Gynecol Obstet Biol Reprod (Paris). 2003 Feb;32(1 Suppl):1S56-60. Navarro J, Grosskopf C, Vidailhet M, Briard ML, Farriaux JP
[National program for neonatal screening for cystic fibrosis: implementation and preliminary results].
J Gynecol Obstet Biol Reprod (Paris). 2003 Feb;32(1 Suppl):1S56-60., [PMID:12592165]

Abstract [show]
Neonatal screening for cystic fibrosis was decided by the national medical authorities after a common investigation conducted by the French association ADPHE and national health insurance fund. Based on therapeutic progress and the proposed method using determination of blood immunoreactive trypsin then study of the main CF mutations, there is strong hope of effective CF detection and clinical benefit for the patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 3 Les mutations étudiées sont : 1717-1G > A - G542X - W 1282 X - N 1303 K - DF 508 (M) - 3849 + 10kbC > T - 621+1 G > T - R553X - G 551D, R117H, R1162X - R 334W - A455E - 2183 AA > G - 3659delC-- 1078 delT - D1507 - R347P - S 1251N, E60X, 2789+5G > A - 394del T - G 85 E - 1811+1.6 - Y122X - 711+1G > T - W 846 X - Y 1092 - 3272-26A > G. Login to comment

[hide] Analysis of cystic fibrosis transmembrane conducta... Am J Med Genet A. 2003 Jul 1;120A(1):72-6. Timmreck LS, Gray MR, Handelin B, Allito B, Rohlfs E, Davis AJ, Gidwani G, Reindollar RH
Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina.
Am J Med Genet A. 2003 Jul 1;120A(1):72-6., 2003-07-01 [PMID:12794695]

Abstract [show]
The relationship between cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations and congenital absence of the uterus and vagina (CAUV) was examined. CFTR mutations have previously been associated with congenital bilateral absence of the vas deferens (CBAVD). CBAVD is caused by a disruption in the vas deferens, a Wolffian duct derivative. Because the embryologic development of the Mullerian ducts directly depends on the prior normal development of the Wolffian ducts, the same gene products may be necessary for normal embryologic development of both ductal systems. This study evaluated the role of CFTR mutations in the development of CAUV. DNA samples from 25 patients with CAUV were tested for the presence of 33 of the most common CFTR mutations. Protein-coding DNA fragments from the CFTR gene were amplified in vitro by the polymerase chain reaction (PCR) and analyzed for mutations using allele-specific oligonucleotide (ASO) probes. Two patients were heterozygous for CFTR mutations. One was heterozygous for the W1282X mutation and the other was heterozygous for the DeltaF508 mutation. The incidence of the 33 CFTR mutations found in the patients with CAUV (8%) was twice that found in the general population (4%), but much less than the incidence of CFTR mutations in men with CBAVD (80%). This data suggests that it is unlikely for CFTR mutations to cause CAUV in females as they cause CBAVD in some males. Furthermore, the data suggest that CAUV in females may be the same disorder as CBAVD in males who do not have CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development. Login to comment

[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]

Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment

[hide] Cystic fibrosis: S158N (605G --> A) is a rare gene... Genet Test. 2003 Spring;7(1):73-6. Hicks K, Beadling W, Shrimpton AE
Cystic fibrosis: S158N (605G --> A) is a rare genetic variant found in coupling with deltaF508.
Genet Test. 2003 Spring;7(1):73-6., [PMID:12820707]

Abstract [show]
A single nucleotide change at codon 158 in exon 4 of the CFTR gene ABCC7 was detected in an asymptomatic individual who carried deltaF508 and had a family history of cystic fibrosis (CF). Further study, using linkage, revealed that S158N was coupled with deltaF508, both having been inherited from the same parent. The clinical implications of double mutations in the same allele are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Novel fragments with sizes not compatible with 621 1 1G R T, Y122X, or any other previously described CF mutation in this exon (www.genet.sickkids. Login to comment

[hide] Mutation analysis of the cystic fibrosis transmemb... Eur J Hum Genet. 2003 Sep;11(9):687-92. Perri F, Piepoli A, Stanziale P, Merla A, Zelante L, Andriulli A
Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis.
Eur J Hum Genet. 2003 Sep;11(9):687-92., [PMID:12939655]

Abstract [show]
Susceptibility to alcoholic chronic pancreatitis (ACP) could be genetically determined. Mutations in cationic trypsinogen (PRSS1), cystic fibrosis transmembrane conductance regulator (CFTR), and serine protease inhibitor, Kazal type 1 (SPINK1) genes have been variably associated with both the hereditary and the idiopathic form of chronic pancreatitis (CP). Our aim was to analyze the three genes in ACP patients. Mutational screening was performed in 45 unrelated ACP patients and 34 patients with alcoholic liver disease (ALD). No mutation of PRSS1 was found in ACP and ALD patients. Three mutations of CFTR were detected in four ACP patients with a prevalence (8.9%) not significantly different from that observed (3.0%) in ALD patients and from that expected (3.2%) in our geographical area. Neither compound heterozygotes for CFTR nor trans-heterozygotes for CFTR/SPINK1 were found. One ACP patient (2.2%) was found to carry the most common mutation (N34S) of SPINK1 compared to none of the ALD patients (P=NS). In five other patients (two with ACP and three with ALD) other rare variants, including P55S, were found. In contrast with the hereditary and the idiopathic forms of CP, in which mutations of PRSS1, CFTR, and SPINK1 genes may occur, ACP is still a "gene(s)-orphan" disease. The supposed genetic susceptibility to ACP relies on other yet unknown gene(s) which could affect the alcohol metabolism or modulate the pancreatic inflammatory response to alcohol abuse.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation. Login to comment

[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

[hide] Neonatal screening for cystic fibrosis: France ris... J Inherit Metab Dis. 2003;26(8):729-44. Farriaux JP, Vidailhet M, Briard ML, Belot V, Dhondt JL
Neonatal screening for cystic fibrosis: France rises to the challenge.
J Inherit Metab Dis. 2003;26(8):729-44., [PMID:14739679]

Abstract [show]
This paper describes the adjustments to the French neonatal screening programme required by the introduction of systematic screening for cystic fibrosis (CF), taking into account both the legal and statutory framework and the lessons of a pilot study carried out 10 years ago. The French association for the screening and prevention of infant handicaps (AFDPHE) has been mandated by its regulatory agencies to organize screening for CF in France (metropolitan and overseas territories). During the year 2001, expert groups (Technical Aspects, Information, Ethics and Genetics, Criteria for CF Centres, Protocol for the Care of a Newborn with CF) issued recommendations for the establishment of a national programme that would guarantee efficiency and adequate patient care from the time of diagnosis onward. The programme is based on a strategy combining immunoreactive trypsin (IRT) assay and the analysis of DNA mutations in dried blood samples obtained at 3 days of age. When an elevated IRT value is found, DNA analysis is performed on the same sample. Owing to the relative regional heterogeneity existing in France, 30 selected mutations are used, which provide 85% coverage. The Ethics and Genetics Committee recommended that, in order to avoid arousing anxiety by a recall, informed consent, according to the French legislation on bioethics, should be obtained for all neonates at birth by having the parents sign directly on the sampling paper. Information brochures for parents and health professionals have been designed. A new organization of patient care, involving the creation of CF centres recognized by the Ministry of Health, has been decided; all children diagnosed are to be referred to such centres, where they can be well cared for by a trained staff with sufficient means. The programme was implemented region by region in France, from the beginning of the year 2002 to early 2003. The expert groups still meet periodically to evaluate the implementation of the programme and to check that the terms of the agreement between the AFDPHE and the Social Security Agency are complied with.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
115 It will soon be upgraded to include a further 10 mutations (2789 þ 5G>A, 394delT, G85E, 1811 þ 1,6kbA>G, Y122X, 711 þ 1G>T, W846X2, Y1092X C>A, 3272 À 26A>G, 3120 þ 1G>A 320pb). Login to comment

[hide] Role of Cftr genotype in the response to chronic P... Am J Physiol Lung Cell Mol Physiol. 2004 Nov;287(5):L944-52. Epub 2004 Jul 9. van Heeckeren AM, Schluchter MD, Drumm ML, Davis PB
Role of Cftr genotype in the response to chronic Pseudomonas aeruginosa lung infection in mice.
Am J Physiol Lung Cell Mol Physiol. 2004 Nov;287(5):L944-52. Epub 2004 Jul 9., [PMID:15246977]

Abstract [show]
Patients with cystic fibrosis have a lesion in the cystic fibrosis transmembrane conductance regulator gene (CFTR), which is associated with abnormal regulation of other ion channels, abnormal glycosylation of secreted and cell surface molecules, and vulnerability to bacterial infection and inflammation in the lung usually leading to the death of these patients. The exact mechanism(s) by which mutation in CFTR leads to lung infection and inflammation is not clear. Mice bearing different mutations in the murine homolog to CFTR (Cftr) (R117H, S489X, Y122X, and DeltaF508, all backcrossed to the C57BL/6J background) were compared with respect to growth and in their ability to respond to lung infection elicited with Pseudomonas aeruginosa-laden agarose beads. Body weights of mice bearing mutations in Cftr were significantly smaller than wild-type mice at most ages. The inflammatory responses to P. aeruginosa-laden agarose beads were comparable in mice of all four Cftr mutant genotypes with respect to absolute and relative cell counts in bronchoalveolar lavage fluid, and cytokine levels (TNF-alpha, IL-1beta, IL-6, macrophage inflammatory protein-2, and keratinocyte chemoattractant) and eicosanoid levels (PGE2 and LTB4) in epithelial lining fluid: the few small differences observed occurred only between cystic fibrosis mice bearing the S489X mutation and those bearing the knockout mutation Y122X. Thus we cannot implicate either misprocessing of CFTR or failure of CFTR to reach the plasma membrane in the genesis of the excess inflammatory response of CF mice. Therefore, it appears that any functional defect in CFTR produces comparable inflammatory responses to lung infections with P. aeruginosa.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Mice bearing different mutations in the murine homolog to CFTR (Cftr) (R117H, S489X, Y122X, and ⌬F508, all backcrossed to the C57BL/6J background) were compared with respect to growth and in their ability to respond to lung infection elicited with Pseudomonas aeruginosa-laden agarose beads. Login to comment
17 The inflammatory responses to P. aeruginosa-laden agarose beads were comparable in mice of all four Cftr mutant genotypes with respect to absolute and relative cell counts in bronchoalveolar lavage fluid, and cytokine levels (TNF-␣, IL-1beta, IL-6, macrophage inflammatory protein-2, and keratinocyte chemoattractant) and eicosanoid levels (PGE2 and LTB4) in epithelial lining fluid: the few small differences observed occurred only between cystic fibrosis mice bearing the S489X mutation and those bearing the knockout mutation Y122X. Login to comment
49 In these experiments we tested cystic fibrosis mice bearing the ⌬F508, R117H, Y122X, or S489X genotypes, all backcrossed to the common C57BL/6J genetic background, using the mucoid P. aeruginosa agarose bead model to compare their inflammatory responses. Login to comment
56 Nomenclature rules available on the Jackson Laboratory website were followed; B6.129S6-Cftrtm2Uth mice bear the R117H mutation, and B6.129S6-Cftrtm3Uth mice bear the Y122X mutation. Login to comment
61 Cystic fibrosis mice bearing the severe mutations S489X, Y122X, and ⌬F508 were fed the liquid elemental diet Peptamen (Nestle Clinical Nutrition, Deerfield, IL) after weaning, whereas cystic fibrosis mice bearing the mild mutation R117H were fed a standard rodent chow until 1 wk before the start of the experiment at which point they were fed Peptamen until the termination of the experiment. Login to comment
78 At 3 wk of age mice were weighed and then weaned, at which point cystic fibrosis mice bearing the severe Cftr mutations S489X, Y122X, and ⌬F508 were fed a liquid diet. Login to comment
124 Cystic fibrosis mice bearing the severe Cftr mutations Y122X, S489X, and ⌬F508 weighed significantly less (P Ͻ 0.05) than homozygote wild-type controls at 7, 14, and 21 days of life with one exception; cystic fibrosis mice with the Y122X mutation did not differ significantly from wild-type mice at 7 days of age (P Ͼ 0.05), but sample sizes were small. Login to comment
133 Absolute body weight of cystic fibrosis mice before weaning Cftr Genotype Sample Size Age, days 7 14 21 S489X/S489X 14 3.0Ϯ0.6 5.8Ϯ0.9 7.0Ϯ1.1 Y122X/Y122X 4 3.6Ϯ1.7 6.1Ϯ2.3 7.2Ϯ2.5 ⌬F508/⌬F508 10 3.1Ϯ0.9 5.6Ϯ1.2 6.7Ϯ0.8 R117H/R117H 15 4.7Ϯ0.7* 7.1Ϯ0.9* 7.9Ϯ1.8 Data are represented as means Ϯ SD. Login to comment
145 That is, when comparisons were made between mice bearing the S489X mutation and those bearing the Y122X mutation, we combined data from experiments 68, 72, 80, and 94, taking into account any differences between the experiments. Login to comment
149 There were no significant differences in starting weight between cystic fibrosis mice bearing the S489X mutation and those bearing any other Cftr mutation (Fig. 3A). Login to comment
152 After differences between the experiments are taken into consideration (Fig. 3B), weight loss in cystic fibrosis mice bearing the S489X mutation is significantly greater than those bearing the Y122X mutation on days 1, 2, and 3 (P Ͻ 0.05) and significantly less than those bearing the R117H mutation on days 1 and 2 (P Ͻ 0.05). Login to comment
153 There were no significant differences in weight loss between cystic fibrosis mice bearing the S489X mutation and those bearing the ⌬F508 mutation. Login to comment
156 When stratifying for experiment, we found significant differences (P Ͻ 0.05) between cystic fibrosis mice bearing the Y122X mutation and those bearing the S489X mutation with Fig. 1. Login to comment
160 Cystic fibrosis mice bearing the S489X mutation were removed from this study to be used in other studies starting at 6 wk of age, and data are censored by death in cystic fibrosis mice bearing the Y122X mutation starting after 6 wk of age. Login to comment
167 In a comparison of S489X vs. Y122X, ⌬F508, and R117H genotypes, the available sample sizes provide 80% power to detect Fig. 2. Login to comment
171 The difference in nasal PD from the start of the response to 1 min later was determined, and representative tracings are shown to the end of the tracing period from wild type (A), S489X (B), Y122X (C), ⌬F508 (D), and R117H (E) mice. Login to comment
173 Nasal potential differences in wild-type mice and mice bearing mutations in Cftr Cftr Mutation Sample Size Amiloride, mV Chloride-free, Amiloride, Forskolin, mV None 3 -2.1Ϯ1.5 14.4Ϯ1.2 S489X 7 -13.2Ϯ5.1* -2.6Ϯ2.2* Y122X 3 -10.9Ϯ3.7 -0.8Ϯ1.3* ⌬F508 6 -7.6Ϯ3.5 -1.8Ϯ0.8* R117H 3 -8.5Ϯ0.1 0.1Ϯ0.8* Data are means Ϯ SD. Login to comment
176 Starting sample sizes in each experiment Experiment Mouse Strain by Cftr Mutation S489X Y122X ⌬F508 R117H 64 9 (1) 0 0 9 (1) 68 8 4 5 0 72 8 (1)* 8 0 0 75 7 (1) 0 11 (1) [2]* 0 80 9* 10 0 0 90† 10 0 10 0 94† 9 7* 9 (1) 9 (1)* Total 60 (3) 29 35 (2) [2] 18 (2) The number of mice that died due to surgical complications or pulmonary obstruction is noted in parentheses and brackets, respectively. Login to comment
181 When comparing the S489X to Y122X or ⌬F508 strains, we could detect even smaller differences with high power. Login to comment
196 Inflammatory mediators in epithelial lining fluid Parameter Comparison 1 Comparison 2 Comparison 3 Y122X S489X ⌬F508 S489X R117H S489X TNF-␣ 7.8* (5.1/13.1) 10.3 (6.0/14.3) 8.0 (6.7/12.2) 9.5 (7.2/12.4) 14.7 (5.9/23.5) 13.6 (9.1/22.3) IL-1beta 14.5* (5.6/19.3) 16.0 (7.5/25.7) 14.4 (10.0/20.2) 16.0 (8.2/20.2) 12.2 (3.0/32.6) 18.2 (8.1/24.3) IL-6 12.3 (5.9/28.4) 14.6 (7.9/33.1) 11.9 (7.8 (22.8) 13.4 (8.0/19.2) 16.6 (7.3/24.7) 20.8 (9.0/62.4) MIP-2 55.8 (12.1/86.3) 66.9 (34.8/107.3) 90.8 (58.8/129.7) 102.2 (48.0/140.8) 55.6 (21.2/202.5) 96.0 (37.6/131.5) KC 4.1 (3.3/5.5) 5.9 (3.5/7.8) 5.4 (4.1/9.4) 6.3 (4.8/8.6) 12.8 (5.0/15.8) 7.4 (4.6/10.7) LTB4 1.2 (0.2/3.3) 2.3 (1.3/7.8) 5.9 (3.6/10.5) 7.1 (2.3/10.5) 2.1 (1.2/16.7) 2.3 (1.3/7.8) PGE2 4.4 (2.3/6.0) 8.0 (4.4/12.2) 11.4 (7.3/16.6) 12.9 (7.6/22.0) 9.2 (5.9/13.5) 8.0 (4.4/12.2) Data are pooled from available data, are represented as the median (25th/75th percentiles), and are expressed as ng/ml epithelial lining fluid (ELF). Login to comment
207 Correcting the Cftr defect in the gut of cystic fibrosis mice bearing the S489X mutation, by transgenic provision of human CFTR driven by the fatty acid binding protein promoter, results in a much more robust cystic fibrosis mouse that grows normally and does not have intestinal obstruction on a diet of normal mouse chow. Login to comment
210 In this model of lung infection and inflammation, four different genotypes of cystic fibrosis mice were tested: two knockout mice, Y122X and S489X; mice homozygous for the major processing mutation in cystic fibrosis, ⌬F508; and mice homozygous for a channel mutant, R117H, which reaches the plasma membrane but does not function normally. Login to comment
211 None of the cystic fibrosis mice studied here grows as well as their wild-type littermates, although the cystic fibrosis mice bearing the R117H mutation maintain weight better at week 1 of life. Login to comment
214 Here we show that cystic fibrosis mice bearing the Cftr mutations S489X, ⌬F508, Y122X, and R117H on the congenic C57BL/6J background also display the cystic fibrosis electrophysiological phenotype. Login to comment
227 Cell numbers in BAL fluid Parameter Comparison 1 Comparison 2 Comparison 3 Y122X S489X ⌬F508 S489X R117H S489X %AM 5.3 (2.8/41.1) 6.0 (4.3/11.9) 5.8 (3.3/8.7) 4.3 (2.4/5.9) 12.7 (5.8/25.0) 4.7 (4.3/7.4) %PMN 94.3 (58.9/96.9) 94.0 (87.3/95.6) 94.2 (91.3/96.7) 95.3 (94.1/97.6) 87.3* (75.0/94.2) 95.0 (92.6/95.3) %Lymph 0.0 (0.0/0.7) 0.0 (0.0/1.3) 0.0 (0.0/0.0) 0.0 (0.0/0.0) 0.0 (0.0/0.0) 0.0 (0.0/0.0) AM/ml 36 (12/66) 34 (15/72) 47 (23/88) 60 (12/126) 104* (32/168) 78 (56/102) PMN/ml 787 (14/1,449) 801 (422/1,528) 850 (396/1,310) 1,378 (423/1,714) 857 (415/1,549) 1,520 (1,125/1,716) Data are pooled from available data and are represented as the median (25th/75th percentiles). Login to comment
243 Only the cystic fibrosis mice bearing the Y122X mutation differed in two cytokines from S489X, and this may represent the effect of multiple comparisons, rather than a real difference between them. Login to comment
13 Mice bearing different mutations in the murine homolog to CFTR (Cftr) (R117H, S489X, Y122X, and ⌬F508, all backcrossed to the C57BL/6J background) were compared with respect to growth and in their ability to respond to lung infection elicited with Pseudomonas aeruginosa-laden agarose beads. Login to comment
46 In these experiments we tested cystic fibrosis mice bearing the ⌬F508, R117H, Y122X, or S489X genotypes, all backcrossed to the common C57BL/6J genetic background, using the mucoid P. aeruginosa agarose bead model to compare their inflammatory responses. Login to comment
53 Nomenclature rules available on the Jackson Laboratory website were followed; B6.129S6-Cftrtm2Uth mice bear the R117H mutation, and B6.129S6-Cftrtm3Uth mice bear the Y122X mutation. Login to comment
58 Cystic fibrosis mice bearing the severe mutations S489X, Y122X, and ⌬F508 were fed the liquid elemental diet Peptamen (Nestle Clinical Nutrition, Deerfield, IL) after weaning, whereas cystic fibrosis mice bearing the mild mutation R117H were fed a standard rodent chow until 1 wk before the start of the experiment at which point they were fed Peptamen until the termination of the experiment. Login to comment
75 At 3 wk of age mice were weighed and then weaned, at which point cystic fibrosis mice bearing the severe Cftr mutations S489X, Y122X, and ⌬F508 were fed a liquid diet. Login to comment
121 Cystic fibrosis mice bearing the severe Cftr mutations Y122X, S489X, and ⌬F508 weighed significantly less (P Ͻ 0.05) than homozygote wild-type controls at 7, 14, and 21 days of life with one exception; cystic fibrosis mice with the Y122X mutation did not differ significantly from wild-type mice at 7 days of age (P Ͼ 0.05), but sample sizes were small. Login to comment
130 Absolute body weight of cystic fibrosis mice before weaning Cftr Genotype Sample Size Age, days 7 14 21 S489X/S489X 14 3.0Ϯ0.6 5.8Ϯ0.9 7.0Ϯ1.1 Y122X/Y122X 4 3.6Ϯ1.7 6.1Ϯ2.3 7.2Ϯ2.5 ⌬F508/⌬F508 10 3.1Ϯ0.9 5.6Ϯ1.2 6.7Ϯ0.8 R117H/R117H 15 4.7Ϯ0.7* 7.1Ϯ0.9* 7.9Ϯ1.8 Data are represented as means Ϯ SD. Login to comment
142 That is, when comparisons were made between mice bearing the S489X mutation and those bearing the Y122X mutation, we combined data from experiments 68, 72, 80, and 94, taking into account any differences between the experiments. Login to comment
157 Cystic fibrosis mice bearing the S489X mutation were removed from this study to be used in other studies starting at 6 wk of age, and data are censored by death in cystic fibrosis mice bearing the Y122X mutation starting after 6 wk of age. Login to comment
164 In a comparison of S489X vs. Y122X, ⌬F508, and R117H genotypes, the available sample sizes provide 80% power to detect Fig. 2. Login to comment
168 The difference in nasal PD from the start of the response to 1 min later was determined, and representative tracings are shown to the end of the tracing period from wild type (A), S489X (B), Y122X (C), ⌬F508 (D), and R117H (E) mice. Login to comment
170 Nasal potential differences in wild-type mice and mice bearing mutations in Cftr Cftr Mutation Sample Size Amiloride, mV Chloride-free, Amiloride, Forskolin, mV None 3 -2.1Ϯ1.5 14.4Ϯ1.2 S489X 7 -13.2Ϯ5.1* -2.6Ϯ2.2* Y122X 3 -10.9Ϯ3.7 -0.8Ϯ1.3* ⌬F508 6 -7.6Ϯ3.5 -1.8Ϯ0.8* R117H 3 -8.5Ϯ0.1 0.1Ϯ0.8* Data are means Ϯ SD. Login to comment
178 When comparing the S489X to Y122X or ⌬F508 strains, we could detect even smaller differences with high power. Login to comment
193 Inflammatory mediators in epithelial lining fluid Parameter Comparison 1 Comparison 2 Comparison 3 Y122X S489X ⌬F508 S489X R117H S489X TNF-␣ 7.8* (5.1/13.1) 10.3 (6.0/14.3) 8.0 (6.7/12.2) 9.5 (7.2/12.4) 14.7 (5.9/23.5) 13.6 (9.1/22.3) IL-1beta 14.5* (5.6/19.3) 16.0 (7.5/25.7) 14.4 (10.0/20.2) 16.0 (8.2/20.2) 12.2 (3.0/32.6) 18.2 (8.1/24.3) IL-6 12.3 (5.9/28.4) 14.6 (7.9/33.1) 11.9 (7.8 (22.8) 13.4 (8.0/19.2) 16.6 (7.3/24.7) 20.8 (9.0/62.4) MIP-2 55.8 (12.1/86.3) 66.9 (34.8/107.3) 90.8 (58.8/129.7) 102.2 (48.0/140.8) 55.6 (21.2/202.5) 96.0 (37.6/131.5) KC 4.1 (3.3/5.5) 5.9 (3.5/7.8) 5.4 (4.1/9.4) 6.3 (4.8/8.6) 12.8 (5.0/15.8) 7.4 (4.6/10.7) LTB4 1.2 (0.2/3.3) 2.3 (1.3/7.8) 5.9 (3.6/10.5) 7.1 (2.3/10.5) 2.1 (1.2/16.7) 2.3 (1.3/7.8) PGE2 4.4 (2.3/6.0) 8.0 (4.4/12.2) 11.4 (7.3/16.6) 12.9 (7.6/22.0) 9.2 (5.9/13.5) 8.0 (4.4/12.2) Data are pooled from available data, are represented as the median (25th/75th percentiles), and are expressed as ng/ml epithelial lining fluid (ELF). Login to comment
224 Cell numbers in BAL fluid Parameter Comparison 1 Comparison 2 Comparison 3 Y122X S489X ⌬F508 S489X R117H S489X %AM 5.3 (2.8/41.1) 6.0 (4.3/11.9) 5.8 (3.3/8.7) 4.3 (2.4/5.9) 12.7 (5.8/25.0) 4.7 (4.3/7.4) %PMN 94.3 (58.9/96.9) 94.0 (87.3/95.6) 94.2 (91.3/96.7) 95.3 (94.1/97.6) 87.3* (75.0/94.2) 95.0 (92.6/95.3) %Lymph 0.0 (0.0/0.7) 0.0 (0.0/1.3) 0.0 (0.0/0.0) 0.0 (0.0/0.0) 0.0 (0.0/0.0) 0.0 (0.0/0.0) AM/ml 36 (12/66) 34 (15/72) 47 (23/88) 60 (12/126) 104* (32/168) 78 (56/102) PMN/ml 787 (14/1,449) 801 (422/1,528) 850 (396/1,310) 1,378 (423/1,714) 857 (415/1,549) 1,520 (1,125/1,716) Data are pooled from available data and are represented as the median (25th/75th percentiles). Login to comment
240 Only the cystic fibrosis mice bearing the Y122X mutation differed in two cytokines from S489X, and this may represent the effect of multiple comparisons, rather than a real difference between them. Login to comment

[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]

Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment

[hide] Comprehensive cystic fibrosis mutation epidemiolog... Ann Hum Genet. 2005 Jan;69(Pt 1):15-24. Castaldo G, Polizzi A, Tomaiuolo R, Cazeneuve C, Girodon E, Santostasi T, Salvatore D, Raia V, Rigillo N, Goossens M, Salvatore F
Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population.
Ann Hum Genet. 2005 Jan;69(Pt 1):15-24., [PMID:15638824]

Abstract [show]
We screened the whole coding region of the cystic fibrosis transmembrane regulator (CFTR) gene in 371 unrelated cystic fibrosis (CF) patients from three regions of southern Italy. Forty-three mutations detected 91.5% of CF mutated chromosomes by denaturing gradient gel electrophoresis analysis, and three intragenic CFTR polymorphisms predicted a myriad of rare mutations in uncharacterized CF chromosomes. Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711 + 1G > T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Several mutations frequently found in northern Italy (e.g., R1162X, 711 + 5G > T) and northern Europe (e.g., G551D, I507del and 621 + 1G > T) are absent from the studied population. The I148T-3195del6 complex allele was present in two CF chromosomes, whereas I148T was present in both alleles (as a single mutation) in another CF patient and in five CF carriers; this could result from crossover events. The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849 + 10kbC > T, 1717-1G > A, E585X, 3272-26G > A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events. Given the large population migration from southern Italy, knowledge of the CF molecular epidemiology in this area is an important contribution to diagnosis, counselling and interlaboratory quality control for molecular laboratories worldwide.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
14 Most mutations are "private," but some are frequent in specific regions or ethnic groups (Estivill et al. 1997): 2143delT in Germany (Dork et al. 1992), W1282X among Ashkenazim (Shoshani et al. 1992), Y122X in Reunion Island (Chevalier-Porst et al. 1992), 2183AA>G and R1162X in northeast Italy and T338I in Sardinia (Rendine et al. 1997). Login to comment

[hide] Multiple mutation analysis of the cystic fibrosis ... Mol Hum Reprod. 2005 Jun;11(6):463-8. Epub 2005 May 20. Sanchez-Garcia JF, Benet J, Gutierrez-Mateo C, Luis Seculi J, Monros E, Navarro J
Multiple mutation analysis of the cystic fibrosis gene in single cells.
Mol Hum Reprod. 2005 Jun;11(6):463-8. Epub 2005 May 20., [PMID:15908456]

Abstract [show]
PGD is becoming an alternative to prenatal diagnosis. The combination of IVF techniques with the PCR technology allows for the detection of genetic abnormalities in first polar bodies from oocytes and blastomeres from cleavage-stage embryos. Dealing with a genetic disease with a heterogeneous spectrum of mutations like cystic fibrosis, one of the objectives of centres offering PGD is the application of simple and efficient protocols that allow for the detection of a wide range of mutations with a single procedure. In the present work, 29 normal loci and the 31 most frequent cystic fibrosis transmembrane conductance regulator (CFTR) mutations in Southern Europe could be detected at the same time in single cells applying a modified and improved primer extension preamplification-PCR. Two different Taq polymerases were tested in isolated buccal cells heterozygous for several mutations. The protocol that gave statistically significant better results was also successful in oocytes and their first polar bodies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 G, R1162X, 3659delC, W1282X, 3905insT, N1303K, 1078delT, R347P, R347H and R334W labelled with TET (green) and A455E, 1898þ1G.A, 2183AA.G, 2789þ5G.A, G85E, 621þ1G.T, R117H, Y122X and 711þ1G.T labelled with HEX (yellow). Login to comment

[hide] Down-regulation of the anti-inflammatory protein a... Mol Cell Proteomics. 2005 Oct;4(10):1591-601. Epub 2005 Jul 12. Bensalem N, Ventura AP, Vallee B, Lipecka J, Tondelier D, Davezac N, Dos Santos A, Perretti M, Fajac A, Sermet-Gaudelus I, Renouil M, Lesure JF, Halgand F, Laprevote O, Edelman A
Down-regulation of the anti-inflammatory protein annexin A1 in cystic fibrosis knock-out mice and patients.
Mol Cell Proteomics. 2005 Oct;4(10):1591-601. Epub 2005 Jul 12., [PMID:16014420]

Abstract [show]
Cystic fibrosis is a fatal human genetic disease caused by mutations in the CFTR gene encoding a cAMP-activated chloride channel. It is characterized by abnormal fluid transport across secretory epithelia and chronic inflammation in lung, pancreas, and intestine. Because cystic fibrosis (CF) pathophysiology cannot be explained solely by dysfunction of cystic fibrosis transmembrane conductance regulator (CFTR), we applied a proteomic approach (bidimensional electrophoresis and mass spectrometry) to search for differentially expressed proteins between mice lacking cftr (cftr(tm1Unc), cftr-/-) and controls using colonic crypts from young animals, i.e. prior to the development of intestinal inflammation. By analyzing total proteins separated in the range of pH 6-11, we detected 24 differentially expressed proteins (>2-fold). In this work, we focused on one of these proteins that was absent in two-dimensional gels from cftr-/- mice. This protein spot (molecular mass, 37 kDa; pI 7) was identified by mass spectrometry as annexin A1, an anti-inflammatory protein. Interestingly, annexin A1 was also undetectable in lungs and pancreas of cftr-/- mice, tissues known to express CFTR. Absence of this inhibitory mediator of the host inflammatory response was associated with colonic up-regulation of the proinflammatory cytosolic phospholipase A2. More importantly, annexin A1 was down-regulated in nasal epithelial cells from CF patients bearing homozygous nonsense mutations in the CFTR gene (Y122X, 489delC) and differentially expressed in F508del patients. These results suggest that annexin A1 may be a key protein involved in CF pathogenesis especially in relation to the not well defined field of inflammation in CF. We suggest that decreased expression of annexin A1 contributes to the worsening of the CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 More importantly, annexin A1 was down-regulated in nasal epithelial cells from CF patients bearing homozygous nonsense mutations in the CFTR gene (Y122X, 489delC) and differentially expressed in F508del patients. Login to comment
48 Nasal Epithelial Cells from CF Patients-Six CF patients with a Y122X/Y122X nonsense mutation were followed up in the CF centers at the Saint Pierre Children Hospital and at Saint Denis Children Hospital (La Re´ union, France). Login to comment
156 Six CF patients, bearing the Y122X/Y122X nonsense mutation and one homozygous for 489delC, both predicted to encode a truncated protein ending at part of the second transmembrane domain of the CFTR protein, were analyzed. Login to comment
160 First, we conducted an immunocytochemistry investigation to confirm the absence of CFTR in nasal epithelial cells from Y122X/Y122X and 489delC patients (data not shown). Login to comment
259 d-f, annexin A1 staining could not be detected in CF patients bearing the Y122X/ Y122X mutation (d and f); slight staining was observed in another Y122X/Y122X CF patient (e). Login to comment
262 CF patients Age Sweat test FEV1 a Annexin A1 staining Severity yr meq/liter % Y122X/Y122X 18 126 99 - Mild Y122X/Y122X 13 103 78 ϩ/- Mild Y122X/Y122X 22 108 80 - Mild Y122X/Y122X 14 116 76 - Mild Y122X/Y122X 15 90 62 - Mild 489delC/489delC 12 130 89 - Severe F508del/ F508del 15 98 77 ϩϩ Mild F508del/ F508del 2 ND ND ϩϩ Mild F508del/ F508del 11 110 60 ϩ Severe a Forced expiratory volume. Login to comment

[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 In effect, virtually no func- Table 2 Unusually Common Cystic Fibrosis Mutations in Specific Populationsa Total Exon/ Number Number Frequency Mutation Intron Ethnic Origin Observed Screened (%) 296+12T→C intron 02 Pakistani 02 24 8.33 E60X exon 03 Belgian 06 394 1.52 G91R exon 03 French 04 266 1.50 394delTT exon 03 Scandinavian 78 1588 4.91 457TAT→G exon 04 Austrian 04 334 1.20 Y122X exon 04 Réunion Island 14 29 48.27 I148T exon 04 French Canadian 06 66 9.09 711+5G→A intron 05 Italian (North East) 06 225 2.67 1078delT exon 07 Celtic 27 475 5.68 1161delC exon 07 Pakistani 02 24 8.33 T338I exon 07 Italian, Sardinian 04 86 4.65 Q359K/T360K exon 07 Georgian Jews 07 8 87.50 R347H exon 07 Turkish 04 134 2.98 1609delCA exon 10 Spanish 03 96 3.12 1677delTA exon 10 Bulgarian 05 222 2.25 S549I exon 11 Arabs 02 40 5.00 Q552X exon 11 Italian (North East) 03 225 1.33 A559T exon 11 African-American 02 79 2.53 1811+1.2kbA→G intron 11 Spanish 22 1068 2.06 1898+5G→T intron 12 Chinese 03 10 30.00 1949del84 exon 13 Spanish 02 136 1.47 2143delT exon 13 Russian 04 118 3.39 2183AA→G exon 13 Italian (North East) 21 225 9.33 2184insA exon 13 Russian 03 118 2.54 3120+1G→A intron 16 African-American 14 112 12.50 3272-26A→G intron 17a Portugese, French 06 386 1.55 R1066C exon 17b Portugese 05 105 4.76 R1070Q exon 17b Bulgarian 04 166 2.41 Y1092X exon 17b French Canadian, 11 725 1.52 French M1101K exon 17b Hutterite 22 32 68.75 3821delT exon 19 Russian 03 118 2.54 S1235R exon 19 French (South) 04 340 1.18 S1251N exon 20 Dutch, Belgian 11 792 1.39 S1255X exon 20 African-American 02 79 2.53 3905insT exon 20 Swiss 45 982 4.58 Amish, Arcadian 13 86 15.12 W1282X Exon 20 Jewish-Ashkenazi 50 95 52.63 R1283M exon 20 Welsh 03 183 1.64 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/. Login to comment
67 SSCP analysis is one of the most popular methods for the detection of sequence variants in polymerase chain reaction (PCR) amplified DNA fragments.29 The princi- Table 3 Cystic Fibrosis Mutations Detected by Commercial Kits INNO-LiPA Mutations CF2 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K CFTR12 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K, S1251N, R560T, 3905insT, Q552X CFTR17+Tn 394delTT, G85E, 621+1G→T, R117H, 1078delT, R347P, R334W, E60X, 2183AA→G, 2184delA, 711+5G→A, 2789+5G→A, R1162X, 3659delC, 3849+10kbC→T, 2143delT, A455E, (5T/7T/9T) Elucigene CF4 ⌬F508, G542X, G551D, 621+1G→T CF12 ⌬F508, G542X, G551D, N1303K, W1282X, 1717-1G→A, R553X, 621+1G→T, R117H, R1162X, 3849+10kbC→T, R334W CF20 1717-1G→A, G542X, W1282X, N1303K, ⌬F508, 3849+10kbC→T, 621+1G→T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA→G, 3659delC, 1078delT, ⌬I507, R345P, S1251N, E60X CF Poly-T 5T/7T/9T OLA CF OLA assay ⌬F508, F508C, ⌬I507, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183AA→G, 2789+5G→A b Figure 2 Mutation screening of exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene using polymerase chain reaction (PCR) followed by single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis on a silver-stained polyacrylamide gel. Login to comment

[hide] A comparison of high-resolution melting analysis w... Am J Clin Pathol. 2005 Sep;124(3):330-8. Chou LS, Lyon E, Wittwer CT
A comparison of high-resolution melting analysis with denaturing high-performance liquid chromatography for mutation scanning: cystic fibrosis transmembrane conductance regulator gene as a model.
Am J Clin Pathol. 2005 Sep;124(3):330-8., [PMID:16191501]

Abstract [show]
High-resolution melting analysis (HRMA) was compared with denaturing high-performance liquid chromatography (dHPLC) for mutation scanning of common mutations in the cystic fibrosis transmembrane conductance regulator gene. We amplified (polymerase chain reaction under conditions optimized for melting analysis or dHPLC) 26 previously genotyped samples with mutations in exons 3, 4, 7, 9, 10, 11, 13, 17b, and 21, including 20 different genotypes. Heterozygous mutations were detected by a change in shape of the melting curve or dHPLC tracing. All 20 samples with heterozygous mutations studied by both techniques were identified correctly by melting (100% sensitivity), and 19 were identified by dHPLC (95% sensitivity). The specificity of both methods also was good, although the dHPLC traces of exon 7 consistently revealed 2 peaks for wild-type samples, risking false-positive interpretation. Homozygous mutations could not be detected using curve shape by either method. However, when the absolute temperatures of HRMA were considered, G542X but not F508del homozygotes could be distinguished from wild type. HRMA easily detected heterozygotes in all single nucleotide polymorphism (SNP) classes (including A/T SNPs) and 1- or 2-base-pair deletions. HRMA had better sensitivity and specificity than dHPLC with the added advantage that some homozygous sequence alterations could be identified. HRMA has great potential for rapid, closed-tube mutation scanning.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 Materials and Methods Sample Source and Study Design Eleven commercially genotyped samples were obtained from Coriell Cell Repositories, Coriell Institute for Medical Research, Camden, NJ (Y122X, R334W, R347P, A455E, I507del, F508del, F508C, G542X/G542X, R553X, R560T, and M1101K). Login to comment
31 ❚Table 1❚ Mutations Analyzed in the Study Position From 5' Exon (or Intron) Genotype* No. of Samples Nucleotide Change SNP Class† End/Amplicon Size (bp) 3 394delTT 1 Del‡ - 132/234 4 R117H 1 G→A 1 83/270 Y122X 1 T→A 4 99/270 I148T 2 T→C 1 176/270 Intron 4 621+1 2 G→T 2 233/270 7 R334W 1 C→T 1 208/345 R347P 1 G→C 3 248/345 9 A455E 2 C→A 2 155/263 10 I507del 1 Del‡ - 171/292 F508del 3 Del‡ - 174/292 F508del/F508del 1 Del - 174/292 F508C 1 T→G 2 175/292 11 G542X 1 G→T 2 90/175 G542X/G542X 1 G→T 2 90/175 G551D 1 G→A 1 118/175 R553X 2 C→T 1 123/175 R560T 1 G→C 3 145/175 13 2184delA 1 Del‡ - 356/458 17b M1101K 1 T→A 4 196/292 21 N1303K 1 C→G 3 175/250 bp, base pairs; SNP, single nucleotide polymorphism. Login to comment
39 Mutation Scanning by dHPLC Twenty-two of the samples (all except 394delTT, Y122X, 2184delA, and M1101K) also were amplified under conditions optimized for dHPLC with the same primers (Transgenomic, Omaha, NE). Login to comment
90 Y122X and M1101K are both class 4 SNPs20 (A/T heterozygotes), a class otherwise absent from our study. Login to comment
113 To discriminate differences at single base resolution, saturating DNA Temperature (°C) Fluorescence 81 82 83 84 85 86 87 88 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - Y122X het A::A T::T WT T::A Temperature (°C) Fluorescence 79 80 81 82 83 84 85 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - 2184delA het WT Temperature (°C) Fluorescence 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - M1101K het A::A T::T WT T::A Temperature (°C) Fluorescence 77 78 79 80 81 82 83 84 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - 394delTT het WT A B C D ❚Figure 5❚ High-resolution melting detection of heterozygous A/T single nucleotide polymorphisms and small (1-2 base pair) deletions. Login to comment

[hide] Indirect CFTR mutation identification by PCR/OLA a... Genet Test. 2005 Winter;9(4):285-91. Stanziale P, Savino M, De Bonis P, Granatiero M, Zelante L, Bisceglia L
Indirect CFTR mutation identification by PCR/OLA anomalous electropherograms.
Genet Test. 2005 Winter;9(4):285-91., [PMID:16379540]

Abstract [show]
Mutations of CFTR gene are responsible for cystic fibrosis (CF) and other clinical conditions such as congenital absence of the vas deferens (CAVD), chronic pancreatitis (IP), and idiopathic disseminated bronchiectasis (DBE) classified as CFTR-related disorders. The PCR/OLA assay is designed to detect 31 known mutations including the 24 most common CF mutations worldwide, as identified by the CF Consortium. In order to define the CFTR genotype a series of 1812 individuals from central-southern Italy with and without CF manifestations were screened by using the PCR/OLA assay. Here we report the description of five cases of anomalous electropherograms obtained after PCR/OLA analysis, that led to the identification, in the homozygous state, of two point mutations (D110H and S589N) not included in the assay test panel, a large gene deletion (CFTRdel14b_17b), and an exonic polymorphism (c.4002A > G). Haplotype and real time PCR analysis were also performed in the subject carrying the large CFTR deletion. The study demonstrates that the PCR/OLA assay, besides being an efficient and user-friendly method to screen known mutations in the CFTR gene, may also function as a mutation/polymorphism-scanning assay, at least for certain nucleotide changes located in some critical regions of the gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Case 1 In a 34-year-old male subject affected by obstructive azoospermia resulting from CBAVD diagnosed by scrotal exploration and impalpable vasa clinically observed, no signal could be obtained at either the wild-type or the mutated site with the allele-specific probes R117H, Y122X and 621 ϩ 1G Ͼ T (Fig. 1). Login to comment

[hide] Detection of F508del mutation in cystic fibrosis t... Singapore Med J. 2006 Feb;47(2):129-33. Zilfalil BA, Sarina S, Liza-Sharmini AT, Oldfield NJ, Stenhouse SA
Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays.
Singapore Med J. 2006 Feb;47(2):129-33., [PMID:16435054]

Abstract [show]
INTRODUCTION: Cystic fibrosis (CF) is one of the common genetic disorders in the western world. It has been reported to be very rare in Asian populations. According to the Cystic Fibrosis Genetic Analysis Consortium, more than 1,000 mutations of the CF gene have been identified. The CF gene, named the cystic fibrosis transmembrane conductance regulator (CFTR), is located on chromosome 7 and composed of 27 exons. This study aims to detect possible CFTR gene mutations in Malays. METHODS: We analysed 50 blood samples from healthy Malays with no symptoms of CF. DNA was extracted from blood using commercially available extraction kits (Eppendorf, Germany). Identification of CFTR gene mutation was performed using the CF OLA (Oligonucleotide Ligation Assay) kit (Applied Biosystems, USA). The PCR-ligation products were electrophoresed on eight percent sequagel using an ABI PRISM 377 genetic analyser (Applied Biosystems, USA). Electrophoresis data was analysed using the Genotyper software and a report of the CF genotype for all loci tested was created using the CF Genotyper Template software. Out of 50, one sample (two percent) was detected to have the F508del mutation (3bp deletion at exon 10), which is one of the most common CFTR gene mutations in Caucasians. RESULTS: The F508del mutation allele was detected in one subject. This indicates that she was a CF carrier. CONCLUSION: We report the finding of a carrier of the F508del mutation of the CFTR gene in the Malay population. Our finding revealed that CF could also affect the Malay population. Larger studies are necessary to determine the exact gene frequency of this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 MUTATIONS R553X G551D 1507 del F508 del 1717-1 G>A G542X R560T R347P W1282X R334W 1078 Del T 3849 + 10KB C>T R1162X N1303K 3659 Del C A455E R117H 2183 AA>G 2789+5 G>A 1898 +1 G>A 621+1 G>T 711+1 G>T G85E S549N S549R V520F Q493X R347H 3849 +4 A>G 3905 INS T Y122X 4 software before running the gel electrophoresis in 1X TBE using ABI PRISM® 377 Genetic Analyzer (Applied Biosystems, USA) for 45 minutes. Login to comment

[hide] Cystic fibrosis enters the proteomics scene: new a... Proteomics. 2006 Jul;6(14):4084-99. Ollero M, Brouillard F, Edelman A
Cystic fibrosis enters the proteomics scene: new answers to old questions.
Proteomics. 2006 Jul;6(14):4084-99., [PMID:16791827]

Abstract [show]
The discovery in 1989 of the gene encoding for the cystic fibrosis transmembrane conductance regulator (CFTR) and its mutation as the primary cause of cystic fibrosis (CF), generated an optimistic reaction with respect to the development of potential therapies. This extraordinary milestone, however, represented only the initial key step in a long path. Many of the mechanisms that govern the pathogenesis of CF, the most commonly inherited lethal pulmonary disorder in Caucasians, remain even today unknown. As a continuation to genomic research, proteomics now offers the unique advantage to examine global alterations in the protein expression patterns of CF cells and tissues. The systematic use of this approach will probably provide new insights into the cellular mechanisms involved in CF dysfunctions, and should ultimately result in the finding of new prognostic markers, and in the generation of new therapies. In this article we review the current status of proteomic research applied to the study of CF, including CFTR-related interactomics, and evaluate the potential of these technologies for future investigations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
184 It is worth noting that annexin-1 expression in nasal cells from patients bearing the homozygous nonsense mutation Y122X, a genotype that resembles that of cftr2/2 mice, was strongly diminished as compared to healthy subjects, suggesting that annexin-1 expression may be related to CF pathogenesis. Login to comment

[hide] In vitro prediction of stop-codon suppression by i... BMC Med. 2007 Mar 29;5:5. Sermet-Gaudelus I, Renouil M, Fajac A, Bidou L, Parbaille B, Pierrot S, Davy N, Bismuth E, Reinert P, Lenoir G, Lesure JF, Rousset JP, Edelman A
In vitro prediction of stop-codon suppression by intravenous gentamicin in patients with cystic fibrosis: a pilot study.
BMC Med. 2007 Mar 29;5:5., [PMID:17394637]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is caused by mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) protein, which acts as a chloride channel activated by cyclic AMP (cAMP). The most frequent mutation found in 70% of CF patients is F508del, while premature stop mutations are found in about 10% of patients. In vitro aminoglycoside antibiotics (e.g. gentamicin) suppress nonsense mutations located in CFTR permitting translation to continue to the natural termination codon. Pharmacologic suppression of stop mutations within the CFTR may be of benefit to a significant number of patients. Our pilot study was conducted to determine whether intravenous gentamicin suppresses stop codons in CF patients and whether it has clinical benefits. METHODS: A dual gene reporter system was used to determine the gentamicin-induced readthrough level of the most frequent stop mutations within the CFTR in the French population. We investigated readthrough efficiency in response to 10 mg/kg once-daily intravenous gentamicin perfusions in patients with and without stop mutations. Respiratory function, sweat chloride concentration, nasal potential difference (NPD) and CFTR expression in nasal epithelial cells were measured at baseline and after 15 days of treatment. RESULTS: After in vitro gentamicin incubation, the readthrough efficiency for the Y122X mutation was at least five times higher than that for G542X, R1162X, and W1282X. In six of the nine patients with the Y122X mutation, CFTR immunodetection showed protein at the membrane of the nasal epithelial cells and the CFTR-dependent Cl- secretion in NPD measurements increased significantly. Respiratory status also improved in these patients, irrespective of the gentamicin sensitivity of the bacteria present in the sputum. Mean sweat chloride concentration decreased significantly and normalised in two patients. Clinical status, NPD and sweat Cl- values did not change in the Y122X patients with no protein expression, in patients with the other stop mutations investigated in vitro and those without stop mutations. CONCLUSION: Suppression of stop mutations in the CFTR gene with parenteral gentamicin can be predicted in vitro and is associated with clinical benefit and significant modification of the CFTR-mediated Cl- transport in nasal and sweat gland epithelium.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Results: After in vitro gentamicin incubation, the readthrough efficiency for the Y122X mutation was at least five times higher than that for G542X, R1162X, and W1282X. Login to comment
9 In six of the nine patients with the Y122X mutation, CFTR immunodetection showed protein at the membrane of the nasal epithelial cells and the CFTR-dependent Cl-secretion in NPD measurements increased significantly. Login to comment
13 Clinical status, NPD and sweat Cl- values did not change in the Y122X patients with no protein expression, in patients with the other stop mutations investigated in vitro and those without stop mutations. Login to comment
27 Methods Readthrough quantification in cell culture A dual gene reporter system was used to quantify the readthrough efficiency directed by the most frequent stop mutations in the French population (Y122X, G542X, R1162X and W1282X) [10], in the presence or absence of gentamicin. Login to comment
65 Table 1: Oligonucleotide sequences used in the dual reporter gene assay, corresponding to the Y122X, G542X, R1162X and W1292X mutations and the TQ in frame control. Login to comment
67 Readthrough level (%)* Mutation Oligonucleotides** 0 600 μg/ml gentamicin Y122X w 5' CGCTCTATCGCGTAACTAGGCATAGGC 3'; c 5' GCCTATGCCTAGTTACGCGATAGAGCG 3' 0.52 1.6 W1282X w 5` AATATAGTTCTTTGAGAAGGTGGAATC 3` c 5` GATTCCACCTTCTCAAAGAACTATATT 3` 0.115 0.35 R1162X w 5' CGATCTGTGAGCTGAGTCTTTAAGTTC 3'; c 5' GAACTTAAAGACTCAGCTCACAGATCG 3' 0.023 0.22 G542X w 5' ACTTTGCAACAGTGAAGGAAAGCCTTT 3'; c 5' AAAGGCTTCCTTCACTGTTGCAAAGT 3' 0.017 0.26 TQ: in frame control w 5' GCAGGAACACAACAGCAATTACAG 3' c 5' CTGTAATTGCTGTTGTGTTCCTGC 3' 100 100 *At least five independent experiments were performed with each construct and showed less than 20% variation. Login to comment
80 Y122X had a basal readthrough level five times higher than that for the W1282X mutation, 22 times that for R1162X and 30 times that for G542X. Login to comment
81 After gentamicin incubation, Y122X readthrough efficiency remained at least 4.5 times higher than that for W1282X, six times that for G542X and 7.3 that for R1162X. Login to comment
82 We therefore decided to focus the clinical trial on patients with the Y122X mutation. Login to comment
84 Nine carried the Y122X mutation (eight were Y122X homozygous and one was Y122X/F508del) (Group A). Login to comment
90 Clinical scores for the nine patients with the Y122X mutation (Group A) improved significantly at the end of the study, mainly because of improvements in coughing, sputum production, dyspnea and energy level. Login to comment
102 These levels decreased significantly after treatment among patients with the Y122X mutation (Group A) (Tables 3 and 5; Figure 1). Login to comment
114 In contrast to the patients with the Y122X mutation, the patients with other stop mutations (Group B) and those without any stop mutations (Group C) had no significant modifications of their basal potential difference or response to amiloride or isoproterenol (Table 5). Login to comment
116 The effect of parenteral gentamicin on CFTR was analysed in patients who agreed to nasal brushing, i.e., seven Y122X homozygous patients, one compound F508del/Y122X patient, one R1162X homozygous patient, and the five patients without stop mutations. Login to comment
117 Before gentamicin treatment, no CFTR labeling was observed in any of the Y122X homozygous patients (see representative picture in Figure 2c), while afterwards, five patients expressed CFTR at the membrane in 10 to 80% of cells (Figure 2d). Login to comment
120 Before treatment, cytoplasmic labeling in the compound heterozygous Y122X/ΔF508 patient was found in 20% of the cells with 24-1 antibody and 70% of the cells with MATG 1061 antibody and, after treatment, in 70% and 100% of the cells, respectively. Login to comment
122 Among the Y122X responders, CFTR-depend- Table 3: Characteristics of the subjects with stop codon mutations and variation of clinical and functional parameters after treatment with gentamicin. Login to comment
131 Patients Group A n = 9 Group B n = 4 Group C n = 5 p Group A vs. B p Group A vs. C p Group B vs. C Age 15.4(4.2) 12(1.8) 16.5(1.7) NS NS NS CFCS 31(8) 26(2) 24(2) NS NS NS FEV1 (%) 69(21) 80(12) 74(10) NS NS NS FVC (%) 70(20) 83(7) 84(22) NS NS NS FEF25-75 (%) 46(30) 67(26) 54(26) NS NS NS Group A: patients with the Y122X stop mutation. Group B: patients with another stop mutation. Group C: patients without any stop mutation. CFCS refers to the Cystic Fibrosis Clinical Score. FEV1, FVC, FEF25-75 refer respectively to forced expiratory volume in one second, forced vital capacity, and forced expiratory flow at 25 to 75 percent of vital capacity and are expressed as percentages of predicted values for age, sex, and height. Login to comment
140 Overall, the pattern of the in vitro readthrough, clearly most efficient for the Y122X mutation, was strongly correlated with the immunocytochemically determined CFTR expression in nasal cells, as assessed by the CFTR staining after treatment for the Y122X patients, compared with the lack of staining in both the R1162X patient and the patients without stop mutations. Login to comment
142 In patients carrying the Y122X mutation, gentamicin treatment resulted in delivery of the CFTR protein at the membrane and in restoration of CFTR-dependent chloride transport in nasal epithelial cells. Login to comment
157 Group A n = 9 Group B n = 4 Group C n = 5 D0 D15 p D0 D15 p D0 D15 p CFCS 30(8) 21(8) 0.007 25(1) 22 (1) NS 23.5(2) 23(3) NS FEV1(L) 1.82(0.8) 2.07(0.8) 0.04 1.68(0.4) 1.77(0.3) NS 2(0.3) 2.12(0.4) NS FVC(L) 2.2(1) 2.36(0.9) NS 2.08(0.6) 2.14(0.5) NS 2.93(0.5) 3(0.4) NS FEF25-75(L) 1.54(1.1) 1.95(1.06) NS 1.91(0.9) 1.96(0.8) NS 1.93(1.8) 1.99(1.8) NS Group A: patients with the Y122X stop mutation. Group B: patients with another stop mutation. Group C: patients without any stop mutation. CFCS refers to the Cystic Fibrosis Clinical Score. FEV1, FVC, FEF25-75 as defined in Table 2 and are expressed as absolute values. Login to comment
164 Group A n = 9 Group B n = 4 Group C n = 5 Patients D0 D15 p D0 D15 p D0 D15 p Sweat chloride (mM/L) 109(17) 85(31) 0.03 110(7) 112(16) NS 96(1.5) 105(18) NS Basal PD -56(10) -49(5) 0.12 -53(11) -50(8) NS -52(8) -52(7) NS ΔAmiloride 20(6) 15(7) 0.09 22(15) 20(9) NS 19(12) 21(13) NS ΔCl-free-isoproterenol -0.8(1.3) -4.6(6) 0.04 -0.2(0.5) -0.9(1) NS 0(0.5) -0.8(1) NS Group A: patients with the Y122X stop mutation. Group B: patients with another stop mutation. Group C: patients without any stop mutation. Login to comment
167 Sweat chloride concentration and ΔCl-free-isoproterenol before and after gentamicin in Y122X patients (●)Figure 1 Sweat chloride concentration and ΔCl-free-isoproterenol before and after gentamicin in Y122X patients (●). Login to comment
171 Although there was a correlation in patients carrying the Y122X mutation between the decrease of the response to amiloride (sodium absorption) and the increase of the response to isoproterenol (CFTR dependent chloride secretion), there was only a trend in the decrease of the response to amiloride, the non-significant level probably being due to the small sample of patients. Login to comment
173 Interestingly, the R1162X patient did not have positive protein immunostaining at the end of the treatment, demonstrating a correlation between proteic expression and Example of nasal potential difference tracing (NPD) (a, b) and CFTR immunostaining with MATG 1061 monoclonal antibody ofnasal ciliated cells (c,d) before (a,c) and after (b,d) parenteral gentamicin treatment in a Y122X homozygous CF patientFigure 2 Example of nasal potential difference tracing (NPD) (a, b) and CFTR immunostaining with MATG 1061 monoclonal antibody of nasal ciliated cells (c,d) before (a,c) and after (b,d) parenteral gentamicin treatment in a Y122X homozygous CF patient. Login to comment
189 The readthrough efficiency for the Y122X mutation, a nonsense mutation mainly found among inhabitants of the Reunion Island and resulting in an ochre termination codon (UAA) [18], was at least five times higher than that for the other CFTR stop mutations tested and more generally, 10 to 40 times higher than that for other previously tested TAA-coded mutations [11]. Login to comment
191 The high readthrough levels observed for the Y122X mutation, both basal and induced, suggest that the nucleotide environment of the stop codon may overcome the strong termination efficiency directed by the UAA codon. Login to comment
193 As the readthrough levels obtained with this experimental system for a given mutation are similar to those obtained in vivo [11], these results suggested that patients with the Y122X mutation may benefit from gentamicin treatment. Login to comment
194 We therefore decided to focus the clinical study on patients homozygous for the Y122X mutation and compare them with a group of patients with the other stop mutations we tested in vitro, and a control group of patients with no stop mutations. Login to comment
197 Cell membrane staining with an antibody that recognises the C terminal region of CFTR demonstrated that gentamicin treatment of CF patients with the Y122X mutation can induce the readthrough of this stop mutation and the synthesis of a full-length CFTR protein delivered at the membrane. Login to comment
201 The absence of response to gentamicin in two of the Y122X patients enrolled may be due to inefficient uptake or distribution of gentamicin in patients' bronchial secretions, depending on individual pharmacokinetic characteristics, but also to inefficiency at any step during the complex mechanism of stop codon readthrough [23]. Login to comment
204 Conclusion Although our data concern only the Y122X genotype, a rare mutation, they can theoretically be generalised. Login to comment

[hide] Negative genetic neonatal screening for cystic fib... Clin Genet. 2007 Oct;72(4):374-7. Girardet A, Guittard C, Altieri JP, Templin C, Stremler N, Beroud C, des Georges M, Claustres M
Negative genetic neonatal screening for cystic fibrosis caused by compound heterozygosity for two large CFTR rearrangements.
Clin Genet. 2007 Oct;72(4):374-7., [PMID:17850636]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 6 k b A .G , 3 2 7 2 - 2 6 A .G , 2 7 8 9 15 G .A , 312011G.A, 71111G.T, G85E, Y122X and W846X). Login to comment

[hide] One multiplex control for 29 cystic fibrosis mutat... Genet Test. 2007 Fall;11(3):256-68. Lebo RV, Bixler M, Galehouse D
One multiplex control for 29 cystic fibrosis mutations.
Genet Test. 2007 Fall;11(3):256-68., [PMID:17949287]

Abstract [show]
A simple approach is described to synthesize and clone an inexhaustible supply of any homozygous and/or heterozygous controls diluted with yeast genomic DNA to mimic human genome equivalents for use throughout the entire multiplex mutation assay. As a proof of principle, the 25 cystic fibrosis mutation panel selected by the American College of Medical Genetics and four additional mutant sequences were prepared as a single control mixture. The 29 CFTR mutations were incorporated into 17 gene fragments by PCR amplification of targeted sequences using mutagenic primers on normal human genomic DNA template. Flanking primers selected to bind beyond all published PCR primer sites amplified controls for most assay platforms. The 17 synthesized 433-933-bp CFTR fragments each with one to four homozygous mutant sequences were cloned into nine plasmid vectors at the multiple cloning site and bidirectionally sequenced. Miniplasmid preps from these nine clones were mixed and diluted with genomic yeast DNA to mimic the final nucleotide molar ratio of two CFTR genes in 6 x 10(9) bp total human genomic DNA. This mixture was added to control PCR reactions prior to amplification as the only positive control sample. In this fashion >200 multiplex clinical PCR analyses of >4,000 clinical patient samples have been controlled simultaneously for PCR amplification and substrate specificity for 29 tested mutations without cross contamination. This clinically validated multiplex cystic fibrosis control can be modified readily for different test formats and provides a robust means to control for all mutations instead of rotating human genomic controls each with a fraction of the mutations. This approach allows scores of additional mutation controls from any gene loci to be added to the same mixture annually.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
229 The nine normal sequences detected at other tested mutation sites (3876delA; S1255X; 2307insA; 1898ϩ5G Ǟ T; S549R; S549N; V520F; Y122X; and 394delTT) reflected the correct sequence in this mixture of nine cloned sequences. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Cancer. 2010 Jan 1;116(1):203-9. McWilliams RR, Petersen GM, Rabe KG, Holtegaard LM, Lynch PJ, Bishop MD, Highsmith WE Jr
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations and risk for pancreatic adenocarcinoma.
Cancer. 2010 Jan 1;116(1):203-9., 2010-01-01 [PMID:19885835]

Abstract [show]
BACKGROUND: Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are common in white persons and are associated with pancreatic disease. The purpose of this case-control study was to determine whether CFTR mutations confer a higher risk of pancreatic cancer. METHODS: In a case-control study, the authors compared the rates of 39 common cystic fibrosis-associated CFTR mutations between 949 white patients with pancreatic adenocarcinoma and 13,340 white controls from a clinical laboratory database for prenatal testing for CFTR mutations. The main outcome measure was the CFTR mutation frequency in patients and controls. RESULTS: Overall, 50 (5.3%) of 949 patients with pancreatic cancer carried a common CFTR mutation versus 510 (3.8%) of 13,340 controls (odds ratio [OR], 1.40; 95% confidence interval [CI], 1.04-1.89; P = .027). Among patients who were younger when their disease was diagnosed (<60 years), the carrier frequency was higher than in controls (OR, 1.82; 95% CI, 1.14-2.94; P = .011). In patient-only analyses, the presence of a mutation was associated with younger age (median 62 vs 67 years; P = .034). In subgroups, the difference was seen only among ever-smokers (60 vs 65 years, P = .028). Subsequent sequencing analysis of the CFTR gene detected 8 (16%) compound heterozygotes among the 50 patients initially detected to have 1 mutation. CONCLUSIONS: Carrying a disease-associated mutation in CFTR is associated with a modest increase in risk for pancreatic cancer. Those affected appear to be diagnosed at a younger age, especially among smokers. Clinical evidence of antecedent pancreatitis was uncommon among both carriers and noncarriers of CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 * Mutations recommended for screening by the American College of Medical Genetics.16 Mutations not listed but included in the 39-site assay: 3120þ1G>A, R334W, 3569delC, 1078delT, S549N, 3876delA, 1898þ5G>T, 2307insA, Y1092X, M1101K, S1255X, Y122X, A559T; in the 33-site assay: 3120þ1G>A, R334W, 3569delC, S549N, 3876delA, F508C. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Curr Opin Pulm Med. 2010 Nov;16(6):591-7. Sloane PA, Rowe SM
Cystic fibrosis transmembrane conductance regulator protein repair as a therapeutic strategy in cystic fibrosis.
Curr Opin Pulm Med. 2010 Nov;16(6):591-7., [PMID:20829696]

Abstract [show]
PURPOSE OF REVIEW: Recent progress in understanding the production, processing, and function of the cystic fibrosis gene product, the cystic fibrosis transmembrane conductance regulator (CFTR), has revealed new therapeutic targets to repair the mutant protein. Classification of CFTR mutations and new treatment strategies to address each will be described here. RECENT FINDINGS: High-throughput screening and other drug discovery efforts have identified small molecules that restore activity to mutant CFTR. Compounds such as VX-770 that potentiate CFTR have demonstrated exciting results in recent clinical trials and demonstrate robust effects across several CFTR mutation classes in the laboratory. A number of novel F508del CFTR processing correctors restore protein to the cell surface and improve ion channel function in vitro and are augmented by coadministration of CFTR potentiators. Ongoing discovery efforts that target protein folding, CFTR trafficking, and cell stress have also indicated promising results. Aminoglycosides and the novel small molecule ataluren induce translational readthrough of nonsense mutations in CFTR and other genetic diseases in vitro and in vivo and have shown activity in proof of concept trials, and ataluren is now being studied in confirmatory trials. SUMMARY: An improved understanding of the molecular mechanisms underlying the basic genetic defect in cystic fibrosis have led to new treatment strategies to repair the mutant protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 A trial examining systemic gentamicin in seven French individuals with Y122X CFTR, a mutation highly susceptible to readthrough, also indicated rescue of CFTR activity in the airway and sweat duct [53]. Login to comment

[hide] Low abundance of sweat duct Cl- channel CFTR in bo... Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12. Brown MB, Haack KK, Pollack BP, Millard-Stafford M, McCarty NA
Low abundance of sweat duct Cl- channel CFTR in both healthy and cystic fibrosis athletes with exceptionally salty sweat during exercise.
Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12., [PMID:21228336]

Abstract [show]
To understand potential mechanisms explaining interindividual variability observed in human sweat sodium concentration ([Na(+)]), we investigated the relationship among [Na(+)] of thermoregulatory sweat, plasma membrane expression of Na(+) and Cl(-) transport proteins in biopsied human eccrine sweat ducts, and basal levels of vasopressin (AVP) and aldosterone. Lower ductal luminal membrane expression of the Cl(-) channel cystic fibrosis transmembrane conductance regulator (CFTR) was observed in immunofluorescent staining of sweat glands from healthy young adults identified as exceptionally "salty sweaters" (SS) (n = 6, P < 0.05) and from patients with cystic fibrosis (CF) (n = 6, P < 0.005) compared with ducts from healthy young adults with "typical" sweat [Na(+)] (control, n = 6). Genetic testing of healthy subjects did not reveal any heterozygotes ("carriers") for any of the 39 most common disease-causing CFTR mutations in the United States. SS had higher baseline plasma [AVP] compared with control (P = 0.029). Immunostaining to investigate a potential relationship between higher plasma [AVP] (and sweat [Na(+)]) and ductal membrane aquaporin-5 revealed for all groups a relatively sparse and location-dependent ductal expression of the water channel with localization primarily to the secretory coil. Availability of CFTR for NaCl transport across the ductal membrane appears related to the significant physiological variability observed in sweat salt concentration in apparently healthy humans. At present, a heritable link between healthy salty sweaters and the most prevalent disease-causing CFTR mutations cannot be established.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
114 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment
119 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment

[hide] An overview of international literature from cysti... J Cyst Fibros. 2011 Mar;10(2):71-85. Epub 2011 Jan 22. Salvatore D, Buzzetti R, Baldo E, Forneris MP, Lucidi V, Manunza D, Marinelli I, Messore B, Neri AS, Raia V, Furnari ML, Mastella G
An overview of international literature from cystic fibrosis registries. Part 3. Disease incidence, genotype/phenotype correlation, microbiology, pregnancy, clinical complications, lung transplantation, and miscellanea.
J Cyst Fibros. 2011 Mar;10(2):71-85. Epub 2011 Jan 22., [PMID:21257352]

Abstract [show]
This is the third article related to a review of the literature based on data from national cystic fibrosis (CF) patient registries up to June 2008 and covering a total of 115 published studies. It focuses on several topics: CF incidence, genotype/phenotype correlation, microbiology, pregnancy/paternity, clinical complications, lung transplantation, and others. Seventy seven papers meeting the inclusion criteria were found to be related to the topics listed above. Another seven studies, already evaluated in previous papers of this series, were recalled for specific topics. Incidence is described by several studies, results being quite different from one country to another and quite inhomogeneous among regions within the same country. Studies on genetics address the genotype/phenotype correlation and look for a predictive value of CFTR mutations in terms of clinical outcome, with controversial results. Papers on microbiology describe the clinical relevance of different pathogens and their role in the progress of CF lung disease. A few articles give information on the features of CF women undergoing a pregnancy and try to identify the ones associated with a better outcome. Studies on clinical complications discuss prevalence and the role of haemoptysis, pneumothorax, CF related diabetes, ABPA and cancer. Papers on lung transplantation focus on models able to improve the selection criteria for transplantation candidates and the factors linked to post transplantation survival. Finally, several studies deal with a number of interesting topics related to CF epidemiology: clinical trial methodology, quality of care comparison among countries and centers, relationship between diagnosis and age/gender, and evaluation of pharmacological therapy. On the whole, CF Registries have already contributed to important advances in the knowledge of the natural history of CF, establishing the foundations for future improvement in CF research and care.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1256 Finally, 4 studies evaluated the genotype-phenotype correlation for rare mutations (E60X, W486X, Y122X, 3849+10KbCNT and 2789+5 GNA) [27-30]. Login to comment

[hide] Mouse models of cystic fibrosis: phenotypic analys... J Cyst Fibros. 2011 Jun;10 Suppl 2:S152-71. Wilke M, Buijs-Offerman RM, Aarbiou J, Colledge WH, Sheppard DN, Touqui L, Bot A, Jorna H, de Jonge HR, Scholte BJ
Mouse models of cystic fibrosis: phenotypic analysis and research applications.
J Cyst Fibros. 2011 Jun;10 Suppl 2:S152-71., [PMID:21658634]

Abstract [show]
Genetically modified mice have been studied for more than fifteen years as models of cystic fibrosis (CF). The large amount of experimental data generated illuminates the complex multi-organ pathology of CF and raises new questions relevant to human disease. CF mice have also been used to test experimental therapies prior to clinical trials. This review recapitulates the major phenotypic traits of CF mice and highlights important new findings including aberrant alveolar macrophages, bone and cartilage abnormalities and abnormal bioactive lipid metabolism. Novel data are presented on the intestinal and nasal physiology of F508del-CFTR CF mice backcrossed onto different genetic backgrounds. Caveats, and sources of variability including age, gender and animal husbandry, are discussed. Interspecies differences limit comparison of lung pathology in CF mice to the human disease. The recent development of genetically modified pigs and ferrets heralds the application of more advanced animal models to CF research and drug development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Unfortunately, there is no Table 1 CFTR mutant mice Mouse Mutation Cftr mRNA Genetic Survival to Body wt Contact References background maturity Null mutations Cftrtm1Unc S489X Ex10 R Not detectable* C57Bl/6 <5% 10-25% reduction BH Koller/Jax Labs [113,158] Cftrtm1Cam R487X Ex10 R Not detectable 129S6/Sv/Ev <5% 20% reduction WH Colledge [159] Cftrtm1Hsc M1X Ex1 R Not detectable CD1 x 129 25% Delayed LC Tsui [160] Cftrtm3Bay Ex2 R Not detectable C57Bl/6 x 129 40% Reduced AT Beaudet [161] Cftrtm3Uth Y122X Ex4 R Not detectable C57Bl/6 25% 25-50% reduction M Capecchi/PB Davis [113,162] Hypomorphic mutations Cftrtm1Hgu ** Ex10 I 10% of wt MF1 x 129 90% No reduction J Dorin [113] Cftrtm1Bay Ex3 I <2% wt C57Bl/6 x 129 40% 70% reduction AL Beaudet [163] F508del mutations Cftrtm2Cam F508del R 30% of wt 129S6/Sv/Ev <5% 10-20% reduction WH Colledge [164] Cftrtm1Kth F508del R Low in intestine C57Bl/6 x 129 40% 10-50% reduction KR Thomas/Jax labs [165] Cftrtm1Eur F508del (H&R) Normal levels FVB/129; FVB 90% 10-20% reduction BJ Scholte [9] C57Bl/6 Other point mutations Cftrtm2Hgu G551D R 50% of wt CD1/129 65% 30-50% reduction J Dorin [11] Cftrtm3Hgu G480C (H&R) Normal levels C57Bl/6/129 Normal No reduction J Dorin [166] Cftrtm2Uth R117H R 5-20% of wt C57/Bl6 95% 10-25% reduction M Capecchi/PB Davis [113,162] Transgenes Mouse Transgene Promoter Expression Phenotype References Tg(FABPCFTR) CFTR Rat intestinal fatty acid Intestinal villus epithelia Rescue of CF intestinal pathology [167] binding protein Tg(CCSPScnn1b) Scnn1b Clara cell secretory Airway surface epithelia Na+ hyperabsorption [13] protein (CCSP) Reduced airway surface fluid volume Mucus accumulation, CF-like lung disease; 40% survival. Login to comment

[hide] Detection of more than 91% cystic fibrosis mutatio... Clin Genet. 1998 Nov;54(5):437-9. Cartault F, Steffann J, Vidaud D, Bousquet S, Lesure F, Renouil M, McDonell N, Feingold J, Beldjord C, Bienvenu T
Detection of more than 91% cystic fibrosis mutations in a sample of the population from Reunion Island and identification of two novel mutations (A309G, S1255L) and one novel polymorphism (L49L)
Clin Genet. 1998 Nov;54(5):437-9., [PMID:9842999]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Five have a frequency of 1% and above: AF508 (51%), Y122X (22.4%), 3120+ lG+A (7.7%), A455E (2.1%) and G551D (1.4%). Login to comment
23 The nonsense mutation Y122X has only been found on CF chromosomes of white Caucasians known as "petits blancs". Login to comment
30 Ten CFTR mutations identified in 69 CF families from Reunion Island Mutationa Exonlintron CF alleles Percentage Ama E.10 72 52 Y122X E.4 33 24 A455E E.9 3 2.2 G551D E.11 2 1.4 1717-1G-+A i.10 1 0.7 G542X E.ll 1 0.7 116ldelC E.7 1 0.7 A3G9G E.7 1 0.7 zag+ 5~-+A i.14b 1 0.7 3120tlG-A i.16 11 a Unknown mutations 12 8.7 aCystic Fibrosis Genetic Analysis Consortium: Web site: http // w.genet.sickkids.on.ca/cftr/ CFTR represents the missense mutation A309G (Fig. 1A). Login to comment

[hide] A frequent large rearrangement in the CFTR gene in... Genet Test. 2006 Fall;10(3):208-14. Nectoux J, Audrezet MP, Viel M, Leroy C, Raguenes O, Ferec C, Lesure JF, Davy N, Renouil M, Cartault F, Bienvenu T
A frequent large rearrangement in the CFTR gene in cystic fibrosis patients from Reunion Island.
Genet Test. 2006 Fall;10(3):208-14., [PMID:17020473]

Abstract [show]
Reunion Island is a French province, 800 km east of Madagascar and 200 km west of Mauritius. On Reunion Island, the birth prevalence of cystic fibrosis (CF) is particularly high in the population of European origin, approximately 1:1000. In a previous study, we demonstrated that the screening of the 27 exons of the CF transmembrane conductance regulator (CFTR) gene by denaturing high-pressure liquid chromatography (DHPLC) in 114 CF families allowed the detection of about 93% of the molecular defects present on Reunion Island. Unidentified CF mutations may lie in introns or in regulatory regions that are not routinely investigated, or may correspond to gene rearrangements such as large, heterozygous deletions that escape detection using current PCR-based techniques. Using a combination of different methods (such as multiplex ligation-dependent probe amplification), 6 of the 13 unidentified CF alleles (46%) were found to harbor a deletion of 5288 bp, spanning from exon 17a to 18. Identification and examination of the breakpoint sequences showed that this deletion is different from the 3120+1kbdel8.6Kb previously found in the Palestinian Arabs. The chromosomes bearing IVS16+3316_IVS18+644del5288 did not have a common extragenic haplotype. Clinical evaluation of homozygotes (2 unrelated patients) and compound heterozygotes indicated that this deletion represents a severe mutation associated with positive sweat chloride test, pancreatic insufficiency, and early age at diagnosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 The three most frequent mutations are: p.F508del (47%), p.Y122X (20%) and c.3120ϩ1G Ǟ A (8.7%). Login to comment

[hide] Cftr biomarkers: time for promotion to surrogate e... Eur Respir J. 2012 Aug 9. De Boeck K, Kent L, Davies J, Derichs N, Amaral M, Rowe S, Middleton P, de Jonge H, Bronsveld I, Wilschanski M, Melotti P, Danner-Boucher I, Boerner S, Fajac I, Southern K, de Nooijer R, Bot A, de Rijke Y, de Wachter E, Leal T, Vermeulen F, J Hug M, Rault G, Nguyen-Khoa T, Barreto C, Proesmans M, Sermet-Gaudelus I
Cftr biomarkers: time for promotion to surrogate endpoint?
Eur Respir J. 2012 Aug 9., [PMID:22878883]

Abstract [show]
In patients with cystic fibrosis, CFTR biomarkers such as sweat chloride concentration and/or nasal potential difference are used as endpoints of efficacy in phase III clinical trials with the disease modifying drugs ivacaftor (VX-770), VX809 and ataluren. The aim of this project was to review the literature on reliability, validity and responsiveness of nasal potential difference, sweat chloride, and intestinal current measurement in patients with cystic fibrosis.Data on clinimetric properties were collected for each biomarker and reviewed by an international team of experts. Data on reliability, validity and responsiveness were tabulated. In addition, narrative answers to 4 key questions were discussed and agreed by the team of experts.Data collected demonstrated the reliability, validity and responsiveness of nasal potential difference. Fewer data were found on reliability of sweat chloride concentration, however validity and responsiveness were demonstrated. Validity was demonstrated for intestinal current measurement, however further information is required on reliability and responsiveness. For all three endpoints, normal values were collected and further research requirements were proposed.This body of work adds useful information to support the promotion of CFTR biomarkers to surrogate endpoints and to guide further research in the area.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
220 15d intravenous gentamycin treatment 9 CF with Y122X mutation NS 0.09 (20 to 15mV) 0.04 (‐0.8 to ‐4.6mV) 0.03 (109 to 85 mmol/L) Wilcoxon (mean before and after) (74) 4 CF with other nonsense mutation NS NS NS 5 CF without nonsense mutation NS NS NS 15d nasal aminoglycoside treatment 11 CF with nonsense mutation NS NS NS NA paired t‐test (75) 18 CF without nonsense mutation NS NS NS NA 7d intravenous gentamycin treatment 5 CF with nonsense mutation NS NS NS (/5) NS GLM for repeat measures (76) 5 CF without nonsense mutation NS NS NS (0/5) NS (#patients with ≥1 reading ≥5mV) 14d gentamycin nose drops TID 11 CF homozygous nonsense mutation 0.008 (‐48 to ‐ 34mV) 0.05 (33 to 24mV) 0.001 (0.4 to ‐5.5mV) NA t‐test/MWU p value (mean before and after) (17) 8 CF heterozygous nonsense mutation NS NS 0.04 (‐.05 to ‐4.8mV) NA 5 CF homozygous F508del NS NS NS NA 14d gentamycin nose drops TID 9 CF with nonsense mutation NS NS <0.001 (‐0.6 to ‐10mV) NA MWU (mean before and after) (77) Systemic administration of VX‐770 to CF adults and children carrying at least 1 G551D mutation is associated with large drop in sweat chloride and a moderate improvement of total chloride response measured by NPD. Login to comment
94 TABLE 3 Responsiveness of nasal potential difference (NPD) and sweat chloride concentration First author [ref.] Subject n and type Intervention Basal potential p-value D amiloride p-value D low chloride + isoproterenol p-value Sweat chloride Statistic The total chloride response (low chloride + isoproterenol) improves during treatment with ataluren t.i.d. in phase-II open label trials in children and adults with CF carrying at least one nonsense mutation S ERMET- G AUDELUS [19] 30 CF with nonsense mutation Ataluren 4, 4, 8 mg (14 d) NS NS 0.04 (-4.6 mV) ND Paired t-test (mean change) Ataluren 10, 10, 20 mg (14 d) NS NS 0.05 (-3.9 mV) ND K EREM [18] 53 CF with nonsense mutation Ataluren 4, 4, 8 mg (14 d) Ataluren 10, 10, 20 mg (14 d) NS NS NS NS 0.0001 (-7.1 mV) 0.03 (-3.7 mV) NS NS Paired t-test (mean change) Inconsistent findings whether systemic administration of aminoglycoside changes NPD or sweat chloride values in patients with CF Local administration of gentamycin nose drops improves NPD read-out in CF patients carrying at least one nonsense mutation 15 d intravenous gentamycin treatment S ERMET -G AUDELUS [46] 9 CF with Y122X mutation NS 0.09 (20 to 15 mV) 0.04 (-0.8 to -4.6 mV) 0.03 (109 to 85 mmol?L -1 ) Wilcoxon (mean before and after) 4 CF with other nonsense mutation NS NS NS 5 CF without nonsense mutation NS NS NS 15 d nasal aminoglycoside treatment C LANCY [47] 11 CF with nonsense mutation NS NS NS NA Paired t-test 18 CF without nonsense mutation NS NS NS NA 7 d intravenous gentamycin treatment C LANCY [48] 5 CF with nonsense mutation NS NS NS (4/5) NS GLM for repeat measures (number of patients with o1 reading o5 mV) 5 CF without nonsense mutation NS NS NS (0/5) NS 14 d gentamycin nose drops t.i.d. W ILSCHANSKI [17] 11 CF homozygous nonsense mutation 0.008 (-48 to -34 mV) 0.05 (33 to 24 mV) 0.001 (0.4 to -5.5 mV) NA t-test/MWU p-value (mean before and after) 8 CF heterozygous nonsense mutation NS NS 0.04 (-05 to -4.8 mV) NA 5 CF homozygous F508del NS NS NS NA 14 d gentamycin nose drops t.i.d. W ILSCHANSKI [49] 9 CF with nonsense mutation NS NS ,0.001 (-0.6 to -10 mV) NA MWU (mean before and after) Systemic administration of VX-770 to CF adults and children carrying at least one G551D mutation is associated with large drop in sweat chloride and a moderate improvement of total chloride response measured by NPD A CCURSO [20] 20 CF with G551D mutation VX-770 75 mg b.i.d. 14 d ND ND 0.003 (-4.7 mV) ,0.001 (-40 mEq?L -1 ) Paired t-test (mean change from baseline) VX-770 150 mg b.i.d. 14 d ND ND 0 .01 (-5.3 mV) ,0.001 (-42 mEq?L -1 ) VX-770 150 mg b.i.d. 28 d ND ND 0.02 (-3.5 mV) 0.008 (-60 mEq?L -1 ) VX-770 250 mg b.i.d. 28 d ND ND 0.05 (-5.5 mV) 0.02 (-38 mEq?L -1 ) First author [ref.] Subject n and type Intervention Basal potential p-value D amiloride p-value D low chloride + isoproterenol p-value Sweat chloride Statistic R AMSEY [50] 161 CF with G551D mutation 83 VX-770 150 mg b.i.d. 48 wks ND ND ND ,0.0001 (-49 mEq?L -1 ) MMRM (mean change from baseline through 24 wks) 78 placebo ND ND ND NS (-0.8 mEq?L -1 ) A HERNS [51] 52 CF (6-11 yrs) with G551D mutation 26 VX-770 150 mg b.i.d. 24 wks ND ND ND ,0.0001 (-56 mEq?L -1 ) MMRM (mean change from baseline through 24 wks) 26 placebo ND ND ND NS (-1.2 mEq?L -1 ) Systemic administration of VX-809 to CF patients homozygous for F508del is associated with a small, dose-dependent drop in sweat chloride C LANCY [21] 89 CF homozygous F508del mutation VX-809 25 mg q.d. 28 d ND ND NS NS Paired t-test (mean change from baseline); linear trend test p50.0013 VX-809 50 mg q.d. 28 d ND ND NS NS VX-809 100 mg q.d. 28 d ND ND NS ,0.05 (-6 mEq?L -1 ) VX-809 200 mg q.d. 28 d ND ND NS ,0.01 (-8 mEq?L -1 ) After treating patients homozygous for F508del with VX-809 for 14 days, the addition of ivacaftor 250 mg b.i.d. for 7 days is associated with a further small but statistically significant drop in sweat chloride B OYLE [52] 61 CF homozygous F508del mutation VX-809 200 mg q.d. 14 d ND ND ND ,0.01 (-4.2 mEq?L -1 ) # Paired t-test mean change from day 14 or baseline # +VX-770 150 mg b.i.d. 7 d ND ND ND NS (-2.2 mEq?L -1 ) +VX-770 250 mg b.i.d. 7 d ND ND ND p,0.001(-9.1 mEq?L -1 ) NPD parameters detect effect of treatment in phase-II trials of various modes of gene therapy K ONSTAN [53] 12 CF Compacted DNA nanoparticles in saline 0.8 mg, 2.67 mg or 8.0 mg, single dose No change ND 8 out of 12 subjects showed partial to complete response NA Descriptive N OONE [54] 11 CF EDMPC cholesterol complexed with CFTR cDNA 0.4375 mg, 1.3 mg or 4 mg total dose NS NS NS NA Paired t-test A LTON [55] 16 CF pCF1-CFTR cDNA complexed with 229 mg GL-67/DOPE/DMPE-PEG 5000 single dose NS NS NS NA MWU and Wilcoxon rank sum Z ABNER [56] 9 CF pCF1-CFTR plasmid 1.25 mg, single dose NS NS p,0.05 (3 mV to -3 mV) NA Not reported (mean before and after) pCF1-CFTR plasmid 1.25 mg complexed with 2 mg GL-67:DOPE, single dose NS NS p,0.05 (3 mV to 0.5 mV) NA TABLE 3 Continued First author [ref.] Subject n and type Intervention Basal potential p-value D amiloride p-value D low chloride + isoproterenol p-value Sweat chloride Statistic P ORTEOUS [57] 16 CF 400 mg pCMV-CFTR complexed with 2.4 mg DOTAP cationic liposome, single dose NS for group 2/8 treated patients demonstrated partial correction NS for group 2/8 treated patients demonstrated partial correction NS for group 2/8 treated patients demonstrated partial correction NA Not reported Z ABNER [58] 6 CF CFTR cDNA via adenovirus vector, single dose Sign rank statistic 2610 9 IU NS NS p50.04 (2 to -2 mV) (terbutaline) NA 6610 9 IU NS NS p50.03 (2 to -0.5 mV) (terbutaline) NA G ILL [59] 12 CF CFTR cDNA via DC-Chol/ DOPE NS NS NS NA Not reported C APLEN [60] 9 CF CFTR cDNA NS p,0.05 (+4 mV) NS NA Not reported H AY [61] 9 CF AdCFTR cDNA via adenovirus vector, single dose p50.01 (-53 to -35 mV) p50.02 (37 to 20 mV) p50.05 (-5 to -9 mV) NA Paired t-test M IDDLETON [29] 3 CF DC-Chol:DOPE NS NS NS NA Not reported No observed effect of single dose of CPX on either NPD or sweat chloride parameters M C C ARTY [62] 37 CF CPX, single dose NS NS NS NS ANOVA NPD total chloride response detects effect of Moli1901 (activator of alternative chloride channels) Z EITLIN [63] 4 CF Moli1901 (1, 3 and 10 mmol?L -1 ) NA NA ,0.05 for all doses NA Paired t-test versus vehicle NPD total chloride response detects effect of CFTR activation in patients homozygous for F508del mutation R UBENSTEIN [64] 10 CF homozygous F508del mutation Sodium 4-phenylbutu- rate 6, 6, 7 g (7 d) NS NS p50.0055 (5.2 to 0.6) NS Paired t-test (mean before and after) Basal NPD detects effect of aerosolised sodium channel blockers R ODGERS [65] 10 CF Amiloride nasal spray p,0.0001 (+20 mV) NA NA NA Two way ANOVA Benzamil nasal spray p,0.0001 (+21 mV) H OFMANN [66] 12 CF Aerosolised amiloride p,0.05 NA NA NA Independent t-test H OFMANN [67] 41 CF Aerosolised amiloride (10 -3 M) (n516) +35 mV NA NA NA No statistics Aerosolised benzamil (7610 -3 M) (n55) +35 mV TABLE 3 Continued First author [ref.] Subject n and type Intervention Basal potential p-value D amiloride p-value D low chloride + isoproterenol p-value Sweat chloride Statistic NPD detects effect of flavonoids on CFTR function P YLE [68] 12 non-CF Quercetin 20 mg:mL single dose NR p,0.05 (-7 mV) p,0.05 (-15 mV) NA ANOVA I LLEK [69] 25 non-CF Quercetin (n515), genistein (n53), kaempferol (n53), apigenin (n54) p,0.05 (-3 mV) ND ND ND Paired t-test NPD detects effect of hypertonic saline M IDDLETON [70] 7 non-CF 150 mM p,0.05 (6.6 mV) ND ND ND Paired t-test 250 mM p,0.05 (7.6 mV) 500 mM p,0.05 (10.0 mV) 1200 mM p,0.05 (13.1 mV) 2000 mM p,0.05 (14.8 mV) NPD detects effect of fluticasone propionate on epithelial sodium absorption G RAHAM [71] 6 non-CF Fluticasone propionate ND p50.03 (1.8 to 3.3 mV) NS NA Paired t-test NPD detects effect of milrinone on epithelial sodium absorption S MITH [72] 6 CF Milrinone (perfused during NPD) p,0.05 (52 to 57 mV) NS NS NA MWU Total chloride response increases in response to increased temperature B OYLE [73] 32 non-CF NS NS 0.01 (-4.4 mV) NA Paired t-test PD recorded at the end of Ringers (i.e. basal) and at the end of isoproteronol were more polarised when using agar catheter versus perfusion method S OLOMON [74] 26 non-CF p,0.05 (-15.9 versus -14.0 mV) NS p,0.05 (-31.2 versus -24.8 mV) NA Paired t-test Basal NPD and amiloride response detects effect of moderate exercise A LSUWAIDAN [75] 7 CF Cycle ergometer exercise at 80% HR peak p,0.05 ND ND ND Paired t-test H EBESTREIT [76] 9 CF Cycle ergometer exercise at 85% of VT p,0.01 (-34 to -7 mV) p,0.01 (+26 to +16 mV) NS ND Paired t-test CF: cystic fibrosis; NS: nonsignificant; ND: no data; NA: not applicable; GLM: generalised linear model; MWU: Mann-Whitney U-test; MMRM: mixed-effects models for repeated measurements; NR: not reported; HR peak : peak heart rate, VT: ventilatory threshold. Login to comment

[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]

Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

[hide] Results of a phase IIa study of VX-809, an investi... Thorax. 2012 Jan;67(1):12-8. Epub 2011 Aug 8. Clancy JP, Rowe SM, Accurso FJ, Aitken ML, Amin RS, Ashlock MA, Ballmann M, Boyle MP, Bronsveld I, Campbell PW, De Boeck K, Donaldson SH, Dorkin HL, Dunitz JM, Durie PR, Jain M, Leonard A, McCoy KS, Moss RB, Pilewski JM, Rosenbluth DB, Rubenstein RC, Schechter MS, Botfield M, Ordonez CL, Spencer-Green GT, Vernillet L, Wisseh S, Yen K, Konstan MW
Results of a phase IIa study of VX-809, an investigational CFTR corrector compound, in subjects with cystic fibrosis homozygous for the F508del-CFTR mutation.
Thorax. 2012 Jan;67(1):12-8. Epub 2011 Aug 8., [PMID:21825083]

Abstract [show]
BACKGROUND: VX-809, a cystic fibrosis transmembrane conductance regulator (CFTR) modulator, has been shown to increase the cell surface density of functional F508del-CFTR in vitro. METHODS: A randomised, double-blind, placebo-controlled study evaluated the safety, tolerability and pharmacodynamics of VX-809 in adult patients with cystic fibrosis (n=89) who were homozygous for the F508del-CFTR mutation. Subjects were randomised to one of four VX-809 28 day dose groups (25, 50, 100 and 200 mg) or matching placebo. RESULTS: The type and incidence of adverse events were similar among VX-809- and placebo-treated subjects. Respiratory events were the most commonly reported and led to discontinuation by one subject in each active treatment arm. Pharmacokinetic data supported a once-daily oral dosing regimen. Pharmacodynamic data suggested that VX-809 improved CFTR function in at least one organ (sweat gland). VX-809 reduced elevated sweat chloride values in a dose-dependent manner (p=0.0013) that was statistically significant in the 100 and 200 mg dose groups. There was no statistically significant improvement in CFTR function in the nasal epithelium as measured by nasal potential difference, nor were there statistically significant changes in lung function or patient-reported outcomes. No maturation of immature F508del-CFTR was detected in the subgroup that provided rectal biopsy specimens. CONCLUSIONS: In this study, VX-809 had a similar adverse event profile to placebo for 28 days in F508del-CFTR homozygous patients, and demonstrated biological activity with positive impact on CFTR function in the sweat gland. Additional data are needed to determine how improvements detected in CFTR function secondary to VX-809 in the sweat gland relate to those measurable in the respiratory tract and to long-term measures of clinical benefit. CLINICAL TRIAL NUMBER: NCT00865904.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
124 For example, PTC124 has been shown to have detectable bioactivity by NPD over 2 weeks of treatment in patients with CF possessing premature termination codons in CFTR, while sweat chloride measurements remained unchanged.24 Improvements in lung function and cough frequency were not observed until months of treatment were completed.25 Systemic gentamicin has also been shown to suppress PTCs26 and improve NPD parameters in two pilot studies, but effects on sweat chloride were predominantly limited to a subset of patients with the Y122X mutation.27 28 Using a separate CFTR modulator strategy, Rubenstein and colleagues treated F508del-CFTR homozygous patients with CF with the F508del-CFTR modulator 4-phenyl butyrate. Login to comment

[hide] Twenty years after cystic fibrosis gene identifica... Pathol Biol (Paris). 2011 Jun;59(3):131-3. Epub 2009 Nov 5. Edelman A, Fritsch J, Ollero M
Twenty years after cystic fibrosis gene identification: Where are we and what are we up to?
Pathol Biol (Paris). 2011 Jun;59(3):131-3. Epub 2009 Nov 5., [PMID:19896304]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Our initial pilot study showed that systemic administration of gentamycin, an antibiotic known to suppress two PTCs found in CFTR (G542X and R553X) when expressed in HeLa cells, improves the clinical status of patients bearing the Y122X mutation. Login to comment

[hide] Defective formation of PKA/CnA-dependent annexin 2... Cell Signal. 2008 Jun;20(6):1073-83. Epub 2008 Feb 5. Borthwick LA, Riemen C, Goddard C, Colledge WH, Mehta A, Gerke V, Muimo R
Defective formation of PKA/CnA-dependent annexin 2-S100A10/CFTR complex in DeltaF508 cystic fibrosis cells.
Cell Signal. 2008 Jun;20(6):1073-83. Epub 2008 Feb 5., [PMID:18346874]

Abstract [show]
Cystic fibrosis (CF) is characterised by impaired epithelial ion transport and is caused by mutations in the cystic fibrosis conductance regulator protein (CFTR), a cAMP/PKA and ATP-regulated chloride channel. We recently demonstrated a cAMP/PKA/calcineurin (CnA)-driven association between annexin 2 (anx 2), its cognate partner -S100A10 and cell surface CFTR. The complex is required for CFTR and outwardly rectifying chloride channel function in epithelia. Since the cAMP/PKA-induced Cl(-) current is absent in CF epithelia, we hypothesized that the anx 2-S100A10/CFTR complex may be defective in CFBE41o cells expressing the commonest F508del-CFTR (DeltaF-CFTR) mutation. Here, we demonstrate that, despite the presence of cell surface DeltaF-CFTR, cAMP/PKA fails to induce anx 2-S100A10/CFTR complex formation in CFBE41o- cells homozygous for F508del-CFTR. Mechanistically, PKA-dependent serine phosphorylation of CnA, CnA-anx 2 complex formation and CnA-dependent dephosphorylation of anx 2 are all defective in CFBE41o- cells. Immunohistochemical analysis confirms an abnormal cellular distribution of anx 2 in human and CF mouse epithelia. Thus, we demonstrate that cAMP/PKA/CnA signaling pathway is defective in CF cells and suggest that loss of anx 2-S100A10/CFTR complex formation may contribute to defective cAMP/PKA-dependent CFTR channel function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
307 Interestingly, recent evidence shows firstly that annexin A1 could not be detected in mice lacking cftr (cftrtm1Unc ), secondly is down-regulated in nasal epithelial cells from CF patients bearing homozygous nonsense mutations in the CFTR gene (Y122X, 489delC) and thirdly is differentially expressed in F508del patients [58]. Login to comment
306 Interestingly, recent evidence shows firstly that annexin A1 could not be detected in mice lacking cftr (cftrtm1Unc ), secondly is down-regulated in nasal epithelial cells from CF patients bearing homozygous nonsense mutations in the CFTR gene (Y122X, 489delC) and thirdly is differentially expressed in F508del patients [58]. Login to comment

[hide] Airway epithelial control of Pseudomonas aeruginos... Trends Mol Med. 2008 Mar;14(3):120-33. Epub 2008 Feb 11. Campodonico VL, Gadjeva M, Paradis-Bleau C, Uluer A, Pier GB
Airway epithelial control of Pseudomonas aeruginosa infection in cystic fibrosis.
Trends Mol Med. 2008 Mar;14(3):120-33. Epub 2008 Feb 11., [PMID:18262467]

Abstract [show]
Defective expression or function of the cystic fibrosis transmembrane conductance regulator (CFTR) underlies the hypersusceptibility of cystic fibrosis (CF) patients to chronic airway infections, particularly with Pseudomonas aeruginosa. CFTR is involved in the specific recognition of P. aeruginosa, thereby contributing to effective innate immunity and proper hydration of the airway surface layer (ASL). In CF, the airway epithelium fails to initiate an appropriate innate immune response, allowing the microbe to bind to mucus plugs that are then not properly cleared because of the dehydrated ASL. Recent studies have identified numerous CFTR-dependent factors that are recruited to the epithelial plasma membrane in response to infection and that are needed for bacterial clearance, a process that is defective in CF patients hypersusceptible to infection with this organism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
228 In a study of nine French CF patients with the Y122X CFTR allele, six patients treated with parenteral gentamicin showed detectable CFTR protein and improved respiratory function and sweat chloride values [83]. Login to comment
229 In another study of 11 CF patients with stop mutations (none of whom had the Y122X allele), no effect of gentamicin on CFTR expression or nasal potential difference was achieved [84]. Login to comment

[hide] ENaCbeta and gamma genes as modifier genes in cyst... J Cyst Fibros. 2008 Jan;7(1):23-9. Epub 2007 Jun 7. Viel M, Leroy C, Hubert D, Fajac I, Bienvenu T
ENaCbeta and gamma genes as modifier genes in cystic fibrosis.
J Cyst Fibros. 2008 Jan;7(1):23-9. Epub 2007 Jun 7., [PMID:17560176]

Abstract [show]
BACKGROUND: Clinical phenotype varies among cystic fibrosis (CF) patients with identical CF transmembrane conductance regulator (CFTR)genotype, suggesting that genetic modifiers exist. Transgenic mice that overexpress SCNN1beta present CF-like lung disease symptoms. Mutations or variants in SCNN1beta may therefore potentially modulate the clinical phenotype in CF patients. METHODS: We analysed by DHPLC SCNN1beta and SCNN1gamma genes in 56 patients with classical CF. Patients were classified into two groups according to their CFTR genotype and their severity: 38 patients with severe genotype and an unexpectedly mild lung phenotype, and 18 patients with mild genotype and a severe lung phenotype. RESULTS: We found 3 patients out of 56 carrying at least one missense mutation. Two were novel (p.Thr313Met in SCNN1beta, p.Leu481Gln in SCNN1gamma) and two were previously described (p.Gly589Ser in SCNN1beta and p.Val546Ileu in SCNNgamma). p.Thr313Met has been identified in a CF patient with mild genotype and severe lung phenotype suggesting that it could act in increasing ENaC activity. The three other variants have been identified in CF patients with severe genotype and mild lung phenotype suggesting that they might decrease ENaC activity. However, the function of ENaC in the nasal epithelia of these patients, evaluated by nasal potential difference measurements, did not support the fact that these variants were functional, at least in nasal epithelium. CONCLUSION: Our results suggest that genetic variants in ENaCbeta and gamma genes do not modulate disease severity in the majority of CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 Twenty-one were homozygous for the Phe508del mutation and 17 were compound heterozygous or homozygous for two severe mutations (R553X:1717-1GNA, Phe508del:W1282X, Phe508del:1717-1GNA, 2 Phe508del:3659delC, Phe508del:N1303K, Phe508del:W57X, Phe508del:Q1411X, G542X:1380insT, Phe508del:R553X, Table 1 Parameters for amplification of the ENaCβ and ENaCγ gene fragments (GenBank accession number NM_000336 and NM_001039, respectively) Fragment Sequence of primers Annealing temperature (°C) ENaCβ Exon 2 2F 5' gtgtcccagctgatgtgcgt 3' 55 2R 5' tgaggccagctgtgcactcc 3' Exon 3 3F 5' acagactactatggagtggg 3' 55 3R 5' aagaaacacccatcagcctc 3' Exon 4 4F 5' gtcctgctagcagctcccac 3' 59 4R 5' caaccgtaacatgccactgt 3' Exon 5 5F 5' ctgccctgcagctgatgctg 3' 55 5R 5' ccctgcaacagctgatggtc 3' Exon 6 6F gtctcctttctgcctcagga 3' 59 6R 5' tcagaccctctaggactgcc 3' Exon 7 7F 5' aggtgcagaaagggcttcct 3' 63 7R 5' catgaggcgtgcaccaccttcccac 3' Exon 8 8F 5' ctgaccatgcctgtgttctc 3' 59 8R 5' ctctatggtcagagcctctg 3' Exon 9-10 9F 5' cagaggctcagcagggaaca 3' 63 10R 5' catcttatgcccagacttgt 3' Exon 11 11F 5' gatgctgcagatggcaactt 3' 55 11R 5' gagctgtcctgtgtccaaac 3' Exon 12 12F 5' acattagtcccggcccttct 3' 55 12R 5' ggtattgggagactcctaaa 3' Exon 13 13F 5' fgaggcaagaatgtgtggcct 3' 59 13R 5' tcttggctgctcagtgagtt 3' ENaCγ Exon 2 2F 5' agcacgcccgtcctcagagt 3' 57 2R 5' ccagtgtgtcactttcggga 3' Exon 3 3F 5' tgaggctgacacgtgttgat 3' 55 3R 5' tgcccctaagcagtgaaaga 3' Exon 4 4F 5' agtagcgataggaccgatgg 3' 55 4R 5' tcagagctgccagtccttag 3' Exon 5 5F 5' cccaacttcagctaagatgc 3' 55 5R 5' agatctccttggcacaggtt 3' Exon 6 6F 5' ttggatcacagcaggttgtc 3' 55 6R 5' gatctgttctctccaagcct 3' Exon 7 7F 5' ctgtctggtgctccttgcaa 3' 55 7R 5' ccagcttagatataactttg 3' Exon 8 8F 5' tgagcaaagacatgaatggc 3' 57 8R 5' agtgcctattgccaggacta 3' Exon 9-10-11 9F 5' tccaaagctcatgctgccct 3' 57 11R 5' acagaggaacagggtagagg 3' Exon 12 12F 5' ggatgccaaggctcttgatt 3' 52 12R 5' gccaggaagatgctcacatt 3' Exon 13 13F 5' aggttcctcttgatggtgt 3' 55 13R 5' ggtcctgactagatctgtct 3' Table 2 Parameters for dHPLC conditions Fragment Temperature (°C) ENaCβ Exon 2 62.3/63.3 Exon 3 59.5/60.7 Exon 4 62.2/63.4 Exon 5 59.5/61 Exon 6 63 Exon 7 61.6/62.6/63.6 Exon 8 62.8/64.8 Exon 9-10 61.5/62.5/65 Exon 11 61/62/63.5 Exon 12 69 Exon 13 61/63.3/64.8 ENaCγ Exon 2 60.8/63.2/66 Exon 3 61/61.4 Exon 4 60.6 Exon 5 59.5/60.5 Exon 6 56.5/59/60.5 Exon 7 63/63.6 Exon 8 59.5/63 Exon 9-10-11 60.7/61.5/62.7/64.7 Exon 12 59.5/61.7 Exon 13 61/62.2 Phe508del:I507del, Phe508del:4382delA, S549R:3120+ 1GNA, Phe508del:3120+1GNA, Y122X:Y122X; Phe508del:W846X; Phe508del:E60X). Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
73 Genomic DNA Samples Used for Mutation Evaluation on the APEX Array Mutations validated with native DNA CFTRdel 2,3 (21 kb) 394delTT G85E R75X 574delA Y122X R117C R117H 621 ϩ 1GϾT 621 ϩ 3AϾG 711 ϩ 1GϾT I336K R334W R347P IVS8-5T IVS8-7T IVS8-9T A455E ⌬F508 ⌬I507 1677delTA 1717 - 1GϾA G542X G551D R553X R560T S549N 1898 ϩ 1GϾA 1898 ϩ 1GϾC 2183AAϾG 2043delG R668C 2143delT 2184delA 2184insA 2789 ϩ 5GϾA S945L 3120 ϩ 1GϾA I1005R 3272 - 26AϾG R1066C G1069R Y1092X (CϾA) 3500 - 2AϾT R1158X R1162X 3659delC S1235R 3849 ϩ 10 kb CϾT W1282X primer. Login to comment

[hide] High heterogeneity of CFTR mutations and unexpecte... J Cyst Fibros. 2004 Dec;3(4):265-72. des Georges M, Guittard C, Altieri JP, Templin C, Sarles J, Sarda P, Claustres M
High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France.
J Cyst Fibros. 2004 Dec;3(4):265-72., [PMID:15698946]

Abstract [show]
In this report, we present updated spectrum and frequency of mutations of the CFTR gene that are responsible for cystic fibrosis (CF) in Languedoc-Roussillon (L-R), the southwestern part of France. A total of 75 different mutations were identified by DGGE in 215 families, accounting for 97.6% of CF genes and generating 88 different mutational genotypes. The frequency of p.F508del was 60.23% in L-R versus 67.18% in the whole country and only five other mutations (p.G542X, p.N1303K, p.R334W, c.1717-1G>A, c.711+1G>T) had a frequency higher than 1%. The mutations were scattered over 20 exons or their border. This sample representing only 5.7% of French CF patients contributed to 24% of CFTR mutations reported in France. This is one of the highest molecular allelic heterogeneity reported so far in CF. We also present the result of a neonatal screening program based on a two-tiered approach "IRT/20 mutations/IRT" analysis on blood spots, implemented in France with the aim to improve survival and quality of life of patients diagnosed before clinical onset. This 18-month pilot project showed an unexpected low incidence of CF (1/8885) in South of France, with only six CF children detected among 43,489 neonates born in L-R, and 13 among 125,339 neonates born in Provence-Alpes-Cote-d'Azur (PACA).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 of chromosomes (frequency %) p.M1V 1 1 (0.23) p.M1K 1 1 (0.23) c.300delA 3 1 (0.23) p.P67L 3 1 (0.23) c.359insT 3 1 (0.23) p.G85E 3 3 (0.70) c.394delTT 3 1 (0.23) p.Q98R 4 1 (0.23) p.R117H 4 2 (0.47) p.Y122X 4 2 (0.47) p.Y161N 4 1 (0.23) c.621+1GNT intron 4 1 (0.23) c.621+2TNG intron 4 1 (0.23) p.I175V 5 2 (0.47) c.711+1GNT intron 5 5 (1.16) p.L206W 6 3 (0.70) p.Q220X 6 1 (0.23) p.L227R 6 1 (0.23) c.1078delT 7 2 (0.47) p.R334W 7 7 (1.63) p.R347P 7 2 (0.47) c.1215delG 7 1 (0.23) c.T5 intron 8 1 (0.23) p.D443Y 9 1 (0.23) p.I506T 10 1 (0.23) p.I507del 10 4 (0.93) p.F508del 10 259 (60.23) p.F508C 10 1 (0.23) c.1677delTA 10 1 (0.23) c.1717-8GNA intron 10 1 (0.23) c.1717-1GNA intron 10 6 (1.40) p.G542X 11 23 (5.35) p.S549R 11 1 (0.23) p.G551D 11 2 (0.47) p.R553X 11 1 (0.23) c1811+1.6kbANG intron 11 4 (0.93) c.1812-1GNA intron 11 1 (0.23) p.T582I 12 1 (0.23) p.E585X 12 2 (0,47) c.1898+1GNA intron 12 1 (0.23) [c.1898+5GNA ;p.E725K] intron 12 1 (0.23) c.1898+73TNG intron 12 1 (0.23) c.2183AANG 13 4 (0.93) c.2184insA 13 1 (0.23) p.K710X 13 4 (0.93) c.2423delG 13 1 (0.23) p.S776X 13 1 (0.23) c.2493ins8 13 1 (0.23) p.R792X 13 1 (0.23) p.K830X 13 1 (0.23) p.D836Y 14a 1 (0.23) p.W846X1 14a 1 (0.23) c.2711delT 14a 1 (0.23) c.2789+5GNA intron 14b 3 (0.70) p.S945L 15 3 (0.70) p.D993Y 16 1 (0.23) c.3129del4 17a 1 (0.23) c.3195del6 17a 1 (0.23) c.3272-26ANG intron 17a 1 (0.23) [c.3395insA ;pI148T] 17b/4 1 (0,23) p.Y1092X 17b 3 (0.70) Table 1 (continued) Mutation Location exon/intron No. Login to comment
131 The panel of 30 mutations (c.1717-1GNA, p.G542X, p.W1282X, p.N1303K, p.F508del, c.3849+10kbCNT, c.621+1GNT, p.R553X, p.G551D, p.R117H, p.R1162X, p.R334W, p.A455E, c.2183AANG, c.3659delC, c.1078delT, p.I507del, p.R347P, p.S1251N, p.E60X, p.Y1092X, c.394delTT, c.1811+1.6kbANG, c.3272-26ANG, c.2789+5GNA, c.3120+1GNA, c.711+ 1GNT, p.G85E, p.Y122X, p.W846X) should account for 83.32% of the CF alleles in L-R and 84.25% in the whole country. Login to comment

[hide] Cystic fibrosis at the Reunion Island (France): sp... J Cyst Fibros. 2004 Aug;3(3):185-8. Dugueperoux I, Bellis G, Lesure JF, Renouil M, Flodrops H, De Braekeleer M
Cystic fibrosis at the Reunion Island (France): spectrum of mutations and genotype-phenotype for the Y122X mutation.
J Cyst Fibros. 2004 Aug;3(3):185-8., [PMID:15463906]

Abstract [show]
BACKGROUND: The Reunion Island is a French administrative department located in the Indian Ocean between the islands of Madagascar and Mauritius. Its population is known to be at a high risk of cystic fibrosis (CF). METHODS: Data concerning all CF patients born at the Reunion Island was extracted from the French CF Registry. Twenty-eight DeltaF508/DeltaF508, 17 Y122X/DeltaF508, and 11 Y122X/Y122X were included in a genotype-phenotype study. RESULTS: The detection rate of the CFTR mutations was 83% among the CF patients born at the Reunion Island. Three CFTR mutations accounted for 75% of the detected CF alleles at the Reunion Island (DeltaF508, Y122X, and 3120 + 1G-->A.). The DeltaF508/DeltaF508, DeltaF508/Y122X, and Y122X/Y122X genotypes accounted for 60.2% of the CF patients. Patients carrying at least one Y122X mutation were pancreatic insufficient, had high sweat chloride values and significantly lower anthropometric measures. The mean anthropometric values in all three groups were lower that in the whole CF population followed in "continental" France. This may reflect the poor compliance and even the refusal of treatment noted by the clinicians. CONCLUSIONS: The distribution of CFTR mutations could be explained by the history of the Reunion Island: admixture of French settlers, African and Asian populations, founder effect and isolation followed by genetic drift. The Y122X allele appears to be associated with a severe phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Three CFTR mutations accounted for 75% of the detected CF alleles at the Reunion Island (DF508, Y122X, and 3120 + 1G ! Login to comment
7 The DF508/DF508, DF508/Y122X, and Y122X/Y122X genotypes accounted for 60.2% of the CF patients. Login to comment
8 Patients carrying at least one Y122X mutation were pancreatic insufficient, had high sweat chloride values and significantly lower anthropometric measures. Login to comment
12 The Y122X allele appears to be associated with a severe phenotype. Login to comment
14 Keywords: Cystic fibrosis; Y122X; Genotype-phenotype; Reunion Island; Rare mutations; 3120+1G!A 1. Login to comment
21 Because of its specificity (history and population constitution), we decided to study the spectrum of mutations identified in the island and the genotype-phenotype correlation of the most frequent mutation (Y122X) using the French Cystic Fibrosis Registry. Login to comment
32 In a second step, we extracted the available data for all 11 patients homozygous for the Y122X mutation and 17 compound heterozygotes for the Y122X and DF508 mutations, as previously described [1]. Login to comment
33 Because of the small size of the CF population, the patients followed at the Reunion Island (ten Y122X homozygotes and ten compound heterozygotes) were compared to all 20 Reunion Island patients homozygous for the DF508 mutation. Login to comment
45 Three accounted for 90.4% of the identified mutations: DF508 (53.4%), Y122X (32.2%), and 3120 + 1G ! Login to comment
49 Three genotypes accounted for 79.1% of the fully identified genotypes; they were DF508/DF508 (32.8%), DF508/Y122X (26.9%), and Y122X/Y122X (19.4%). Login to comment
50 Fifty-six patients (28 DF508/DF508, 17 Y122X/DF508, and 11 Y122X/Y122X) were included in the genotype-phenotype study (Table 2). Login to comment
53 Although the mean age at diagnosis (excluding those diagnosed prenatally or on familial history and those neonatally screened) was not statistically different between all three groups ( p = 0.90), patients homozygous for the Y122X tended to be diagnosed early, the median age for this group being much lower than for both other groups. Login to comment
58 Patients homozygous for the Y122X mutation or compound heterozygous for the Y122X and DF508 mutations had significantly lower anthropometric measures (height and weight) than those homozygous for the DF508 mutation. Login to comment
62 Aspergillus was more frequently identified in the patients carrying at least one Y122X allele, but the difference was not significant ( p = 0.08). Login to comment
63 One 17-year-old Y122X/DF508 male had a cardiopulmonary transplantation in 2000. Login to comment
66 Nasal polyposis was more frequent among CF patients carrying at least one Y122X allele compared to Table 1 Mutations and genotypes identified among CF patients born in the Reunion Island Mutations Number (%) Genotypes Number (%) DeltaF508 78 (53.42) DeltaF508/DeltaF508 22 (32.84) Y122X 47 (32.19) DeltaF508/Y122X 18 (26.87) 3120 +1G ! Login to comment
67 A 7 (4.79) Y122X/Y122X 13 (19.40) G542X 2 (1.37) 3120 + 1G ! Login to comment
77 G 1 (1.49) D993Y 1 (0.68) DeltaF508/ G551D 1 (1.49) G149R 1 (0.68) DeltaF508/1161delC 1 (1.49) G85E 1 (0.68) Y122X/3120 + 1G ! Login to comment
78 A 1 (1.49) R1162X 1 (0.68) Y122X/1717-1G ! Login to comment
83 The spectrum of CFTR mutations in natives of the Reunion Island is dominated by three mutations: DF508 present on 44.3%, Y122X on 26.7% and 3120 + 1G ! Login to comment
85 The Cystic Fibrosis database maintained at the Sickkids Hospital in Toronto (Canada) reports that the world-wide frequency of the DF508 mutation is close to 66% and that the Y122X and 3120 + 1G ! Login to comment
86 A alleles are Table 2 Characteristics of patients homozygous for the Y122X mutation, compound heterozygous for the Y122X and DF508 mutations compared to homozygous for the DF508 mutation (*no significant difference at p = 0.05) DeltaF508/DeltaF508 Y122X/DeltaF508 Y122X/Y122X p values Sex (males/females) 20/8 = 28 8/9 = 17 7/4 = 11 Age at 01/01/2001 (years) Mean age F SD 12.4 F 5.7 12.4 F 6.1 12.4 F 3.8 * Median age 11.5 13.0 12.0 Range 3-24 1-23 7-19 Age at diagnosis (months)a Mean age 31.36 F 44.53 32.50 F 51.2 24.67 F 56.02 * Median age 7.0 8.0 2.0 Range 0-160 1-159 0-139 Sweat chloride concentration (mEq/l) Mean value F SD 106.8 F 33.7 119.9 F 26.7 107.9 F 36.7 * Median value F SD 119.0 114.0 99.5 Range 25-179 110-166 68-175 Status at diagnosis Family history 3 1 1 * Prenatal diagnosis 0 0 2 0.022 Neonatal screening 3 4 3 * Meconium ileus 6 (21.4%) 4 (23.5%) 3 (27.3%) * Dehydration 0 1 0 * Gastrointestinal symptoms 19 (73.1%) 8 (53.3%) 5 (45.4%) * Respiratory symptoms 11 (39.2%) 9 (52.9%) 3 (27.3%) * Nasal polyposis 1 0 0 * Physical status Height (Z score F SD) À 0.572 F 1.095 À 1.007 F 1.025 À 2.164 F 1.474 0.002 Weight (Z score F SD) À 1.180 F 1.092 À 1.621 F1.207 À 2.291 F1.451 0.047 BMI F SD (kg/m2) 16.80 F 2.45 16.11 F1.93 16.23 F 2.79 * Pulmonary status (% of predicted value) FEV1 F SD 73.25 F 25.47 62.74 F 22.74 80.71 F 27.06 * FVC F SD 80.21 F 21.87 66.47 F 16.46 80.21 F19.37 * Throat cultures (nr of patients) Haemophilus influenzae 14 (50.0%) 3 (17.6%) 2 (18.1%) 0.042 Staphylococcus aureus 19 (67.9%) 9 (52.9%) 10 (90.9%) * Pseudomonas aeruginosa 14 (50.0%) 8 (47.0%) 7 (63.6%) * Stenotrophomonas maltophilia 2 0 0 * Burkholderia cepacia 4 1 1 * Aspergillus 6 (21.4%) 8 (47.1%) 6 (54.5%) 0.080 Candida 2 2 1 * Clinical events (number of patients) Cirrhosis 3 (10.7%) 3 (17.6%) 1 (9.1%) * Mellitus diabetes 3 (10.7%) 1 (5.9%) 1 (9.1%) * Gallstones 1 0 1 * Nasal polyposis 4 (14.2%) 6 (36.3%) 4 (36.4%) * a Excluding patients diagnosed prenatally or on familial history and those neonatally screened. Login to comment
89 The Y122X mutation was first described by Chevalier-Porst et al. [2] in 1992 in a white native patient of the Reunion Island. Login to comment
91 The Cystic Fibrosis Genetic Analysis Consortium counted 14 CF chromosomes carrying the Y122X allele, all coming from France, without specification [3]. Login to comment
103 It is presumed that the Y122X mutation was present among the first French settlers, its high frequency being probably the result of a founder effect and isolation from the mainland, followed by genetic drift. Login to comment
106 This is the first genotype-phenotype correlation study on the Y122X mutation using a cohort approach. Login to comment
107 Our results showed that patients carrying the Y122X allele, either in an homozygous or compound heterozygous status, have a severe CF phenotype. Login to comment
90 The Y122X mutation was first described by Chevalier-Porst et al. [2] in 1992 in a white native patient of the Reunion Island. Login to comment
92 The Cystic Fibrosis Genetic Analysis Consortium counted 14 CF chromosomes carrying the Y122X allele, all coming from France, without specification [3]. Login to comment
104 It is presumed that the Y122X mutation was present among the first French settlers, its high frequency being probably the result of a founder effect and isolation from the mainland, followed by genetic drift. Login to comment
108 Our results showed that patients carrying the Y122X allele, either in an homozygous or compound heterozygous status, have a severe CF phenotype. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 b 3905insT, 1811+1.6kbA>G, S945L, S1251N, Y122X, 2711delT, R117H, E60X, 2184insA, E585X, L558S, S1235R, D1152H, K710X, Q493X, A455E, G178R, I148T, 574delA. Login to comment

[hide] SSCP analysis: a blind sensitivity trial. Hum Mutat. 1997;10(1):65-70. Jordanova A, Kalaydjieva L, Savov A, Claustres M, Schwarz M, Estivill X, Angelicheva D, Haworth A, Casals T, Kremensky I
SSCP analysis: a blind sensitivity trial.
Hum Mutat. 1997;10(1):65-70., [PMID:9222762]

Abstract [show]
Studies of the sensitivity of SSCP analysis usually have been performed under conditions contrary to the rules of quality control trials and have produced widely different results. We have performed a blind trial of the sensitivity of SSCP analysis for the detection of mutations in fragments up to 500 bp in length under a fixed single set of electrophoretic conditions. The mutation detection rate was 84%. In addition, we have identified a second mutation in nine samples. All these mutations are polymorphisms, including a novel polymorphism 1248 + 52T/C first reported in the present work.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
54 These included G551D(G→A) inexon11 (see Fig. 2);S945L(C→T) in exon 15; 1215delG in exon 7; Y122X (T→A), 621 + 1 (G→T), and 621 + 2 (T→G) in exon 4. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment
89 Mutations detected by the referring laboratories using SSCP analysis. This group included mutations 621+1(G→T), 621+2(T→G), Y122X, G551D, and S945L. Login to comment
90 They had been detected after preliminary restriction digestion (mutations G551D and S945L) or under two different SSCP conditions (mutations 621+1(G→T), 621+2(T→G) and Y122X) (see Table 1). Login to comment

[hide] Survey of cystic fibrosis transmembrane conductanc... Dig Dis Sci. 1996 Mar;41(3):540-2. McGill JM, Williams DM, Hunt CM
Survey of cystic fibrosis transmembrane conductance regulator genotypes in primary sclerosing cholangitis.
Dig Dis Sci. 1996 Mar;41(3):540-2., [PMID:8617131]

Abstract [show]
A variety of cholestatic liver diseases appear to primarily affect the biliary epithelium, including cystic fibrosis (CF). CF results from a defect in the chloride channel protein, cystic fibrosis transmembrane conductance regulator (CFTR). Although the majority of CF patients have a genomic deletion in deltaF508, other mutations of CFTR may result in less severe clinical presentations and outcomes. Recently, CFTR has been shown to be involved in secretin-stimulated choleresis in intrahepatic bile duct epithelial cells. Cholestasis in cystic fibrosis appears to result from defective chloride transport across the biliary epithelium and is the only cholestatic disease of bile ducts for which a cellular defect has been identified. Primary sclerosing cholangitis (PSC) is a cholestatic disease with histological and cholangiographic features similar to CF. The purpose of this pilot study was to explore whether there is an increased prevalence of CFTR mutations. Two patients exhibited mutations in one allele, yielding a carrier rate of 10.6%, not statistically different from the general U.S. population carrier rate of 4%.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 In total, 32 mutations were evaluated, which represent 90% of the most common mutations (t4): AF508 G542X G551D W1282X 3905insT NI303K 3849+ 10kbC--~T R553X 621+ IG--*T 1717- IG--,A lt)78delT 2789+5G---~A 3849+4A--~G 711+ IG---oT R1162X 1898+IG----~A R117H 3659delC G85E 2184delA A1507 R347P Y1092X R560T A455E R334W Y122X S549R(T---~G) Q493X V520F $549N R347H Patient Selection. Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 We also identified four other mutations which have already been reported, a nonsense mutation in exon 4 (Y122X)22 and three frameshift mutations in exon 13, 1918delGC, 2118del4, and 2372del8.2' This study underlines some other factors. Login to comment

[hide] Analysis of the CFTR gene confirms the high geneti... Hum Genet. 1994 Apr;93(4):447-51. Chillon M, Casals T, Gimenez J, Ramos MD, Palacio A, Morral N, Estivill X, Nunes V
Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes.
Hum Genet. 1994 Apr;93(4):447-51., [PMID:7513293]

Abstract [show]
We have analysed 972 unrelated Spanish cystic fibrosis patients for 70 known mutations. Analysis was performed on exons 1, 2, 3, 4, 5, 6a, 6b, 7, 10, 11, 12, 13, 14a, 14b, 15, 16, 17b, 18, 19, 20 and 21 of the cystic fibrosis transmembrane regulator gene using single strand conformation polymorphism analysis and denaturing gradient gel electrophoresis. The major mutation delta F508 accounts for 50.6% of CF chromosomes, whereas another 42 mutations account for 27.6% of CF chromosomes, with 21.8% of Spanish CF chromosomes remaining uncharacterized. At present, we have identified 36 mutations that have frequency of less than 1% and that are spread over 15 different exons. This indicates that, in the Spanish population, with the exception of delta F508 (50.6%) and G542X (8%), the mutations are not concentrated in a few exons of the gene nor are there any predominating mutations. This high degree of genetic heterogeneity is mainly a result of the different ethnic groups that have populated Spain and of the maintenance of separated population sets (Basques, Arab-Andalusian, Mediterranean, Canarian and Gallician). The high proportion of CF chromosomes still unidentified (21.8%) together with association analysis with intragenic markers suggest that at least 100 different mutations causing CF are present in our population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 At present, we have not detected any Spanish CF chromosomes bearing any of the following mutations: 394delTA, Y122X, 556delA, 852de122, R347P, $492F, 1677delTA, V520F, Q552X, R553X, L559S, R560K, R560T, Y563N, P564H, 2043delG, 3320ins5, R1066H, A1067T, H1085R, 3732delA, 3737delA, I1234V, S1255P, 3898insC, Q1291H or 4005+ 1G---~A. Login to comment

[hide] Genetic analysis of Hispanic individuals with cyst... Am J Hum Genet. 1994 Mar;54(3):443-6. Grebe TA, Seltzer WK, DeMarchi J, Silva DK, Doane WW, Gozal D, Richter SF, Bowman CM, Norman RA, Rhodes SN, et al.
Genetic analysis of Hispanic individuals with cystic fibrosis.
Am J Hum Genet. 1994 Mar;54(3):443-6., [PMID:7509564]

Abstract [show]
We have performed molecular genetic analyses of Hispanic individuals with cystic fibrosis (CF) in the southwestern United States. Of 129 CF chromosomes analyzed, only 46% (59/129) carry delta F508. The G542X mutation was found on 5% (7/129) of CF chromosomes. The 3849 + 10kbC-->T mutation, detected primarily in Ashkenazi Jews, was present on 2% (3/129). R1162X and R334W, mutations identified in Spain and Italy, each occurred on 1.6% (2/129) of CF chromosomes. W1282X and R553X were each detected once. G551D and N1303K were not found. Overall, screening for 22 or more mutations resulted in detection of only 58% of CF transmembrane conductance regulator gene mutations among Hispanic individuals. Analysis of KM19/XV2c haplotypes revealed an unusual distribution. Although the majority of delta F508 mutations are on chromosomes of B haplotypes, the other CF mutations are on A and C haplotypes at higher-than-expected frequencies. These genetic analyses demonstrate significant differences between Hispanic individuals with CF and those of the general North American population. Assessment of carrier/affected risk in Hispanic CF individuals cannot, therefore, be based on the mutation frequencies found through studies of the general population but must be adjusted to better reflect the genetic makeup of this ethnic group. Further studies are necessary to identify the causative mutation(s) in this population and to better delineate genotype/phenotype correlations. These will enable counselors to provide more accurate genetic counseling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 The following CFTR gene mutations were identified by published methods: AF508 (Rommens et al. 1990); G542X (Kerem et al. 1990); GS51D and R553X (Cutting et al. 1990); R1162X (Gasparini et al. 1991); W1282X (Vidaud et al. 1990); N1303K (Osborne et al. 1991); 3849 +lOkbC- T (Highsmith et al., submitted); and R117H, Y122X, 1148T, 621+1G-*oT, 711+1G- T, G314E, 1078AT, R334W, R347P, Q493X, A1507, V520F, 1717 -1G-oA, R560T, and 3569AC (J. DeMarchi et al., submitted). Login to comment
54 COther = A1507, 621+1G- T, R117H, N1303K, 711+1G-*.T, 1717-1G-.A, R560T, Y122X, 1148T, G314E, 1078AT, R347P, Q493X, V520F, and 3659AC. Login to comment
56 The G542X mutation was found in 5.4% of Hispanic CF chromosomes, similar to the 3% frequency in the general population. Login to comment
47 The following CFTR gene mutations were identified by published methods: AF508 (Rommens et al. 1990); G542X (Kerem et al. 1990); GS51D and R553X (Cutting et al. 1990); R1162X (Gasparini et al. 1991); W1282X (Vidaud et al. 1990); N1303K (Osborne et al. 1991); 3849 +lOkbC-T (Highsmith et al., submitted); and R117H, Y122X, 1148T, 621+1G-*oT, 711+1G-T, G314E, 1078AT, R334W, R347P, Q493X, A1507, V520F, 1717 -1G-oA, R560T, and 3569AC (J. DeMarchi et al., submitted). Login to comment

[hide] Analysis of the 27 exons and flanking regions of t... Hum Mol Genet. 1993 Aug;2(8):1209-13. Claustres M, Laussel M, Desgeorges M, Giansily M, Culard JF, Razakatsara G, Demaille J
Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France.
Hum Mol Genet. 1993 Aug;2(8):1209-13., [PMID:7691344]

Abstract [show]
In order to characterize the non-delta F508 mutations that account for 36% of cystic fibrosis (CF) chromosomes in Southern France in a sample of 137 patients, we have systematically screened the entire coding region and adjacent sequences of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by the single strand conformation polymorphism (SSCP) technique followed by direct sequencing of the mutant DNAs. We identified 13 novel mutations (9 reported in this paper) and 4 novel rare nucleotide sequence variations. Forty different mutations including delta F508, located in 15 exons, account for only 91.2% of mutants in a population originating from Southern France, in contrast with a recent report on the Celtic population of Brittany demonstrating that 90% of mutations can be detected with only three mutations. We present a very large spectrum of different CF mutations identified in a small geographical area.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation? Login to comment

[hide] A nonsense mutation in exon 4 of the cystic fibros... Hum Mol Genet. 1992 Nov;1(8):647-8. Chevalier-Porst F, Chomel JC, Hillaire D, Kitzis A, Kaplan JC, Goutaland R, Mathieu M, Bozon D
A nonsense mutation in exon 4 of the cystic fibrosis gene frequent among the population of the Reunion Island.
Hum Mol Genet. 1992 Nov;1(8):647-8., [PMID:1284471]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 This mutation creates a stop codon (TAA) at amino acid position 122 of CFTR instead of a tyrosine (TAT) and thus was named Y122X. Login to comment
7 Y122X is located in the first transmembrane spanning region and is predicted to create a truncated, non functional, polypeptide. Login to comment
10 The maternal CF chromosome bearing Y122X carries the C haplotype defined by the extragenic DNA markers XV2C and KM19 (7). Login to comment
12 The screening for Y122X in this particular population by Msel digestion showed that 19 CF chromosomes out 66 are positive, 4 patients being homozygous. Login to comment
13 In this population delta F508 represents 39% of the CF alleles and Y122X 29%. Login to comment
14 In our sample of 1000 CF chromosomes from mainland France, delta F508 accounts for 68 % of the CF alleles and none of them tested by Msel digestion carry Y122X. Login to comment
18 Identification of Y122X on a 10% acrylamide gel electrophoresis after Msel digestion of exon 4 amplified product showing the segregation in a CF family: the affected child is homozygous for this mutation. Login to comment
19 F508 + Y122X) account for 68% of the CF chromosomes is probably due to the settlement of the population in this island. Login to comment
20 Y122X has been found only on CF chromosomes of white Caucasians known as 'petits blancs' who are the descendants of * To whom correspondence should be addressed atUniversityofNorthCarolinaatChapelHillonOctober25,2012http://hmg.oxfordjournals.org/Downloadedfrom 648 Human Molecular Genetics, Vol. 1, No. 8 the first French Settlers (46 men and 37 women) in the XVIIth century (8). Login to comment
24 The real origin of Y122X is unknown but the fact that all the Y122X chromosomes are of the same haplotype group (C) suggests a common origin for these chromosomes. Login to comment
25 In the remaining non delta F508, non Y122X CF chromosomes, the distribution of haplotypes does not differ significantly from the one observed in mainland France, suggesting that several rare mutations must account for these alleles. Login to comment

[hide] The spectrum of cystic fibrosis mutations. Trends Genet. 1992 Nov;8(11):392-8. Tsui LC
The spectrum of cystic fibrosis mutations.
Trends Genet. 1992 Nov;8(11):392-8., [PMID:1279852]

Abstract [show]
Although the major mutation causing cystic fibrosis accounts for almost 70% of mutant chromosomes screened, almost 300 sequence alterations have been identified in the gene during the past two and a half years. At least 230 of these mutations are probably associated with disease. This rapid accumulation of data is in part due to the highly coordinated effort by members of the Cystic Fibrosis Genetic Analysis Consortium. The information is not only essential to genetic diagnosis, but also will aid in understanding the structure and function of the protein, and possibly in correlating genotype with phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Frequent cystic fibrosis mutations Name Relative freqeenc~ Mutation Con~,~'~luence Ref. Z~508 67.2 G542X 3.4 G551D 2.4 W1282X 2.1 3905insT 2.1 N1303K 1.8 3849+10kbC-+T 1.4 1717-1G-+A 1078delT 2789+5G--+A Deletion of 3 bp between nt 1652 and t655 in exon 10 G-+T at nt 1756 in exon 11 G-+A at nt 1784 in exon 1I G-+A at nt 3978 in exon 20 Insertion of T after nt 3905 in exon 20 C-+G at nt 4041 in exon 21 C-->T in a 6.2 kb EcoRI fragment 10 kb from 5' junction of intron 19 3849+4A-+G 1.0 7tt÷IG--+T 0.9 Rl162X 0.9 1898+lG-+A 0.9 Rll7H 0.8 3659delc 0.8 G85E 0.7 2184delA 0.7 AI5W 0.5 R347P 0.5 R~ 0.4 1,3 C-+T at nt 1"789in exon 11 1.3 G-+T at nt 1 from 5' junction of intron 4 1.1 G--+A at nt 1 from 3' junction of intron 10 1.1 Deletion of T at nt 1078 in exon 7 1.1 G-cA at 5 nt from 5' end of intron 14b A-->G at 4 nt from 5' end of intron 19 G-+T at nt 1 from 5' junction of intron 5 C-+T at nt 3616 in exon 19 G-+A at nt 1 from 5' junction of intron 12 G--)A at nt 482 in exon Deletion of C at nt 3659 in exon 19 G-+A at nt 386 in exon 3 A-->G at nt 2183 and deletion of A at nt 2184 in exon 13 Deletion of 3 bp between nt 1648 and 1653 in exon 10 G-+C at nt 1172 in exon 7 G-~C at nt 1811 in exon 11 A455E 0.4 R334W 0.4 Y122X 0.3 S549R(T-+G) 0.3 Q493X 0.3 V520F 0.2 S549N 0.2 C-+A at nt 1496 in exon 9 C-+T at nt 1132 in exon 7 T-cA at nt ~i98 in exon 4 T--+G at nt 1779 in exon 11 C-+T at nt 1609 in exon 10 G-+T at nt 1690 in exon 10 G-->A at nt I778 in exon !1 Deletion of Phe at codon 508 Gly-+Stop at codon 542 12 Gly-~Asp at codon 551 10 l"rp-->Stop at codon t282 35 Frameshift -~ Asn-+Lys at codon 1303 36 Aberrant splicing -~ Arg~Stop ~ codon 553 Splice mutation 10 37 Splice mutation 12 Frameshift 38 Splice mutation _c Splice mutation? Login to comment

[hide] [CFTR gene analyis in 207 patients with cystic fib... Arch Pediatr. 2001 Feb;8(2):150-7. Federici S, Iron A, Reboul MP, Desgeorges M, Claustres M, Bremont F, Bieth E
[CFTR gene analyis in 207 patients with cystic fibrosis in southwest France: high frequency of N1303K and 1811+1.6bA>G mutations].
Arch Pediatr. 2001 Feb;8(2):150-7., [PMID:11232455]

Abstract [show]
The large molecular heterogeneity in cystic fibrosis (CF) represents the main difficulty for the genotype characterization. Moreover, numerous studies have reported considerable variations in frequencies of cystic fibrosis transmembrane conductance regulator (CFTR) mutations in different populations. MATERIAL AND METHODS: We analyzed the genotype of 207 CF children living in southwest France. RESULTS: Among 50 identified mutations, we report for some of them a widely modified incidence compared with those observed in other regions of France. These differences were more significant in the subset of the CF chromosomes originating in southwest France. Thus, the 1811 + 1.6 kbA > G mutation, rarely observed in the other French regions (< 0.5%), proved to be, with a frequency of 8.8%, the most frequent mutation after the F508 deletion (57%). The frequencies of N1303K, 1811 + 1.6 kbA > G and R334W mutations were also clearly increased: 7.9 and 2.6%, respectively. CONCLUSION: We show that the southwest of France is characterized by a specific mutational spectrum. We consider that these regional data on the spectrum of CF mutations are crucial to develop more accurate and less expensive molecular screening strategies for cystic fibrosis in France.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 Dans certaines populations constitu&#e9;es plus r&#e9;cemment, l`importance d`un effet fondateur appara&#ee;t encore plus significativement, c`est le cas, par exemple, de la population de l`&#ee;le de la R&#e9;union dans laquelle la mutation Y122X repr&#e9;sente presque la moiti&#e9; des all&#e8;les CF [5]. Login to comment

[hide] Analysis of 31 CFTR mutations in 55 families from ... Early Hum Dev. 2001 Nov;65 Suppl:S161-4. Gomez-Llorente MA, Suarez A, Gomez-Llorente C, Munoz A, Arauzo M, Antunez A, Navarro M, Gil A, Gomez-Capilla JA
Analysis of 31 CFTR mutations in 55 families from the South of Spain.
Early Hum Dev. 2001 Nov;65 Suppl:S161-4., [PMID:11755047]

Abstract [show]
We carried out a molecular analysis of 350 chromosomes from 55 families originating from the South of Spain (Andalucia) who were diagnosed with cystic fibrosis (CF). We used polymerase chain reaction, followed by an oligonucleotide ligation assay (OLA) and sequence-coded separation using capillary electrophoresis. A frequency of 43.5% for DeltaF508 was found, making it the most common CF mutation in our sample. Seven more mutations (G542X, R334W, R1162X, 2789+5G-->A, R117H, DeltaI507 and W1282X) were detected and accounted for 24.7% of the total. The remaining mutations (31.8%) were undetectable with the methodology used in this study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 A I.10 R117H E.4 G542X E.11 Y122X E.4 G551D E.11 711 + 1G ! Login to comment

[hide] [Clinical aspects and genetic specificities of cys... Arch Pediatr. 2003 Nov;10(11):955-9. Flodrops H, Renouil M, Lesure F, Marechal D, Piyaraly S, Arvin-Berod C, Robillard PY, Fourmaintraux A, Cartault F
[Clinical aspects and genetic specificities of cystic fibrosis in Reunion Island].
Arch Pediatr. 2003 Nov;10(11):955-9., [PMID:14613688]

Abstract [show]
OBJECTIVES: Evaluation of the phenotype-genotype correlation of a specific mucoviscidosis mutation, "Y122X", in Reunion Island. This mutation represents 25% of our cases. PATIENTS AND METHODS: Retrospective study of a cohort of 84 children presenting cystic fibrosis (CF) during a 5-year period (1994-1998). Diagnosis was based on one or two identified genetic mutations and/or minimum two abnormal chloride sweat tests (Cl > 70 mmol/l). Follow-up of this cohort was performed in the two referral centers of the Island following the French national guidelines (INSERM U 155). RESULTS: In our population, we identified 10 mutations, of which three of them represented more than 80% of the cases: Delta F508 (51.8%), Y122X (24.4%) and 3120 + 1G --> A (4.8%). The authors report clinical significant differences in children with the homozygote mutation Y122X as compared with children presenting the Delta F508 CF-mutation: failure to thrive affecting mainly the height with, paradoxically, a relatively normal weight development, and a better pulmonary function. CONCLUSION: The frequent Y122X CF-mutation reported in "la Reunion" seems to affect mainly height in children with a relatively good nutritional outcome. This failure to thrive does not seem to be of digestive origin. These results suggest that growth gene(s) located nearby the cystic fibrosis transmembrane conductance regulator (CFTR) may have suffered the same segregation than the Y122X mutation or that clusters of this specific Caucasian population known as "petits blancs" in la Reunion are smallest for ethnic reasons.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
12 Un g&#e8;ne proche du g&#e8;ne CFTR (Cystic Fibrosis Transmenbrane conductance Regulator) a pu subir la m&#ea;me s&#e9;gr&#e9;gation que la mutation Y122X, ou la population &#ab; des petits blancs &#bb; habitant les hauts plateaux de la R&#e9;union est significativement plus petite pour des raisons ethniques. Login to comment
15 - Evaluation of the phenotype-genotype correlation of a specific mucoviscidosis mutation, "Y122X", in Reunion Island. Login to comment
24 - In our population, we identified 10 mutations, of which three of them represented more than 80% of the cases: D F508 (51.8%), Y122X (24.4%) and 3120 + 1G ࢐ A (4.8%). Login to comment
25 The authors report clinical significant differences in children with the homozygote mutation Y122X as compared with children presenting the D F508 CF-mutation: failure to thrive affecting mainly the height with, paradoxically, a relatively normal weight development, and a better pulmonary function. Login to comment
38 Cette mixit&#e9; et une certaine consanguinit&#e9; dans les cirques (Mafate, Cilaos, Sa- lazie) et les hauts de l`&#ee;le longtemps renferm&#e9;s sur eux-m&#ea;mes, expliquent en partie pourquoi la mutation Y122X pr&#e9;domine dans le sud de l`&#ee;le, car ce n`est que depuis 1960 que Cilaos poss&#e8;de une route fiable. Login to comment
41 L`absence d`&#e9;tude &#e9;pid&#e9;miologique depuis 1989 et les progr&#e8;s consid&#e9;rables effectu&#e9;s en biologie mol&#e9;culaire ces dix derni&#e8;res ann&#e9;es nous ont conduits &#e0; refaire le point sur la mucoviscidose &#e0; l`&#ee;le de la R&#e9;union et &#e0; tenter de pr&#e9;ciser la corr&#e9;lation ph&#e9;notype-g&#e9;notype d`une mutation, &#e0; notre connaissance typiquement r&#e9;unionnaise, la mutation Y122X, ainsi que sa fr&#e9;quence [4,5]. Login to comment
72 La mutation Y122X &#e0; l`&#e9;tat homozygote &#e9;tait retrouv&#e9;e chez 14,3 % des patients et chez 23,8 % &#e0; l`&#e9;tat h&#e9;t&#e9;rozygote composite, soit 38 % des patients. Login to comment
74 La comparaison des g&#e9;notypes entre la R&#e9;union et la m&#e9;tropole a mis en &#e9;vidence deux diff&#e9;rences significatives : ߦ la premi&#e8;re concernait les homozygotes pour la mutation DF508 qui sont retrouv&#e9;s avec une fr&#e9;quence moindre &#e0; la R&#e9;union qu`en m&#e9;tropole (34,4 contre 49,6 %), (p < 0,01) ; ߦ la deuxi&#e8;me concernait les patients porteurs de deux mutations autres que DF508, en particulier les mutations Y122X et 3120+1G࢐A qui sont relev&#e9;es avec une fr&#e9;- quence plus &#e9;lev&#e9;e &#e0; la R&#e9;union qu`en m&#e9;tropole, (20,3 vs 4,6 %) (p < 0,0001). Login to comment
76 Tableau 1 R&#e9;sultats des dosages du chlore sudoral G&#e9;notypes Chlore sudoral en meq/litre* Nombre d`enfants Moyenne &#c9;cart-type Extr&#ea;mes DF508/DF508 29 103,5 34 80-179 DF508/Y122X 14 125,4 36 85-218 Y122X/Y122X 12 115 32 85-160 * Meq/litre : milli&#e9;quivalent de chlore par litre de sueur. Login to comment
77 Tableau 2 R&#e9;partition g&#e9;ographique des g&#e9;notypes &#e0; la R&#e9;union G&#e9;notypes Nord % Sud % Total % DF508/DF508 18 21,4 11 13,1 29 34,5 DF508/Y122X 6 7,1 8 9,5 14 16,6 DF508/A455E 2 2,4 1 1,2 3 3,6 DF508/3120+1G࢐A 2 2,4 - - 2 2,4 D F508/G551D - - 1 1,2 1 1,2 DF508/2789+5G࢐A 1 1,2 - - 1 1,2 D F508/1161 del C - - 1 1,2 1 1,2 D F508/1078 del T - - 1 1,2 1 1,2 D F508/ ??? Login to comment
78 6 7,1 - - 6 7,1 Y122X/Y122X 4 4,8 8 9,5 12 14,3 Y122X/3120+1G࢐A 2 2,4 - - 2 2,4 3120+1G࢐A/3120+1G࢐A 1 1,2 1 1,2 2 2,4 1717-1G࢐A/Y122X 1 1,2 - - 1 1,2 G452X / ??? Login to comment
82 = mutation non identifi&#e9;e. Tableau 3 Distribution des mutations &#e0; la R&#e9;union Mutation Nombre de chromosomes Total % Total cumul&#e9; nord (1) sud (2) D F508 53 34 87 51,8 87 Y122X 17 24 41 24,4 128 3120+1G࢐A 6 2 8 4,8 136 A455E 2 1 3 1,8 139 G551D - 1 1 0,6 140 2789+5G࢐A 1 - 1 0,6 141 1161 del C - 1 1 0,6 142 1078 del T - 1 1 0,6 143 1717-1G࢐A 1 - 1 0,6 144 G542X - 1 1 0,6 145 ??? Login to comment
86 La mutation Y122X para&#ee;t &#ea;tre une particularit&#e9; de la population r&#e9;unionnaise Le s&#e9;quen&#e7;age direct du produit de la PCR (polymerase chain reaction) de l`exon 4 a montr&#e9; une substitution du nucl&#e9;otide T par A en position 498 de la s&#e9;quence d`ADNc. Login to comment
88 Elle a &#e9;t&#e9; responsable de la formation d`un polypeptide tronqu&#e9;, non fonctionnel [12], ce qui a permis de la situer parmi les anomalies de codage du g&#e8;ne de classe I. La mutation Y122X, fr&#e9;quente &#e0; la R&#e9;union (24,4 % des cas), n`a &#e9;t&#e9; retrouv&#e9;e qu`exceptionnellement en m&#e9;tropole (0,15 % des cas). Login to comment
91 Il existait une diff&#e9;rence hautement significative de la distribution de la mutation Y122X entre R&#e9;union et m&#e9;tropole (p < 0,00001). Login to comment
94 La v&#e9;ritable origine de cette mutation restait inconnue, mais le fait que tous les chromosomes &#ab; Y122X &#bb; portaient le m&#ea;me haplotype &#ab; C &#bb; sugg&#e9;rait un lien de communaut&#e9; et un probable effet fondateur [4]. Login to comment
98 L`analyse des effectifs cumul&#e9;s sur les cinq ans &#e9;tudi&#e9;s a permis de mettre en &#e9;vidence les diff&#e9;rences significatives suivantes (Tableau 4) : ߦ concernant la taille (exprim&#e9;e en DS) : les homozygotes Y122X pr&#e9;sentaient un retard statural plus important que les homozygotes DF508, -1,6 DS vs -0,6DS (p < 0,001), que les h&#e9;t&#e9;rozygotes composites DF508/Y122X, -1,6 DS vs -0,2 DS (p < 0,000005), et que l`ensemble des patients, -1,6DS vs -0,6DS (p < 0,0002) ; ߦ concernant le poids (en % du poids id&#e9;al pour la taille) : les homozygotesY122X avaient un meilleur &#e9;tat nutritionnel que les homozygotes DF508, 97,3 vs 92,6 % (p < 0,02), que les h&#e9;t&#e9;rozygotes composites DF508/ Y122X, 97,3 vs 92 % (p < 0,01) et que l`ensemble des patients , 97,3 vs 93,4 % (p < 0,05) ; ߦ concernant le poids (exprim&#e9; en DS) : les homozygotes Y122X avaient un retard pond&#e9;ral plus marqu&#e9; que les homozygotes DF508, -1,3 DS vs -1 DS (p < 0,05), que les h&#e9;t&#e9;rozygotes composites DF508/Y122X, -1,3 DS vs -0,8 DS (p < 0,01) et que l`ensemble des patients, -1,3 DS vs -1DS (p < 0,05) ; ߦ concernant la fonction pulmonaire, les homozygotes Y122X avaient une moindre alt&#e9;ration de leur VEMS que les homozygotes DF508, et que l`ensemble des patients. Login to comment
99 Les homozygotes Y122X avaient une moindre alt&#e9;ration de leur CVF que les homozygotes DF508, 88 vs 68 % (p < 0,00002), et que les h&#e9;t&#e9;rozygotes composites DF508/Y122X, 88 vs 76 % (p < 0,02) et par rapport &#e0; l`ensemble des patients, 88 vs 72 % (p < 0,00005). Login to comment
104 Les r&#e9;sultats pr&#e9;liminaires de notre &#e9;tude sugg&#e8;rent que les homozygotes Y122X ont un retard statural plus marqu&#e9;, un meilleur &#e9;tat nutritionnel et une moindre alt&#e9;ration de leur fonction pulmonaire ; &#e0; l`inverse les homozygotes DF508 pr&#e9;sentent une alt&#e9;ration de leur fonction pulmonaire plus prononc&#e9;e. Login to comment
105 Le meilleur &#e9;tat nutritionnel des homozygotes Y122X montre que le retard statural de ces derniers n`est pas &#e0; mettre en rapport avec une insuffisance pancr&#e9;atique ou une malnu- Tableau 4 Comparaison de l`expression ph&#e9;notypique entre les trois principaux g&#e9;notypes. Login to comment
106 Donn&#e9;es cumul&#e9;es de 1994 &#e0; 1998 &#e0; la R&#e9;union DF508/DF508 DF508/Y122X Y122X/Y122X Total Tous Patients Sex-Ratio 5 0,7 2,3 1,7 A c6; ge Moyen 9,4 8,9 8,7 10,1 Taille (DS) -0,6 -0,2 -1,6 -0,6 &#c9;cart-Type 0,36 0,33 0,31 0,35 Poids (DS) -1 -0,8 -1,3 -1 &#c9;cart-Type 0,4 0,375 0,30 0,4 Poids id&#e9;al (%) 92,6 91,9 97,3 93,4 &#c9;cart-Type 3,8 3,4 3,7 3,75 IMC 15,6 14,9 15,8 15,4 VEMS (%) 65,4 74,8 85,4 70 CVF (%) 68,1 76,1 87,9 71,9 Effectifs cumul&#e9;s 96 47 49 281 trition associ&#e9;e. Login to comment
108 Une des hypoth&#e8;ses &#e9;voqu&#e9;es est qu`un g&#e8;ne proche de celui de la mucoviscidose pourrait &#ea;tre en rapport avec la croissance et que s`il existe, il subirait la m&#ea;me s&#e9;gr&#e9;gation que la mutation Y122X. Login to comment
112 Dans notre &#e9;tude, l`esp&#e9;rance de vie des homozygotes Y122X n`a pu &#ea;tre compar&#e9;e &#e0; celle des patients ayant d`autres g&#e9;notypes, faute de recul suffisant. Login to comment
113 Toutefois, compte tenu du fait que les homozygotes Y122X, malgr&#e9; leur &#ab; petite taille &#bb;, pr&#e9;sentent une moindre alt&#e9;ration de leur fonction pulmonaire et un meilleur &#e9;tat nutritionnel, une diminution de leur esp&#e9;rance de vie semble peu probable. Login to comment
115 Conclusion Notre &#e9;tude a permis de r&#e9;actualiser le g&#e9;notype CFTR en confirmant la pr&#e9;sence d`une mutation particuli&#e8;re, la mutation Y122X, &#e0; un taux important de 25 % sur l`&#ee;le de la R&#e9;union. Login to comment
118 L`hypoth&#e8;se que nous faisons est que le facteur &#ab; petite taille &#bb; est un marqueur de la population des porteurs de la mutation Y122X. Login to comment

[hide] Diagnosis of cystic fibrosis in adults with diffus... J Cyst Fibros. 2004 Mar;3(1):15-22. Hubert D, Fajac I, Bienvenu T, Desmazes-Dufeu N, Ellaffi M, Dall'ava-Santucci J, Dusser D
Diagnosis of cystic fibrosis in adults with diffuse bronchiectasis.
J Cyst Fibros. 2004 Mar;3(1):15-22., [PMID:15463882]

Abstract [show]
We assessed the contribution of the sweat test, genotyping and nasal potential difference (NPD) in the diagnosis of cystic fibrosis (CF) in adults with diffuse bronchiectasis (DB). Among 601 adults referred for DB from 1992 to 2001, 46 were diagnosed with CF. The sweat test was positive in 37 patients and normal or intermediate in nine patients. Two CF mutations were identified in 18 patients (39%) by screening for 31 mutations and in 36 patients (78%) after complete genetic analysis. NPD was suggestive of CF in 71% of the patients. The combination of the sweat test and genetic analysis led to the diagnosis of CF in 45 patients. In the nine patients with normal or intermediate sweat test, the diagnosis was confirmed by screening for 31 mutations in five, by complete genetic screening in three, and by NPD in the remaining patient. Searching for CF should start with sweat test. If the sweat test is normal or intermediate, screening for 31 mutations may help to diagnose CF. A complete genetic analysis is indicated when only one mutation is detected and/or when other clinical features, such as obstructive azoospermia or pancreatic insufficiency, are suggestive of CF. NPD measurement is indicated in controversial cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 We used an oligonucleotide ligation assay using a commercially available kit (Cystic Fibrosis Assay, Applied Biosystems, Foster City, CA, USA) to seek 31 mutations in the CFTR gene (F508del, I507del, Q943X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA) which allowed to detect 82% of the CF alleles in France. Login to comment
129 * 31 mutations: F508del, I507del, Q493X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q ** 4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA. that the laboratory criteria for the diagnosis of CF should be expanded to include identification of CFTR mutations and abnormal bioelectrical properties of the nasal epithelium, in addition to the sweat test w7x. Login to comment

[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]

Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 None of these subjects showed any clinical manifestations of CF, nor were any positive for CFTR mutations when analyzed by means of the PCR/OLA/SCS method (Celera Diagnostics) [21], which searches for the most common worldwide 31 CFTR mutations (G85E, R117H, Y122X, 621+1G->T, 711+1G->T, 1078delT, R347P, R347H, R334W, A455E, DF508, DI507, Q493X, V520F, 1717-1G->A, G542X, G551D, R553X, R560T, S549R(T->G), S549N, 1898+1G->A, 2183AA->G, 2789+5G->A, R1162X, 3659delC, 3849+10kbC->T, 3849+4A->G, W1282X, 3905insT, N1303K), including the 12 most common in Italy [1,22]. Login to comment

[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT. Login to comment

[hide] [The French nationwide cystic fibrosis newborn scr... Arch Pediatr. 2008 Jun;15 Suppl 1:S1-6. doi: 10.1016/S0929-693X(08)73940-X. Munck A, Roussey M
[The French nationwide cystic fibrosis newborn screening program: strategy and results].
Arch Pediatr. 2008 Jun;15 Suppl 1:S1-6. doi: 10.1016/S0929-693X(08)73940-X., [PMID:18822253]

Abstract [show]
In 2002 France implemented a nationwide newborn screening program for cystic fibrosis (CF). The strategy combined immunoreactive trypsinogen and, in case of a value over the cut-off level, DNA analysis in dried blood samples at day 3. Data were centralized and periodically analyzed thus maintaining the percentage of samples requiring mutation analysis (0.6%), limiting the number of false-positive cases (0.1%) without increasing the number of false-negative cases (3.2%). 3.527.353 infants were screened between 2002 and 2006. The overall cystic fibrosis incidence was 1/ 4136 with a wide range of regional variations. Dilemma case presentation occurred for 14 % of the patients; an European working group is actively working on this topic, attempting to establish a consensus on the adequate procedures. Cystic fibrosis newborn screening is feasible all over a nation but needs a strong organization from maternity wards to CF care centers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 L`organigramme du DNN (fig. 1) pr&#e9;voit une valeur seuil de TIR &#e0; J3 d&#e9;termin&#e9;e sur les donn&#e9;es des r&#e9;gions fran&#e7;aises ayant d&#e9;but&#e9; ce d&#e9;pistage il y a plus de 10 ans afin de s&#e9;lec- Mutations recherch&#e9;es par le Kit Elucigen dans le cadre du d&#e9;pistage n&#e9;onatal de la mucoviscidose (Kit CF30) : F508del ; I 507del ; 1078delT, 1717-1 G>A ; 2183AA>G ; 3659delC ; 3849+10kbC>T ; 621+1G>T ; A455E ; E60X ; G542X ; G551D ; N1303K ; R1162X ; R117H ; R334W ; R347P ; R553X ; S1251N ;W1282X ; 1811+1.6kbA>G ; 2789+5G>A ; 3120+1G>A ; 3272-26A>G ; 394delT ; 711+1G>T ; G85E ; Y1092X ; Y122X ;W846X. Login to comment

[hide] Pharmaceuticals targeting nonsense mutations in ge... BioDrugs. 2009;23(3):165-74. doi: 10.2165/00063030-200923030-00003. Rowe SM, Clancy JP
Pharmaceuticals targeting nonsense mutations in genetic diseases: progress in development.
BioDrugs. 2009;23(3):165-74. doi: 10.2165/00063030-200923030-00003., [PMID:19627168]

Abstract [show]
Premature termination codons (PTCs) are a cause of numerous genetic disorders spanning diseases that affect children and adults, and are produced by base pair substitutions that create abnormal stop codons within the open reading frame. Several ribosome-binding drugs, including select aminoglycosides and synthetic novel small molecules, induce 'translational readthrough' of PTCs, restoring full-length functional protein in a number of preclinical and clinical settings. In this review, we examine the mechanistic underpinnings of PTC suppression, including the nature of the interactions between agents that suppress PTCs and the eukaryotic ribosome regulation of transcript levels in eukaryotic cells, and the importance of the mRNA context in suppression of PTCs. We also examine results from proof-of-concept studies in preclinical model systems and clinical trials (with a focus on PTC124). Several of the published studies in cystic fibrosis have reported improvements in cystic fibrosis transmembrane conductance regulator (CFTR) biomarkers during short-term evaluation, including topical and systemic aminoglycoside treatment, and oral dosing with PTC124. These results, coupled with our improved understanding of how translation termination is regulated at PTCs, will help guide future directions of research involving this innovative treatment strategy for genetic diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
559 Sermet-Gaudelus et al.,[52] recently reported correction of CFTR-dependent Cl-conductance, as measured by NPD, following 15 days of systemic treatment with gentamicin in six of nine CF patients with the Y122X mutation (eight of nine were homozygous). Login to comment
561 Notably, the sweat Cl-concentration improved from a mean of 109 mEq at baseline to 85mEq in CF patients with the Y122X mutation, following treatment with gentamicin (see further discussion of related studies below). Login to comment
571 A rank order of Y122X, W1282X, G542X, and R1162X was seen among the most frequent stop mutations after gentamicin treatment, with relative suppression varying by as much as 7.2-fold, post-therapy. Login to comment

[hide] Newborn screening for cystic fibrosis in Alberta: ... Paediatr Child Health. 2010 Nov;15(9):590-4. Lilley M, Christian S, Hume S, Scott P, Montgomery M, Semple L, Zuberbuhler P, Tabak J, Bamforth F, Somerville MJ
Newborn screening for cystic fibrosis in Alberta: Two years of experience.
Paediatr Child Health. 2010 Nov;15(9):590-4., [PMID:22043142]

Abstract [show]
On April 1, 2007, Alberta became the first province in Canada to introduce cystic fibrosis (CF) to its newborn screening program. The Alberta protocol involves a two-tier algorithm involving an immunoreactive trypsinogen measurement followed by molecular analysis using a CF panel for 39 mutations. Positive screens are followed up with sweat chloride testing and an assessment by a CF specialist. Of the 99,408 newborns screened in Alberta during the first two years of the program, 221 had a positive CF newborn screen. The program subsequently identified and initiated treatment in 31 newborns with CF. A relatively high frequency of the R117H mutation and the M1101K mutation was noted. The M1101K mutation is common in the Hutterite population. The presence of the R117H mutation has created both counselling and management dilemmas. The ability to offer CF transmembrane regulator full sequencing may help resolve diagnostic dilemmas. Counselling and management challenges are created when mutations are mild or of unknown clinical significance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 These include the following mutations: delF508, I507del, G542X, G85E, R117H, 621+1G࢐T, 711+1G࢐T, G551D, R334W, R347P, A455E, 1717-1G࢐A, R560T, R553X, N1303K, 1898+1G࢐A, 2184delA, 2789+5G࢐A, 3120+1G࢐A, R1162X, 3659delC, 3849+10kbC࢐T, W1282X, 1078delT, 394delTT, Y122X, R347H, V520F, A559T, S549N, S549R, 1898+5G࢐T, 2183AA࢐G, 2307insA, Y1092X, M1101K, S1255X, 3876delA and 3905insT. Login to comment
84 TAbLe 1 Mutation frequency Mutation name Number of times detected (247 total mutations) Frequency, % expected, % (reference) delF508* 156 63.2 68.6 (1) R117H* 36 14.6 0.7 (1) G551D* 11 4.5 2.1 (1) 3849+10kbC࢐T* 6 2.4 0.7 (1) M1101K 5 2.0 Undetermined (1) G542X* 4 1.6 2.4 (1) 1717-1G࢐A* 4 1.6 0.7 (1) 621+1G࢐T* 3 1.2 0.9 (1) 3120+1G࢐A* 3 1.2 1.5 (1) G85E* 2 0.8 0.3 (1) A455E* 2 0.8 0.2 (1) R553X* 2 0.8 0.9 (1) 2789+5G࢐A* 2 0.8 0.3 (1) ƊI507* 1 0.4 0.3 (1) 711+1G࢐T* 1 0.4 0.1 (1) R334W* 1 0.4 0.2 (1) N1303K* 1 0.4 1.3 (1) 1898+1G࢐A* 1 0.4 Undetermined (1) 2184delA* 1 0.4 0.1 (1) 394delTT 1 0.4 Undetermined (1) R347H 1 0.4 0.2 (4) V520F 1 0.4 0.2 (4) S549N 1 0.4 0.1 (1) 2307insA 1 0.4 0.2 (1) R347P* 0 0 0.2 (1) R560T* 0 0 0.2 (1) R1162X* 0 0 0.2 (1) 3659delC* 0 0 0.2 (1) W1282X* 0 0 1.4 (1) 1078delT 0 0 0.03 (2) Y122X 0 0 Undetermined (3) A559T 0 0 0.2 (1) S549R 0 0 Undetermined (1) 1898+5G࢐T 0 0 Undetermined (1) 2183AA࢐G 0 0 0.1 (1) Y1092X 0 0 Undetermined (1) S1255X 0 0 0.2 (1) 3876delA 0 0 Undetermined (4) 3905insT 0 0 0.12 (1) *American College of Medical Genetics-recommended mutations TAbLe 2 Positive cystic fibrosis newborn screen summary Screen result Unaffected Affected Further follow-up required Lost to follow-up Total Probable screen 0 23 0 0 23 Inconclusive screen One mutation 179 8 2 2 191 Markedly elevated IRT 2 0 0 0 2 R117H/F508del 0 0 5 0 5 Total 181 31 7 2 221 Data presented as n. IRT Immunoreactive trypsinogen TAbLe 3 F508del/R117H cases ID number Mutation status Sweat test result(s), &#b5;mol/L Other clinical information 24827 F508del/R117H 28 None 23726 F508del/R117H 36/insufficient/20 Fecal elastase normal 22578 F508del/R117H 10 None 24500 F508del/R117H 34/insufficient None 18527 F508del/R117H 29 None 23317 F508del/R117H+5T 47/62 Affected sibling 5T 5 thymine There were 23 newborns with probable screens. Login to comment

[hide] [Mucoviscidosis: CFTR mutation-specific therapy: a... Arch Pediatr. 2013 Jan;20(1):63-73. doi: 10.1016/j.arcped.2012.10.018. Epub 2012 Nov 27. Leonard A, Leal T, Lebecque P
[Mucoviscidosis: CFTR mutation-specific therapy: a ray of sunshine in a cloudy sky].
Arch Pediatr. 2013 Jan;20(1):63-73. doi: 10.1016/j.arcped.2012.10.018. Epub 2012 Nov 27., [PMID:23199563]

Abstract [show]
There is a need to find a cure for pulmonary disease in cystic fibrosis (CF), though full benefit of this approach will be restricted to those patients with well-preserved lungs. The most promising route is currently that of a pharmacological mutation-specific approach aiming at correcting the mechanism by which mutations lead to impairment of chloride conductance across respiratory epithelial cells. In the past 14years, 7 candidate drugs (CPX, 4PBA, gentamicin, PTC124, VX-770 or Ivacaftor, VX-809 or Lumacaftor, and Miglustat) have been investigated in CF patients. A postulate of 14 out of the 15 published studies has been that an effective agent had to improve total chloride secretion as assessed in vivo by nasal potential difference measurements. The present review casts a critical look at these studies. Apparent inconsistencies are discussed as well as possible limitations of nasal potential difference measurements as outcome parameters in these trials. Primarily targeting a mutation carried by less than 2% of French CF patients, the 2 Ivacaftor studies could well be a milestone on the long road toward a cure for CF. However, further data on safety and long-term efficacy are obviously needed and the current price of this medication in the US would make it unaffordable for European patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
128 Une seconde e &#b4;tude mettait en e &#b4;vidence, sous gentamicine, une ame &#b4;lioration significative de la STC et une re &#b4;duction moyenne du taux de chlorure dans la sueur de 24 mmol/L chez 9 patients porteurs d`une copie de la mutation Y122X [35]. Login to comment
130 Dans une partie distincte du travail, les auteurs de &#b4;montraient in vitro une translecture en pre &#b4;sence de gentamicine 4 a ` 7 fois plus efficace pour la mutation Y122X que pour les mutations W1282X, G542X et R1162X. Login to comment

[hide] Assessing the Disease-Liability of Mutations in CF... Cold Spring Harb Perspect Med. 2012 Dec 1;2(12):a009480. doi: 10.1101/cshperspect.a009480. Ferec C, Cutting GR
Assessing the Disease-Liability of Mutations in CFTR.
Cold Spring Harb Perspect Med. 2012 Dec 1;2(12):a009480. doi: 10.1101/cshperspect.a009480., [PMID:23209179]

Abstract [show]
Over 1900 mutations have been reported in the cystic fibrosis transmembrane conductance regulator (CFTR), the gene defective in patients with cystic fibrosis. These mutations have been discovered primarily in individuals who have features consistent with the diagnosis of CF. In some cases, it has been recognized that the mutations are not causative of cystic fibrosis but are responsible for disorders with features similar to CF, and these conditions have been termed CFTR-related disorders or CFTR-RD. There are also mutations in CFTR that do not contribute to any known disease state. Distinguishing CFTR mutations according to their penetrance for an abnormal phenotype is important for clinical management, structure/function analysis of CFTR, and understanding the molecular and cellular mechanisms underlying CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Besides these rather common mutations, which are largely distributed in the Caucasian population, there are also some foundereffects of mutated allelesobserved C. Ferec and G.R. Cutting 2 Cite this article as Cold Spring Harb Perspect Med 2012;2:a009480 www.perspectivesinmedicine.org by Cold Spring Harbor Laboratory Press at SEMMELWEIS UNIV OF MEDICINE on December 5, as, for example, in the Reunion Island, where the Y122X (p.Tyr122X) mutation displays a frequency of 24% (Dugue &#b4;pe &#b4;roux et al. 2004), or the 394delTT (p.Leu88IlefsX22) referred to as aNordicmutationfoundincountriesbordering the Baltic sea (Schwartz et al. 1994). Login to comment

[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]

Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
80 The Table 3ߒ Frequency of 5T/7T/9T genotypes as a result of R117H reflex testing Poly-T alleles Number of detected alleles (%) CF32 panel CF69 panel 5T/5T 23 (0.44) 2 (0.73) 5T/7T 430 (8.27) 26 (9.49) 5T/9T 38 (0.73) 1 (0.37) 7T/7T 4,103 (78.93) 219 (79.92) 7T/9T 604 (11.61) 26 (9.49) 9T/9T 1 (0.02) 0 Total 5,198 (100) 274 (100) 394delTTd c.262_263delTT 3 0.10 G178Rd p.G178R 3 0.10 V520Fd p.V520F 3 0.10 2143delTd c.2012delT 2 0.06 935delAe c.803delA 2 0.06 A455Eb p.A455E 2 0.06 Q890Xd p.Q890X 2 0.06 S549Rd p.S549R 2 0.06 2869insGd c.2737insG 1 0.03 405ߙ+ߙ3A>Ce c.273ߙ+ߙ3A>C 1 0.03 G480Ce p.G480C 1 0.03 M1101Kd p.M1101K 1 0.03 Y122Xd p.Y122X 1 0.03 Total 3,088 100 a 1898ߙ+ߙ5G>Te , 444delA, G330X, S364Pe , K710X, and S1196X mutations were not detected in the target population. Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] Biosynthesis of cystic fibrosis transmembrane cond... Int J Biochem Cell Biol. 2014 Jul;52:26-38. doi: 10.1016/j.biocel.2014.03.020. Epub 2014 Mar 28. Pranke IM, Sermet-Gaudelus I
Biosynthesis of cystic fibrosis transmembrane conductance regulator.
Int J Biochem Cell Biol. 2014 Jul;52:26-38. doi: 10.1016/j.biocel.2014.03.020. Epub 2014 Mar 28., [PMID:24685677]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a cAMP-regulated chloride (Cl(-)) channel. Mutations of its gene lead to the disease of cystis fibrosis (CF) among which the most common is the deletion of phenylalanine at position 508 (Phe508del). CFTR is a multi-domain glycoprotein whose biosynthesis, maturation and functioning as an anion channel involve multi-level post-translational modifications of CFTR molecules and complex folding processes to reach its native, tertiary conformation. Only 20-40% of the nascent chains achieve folded conformation, while the remaining molecules are targeted for degradation by endoplasmic reticulum, lysosomes, or autophagy. A large number of mutations causing CF impair processing of CFTR. Growing knowledge of CFTR biosynthesis has enabled understanding the cellular basis of CF and has brought to light various potential targets for novel, promising therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1372 The nonsense and frameshift mutations, belonging to the Class I, lead to creation of premature termination codons (PTCs) such as W1282X, G542X, Y122X, and result either in the synthesis of truncated and unstable protein or in the decrease of the half-lives of mutant mRNAs. Login to comment

[hide] Comprehensive CFTR gene analysis of the French cys... Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14. Audrezet MP, Munck A, Scotet V, Claustres M, Roussey M, Delmas D, Ferec C, Desgeorges M
Comprehensive CFTR gene analysis of the French cystic fibrosis screened newborn cohort: implications for diagnosis, genetic counseling, and mutation-specific therapy.
Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14., [PMID:25122143]

Abstract [show]
PURPOSE: Newborn screening (NBS) for cystic fibrosis (CF) was implemented throughout France in 2002. It involves a four-tiered procedure: immunoreactive trypsin (IRT)/DNA/IRT/sweat test [corrected] was implemented throughout France in 2002. The aim of this study was to assess the performance of molecular CFTR gene analysis from the French NBS cohort, to evaluate CF incidence, mutation detection rate, and allelic heterogeneity. METHODS: During the 8-year period, 5,947,148 newborns were screened for cystic fibrosis. The data were collected by the Association Francaise pour le Depistage et la Prevention des Handicaps de l'Enfant. The mutations identified were classified into four groups based on their potential for causing disease, and a diagnostic algorithm was proposed. RESULTS: Combining the genetic and sweat test results, 1,160 neonates were diagnosed as having cystic fibrosis. The corresponding incidence, including both the meconium ileus (MI) and false-negative cases, was calculated at 1 in 4,726 live births. The CF30 kit, completed with a comprehensive CFTR gene analysis, provides an excellent detection rate of 99.77% for the mutated alleles, enabling the identification of a complete genotype in 99.55% of affected neonates. With more than 200 different mutations characterized, we confirmed the French allelic heterogeneity. CONCLUSION: The very good sensitivity, specificity, and positive predictive value obtained suggest that the four-tiered IRT/DNA/IRT/sweat test procedure may provide an effective strategy for newborn screening for cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Because only a limited number of functional studies have assessed the pathogenicity of variants, mutations have been classified in previous studies according to their disease-causing potential.16,22,23 Based on the recommendations and data from these studies (UMD-CFTR-France),24 variants were classified into four groups: A, CF-causing; B, associated with CFTR-RDs; C, no clinical consequences; and D, unknown or Table 1ߒ Allelic frequencies of CF30-kit mutations, identified in neonates with CF, and correspondence between traditional mutation nomenclature and that on the Human Genome Variation Society website Frequency (F) % Mutation Legacy mutation nomenclature Number of alleles/2,320 % of alleles/2,320 Cumulative % ࣙ5 p.Phe508del F508del 1,560 67.24 67.24 p.Gly542* G542X 113 3.19 10.51 p.Asn1303Lys N1303K 81 1.98 c.1585-1G>A 1717-1G>A 48 1.47 1.00ࣙFࣙ4.99 c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A 37 1.42 p.Arg553* R553X 36 1.29 p.Gly551Asp G551D 31 1.16 p.Tyr122* Y122X 26 0.97 6.86 c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 22 0.82 c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 18 0.67 p.Ile507del I507del 17 0.63 c.3140-26A>G 3272-26A>G 16 0.59 0.40ࣙFࣙ0.99 p.Arg347Pro R347P 15 0.56 p.Arg1162* R1162X 15 0.56 p.Trp1282* W1282X 14 0.52 p.Tyr1092* Y1092X 13 0.48 c.2051_2052delinsG 2183AA>G 12 0.45 c.3528delC 3659delC 11 0.41 c.1680-886A>G 1811ߙ+ߙ1.6kbA>G 9 0.39 p.Gly85Glu G85E 8 0.34 3.06 p.Ser1251Asn S1251N 7 0.30 p.Arg334Trp R334W 7 0.30 p.Arg117His R117H 7 0.30 0.1ࣙFࣙ0.39 p.Trp846* W846X 6 0.26 c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T 6 0.26 c.948delT 1078delT 5 0.22 p.Ala455Glu A455E 5 0.22 p.Glu60* E60X 4 0.17 c.262_263delTT 394delTT 4 0.17 c.3718-2477C>T 3849ߙ+ߙ10kbC>T 3 0.13 Total 2,034 87.67 87.67 Mutations are clustered into four groups of frequency intervals (>5%, 1-4.99%, 0.99-0.4%, and <0.4%). Login to comment
121 The mutation spectrum in neonates with CF diagnosed through NBS is consistent with the previously reported spectrum in patients with CF diagnosed based on clinical symptoms.12 The percentage of the main mutations was similar (Figure 3); however, there were significantly higher rates of specific mutations, including p.Tyr122* (Y122X) in CF patients from the R&#e9;union Island (prevalence, 0.97 vs. 0.16%; P < 10-6 ) and c.2988+1G>A (3120+1G>A) (prevalence, 0.82 vs. 0.09%; P < 10-6 ) in patients of African origin. Login to comment

[hide] The p.Gly622Asp (G622D) mutation, frequently found... J Cyst Fibros. 2015 May;14(3):305-9. doi: 10.1016/j.jcf.2014.11.001. Epub 2014 Nov 28. Marion H, Natacha G, Brigitte M, Francois C, Michel R, Corinne T, Emmanuelle G, Thierry B
The p.Gly622Asp (G622D) mutation, frequently found in Reunion Island and in black populations, is associated with a wide spectrum of CF and CFTR-RD phenotypes.
J Cyst Fibros. 2015 May;14(3):305-9. doi: 10.1016/j.jcf.2014.11.001. Epub 2014 Nov 28., [PMID:25443471]

Abstract [show]
Examination of genotype-phenotype correlations along with functional evaluation of CFTR mutations may not be straightforward. The c.1865G>A, p.Gly622Asp (G622D), located at the NBD1 C terminus of the CFTR protein, was initially reported in patients with male infertility. However, the substitution of Gly622 by an aspartic acid in vitro would perturb the local structure or even affect the CFTR folding itself. In order to determine whether p.Gly622Asp affects the risk of developing a CFTR-Related disorder (CFTR-RD) or cystic fibrosis (CF), we analyzed the phenotype of subjects bearing the p.Gly622Asp mutation. We report molecular and clinical analyses in eleven unrelated patients with CF or CFTR-RD with compound heterozygosity for the p.Gly622Asp mutation. On the basis of the clinical features presented by the eleven patients, we postulate that the p.Gly622Asp might be associated with a wide spectrum of phenotypes including classical cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 For patients, healthy individuals and fetuses originating for Reunion Island (903 samples in total), a systematic search for c.366T N A, p.Tyr122Ter (Y122X) and c.1865G N A, p.Gly622Asp (G622D) was performed because of their particular occurrence in this population. Login to comment
49 All carried on the other allele a severe CF-causing mutation such as c.366T N A, p.Tyr122Ter (Y122X), n = 3, and c.2988 + 1G N A (3120 + 1G N A), n = 1 (Table 3). Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment